Senescent fibroblast marker present in senescent bladder is useful for prognosis and diagnosis of bladder cancer

Abstract

The present invention provides a method for prognosis and diagnosis of bladder cancer and an anticancer agent for bladder cancer.SOLUTION: Provided are a method for assisting in determining the prognostic value of progressive or non-progressive bladder cancer in a subject, the method comprising a step of detecting the expression level of a specific gene in a specimen (fibroblast) cell isolated from the subject, and an anticancer agent comprising a senolytic agent.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to a method for prognosticating and diagnosing bladder cancer and an anticancer agent for bladder cancer. [Background technology]

[0002] Bladder cancer is a common age-related cancer and is estimated to rank fourth in the number of new cases and eighth in the number of deaths among men in the United States in 2023. While approximately 80% of bladder cancer patients have non-muscle-invasive bladder cancer, approximately two-thirds of patients with muscle-invasive bladder cancer develop local or systemic disease, resulting in a relatively poor prognosis despite advances in surgical techniques and multidisciplinary treatment. Bladder cancer screening typically involves a urine test to determine the presence of blood or cancer cells in the urine. Recently, immunohistochemistry has been used to detect gene expression abnormalities and nuclear proliferation-associated proteins. The p53 protein is present in the cell nucleus, and mutations and deletions have been reported in various cancers. The tumor suppressor gene Ki-67 antigen (also known as MKI67) is a nuclear proliferation-associated protein that recognizes the nuclei of proliferating cells and is used as an indicator of the malignancy of various other cancers.

[0003] Meanwhile, research into the relationship between cancer and senescent cells is progressing. The senescence response can be induced in many cell types in response to a variety of cellular stress factors. It is a powerful barrier against tumor formation and contributes to the cytotoxicity of certain anticancer drugs. While senescence limits tumor formation and tissue damage in a cell-autonomous manner, senescent cells can induce inflammation, tissue aging and destruction in a cell-independent manner, and can promote tumor formation and metastasis (Patent Document 1). The present inventors have also suggested that a senolytic agent containing a glutaminase inhibitor as an active ingredient may have anti-cancer effects (Patent Document 2). [Prior art documents] [Patent documents]

[0004] [Patent Document 1] Publication of Special Publication No. 2020-525050 [Patent Document 2] International Publication No. 2020 / 095971 [Non-patent literature]

[0005] [Non-Patent Document 1] Cell Metab. 2020 Nov 3;32(5):814-828.e6 [Non-patent document 2] Journal of Internal Medicine, 2020, 288; 518-536 Summary of the Invention [Problem to be solved by the invention]

[0006] The present invention provides a method for prognosticating and diagnosing bladder cancer and an anticancer agent for bladder cancer. [Means for solving the problem]

[0007] As a result of extensive research, the inventors of the present application have newly discovered that the expression of a specific gene contributes to the diagnosis (including prognosis) of bladder cancer, particularly age-related bladder cancer, and have newly discovered that combining a senolytic agent with a specific anticancer agent significantly increases its anticancer effect.

[0008] The present invention includes the following [1] to [4E]. [1] A method for assisting in determining the prognostic value of aggressive or non-aggressive bladder cancer in a subject, comprising: detecting the expression level of at least one gene selected from the group consisting of SMOC2, GUCY1A1 (GUCY1A3), CXCL12, CRISPLD2, GAS1, and LUM in a sample (fibroblast) cell isolated from the subject; The method wherein the expression level obtained is compared with the expression level in normal bladder fibroblasts, and the prognostic value is determined based on the high expression level. [2] The method according to [1], wherein the prognostic value is selected from the group consisting of metastasis, recurrence, pathological T stage, malignancy grade, muscle invasion, tumor size, and survival probability.

[0009] [1A] A pharmaceutical composition for treating age-related bladder cancer in a subject diagnosed with a poor prognosis using the method described in [1], comprising a senolytic agent. [2A] The pharmaceutical composition according to [1A], wherein the senolytic agent is a neutralizing antibody against dasatinib, quercetin, fisetin, ABT-263 (Navitoclax; 4-(4-{[2-(4-Chlorophenyl)-5,5-dimethylcyclohex-1-en-1-yl]methyl}piperazin-1-yl)-N-(4-{[(2R)-4-(morpholin-4-yl)-1-(phenylsulfanyl)butan-2-yl]amino}-3-(trifluoromethanesulfonyl)benzene-1-sulfonyl)benzamide), BPTES, DON, compound 968, CB-839, or KGA, or an siRNA, miRNA, or ASO (antisense oligonucleotide) against the GLS1 gene. [3A] The pharmaceutical composition described in [1A], which is administered in combination with at least one selected from the group consisting of an SMOC2 inhibitor, a GUCY1A1 (GUCY1A3) inhibitor, a CXCL12 inhibitor, a CRISPLD2 inhibitor, a GAS1 inhibitor and a LUM inhibitor. [4A] The pharmaceutical composition according to [3A], wherein the CXCL12 inhibitor is AMD3100 or a pharmacologically acceptable salt thereof. [5A] A pharmaceutical composition for treating age-related bladder cancer in a subject diagnosed with a poor prognosis using the method described in [1], comprising at least one selected from the group consisting of an SMOC2 inhibitor, a GUCY1A1 (GUCY1A3) inhibitor, a CXCL12 inhibitor, a CRISPLD2 inhibitor, a GAS1 inhibitor and a LUM inhibitor. [6A] The pharmaceutical composition according to [5A], wherein the CXCL12 inhibitor is AMD3100 or a pharmacologically acceptable salt thereof. [7A] The pharmaceutical composition according to [5A], which is administered together with a senolytic agent. [8A] The pharmaceutical composition according to [5A], wherein the senolytic agent is dasatinib, quercetin, fisetin, ABT-263 (Navitoclax; 4-(4-{[2-(4-Chlorophenyl)-5,5-dimethylcyclohex-1-en-1-yl]methyl}piperazin-1-yl)-N-(4-{[(2R)-4-(morpholin-4-yl)-1-(phenylsulfanyl)butan-2-yl]amino}-3-(trifluoromethanesulfonyl)benzene-1-sulfonyl)benzamide), BPTES, DON, compound 968, CB-839, a neutralizing antibody against KGA, or an siRNA, miRNA, or ASO against the GLS1 gene.

[0010] [1B] A method for treating senolytic bladder cancer in a subject, comprising administering a senolytic agent to a subject diagnosed with a poor prognosis using the method described in [1]. [2B] The method according to [1B], wherein the senolytic agent is dasatinib, quercetin, fisetin, ABT-263 (Navitoclax; 4-(4-{[2-(4-Chlorophenyl)-5,5-dimethylcyclohex-1-en-1-yl]methyl}piperazin-1-yl)-N-(4-{[(2R)-4-(morpholin-4-yl)-1-(phenylsulfanyl)butan-2-yl]amino}-3-(trifluoromethanesulfonyl)benzene-1-sulfonyl)benzamide), BPTES, DON, compound 968, CB-839, a neutralizing antibody against KGA, or an siRNA, miRNA, or ASO against the GLS1 gene. [3B] The method according to [1B], wherein at least one selected from the group consisting of an SMOC2 inhibitor, a GUCY1A1 (GUCY1A3) inhibitor, a CXCL12 inhibitor, a CRISPLD2 inhibitor, a GAS1 inhibitor and a LUM inhibitor is co-administered. [4B] The method according to [3B], wherein the CXCL12 inhibitor is AMD3100 or a pharmacologically acceptable salt thereof. [5B] A method for treating age-related bladder cancer in a subject diagnosed with a poor prognosis using the method described in [1], comprising administering at least one selected from the group consisting of an SMOC2 inhibitor, a GUCY1A1 (GUCY1A3) inhibitor, a CXCL12 inhibitor, a CRISPLD2 inhibitor, a GAS1 inhibitor and a LUM inhibitor. [6B] The method according to [5B], wherein the CXCL12 inhibitor is AMD3100 or a pharmacologically acceptable salt thereof. [7B] The method according to [5B], wherein a senolytic agent is administered concomitantly. [8B] The method according to [5B], wherein the senolytic agent is dasatinib, quercetin, fisetin, ABT-263 (Navitoclax; 4-(4-{[2-(4-Chlorophenyl)-5,5-dimethylcyclohex-1-en-1-yl]methyl}piperazin-1-yl)-N-(4-{[(2R)-4-(morpholin-4-yl)-1-(phenylsulfanyl)butan-2-yl]amino}-3-(trifluoromethanesulfonyl)benzene-1-sulfonyl)benzamide), BPTES, DON, compound 968, CB-839, a neutralizing antibody against KGA, or an siRNA, miRNA, or ASO against the GLS1 gene.

[0011] [1C] A senolytic agent for use in treating senolytic bladder cancer in a subject diagnosed with poor prognosis using the method described in [1]. [2C] The senolytic agent for use according to [1C], wherein the senolytic agent is a neutralizing antibody against dasatinib, quercetin, fisetin, ABT-263 (Navitoclax; 4-(4-{[2-(4-Chlorophenyl)-5,5-dimethylcyclohex-1-en-1-yl]methyl}piperazin-1-yl)-N-(4-{[(2R)-4-(morpholin-4-yl)-1-(phenylsulfanyl)butan-2-yl]amino}-3-(trifluoromethanesulfonyl)benzene-1-sulfonyl)benzamide), BPTES, DON, compound 968, CB-839, or KGA, or an siRNA, miRNA, or ASO against the GLS1 gene. [3C] The senolytic agent for use according to [1C], which is administered together with at least one selected from the group consisting of an SMOC2 inhibitor, a GUCY1A1 (GUCY1A3) inhibitor, a CXCL12 inhibitor, a CRISPLD2 inhibitor, a GAS1 inhibitor and a LUM inhibitor. [4C] The senolytic agent for use according to [3C], wherein the CXCL12 inhibitor is AMD3100 or a pharmacologically acceptable salt thereof. [5C][1] For use in treating age-related bladder cancer in subjects diagnosed with poor prognosis using the method described in At least one agent selected from the group consisting of a SMOC2 inhibitor, a GUCY1A1 (GUCY1A3) inhibitor, a CXCL12 inhibitor, a CRISPLD2 inhibitor, a GAS1 inhibitor, and a LUM inhibitor. [6C] The agent for use according to [5C], wherein the CXCL12 inhibitor is AMD3100 or a pharmacologically acceptable salt thereof. [7C] A drug for use according to [5C], administered together with a senolytic agent. [8C] The agent for use according to [5C], wherein the senolytic agent is dasatinib, quercetin, fisetin, ABT-263 (Navitoclax; 4-(4-{[2-(4-Chlorophenyl)-5,5-dimethylcyclohex-1-en-1-yl]methyl}piperazin-1-yl)-N-(4-{[(2R)-4-(morpholin-4-yl)-1-(phenylsulfanyl)butan-2-yl]amino}-3-(trifluoromethanesulfonyl)benzene-1-sulfonyl)benzamide), BPTES, DON, compound 968, CB-839, a neutralizing antibody against KGA, or an siRNA, miRNA or ASO against the GLS1 gene.

[0012] [1D] Use of a senolytic agent in the manufacture of a medicament for the treatment of senolytic bladder cancer in a subject diagnosed with poor prognosis using the method described in [1]. [2D] The use according to [1D], wherein the senolytic agent is a neutralizing antibody against dasatinib, quercetin, fisetin, ABT-263 (Navitoclax; 4-(4-{[2-(4-Chlorophenyl)-5,5-dimethylcyclohex-1-en-1-yl]methyl}piperazin-1-yl)-N-(4-{[(2R)-4-(morpholin-4-yl)-1-(phenylsulfanyl)butan-2-yl]amino}-3-(trifluoromethanesulfonyl)benzene-1-sulfonyl)benzamide), BPTES, DON, compound 968, CB-839, or KGA, or an siRNA, miRNA, or ASO against the GLS1 gene. [3D] The use described in [1D], wherein the pharmaceutical agent is administered together with at least one selected from the group consisting of an SMOC2 inhibitor, a GUCY1A1 (GUCY1A3) inhibitor, a CXCL12 inhibitor, a CRISPLD2 inhibitor, a GAS1 inhibitor and a LUM inhibitor. [4D] The use according to [3D], wherein the CXCL12 inhibitor is AMD3100 or a pharmacologically acceptable salt thereof. [5D] [1] In the manufacture of a medicament for treating age-related bladder cancer in a subject diagnosed with a poor prognosis using the method described in Use of at least one agent selected from the group consisting of an SMOC2 inhibitor, a GUCY1A1 (GUCY1A3) inhibitor, a CXCL12 inhibitor, a CRISPLD2 inhibitor, a GAS1 inhibitor, and a LUM inhibitor. [6D] The use according to [5D], wherein the CXCL12 inhibitor is AMD3100 or a pharmacologically acceptable salt thereof. [7D] The agent for use according to [5D], wherein the pharmaceutical agent is administered together with a senolytic agent. [8D] The use according to [5D], wherein the senolytic agent is a neutralizing antibody against dasatinib, quercetin, fisetin, ABT-263 (Navitoclax; 4-(4-{[2-(4-Chlorophenyl)-5,5-dimethylcyclohex-1-en-1-yl]methyl}piperazin-1-yl)-N-(4-{[(2R)-4-(morpholin-4-yl)-1-(phenylsulfanyl)butan-2-yl]amino}-3-(trifluoromethanesulfonyl)benzene-1-sulfonyl)benzamide), BPTES, DON, compound 968, CB-839, or KGA, or an siRNA, miRNA, or ASO against the GLS1 gene.

[0013] [1E] An in vivo or in vitro senolytic agent selected from the group consisting of an SMOC2 inhibitor, a GUCY1A1 (GUCY1A3) inhibitor, a CXCL12 inhibitor, a CRISPLD2 inhibitor, a GAS1 inhibitor, and a LUM inhibitor. [2E] The senolytic agent according to [1E], which is administered together with another senolytic agent. [3E] The senolytic agent according to [1E], wherein the CXCL12 inhibitor is AMD3100 or a pharmacologically acceptable salt thereof. [4E] The senolytic agent according to [2E], wherein the other senolytic agent is a neutralizing antibody against dasatinib, quercetin, fisetin, ABT-263 (Navitoclax; 4-(4-{[2-(4-Chlorophenyl)-5,5-dimethylcyclohex-1-en-1-yl]methyl}piperazin-1-yl)-N-(4-{[(2R)-4-(morpholin-4-yl)-1-(phenylsulfanyl)butan-2-yl]amino}-3-(trifluoromethanesulfonyl)benzene-1-sulfonyl)benzamide), BPTES, DON, compound 968, CB-839, or KGA, or an siRNA, miRNA, or ASO against the GLS1 gene. [Effects of the Invention]

[0014] The present invention makes it possible to provide a method for prognosticating and diagnosing bladder cancer and an anticancer agent for bladder cancer. [Brief explanation of the drawings]

[0015] [Figure 1] How p16-CreERT2-tdTomato mice work [Figure 2]Age-related increase in p16h cell numbers in the mouse bladder. a: FACS detection of Tomato+ (p16h) cells in the bladders of wild-type male mice (3-month-old mice) and p16-CreERT2-tdTomato male mice ("WT": wild-type; "3": 3-month-old mice; "12": 12-month-old mice; "25": 25-month-old mice). b: Percentage of Tomato+ (p16h) cell population in the bladders of male mice at the indicated ages, determined by FACS (n = 3 per group). c: FACS detection of Tomato+ (p16h) cells in the bladders of wild-type male mice (3-month-old mice) and p16-CreERT2-tdTomato female mice ("WT": wild-type; "3": 3-month-old mice; "12": 12-month-old mice; "25": 25-month-old mice). d: Percentage of Tomato+ (p16h) cell population in the bladder of female mice of the indicated ages, determined by FACS (n = 3 per group). e: Immunohistochemistry (IHC) staining of the three layers of the bladder wall (urothelium, lamina propria, and muscle layer) of p16-CreERT2-tdTomato male mice ("6": 6-month-old mice; "18": 18-month-old mice; "24": 24-month-old mice). Tomato protein was stained using anti-RFP antibody. The area enclosed by the dashed line indicates the urothelium or lamina propria. Scale bar, 100 μm. f: Number of Tomato+ (p16h) cells in the three layers of the bladder wall (urothelium, lamina propria, and muscle layer) of male mice of each age (n = 3 per group). [Figure 3]Senescent characteristics of p16h bladder cells. a: qPCR of cells derived from young (7-12 week old) male p16-CreERT2-Tomato mice (p16 n=9; p21 n=10; p15 n=11). b: qPCR of cells derived from young (7-12 week old) male p16-CreERT2-Tomato mice (Glb1 n=6). c: Percentage of p21+ cells in Tomato- (p16l) and Tomato+ (p16h) cells derived from young male p16-CreERT2-Tomato mice (n=4). d: Percentage of MKI67+ cells in Tomato- (p16l) and Tomato+ (p16h) cells derived from mouse bladders (n=4). e: Percentage of LMNB1+ cells among Tomato- (p16l) and Tomato+ (p16h) cells derived from the mouse bladder (n=4). Unpaired t-tests were performed on a–e, and all showed significant differences between Tomato- (p16l) and Tomato+ (p16h). [Figure 4] Increased expression of CXCL12 in p16h-sn fibroblasts derived from senescent bladder. a: Number of Tomato- (p16l) and Tomato+ (p16h-sn) cells by cell type. b: Cell type distribution of Tomato+ cells (p16h-sn). c: Volcano plot showing differentially expressed genes (DEGs) between Tomato+ (p16h-sn) and Tomato- (p16l) fibroblasts derived from bladder. Red and blue dots indicate up- and down-regulated DEGs with p-values ​​<0.05 and log fold change (log2FC) >0.15. d: Percentage of CXCL12+ cells in Tomato- (p16l) and Tomato+ (p16h-sn) fibroblasts (n=3 per group). e: Results of pathway analysis of up-regulated DEGs and their closely related pathways based on GO (Gene Ontology) terms (top 15 pathways). [Figure 5]Bladder cancer growth suppression by removal of p16h-sn cells. a: Percentage of Tomato+ (p16h-sn) cells in bladder tumors implanted in young (7-12 week old) female p16-CreERT2-DTR mice treated with tamoxifen alone or tamoxifen + DT (n=3 per group). b: Representative images (left) and bladder weights (right) of bladders in young (7-12 week old) female p16-CreERT2 or p16-CreERT2-DTR mice without MB49 cell implantation. Scale bar: 5mm (n=3 per group). c: Percentage of Tomato+ (p16h-sn) cells in bladder tumors implanted in ABT-263 or vehicle-treated groups. Tomato protein was measured by staining with anti-mCherry antibody. d: Tamoxifen + DT + vehicle treatment group: p16-CreERT2, n=11; p16-CreERT2-DTR, n=8. Tamoxifen + DT + ABT-263 treatment group: p16-CreERT2, n=11; p16-CreERT2-DTR, n=7. e: Bladder weights in each treatment group: Tamoxifen + DT + vehicle treatment group (p16-CreERT2, n=11; p16-CreERT2-DTR, n=8); Tamoxifen + DT + ABT-263 treatment group (p16-CreERT2, n=11; p16-CreERT2-DTR, n=7). One-way analysis of variance using the Games-Howell test was performed for d; unpaired t-tests were used for all other groups. [Figure 6]Bladder cancer growth suppression by removal of p16h-sn cells. 2 a: Representative images of the bladders of 7-12 week-old female p16-CreERT2 or p16-CreERT2-DTR mice after MB49 cell transplantation. Scale bar: 5 mm. b: Bladder weights of 7-12 week-old female p16-CreERT2 or p16-CreERT2-DTR mice after MB49 cell transplantation (CreERT2 n=10; p16-CreERT2-DTR n=11). c: Survival rates of young (7-12 week-old) female p16-CreERT2 and p16-CreERT2-DTR mice (p16-CreERT2 n=6; p16-CreERT2-DTR, n=7). d: Images of MB49 cell-implanted bladders in young (7-12 week old) female wild-type mice treated with ABT-263 or vehicle (vehicle n=12; ABT-263 n=11). Scale bar: 1 cm. e: Bladder weights of the samples in d (vehicle, n=12; ABT-263, n=11). f: Representative images of MB49 cell-implanted bladders after senescent cell removal in young (7-12 week old) female p16-CreERT2 or p16-CreERT2-DTR mice. Scale bar: 5 mm. g: Weights of MB49 cell-implanted bladders after senescent cell removal in young (7-12 week old) female p16-CreERT2 or p16-CreERT2-DTR mice. (p16-CreERT2 n=11; p16-CreERT2-DTR n=11). Unpaired t-test was performed for both. [Figure 7] Suppression of bladder tumorigenesis by elimination of p16h-sn cells. a: Images of the bladders of young male p16-CreERT2 or p16-CreERT2-DTR mice after BBN administration. Scale bar: 5 mm. b: Bladder weights of young male p16-CreERT2 or p16-CreERT2-DTR mice after BBN administration (p16-CreERT2 n=12; wild-type n=5; p16-CreERT2-DTR n=12). c: Tumor area in the bladders of young male p16-CreERT2 or p16-CreERT2-DTR mice after BBN administration. [Figure 8]CXCL12 secreted by p16h-sn stromal cells during bladder cancer progression. a: Percentage of CXCL12 expression levels in bladder cancer transplants in young (7-12 week old) female p16-CreERT2 or p16-CreERT2-DTR mice using anti-MKI67 antibody (p16-CreERT2 n=11; p16-CreERT2-DTR n=14). b: Percentage of MKI67+ cells after MB49 cell transplantation in young (7-12 week old) female p16-CreERT2 or p16-CreERT2-DTR mice (p16-CreERT2 n=4; p16-CreERT2-DTR n=3). Detected with MKI67 antibody. c: Percentage of CD31+ areas in the bladders of 12-week-old female p16-CreERT2 or p16-CreERT2-DTR mice after MB49 cell transplantation (p16-CreERT2 n=5; p16-CreERT2-DTR n=3). Detected with anti-CD31 antibody. d: AKT / pAKT expression levels in the bladders of p16-CreERT2 or p16-CreERT2-DTR mice. pAKT: phosphorylated AKT; ACTB: β-actin. e: AKT / phospho-AKT expression ratio in the bladders of p16-CreERT2 or p16-CreERT2-DTR mice. f: Images of female wild-type mouse bladders (vehicle-treated and AMD3100-treated groups) implanted with MB49 cells (shControl) or CXCR4 / CXCR7-knockdown MB49 cells (shCxc4-1 / Cxc7-1). Scale bar, 1 cm. g: Bladder weights of the samples in f. One-way analysis of variance using the Games-Howell test was performed for h. Unpaired t-tests were used for all other data. [Figure 9]Secretion of CXCL12 from p16h-sn iCAFs. a: FACS gating strategy for sorting Tomato+ (p16h-sn) iCAFs using young (7-12 week old) female p16-CreERT2-Tomato mice. b: Percentage of Tomato+ (p16h-sn) cells in iCAFs using young (7-12 week old) female p16-CreERT2-Tomato mice (n=4). c: Percentage of CXCL12+ cells in Tomato- (p16l) and Tomato+ (p16h-sn) iCAFs using young (7-12 week old) female p16-CreERT2-Tomato mice (n=3). d: qPCR using primers for Cxcl12 on Tomato- (p16l) cells and Tomato+ (p16h-sn) iCAFs in young (7-12 weeks old) female p16-CreERT2-Tomato mice (n = 4 per group). [Figure 10] Association of upregulated genes in mouse p16h-sn fibroblasts with patient prognosis in bladder cancer patients from the TCGA dataset (1). a: Overall survival rate by age for bladder cancer patients (<64 years old, n=159; 65-74 years old, n=135; 75 years old or older, n=141). b: Log2FC values ​​of the top seven upregulated genes in Tomato+ (p16h-sn) fibroblasts compared with Tomato- (p16h-sn) fibroblasts and Tomato- (p16l) fibroblasts from scRNA-seq data using aged male mouse bladders. c: Correlation coefficient matrix between mRNA expression of gene sets from the TCGA bladder cancer dataset. P<0.001 for all correlation coefficients. d: Expression levels of the indicated genes across different age groups of patients from the TCGA dataset (<64 years old, n=159; 65-74 years old, n=135; 75 years old or older, n=141). One-way analysis of variance using Tukey's test or Games-Howell test was performed on d. [Figure 11]Association of upregulated genes in mouse p16h-sn fibroblasts with patient prognosis in the TCGA dataset of bladder cancer patients (2). a: Expression of the indicated genes in different clinical predictors of patients obtained from the TCGA dataset (metastasis-negative, n=139; metastasis-positive, n=140; recurrence-negative, n=264; recurrence-positive, n=129; pathological T classification: ≤pT2, n=127; pT3, n=204 cases; pT4, n=61; grade-negative, n=21; grade-positive, n=402). b: Overall survival of bladder cancer patients grouped by gene expression level (SMOC2, GUCY1A3, CXCL12, MATN2, CRISPLD2, and GAS1: low expression, n=213; high expression, n=212; LUM: low expression, n=212; high expression, n=213). One-way analysis of variance using unpaired t-tests and Tukey's or Games-Howell's tests was performed. [Figure 12]p16h-sn CAF transcriptome signature as prognostic value in bladder cancer patients. a: Quantitative score of p16h-sn CAF signature in each age group of patients from the TCGA dataset (<64 years old n=138; 65-74 years old n=133; ≥75 years old n=155). b: Overall survival rate of patients from the TCGA dataset. All patients were divided equally into two groups based on p16h-sn CAF signature score (low score n=212; high score n=213). c: Comparison of p16h-sn CAF signature scores among patients in the TCGA dataset with clinical predictors (metastasis-negative n=139; metastasis-positive n=140; recurrence-negative n=264; recurrence-positive n=129; pathological T classification: pT2 or lower n=127; pT3 n=204; pT4 n=61; Grade-negative n=21; Grade-positive n=402). d: Hazard ratios and 95% confidence intervals of p16h-sn CAF signature and four clinical outcomes for survival. e: Comparison of p16h-sn CAF signature scores among bladder cancer patients at Fukushima Medical University with clinical predictors from microarray data (metastasis-negative n=114, metastasis-positive n=13; recurrence-negative n=90, recurrence-positive n=31; pathological T classification: pTa n=24, pT1 n=45, pT2 or higher n=21; Grade-negative n=39, Grade-positive n=61; muscle invasion-negative n=97, muscle invasion-positive n=39; tumor size: ≤3cm n=86, ≥3cm n=48; number of tumors: single n=56, multiple n=80). Cox proportional hazards analysis was performed for d; one-way analysis of variance with Games-Howell test was performed for a; unpaired t-test and one-way analysis of variance with Turkey's test were performed for c and e. DETAILED DESCRIPTION OF THE INVENTION

[0016] Preferred embodiments of the present invention will be described in detail below with reference to the accompanying drawings, but the present invention is not necessarily limited thereto. The objects, features, advantages, and concepts of the present invention will be apparent to those skilled in the art from the description in this specification, and those skilled in the art will be able to easily reproduce the present invention from the description in this specification. The embodiments and specific examples of the invention described below show preferred embodiments of the present invention and are presented for illustrative or explanatory purposes, and are not intended to limit the present invention thereto. It will be apparent to those skilled in the art that various changes and modifications can be made based on the description in this specification within the spirit and scope of the present invention disclosed herein.

[0017] As used herein, "comprising" encompasses "substantially comprising," "essentially comprising," "consisting essentially of," and "consisting of."

[0018] One embodiment of the present invention is a method for determining, or aiding in determining, the prognostic value of aggressive or non-aggressive bladder cancer in a subject. Subjects include humans and non-human mammals (mice, rats, dogs, cats, etc.). Bladder cancer is cancer that develops in the bladder, and the majority of bladder cancers are urothelial carcinomas that develop in the urothelium that lines the inside of the bladder. Urothelial carcinomas are classified as non-muscle invasive or muscle invasive depending on how deep the cancer has spread into the bladder wall (depth of invasion). In addition to urothelial carcinoma, bladder cancer also includes squamous cell carcinoma, adenocarcinoma, and small cell carcinoma. Bladder cancer can be either metastatic or primary. Non-advanced bladder cancer refers to cancer that has invaded only partially within the bladder. This includes, but is not limited to, non-muscle-invasive bladder cancer (Ta: papillary non-invasive carcinoma; Tis: carcinoma in situ; T1 subepithelial connective tissue carcinoma, etc.). Advanced bladder cancer refers to cancer that has invaded deeply into the muscle layer. This includes, but is not limited to, muscle-invasive bladder cancer (T2: invasion into the muscle layer; T3: invasion of perivesical fat tissue; T4: invasion of adjacent organs). A prognostic value is a numerical index that predicts the prognosis of a subject. Such values ​​are measured before and after treatment (chemotherapy, radiation therapy, etc.) and are also used to evaluate the effectiveness of treatment. Prognostic values ​​include, but are not limited to, metastasis (probability of metastasis), recurrence (probability of recurrence), pathological T stage, malignancy, muscle invasion (degree), tumor size, and survival probability. Bladder cancer is a disease that occurs more frequently in older people, and although not limited to this, age-related bladder cancer may be cancer that occurs in people aged 60 or older, 65 or older, 70 or older, or 75 or older (or cancer that is first discovered at that age).

[0019] In one embodiment of the present invention, the method of determining or aiding in determining a prognostic value comprises detecting the expression level of the gene in a sample isolated from the subject. Preferably, the sample contains bladder cells, more preferably bladder fibroblasts. The sample may be obtained from a subject by biopsy or during surgery. Alternatively, bladder cells may be obtained from a urine sample. The genes detected are SMOC2(SPARC Related Modular Calcium Binding 2;HGNC: 20323 NCBI Gene: 64094 Ensembl: ENSG00000112562 OMIM: 607223 UniProtKB / Swiss-Prot: Q9H3U7); GUCY1A1(GUCY1A3)(Guanylate Cyclase 1 Soluble Subunit Alpha 1;HGNC: 4685 NCBI Gene: 2982 Ensembl: ENSG00000164116 OMIM: 139396 UniProtKB / Swiss-Prot: Q02108); CXCL12(C-X-C Motif Chemokine Ligand 12;HGNC: 10672 NCBI Gene: 6387 Ensembl: ENSG00000107562 OMIM: 600835 UniProtKB / Swiss-Prot: P48061); CRISPLD2(Cysteine Rich Secretory Protein LCCL Domain Containing 2;HGNC: 25248 NCBI Gene: 83716 Ensembl: ENSG00000103196 OMIM: 612434 UniProtKB / Swiss-Prot: Q9H0B8) GAS1(Growth Arrest Specific 1;HGNC: 4165 NCBI Gene: 2619 Ensembl: ENSG00000180447 OMIM: 139185 UniProtKB / Swiss-Prot: P54826) LUM(Lumican;HGNC: 6724 NCBI Gene: 4060 Ensembl: ENSG00000139329 OMIM: 600616 UniProtKB / Swiss-Prot: P51884); Matn2(Matrilin 2; HGNC: 6908 NCBI Gene: 4147 Ensembl: ENSG00000132561 OMIM: 602108 UniProtKB / Swiss-Prot: O00339); Clec3b(C-Type Lectin Domain Family 3 Member B;HGNC: 11891 NCBI Gene: 7123 Ensembl: ENSG00000163815 OMIM: 187520 UniProtKB / Swiss-Prot: P05452); Pid1 (Phosphotyrosine Interaction Domain Containing 1;HGNC: 26084 NCBI Gene: 55022 Ensembl: ENSG00000153823 OMIM: 612930 UniProtKB / Swiss-Prot: Q7Z2X4); Pam(Peptidylglycine Alpha-Amidating Monooxygenase;HGNC: 8596 NCBI Gene: 5066 Ensembl: ENSG00000145730 OMIM: 170270 UniProtKB / Swiss-Prot: P19021) Cd55(CD55 Molecule (Cromer Blood Group);HGNC: 2665 NCBI Gene: 1604 Ensembl: ENSG00000196352 OMIM(R): 125240 UniProtKB / Swiss-Prot: P08174)、 Col14a1(Collagen Type XIV Alpha 1 Chain;HGNC: 2191 NCBI Gene: 7373 Ensembl: ENSG00000187955 OMIM(R): 120324 UniProtKB / Swiss-Prot: Q05707); Fmo2(Flavin Containing Dimethylaniline Monoxygenase 2;HGNC: 3770 NCBI Gene: 2327 Ensembl: ENSG00000094963 OMIM(R): 603955 UniProtKB / Swiss-Prot: Q99518); Dner((Delta / Notch Like EGF Repeat Containing, HGNC: 24456 NCBI Gene: 92737 Ensembl: ENSG00000187957 OMIM: 607299 UniProtKB / Swiss-Prot: Q8NFT8); and Sparcl1(SPARC Like 1;HGNC: 11220 NCBI Gene: 8404 Ensembl: ENSG00000152583 OMIM: 606041 UniProtKB / Swiss-Prot: Q14515) It may be at least one selected from the group consisting of: Although not particularly limited, the expression levels of these genes can be calculated by reverse transcribing mRNA extracted from cells in a sample and performing quantitative PCR (qPCR) using specific primers for each gene. Alternatively, the expression levels can be calculated by determining the entire sequence of the extracted mRNA (RNA-Seq analysis (transcriptome analysis)). The expression level obtained may be compared with that in normal bladder cells, and the prognostic value may be determined based on the high expression level, or may be compared with that in cells derived from nearby normal tissue samples taken at the same time as biopsy or cancer removal surgery.

[0020] One embodiment of the present invention is a pharmaceutical composition comprising a senolytic agent for treating or preventing age-related bladder cancer in a subject determined to have a poor prognosis. To determine a poor prognosis, the above-mentioned methods for determining a prognosis value or methods assisting in determining a prognosis value may be used, or other methods (e.g., immunohistological detection of abnormal gene expression or intranuclear proliferation-associated proteins) may also be used. When chromosomal damage occurs due to age-related stress, cells undergo senescence and cease cell division to prevent cancer. Senescent cells that accumulate in tissues in this way are programmed to secrete senescence-associated secreted phenotype factors (SASP factors, including inflammatory cytokines), which activate the immune system and lead to their own elimination. However, if this elimination mechanism does not function for some reason, the accumulation of senescent cells is prolonged, leading to chronic tissue inflammation and the onset and progression of associated age-related diseases. A variety of molecules have been reported to function as senolytic agents (sometimes called senolytic agents).

[0021] "Treatment of bladder cancer" includes the disappearance of cancer cells or the inhibition of their proliferation in bladder cancer as a result of administration of the pharmaceutical composition or the like according to the present invention. Alternatively, it includes the alleviation or remission of various symptoms associated with bladder cancer (such as hematuria, frequent urination, pain during urination, a feeling of retained urine, and an urgent need to urinate). Without being particularly limited, "treatment of bladder cancer" may also include an improvement in prognosis value. Such prognosis value may be calculated using a method for determining a prognosis value or a method for assisting in determining a prognosis value according to one embodiment of the present invention, or may be calculated by other methods (for example, immunohistological examination of gene expression abnormalities or nuclear proliferation-associated proteins).

[0022] "Prevention of bladder cancer" includes suppressing the occurrence of symptoms associated with bladder cancer (such as hematuria, frequent urination, pain during urination, feeling of retained urine, and the urge to urinate) as a result of administering the pharmaceutical composition or the like according to the present invention. Without being particularly limited, "prevention of bladder cancer" may also include no change in prognostic value. Such prognostic value may be calculated using a method for determining a prognostic value or a method for assisting in determining a prognostic value according to one embodiment of the present invention, or may be calculated by other methods (for example, immunohistological detection of gene expression abnormalities or nuclear proliferation-associated proteins).

[0023] Although not limited thereto, senolytic agents include: Dasatinib; Quercetin; Fisetin; Luteolin Curcumin; Curcumin Analog EF24; Navitoclax; ABT263;4-(4-{[2-(4-Chlorophenyl)-5,5-dimethylcyclohex-1-en-1-yl]methyl}piperazin-1-yl)-N-(4-{[(2R)-4-(morp holin-4-yl)-1-(phenylsulfanyl)butan-2-yl]amino}-3-(trifluoromethanesulfonyl)benzene-1-sulfonyl)benzamide); A1331852;A1155463; Geldanamycin; Tanespimycin; Alvespimycin; Piperlongumine; These include first-generation drugs such as (Non-Patent Document 2).

[0024] The senolytic agent may also contain a kidney-type glutaminase (KGA) inhibitor (Patent Document 2). The KGA inhibitor is not particularly limited, but may be: BPTES (Bis-2-(5-phenylacetamido-1,3,4-thiadiazol-2-yl)ethyl sulfide CAS No: 314045-39-1); DON (6-Diazo-5-oxo-L-norleucine CAS No:51481-10-8), compound 968 (CAS No: 311795), CB-839 (CAS No: 1439399-58-2), pharmacologically acceptable salts thereof, It may also include a neutralizing antibody against KGA, or siRNA, miRNA or ASO (antisense oligonucleotide) against the GLS1 gene.

[0025] In one embodiment of the present invention, an inhibitor that inhibits the expression or function of at least one gene product selected from the group consisting of SMOC2, GUCY1A1 (GUCY1A3), CXCL12, CRISPLD2, GAS1, and LUM can function as a senolytic agent. These inhibitors may be administered to a subject in combination with other senolytic agents as described above.

[0026] One embodiment of the present invention is a pharmaceutical composition for treating age-related bladder cancer in a subject determined to have a poor prognosis, comprising an inhibitor that inhibits the expression or function of at least one gene product selected from the group consisting of SMOC2, GUCY1A1 (GUCY1A3), CXCL12, CRISPLD2, GAS1, and LUM.

[0027] SMOC2 inhibitors, GUCY1A1 (GUCY1A3) inhibitors, CXCL12 inhibitors, CRISPLD2 inhibitors, GAS1 inhibitors and LUM inhibitors are not particularly limited, and may include antibodies, siRNAs, miRNAs or ASOs against SMOC2, GUCY1A1 (GUCY1A3), CXCL12, CRISPLD2 and GAS1. GUCY1A1 (GUCY1A3) inhibitors include guanylyl cyclase inhibitors, including, but not limited to, AS 184285 (5-Amino-7-(cyclohexylamino)-1-ethyl-6-fluoro-1,4-dihydro-4-oxo-3-quinolinecarboxylic acid; NS 2028 (8-Bromo-1H,4H-[1,2,4]oxadiazolo[3,4-c][1,4]benzoxazin-1-one) and pharmacologically acceptable salts thereof. CXCL12 inhibitors include chemokine receptor antagonists, including, but not limited to, Plerixafor (AMD3100, JM 3100, SID791; CAS No. 110078-46-1), LIT-927 (CAS No. 2172879-52-4), or pharmacologically acceptable salts thereof.

[0028] In one embodiment of the present invention, the senolytic agent and the gene expression or function inhibitor may be administered in combination to a subject. Such a combination is expected to have a synergistic effect.

[0029] The present invention will be described in detail below with reference to examples, but the present invention is not limited to these examples. [Example]

[0030] Example 1 Identification of senescent cells in the bladder The accumulation of p16-high expressing cells (hereafter referred to as p16h cells) in organs is known to provide an inflammatory environment, which is a characteristic of the aging process. To investigate whether this is also the case in the bladder, we used a previously established mouse model (p16-Cre ERT2Using the CreERT2-tdTomato (Non-Patent Document 1) gene, the number of p16h cells in the bladders of different ages was measured. This mouse model was a cross between p16-CreERT2 mice, in which the CreERT2 recombinase gene was inserted downstream of the p16 gene promoter, a marker gene for senescent cells, and Rosa26-CAG-lsl-tdTomato mice, which express the red fluorescent protein tdTomato in a CreERT2 recombinase activity-dependent manner. Administration of tamoxifen (TAM) allows CreERT2 to translocate into the nucleus of p16-positive cells. As a result, the STOP sequence flanked by the lox sequences in Rosa26 is removed by CreERT2 recombination, allowing the subsequent tdTomato to be expressed, and p16-positive cells are labeled red. Furthermore, p16-CreERT2 ERT2 -DTR-tdTomato mice also showed the ability to specifically eliminate red-labeled p16-positive cells by adding diphtheria toxin (DT) (Figure 1).

[0031] Mice were given ip injections of tamoxifen (80 mg / kg body weight) (#T 5648-G, Sigma-Aldrich or #13258, Cayman Chem) dissolved in sunflower oil (#196-15265, Wako) using a 25G needle for 5 consecutive days, and were euthanized two weeks after the first day of tamoxifen injection. We then examined the number of Tomato-positive p16h non-immune cells in the entire bladders of male and female mice with aging. The results showed that the number of these cells increased more than threefold in 24- and 25-month-old mice compared with 3-month-old mice (Fig. 2a-d). Furthermore, tissue section analysis confirmed an increase in these p16h cells in the epithelial layer, lamina propria, and muscularis of the bladder tissue (Fig. 2e-f).

[0032] To examine whether p16h bladder cells exhibit a senescent phenotype, we measured the mRNA levels of p16 (CDKN2A: Cyclin-Dependent Kinase Inhibitor 2A), p21 (CDKN1A: Cyclin-Dependent Kinase Inhibitor 1A), and p15 (CDKN2B: Cyclin-Dependent Kinase Inhibitor 2B) (Fig. 3a). We also examined the expression of senescence-associated β-galactosidase (Fig. 3b), the percentage of p21-positive cells (Fig. 3c), and the percentage of cells expressing the proliferation markers MKI67 and LMNB1 (Figs. 3d and e). RNA was extracted from the isolated bladder tissue, reverse transcribed, and then the expression levels of each gene were detected by real-time PCR using the following primers. The expression levels were normalized by the expression level of Actb (β-actin). p16: forward primer CGTACCCCGATTCAGGTGAT (SEQ ID NO: 1); Reverse primer TTGAGCAGAAGAGCTGCTACGT (SEQ ID NO: 2). p21: forward primer CCTGGTGATGTCCGACCTG (SEQ ID NO: 3); Reverse primer CCATGAGCGCATCGCAATC (SEQ ID NO: 4). p15: forward primer GACCCTGCCACCCTTACCAGACC (SEQ ID NO: 5); Reverse primer CAGGCGTCACACACATCCAGCC (SEQ ID NO: 6). Glb1: forward primer CTTCCCACTGAACACTGAGGC (SEQ ID NO: 7); Reverse primer TTGGCACGAACAAGGTCTTTT (SEQ ID NO: 8). Cxcl12: forward primer TGCATCAGTGACGGTAAACCA (SEQ ID NO: 9); Reverse primer CACAGTTTGGAGTGTT (SEQ ID NO: 10). Actb: forward primer GGCTGTATTCCCCTCCATCG (SEQ ID NO: 11); Reverse primer CCAGTTGGTAACAATGCCATGT (SEQ ID NO: 12).

[0033] The results showed that the expression of p16, p21, and p15 was increased, and that of senescence-associated β-galactosidase was increased, while proliferation markers were decreased, indicating that p16h bladder cells are senescent cells (sometimes referred to as p16h-sn cells or p16h senescent cells).

[0034] Example 2 Upregulation of Cxcl12 expression in p16h-sn fibroblasts derived from senescent bladder To identify the cell type and transcriptome characteristics of p16h-sn cells in the bladder, we performed single-cell RNA sequencing (scRNA-seq) analysis of non-immune cells in the bladder of 25-month-old male mice. Cells were isolated from bladder tissue and separated using FACS into 1,527 Tomato+ / CD45- bladder cells and 8,588 Tomato-negative (Tomato-) / CD45- bladder cells. Using scRNA-seq, the isolated cells were classified into eight cell types: fibroblasts, basal cells, smooth muscle cells, umbrella cells, endothelial cells, neurons, myofibroblasts, and intermediate cells. As a result, the proportion of fibroblasts was the highest (Fig. 4a and b).

[0035] Therefore, we analyzed the differentially expressed genes between Tomato+ and Tomato fibroblasts. The results revealed several upregulated genes, including Cxcl12, Matn2, Clec3b, Lum, Cripid2, Smoc2, Gucy1a1, Gas1, Pid1, Pam, Cd55, Col14a1, Fmo2, Dner, and Sparcl1 (Figure 4e). We also found several downregulated genes, including Cxcl14, Csrp2, Sfrp2, Ly6d, Gsta4, Gstm1, Eef1a1, Krt19, Plac8, Wnt2, Gm973, Car3, Asz1, and Igfba5 (Figure 4c). Furthermore, the proportion of Cxcl12-positive cells was also increased in Tomato+ / CD45- bladder cells (Fig. 4d).

[0036] CXCL12 is a chemokine reported as one of the senescence-associated secretory phenotype (SASP) factors and is secreted by senescent tumor cells. Gene ontology (GO) analysis of up-regulated DEGs in Tomato+ fibroblasts revealed relationships with several biological processes related to cancer progression, including cell migration, protein kinase B signaling, angiogenesis, and cell-cell adhesion (Figure 4e). On the other hand, in other cell types such as endothelial cells, smooth muscle cells, and urothelial cells, the SASP factors and their associated functions were unclear.

[0037] Example 3 Bladder cancer growth suppression by depletion of p16h-sn cells p16 h To clarify whether -sn cells affect the incidence and progression of bladder cancer, the following experiment was performed. (0) Effects of Tamoxifen and Diphtheria Toxin p16-Cre ERT2 -DTR-tdTomato mice and p16-Cre ERT2 -tdTomato mouse, 1) tamoxifen (80 mg / kg body weight) alone administered intraperitoneally (4 days); or 2) tamoxifen (80 mg / kg body weight) and diphtheria toxin (25 μg / kg body weight) administered intraperitoneally for 14 days in alternating fashion; was carried out.

[0038] As a result, p16-Cre ERT2 Although DT treatment significantly reduced the number of Tomato+ cells in the -DTR-tdTomato mice (Fig. 5a), the bladder weight and bladder wall thickness were significantly reduced compared with those in the p16-Cre mice. ERT2 -DTR-tdTomato mice and p16-Cre ERT2We confirmed that there was no difference between p16h and tdTomato mice (Fig. 5b, c), indicating that normal bladder tissue was maintained even after p16h cell removal.

[0039] (1) Orthotopic transplantation of mouse bladder cancer cell lines Female mice (p16-Cre ERT2 -DTR-tdTomato mice and p16-Cre ERT2 Mice (-tdTomato) were anesthetized with isoflurane and placed in the supine position. The bladder was emptied by gently compressing the abdomen with a hand. A polyethylene catheter (#427400 BD) with an inner diameter of 0.28 mm and an outer diameter of 0.61 mm was inserted into the urethra. A 28G needle connected to a 1 ml syringe was attached to the other end of the catheter. Before injection of MB49 cells (a murine bladder cancer cell line), 100 μl of poly-L-lysine hydrobromide solution (#4832, Sigma-Aldrich) was injected into the urethra. After 30 min, the bladder was emptied again, and 1.0 x 10 5 of MB49 cells (100 μl PBS) were injected.

[0040] (2) Selective cell removal by DT administration Starting from day 14 after bladder cancer cell transplantation, mice were treated with alternating intraperitoneal administration of tamoxifen (80 mg / kg body weight per day) and diphtheria toxin (25 μg / kg body weight per day) for 14 days.

[0041] result MB49 cells were transplanted with p16-Cre ERT2 The tumor size and bladder weight of the -DTR-tdTomato group were compared with those of p16-Cre ERT2 p16-Cre mice showed significantly lower levels of α- and β-tomatopoietin (Fig. 6a, b). ERT2 The survival rate was also significantly improved in the -DTR-tdTomato group (Fig. 6c). This indicates that p16h senescent cells contribute to the proliferation of cancer cells.

[0042] Example 4. Suppression of cancer cell proliferation by senolytic agents (0) Elimination of p16h-sn cells by ABT-263 p16-Cre ERT2 Tamoxifen (80 mg / kg body weight) was administered intraperitoneally (4 days) to a group of -tdTomato female mice. 14 days after the start of tamoxifen administration, MB49 cells were injected as described in Example 3. From days 7 to 13 and from days 21 to 27 after injection, the senolytic agent ABT-263 (50 mg / kg body weight per day) or vehicle was administered daily. On day 28 after cancer cell injection, the mice were euthanized and the percentage of Tomato+ cells in the bladder tissue was determined. As a result, ABT-263 administration resulted in Tomato + The number of cells was significantly reduced (Fig. 5d), indicating that ABT-263 also has an effect on p16h senescent cells.

[0043] (1) p16-Cre by ABT-263 ERT2 -DTR-tdTomato mice and p16-Cre ERT2 -Inhibition of cancer cell growth in tdTomato mice p16-Cre ERT2 -DTR-tdTomato mice (female) and p16-Cre ERT2 Female -tdTomato mice were injected with MB49 cells as in Example 3 and then administered ABT-263 (50 mg / kg body weight per day) or vehicle daily from days 7 to 13 and from days 21 to 27 after injection. Starting on day 14 after injection, the mice were treated with alternating intraperitoneal administration of tamoxifen (80 mg / kg body weight per day) and diphtheria toxin (DT) (25 μg / kg body weight per day) for 14 days. As a result, the bladder weight was significantly higher in the p16-Cre ERT2 -DTR-tdTomato mice (DT-treated) and p16-Cre ERT2 -tdTomato mice (DT+ABT-263 treated) and p16-Cre ERT2 -DTR-tdTomato mice (DT+ABT-263 treated) (Fig. 5e).

[0044] (2) ABT-263 inhibits cancer cell growth in wild-type mice Wild-type mice were injected with MB49 cells as in Example 3, and then daily administered the senolytic agent ABT-263 (50 mg / kg body weight per day) or vehicle from days 7 to 13 and from days 21 to 27 after injection. On day 28 after cancer cell injection, the mice were euthanized and the bladders were removed (Figure 6d). Bladder size was significantly reduced in the ABT-263-treated group (Figure 6e). However, it was not confirmed that ABT-263 administration specifically caused apoptosis or necrosis in cancer cells.

[0045] These results indicate that ABT-263 eliminates naturally occurring p16h senescent cells, resulting in the suppression of cancer cell proliferation.

[0046] Example 5. Suppression of tumorigenesis by eliminating p16h senescent cells (0) Tumor formation suppression by selective elimination of senescent cells with DT administration Female mice (p16-Cre ERT2 -DTR-tdTomato mice and p16-Cre ERT2 Tamoxifen (80 mg / kg body weight per day) and diphtheria toxin (25 μg / kg body weight per day) were administered intraperitoneally to mice (i.e., tdTomato mice) for 14 days. 5 MB49 cells (100 μl PBS) were injected into the bladder. On the 28th day after injection, the mice were euthanized and the bladders were removed (Fig. 6f). ERT2 -DTR-tdTomato mice had significantly reduced bladder size (Fig. 6g). (1) Effects of p16h-sn bladder cell ablation in tumor-inducing mouse models The effect of p16h-sn bladder cell ablation on tumorigenesis was examined using a carcinogen-induced carcinogenesis model using N-butyl-N-(4-hydroxybutyl) nitrosamine (BBN). Drinking water containing 0.05% BBN was cultured in a 2000-well plate containing p16-Cre ERT2 -DTR-tdTomato mice (female), p16-Cre ERT2 Female tdTomato mice and female wild-type mice were given BBN ad libitum and were treated with alternating intraperitoneal administration of tamoxifen (80 mg / kg body weight per day) and diphtheria toxin (DT) (25 μg / kg body weight per day) for 14 days from day 70 to day 83. On day 84, the mice were euthanized and their bladders were removed.

[0047] result Wild-type mice and p16-Cre ERT2 p16-Cre eliminated p16h senescent cells compared with -tdTomato mice ERT2 In -DTR-tdTomato mice, the bladder weight was reduced and the tumor area was also reduced (Fig. 7a-c).

[0048] These results indicate that the elimination of p16h senescent cells is effective in suppressing tumor formation not only in metastatic cancers but also in primary cancers.

[0049] Example 6 The effect of CXCL12 secreted by p16h-sn stromal cells on bladder cancer progression In Examples 3 and 4, p16-Cre ERT2 The reduction in tumor size due to the -DTR model and the loss of p16h-sn cells by ABT-263 suggests that some signal from p16h-sn cells may support tumor growth. The chemokine CXCL12 promotes tumor growth, cancer cell migration, proliferation, cell adhesion, angiogenesis, epithelial-mesenchymal transition, and metastasis in various cancers. CXCL12 was one of the top 10 up-regulated genes in p16hsn fibroblasts (Figure 4c) and was the most enriched of 15 terms in the GO analysis (Figure 4e). Intratumoral CXCL12 protein levels in the presence of DT were significantly higher than those in p16-Cre ERT2 -DTR group was compared with the control group (p16Cre ERT2 ) was reduced compared to p16-Cre (Fig. 8a).ERT2 The number of MKI67+ cells, a cell proliferation marker, decreased in the -DTR group, and p16-Cre ERT2 In the -DTR group, the CD31+ area associated with intratumoral angiogenesis was reduced compared to the control group (Fig. 8c). These data indicate that elimination of senescent cells reduces the effects of CXCL12, suppressing cancer cell proliferation and angiogenesis in cancer tissues, resulting in tumor regression. Furthermore, the amount of phosphorylated AKT (pAKT), one of the downstream signaling pathways of CXCL12, was also significantly reduced after DT administration by p16-Cre. ERT2 -DTR group was significantly decreased (Fig. 8d, e).

[0050] (1) Suppression of cancer cell proliferation by CXCL12 inhibitors MB49 cells, which had been infected with lentivirus expressing shRNA for two CXCL12 receptors, CXCR4 and CXCR7, and had CXCR4 and CXCR7 expression knocked down, were injected into a group of wild-type mice as described in Example 4. As a control, non-knockdown MB49 cells were also injected into another group of mice. After injection, the mice were administered 3.5 mg / kg body weight per day of the chemokine receptor antagonist AMD3100 (#S3013, Selleck) or vehicle on days 14 to 18 and 21 to 25. On day 28, the mice were euthanized, and their bladders were removed and weighed.

[0051] result AMD3100 treatment suppressed the proliferation of cancer cells derived from MB49 cells expressing CXCR4 and CXCR7. On the other hand, the proliferation of MB49 cells that do not express CXCR4 or CXCR7 (i.e., do not respond to CXCL12) was suppressed even by vehicle treatment (Fig. 8f, g). This indicates that the CXCL12 signaling cascade contributes to cancer cell proliferation.

[0052] Example 7 CXCL12 secretion from p16h-sn inflammatory cancer-associated fibroblasts Cancer-associated fibroblasts (CAFs), a major component of the stroma, are classified into inflammatory CAFs (iCAFs) and myofibroblastic CAFs (myCAFs) based on the expression of CD140a and aSMA, respectively. iCAFs are known to secrete various cytokines and chemokines, including CXCL12, in bladder cancer. MB49 cells were transplanted with p16-Cre ERT2 Bladder tissue cells from -tdTomato mice were separated by FACS, and approximately 3% of the iCAFs were Tomato-positive, i.e., p16h-sn fibroblasts (Fig. 9a, b). Furthermore, Tomato-positive iCAFs secreted and expressed significantly more CXCL12 than Tomato-negative iCAFs (Fig. 9c, d). This indicates that CXCL12 is secreted from p16h-sn inflammatory cancer-associated fibroblasts.

[0053] Example 8 Impact of p16h-sniCAF on the prognosis of bladder cancer patients Publicly available transcriptome-based clinical data for bladder cancer (The Cancer Genome Atlas (TCGA)) showed that the pre-elderly (65-74 years) and elderly (=75 years) groups had significantly worse prognosis than the younger (=64 years) group (Figure 10a). In Example 2, p16 low The top seven genes (Smoc2, Gucyla (Gucy1a3), Cxcl12, Matn2, Crispld2, Gasl, and Lum) that showed the greatest changes in expression levels in p16h-sn fibroblasts (i.e., Tomato-positive cells with high Tomato expression) compared to fibroblasts (i.e., Tomato-negative cells with low Tomato expression) were selected as candidates (Figure 10b). The expression levels of all of these genes, except for MATN2, showed a high positive correlation in the TCGA dataset (Figure 10c). Five genes, excluding MATN2 and CRISPLD2, tended to increase in the elderly group (Fig. 10d). Regarding cancer prognostic factors, only GUCY1A1 (GUCY1A3), GAS1, and LUM correlated with recurrence, while six genes, excluding MATN2, were associated with metastasis, pathological T stage, and grade (Fig. 11a). SMOC2, CXCL12, CRISPLD2, and LUM also correlated with survival probability, and GUCY1A1 (GUCY1A3) and GAS1 also tended to be associated (p-value < 0.1) (Fig. 11b). Based on these results, we defined high expression of SMOC2, GUCY1A1 (GUCY1A3), CXCL12, CRISPLD2, GAS1, and LUM as a signature of p16h-sn CAFs. TCGA patients were classified based on the p16h-sn CAF signature. The p16h-sn CAF signature score correlated with age and poor prognosis (Fig. 12a, b). The p16h-sn CAF signature score was higher than the pathological T stage (tumor size and invasion) (Fig. 12c, d). Because the majority of TCGA samples were obtained from patients with advanced bladder cancer with muscle invasion, we also examined samples from patients with non-advanced bladder cancer to comprehensively use the p16h-sn CAF signature as a prognostic value. We performed microarray RNA analysis on samples from 136 bladder cancer patients, most of whom had non-muscle-invasive bladder cancer. The p16h-snCAF signature score was associated with poor prognostic outcomes, including metastasis, pathological T stage, grade, muscle invasion, and tumor size (Fig. ​(Fig.12e). 12e).

[0054] These results suggest that p16h-sn CAFs play an important role in age-dependent bladder cancer progression, and that the p16h-sn CAF signature may be a useful prognostic indicator for both advanced and non-advanced bladder cancer patients. Furthermore, elimination of p16h-sn cells suppresses cancer cell proliferation and metastasis, suggesting that senolytic agents may be effective for patients with poor prognosis. [Industrial Applicability]

[0055] Bladder cancer is one of the most challenging cancers with a poor prognosis. Systemic therapy for metastatic urothelial cancer includes typical cisplatin-based combination therapy and immune checkpoint inhibitors, as well as the validation of novel agents such as FGFR tyrosine kinase inhibitors and enfortumab vedotin. However, the 5-year survival rate for muscle-invasive bladder cancer remains poor. Therefore, identifying high expression of SMOC2, GUCY1A1 (GUCY1A3), CXCL12, CRISPLD2, GAS1, and LUM as prognostic factors is useful for diagnosing bladder cancer requiring aggressive treatment, including senolytic agents.

Claims

1. 1. A method for aiding in determining the prognostic value of aggressive or non-aggressive bladder cancer in a subject, comprising: detecting the expression level of at least one gene selected from the group consisting of SMOC2, GUCY1A1 (GUCY1A3), CXCL12, CRISPLD2, GAS1, and LUM in a sample (fibroblast) cell isolated from the subject; The method wherein the expression level obtained is compared with the expression level in normal bladder fibroblasts, and the prognostic value is determined based on the high expression level.

2. 2. The method of claim 1, wherein the prognostic value is selected from the group consisting of metastasis, recurrence, pathological T stage, grade, muscle invasion, tumor size, and survival probability.

3. A pharmaceutical composition for treating age-related bladder cancer in a subject diagnosed with a poor prognosis using the method of claim 1, comprising a senolytic agent.

4. Senescent cell-busting agents include dasatinib, quercetin, fisetin, and ABT-263 (Navitoclax; 4-(4-{[2-(4-Chlorophenyl)-5,5-dimethylcyclohex-1-en-1-yl]methyl}piperazin-1-yl)-N-(4-{[(2R)-4-(morpholin-4-yl)-1-(phenylsulfanyl)butan-2-yl]amino}-3-(trifluoromethanesulfonyl)benzene-1-sulfonyl)benzamide). The pharmaceutical composition according to claim 3, which is a neutralizing antibody against BPTES, DON, compound 968, CB-839, or KGA, or an siRNA, miRNA, or ASO against the GLS1 gene.

5. The pharmaceutical composition of claim 3, which is administered in combination with at least one selected from the group consisting of a SMOC2 inhibitor, a GUCY1A1 (GUCY1A3) inhibitor, a CXCL12 inhibitor, a CRISPLD2 inhibitor, a GAS1 inhibitor, and a LUM inhibitor.

6. The pharmaceutical composition according to claim 5, wherein the CXCL12 inhibitor is AMD3100 or a pharmacologically acceptable salt thereof.

7. A pharmaceutical composition for treating age-related bladder cancer in a subject diagnosed with a poor prognosis using the method of claim 1, comprising at least one selected from the group consisting of a SMOC2 inhibitor, a GUCY1A1 (GUCY1A3) inhibitor, a CXCL12 inhibitor, a CRISPLD2 inhibitor, a GAS1 inhibitor and a LUM inhibitor.

8. The pharmaceutical composition according to claim 7, wherein the CXCL12 inhibitor is AMD3100 or a pharmacologically acceptable salt thereof.

9. The pharmaceutical composition of claim 7 , which is administered together with a senolytic agent.

10. 10. The pharmaceutical composition according to claim 9, wherein the senolytic agent is dasatinib, quercetin, fisetin, ABT-263 (Navitoclax; 4-(4-{[2-(4-Chlorophenyl)-5,5-dimethylcyclohex-1-en-1-yl]methyl}piperazin-1-yl)-N-(4-{[(2R)-4-(morpholin-4-yl)-1-(phenylsulfanyl)butan-2-yl]amino}-3-(trifluoromethanesulfonyl)benzene-1-sulfonyl)benzamide), BPTES, DON, compound 968, CB-839, a neutralizing antibody against KGA, or an siRNA, miRNA, or ASO against the GLS1 gene.

11. An in vivo or in vitro senolytic agent selected from the group consisting of a SMOC2 inhibitor, a GUCY1A1 (GUCY1A3) inhibitor, a CXCL12 inhibitor, a CRISPLD2 inhibitor, a GAS1 inhibitor, and a LUM inhibitor.

12. The senolytic agent of claim 11 , administered in combination with other senolytic agents.

13. The senolytic agent of claim 11 , wherein the CXCL12 inhibitor is AMD3100 or a pharmacologically acceptable salt thereof.

14. The senolytic agent according to claim 12, wherein the other senolytic agent is a neutralizing antibody against dasatinib, quercetin, fisetin, ABT-263 (Navitoclax; 4-(4-{[2-(4-Chlorophenyl)-5,5-dimethylcyclohex-1-en-1-yl]methyl}piperazin-1-yl)-N-(4-{[(2R)-4-(morpholin-4-yl)-1-(phenylsulfanyl)butan-2-yl]amino}-3-(trifluoromethanesulfonyl)benzene-1-sulfonyl)benzamide), BPTES, DON, compound 968, CB-839, or KGA, or an siRNA, miRNA, or ASO against the GLS1 gene.

Images