Antibodies, compositions, methods of detecting cells, and screening methods

VHH antibodies targeting the ALCAM-TFRC complex in cancer cells offer a novel approach for detecting and treating TNBC and pancreatic cancer by selectively recognizing the 70 kDa form of ALCAM, addressing the limitations of current treatments.

JP2026007238APending Publication Date: 2026-01-16COGNANO INC
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
JP2024106873
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-07-02
Publication Date
2026-01-16

AI Technical Summary

Technical Problem

Current drug discovery methods are limited for treating specific subtypes of cancer, such as triple-negative breast cancer (TNBC) and pancreatic cancer, as existing treatments are not effective.

Method used

Development of VHH antibodies that selectively recognize the three-dimensional structure of antigens expressed by cancer cells, particularly ALCAM with a molecular weight of 70 kDa, which are used to form complexes with TFRC, enabling targeted detection and treatment of cholangiocarcinoma, gallbladder cancer, pancreatic cancer, and TNBC cells.

Benefits of technology

Provides a novel target for cancer detection and treatment by selectively recognizing specific cancer cells, including subtypes like TNBC and pancreatic cancer, through the use of VHH antibodies that bind to ALCAM and the ALCAM-TFRC complex.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026007238000001_ABST
    Figure 2026007238000001_ABST
Patent Text Reader

Abstract

To provide a new target in detection or treatment of cancer.SOLUTION: Antibodies against activated leucocyte adhesion molecule (ALCAM) having a molecular weight of about 110kDa, which selectively recognize ALCAM having a molecular weight of about 70kDa relative to ALCAM having a molecular weight of 90 to 70kDa.SELECTED DRAWING: Figure 2
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to antibodies, compositions, methods for detecting cells, and screening methods, and in particular to antibodies against antigens expressed on specific cancer cells. [Background technology]

[0002] VHH antibodies are heavy-chain antibodies found in the serum of Camelidae (e.g., Bactrian camels, dromedaries, llamas, and alpacas). While VHH antibodies can specifically bind to antigens like conventional antibodies, they also have high recognition ability and high stability, which has attracted attention (see, for example, Patent Documents 1 to 3). Furthermore, VHH antibodies typically have a short amino acid chain length, making them easy to produce. Patent Documents 4 and 5 disclose methods for logically identifying the amino acid sequence of a VHH antibody that recognizes a target substance and producing it. Specifically, Patent Document 4 discloses next-generation sequencing of the gene sequences of a group of antibodies obtained by panning using a target substance from a VHH antibody mother library. Similarly, the gene sequences of a group of antibodies obtained by similar panning using a control substance are also analyzed by next-generation sequencing. Then, by comparing the number of reads in both groups for the same gene sequence, a VHH antibody that selectively recognizes the target substance over the target substance can be identified. Furthermore, as described in Patent Documents 1 and 3, modifications to VHH antibodies have also been performed, for example, by mutating the framework regions before and after the complementarity-determining region (CDR) of a VHH antibody that recognizes an antigen, or by introducing the amino acid sequence of the CDR into other types of antibodies. [Prior art documents] [Patent documents]

[0003] [Patent Document 1] Special Publication No. 2005-520494 [Patent Document 2] Japanese Patent Application Laid-Open No. 2017-14112 [Patent Document 3] Special Publication No. 2013-506411 [Patent Document 4] International Publication No. 2019 / 230823 [Patent Document 5] International Publication No. 2024 / 106394 Summary of the Invention [Problem to be solved by the invention]

[0004] Drug discovery is being developed that targets specific proteins expressed by cancer cells. For example, treatment with anti-HER2 antibodies has been successful for HER2-positive breast cancer, a subtype of breast cancer. However, there are still subtypes for which effective treatments are limited, such as triple-negative breast cancer (TNBC), and cancers for which effective treatments are limited, such as pancreatic cancer.

[0005] The present invention aims to provide a novel target for the detection or treatment of cancer. [Means for solving the problem]

[0006] The present inventors have focused on the excellent ability of VHH antibodies to recognize the three-dimensional structure of target epitopes. Furthermore, the present inventors have hypothesized that, by using the method described in Patent Document 4 (Inverse Biomarker Exploring Technology, IBMET), it would be possible to efficiently discover antibodies that selectively recognize antigens expressed by cancer cells, even when the structural change between the antigen expressed by cancer cells and the homologous antigen expressed by normal cells is small. Furthermore, they hypothesized that even when the site of such structural change is only slightly exposed on the antigen surface, small-sized VHH antibodies would be able to effectively recognize the site of structural change. The present inventors have hypothesized that such a method would enable the search for antibodies that selectively recognize specific cancer cells, and that, based on the search results, it would be possible to identify antigens selectively expressed in specific cancer cells. Based on this belief, they embarked on research and completed the present invention.

[0007] One embodiment of the present invention is an antibody against activated leukocyte cell adhesion molecule (ALCAM) having a molecular weight of about 70 kDa, which selectively recognizes ALCAM having a molecular weight of about 70 kDa compared to ALCAM having a molecular weight of 90 to 110 kDa. [Effects of the Invention]

[0008] This may provide a novel target for cancer detection or treatment. [Brief explanation of the drawings]

[0009] [Figure 1] FIG. 1 shows the results of Western blotting of cross-linked immunoprecipitates. [Figure 2] FIG. 1 shows the results of Western blotting of immunoprecipitates obtained using cells expressing ALCAM protein and VHH-TNBC89. [Figure 3] FIG. 1 shows the results of Western blotting of immunoprecipitates obtained using cells co-expressing ALCAM and TFRC proteins and VHH-TNBC89. [Figure 4] FIG. 1 shows the results of cell staining of cultured BT549 cells using VHH-TNBC89. [Figure 5] FIG. 1 shows the results of staining pancreatic tissue sections from a pancreatic cancer patient using VHH-TNBC89. [Figure 6] Figure showing the staining results of bile duct tissue sections from a bile duct cancer patient using VHH-TNBC89. [Figure 7] A diagram showing the results of staining mammary gland tissue sections from TNBC patients with VHH-TNBC89. [Figure 8] A diagram showing the results of staining mammary gland tissue sections from TNBC patients with VHH-TNBC89. [Figure 9] FIG. 1 shows the results of staining normal tissue sections with VHH-TNBC89. DETAILED DESCRIPTION OF THE INVENTION

[0010] The following describes in detail the embodiments of the present invention. Note that the following embodiments do not limit the scope of the invention as claimed, and not all combinations of features described in the embodiments are necessarily essential to the invention. Two or more of the features described in the embodiments may be combined in any desired manner.

[0011] An antibody according to one embodiment of the present invention is an antibody against activated leukocyte cell adhesion molecule (ALCAM, CD166) having a molecular weight of approximately 70 kDa. ALCAM is a protein belonging to the immunoglobulin superfamily and is generally known as a transmembrane protein having a molecular weight of 90 to 110 kDa. ALCAM is expressed widely throughout the body, including in immune cells. Meanwhile, ALCAM, which has a molecular weight of approximately 70 kDa, is localized in certain cells, such as cholangiocarcinoma cells, gallbladder cancer cells, pancreatic cancer cells, and TNBC cells.

[0012] An antibody according to one embodiment of the present invention selectively binds to ALCAM having a molecular weight of approximately 70 kDa compared to ALCAM having a molecular weight of 90 to 110 kDa. As used herein, approximately 70 kDa refers to a range of 60 to 80 kDa, may refer to a range of 65 to 75 kDa, or may refer to a range of 68 to 72 kDa. An antibody according to one embodiment of the present invention specifically binds to ALCAM having a molecular weight of approximately 70 kDa.

[0013] An antibody according to one embodiment of the present invention is an antibody against immature ALCAM. Meanwhile, as described in A. Masedunskas et al. "Activated leukocyte cell adhesion molecule is a component of the endothelial junction involved in transendothelial monocyte migration," FEBS Letters, 580, pp. 2637-2645 (2006), it is known that immature ALCAM of approximately 70 kDa also exists, and that mature ALCAM of approximately 90 to 110 kDa is generated by glycosylation. The ALCAM with a molecular weight of approximately 70 kDa is considered to correspond to immature ALCAM. An antibody according to one embodiment of the present invention selectively binds to immature ALCAM compared to mature ALCAM. An antibody according to one embodiment of the present invention specifically binds to immature ALCAM.

[0014] An antibody according to one embodiment of the present invention is an antibody against the activated leukocyte cell adhesion molecule (ALCAM)-transferrin receptor 1 (TFRC, TfR1, CD71) complex. TFRC is a transmembrane glycoprotein that internalizes transferrin-iron complexes. The present inventors have found that ALCAM and TFRC form a complex. In particular, the present inventors have found that ALCAM having a molecular weight of approximately 70 kDa, rather than ALCAM having a molecular weight of 90 to 110 kDa, forms a complex with TFRC. In other words, immature ALCAM, rather than mature ALCAM, forms a complex with TFRC. The present inventors have found that such an ALCAM-TFRC complex exists in cells. An antibody according to one embodiment of the present invention specifically binds to the ALCAM-TFRC complex. Furthermore, an antibody according to one embodiment of the present invention can specifically bind to both ALCAM having a molecular weight of approximately 70 kDa and the ALCAM-TFRC complex.

[0015] Here, the ALCAM-TFRC complex may be a complex formed by binding one molecule of ALCAM to one molecule of TFRC. Alternatively, the ALCAM-TFRC complex may be a complex (multimer) of three or more molecules. For example, the ALCAM-TFRC complex may be a complex formed by binding one or more molecules of ALCAM to one or more molecules of TFRC. Specifically, the ALCAM-TFRC complex may be a tetramer formed by binding two molecules of ALCAM to two molecules of TFRC. Alternatively, the ALCAM-TFRC complex may be a hexamer formed by binding three molecules of ALCAM to three molecules of TFRC. For example, the ALCAM-TFRC complex may be a multimer having a molecular weight of approximately 400 kDa (e.g., 350 kDa to 450 kDa). The present inventors have discovered that such multimers exist in cells.

[0016] An antibody according to one embodiment of the present invention is an antibody against ALCAM capable of forming a complex with TFRC. The antibody according to one embodiment of the present invention selectively binds to a type of ALCAM capable of forming a complex with TFRC (e.g., ALCAM having a molecular weight of about 70 kDa) compared to a type of ALCAM that does not form a complex with TFRC (e.g., ALCAM having a molecular weight of 90 to 110 kDa). The antibody according to one embodiment of the present invention specifically binds to ALCAM capable of forming a complex with TFRC.

[0017] An antibody according to one embodiment of the present invention is an antibody against ALCAM in a complex with TFRC. The antibody according to one embodiment of the present invention selectively binds to ALCAM in a complex with TFRC (e.g., ALCAM having a molecular weight of about 70 kDa) compared to ALCAM not in a complex with TFRC (e.g., ALCAM having a molecular weight of 90 to 110 kDa). The antibody according to one embodiment of the present invention specifically binds to ALCAM in a complex with TFRC.

[0018] As used herein, the term "antibody" refers to an antibody as generally used. The antibody may be a polyclonal antibody or a monoclonal antibody. In one embodiment, the antibody is an isolated monoclonal antibody. Antibodies also include multimers and antigen-binding fragments. For example, an antibody according to one embodiment may form a dimer via a linker. As a specific example, a VHH antibody according to one embodiment may form a homodimer with a VHH antibody having the same sequence, or may form a heterodimer with a VHH antibody having a different sequence. Examples of antigen-binding fragments include minibodies, single-chain antibodies (scFv), variable region fragments (Fv or Fd), Fab, or F(ab)2.

[0019] In one embodiment, the antibody is a VHH antibody. A VHH antibody is a heavy-chain antibody also known as a single-domain antibody or nanobody. A VHH is generally composed of FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4. FR1 to FR4 are called framework regions. CDR1 to CDR3, which are sandwiched between the framework regions, are hypervariable regions called complementarity-determining regions. It is generally believed that CDR1 to CDR3 recognize and specifically bind to an antigen. Each region can be identified as described in Elvin A. Kabat et al., "Sequence of proteins of immunological interest," NIH publication No. 91-3242, and L. Riechmann et al., "Single domain antibodies: comparison of camel VH and camelized human VH domains," J. Immunol. Methods, 1999, 231, 25-38.

[0020] Such VHH antibodies are produced by alpacas and other members of the camelid family. On the other hand, VHH antibodies with specific amino acid sequences can be easily produced by gene synthesis and introducing the gene into Escherichia coli as a plasmid.

[0021] On the other hand, antibodies, including VHH antibodies, may be human antibodies, humanized antibodies, or chimeric antibodies. For example, VHH antibodies may be humanized. Specifically, one or more amino acid residues may be deleted, substituted, or added in the framework regions of a VHH antibody according to the amino acid sequence of the VH domain of a human antibody. VHH antibodies may also be optimized by other techniques. In one embodiment, the antibody may be a bispecific antibody, i.e., the antibody may specifically bind to another antigen in addition to ALCAM or the ALCAM-TFRC complex having a molecular weight of approximately 70 kDa.

[0022] Furthermore, an antibody according to one embodiment may have an additional molecule bound to it. The optionally bound molecule may be a polypeptide chain (e.g., a VHH antibody, an immunoglobulin, or a fragment thereof, or an enzyme), a pharmaceutical (e.g., an antiviral agent, an antitumor agent, or a cytotoxic agent), a luminescent substance, or other chemical substance (e.g., polyethylene glycol). A cytotoxic agent refers to an agent that exerts a cytotoxic or growth-inhibitory effect on cells. An antitumor agent refers to an agent that selectively exerts a cytotoxic or growth-inhibitory effect on tumor cells. These molecules may be bound to the VHH antibody via a linker sequence. As used herein, the term "antibody" also includes antibodies modified by such a method, such as by the attachment of a molecule.

[0023] As used herein, "selective binding" means that the binding to a specific antigen is weaker than the binding to a control antigen. Specifically, "selective binding" means that the dissociation constant KD between the control antigen and the antibody is at least 10-fold, preferably at least 100-fold, and more preferably at least 1000-fold, the dissociation constant KD between the specific antigen and the antibody.

[0024] As used herein, "specifically binds" means to bind strongly to a specific antigen. Here, "strongly binds" means that the dissociation constant KD between the specific antigen and the antibody is 1×10 -6Less than M, preferably 1 x 10 -7 M or less, more preferably 1×10 -8 M or less, more preferably 1 × 10 -9 M. Alternatively, "specific binding" may mean that the antibody does not substantially bind to other antigens. Specifically, the dissociation constant KD between the antibody and other antigens is 1×10 or less. -5 M or more, preferably 1 × 10 -4 M or more, preferably 1×10 -3 It may be M or more.

[0025] As the above-mentioned antibodies against ALCAM having a molecular weight of about 70 kDa or antibodies against the ALCAM-TFRC complex, (1) an antibody having the amino acid sequence shown in SEQ ID NO: 1 (VHH-TNBC89, described below); (2) An antibody having an amino acid sequence having at least 90% homology with the amino acid sequence shown in SEQ ID NO: 1, or (3) An antibody having a CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 2 in which 0 or 1 amino acid has been deleted, substituted or added, a CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 3 in which 0 or 1 amino acid has been deleted, substituted or added, and a CDR3 consisting of the amino acid sequence shown in SEQ ID NO: 4 in which 0 or 1 amino acid has been deleted, substituted or added. As mentioned above, these antibodies may have additional molecules attached to them.

[0026] Furthermore, antibodies other than the above-mentioned antibodies (for example, VHH-TNBC89) can be used as antibodies against ALCAM having a molecular weight of about 70 kDa or antibodies against the ALCAM-TFRC complex.

[0027] A composition according to one embodiment of the present invention is a composition for recognizing ALCAM having a molecular weight of about 70 kDa, comprising an antibody against ALCAM having a molecular weight of about 70 kDa as described above. Also, a composition according to one embodiment of the present invention is a composition for recognizing the ALCAM-TFRC complex, comprising an antibody against the ALCAM-TFRC complex as described above.

[0028] Furthermore, a composition according to one embodiment of the present invention is a composition for recognizing at least one of cholangiocarcinoma cells, gallbladder cancer cells, and pancreatic cancer cells, comprising the above-described antibody against ALCAM having a molecular weight of approximately 70 kDa. A composition according to one embodiment of the present invention may be a composition for recognizing triple-negative breast cancer (TNBC) cells, comprising the above-described antibody against ALCAM-TFRC complex. A composition according to one embodiment of the present invention is a composition for recognizing at least one of cholangiocarcinoma cells, gallbladder cancer cells, and pancreatic cancer cells, comprising the above-described antibody against the ALCAM-TFRC complex. Such a composition can recognize at least a specific subtype of cholangiocarcinoma cells, gallbladder cancer cells, or pancreatic cancer cells. A composition according to one embodiment of the present invention may be a composition for recognizing triple-negative breast cancer (TNBC) cells, comprising the above-described antibody against the ALCAM-TFRC complex. Such a composition can recognize at least a specific subtype of TNBC cells. As shown in the Examples below, ALCAM having a molecular weight of approximately 70 kDa and the ALCAM-TFRC complex are localized in cholangiocarcinoma cells, gallbladder cancer cells, pancreatic cancer cells, and TNBC cells.

[0029] In one embodiment, the composition selectively recognizes cholangiocarcinoma cells over non-cancerous cholangiocarcinoma cells. In one embodiment, the composition selectively recognizes gallbladder cancer cells over non-cancerous gallbladder cells. In one embodiment, the composition selectively recognizes pancreatic cancer cells over non-cancerous pancreatic cells. In one embodiment, the composition selectively recognizes TNBC cells over non-cancerous breast cells. In one embodiment, the composition selectively recognizes TNBC cells over hormone receptor-positive (HR+) breast cancer cells.

[0030] In the present invention, a "composition for recognizing" a specific molecule or cell refers to a composition that exerts its effect by interacting with a specific molecule or cell. For example, a "composition for recognizing" a specific molecule or cell may be a detection reagent for detecting a specific molecule or cell. Such a detection reagent may comprise a fluorescently labeled antibody against ALCAM or the ALCAM-TFRC complex having a molecular weight of about 70 kDa. Alternatively, such a detection reagent may comprise an antibody against ALCAM or the ALCAM-TFRC complex having a molecular weight of about 70 kDa, to which a tag that can be specifically recognized by another antibody, such as a fluorescently labeled antibody, has been added.

[0031] Furthermore, a "composition for recognizing" a specific molecule may be an agent that blocks or promotes signal transduction mediated by the specific molecule. Such agents can function as agonists, blockers, or partial agonists for a specific molecule such as a receptor. As described above, antibodies against ALCAM or the ALCAM-TFRC complex, which has a molecular weight of about 70 kDa, can function to block or promote signal transduction.

[0032] Furthermore, a "composition for recognizing" a specific molecule or cell may be a cell expressing a specific molecule, or a drug that damages a specific cell. Such a drug may contain, for example, an antibody against ALCAM or the ALCAM-TFRC complex having an Fc region and having a molecular weight of about 70 kDa, so as to exert antibody-dependent cellular cytotoxicity (ADCC). Alternatively, such a drug may be a conjugate of an antibody against ALCAM or the ALCAM-TFRC complex having a molecular weight of about 70 kDa and an antitumor agent.

[0033] In the present invention, "selectively recognizing" a specific molecule or cell means being able to distinguish between an interaction of the specific molecule or cell and an interaction with a control molecule or cell. For example, a composition for "selectively recognizing" a specific cell compared to a control cell may mean that the specific cell can be distinguished from the control cell by cell staining with the composition.

[0034] As used herein, TNBC cells are breast cancer cells in which estrogen receptors (ER) and progesterone receptors (PR) are not detected and HER2 is not overexpressed. Hormone receptor-positive breast cancer cells are breast cancer cells in which ER or PR is detected. Classification of TNBC cells and hormone receptor-positive breast cancer cells can be performed according to conventional diagnostic methods.

[0035] In one embodiment, antibodies can be identified by immunizing an animal with an antigen and panning the immunized antibodies. Furthermore, by identifying the amino acid sequence of the identified antibody, monoclonal antibodies that recognize the antigen can be produced. TNBC cells, particularly TNBC cells expressing ALCAM or the ALCAM-TFRC complex with a molecular weight of approximately 70 kDa, can be used as the antigen. A combination of multiple TNBC cell lines can also be used as the antigen. Alternatively, cholangiocarcinoma cells, gallbladder cancer cells, or pancreatic cancer cells expressing ALCAM or the ALCAM-TFRC complex with a molecular weight of approximately 70 kDa can also be used as the antigen. When identifying VHH antibodies, camelids such as alpacas or cartilaginous fish such as sharks can be used as animals. Antibodies with specific amino acid sequences can be produced by methods such as transfecting antibody-encoding plasmids into Escherichia coli or CHO cells.

[0036] The amino acid sequence of an antibody according to one embodiment can be identified according to the method described in International Publication No. WO 2019 / 230823. Here, TNBC cells are used as the target substance, and non-TNBC breast cancer cells are used as the control substance. The amino acid sequence of an antibody that recognizes the target substance can be subtracted from the amino acid sequence of an antibody that recognizes the target substance. As shown in the examples, TNBC cells can express ALCAM and the ALCAM-TFRC complex, which have a molecular weight of approximately 70 kDa, while non-TNBC breast cancer cells do not express these proteins. Therefore, this method can be used to identify antibodies against ALCAM or the ALCAM-TFRC complex, which have a molecular weight of approximately 70 kDa. Alternatively, cholangiocarcinoma cells, gallbladder cancer cells, or pancreatic cancer cells that express ALCAM or the ALCAM-TFRC complex, which have a molecular weight of approximately 70 kDa, can be used as the target substance, and non-cancerous cholangiocarcinoma cells, gallbladder cells, or pancreatic cells can be used as the control substance.

[0037] Specifically, an antibody-producing animal is immunized with TNBC cells, and the gene sequences of lymphocytes producing the induced antibodies are decoded. Phages carrying genes containing the decoded gene sequences are then allowed to interact with TNBC cells, and the amino acid sequence corresponding to the gene sequence carried in the phage that bound to the TNBC cells is identified as the amino acid sequence of an antibody that recognizes the TNBC cells. Similarly, phage carrying genes carrying the decoded gene sequences are allowed to interact with a control substance, and the amino acid sequence corresponding to the gene sequence carried in the phage that bound to the control substance is identified as the amino acid sequence of an antibody that recognizes the control substance. Here, a next-generation sequencer can be used to decode the gene sequences.

[0038] Then, by comparing the amino acid sequences of antibodies that recognize TNBC cells with those of antibodies that recognize a control substance, antibodies that selectively recognize TNBC cells compared to the control substance can be identified. This method allows for the identification of antibodies against ALCAM or the ALCAM-TFRC complex, which have a molecular weight of approximately 70 kDa. To facilitate the discovery of antibodies that selectively recognize ALCAM or the ALCAM-TFRC complex, which have a molecular weight of approximately 70 kDa, the antibodies that recognize TNBC cells can be grouped by clustering them based on amino acid sequence similarity. Furthermore, similar clustering can be performed to group antibodies that recognize a control substance.

[0039] This method allows for the acquisition of a large number of amino acid sequences for VHH antibodies that recognize a substance of interest. Clustering based on sequence homology for the amino acid sequences thus obtained can be considered to yield a single cluster corresponding to a single epitope of the substance of interest. In other words, a cluster in which the number of reads in the antibody group obtained by panning with the substance of interest is significantly higher than the number of reads in the antibody group obtained by panning with a control substance recognizes an epitope present in the substance of interest but absent in the control substance.

[0040] In comparing amino acid sequences, the frequency of a particular amino acid sequence (or group) in a group of antibodies that recognize TNBC cells can be compared with the frequency of a particular amino acid sequence (or group) in a group of antibodies that recognize a control substance. Then, an amino acid sequence (or group) whose frequency in the group of antibodies that recognize TNBC cells is relatively higher than its frequency in the group of antibodies that recognize the control substance can be preferentially identified as an antibody that recognizes TNBC cells. In this case, an amino acid sequence (or group) whose frequency in the group of antibodies that recognize TNBC cells is statistically significantly higher than its frequency in the group of antibodies that recognize the control substance can be identified as an antibody that recognizes TNBC cells.

[0041] For example, antibodies that are included in the group of antibodies that recognize TNBC cells and whose number in the group of antibodies that recognize a control substance is below a predetermined standard can be identified as antibodies that selectively recognize TNBC cells. In one example, group C0 is an antibody group that is included in the group of antibodies that recognize TNBC cells (group A) but is not included in the group of antibodies that recognize a control substance (group B). 10 Group B is an antibody group included in group A, and the number of antibodies in group B is one-tenth or less of the number of antibodies in group A. 1 / 2 Group C is an antibody group included in group A, and the number of antibodies in group B is half or less of the number of antibodies in group A. 10 Group, and C 1 / 2 Antibodies included in the group can be selected as antibodies that selectively recognize TNBC cells.

[0042] One embodiment of the present invention relates to a method for detecting at least one of TNBC cells, cholangiocarcinoma cells, gallbladder cancer cells, and pancreatic cancer cells. This method includes detecting ALCAM having a molecular weight of approximately 70 kDa or the ALCAM-TFRC complex. As shown in the Examples below, ALCAM having a molecular weight of approximately 70 kDa and the ALCAM-TFRC complex are localized in cholangiocarcinoma cells, gallbladder cancer cells, pancreatic cancer cells, and TNBC cells. Therefore, TNBC cells, cholangiocarcinoma cells, gallbladder cancer cells, and pancreatic cancer cells can be detected based on detecting ALCAM having a molecular weight of approximately 70 kDa or the ALCAM-TFRC complex. This method allows the detection of at least specific subtypes of TNBC cells, cholangiocarcinoma cells, gallbladder cancer cells, or pancreatic cancer cells.

[0043] One embodiment of the present invention relates to a method for screening therapeutic agents for at least one of TNBC, cholangiocarcinoma, gallbladder cancer, and pancreatic cancer. This method includes the step of preparing an antibody against ALCAM having a molecular weight of approximately 70 kDa or an ALCAM-TFRC complex. This method further includes the step of evaluating the activity of the antibody-based therapeutic agent against at least one of TNBC cells, cholangiocarcinoma cells, gallbladder cancer cells, and pancreatic cancer cells. As shown in the Examples below, ALCAM having a molecular weight of approximately 70 kDa and the ALCAM-TFRC complex are localized in cholangiocarcinoma cells, gallbladder cancer cells, pancreatic cancer cells, and TNBC cells. Therefore, ALCAM having a molecular weight of approximately 70 kDa or the ALCAM-TFRC complex can be used to treat TNBC, cholangiocarcinoma, gallbladder cancer, and pancreatic cancer. This method allows for the production of therapeutic agents for at least specific subtypes of TNBC, cholangiocarcinoma, gallbladder cancer, or pancreatic cancer. [Example]

[0044] The present invention will be described in detail below with reference to examples, but the present invention is not limited thereto. Antibodies were identified according to the method described in WO 2019 / 230823 as follows.

[0045] Example 1: Induction of an immune response in alpacas Alpacas were immunized with seven breast cancer cell lines (SKBR3, MDA-MB-231, HS578, BT549, MDA-MB-436, MDA-MB-468, and HCC1937) according to standard methods.

[0046] Example 2: Construction of a VHH antibody phage library Lymphocytes were collected from the blood of an alpaca that had undergone an immune response in accordance with Example 1. The VHH antibody genes contained in the lymphocytes (VHH antibody gene library) were obtained, and a phage group carrying these gene sequences (VHH antibody phage library) was produced according to known methods.

[0047] Specifically, blood samples were collected from the jugular vein, and peripheral blood mononuclear cells (PBMCs) were isolated on a sucrose density gradient using Ficoll (Nacalai Tesque). PBMCs were washed with PBS and then suspended in RNAlater solution (Thermo Fisher Scientific). Total RNA was then isolated from the PBMC samples (Direct-Zol RNA MiniPrep, Zymo Research). Complementary DNA was synthesized using 1 μg of total RNA as a template, random hexamer primers, and SuperScript II reverse transcriptase (Thermo). The coding region of the heavy chain variable domain was amplified with LA taq polymerase (Takara Bio) and two PAGE-purified primers: CALL001: 5'-GTCCTGGCTGCTCTTCTACAAGG-3' (SEQ ID NO: 5) and CALL002: 5'-GGTACGTGCTGTTGAACTGTTCC-3' (SEQ ID NO: 6). The amplified heavy chain variable domain-encoding gene fragment was separated on a 1.5% low-melting-point agarose gel (Lonza Group), and a lower band of approximately 700 base pairs corresponding to heavy chain-only immunoglobulin was extracted (QIAquick Gel Extraction Kit, Qiagen). To amplify the VHH domain-encoding gene, nested PCR was performed using VHH-PstI-For and VHH-BstEII-Rev primers, followed by subcloning into the pMES4 phagemid vector (GeneArt DNA Synthesis, Thermo Scientific). Electroporation-competent E. coli TG1 cells (Agilent Technologies Japan) were transformed with the ligated plasmid under low-temperature conditions, and 10 per microliter of ligated plasmid was used. 7 The titer was confirmed by limiting dilution to maintain a high colony-forming unit (CFU) level. Colonies were harvested from 8 mL of cultured cells, pooled, and stored as frozen glycerol stocks to serve as the mother library.

[0048] Example 3: Selection of VHH antibodies that interact with a substance of interest, and Example 4: Selection of VHH antibodies that interact with a control substance Eight TNBC cell lines (MDA-MB-231, HS578, BT549, MDA-MB-436, MDA-MB-468, HCC1937, HCC1599, and HCC38) were used as target substances. The phage population obtained in Example 2 was allowed to interact with the target cell lines, and phages that bound to these cell lines were enriched.

[0049] The recovered phages were infected into Escherichia coli (TG1 competent cells) for phage infection and stored as an E. coli library. The gene sequences of VHH antibodies that bound to the magnetic beads containing the target substance were present in the form of plasmids in the E. coli library, and these plasmids were purified according to the manufacturer's recommended method (Qiagen).

[0050] As control substances, a HER2-positive breast cancer cell line (SKBR3) and a hormone receptor-positive breast cancer cell line (T47D) were used. As in Example 3, the phage group obtained in Example 2 was allowed to interact with the cell lines of interest, and phages that bound to these cell lines were enriched. The recovered phages were stored as an E. coli library. Furthermore, plasmids containing the gene sequences of VHH antibodies were purified.

[0051] Specifically, each eluted phage-containing solution was neutralized with a PBS-diluted protein inhibitor cocktail (cOmplete, EDTA-free, protease inhibitor cocktail tablets, Roche Diagnostics) and used to infect TG1 electroporation-competent cells. The infected cells were cultured overnight at 37°C in LB broth (Miller) containing 100 μg / mL ampicillin (Nacalai) and selected. Selected phagemids were recovered using a QIAprep mini-prep kit (Qiagen).

[0052] Example 5: Decoding the amino acid sequence of VHH antibodies The gene sequences of the VHH antibodies obtained in Examples 3 and 4 were decoded by next-generation sequencing. Specifically, a portion of the VHH antibody gene sequence of 500 base pairs or less was used as a target region, and the gene sequence contained in this portion was decoded. Primers for amplifying the target region were designed: 5'gaaatacctattgcctacggc (5' end, SEQ ID NO: 7) and 5'ggaaccgtagtccggaacgtc (3' end, SEQ ID NO: 8). Using this primer set in polymerase chain reaction (PCR), the target region of 500 base pairs or less in the VHH antibody gene sequence was amplified. Furthermore, the gene sequence of the target region was decoded using the Illumina_MiSeq_Amplicon_Deep_Sequence method in accordance with the method recommended by the manufacturer (Illumina) using a primer set in which the above primers were fused with the specific sequences 5'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG- (SEQ ID NO: 9) and 5'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG- (SEQ ID NO: 10) specific to the next-generation sequencer.

[0053] The gene sequences thus decoded were translated into amino acid sequences using commercially available analysis software (Genetyx). Among these gene and amino acid sequences, those whose terminal sequences perfectly matched the primers used, whose target region had a base length of 401 base pairs or more, whose read count was 2 or more, and whose vector sequence contained a His tag sequence (6xHis) were selected. Furthermore, sequences with different gene sequences but identical amino acid sequences were added together, and the amino acid sequences were ranked in order of frequency of occurrence (read count).

[0054] Specifically, VHH-coding regions in the mother library and sublibraries after one round of target enrichment were PCR-amplified and purified using AMPure XP beads (Beckman Coulter). Dual-indexed libraries were then prepared and sequenced using the MiSeq Reagent Kit v3 on an Illumina MiSeq (Illumina) with paired, 300-bp reads. Approximately 100,000 paired reads were generated for each sublibrary. Raw reads were trimmed of adapter sequences using cutadapt v1.18 (Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet.journal, 17, 10-12, doi:10.14806 / ej.17.1.200 (2011).), and low-quality reads were then removed using Trimmatic v0.39 (Bolger, A. M., Lohse, M. & Usadel, B. Trimmomatic: a flexible trimmer for Illumina sequencing data. Bioinformatics 30, 2114-2120, doi:10.1093 / bioinformatics / btu170 (2014)).The remaining paired reads were merged using fastq-join (Aronesty, E. Comparison of Sequencing Utility Programs. The Open Bioinformatics Journal 7, 1-8, doi:10.2174 / 1875036201307010001 (2013)) and translated into amino acid sequences using EMBOSS v6.6.0.0 (Rice, P., Longden, I. & Bleasby, A. EMBOSS: the European Molecular Biology Open Software Suite. Trends in genetics: TIG 16, 276-277, doi:10.1016 / s0168-9525(00)02024-2 (2000)).

[0055] Example 6: Subtracting the amino acid sequences of VHH antibodies that interact with a control substance from the amino acid sequences of VHH antibodies that interact with a target substance The number of reads in each cluster obtained by clustering for each library was counted using a custom Python script combining seqkit v0.10.1 (Shen, W., Le, S., Li, Y. & Hu, F. SeqKit: A Cross-Platform and Ultrafast Toolkit for FASTA / Q File Manipulation. PLOS ONE 11, e0163962, doi:10.1371 / journal.pone.0163962 (2016)) and usearch v.11 (Edgar, R.C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics 26, 2460–2461, doi:10.1093 / bioinformatics / btq461 (2010)). The enrichment score of each clone was analyzed by calculating the P value of a chi-squared test between the abundance ratios in each biopanned sublibrary. As a result, clones with higher enrichment scores in the sublibrary panned with TNBC cell lines than in the sublibraries panned with HER2-positive breast cancer cells and hormone receptor-positive breast cancer cell lines were selected. From these selected clones, a VHH antibody, hereafter referred to as VHH-TNBC89, was identified. The amino acid sequence of VHH-TNBC89 is shown in SEQ ID NO: 1.

[0056] Example 7: Artificial gene synthesis of gene sequences encoding identified VHH antibodies The gene sequence encoding the amino acid sequence of VHH-TNBC89 was artificially synthesized as an optimized gene sequence provided by the manufacturer (Eurofins). (An optimized gene sequence here refers to a gene sequence that is, for example, easy to synthesize, resistant to degradation, has an even base distribution, has few repeated sequences, and is less likely to form secondary structures.) In this example, a gene encoding a tandem dimer of VHH antibodies was synthesized. Methods for expressing and using VHH antibodies as dimers or multimers are well known, as described in, for example, JP 2010-534465 A. The artificially synthesized gene could be incorporated into any expression vector.

[0057] Specifically, the amino acid sequence of VHH-TNBC89 was linked as a tandem homodimer with a (GGGGS)4 linker (SEQ ID NO: 11), and the gene encoding this homodimer was synthesized with codon optimization.

[0058] Example 8: Expression of VHH antibody proteins encoded by artificial genes The artificial gene incorporated into the expression vector was introduced into Escherichia coli (BL21 strain) as a plasmid, allowing the VHH antibody protein encoded by the artificial gene to be expressed in the E. coli. Specifically, the amino acid sequence encoded by the artificial gene was expressed by adding IPTG when the E. coli was in the logarithmic growth phase. The expressed amino acid sequence (VHH antibody with a His tag attached) was purified using a nickel-immobilized resin column according to the method recommended by the manufacturer (GE Healthcare). In this way, VHH-TNBC89-His, a VHH antibody with a His tag attached to the carboxyl terminus, was produced.

[0059] Example 9: Cross-linked immunoprecipitation The purified antibody VHH-TNBC89-His was added to triple-negative breast cancer cell line BT549 cultured cells at a concentration of 10 μg per 10 ml of culture medium. The cells were then cultured at 37°C for 30 minutes. The culture medium was removed, and the culture dish with the attached cells was washed with PBS. A minimal culture medium (OptiMEM, Thermo Scientific) containing a 5 mM crosslinker (sulfo-EGS, ProteoChem) was then added. The cells were then cultured at 37°C for 30 minutes to allow covalent bonding (crosslinking) between adjacent amino groups. The minimal culture medium containing the crosslinker was removed, and the culture dish with the attached cells was washed with PBS. A surfactant-containing lysis solution (SDS-free RIPA buffer, Nacalai Tesque) was then added. This yielded a lysate of cultured cells in which the amino groups of the proteins were crosslinked.

[0060] The lysate was immunoprecipitated using magnetic beads (Protein G-conjugated Dynabeads, Dynal) bearing an anti-His antibody (rabbit polyclonal antibody, MBL) according to standard procedures. The immunoprecipitates were separated by SDS-PAGE and Western blotted using an anti-His antibody. As shown in Figure 1 (TNBC cells), a complex of approximately 400 kDa (Ag) was detected, which bound VHH-TNBC89-His.

[0061] When similar cross-linking immunoprecipitation and Western blotting were performed on control cells (HEK cells) instead of BT549, no complex of approximately 400 kDa was detected, as shown in Figure 1 (Control cells).

[0062] Example 10: Mass spectrometry of immunoprecipitates In Example 9, the immunoprecipitates obtained using BT549 cultured cells and VHH-TNBC89-His were separated by SDS-PAGE and stained with Coomassie Brilliant Blue (CBB). As described above, a complex of approximately 400 kDa bound to VHH-TNBC89-His was detected.

[0063] Furthermore, immunoprecipitates obtained using BT549 cultured cells and the antibody VHH-Her2_18-His, as described in Example 9, were separated by SDS-PAGE and stained with Coomassie Brilliant Blue (CBB). VHH-Her2_18-His is a purified VHH antibody against the HER2 protein, with a His tag attached to the carboxyl terminus. SDS-PAGE detected a complex bound to VHH-Her2_18-His with a molecular weight greater than 250 kDa, but no band was observed around 400 kDa.

[0064] From the gel obtained by SDS-PAGE of the immunoprecipitates obtained with VHH-TNBC89-His, a gel containing the approximately 400 kDa VHH-TNBC89-His-bound complex was physically excised. Similarly, from the gel obtained by SDS-PAGE of the immunoprecipitates obtained with VHH-Her2_18-His, a gel containing the VHH-Her2_18-His-bound complex was physically excised. Proteins contained in each excised gel piece were digested with trypsin, and the tryptic digests (peptides) were separated by liquid chromatography. The molecular weights of the peptides were then measured using a mass spectrometer. The peptide sequences were identified by Mascot search. This method allowed us to identify proteins involved in the VHH-TNBC89-His-bound complex.

[0065] Activated leukocyte cell adhesion molecule (ALCAM, CD166) (Accession Number: IPI00015102) and transferrin receptor 1 (TFRC, TfR1, CD71) (Accession Number: IPI00022462) were identified as proteins that were abundant in the VHH-TNBC89-His complex but not in the VHH-Her2_18-His complex. These results suggest that VHH-TNBC89 recognizes the ALCAM-TFRC complex.

[0066] Example 11: Immunoprecipitation using transiently ALCAM-expressing HEK cells and VHH-TNBC89

[0067] An expression vector (Vector Builder) encoding the ALCAM gene was introduced into cultured HEK cells by lipofection. After gene introduction, the cells were cultured for 48 hours to allow the ALCAM protein to be expressed in the HEK cells. The HEK cells expressing the ALCAM protein were lysed in a detergent-containing lysis solution (SDS-free RIPA buffer, Nacalai Tesque). Insoluble matter was removed by centrifugation to obtain a cell extract (whole extract).

[0068] Anti-His antibody (rabbit polyclonal antibody, manufactured by MBL) was attached to the surface of magnetic beads (Protein G-conjugated Dynabeads, manufactured by Dynal) according to standard methods. Purified antibody VHH-TNBC89-His was then bound to the anti-His antibody-conjugated magnetic beads according to standard methods. As a negative control, purified antibody VHH-Her2_18-His was also bound to the anti-His antibody-conjugated magnetic beads according to standard methods.

[0069] The above magnetic beads carrying VHH-TNBC89-His or VHH-Her2_18-His were added to cell extracts from HEK cells expressing ALCAM protein and incubated overnight. The magnetic beads were then washed four times with a detergent-containing lysis solution (RIPA buffer without SDS). After washing, SDS sample buffer (Nacalai Tesque) was added to the washed magnetic beads and incubated at 37°C for 30 minutes to obtain immunoprecipitates.

[0070] Immunoprecipitates sampled in SDS sample buffer were separated by SDS-PAGE and transferred (blotted) onto a PVDF membrane (BioRad). The membrane was then reacted with anti-ALCAM antibody (mouse monoclonal antibody, Santa Cruz) and HRP-labeled anti-mouse antibody (Cytiva) according to standard Western blotting techniques. The luminescence from the HRP enzyme was then detected using X-ray film. Figure 2 shows the results of Western blotting of the immunoprecipitate obtained with VHH-TNBC89-His (IP, TNBC89) and the immunoprecipitate obtained with VHH-Her2_18-His (IP, Control).

[0071] FIG. 2 shows the results of Western blotting performed in the same manner on cell extracts sampled in SDS sample buffer before immunoprecipitation using magnetic beads (WE, Control and WE, TNBC89).

[0072] As shown in Figure 2, ALCAM protein with a molecular weight range of 70 to 100 kDa was detected in the cell extracts of HEK cells expressing ALCAM protein (WE, Control and WE, TNBC89), mainly with molecular weights of 70 kDa or 90 kDa. On the other hand, ALCAM protein with a molecular weight of approximately 70 kDa was detected in the immunoprecipitate (IP, TNBC89) obtained from the cell extract of HEK cells expressing ALCAM protein using VHH-TNBC89-His.

[0073] The majority of ALCAM protein present in cell extracts from HEK cells expressing ALCAM has an electrophoretic molecular weight of approximately 70 kDa or 90 kDa. Furthermore, the 90 kDa ALCAM protein was more abundant. The difference in molecular weight on electrophoresis likely reflects differences in post-translational modifications of ALCAM protein. Post-translational modifications include glycosylation and protein cleavage, which may result in different 3D structures of ALCAM protein. On the other hand, the molecular weight of ALCAM protein bound by VHH-TNBC89-His was approximately 70 kDa. Therefore, the ALCAM protein bound by VHH-TNBC89-His is likely to have a different post-translational modification and thus a different 3D structure than the majority of ALCAM protein present in the cell extract.

[0074] Example 12: Immunoprecipitation using HEK cells transiently expressing ALCAM and TFRC and VHH-TNBC89

[0075] Expression vectors (Vector Builder) encoding the ALCAM and TFRC genes were introduced into cultured HEK cells by lipofection. After gene introduction, the cells were cultured for 48 hours to allow the ALCAM and TFRC proteins to be expressed in the HEK cells. The HEK cells expressing the ALCAM and TFRC proteins were lysed in a detergent-containing lysis solution (SDS-free RIPA buffer, Nacalai Tesque). Insoluble matter was removed by centrifugation to obtain a cell extract (whole extract).

[0076] Anti-His antibody (rabbit polyclonal antibody, manufactured by MBL) was attached to the surface of magnetic beads (Protein G-conjugated Dynabeads, manufactured by Dynal) according to standard procedures. Purified anti-TFRC antibody with a His tag attached to the carboxyl terminus was then bound to the magnetic beads according to standard procedures.

[0077] Subsequently, immunoprecipitates were obtained by adding anti-TFRC antibody-conjugated magnetic beads to cell extracts from HEK cells and allowing the reaction to proceed as described in Example 11. Furthermore, immunoprecipitates were obtained by adding magnetic beads before anti-TFRC antibody conjugation to cell extracts from HEK cells and allowing the reaction to proceed as described in Example 11. Furthermore, Western blotting was performed on the obtained immunoprecipitates and the cell extracts before immunoprecipitation using anti-ALCAM antibody and HRP-labeled anti-mouse antibody as described in Example 11. Figure 3 shows the results of Western blotting for immunoprecipitates obtained using magnetic beads conjugated with anti-TFRC antibody (IP, TFR), immunoprecipitates obtained using magnetic beads without anti-TFRC antibody (IP, Control), and cell extracts (WE).

[0078] As shown in Figure 3, ALCAM protein was detected in the cell extract (WE) over a molecular weight range of 70 to 100 kDa, with the majority having a molecular weight of approximately 90 kDa. On the other hand, immunoprecipitation using anti-TFRC antibody-conjugated magnetic beads clearly demonstrated the production of approximately 70 kDa ALCAM protein, but the production of approximately 90 kDa ALCAM protein was not confirmed. These results indicate that TFRC protein and ALCAM protein form a complex, and that the molecular weight of the ALCAM protein complexed with TFRC protein is approximately 70 kDa, not approximately 90 kDa. Furthermore, the results of Examples 9 and 10 confirmed that VHH-TNBC89 recognizes the ALCAM-TFRC complex. Based on these results and the molecular weight of the complex, the approximately 400 kDa complex detected in Example 9 was presumed to be a tetrameric to hexameric ALCAM-TFRC complex.

[0079] Example 13: Cellular uptake of VHH-TNBC89 VHH-TNBC89-His obtained in Example 8 was added to the culture medium at a concentration of 10 μg per ml. BT549 cells were then cultured in the presence of VHH-TNBC89 diluted in culture medium for 120 minutes and fixed with 2% paraformaldehyde. The specimen was washed with PBST and incubated with an anti-His antibody (rabbit monoclonal secondary antibody, Abcam) diluted 1:1000 in PBST at room temperature for 1 hour. The specimen was then washed with PBST and incubated with a fluorescently labeled anti-rabbit antibody (Alexa Fluor 594 anti-rabbit tertiary antibody, Thermo Scientific) diluted 3:3000 in PBST at room temperature for 1 hour. Nuclear staining was then performed using 4',6-diamidino-2-phenylindole (DAPI). Fluorescence images obtained using a confocal microscope are shown in Figure 4. FIG. 4 shows the fluorescent signal based on VHH-TNBC89-His (TNBC89), the fluorescent signal based on DAPI (DAPI), and a merged version of these fluorescent signals.

[0080] Figure 4 shows that TNBC cells can be identified using antibodies, such as VHH-TNBC89, that recognize the approximately 70 kDa ALCAM protein or the ALCAM-TFRC complex. Furthermore, as shown in Figure 4 (TNBC89), the fluorescent signal from VHH-TNBC89 was detected more predominantly in the cytoplasm than on the cell membrane. This result indicates that VHH-TNBC89 is internalized into cells and that the approximately 70 kDa ALCAM protein or the ALCAM-TFRC complex is highly localized within the cells.

[0081] Example 14: Cancer cell line staining using VHH-TNBC89 Specimens from various cancer cell lines were fixed with 2% paraformaldehyde. They were then washed with PBST and blocked with PBST containing 1% goat serum. The resulting specimens were incubated overnight at 4°C with VHH-TNBC89-His (primary antibody) obtained in Example 8, diluted 300-fold in PBST. The specimens were then washed with PBST and incubated with an anti-His antibody (rabbit monoclonal secondary antibody, Abcam) diluted 1000-fold in PBST at room temperature for 1 hour. The specimens were then washed with PBST and incubated with a fluorescently labeled anti-rabbit antibody (Alexa Fluor 594 anti-rabbit tertiary antibody, Thermo Scientific) diluted 3000-fold in PBST at room temperature for 1 hour. Cell staining of the cancer cell lines was then performed. Fluorescent signals were then confirmed using a confocal microscope.

[0082] The results of cell staining are shown in the table below, where "++" indicates a strong fluorescent signal, "+" indicates a weak fluorescent signal, and "-" indicates no fluorescent signal.

[0083] [Table 1]

[0084] Cell staining demonstrated that VHH-TNBC89 bound to specific subtypes of triple-negative breast cancer, cholangiocarcinoma, gallbladder cancer, and pancreatic cancer cells. Furthermore, this antibody did not bind to HER2+ breast cancer cells. These results demonstrate that antibodies that recognize the approximately 70 kDa ALCAM protein or the ALCAM-TFRC complex, such as VHH-TNBC89, can be used to distinguish between triple-negative breast cancer, cholangiocarcinoma, gallbladder cancer, and pancreatic cancer cells. These results also demonstrate that such antibodies can be used to selectively recognize triple-negative breast cancer cells over HER2+ breast cancer cells.

[0085] Example 15: Immunochemical staining of patient tissue specimens using VHH-TNBC89 The patient tissue samples used were pancreatic tissue sections from a pancreatic cancer patient, bile duct tissue sections from a bile duct cancer patient, and breast tissue sections from a TNBC patient. Two breast tissue sections from TNBC patients (C6-2 and C5-2) were purchased from Biochain. Frozen specimens of each patient's tissue were fixed with 2% paraformaldehyde. They were then washed with phosphate buffered saline (PBST) containing surfactant (0.05% Triton X-100) and blocked with PBST containing 1% goat serum.

[0086] Of the specimens obtained in this manner, the pancreatic cancer tissue and bile duct cancer tissue specimens were incubated overnight at 4°C with VHH-TNBC89-His (primary antibody) obtained in Example 8 diluted 300-fold in PBST. These specimens were then washed with PBST and incubated for 1 hour at room temperature with an anti-His antibody (rabbit monoclonal secondary antibody, Abcam) diluted 1000-fold in PBST. These specimens were then washed with PBST and incubated for 1 hour at room temperature with a fluorescently labeled anti-rabbit antibody (Alexa Fluor 594 anti-rabbit tertiary antibody, Thermo Scientific) diluted 3000-fold in PBST. Thus, immunochemical staining of the patient tissue specimens was performed. Furthermore, nuclear staining was performed using DAPI.

[0087] In addition, TNBC breast cancer tissue specimens were incubated overnight at 4°C with VHH-TNBC89-His (primary antibody) obtained in Example 8 diluted 300-fold in PBST and anti-ALCAM antibody (mouse monoclonal primary antibody, Millipore) diluted 200-fold in PBST. These specimens were washed with PBST and incubated for 1 hour at room temperature with anti-His antibody (rabbit monoclonal secondary antibody, Abcam) diluted 1000-fold in PBST. These specimens were then washed with PBST and incubated for 1 hour at room temperature with fluorescently labeled anti-rabbit antibody (Alexa Fluor 594 anti-rabbit tertiary antibody, Thermo Scientific) diluted 3000-fold in PBST and fluorescently labeled anti-mouse antibody (Alexa Fluor 488 anti-mouse tertiary antibody, Thermo Scientific) diluted 3000-fold in PBST. Immunochemical staining of the patient tissue specimens was then performed. Nuclear staining was also performed using DAPI.

[0088] Fluorescent signals from patient tissue specimens immunochemically stained as described above were observed using a confocal microscope. Figure 5 shows the staining results for a pancreatic tissue section. Figure 6 shows the staining results for a bile duct tissue section. Figure 7 shows the staining results for a mammary gland tissue section (C6-2). Figure 8 shows the staining results for a mammary gland tissue section (C5-2). Figures 5 to 8 show the fluorescent signal derived from VHH-TNBC89-His (TNBC89) and the fluorescent signal derived from DAPI (DAPI). Figures 7 and 8 also show the fluorescent signal derived from an anti-ALCAM antibody (ALCAM).

[0089] As shown in Figure 5, fluorescent signals derived from VHH-TNBC89-His were detected in a portion of the luminal structure of pancreatic tissue from a pancreatic cancer patient. Furthermore, as shown in Figure 6, fluorescent signals derived from VHH-TNBC89-His were detected in a portion of the luminal structure of bile duct tissue from a bile duct cancer patient. These results demonstrate that antibodies that recognize the approximately 70 kDa ALCAM protein or the ALCAM-TFRC complex, such as VHH-TNBC89, can be used to recognize pancreatic cancer and bile duct cancer tissues.

[0090] Furthermore, in the staining results shown in Figure 7, VHH-TNBC89-His signals were observed in areas of TNBC patient mammary gland tissue with high nuclear content, overlapping with the ALCAM antibody signal. Furthermore, in the staining results shown in Figure 8, VHH-TNBC89-His signals were observed not only in areas of TNBC patient mammary gland tissue with high nuclear content, overlapping with the ALCAM antibody signal, but also in areas where ALCAM antibody signals were not observed. These results indicate that antibodies recognizing the approximately 70 kDa ALCAM protein or the ALCAM-TFRC complex, such as VHH-TNBC89, bind to a wider range of TNBC tissue than commercially available ALCAM antibodies. These results also demonstrate that antibodies recognizing the approximately 70 kDa ALCAM protein or the ALCAM-TFRC complex, such as VHH-TNBC89, can recognize TNBC tissue.

[0091] Furthermore, immunochemical staining using VHH-TNBC89-His was performed on normal human tissue sections (thyroid, thymus, esophagus, pancreas, cervix, prostate, ovary, spleen, skin, kidney, and breast) using a similar method. Figure 9 shows the staining results for each tissue section. As shown in Figure 9, no significant signal based on VHH-TNBC89-His was observed in these tissues. These results indicate that antibodies such as VHH-TNBC89 that recognize the approximately 70 kDa ALCAM protein or the ALCAM-TFRC complex can selectively recognize TNBC, cholangiocarcinoma, gallbladder cancer, and pancreatic cancer cells compared to normal tissues.

[0092] The invention is not limited to the above-described embodiment, and various modifications and variations are possible within the scope of the gist of the invention.

Claims

1. An antibody against activated leukocyte cell adhesion molecule (ALCAM) having a molecular weight of about 70 kDa, which selectively recognizes ALCAM having a molecular weight of about 70 kDa relative to ALCAM having a molecular weight of 90 to 110 kDa.

2. Antibodies against the activated leukocyte cell adhesion molecule (ALCAM)-transferrin receptor 1 (TFRC) complex.

3. A composition for recognizing ALCAM having a molecular weight of approximately 70 kDa, comprising the antibody of claim 1.

4. A composition for recognizing an ALCAM-TFRC complex, comprising the antibody of claim 2.

5. A composition for recognizing at least one of bile duct cancer cells, gallbladder cancer cells, and pancreatic cancer cells, comprising the antibody described in claim 1.

6. A composition for recognizing at least one of bile duct cancer cells, gallbladder cancer cells, and pancreatic cancer cells, comprising the antibody described in claim 2.

7. The composition of claim 3 , wherein the antibody is a VHH antibody.

8. The antibody (1) Having the amino acid sequence shown in SEQ ID NO: 1; (2) having an amino acid sequence having at least 90% homology with the amino acid sequence shown in SEQ ID NO: 1, or (3) A CDR1 consisting of an amino acid sequence in which 0 or 1 amino acid is deleted, substituted, or added in the amino acid sequence shown in SEQ ID NO: 2, a CDR2 consisting of an amino acid sequence in which 0 or 1 amino acid is deleted, substituted, or added in the amino acid sequence shown in SEQ ID NO: 3, and a CDR3 consisting of an amino acid sequence in which 0 or 1 amino acid is deleted, substituted, or added in the amino acid sequence shown in SEQ ID NO: 4, The composition according to any one of claims 3 to 6.

9. 1. A method for detecting at least one of triple-negative breast cancer (TNBC) cells, cholangiocarcinoma cells, gallbladder cancer cells, and pancreatic cancer cells, comprising: A method comprising the step of detecting activated leukocyte cell adhesion molecule (ALCAM) having a molecular weight of about 70 kDa, or an ALCAM-transferrin receptor 1 (TFRC) complex.

10. A method for screening a therapeutic agent for at least one of triple-negative breast cancer (TNBC), bile duct cancer, gallbladder cancer, and pancreatic cancer, comprising: providing an antibody against activated leukocyte cell adhesion molecule (ALCAM) having a molecular weight of about 70 kDa or an ALCAM-transferrin receptor 1 (TFRC) complex; a step of evaluating the activity of the therapeutic agent using the antibody against at least one of TNBC cells, bile duct cancer cells, gallbladder cancer cells, and pancreatic cancer cells; A method comprising:

Citation Information

Patent Citations

  • Functional heavy chain antibodies, fragments thereof, libraries thereof and methods for their production

    JP2005520494A

  • Bispecific binding molecules for antivascularization therapy

    JP2013506411A

  • Anti-survivin antibody or antibody derivatives, and their applications

    JP2017014112A

  • Method for obtaining antibody, method for identifying antibody, method for producing antibody, and antibody

    WO2019230823A1

  • Antibody and method for producing antibody

    WO2024106394A1