Compounds and methods for reducing prion expression
Oligomeric compounds targeting PRNP RNA and PrP protein expression provide a therapeutic approach to slow neurodegenerative diseases by reducing prion protein aggregates and neuronal loss, addressing the lack of effective treatments.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-11-21
- Publication Date
- 2026-03-04
AI Technical Summary
Current treatments for neurodegenerative diseases such as prion diseases, Creutzfeldt-Jakob disease, and Alzheimer's disease lack effective options to reduce prion RNA and protein expression, leading to progressive neuronal loss and fatal symptoms.
Development of oligomeric compounds, including modified oligonucleotides, that specifically target and reduce PRNP RNA and PrP protein expression, using complementary sequences to hybridize with target nucleic acids and modulate their activity.
The compounds effectively ameliorate symptoms of neurodegenerative diseases by reducing prion protein aggregates and neuronal loss, slowing disease progression and improving patient outcomes.
Smart Images

Figure 2026035668000001 
Figure 2026035668000002 
Figure 2026035668000003
Abstract
Description
[Technical Field]
[0001] Sequence Listing This application has been filed in electronic format along with a Sequence Listing, which is provided as a 587 MB file entitled BIOL0345WO_ST25.txt, created on November 21, 2019. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety.
[0002] Field Compounds, methods, and pharmaceutical compositions are provided for reducing the amount of prion RNA (PRNP RNA) in cells or animals, and in certain cases, reducing the amount of prion protein (PrP protein) in cells or animals. Such compounds, methods, and pharmaceutical compositions are useful for ameliorating at least one symptom or characteristic of a neurodegenerative disease, including spongiform changes in the brain, the development of abnormal protein aggregates, neuronal loss, markers of neuronal loss, rapidly progressive dementia, and death. Such neurodegenerative diseases include prion diseases, Creutzfeldt-Jakob disease (CJD), variant Creutzfeldt-Jakob disease (vCJD), familial Creutzfeldt-Jakob disease (fCJD), Gerstmann-Sträussler-Scheinker syndrome, fatal familial insomnia, kuru, Alzheimer's disease, and Parkinson's disease. [Background technology]
[0003] Prion diseases are a family of rare, progressive neurodegenerative disorders that affect both humans and non-human animals. These diseases involve the loss of normal prion protein (PrP). CPrion-like disorders are caused by the misfolding of the prion protein α-glucan (PNP) and are distinguished by characteristic spongy changes associated with a long latency period and neuronal loss (Senesi, et al., "In vivo prion models and the disconnection between transmissibility and neurotoxicity," Ageing Research Reviews 2017, 36:156-164; Erana, et al., Biochem. And Biophys. Res. Comm., "Prion-like disorders and Transmissible Spongiform Encephalopathies: An "Overview of the mechanistic features that are shared by the various disease-related misfolded proteins,” 2017, 483:1125-1136). Characteristics of prion diseases include, but are not limited to, spongy changes in the brain, development of abnormal protein aggregates, neuronal loss, and markers of neuronal loss. Symptoms of prion diseases include, but are not limited to, rapidly progressive dementia, personality changes, ataxia, hallucinations, myoclonus, chorea, autonomic dysfunction, visual impairment, insomnia, blindness, loss of speech, coma, and death.
[0004] The prion protein exists in several different conformational states: normal cellular form PrP C , and a collection of misfolded conformers (such as the scrapie or pathogenic prion protein "PrP" Sc This can occur in a protease-resistant pathogenic form of scrapie, which is hypothesized to represent the scrapie form of the prion protein, PrP (Sensei, 2017). Sc PRNP is the causative agent of transmissible spongiform encephalopathies. Both protein forms have the same amino acid sequence encoded by PRNP RNA and differ only in the way they fold in three-dimensional space. However, certain mutations in PRNP RNA can cause The protein is pathogenic PrP Sc (Mastrianni, "The genetics of prion diseases", Genetic Med., 2010, 12(4):187-195). Sc forms aggregates and is resistant to proteolysis by proteinase K. Infectious PrP Sc is normal cell PrP C This leads to misfolding of PrP, which is proteinase K-resistant. Sc This allows PrP to be converted to Sc Cellular levels of prion increase, leading to increased protein aggregation and the spread of misfolded forms throughout the central nervous system. Patients rapidly develop the characteristic signs and symptoms of prion disease, which is invariably fatal.
[0005] In addition to prion diseases, PrP C α-synuclein has also been implicated as a molecular target in synucleinopathies, such as Parkinson's disease and dementia with Lewy bodies (Ferreira, et al., "α-synuclein interacts with PrPC to induce cognitive impairment through mGluR5 and NMDAR2B", Nature Neuroscience, 2017, 20:1569-157) and Alzheimer's disease (Purro, et al., "Alzheimer's", Biological Psychiatry, 2018, 83(4):358-368).
[0006] PrP C and PrP Sc Both can be detected in cerebrospinal fluid (CSF). C Infectious PrP can be detected in CSF by standard methods such as Western blot. Sc Orru,et.al.,mBio,“Rapid and As described in “Sensitive RT-QuIC detection of human Creutzfeldt-Jakob disease using cerebrospinal fluid,” 2015, 6(1):e02451-14, prion infection can be detected in the CSF of infected patients via the RT-QuIC test (real-time quaking induced conversion). In this test, the CSF sample is able to induce misfolding of recombinant PrP substrate, resulting in the formation of PrP. Sc and PrP C Distinguish between:
[0007] Currently, there is a lack of acceptable options for treating neurodegenerative diseases, and therefore, it is an object herein to provide compounds, methods, and pharmaceutical compositions for the treatment of such diseases. Summary of the Invention
[0008] Provided herein are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of PRNP RNA, and in certain embodiments, compounds, methods, and pharmaceutical compositions for reducing the amount of PrP protein in a cell or animal. In certain embodiments, the animal has a neurodegenerative disease. In certain embodiments, the neurodegenerative disease is prion disease, Creutzfeldt-Jakob disease (CJD), variant Creutzfeldt-Jakob disease (vCJD), familial Creutzfeldt-Jakob disease (fCJD), Gerstmann-Sträussler-Scheinker syndrome (GSS), fatal familial insomnia (FFI), kuru, Alzheimer's disease, or Parkinson's disease. In certain embodiments, compounds useful for reducing PRNP RNA expression are oligomeric compounds. In certain embodiments, compounds useful for reducing PRNP RNA expression are modified oligonucleotides.
[0009] Also provided are methods useful for ameliorating at least one symptom or characteristic of a neurodegenerative disease. In certain embodiments, the neurodegenerative disease is a prion disease, Creutzfeldt-Jakob disease (CJD), variant Creutzfeldt-Jakob disease (vCJD), familial Creutzfeldt-Jakob disease (FJD), or genotype 1 (GnRH). Creutzfeldt-Jakob disease (fCJD), Gerstmann-Sträussler-Scheinker syndrome, fatal familial insomnia, kuru, Alzheimer's disease, or Parkinson's disease. In certain embodiments, the symptoms or features include spongiform changes in the brain, development of abnormal protein aggregates, neuronal loss, markers of neuronal loss, rapidly progressive dementia, and death. DETAILED DESCRIPTION OF THE INVENTION
[0010] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not limiting. As used herein, the use of the singular includes the plural unless expressly stated otherwise. As used herein, the use of "or" means "and / or" unless expressly stated otherwise. Furthermore, the use of "including" and other forms, such as "includes" and "included," is not limiting. Also, terms such as "element" or "component" include both elements and components that include one unit and elements and components that include two or more subunits, unless expressly stated otherwise.
[0011] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents or portions of documents cited in this application (including, but not limited to, patents, patent applications, articles, books, and papers) are expressly incorporated herein by reference in their entirety, as well as for the portions of the documents discussed herein.
[0012] definition Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal chemistry described herein are those well known and commonly used in the art. Where permitted, all patents, applications, published applications, and other publications and other data referred to throughout this disclosure are incorporated herein by reference in their entirety.
[0013] Unless otherwise indicated, the following terms have the following meanings:
[0014] definition As used herein, "2'-deoxynucleoside" refers to a nucleoside containing a 2'-H(H) deoxyribosyl sugar moiety as found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, 2'-deoxynucleosides may contain modified nucleobases or RNA nucleobases (uracil). Unless otherwise specified, 2'-deoxynucleosides are in the β-D configuration.
[0015] As used herein, "2'-substituted nucleoside" refers to a nucleoside that includes a 2'-substituted sugar moiety. As used herein, "2'-substituted" with respect to the sugar moiety means that the sugar moiety includes at least one 2'-substituent other than H or OH.
[0016] As used herein, "5-methylcytosine" means a cytosine modified with a methyl group attached to position 5. 5-methylcytosine is a modified nucleobase.
[0017] As used herein, "administering" means providing a pharmaceutical agent to an animal.
[0018] As used herein, "animal" means a human or non-human animal.
[0019] As used herein, "antisense activity" refers to any detectable and / or measurable change resulting from hybridization of an antisense compound with its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or a protein encoded by such a target nucleic acid, compared to the target nucleic acid or target protein level in the absence of the antisense compound.
[0020] As used herein, "antisense compound" means an oligomeric compound capable of achieving at least one antisense activity.
[0021] As used herein, "alleviating" in the context of treatment refers to an improvement in at least one symptom compared to the same symptom in the absence of treatment. In certain embodiments, alleviation refers to a reduction in the severity or frequency of a symptom, or a delay in the onset or progression of its severity or frequency. In certain embodiments, the symptom or characteristic is spongiform changes in the brain, the development of abnormal protein aggregates, neuronal loss, markers of neuronal loss, rapidly progressing dementia, and death.
[0022] As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside that includes a bicyclic sugar moiety.
[0023] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" means a modified sugar moiety comprising two rings, where the second ring is formed via a bridge connecting two atoms in the first ring, thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety.
[0024] As used herein, "cleavable moiety" means a bond or group of atoms that is cleaved under physiological conditions, eg, inside a cell, animal, or human.
[0025] As used herein, "complementary" with respect to an oligonucleotide means that at least 70% of the nucleobases, or one or more regions thereof, of the oligonucleotide and at least 70% of the nucleobases, or one or more regions thereof, of another nucleic acid are capable of hydrogen bonding with each other when the nucleobase sequences of the oligonucleotide and the other nucleic acid are aligned in opposite directions. Complementary nucleobases refer to nucleobases that can form hydrogen bonds with each other. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (mC) and guanine (G). Complementary oligonucleotides and / or nucleic acids do not need to have nucleobase complementarity at every nucleoside. Rather, some mismatches are permitted. As used herein, "fully complementary" or "100% complementary" with respect to an oligonucleotide means that the oligonucleotide is complementary to another oligonucleotide or nucleic acid at every nucleoside of the oligonucleotide.
[0026] As used herein, "conjugate group" means a group of atoms directly attached to an oligonucleotide. The conjugate group includes a conjugate moiety and a conjugate linker that connects the conjugate moiety to the oligonucleotide.
[0027] As used herein, "conjugate linker" means a bond or group of atoms that comprises at least one bond that connects a conjugate moiety to an oligonucleotide.
[0028] As used herein, "conjugate moiety" means a group of atoms that is attached to an oligonucleotide via a conjugate linker.
[0029] As used herein, in the context of oligonucleotides, "contiguous" means nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, "contiguous nucleobases" means nucleobases that are immediately adjacent to each other in a sequence.
[0030] As used herein, "constrained ethyl" or "cEt" or "cEt-modified sugar" means a β-D ribosyl bicyclic sugar moiety in which the second ring of the bicyclic sugar is formed via a bridge connecting the 4'-carbon and 2'-carbon of the β-D ribosyl sugar moiety, where the bridge has the formula 4'-CH(CH3)-O-2' and the methyl group of the bridge is in the S configuration.
[0031] As used herein, "cEt nucleoside" means a nucleoside that includes a cEt modified sugar.
[0032] As used herein, a "chirally enriched population" refers to a plurality of molecules having the same molecular formula, wherein the number or percentage of molecules in the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules in the population that would be expected to contain the same particular stereochemical configuration at the same particular chiral center if the particular chiral center were stereorandom. A chirally enriched population of molecules having multiple chiral centers within each molecule can contain one or more stereorandom chiral centers. In certain embodiments, the molecule is a modified oligonucleotide. In certain embodiments, the molecule is a compound comprising a modified oligonucleotide.
[0033] As used herein, "gapmer" refers to a modified oligonucleotide comprising an internal region having multiple nucleosides that support RNase H cleavage, located between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside(s) comprising the external regions. The internal region may be referred to as the "gap," and the external regions may be referred to as the "wings." Unless otherwise indicated, "gapmer" refers to a sugar motif. Unless otherwise indicated, the sugar moieties of the nucleosides in the gapmer gap are unmodified 2'-β-D-deoxyribosyl. Thus, the term "MOE gapmer" refers to a gapmer having a 2'-MOE nucleoside sugar motif and a 2'-deoxynucleoside gap in both wings. Unless otherwise indicated, MOE gapmers may contain one or more modified internucleoside linkages and / or modified nucleobases, although such modifications do not necessarily follow a gapmer pattern of sugar modifications.
[0034] As used herein, a "hotspot region" is a range of nucleobases on a target nucleic acid that is amenable to oligomeric compound-mediated reduction in the amount or activity of the target nucleic acid.
[0035] As used herein, "hybridization" refers to the pairing or annealing of complementary oligonucleotides and / or nucleic acids. While not limited to a particular mechanism, the most common hybridization mechanisms involve hydrogen bonding, which can be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding between complementary nucleobases.
[0036] As used herein, the term "internucleoside linkage" refers to a covalent bond between adjacent nucleosides within an oligonucleotide. As used herein, a "modified internucleoside linkage" refers to any internucleoside linkage other than a phosphodiester internucleoside linkage. A "phosphorothioate internucleoside linkage" is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom.
[0037] As used herein, "linker nucleoside" refers to a nucleoside that directly or indirectly connects an oligonucleotide to a conjugate moiety. The linker nucleoside is within the conjugate linker of an oligomeric compound. The linker nucleoside is not considered part of the oligonucleotide moiety of the oligomeric compound, even if it is contiguous with the oligonucleotide.
[0038] As used herein, "non-bicyclic modified sugar moiety" means a modified sugar moiety that includes a modification (e.g., a substituent) that does not form a bridge between two atoms of the sugar to form a second ring.
[0039] As used herein, "mismatch" or "non-complementary" means a nucleobase of a first oligonucleotide that is not complementary to the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned.
[0040] As used herein, "MOE" means methoxyethyl. "2'-MOE" or "2'-MOE modified sugar" refers to a 2'-OCH2CH2OCH3 group in place of the 2'-OH group of a ribosyl sugar moiety. As used herein, "2'-MOE nucleoside" refers to a nucleoside containing a 2'-MOE modified sugar.
[0041] As used herein, "motif" means a pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages within an oligonucleotide.
[0042] As used herein, unless otherwise specified, "RNA" means RNA transcripts that encode proteins and includes pre-mRNA and mature mRNA.
[0043] As used herein, "neurodegenerative disease" refers to a condition characterized by progressive loss of function or structure, including loss of motor function and death of neurons. In certain embodiments, the neurodegenerative disease is a prion disease. In certain embodiments, the neurodegenerative disease is any of Creutzfeldt-Jakob disease (CJD), variant Creutzfeldt-Jakob disease (vCJD), familial Creutzfeldt-Jakob disease (fCJD), Gerstmann-Sträussler-Scheinker syndrome, fatal familial insomnia, kuru, Alzheimer's disease, or Parkinson's disease.
[0044] As used herein, "nucleobase" refers to an unmodified nucleobase or a modified nucleobase. As used herein, an "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a "modified nucleobase" is an atomic group other than unmodified A, T, C, U, or G that can pair with at least one unmodified nucleobase. "5-methylcytosine" is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. As used herein, a "nucleobase sequence" refers to the order of consecutive nucleobases in a nucleic acid or oligonucleotide that is independent of any sugar or nucleoside linkage modifications.
[0045] As used herein, "nucleoside" refers to a compound comprising a nucleobase and a sugar moiety, each of which may be independently unmodified or modified. As used herein, "modified nucleoside" means a nucleoside comprising a modified nucleobase and / or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nucleobase. "Linked nucleosides" are nucleosides that are joined in a contiguous sequence (i.e., no additional nucleosides are present between the linked nucleosides).
[0046] As used herein, "oligomeric compound" refers to an oligonucleotide and, optionally, one or more additional features (e.g., a conjugate group or a terminal group). An oligomeric compound may or may not be paired with a second oligomeric compound that is complementary to the first oligomeric compound. A "single-stranded oligomeric compound" is an unpaired oligomeric compound. The term "oligomeric duplex" refers to a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound in an oligomeric duplex may be referred to as a "duplexed oligomeric compound."
[0047] As used herein, "oligonucleotide" refers to a single strand of linked nucleosides linked via internucleoside linkages, where each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise specified, an oligonucleotide consists of 8 to 50 linked nucleosides. As used herein, "modified oligonucleotide" refers to an oligonucleotide in which at least one nucleoside or internucleoside linkage is modified. As used herein, "unmodified oligonucleotide" refers to an oligonucleotide that does not contain any nucleoside or internucleoside modifications.
[0048] As used herein, "pharmaceutically acceptable carrier or diluent" means any substance suitable for use in administration to an animal. Certain such carriers allow the pharmaceutical composition to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject. In certain embodiments, the pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution, or sterile artificial cerebrospinal fluid.
[0049] As used herein, "pharmaceutically acceptable salts" means salts that are physiologically and pharmaceutical equivalents of the parent compound and do not impart undesired toxicological effects thereto.
[0050] As used herein, "pharmaceutical composition" refers to a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may include an oligomeric compound and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition exhibits activity in a free uptake assay in certain cell lines.
[0051] As used herein, "PrP C " refers to the normal cellular form of the PrP protein.
[0052] As used herein, "PrP Sc " refers to a protease-resistant pathogenic form of the PrP protein.
[0053] As used herein, "prodrug" refers to an exogenous form of a therapeutic agent that is converted into a different form within an animal or its cells. Typically, the conversion of the prodrug within the animal is facilitated by the action of enzymes (e.g., endogenous or viral enzymes) or chemicals present in the cells or tissues and / or by physiological conditions.
[0054] As used herein, "reducing or inhibiting the amount or activity" refers to a reduction in the amount or activity of an untreated or control It refers to a reduction or blocking of transcriptional expression or activity relative to that of a sample, and does not necessarily indicate a complete abolition of transcriptional expression or activity.
[0055] As used herein, "RNAi compound" refers to an antisense compound that acts, at least in part, through RISC or Ago2 to regulate a target nucleic acid and / or protein encoded by the target nucleic acid. RNAi compounds include, but are not limited to, double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA (including microRNA mimics). In certain embodiments, an RNAi compound regulates the amount, activity, and / or splicing of a target nucleic acid. The term RNAi compound excludes antisense compounds that act through RNase H.
[0056] As used herein, "self-complementary" with respect to an oligonucleotide means an oligonucleotide that at least partially hybridizes to itself.
[0057] As used herein, " siRNA " refers to a ribonucleic acid molecule that has a double-stranded structure and comprises two antiparallel and substantially complementary nucleic acid strands.The two strands that form the double-stranded structure can be different parts of one large RNA molecule, or can be separate RNA molecules.When the two strands are part of one large molecule, and therefore form a double-stranded structure by connecting the consecutive nucleic acid bases between the 3' end of one strand and the 5' end of each other strand, the connecting RNA strands are called "hairpin loops".The RNA strands can have the same or different number of nucleotides.
[0058] As used herein, "standard cell assay" refers to the assay described in Example 1 and reasonable variations thereof.
[0059] As used herein, "stereorandom chiral center" in the context of a population of molecules of the same molecular formula refers to a chiral center having random stereochemical configuration. For example, in a population of molecules containing stereorandom chiral centers, the number of molecules having the (S) configuration of the stereorandom chiral center can be, but is not necessarily, the same as the number of molecules having the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method not designed to control the stereochemical configuration. In certain embodiments, the stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.
[0060] As used herein, "sugar moiety" refers to an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" refers to a 2'-OH(H) ribosyl moiety as found in RNA (an "unmodified RNA sugar moiety") or a 2'-H(H) deoxyribosyl moiety as found in DNA (an "unmodified DNA sugar moiety"). An unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, one oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, "modified sugar moiety" or "modified sugar" refers to a modified furanosyl sugar moiety or a modified sugar surrogate.
[0061] As used herein, "sugar surrogate" means a modified sugar moiety, other than a furanosyl moiety, that is capable of attaching a nucleobase to another group (e.g., an internucleoside linkage, a conjugate group, or a terminal group within an oligonucleotide). Modified nucleosides containing sugar surrogates can be incorporated at one or more positions within an oligonucleotide, and such oligonucleotides are capable of hybridizing to a complementary oligomeric compound or target nucleic acid.
[0062] As used herein, a "symptom or characteristic" refers to the presence or extent of a disease or disorder. "Symptom" refers to any physical characteristic or test result that indicates a symptom. In certain embodiments, the symptom is apparent to the subject or to a medical professional examining or testing the subject. In certain embodiments, the characteristic is apparent upon invasive diagnostic testing (including, but not limited to, post-mortem examination).
[0063] As used herein, "target nucleic acid" and "target RNA" refer to a nucleic acid against which an antisense compound is designed to act.
[0064] As used herein, "target region" means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.
[0065] As used herein, "terminal group" means a chemical group or group of atoms that is covalently attached to the end of an oligonucleotide.
[0066] As used herein, "therapeutically effective amount" means an amount of a pharmaceutical agent that provides a therapeutic benefit to an animal, e.g., an amount that ameliorates a symptom of a disease.
[0067] Certain embodiments The present disclosure provides the following non-limiting numbered embodiments:
[0068] Embodiment 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to an equal length portion of a PRNP nucleic acid, and the modified oligonucleotide comprises at least one modification selected from a modified sugar, a sugar surrogate, and a modified internucleoside linkage.
[0069] Embodiment 2. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases of any of SEQ ID NOs: 27-2744.
[0070] Embodiment 3. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, 16, 17, 18, or 19 nucleobases of any of SEQ ID NOs: 2745-2766.
[0071] Embodiment 4. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, 16, 17, or 18 nucleobases of any of SEQ ID NOs: 2767-2780.
[0072] Embodiment 5. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, 16, or 17 nucleobases of any of SEQ ID NOs: 2781-2802.
[0073] Embodiment 6. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, or 16 nucleobases of any of SEQ ID NOs: 2803-2806.
[0074] Embodiment 7. The nucleotide sequence comprises 12 to 30 linked nucleosides, and includes at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 1. An oligomeric compound comprising a modified oligonucleotide having a nucleobase sequence comprising a portion of at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases, said portion being one of the following: an isometric portion of nucleobases 5635 to 5677 of SEQ ID NO: 2; an isometric portion of nucleobases 5791 to 5826 of SEQ ID NO: 2; or An isometric portion of nucleic acid bases 14366 to 14410 of SEQ ID NO: 2 The oligomeric compound is complementary to
[0075] Embodiment 8. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 consecutive nucleobases, wherein the nucleobase sequence is one of the following: Sequence numbers 530, 607, 684, 761, 838, 915, 1914, 1992, 2069, 2146, 2237, 2301, 2302, 2536, 2640, 2750, 2759, 2760, 2764, 2788-2793, 2803-2806; SEQ ID NOs: 1225, 1302, 1379, 1456, 2240, 2307, 2308, 2383, 2471, 2537, 2568, 2647, 2736-2739, 2798-2801; or Sequence numbers 555, 632, 709, 786, 863, 940, 1017, 1862, 1939, 2017, 2094, 2171, 2257, 2334, 2407, 2408, 2488, 2508, 2543, 2612, 2659, 2677, 2757, 2766, 2794 to 2797 The oligomeric compound is selected from:
[0076] Embodiment 9. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising a portion of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases, wherein said portion is one of the following: an isometric portion of nucleobases 4902 to 4929 of SEQ ID NO: 2; an isometric portion of nucleobases 5000 to 5026 of SEQ ID NO: 2; an isometric portion of nucleobases 5073 to 5100 of SEQ ID NO: 2; an isometric portion of nucleobases 5515 to 5559 of SEQ ID NO: 2; an isometric portion of nucleobases 5595 to 5632 of SEQ ID NO: 2; an isometric portion of nucleobases 5666 to 5690 of SEQ ID NO: 2; an isometric portion of nucleobases 5857 to 5881 of SEQ ID NO: 2; an isometric portion of nucleobases 9352 to 9377 of SEQ ID NO: 2; an isometric portion of nucleobases 11331 to 11358 of SEQ ID NO: 2; an isometric portion of nucleobases 16292 to 16328 of SEQ ID NO: 2; an isometric portion of nucleobases 17120 to 17151 of SEQ ID NO: 2; an isometric portion of nucleobases 17211 to 17241 of SEQ ID NO: 2; an isometric portion of nucleobases 17281 to 17331 of SEQ ID NO: 2; an isometric portion of nucleobases 17410 to 17445 of SEQ ID NO: 2; an isometric portion of nucleobases 17601 to 17641 of SEQ ID NO: 2; an isometric portion of nucleobases 17635 to 17670 of SEQ ID NO: 2; an isometric portion of nucleobases 17663 to 17712 of SEQ ID NO: 2; an isometric portion of nucleobases 17753 to 17781 of SEQ ID NO: 2; or Isometric portion of nucleic acid bases 17985 to 18016 of SEQ ID NO: 2 The oligomeric compound is complementary to
[0077] Embodiment 10. The oligomeric compound of any of embodiments 1-9, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, 85%, 90%, 95%, or 100% complementary to the nucleobase sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4, when measured across the entire nucleobase sequence of the modified oligonucleotide.
[0078] Embodiment 11. The oligomeric compound of any one of embodiments 1 to 10, wherein the modified oligonucleotide comprises at least one modified nucleoside.
[0079] Embodiment 12. The oligomeric compound of embodiment 11, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety.
[0080] Embodiment 13 The oligomeric compound of embodiment 12, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety.
[0081] Embodiment 14. The oligomeric compound of embodiment 13, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety having a 2'-4' bridge, wherein the 2'-4' bridge is selected from -O-CH2- and -O-CH(CH3)-.
[0082] Embodiment 15. The oligomeric compound of any one of Embodiments 11-14, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety.
[0083] Embodiment 16. The oligomeric compound of embodiment 17, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety, including a 2'-MOE or a 2'-OMe modified sugar.
[0084] Embodiment 17. The oligomeric compound of any of embodiments 11 to 16, wherein the modified oligonucleotide comprises at least one modified nucleoside that comprises a sugar surrogate.
[0085] Embodiment 18. The oligomeric compound of embodiment 15, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate selected from morpholino and PNA.
[0086] Embodiment 19. The oligomeric compound of any of embodiments 1-12 or 15-18, wherein the modified oligonucleotide does not contain a bicyclic sugar moiety.
[0087] Embodiment 20. The modified oligonucleotide comprises: a 5' region consisting of 1 to 7 linked 5' region nucleosides; a central region consisting of 6 to 10 linked central region nucleosides; and 3' region consisting of 1 to 7 linked 3' region nucleosides and having a glycomotif comprising each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar; 20. The oligomeric compound according to any one of embodiments 1 to 19.
[0088] Embodiment 21. The modified oligonucleotide comprises: a 5' region consisting of four linked 5' region nucleosides; a central region consisting of eight linked central region nucleosides; and A 3' region consisting of four linked 3' region nucleosides and each of the 5' region nucleosides comprises a 2'-MOE modified sugar, each of the 3' region nucleosides comprises either a 2'-MOE modified sugar or a cEt modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar; 21. The oligomeric compound according to embodiment 20.
[0089] Embodiment 22. The modified oligonucleotide comprises: a 5' region consisting of four linked 5' region nucleosides; a central region consisting of eight linked central region nucleosides; and A 3' region consisting of five linked 3' region nucleosides and each of the 5' region nucleosides comprises a 2'-MOE modified sugar, each of the 3' region nucleosides comprises either a 2'-MOE modified sugar or a cEt modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar; 21. The oligomeric compound according to embodiment 20.
[0090] Embodiment 23. The modified oligonucleotide comprises: a 5' region consisting of five linked 5' region nucleosides; a central region consisting of eight linked central region nucleosides; and A 3' region consisting of five linked 3' region nucleosides and each of the 5' region and each of the 3' region nucleosides comprises a 2'-MOE modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar; 21. The oligomeric compound according to embodiment 20.
[0091] Embodiment 24. The modified oligonucleotide comprises: a 5' region consisting of five linked 5' region nucleosides; a central region consisting of nine linked central region nucleosides; and A 3' region consisting of five linked 3' region nucleosides and each of the 3' region nucleosides comprises either a 2'-MOE modified sugar or a cEt modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar; 21. The oligomeric compound according to embodiment 20.
[0092] Embodiment 25. The modified oligonucleotide comprises: a 5' region consisting of five linked 5' region nucleosides; a central region consisting of nine linked central region nucleosides; and A 3' region consisting of five linked 3' region nucleosides and each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar; 21. The oligomeric compound according to embodiment 20.
[0093] Embodiment 26. The modified oligonucleotide comprises: a 5' region consisting of six linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; and A 3' region consisting of four linked 3' region nucleosides and having a glycomotif comprising each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar; 21. The oligomeric compound according to embodiment 20.
[0094] Embodiment 27. The modified oligonucleotide comprises: a 5' region consisting of six linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; and A 3' region consisting of four linked 3' region nucleosides and having a glycomotif comprising each of the 3' region nucleosides comprises either a 2'-MOE modified sugar or a cEt modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar; 21. The oligomeric compound according to embodiment 20.
[0095] Embodiment 28. The modified oligonucleotide comprises: a 5' region consisting of five linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; and A 3' region consisting of five linked 3' region nucleosides and having a glycomotif comprising each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar; 21. The oligomeric compound according to embodiment 20.
[0096] Embodiment 29. The modified oligonucleotide comprises: a 5' region consisting of five linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; and A 3' region consisting of five linked 3' region nucleosides and having a glycomotif comprising each of the 3' region nucleosides comprises either a 2'-MOE modified sugar or a cEt modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar; 21. The oligomeric compound according to embodiment 20.
[0097] Embodiment 30. The modified oligonucleotide comprises: a 5' region consisting of four linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; and 3' region consisting of six linked 3' region nucleosides and having a glycomotif comprising each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar; 21. The oligomeric compound according to embodiment 20.
[0098] Embodiment 31. The modified oligonucleotide comprises: a 5' region consisting of three linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; and 3' region consisting of seven linked 3' region nucleosides and each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar; 21. The oligomeric compound according to embodiment 20.
[0099] Embodiment 32. The modified oligonucleotide comprises: a 5' region consisting of seven linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; and 3' region consisting of three linked 3' region nucleosides and 21. The oligomeric compound of embodiment 20, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar.
[0100] Embodiment 33. The oligomeric compound of any one of Embodiments 20-32, wherein the 2'-deoxyribosyl sugar is a 2'-β-D-deoxyribosyl sugar.
[0101] Embodiment 34. The modified oligonucleotide comprises: a 5' region consisting of 1 to 6 linked 5' region nucleosides; a central region consisting of 6 to 10 linked central region nucleosides; and 3' region consisting of 1 to 6 linked 3' region nucleosides and having a glycomotif comprising each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar; The central region has the following formula: (Nd)(Nx)(Nd)n wherein Nx is a 2'-OMe nucleoside and each Nd is a 2'-β-D-deoxynucleoside; n is 6 to 8; 20. The oligomeric compound according to any one of embodiments 1 to 19.
[0102] Embodiment 35. The modified oligonucleotide comprises: a 5' region consisting of five linked 5' region nucleosides; a central region consisting of eight linked central region nucleosides; and A 3' region consisting of five linked 3' region nucleosides and having a glycomotif comprising each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE modified sugar; The central region has the following formula: (Nd)(Nx)(Nd)n wherein Nx is a nucleoside that includes a 2'-OMe sugar and each Nd is a nucleoside that includes a 2'-deoxyribosyl sugar; n is 6, 35. The oligomeric compound according to embodiment 34.
[0103] Embodiment 36. The modified oligonucleotide comprises: a 5' region consisting of five linked 5' region nucleosides; a central region consisting of eight linked central region nucleosides; and A 3' region consisting of five linked 3' region nucleosides having a glycomotif comprising each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE modified sugar; The central region has the following formula: (Nd)(Nx)(Nd)n wherein Nx is a nucleoside that includes a 2'-OMe sugar and each Nd is a nucleoside that includes a 2'-deoxyribosyl sugar; n is 6, 35. The oligomeric compound according to embodiment 34.
[0104] Embodiment 37. The modified oligonucleotide comprises: a 5' region consisting of five linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; and A 3' region consisting of five linked 3' region nucleosides and having a glycomotif comprising each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE modified sugar; The central region has the following formula: (Nd)(Nx)(Nd)n wherein Nx is a nucleoside that includes a 2'-OMe sugar and each Nd is a nucleoside that includes a 2'-deoxyribosyl sugar; n is 8, 35. The oligomeric compound according to embodiment 34.
[0105] Embodiment 38. The oligomeric compound of any one of Embodiments 34-37, wherein the 2'-deoxyribosyl sugar is a 2'-β-D-deoxyribosyl sugar.
[0106] Embodiment 39. The oligomeric compound of any one of embodiments 1 to 38, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.
[0107] Embodiment 40 The oligomeric compound of embodiment 39, wherein each internucleoside linkage of said modified oligonucleotide is a modified internucleoside linkage.
[0108] Embodiment 41. The oligomeric compound of embodiment 39 or 40, wherein at least one internucleoside linkage is a phosphorothioate internucleoside linkage.
[0109] Embodiment 42 The oligomeric compound of embodiment 39 or 41, wherein said modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.
[0110] Embodiment 43 The oligomeric compound of any of embodiments 39, 41, or 42, wherein each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.
[0111] Embodiment 44. The oligomeric compound of any one of embodiments 1 to 43, wherein the modified oligonucleotide comprises at least one modified nucleobase.
[0112] Embodiment 45. The oligomeric compound of embodiment 44, wherein the modified nucleobase is 5-methylcytosine.
[0113] Embodiment 46. The oligomeric compound of any one of embodiments 1 to 45, wherein the modified oligonucleotide consists of 12 to 30, 12 to 22, 12 to 20, 14 to 20, 15 to 25, 16 to 20, 18 to 22, or 18 to 20 linked nucleosides.
[0114] Embodiment 47. The modified oligonucleotide is a compound of the present invention, wherein the modified oligonucleotide consists of 16 linked nucleosides. The oligomeric compound of any one of embodiments 1 to 21, 33, 34, or 38 to 46.
[0115] Embodiment 48. The oligomeric compound of any one of embodiments 1-20, 22, 33, 34, or 38-46, wherein the modified oligonucleotide consists of 17 linked nucleosides.
[0116] Embodiment 49. The oligomeric compound of any one of embodiments 1-20, 23, 33, 34-36, or 38-46, wherein the modified oligonucleotide consists of 18 linked nucleosides.
[0117] Embodiment 50. The oligomeric compound of any one of embodiments 1-20, 24, 25, 33, 34, or 38-46, wherein the modified oligonucleotide consists of 19 linked nucleosides.
[0118] Embodiment 51. The oligomeric compound of any one of embodiments 1-20, 26-34, or 37-46, wherein the modified oligonucleotide consists of 20 linked nucleosides.
[0119] Embodiment 52. The oligomeric compound of embodiment 39, wherein said modified oligonucleotide has the internucleoside linkage motif soossssssssssooooss, soooossssssssssoooss, soooosssssssssssss, soooooosssssssssss, ssooooosssssssssss, sooooossssssssss, sooooosssssssss, sooooosssssssss, soooosssssssss, soooosssssssss, soooosssssssss, or sooossssssssssoos, where "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage.
[0120] Embodiment 53. The oligomeric compound of any one of embodiments 1 to 52, consisting of the modified oligonucleotide.
[0121] Embodiment 54. The oligomeric compound of any of embodiments 1 to 52, comprising a conjugate group comprising a conjugate moiety and a conjugate linker.
[0122] Embodiment 55. The oligomeric compound of embodiment 54, wherein the conjugate group comprises a GalNAc cluster comprising 1 to 3 GalNAc ligands.
[0123] Embodiment 56 The oligomeric compound of embodiment 54 or 55, wherein the conjugate linker consists of a single bond.
[0124] Embodiment 57 The oligomeric compound of embodiment 54, wherein the conjugate linker is cleavable.
[0125] Embodiment 58. The oligomeric compound of embodiment 54, wherein the conjugate linker comprises 1 to 3 linker nucleosides.
[0126] Embodiment 59. The oligomeric compound of any of Embodiments 54-58, wherein the conjugate group is attached to the modified oligonucleotide at the 5' end of the modified oligonucleotide.
[0127] Embodiment 60. The oligonucleotide of any one of Embodiments 54 to 58, wherein the conjugate group is attached to the modified oligonucleotide at the 3' end of the modified oligonucleotide. sesame compound.
[0128] Embodiment 61. The oligomeric compound of any one of embodiments 1 to 60, comprising a terminal group.
[0129] Embodiment 62. The oligomeric compound of any one of embodiments 1 to 61, wherein the oligomeric compound is a single-stranded oligomeric compound.
[0130] Embodiment 63. The oligomeric compound of any one of embodiments 1-57 or 59-62, wherein the oligomeric compound does not comprise a linker nucleoside.
[0131] Embodiment 64. An oligomeric duplex comprising an oligomeric compound according to any one of embodiments 1 to 61 or 63.
[0132] Embodiment 65. An antisense compound comprising or consisting of an oligomeric compound according to any one of embodiments 1 to 63 or an oligomeric duplex according to embodiment 64.
[0133] Embodiment 66. A pharmaceutical composition comprising an oligomeric compound according to any one of embodiments 1 to 63 or an oligomeric duplex according to embodiment 64, and a pharmaceutically acceptable carrier or diluent.
[0134] Embodiment 67. The pharmaceutical composition of embodiment 66, comprising a pharmaceutically acceptable diluent, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.
[0135] Embodiment 68. The pharmaceutical composition of embodiment 67, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and phosphate-buffered saline or artificial cerebrospinal fluid.
[0136] Embodiment 69. A method comprising administering to an animal a pharmaceutical composition according to any one of embodiments 66 to 68.
[0137] Embodiment 70. A method for treating a disease associated with PRNP, comprising administering to an individual having or at risk of developing a disease associated with PRNP a therapeutically effective amount of a pharmaceutical composition described in any one of embodiments 66 to 68, thereby treating the disease associated with PRNP.
[0138] Embodiment 71. A method for reducing PrP protein in the CSF of an individual having or at risk of developing a disease associated with PRNP, wherein the PrP protein in the CSF is reduced by a therapeutically effective amount of the pharmaceutical composition described in any one of embodiments 66 to 68.
[0139] Embodiment 72. The PrP protein is PrP C 72. The method of embodiment 71, wherein
[0140] Embodiment 73. The PrP protein is PrP Sc 72. The method of embodiment 71, wherein
[0141] Embodiment 74. The PrP protein is PrP C and PrP Sc 72. The method of embodiment 71, wherein both
[0142] Embodiment 75. The method of embodiment 70, wherein the administering is by intrathecal administration. 71. The method described in claim 71.
[0143] Embodiment 76 The method of embodiment 70 or embodiment 71, wherein the PRNP-associated disease is a neurodegenerative disease.
[0144] Embodiment 77. The method of embodiment 76, wherein the neurodegenerative disease is selected from among prion diseases, Creutzfeldt-Jakob disease (CJD), variant Creutzfeldt-Jakob disease (vCJD), familial Creutzfeldt-Jakob disease (fCJD), Gerstmann-Sträussler-Scheinker syndrome, fatal familial insomnia, kuru, Alzheimer's disease, or Parkinson's disease.
[0145] Embodiment 78. The method of any one of embodiments 70-77, wherein at least one symptom or feature of the neurodegenerative disease is ameliorated.
[0146] Embodiment 79. The method of embodiment 78, wherein the symptom or characteristic is any of spongiform changes in the brain, development of abnormal protein aggregates, neuronal loss, markers of neuronal loss, rapidly progressive dementia, or death.
[0147] Embodiment 80. A method for reducing PRNP RNA in a cell, comprising contacting the cell with an oligomeric compound described in any of Embodiments 1-63, an oligomeric duplex described in Embodiment 64, or an antisense compound described in Embodiment 65, thereby reducing PRNP RNA in the cell.
[0148] Embodiment 81. A method for reducing PrP protein in a cell, comprising contacting the cell with an oligomeric compound of any of embodiments 1-63, an oligomeric duplex of embodiment 64, or an antisense compound of embodiment 65, thereby reducing PrP in the cell.
[0149] Embodiment 82. The PrP protein is PrP C 82. The method of embodiment 81, wherein
[0150] Embodiment 83. The PrP protein is PrP Sc 82. The method of embodiment 81, wherein
[0151] Embodiment 84. The PrP protein is PrP C and PrP Sc 82. The method of embodiment 81, wherein both
[0152] Embodiment 85. The method of any one of embodiments 80 to 84, wherein the cell is in an animal.
[0153] Embodiment 86. A modified oligonucleotide according to the following chemical structure: [ka] (SEQ ID NO: 1914), or a salt thereof.
[0154] Embodiment 87. A modified oligonucleotide according to the following chemical structure: [ka] (SEQ ID NO: 1914).
[0155] Embodiment 88. A modified oligonucleotide according to the following chemical structure: [ka] (SEQ ID NO: 1914), or a salt thereof.
[0156] Embodiment 89. A modified oligonucleotide according to the following chemical structure: [ka] (SEQ ID NO: 1914).
[0157] Embodiment 90. A modified oligonucleotide according to the following chemical structure: [ka] (SEQ ID NO: 1939), or a salt thereof.
[0158] Embodiment 91. A modified oligonucleotide according to the following chemical structure: [ka] (SEQ ID NO: 1939).
[0159] Embodiment 92. A modified oligonucleotide according to the following chemical structure: [ka] (SEQ ID NO: 2302), or a salt thereof.
[0160] Embodiment 93. A modified oligonucleotide according to the following chemical structure: [ka] (SEQ ID NO: 2302).
[0161] Embodiment 94. A modified oligonucleotide according to the following chemical structure: [ka] (SEQ ID NO: 2750), or a salt thereof.
[0162] Embodiment 95. A modified oligonucleotide according to the following chemical structure: [ka] (SEQ ID NO: 2750).
[0163] Embodiment 96. A modified oligonucleotide according to the following chemical structure: [ka] (SEQ ID NO: 2739), or a salt thereof.
[0164] Embodiment 97. A modified oligonucleotide according to the following chemical structure: [ka] (SEQ ID NO: 2739).
[0165] Embodiment 98. The modified oligonucleotide of embodiment 86, 88, 90, 92, 94, or 96, which is a sodium salt of the chemical structure.
[0166] Embodiment 99. The following chemical notation: Ges Teo m Ceo Aeo Tes Ads Ads Tds Tds Tds Tds m Cds Tds Tds Ads Geo m Ceo Tes Aes m A compound comprising a modified oligonucleotide according to Ce (SEQ ID NO: 1914), wherein A = adenine nucleobase m C=5-methylcytosine nucleobase G = guanine nucleobase T=thymine nucleobase e=2'-MOE modified sugar d = 2'-β-D deoxyribosyl sugar s = phosphorothioate internucleoside linkage o = phosphodiester internucleoside linkage) Embodiment 100. The following chemical notation: Ges Teo m Ceo Aeo Teo Aeo Ads Tds Tds Tds Tds m Cds Tds Tds Ads Gds m Ceo Tes Aes m A compound comprising a modified oligonucleotide according to Ce (SEQ ID NO: 1914), wherein A = adenine nucleobase m C=5-methylcytosine nucleobase G = guanine nucleobase T=thymine nucleobase e=2'-MOE modified sugar d = 2'-β-D deoxyribosyl sugar s = phosphorothioate internucleoside linkage o = phosphodiester internucleoside linkage)
[0167] Embodiment 101. The following chemical notation: Ges m Ceo Teo Teo Aeo Teo Tds Ads Tds Tds m Cds Ads Tds Gds Tds Tds m CEO Tes m Ces m A compound comprising a modified oligonucleotide according to Ce (SEQ ID NO: 1939), wherein A = adenine nucleobase m C=5-methylcytosine nucleobase G = guanine nucleobase T=thymine nucleobase e=2'-MOE modified sugar d = 2'-β-D deoxyribosyl sugar s = phosphorothioate internucleoside linkage o = phosphodiester internucleoside linkage)
[0168] Embodiment 102. The following chemical notations: Ges Teo Geo Teo m CEO Aeo Tds Ads Ads Tds Tds Tds Tds m Cds Tds Tds Aeo Ges m A compound comprising a modified oligonucleotide according to Ces Te (SEQ ID NO: 2302), wherein: A = adenine nucleobase mC = 5-methylcytosine nucleobase G = guanine nucleobase T=thymine nucleobase e=2'-MOE modified sugar d = 2'-β-D deoxyribosyl sugar s = phosphorothioate internucleoside linkage o = phosphodiester internucleoside linkage)
[0169] Embodiment 103. The following chemical notations: Ges Teo mCeo Aeo Teo Ads A compound comprising a modified oligonucleotide according to Ads Tds Tds Tds mCds Tds Tds Aes Geo mCeo Tes Ae (SEQ ID NO: 2750), wherein A = adenine nucleobase mC = 5-methylcytosine nucleobase G = guanine nucleobase T=thymine nucleobase e=2'-MOE modified sugar d = 2'-β-D deoxyribosyl sugar s = phosphorothioate internucleoside linkage o = phosphodiester internucleoside linkage)
[0170] Embodiment 104. A compound comprising a modified oligonucleotide according to the following chemical designation: Aes mCeo Geo Teo mCes mCds Ads Tds Tds Tds mCds Tds Gds Tds Geo mCeo Tes Tes Te (SEQ ID NO: 2739), wherein A = adenine nucleobase mC = 5-methylcytosine nucleobase G = guanine nucleobase T=thymine nucleobase e=2'-MOE modified sugar d = 2'-β-D deoxyribosyl sugar s = phosphorothioate internucleoside linkage o = phosphodiester internucleoside linkage)
[0171] Embodiment 105. The compound of any of embodiments 99-104, comprising the modified oligonucleotide covalently attached to a conjugate group.
[0172] Embodiment 106. A chirally enriched population of modified oligonucleotides according to any one of embodiments 86 to 105, wherein the chirally enriched population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.
[0173] Embodiment 107. The chirally enriched population of embodiment 106, wherein the population is enriched for modified oligonucleotides comprising at least one specific phosphorothioate internucleoside linkage having an (Sp) or (Rp) configuration.
[0174] Embodiment 108. The chirally enriched population of embodiment 106, wherein the population is enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.
[0175] Embodiment 109. The chirally enriched population of embodiment 106, wherein the population is enriched for modified oligonucleotides having an (Sp) or (Rp) configuration at each phosphorothioate internucleoside linkage.
[0176] Embodiment 110. The chirally enriched population of embodiment 106, wherein the population is enriched for modified oligonucleotides having an (Rp) configuration at one particular phosphorothioate internucleoside linkage and an (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.
[0177] Embodiment 111. The chiral enriched population of embodiment 106 or 108, wherein the population is enriched for modified oligonucleotides having at least three consecutive phosphorothioate internucleoside linkages in the 5' to 3' direction in the Sp, Sp, and Rp configurations.
[0178] Embodiment 112. The population of modified oligonucleotides of any of embodiments 86 to 105, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are stereorandom.
[0179] Embodiment 113. A pharmaceutical composition comprising a population of modified oligonucleotides according to any one of embodiments 106 to 112 and a pharmaceutically acceptable carrier or diluent.
[0180] Embodiment 114. A pharmaceutical composition according to any one of embodiments 86 to 105, and a pharmaceutically acceptable diluent or carrier.
[0181] Embodiment 115. The pharmaceutical composition of embodiment 114, comprising a pharmaceutically acceptable diluent, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.
[0182] Embodiment 116. The pharmaceutical composition of embodiment 115, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and phosphate-buffered saline or artificial cerebrospinal fluid.
[0183] I. Certain Oligonucleotides In certain embodiments, provided herein are oligomeric compounds comprising oligonucleotides composed of linked nucleosides. The oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or modified oligonucleotides. The modified oligonucleotides contain at least one modification compared to unmodified RNA or DNA. That is, the modified oligonucleotides contain at least one modified nucleoside (containing a modified sugar moiety and / or a modified nucleobase) and / or at least one modified internucleoside linkage.
[0184] A. Certain modified nucleosides A modified nucleoside comprises a modified sugar moiety or a modified nucleobase, or both a modified sugar moiety and a modified nucleobase.
[0185] 1. Certain sugar moieties In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar surrogate. Such sugar surrogates may contain one or more substitutions that correspond to the substitutions in other types of modified sugar moieties.
[0186] In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety comprising a furanosyl ring bearing one or more substituents, none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non-bridging substituents may be located at any position on the furanosyl, including, but not limited to, substituents at the 2', 4', and / or 5' positions. In certain embodiments, one or more of the non-bridging substituents of the non-bicyclic modified sugar moiety is branched. Examples of suitable 2' substituents for non-bicyclic modified sugar moieties include, but are not limited to, 2'-F, 2'-OCH3 ("OMe" or "O-methyl"), and 2'-O(CH2)2OCH3 ("MOE"). In certain embodiments, the 2' substituent is halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-C1-C 10 Alkoxy, O-C1-C 10 Substituted alkoxy, O-C-C 10 Alkyl, O-C1-C 10 Substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ), or OCH2C(=O)-N(R m )(R n )(wherein, R m and R n each independently represents H, an amino protecting group, or a substituted or unsubstituted C-C 10alkyl), and Cook et al., US 6,531,584, Cook et al., US 5,859,221, and Co The 2' substituents are selected from those described in Manoharan et al., US 6,005,087. These 2' substituents in certain embodiments may be further substituted with one or more substituents independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro(NO), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. Examples of suitable 4' substituents for non-bicyclic modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and the substituents described in Manoharan et al., WO 2015 / 106128. Examples of suitable 5' substituents for non-bicyclic modified sugar moieties include, but are not limited to, 5'-methyl (R or S), 5'-vinyl, and 5'-methoxy. In certain embodiments, the non-bicyclic modified sugar moiety comprises two or more non-bridging sugar substituents, such as 2'-F-5'-methyl sugar moieties, and modified sugar moieties and modified nucleosides described in Migawa et al., WO2008 / 101157 and Rajeev et al., US2013 / 0203836.
[0187] In certain embodiments, the 2'-substituted non-bicyclic modified nucleosides are selected from the group consisting of: F, NH, N, OCF, OCH, O(CH)NH, CHCH=CH, OCHCH=CH, OCHCHOCH, O(CH)SCH, O(CH)ON(R m )(R n ), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamides (OCH2C(=O)-N(R m )(R n ))(In the formula, each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C-C 10 The sugar moiety includes a non-bridging 2' substituent selected from the group consisting of alkyl, aryl, aryl, aryl ...
[0188] In certain embodiments, the 2'-substituted nucleoside non-bicyclic modified nucleoside comprises a sugar moiety that includes a non-bridging 2'-substituent selected from F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 ("NMA").
[0189] In certain embodiments, a 2'-substituted non-bicyclic modified nucleoside comprises a sugar moiety that includes a non-bridging 2'-substituent selected from F, OCH3, and OCH2CH2OCH3.
[0190] Certain modified sugar moieties include a substituent bridging two atoms of the furanosyl ring, thereby forming a second ring, resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety includes a bridge between the 4' and 2' furanose ring atoms. Examples of such 4' to 2' bridging sugar substituents include, but are not limited to, 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (referred to as "constrained ethyl" or "cEt"), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CHOCH3)-O-2' ("constrained MOE" or "cMOE") and analogs thereof (e.g., Seth et al., US 7,399,845; Bhat et al., US 7,569,686; Swayze et al., US 7,569,686). al., US 7,741,457, and Swayze et al., US 8,022,193), 4'-C(CH3)(CH3)-O-2' and analogs thereof (see, e.g., Seth et al., US 8,278,283), 4'-CH2-N(OCH3)-2' and analogs thereof (see, e.g., Prakash et al., US 8,278,425), 4'-CH2-ON(CH3)-2' (see, e.g., Allerson et al., US 7,696,345, and Allerson et al., US 8,124,745), 4'-CH2-C(H)(CH3)-2' (see, e.g., See, for example, Zhou, et al., J. Org. Chem., 2009, 74, 118-134), 4'-CH2-C(=CH2)-2' and its analogs (see, for example, Seth et al., US Pat. No. 8,278,426), 4'-C(R a R b )-N(R)-O-2',4'-C(R a R b )-ON(R)-2', 4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2' (wherein R, R a , and R beach independently represents H, a protecting group, or C-C 12 alkyl) (see, for example, Imanishi et al., US Pat. No. 7,427,672).
[0191] In certain embodiments, such 4' to 2' bridges are independently -[C(R a )(R b )] n -, -[C(R a )(R b )] n -O-, -C(R a )=C(R b )-, -C(R a )=N-, -C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-, -S(=O) x - and -N(R a )-, and During the ceremony, x is 0, 1, or 2; n is 1, 2, 3, or 4; R a and R b each independently represents H, a protecting group, hydroxyl, C-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 cycloaliphatic radical, substituted C5-C7 cycloaliphatic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfonyl (S(=O)-J1); Each of J1 and J2 is independently H, C1-C 12 Alkyl, substituted C1-C12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 Aminoalkyl, substituted C1-C 12 aminoalkyl, or a protecting group.
[0192] A 2-layered polysaccharide can be used as a nucleic acid.Freier et al.,Nucleic Acids Research,1997,25(22),4429-4443,Albaek et al.,J.Org.Chem.,2006,71,7731-7740,Singh et al.,Chem.Commun.,1998,4,455-456;Koshkin et al al.,Tetrahedron,1998,54,3607-3630;Kumar et al.,Bioorg.Med.Chem.Lett.,1998,8,2219-2222;Singh et al.,J.Org.Chem.,1998,63,10035-10039;Srivastava et al J.Am.Chem.Soc.,20017,129,8362-8379;Wengel et al.,US7,053,207;Imanishi et al.,US6,268,490;Imanishi et al.US6,770,748; al.,US6,794,499;Wengel et al.,US6,670,461;Wengel et al.,US7,034,133;Wengel et al.,US8,080,644; Ramasamy et al., US6,525,191;Torsten et al.,WO2004 / 106356;Wengel et al.,WO1999 / 014226;Seth et al.,WO2007 / 13418 1; Seth et al., US7,547,684; Seth et al., US7,666,854; Seth et al., US8,088,746; Seth et al., US7,750,131; Seth et al., US8,030,467; Seth et al., US8,268,980; Seth et al., US8,546,556; Seth et al., US8,530,640; Migawa et al., US9,012,421; Seth et al., US8,501,805; and Allerson et al., US Patent Publication No. US2008 / 0039618, and Migawa et al., US2015 / 0191727.
[0193] In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by their isomeric configuration. For example, LNA nucleosides (described herein) can be in the α-L or β-D configuration. [ka] α-L-methyleneoxy (4'-CH2-O-2') or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that have shown antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).In this specification, the general description of bicyclic nucleosides includes both isomeric configurations.When the position of a specific bicyclic nucleoside (e.g., LNA or cEt) is identified in the exemplary embodiments herein, these are in β-D configuration unless otherwise specified.
[0194] In certain embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (eg, 5'-substituted and 4'-2'-bridging sugars).
[0195] In certain embodiments, the modified sugar moiety is a sugar surrogate. In certain such embodiments, the oxygen atom of the sugar moiety is replaced with, for example, a sulfur, carbon, or nitrogen atom. In certain such embodiments, such modified sugar moieties also include bridging and / or non-bridging substituents as described herein. For example, certain sugar surrogates include a 4' sulfur atom as well as substitutions at the 2' position (see, e.g., Bhat et al., US 7,875,733 and Bhat et al., US 7,939,677) and / or 5' position.
[0196] In certain embodiments, the sugar surrogate comprises a ring with more than five atoms. For example, in certain embodiments, the sugar surrogate comprises a six-membered tetrahydropyran ("THP"). Such tetrahydropyrans can be further modified or substituted. Nucleosides containing such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid ("HNA"), anitol nucleic acid ("ANA"), mannitol nucleic acid ("MNA") (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoroHNA: [ka] ("F-HNA", e.g., Swayze et al., US8088904; Swayze et al., US8440803; Swayze et al., US8796437; and Swayze et al., US9005906; F-HNA is sometimes referred to as F-THP or 3'-fluorotetrahydropyran), and further modified THP compounds having the formula: [ka] wherein, independently for each of the modified THP nucleosides above: Bx is a nucleobase moiety, T3 and T4 are each independently an internucleoside linking group that connects a modified THP nucleoside to the remainder of the oligonucleotide, or one of T3 and T4 is an internucleoside linking group that connects a modified THP nucleoside to the remainder of the oligonucleotide, and the other of T3 and T4 is H, a hydroxyl protecting group, a linkage conjugate group, or a 5' or 3' terminal group; q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; Each of R1 and R2 is independently selected from hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, and CN (wherein X is O, S, or NJ1, and each of J1, J2, and J3 is independently H or C1-C6 alkyl).
[0197] In certain embodiments, modified THP nucleosides are provided wherein q1, q2, q3, q4, q5, q6, and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, and in certain embodiments, R1 is methoxyethoxy and R2 is H.
[0198] In certain embodiments, the sugar surrogate comprises a ring having six or more atoms and two or more heteroatoms. For example, its use in nucleosides and oligonucleotides containing morpholino sugar moieties has been reported (e.g., Braasch et al., Biol. Chem. Soc. 1999, 133:111-114). Chemistry, 2002, 41, 4503-4510 and Summerton et al., US 5,698,685; Summerton et al., US 5,166,315; Summerton et al., US 5,185,444; and Summerton et al., US 5,034,506). As used herein, the term "morpholino" refers to a sugar surrogate having the following structure: [ka] .
[0199] In certain embodiments, morpholinos may be modified, for example, by adding or altering various substituents of the morpholino structure. Such sugar surrogates are referred to herein as "modified morpholinos."
[0200] In certain embodiments, the sugar surrogate comprises an acyclic moiety. Examples of nucleosides and oligonucleotides containing such acyclic sugar surrogates include, but are not limited to, peptide nucleic acids ("PNAs"), acyclic butyl nucleic acids (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and the nucleosides and oligonucleotides described in Manoharan et al., WO2011 / 133876.
[0201] Many other bicyclic and tricyclic sugar and sugar surrogate ring systems that can be used in modified nucleosides are known in the art.
[0202] 2. Certain modified nucleobases In certain embodiments, modified oligonucleotide comprises one or more nucleosides that contain unmodified nucleobases.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that contain modified nucleobases.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that do not contain nucleobases, and this is referred to as abasic nucleoside.
[0203] In certain embodiments, the modified nucleobase is selected from 5-substituted pyrimidines, 6-azapyrimidines, alkyl- or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6, and O-6 substituted purines. In certain embodiments, the modified nucleobase is selected from 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine, and 2-thiocytosine, 5-propynyl (—C≡C—CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thio Alkyl, 8-hydroxyl, 8-aza, and other 8-substituted purines, 5-halo, especially 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil It is selected from silyl, universal base, hydrophobic base, promiscuous base, size-expanded base and fluorinated base.Additionally, modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp).Modified nucleobases can also include those in which purine base or pyrimidine base is replaced with other heterocycles, such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in Merigan et al., US 3,687,808, those disclosed in The Concise Encyclopedia of Polymer Science and Engineering, Kroschwitz, JI, Ed., John Wiley & Sons, 1990, pp. 858-859; Englisch et al. al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288; and Chapters 6 and 15, Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443.
[0204] Publications that teach the preparation of some of the above and other modified nucleobases include, but are not limited to, Manoharan et al., US2003 / 0158403; Manoharan et al., US2003 / 0175906; Dinh et al., US4,845,205; Spielvogel et al., US5,130,302; Rogers et al., US5,134,066; Bischofberger et al., US5,175,273; Urdea et al., US5,367,066; Benner et al.,US5,432,272;Matteucci et al.,US5,434,257;Gmeiner et al.,US5,457,187;Cook et al.,US5,459,255;Froehler et al.,US5,484,908;Matteucci et al.,US5,502,177;Hawkins et al. al.,US5,525,711;Haralambidis et al.,US5,552,540;Cook et al.,US5,587,469;Froehler et al.,US5,594,121;Switzer et al.,US5,596,091;Cook et al.,US5,614,617;Froehler et al. al.,US5,645,985;Cook et al.,US5,681,941;Cook et al.,US5,811,534;Cook et al.,US5,750,692;Cook et al.,US5,948,903;Cook et al.,US5,587,470;Cook et al.,US5,457,191;Matteucci et al. Froehler et al., US5,830,653; Cook et al., US5,808,027; Cook et al.,6,166,199; and Matteucci et al., US6,005,096.
[0205] 3. Certain modified internucleoside linkages In certain embodiments, the nucleosides of modified oligonucleotides can be linked together using any internucleoside linkage. Two major classes of internucleoside linkage groups are defined by the presence or absence of a phosphorus atom. Representative internucleoside linkages containing phosphorus include, but are not limited to, phosphodiester linkages ("P=O") (unmodified Modified internucleoside linkages include phosphate-containing linkages (also referred to as "phosphoric acid linkages" or "natural linkages"), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates ("P=S"), and phosphorodithioates ("HS-P=S"). Representative non-phosphorus internucleoside linkage groups include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiesters, thionocarbamate (-OC(=O)(NH)-S-), siloxane (-O-SiH2-O-), and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Modified internucleoside linkages can be used to alter (typically increase) the nuclease resistance of oligonucleotides compared to natural phosphate linkages. In certain embodiments, internucleoside linkages having chiral atoms can be prepared as racemic mixtures or as separate enantiomers. Methods for preparing phosphorus-containing and non-phosphorus-containing internucleoside linkages are well known to those skilled in the art.
[0206] Representative internucleoside linkages having a chiral center include, but are not limited to, alkylphosphonates and phosphorothioates. Modified oligonucleotides containing internucleoside linkages having a chiral center can be prepared as a population of modified oligonucleotides containing stereorandom internucleoside linkages or as a population of modified oligonucleotides containing phosphorothioate linkages in a specific stereochemical configuration. In certain embodiments, a population of modified oligonucleotides contains all stereorandom phosphorothioate internucleoside linkages. Such modified oligonucleotides can be produced using a synthetic method that results in random selection of the stereochemical configuration of each phosphorothioate linkage. Nevertheless, as will be appreciated by those skilled in the art, each individual phosphorothioate in each individual oligonucleotide molecule has a defined stereochemical configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides containing one or more specific phosphorothioate internucleoside linkages in a specific, independently selected stereochemical configuration. In certain embodiments, a specific configuration of a specific phosphorothioate linkage is present in at least 65% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate linkages is present in at least 70% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate linkages is present in at least 80% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate linkages is present in at least 90% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate linkages is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be produced using synthetic methods known in the art, for example, using the methods described in Oka et al., JACS 125, 8307 (2003); Wan et al., Nuc. Acid. Res. 42, 13456 (2014); and WO2017 / 015555.In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one designated phosphorothioate in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one designated phosphorothioate in the (Rp) configuration. In certain embodiments, the modified oligonucleotides comprising (Rp) and / or (Sp) phosphorothioates each comprise one or more of the following formulas, where "B" represents a nucleobase: [ka]
[0207] Unless otherwise specified, the chiral internucleoside linkages of the modified oligonucleotides described herein can be stereorandom or of a specific stereochemical configuration.
[0208] Neutral internucleoside linkages include, but are not limited to, phosphotriester, methylphosphonate, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl, and thioformacetal (3'-S-CH2-O-5'). Additional neutral internucleoside linkages include nonionic linkages including siloxanes (dialkylsiloxanes), carboxylate esters, carboxamides, sulfides, sulfonates, and amides (see, e.g., Carbohydrate Modifications in Antisense Research; YS Sanghvi and PD Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Additional neutral internucleoside linkages include nonionic linkages containing mixed N, O, S, and CH component moieties.
[0209] B. A specific motif In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising modified sugar moieties. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising modified nucleobases. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkages. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and / or internucleoside linkages of modified oligonucleotides define a pattern or motif. In certain embodiments, the sugar moieties, nucleobases, and internucleoside linkage patterns are each independent of one another. Thus, modified oligonucleotides can be described by their sugar motif, nucleobase motif, and / or internucleoside linkage motif (as used herein, nucleobase motif describes modifications to nucleobases that are independent of the sequence of the nucleobases).
[0210] 1. A specific glycomotif In certain embodiments, an oligonucleotide comprises one or more types of modified sugar and / or unmodified sugar moieties arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif, which in certain cases includes, but is not limited to, any of the sugar modifications discussed herein.
[0211] In certain embodiments, the modified oligonucleotide comprises or consists of a region having a gapmer motif defined by two outer regions, or "wings," and a central or internal region, or "gap." The three regions of the gapmer motif (5' wing, gap, and 3' wing) form a contiguous nucleoside sequence. The gap junction is formed by a gap junction, with at least some of the sugar moieties of the nucleosides in each wing being different from at least some of the sugar moieties of the nucleosides in the gap. Specifically, at least the sugar moieties of the nucleosides in each wing closest to the gap (the 3'-most nucleoside of the 5' wing and the 5'-most nucleoside of the 3' wing) are different from the sugar moieties of the adjacent gap nucleosides, thereby defining the boundary between the wing and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties within the gap are the same as each other. In certain embodiments, the gap contains one or more nucleosides having a sugar moiety that is different from the sugar moieties of one or more other nucleosides in the gap. In certain embodiments, the sugar motifs of the two wings are the same as each other (symmetric gapmer). In certain embodiments, the sugar motif of the 5' wing is different from the sugar motif of the 3' wing (asymmetric gapmer).
[0212] In certain embodiments, a gapmer wing comprises 1 to 5 nucleosides. In certain embodiments, a gapmer wing comprises 6 or 7 nucleosides. In certain embodiments, each nucleoside in each wing of a gapmer is a modified nucleoside. In certain embodiments, at least one nucleoside in each wing of a gapmer is a modified nucleoside. In certain embodiments, at least two nucleosides in each wing of a gapmer are modified nucleosides. In certain embodiments, at least three nucleosides in each wing of a gapmer are modified nucleosides. In certain embodiments, at least four nucleosides in each wing of a gapmer are modified nucleosides.
[0213] In certain embodiments, the gapmer gap contains 7 to 12 nucleosides. In certain embodiments, each nucleoside in the gapmer gap is an unmodified 2'-deoxynucleoside. In certain embodiments, at least one nucleoside in the gapmer gap is a modified nucleoside. In certain embodiments, at least one nucleoside in the gapmer gap contains a 2'-deoxyfuranosyl sugar moiety having an isomeric configuration other than the β-D-ribosyl configuration.
[0214] In certain embodiments, the gapmer is a deoxygapmer. In certain embodiments, the nucleosides on the gap side of each wing / gap junction are unmodified 2'-deoxynucleosides, and the nucleosides on the wing side of each wing / gap junction are modified nucleosides. In certain embodiments, each nucleoside of the gap is an unmodified 2'-deoxynucleoside. In certain embodiments, each nucleoside of each wing of the gapmer is a modified nucleoside.
[0215] In certain embodiments, a modified oligonucleotide comprises or consists of a region having a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified region of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside throughout the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, a modified oligonucleotide comprises or consists of a region having a fully modified sugar motif, and each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of the uniform modification comprises the same 2' modification.
[0216] As used herein, the lengths (number of nucleosides) of the three regions of a gapmer may be indicated using the notation [number of nucleosides in the 5' wing] - [number of nucleosides in the gap] - [number of nucleosides in the 3' wing]. Thus, a 5-10-5 gapmer consists of 5 linked nucleosides in each wing and 10 linked nucleosides in the gap. When such a designation is followed by a specific modification, the modification is within each sugar of each wing, and the gap nucleosides comprise unmodified deoxynucleosides. Thus, a 5-10-5 MOE gapmer consists of five linked 2'-MOE modified nucleosides in the 5' wing, ten linked deoxynucleosides in the gap, and five linked 2'-MOE nucleosides in the 3' wing. In certain such embodiments, the deoxynucleosides in the gap comprise 2'-β-D-deoxyribosyl sugars. A mixed-wing gapmer has at least two different modified sugars in the 5' and / or 3' wings.
[0217] In certain embodiments, the modified oligonucleotide is a 5-10-5 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 4-10-6 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 6-10-4 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-7 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 7-10-3 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 5-8-5 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 5-9-5 MOE gapmer. In certain embodiments, the modified oligonucleotide is an XYZ MOE gapmer (X and Z are independently selected from 1, 2, 3, 4, 5, 6, or 7 linked 2'-MOE nucleosides, and Y is selected from 7, 8, 9, 10, or 11 linked deoxynucleosides).
[0218] In certain embodiments, modified oligonucleotides have a sugar motif selected from the following (5' to 3' order): eeeeeddddddddddkkeee, eeeeeeddddddddddkkee, eeeeedddddddddkkeee, eeeeddddddddddkkeee, eeeeddddddddkkeee, eeeeddddddddkkee, eeeeddddddddkkee, eeeeeddyddddddddeeeee, eeeeedyddddddeeeee, or eeeeeedyddddddddeeee (where "d" represents a 2'-deoxyribosyl sugar moiety, "e" represents a 2'-MOE sugar moiety, "k" represents a cEt sugar moiety, and "y" represents a 2'-OMe sugar moiety).
[0219] 2. Certain nucleobase motifs In certain embodiments, an oligonucleotide comprises modified and / or unmodified nucleobases arranged along the oligonucleotide or its region in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in the modified oligonucleotide are 5-methylcytosine. In certain embodiments, all cytosine nucleobases are 5-methylcytosine, and all other nucleobases of the modified oligonucleotide are unmodified nucleobases.
[0220] In certain embodiments, a modified oligonucleotide comprises a block of modified nucleobases. In certain such embodiments, the block is at the 3' end of the oligonucleotide. In certain embodiments, the block is within three nucleosides of the 3' end of the oligonucleotide. In certain embodiments, the block is at the 5' end of the oligonucleotide. In certain embodiments, the block is at the 5' end of the oligonucleotide. It is located within three nucleosides at the 5' end of the
[0221] In certain embodiments, an oligonucleotide having a gapmer motif comprises a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is located in the central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of the nucleoside is a 2'-deoxyribosyl moiety. In certain embodiments, the modified nucleobase is selected from 2-thiopyrimidine and 5-propynepyrimidine.
[0222] 3. Certain internucleoside linkage motifs In certain embodiments, the oligonucleotide comprises modified and / or unmodified internucleoside linkages arranged along the oligonucleotide or a region thereof in a defined pattern or motif. In certain embodiments, each internucleoside linkage group is a phosphodiester internucleoside linkage (P=O). In certain embodiments, each internucleoside linkage group of the modified oligonucleotide is a phosphorothioate internucleoside linkage (P=S). In certain embodiments, each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from stereorandom phosphorothioates, (Sp) phosphorothioates, and (Rp) phosphorothioates. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and all internucleoside linkages within the gap are modified. In certain such embodiments, some or all of the internucleoside linkages within the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkages are modified. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage within at least one wing, wherein the at least one phosphodiester linkage is not a terminal internucleoside linkage and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all phosphorothioate linkages are stereorandom. In certain embodiments, all phosphorothioate linkages within the wings are (Sp) phosphorothioate, and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides comprising such internucleoside linkage motifs.
[0223] C. A certain length It is possible to increase or decrease the length of oligonucleotides without loss of activity. For example, Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992) tested the ability of a series of oligonucleotides ranging from 13 to 25 nucleobases in length to induce target RNA cleavage in an oocyte injection model. Oligonucleotides 25 nucleobases long with 8 or 11 mismatched bases near the ends of the oligonucleotide were able to induce specific cleavage of the target RNA, although this was not as effective as oligonucleotides without mismatches. Similarly, target-specific cleavage was achieved using 13 nucleobase oligonucleotides (including those with one or three mismatches).
[0224] In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of lengths. In certain embodiments, the oligonucleotide consists of X to Y linked nucleosides, where X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In certain such embodiments, wherein X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, provided that X≦Y. For example, in certain embodiments, the oligonucleotides may be 12-13, 12-14, 12-15, 12-16, 12-17, 12-18, 12-19, 12-20, 12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 13-14, 13-15, 13-16, 13-17, 13-18, 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25 , 13-26, 13-27, 13-28, 13-29, 13-30, 14-15, 14-16, 14-17, 14-18, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, 14-25, 14-26, 14-27, 14-28, 14-29, 14-30, 15-16, 15-17, 15-18, 15-19, 15-20, 15-21, 15-22, 15-23, 15-24, 15-25, 15-26, 15-27, 15-28, 15- 29, 15-30, 16-17, 16-18, 16-19, 16-20, 16-21, 16-22, 16-23, 16-24, 16-25, 16-26, 16-27, 16-28, 16-29, 16-30, 17-18, 17-19, 17-20, 17-21, 17-22, 17-23, 17-24, 17-25, 17-26, 17-27, 17-28, 17-29, 17-30, 18-19, 18-20, 18-21, 18-22, 18-23, 18-24, 1 8-25, 18-26, 18-27, 18-28, 18-29, 18-30, 19-20, 19-21, 19-22, 19-23, 19-24, 19-25, 19-26, 19-29, 19-28, 19-29, 19-30, 20-21, 20-22, 20-23, 20-24, 20-25, 20-26, 20-27, 20-28, 20-29, 20-30, 21-22, 21-23, 21-24, 21-25, 21-26, 21-27, 21-28, 21-29,Consisting of 21-30, 22-23, 22-24, 22-25, 22-26, 22-27, 22-28, 22-29, 22-30, 23-24, 23-25, 23-26, 23-27, 23-28, 23-29, 23-30, 24-25, 24-26, 24-27, 24-28, 24-29, 24-30, 25-26, 25-27, 25-28, 25-29, 25-30, 26-27, 26-28, 26-29, 26-30, 27-28, 27-29, 27-30, 28-29, 28-30, or 29-30 linked nucleosides.
[0225] D. Certain Modified Oligonucleotides In certain embodiments, the above-described modifications (sugar, nucleobase, internucleoside linkage) are incorporated into modified oligonucleotides. In certain embodiments, modified oligonucleotides are characterized by these modification motifs and overall length. In certain embodiments, these parameters are independent of each other. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified, and may or may not follow the gapmer modification pattern of sugar modification. For example, the internucleoside linkages within the wing regions of a sugar gapmer may be the same or different from each other and may be the same or different from the internucleoside linkages in the gap region of the sugar motif. Similarly, such sugar gapmer oligonucleotides may contain one or more modified nucleobases independent of the gapmer pattern of sugar modification. Unless otherwise indicated, all modifications are independent of the nucleobase sequence.
[0226] E. Certain Populations of Modified Oligonucleotides A population of modified oligonucleotides in which all modified oligonucleotides in the population have the same molecular formula can be a stereorandom population or a chiral enriched population. Within a stereorandom population, all chiral centers of all modified oligonucleotides are stereorandom. In a chirally enriched population, at least one particular chiral center within the modified oligonucleotides of the population is not stereorandom. In certain embodiments, the modified oligonucleotides of the chirally enriched population are enriched for β-D ribosyl sugar moieties and all phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides of the chirally enriched population are enriched for both β-D ribosyl sugar moieties and at least one particular phosphorothioate internucleoside linkage in a particular stereochemical configuration.
[0227] F. Nucleic Acid Sequence In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleobase sequences. In certain embodiments, the oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid (e.g., a target nucleic acid). In certain such embodiments, a region of the oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid (e.g., a target nucleic acid). In certain embodiments, the nucleobase sequence of a region or the entire length of the oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to a second oligonucleotide or nucleic acid (e.g., a target nucleic acid).
[0228] II. Certain Oligomeric Compounds In certain embodiments, provided herein are oligomeric compounds comprising an oligonucleotide (modified or unmodified) and, optionally, one or more conjugate groups and / or terminal groups. A conjugate group comprises one or more conjugate moieties and a conjugate linker that connects the conjugate moieties to the oligonucleotide. A conjugate group may be attached to one or both termini of an oligonucleotide and / or at any internal position. In certain embodiments, a conjugate group is attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, a conjugate group attached to one or both termini of an oligonucleotide is a terminal group. In certain such embodiments, a conjugate group or terminal group is attached at the 3' and / or 5' termini of an oligonucleotide. In certain such embodiments, a conjugate group (or terminal group) is attached at the 3' terminus of an oligonucleotide. In certain embodiments, a conjugate group is attached near the 3' terminus of an oligonucleotide. In certain embodiments, a conjugate group (or terminal group) is attached at the 5' terminus of an oligonucleotide. In certain embodiments, the conjugate group is attached near the 5' end of the oligonucleotide.
[0229] Examples of terminal groups include, but are not limited to, a conjugate group, a capping group, a phosphate moiety, a protecting group, a modified or unmodified nucleoside, and two or more nucleosides that are independently modified or unmodified.
[0230] A. Certain conjugate groups In certain embodiments, the oligonucleotide is covalently bound to one or more conjugate groups. In certain embodiments, the conjugate group modifies one or more properties of the bound oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. In certain embodiments, the conjugate group imparts new properties to the bound oligonucleotide, such as a fluorophore or reporter group that allows detection of the oligonucleotide. Certain conjugate groups and conjugate moieties have been previously described. Examples of suitable thioethers include cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), and thiocholesterols (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains such as dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids such as di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al. al., Nucl. Acids Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantaneacetic acid, palmityl moieties (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxycholesterol moieties (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), tocopherol groups (Nisshina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nisshina et al., Molecular Therapy, 2008, 16, 734-740), or GalNAc clusters (e.g., WO2014 / 179620).
[0231] 1. Conjugate moiety Conjugate moieties include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, sugars, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folic acid, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluorescein, rhodamine, coumarin, fluorophores, and dyes.
[0232] In certain embodiments, the conjugate moiety comprises an active drug substance, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazide, chlorothiazide, diazepine, indomethicin, barbiturate, cephalosporin, sulfa drug, antidiabetic, antibacterial, or antibiotic.
[0233] 2. Conjugate Linker The conjugate moiety is attached to the oligonucleotide via a conjugate linker. In certain oligomeric compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is directly attached to the oligonucleotide via a single bond). In certain embodiments, the conjugate linker is a hydrocarbyl The term "polysaccharide" includes chain structures such as disaccharide chains, or oligomers of repeating units such as ethylene glycol, nucleoside, or amino acid units.
[0234] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amido, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amido, and ether groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and amido groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.
[0235] In certain embodiments, the conjugate linker, including the conjugate linkers described above, is a bifunctional linking moiety, e.g., one known in the art to be useful for attaching a conjugate group to a parent compound (e.g., an oligonucleotide provided herein). Generally, a bifunctional linking moiety contains at least two functional groups. One of the functional groups is selected to bind to a specific site on the parent compound, and the other is selected to bind to a conjugate group. Examples of functional groups used in bifunctional linking moieties include, but are not limited to, an electrophilic group for reacting with a nucleophilic group and a nucleophilic group for reacting with an electrophilic group. In certain embodiments, the bifunctional linking moiety contains one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.
[0236] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include, but are not limited to, substituted or unsubstituted C1-C 10 Alkyl, substituted or unsubstituted C2-C 10 Alkenyl, or substituted or unsubstituted C2-C 10 Included are alkynyls, where a non-limiting list of preferred substituents includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.
[0237] In certain embodiments, a conjugate linker comprises 1 to 10 linker nucleosides. In certain embodiments, a conjugate linker comprises 2 to 5 linker nucleosides. In certain embodiments, a conjugate linker comprises exactly 3 linker nucleosides. In certain embodiments, a conjugate linker comprises a TCA motif. In certain embodiments, such linker nucleosides are modified nucleosides. In certain embodiments, such linker nucleosides comprise modified sugar moieties. In certain embodiments, linker nucleosides are unmodified. In certain embodiments, a linker nucleoside comprises an optionally protected heterocyclic base selected from a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. Typically, it is desirable for the linker nucleoside to be cleaved from the oligomeric compound after reaching the target tissue. Thus, the linker nucleosides are typically joined to each other and to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such cleavable bond is a phosphodiester bond.
[0238] As used herein, linker nucleosides are not considered part of the oligonucleotide. Thus, in embodiments where an oligomeric compound comprises an oligonucleotide consisting of a specific number or range of linked nucleosides and / or a specific percent complementarity to a reference nucleic acid, and the oligomeric compound also comprises a conjugate group containing a conjugate linker comprising linker nucleosides, these linker nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide to the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8 to 30 nucleosides and (2) a conjugate group consisting of 1 to 10 linker nucleosides contiguous with a nucleoside of the modified oligonucleotide. The total number of contiguous linked nucleosides in such an oligomeric compound is greater than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8 to 30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such an oligomeric compound is 30 or less. Unless otherwise specified, a conjugate linker comprises 10 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 5 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 3 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 2 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 1 or fewer linker nucleoside.
[0239] In certain embodiments, it is desirable for the conjugate group to be cleaved from the oligonucleotide. For example, in certain situations, oligomeric compounds containing certain conjugate moieties are better taken up by certain cell types, but once the oligomeric compound is taken up, it is desirable for the conjugate group to be cleaved to release the unconjugated oligonucleotide or parent oligonucleotide. Thus, certain conjugate linkers may contain one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is an atomic group containing at least one cleavable bond. In certain embodiments, the cleavable moiety comprises an atomic group having one, two, three, four, or five or more cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved within a cell or intracellular compartment (e.g., within a lysosome). In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme such as a nuclease.
[0240] In certain embodiments, the cleavable bond is selected from among amide, ester, ether, one or both esters of phosphodiester, phosphate ester, carbamate, or disulfide. In certain embodiments, the cleavable bond is one or both esters of phosphodiester. In certain embodiments, the cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate bond between the oligonucleotide and the conjugate moiety or conjugate group.
[0241] In certain embodiments, the cleavable moiety comprises or consists of one or more linker nucleosides. In certain such embodiments, one or more linker nucleosides are attached to each other and / or to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such cleavable bond is unmodified. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside attached to either the 3'- or 5'-terminal nucleoside of the oligonucleotide by a phosphate internucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.
[0242] B. Certain end groups In certain embodiments, the oligomeric compound comprises one or more terminal groups. In certain such embodiments, the oligomeric compound comprises a stabilized 5'-phosphate. Stabilized 5'-phosphates include, but are not limited to, 5'-phosphates, including, but not limited to, 5'-vinylphosphonates. In certain embodiments, the terminal group comprises one or more abasic nucleosides and / or inverted nucleosides. In certain embodiments, the terminal group comprises one or more 2'-linked nucleosides. In certain such embodiments, the 2'-linked nucleosides are abasic nucleosides.
[0243] III. Oligomeric Duplexes In certain embodiments, the oligomeric compounds described herein comprise an oligonucleotide having a nucleobase sequence complementary to the nucleobase sequence of a target nucleic acid. In certain embodiments, the oligomeric compound pairs with a second oligomeric compound to form an oligomeric duplex. Such an oligomeric duplex comprises a first oligomeric compound having a region complementary to the target nucleic acid and a second oligomeric compound having a region complementary to the first oligomeric compound. In certain embodiments, the first oligomeric compound of the oligomeric duplex comprises or consists of (1) a modified or unmodified oligonucleotide and optionally a conjugate group, and (2) a second modified or unmodified oligonucleotide and optionally a conjugate group. One or both oligomeric compounds of the oligomeric duplex may comprise a conjugate group. The oligonucleotide of each oligomeric compound of the oligomeric duplex may comprise a non-complementary overhanging nucleoside.
[0244] IV. Antisense Activity In certain embodiments, oligomeric compounds and oligomeric duplexes are capable of hybridizing to a target nucleic acid to provide at least one antisense activity. Such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, an antisense compound has antisense activity if it reduces or inhibits the amount or activity of the target nucleic acid by 25% or more in a standard cell assay. In certain embodiments, an antisense compound selectively affects one or more target nucleic acids. Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acids to provide one or more desired antisense activities and does not hybridize to one or more non-target nucleic acids or does not hybridize to one or more non-target nucleic acids in a manner that results in significant undesired antisense activity.
[0245] In certain antisense activities, the hybridization of an antisense compound with a target nucleic acid results in the recruitment of a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in RNase H-mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex does not need to be unmodified DNA. In certain embodiments, the present specification describes antisense compounds that are sufficiently "DNA-like" to induce RNase H activity. In certain embodiments, one or more non-DNA-like nucleosides are permitted within the gap of a gapmer.
[0246] In certain antisense activity, antisense compound or part of antisense compound is loaded into RNA-induced silencing complex (RISC), and finally leads to the cleavage of target nucleic acid.For example, certain antisense compound leads to the cleavage of target nucleic acid by Argonaute.The antisense compound that is loaded into RISC is RNAi compound.RNAi compound can be double-stranded (siRNA) or single-stranded (ssRNA).
[0247] In certain embodiments, hybridization of an antisense compound with a target nucleic acid results in the failure of the recruitment of a protein that cleaves the target nucleic acid. In certain embodiments, hybridization of an antisense compound with a target nucleic acid results in the alteration of the splicing of a protein that cleaves the target nucleic acid. In certain embodiments, hybridization of an antisense compound with a target nucleic acid results in the inhibition of the binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound with a target nucleic acid results in the alteration of the translation of the target nucleic acid.
[0248] Antisense activity can be observed directly or indirectly. In certain embodiments, observing or detecting antisense activity involves observing or detecting a change in the amount of a target nucleic acid or the amount of a protein encoded by such a target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein, and / or a change in phenotype in a cell or animal.
[0249] V. Certain Target Nucleic Acids In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from mature mRNA and pre-mRNA (including introns, exons, and untranslated regions). In certain embodiments, the target RNA is mature mRNA. In certain embodiments, the target nucleic acid is pre-mRNA. In certain such embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, the target region is at least 50% within an intron. In certain embodiments, the target nucleic acid is an RNA transcript of a retrogene. In certain embodiments, the target nucleic acid is a non-coding RNA. In certain such embodiments, the target non-coding RNA is selected from long non-coding RNA, short non-coding RNA, and intronic RNA molecules.
[0250] A. Complementarity / Mismatch to Target Nucleic Acid It is possible to introduce mismatched bases without losing activity. See, e.g., Gautschi et al. (J. Natl. Cancer Inst. 93:463-471, March 2001) has 100% complementarity to bcl-2 mRNA and bcl-xL We have shown that an oligonucleotide with three mismatches to mRNA can reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide exhibited potent antitumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested the ability of a series of tandem 14-nucleobase oligonucleotides, as well as 28- and 42-nucleobase oligonucleotides composed of sequences of two or three tandem oligonucleotides, to terminate translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14-nucleobase oligonucleotides alone inhibited translation, although to a lesser extent than the 28- or 42-nucleobase oligonucleotides. could be inhibited.
[0251] In certain embodiments, the oligonucleotide is complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, the oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide, and includes a region that is 100% or fully complementary to the target nucleic acid. In certain embodiments, the region of full complementarity is 6 to 20, 10 to 18, or 18 to 20 nucleobases in length.
[0252] In certain embodiments, the oligonucleotide contains one or more mismatched nucleobases relative to the target nucleic acid. In certain embodiments, such mismatches reduce antisense activity against the target, while reducing activity against non-targets to a greater extent. Thus, in certain embodiments, the selectivity of the oligonucleotide is improved. In certain embodiments, the mismatches are specifically located within an oligonucleotide having a gapmer motif. In certain embodiments, the mismatches are located at positions 1, 2, 3, 4, 5, 6, 7, or 8 from the 5' end of the gap region. In certain embodiments, the mismatches are located at positions 9, 8, 7, 6, 5, 4, 3, 2, or 1 from the 3' end of the gap region. In certain embodiments, the mismatches are located at positions 1, 2, 3, or 4 from the 5' end of the wing region. In certain embodiments, the mismatches are located at positions 4, 3, 2, or 1 from the 3' end of the wing region.
[0253] B.PRNP In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid, the target nucleic acid being PRNP. In certain embodiments, the PRNP nucleic acid has the sequence set forth in SEQ ID NO: 1 (GENBANK Accession No. NM_000311.4) or SEQ ID NO: 2 (GENBANK Accession No. NC_000020.11, truncated from nucleotides 4683001-4705000). In certain embodiments, the PRNP nucleic acid has the sequence set forth in SEQ ID NO: 3 (GENBANK Accession No. NM_001080123.2), which is a splice variant of SEQ ID NO: 1. In certain embodiments, the PRNP nucleic acid has the sequence set forth in SEQ ID NO: 4 (ENSEMBL Accession No.: ENST00000359125.6 (ENSEMBL Version 98: September 2019, from human reference assembly version GRCh38.p13 located on the opposite strand of chromosome 20 (CM000682.2) at positions 63,406,137 to 63,472,590); Yates, et al., "Ensembl 2020", Nucleic Acids Research, gkz966, 2019), which is a splice variant of SEQ ID NO: 1.
[0254] In certain embodiments, contacting cells with an oligomeric compound complementary to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4 reduces the amount of PRNP RNA, and in certain embodiments, reduces the amount of PrP protein. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, contacting cells with an oligomeric compound complementary to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4 alleviates one or more symptoms or characteristics of a neurodegenerative disease. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, the symptom or characteristic is spongiform changes in the brain, development of abnormal protein aggregates, neuronal loss, markers of neuronal loss, rapidly progressive dementia, and death. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide.
[0255] In certain embodiments, administration of an oligomeric compound complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4 reduces the detectable amount of PrP protein in the CSF. C In certain embodiments, the PrP protein is PrP Sc In certain embodiments, the PrP protein is PrP C and PrP Sc is.
[0256] C. A specific target nucleic acid in a specific tissue In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid, and the target nucleic acid is expressed in a pharmacologically significant tissue. In certain embodiments, the pharmacologically significant tissue is the cell and tissue that constitutes the central nervous system (CNS). Such tissues include brain tissues, such as the cortex, substantia nigra, striatum, midbrain, and brainstem, and spinal cord.
[0257] VI. Certain Pharmaceutical Compositions In certain embodiments, described herein are pharmaceutical compositions comprising one or more oligomeric compounds. In certain embodiments, the one or more oligomeric compounds each comprise a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric compounds. In certain embodiments, the sterile saline is pharmaceutical-grade saline. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and sterile water. In certain embodiments, the sterile water is pharmaceutical-grade water. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and phosphate-buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical-grade PBS. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical-grade.
[0258] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists essentially of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.
[0259] In certain embodiments, pharmaceutical compositions comprise one or more oligomeric compounds and one or more excipients, in certain embodiments, the excipients are selected from water, saline, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.
[0260] In certain embodiments, the oligomeric compounds may be mixed with pharmaceutically acceptable active and / or inactive substances for the preparation of pharmaceutical compositions or formulations. The composition and method for formulating a pharmaceutical composition will depend on several criteria, including, but not limited to, the route of administration, the extent of the disease, or the dose to be administered.
[0261] In certain embodiments, pharmaceutical compositions comprising oligomeric compounds include any pharmaceutically acceptable salt of the oligomeric compound, an ester of the oligomeric compound, or a salt of such an ester. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotides are biologically active upon administration to an animal, including a human. The oligomeric compounds may provide (directly or indirectly) metabolically active metabolites or residues thereof. Thus, for example, the present disclosure is also directed to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other biological equivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In certain embodiments, the prodrugs comprise one or more conjugate groups attached to the oligonucleotide, which are cleaved by endogenous nucleases in the body.
[0262] Lipid moieties are used in various ways in nucleic acid therapy.In certain such methods, nucleic acids (e.g., oligomeric compounds) are introduced into preformed liposomes or lipoplexes made from a mixture of cationic lipids and neutral lipids.In certain methods, DNA complexes with monocationic or polycationic lipids are formed without the presence of neutral lipids.In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceutical agents to specific cells or tissues.In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceutical agents to adipose tissue.In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceutical agents to muscle tissue.
[0263] In certain embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions, including pharmaceutical compositions containing hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethyl sulfoxide, are used.
[0264] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more pharmaceutical agents of the present invention to a specific tissue or cell type. For example, in certain embodiments, the pharmaceutical composition comprises a liposome coated with a tissue-specific antibody.
[0265] In certain embodiments, the pharmaceutical composition comprises a co-solvent system. Certain such co-solvent systems include, for example, benzyl alcohol, a non-polar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which contains 3% The cosolvent system is a solution of 8% w / v benzyl alcohol, 8% w / v of the nonpolar surfactant Polysorbate 80™, and 65% w / v polyethylene glycol 300 in absolute ethanol. The proportions of such a cosolvent system can be varied significantly without significantly altering its solubility and toxicity characteristics. Furthermore, the content of the cosolvent components may be varied; for example, other surfactants may be substituted for Polysorbate 80™, the fraction size of the polyethylene glycol may be varied, other biocompatible polymers may be substituted for polyethylene glycol, e.g., polyvinylpyrrolidone, and other sugars or polysaccharides may be substituted for dextrose.
[0266] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain such embodiments, the pharmaceutical composition comprises a carrier and is formulated in an aqueous solution, for example, in water or a physiologically compatible buffer, such as Hank's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients (e.g., ingredients that aid solubility or act as preservatives) are included. In certain embodiments, injectable suspensions are prepared using suitable liquid carriers, suspending agents, etc. Certain injectable pharmaceutical compositions are provided in unit dosage form, for example, in ampoules or multi-dose containers. Certain injectable pharmaceutical compositions are suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing, and / or dispersing agents. Certain solvents suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils (e.g., sesame oil), synthetic fatty acid esters (e.g., ethyl oleate or triglycerides), and liposomes.
[0267] VII. Certain Compositions 1. Compound No. 1238994 In certain embodiments, compound No. 1238994 is characterized as a 5-10-5 MOE gapmer having the sequence (in 5'→3' order) GTCATAATTTTCTTAGCTAC (SEQ ID NO: 1914), wherein nucleosides 1-5 and 16-20 (in 5'→3' order) each are 2'-MOE nucleosides, nucleosides 6-15 each are 2'-β-D-deoxynucleosides, and nucleosides 2-3, The internucleoside linkages between nucleosides 3-4, 4-5, 16-17, and 17-18 are phosphodiester internucleoside linkages, and the internucleoside linkages between nucleosides 1-2, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate internucleoside linkages, in which each cytosine is a 5-methylcytosine.
[0268] In certain embodiments, compound number 1238994 has the following chemical designation (5'→3' order): Ges Teo m Ceo Aeo Tes Ads Ads Tds Tds Tds Tds m Cds Tds Tds Ads Geo m CEO Tes Aes m Ce (SEQ ID NO: 1914), where: A = adenine nucleobase m C=5-methylcytosine nucleobase G = guanine nucleobase T=thymine nucleobase e=2'-MOE modified sugar d = 2'-β-D deoxyribosyl sugar s = phosphorothioate internucleoside linkage o = phosphodiester internucleoside linkage.
[0269] In certain embodiments, compound number 1238994 is represented by the following chemical structure: [ka] (SEQ ID NO: 1914). Structure 1. Compound number 1238994
[0270] In certain embodiments, the sodium salt of Compound No. 1238994 is represented by the following chemical structure: [ka] (SEQ ID NO: 1914). Structure 2. Sodium salt of compound number 1238994
[0271] 2. Compound number 1373021 In certain embodiments, compound No. 1373021 is characterized as a 6-10-4 MOE gapmer having the sequence (in 5' to 3' order) GTCATAATTTTCTTAGCTAC (SEQ ID NO: 1914), wherein nucleosides 1-6 and 17-20 (in 5' to 3' order) each are 2'-MOE nucleosides, nucleosides 7-16 each are 2'-β-D-deoxynucleosides, and nucleosides 2-3, The internucleoside linkages between nucleosides 3-4, 4-5, 5-6, 6-7, and 17-18 are phosphodiester internucleoside linkages, and the internucleoside linkages between nucleosides 1-2, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 18-19, and 19-20 are phosphorothioate internucleoside linkages, in which each cytosine is a 5-methylcytosine.
[0272] In certain embodiments, compound number 1373021 has the following chemical designation (5' to 3'): Ges Teo m Ceo Aeo Teo Aeo Ads Tds Tds Tds Tds m Cds Tds Tds Ads Gds m CEO Tes Aes m Ce (SEQ ID NO: 1914), where: A = adenine nucleobase m C=5-methylcytosine nucleobase G = guanine nucleobase T=thymine nucleobase e=2'-MOE modified sugar d = 2'-β-D deoxyribosyl sugar s = phosphorothioate internucleoside linkage o = phosphodiester internucleoside linkage.
[0273] In certain embodiments, compound number 1373021 is represented by the following chemical structure: [ka] (SEQ ID NO: 1914). Structure 3. Compound number 1373021
[0274] In certain embodiments, the sodium salt of Compound No. 1373021 is represented by the following chemical structure: [ka] (SEQ ID NO: 1914). Structure 4. Sodium salt of compound number 1373021
[0275] 3. Compound No. 1373022 In certain embodiments, compound No. 1373022 is characterized as a 6-10-4 MOE gapmer having the sequence (5' to 3' order) GCTTATTATTCATGTTCTCC (SEQ ID NO: 1939), wherein nucleosides 1-6 and 17-20 (5' to 3' order) each are 2'-MOE nucleosides, nucleosides 7-16 each are 2'-β-D-deoxynucleosides, and nucleosides 2-3, The internucleoside linkages between nucleosides 3-4, 4-5, 5-6, 6-7, and 17-18 are phosphodiester internucleoside linkages, and the internucleoside linkages between nucleosides 1-2, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 18-19, and 19-20 are phosphorothioate internucleoside linkages, in which each cytosine is a 5-methylcytosine.
[0276] In certain embodiments, compound number 1373022 has the following chemical designation (5' to 3'): Ges m Ceo Teo Teo Aeo Teo Tds Ads Tds Tds m Cds Ads Tds Gds Tds Tds m CEO Tes m Ces m Ce (SEQ ID NO: 1939), where: A = adenine nucleobase m C=5-methylcytosine nucleobase G = guanine nucleobase T=thymine nucleobase e=2'-MOE modified sugar d = 2'-β-D deoxyribosyl sugar s = phosphorothioate internucleoside linkage o = phosphodiester internucleoside linkage.
[0277] In certain embodiments, compound number 1373022 is represented by the following chemical structure: [ka] (SEQ ID NO: 1939). Structure 5. Compound number 1373022
[0278] In certain embodiments, the sodium salt of Compound No. 1373022 is represented by the following chemical structure: [ka] (SEQ ID NO: 1939). Structure 6. Sodium salt of compound number 1373022
[0279] 4. Compound No. 1373023 In certain embodiments, compound No. 1373023 is characterized as a 6-10-4 MOE gapmer having the sequence (in 5' to 3' order) GTGTCATAATTTTCTTAGCT (SEQ ID NO: 2302), wherein nucleosides 1-6 and 17-20 (in 5' to 3' order) each are 2'-MOE nucleosides, nucleosides 7-16 each are 2'-β-D-deoxynucleosides, and nucleosides 2-3, The internucleoside linkages between nucleosides 3-4, 4-5, 5-6, 6-7, and 17-18 are phosphodiester internucleoside linkages, and the internucleoside linkages between nucleosides 1-2, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 18-19, and 19-20 are phosphorothioate internucleoside linkages, in which each cytosine is a 5-methylcytosine.
[0280] In certain embodiments, compound number 1373023 has the following chemical designation (5' to 3' order): Ges Teo Geo Teo m Ceo Aeo Tds Ads Ads Tds Tds Tds Tds m Cds Tds Tds Aeo Ges m Ces Te (SEQ ID NO: 2302), where: A = adenine nucleobase m C=5-methylcytosine nucleobase G = guanine nucleobase T=thymine nucleobase e=2'-MOE modified sugar d = 2'-β-D deoxyribosyl sugar s = phosphorothioate internucleoside linkage o = phosphodiester internucleoside linkage.
[0281] In certain embodiments, compound number 1373023 is represented by the following chemical structure: [ka] (SEQ ID NO: 2302). Structure 7. Compound number 1373023
[0282] In certain embodiments, the sodium salt of Compound No. 1373023 is represented by the following chemical structure: [ka] (SEQ ID NO: 2302). Structure 8. Sodium salt of compound number 1373023
[0283] 5. Compound No. 1373057 In certain embodiments, compound number 1373057 is characterized as a 5-9-5 MOE gapmer having a sequence of (5' to 3' order) GTCATAATTTTCTTAGCTA (SEQ ID NO: 2750), wherein each of nucleosides 1-5 and 15-19 (5' to 3' order) is a 2'-MOE nucleoside, each of nucleosides 6-14 is a 2'-β-D-deoxynucleoside, and nucleosides The internucleoside linkages between nucleosides 2-3, 3-4, 4-5, 5-6, 16-17, and 17-18 are phosphodiester internucleoside linkages, and the internucleoside linkages between nucleosides 1-2, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, and 18-19 are phosphorothioate internucleoside linkages, in which each cytosine is a 5-methylcytosine.
[0284] In certain embodiments, compound number 1373057 has the following chemical designation (5' to 3'): Ges Teo m Ceo Aeo Teo Ads Ads Tds Tds Tds Tds m Cds Tds Tds Aes Geo m CEO Tes Ae (SEQ ID NO: 2750), where: A = adenine nucleobase m C=5-methylcytosine nucleobase G = guanine nucleobase T=thymine nucleobase e=2'-MOE modified sugar d = 2'-β-D deoxyribosyl sugar s = phosphorothioate internucleoside linkage o = phosphodiester internucleoside linkage.
[0285] In certain embodiments, compound number 1373057 is represented by the following chemical structure: [ka] (SEQ ID NO: 2750). Structure 9. Compound number 1373057
[0286] In certain embodiments, the sodium salt of Compound No. 1373057 is represented by the following chemical structure: [ka] (SEQ ID NO: 2750). Structure 10. Sodium salt of compound number 1373057
[0287] 6. Compound No. 1411016 In certain embodiments, compound number 1411016 is characterized as a 5-10-5 MOE gapmer having the sequence (in 5' to 3' order) ACGTCCATTTTCTGTGCTTT (SEQ ID NO: 2739), wherein each of nucleosides 1-5 and 16-19 (in 5' to 3' order) is a 2'-MOE nucleoside and each of nucleosides 6-15 is a 2'-β-D-deoxynucleoside. The internucleoside bonds between nucleosides 2-3, 3-4, 4-5, 16-17, and 17-18 are phosphodiester internucleoside bonds, and the internucleoside bonds between nucleosides 1-2, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate internucleoside bonds. where each cytosine is a 5-methylcytosine.
[0288] In certain embodiments, compound number 1411016 has the following chemical designation (5'→3'): Aes m CEO Geo Teo m Ces m Cds Ads Tds Tds Tds Tds m Cds Tds Gds Tds Geo m Ceo Tes Tes Te (SEQ ID NO: 2739), where: A = adenine nucleobase m C=5-methylcytosine nucleobase G = guanine nucleobase T=thymine nucleobase e=2'-MOE modified sugar d = 2'-β-D deoxyribosyl sugar s = phosphorothioate internucleoside linkage o = phosphodiester internucleoside linkage.
[0289] In certain embodiments, compound number 1411016 is represented by the following chemical structure: [ka] (SEQ ID NO: 2739). Structure 11. Compound number 1411016
[0290] In certain embodiments, the sodium salt of compound number 1411016 is represented by the following chemical structure: [ka] (SEQ ID NO: 2739). Structure 12. Sodium salt of compound number 1411016
[0291] VIII. Certain Comparative Compositions In certain embodiments, Compound No. 169746, a 5-10-5 MOE gapmer having the sequence (5' to 3' order) GTTATACTTTTACTGGCCTG (SEQ ID NO: 291), wherein each internucleoside linkage is a phosphorothioate internucleoside linkage, each cytosine is a 5-methylcytosine, and wherein nucleosides 1-5 and 16-20 each contain a 2'-MOE modified sugar as previously described in WO2010 / 019270 (hereby incorporated by reference), is a comparative compound.
[0292] In certain embodiments, Compound No. 169750, a 5-10-5 MOE gapmer having a sequence of (5'→3')TGCATATTTCAAAGACCTGT (SEQ ID NO: 11), wherein each internucleoside linkage is a phosphorothioate internucleoside linkage, each cytosine is a 5-methylcytosine, and wherein nucleosides 1-5 and 16-20 each contain a 2'-MOE modified sugar as previously described in WO2010 / 019270 (hereby incorporated by reference), is a comparative compound.
[0293] In certain embodiments, Compound No. 169753, a 5-10-5 gapmer having a sequence of (5'→3')GCCACATATAGGGTCCTTTA (SEQ ID NO: 66), wherein each internucleoside linkage is a phosphorothioate internucleoside linkage, each cytosine is a 5-methylcytosine, and wherein nucleosides 1-5 and 16-20 each contain a 2'-MOE modified sugar as previously described in WO2010 / 019270 (hereby incorporated by reference), is a comparative compound.
[0294] In certain embodiments, Compound No. 169764, a 5-10-5 MOE gapmer having the sequence (5' to 3' order) AGGGTCCTTTAAACATCTAA (SEQ ID NO: 450), wherein each internucleoside linkage is a phosphorothioate internucleoside linkage, each cytosine is a 5-methylcytosine, and wherein nucleosides 1-5 and 16-20 each contain a 2'-MOE modified sugar as previously described in WO2010 / 019270 (hereby incorporated by reference), is a comparative compound.
[0295] Compound numbers 169746, 169750, 169753, and 169764 were selected as comparative compounds because they achieved greater than 90% inhibition of PRNP RNA in human cell lines according to WO2010 / 019270.
[0296] In certain embodiments, the compounds described herein are superior to the compounds described in WO2010 / 019270 because they exhibit improved one or more properties (e.g., in vivo efficacy and tolerability).
[0297] For example, as described herein, certain compounds, Compound No. 1238994, Compound No. 1373021, Compound No. 1373022, Compound No. 1373023, Compound No. 1373057, and Compound No. 1411016, are more effective in vivo than comparator compounds. For example, as shown in Example 5, Compound No. 1238994, Compound No. 1373021, Compound No. 1373022, Compound No. 1373023, Compound No. 1373057, and Compound No. 1411016 achieve average expression levels (% of control) in the spinal cord of transgenic mice of 27% (Tables 65 and 75), 25% (Tables 66 and 75), 30% (Tables 66 and 75), 18% (Tables 66 and 75), 25% (Tables 66 and 75), and 24% (Tables 71 and 72), respectively, while comparator compounds Compound No. 169746, Compound No. 169750, and Compound No. 169764 achieve average expression levels (% of control) in the spinal cord of transgenic mice of 52% (Table 62), 61% (Table 62), and 61% (Table 62), respectively. Thus, certain compounds described herein are more effective in this assay than the comparative compounds Compound No. 169746, Compound No. 169750, and Compound No. 169764.
[0298] For example, as shown in Example 5, Compound No. 1238994, Compound No. 1373021, Compound No. 1373022, Compound No. 1373023, Compound No. 1373057, and Compound No. 1411016 achieve average expression levels (% of control) in the cortex of transgenic mice of 44% (Tables 65 and 75), 33% (Tables 66 and 75), 35% (Tables 66 and 75), 28% (Tables 66 and 75), 52% (Tables 66 and 75), and 36% (Tables 71 and 72), respectively, while the comparator compounds Compound No. 169746, Compound No. 169750, and Compound No. 169764 achieve average expression levels (% of control) in the cortex of transgenic mice of 67% (Table 62), 73% (Table 62), and 77% (Table 62), respectively. Thus, certain compounds described herein are more effective in this assay than the comparative compounds Compound No. 169746, Compound No. 169750, and Compound No. 169764.
[0299] For example, as described herein, certain compounds, Compound No. 1238994, Compound No. 1373021, Compound No. 1373022, Compound No. 1373023, Compound No. 1373057, and Compound No. 1411016, achieved mean 3-hour FOB scores in mice at a dose of 700 μg of 0 (Table 83), 2.5 (Table 84), 1.8 (Table 84), 0 (Table 84), 0 (Table 85), and 1.8 (Table 94), respectively. Compound No. 169753 achieved a 3-hour FOB score of 4.2 in mice (Table 83). Thus, Compound No. 1238994, Compound No. 1373021, Compound No. 1373022, Compound No. 1373023, Compound No. 1373057, and Compound No. 1411016 described herein are better tolerated in this assay than the comparative compound, Compound No. 169753.
[0300] For example, as described herein, certain compounds, Compound No. 1238994, Compound No. 1373021, Compound No. 1373022, Compound No. 1373023, Compound No. 1373057, and Compound No. 1411016, achieved mean 3-hour FOB scores in rats at a 3 mg dose of 1.0 (Table 107), 3.0 (Table 97), 1.5 (Table 97), 1.3 (Table 97), 0.8 (Table 98), and 3.3 (Table 108), respectively. Compound No. 169753 achieved a 3-hour FOB score of 5.5 in rats. (Table 106). Thus, Compound No. 1238994, Compound No. 1373021, Compound No. 1373022, Compound No. 1373023, Compound No. 1373057, and Compound No. 1411016 described herein are better tolerated in this assay than the comparator compound, Compound No. 169753.
[0301] For example, as described herein, certain compounds, Compound No. 1238994, Compound No. 1373021, Compound No. 1373022, Compound No. 1373023, Compound No. 1373057, and Compound No. 1411016, were better tolerated in long-term rat studies than the comparative compound, Compound No. 169753. For example, as shown in Example 8, Compound No. 1238994, Compound No. 1373021, Compound No. 1373022, Compound No. 1373023, Compound No. 1373057, and Compound No. 1411016 did not experience any adverse events during the study period. In contrast, rats treated with Compound No. 169753 experienced adverse events by the fifth week of treatment. Thus, certain compounds described herein are better tolerated in this assay than the comparative compound, Compound No. 169753.
[0302] IX. Certain hotspot areas 1. Nucleic acid bases 5635 to 5677 of SEQ ID NO: 2 In certain embodiments, nucleobases 5635-5677 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary within nucleobases 5635-5677 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 16 nucleobases in length. In certain embodiments, the modified oligonucleotide is 17 nucleobases in length. In certain embodiments, the modified oligonucleotide is 19 nucleobases in length. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the modified oligonucleotide is a 5-10-5, 6-10-4, 4-10-6, 5-9-5, 4-8-5, or 4-8-4 gapmer. In certain embodiments, the gapmer is an MOE gapmer. In certain embodiments, the gapmer is a mixed-wing gapmer. In certain embodiments, a mixed wing gapmer has, in 5' to 3' order, the sugar motifs: eeeeeeddddddddddkkeee, eeeeeeddddddddddkkee, eeeeedddddddddkkeee, eeeeddddddddkkeee, or eeeeddddddddkkee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety, "k" represents a cEt sugar moiety, and "e" represents a 2'-MOE sugar moiety. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are in the following configuration in 5'→3' order: sooossssssssssoooss, soooossssssssssssoos, soooooosssssssssss, sooooossssssssss, sooosssssssssoos, or sooossssssssssoos.
[0303] The nucleobase sequences of SEQ ID NOs: 530, 607, 684, 761, 838, 915, 1914, 1992, 2069, 2146, 2237, 2301, 2302, 2536, 2640, 2750, 2759, 2760, 2764, 2788-2793, and 2803-2806 are complementary to nucleobases 5635-5677 of SEQ ID NO: 2.
[0304] Compounds 1238994, 1238995, 1238996, 1238997, 1238998, 1238999, 1239000, 1239001, 1239002, 1239 003, 1270398, 1270399, 1270400, 1270564, 1270668, 1373021, 1373023, 1373032, 1373034, 1373050, 1373057, 1373063, 1373065, 1418398 to 1418403, 1418418 to 1418420, 1418423, and 1418425 are complementary within nucleobases 5635 to 5677 of SEQ ID NO:2.
[0305] In certain embodiments, modified oligonucleotides complementary within nucleobases 5635-5677 of SEQ ID NO:2 achieve at least a 36% reduction in PRNP RNA in a standard in vitro cell assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 5635-5677 of SEQ ID NO:2 achieve an average of a 79% reduction in PRNP RNA in a standard in vitro cell assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 5635-5677 of SEQ ID NO:2 achieve an average of a 44% reduction in PRNP RNA in the cortex in a standard in vivo assay.
[0306] 2. Nucleic acid bases 5791 to 5826 of SEQ ID NO: 2 In certain embodiments, nucleobases 5791-5826 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary within nucleobases 5791-5826 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 16 nucleobases in length. In certain embodiments, the modified oligonucleotide is 17 nucleobases in length. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 19 nucleobases in length. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the modified oligonucleotide is a 5-10-5, 6-10-4, 4-10-6, 3-10-7, 7-10-3, or 4-8-5 gapmer. In certain embodiments, the gapmer is an MOE gapmer. In certain embodiments, the gapmer is a mixed-wing gapmer. In certain embodiments, a mixed-wing gapmer has, in 5'→3' order, the sugar motif eeeeeddddddddddkkeee or eeeeddddddddkkeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety, "k" represents a cEt sugar moiety, and "e" represents a 2'-MOE sugar moiety. In certain embodiments, the gapmer comprises a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at the 2-position (5'→3' order) of the gap. In certain embodiments, gapmers have, in 5' to 3' order, the sugar motif eeeeedyddddddddeeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety, "k" represents a cEt sugar moiety, "e" represents a 2'-MOE sugar moiety, and "y" represents a 2'-OMe sugar moiety. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate and phosphodiester internucleoside linkages.In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are in the following configuration in 5'→3' order: soosssssssssssooooss, soooosssssssssssoooss, soooosssssssssssss, soooooosssssssssss, ssooooossssssssssos, or sooosssssssssss. The nucleobase sequences of SEQ ID NOs: 1225, 1302, 1379, 1456, 2240, 2307, 2308, 2383, 2471, 2537, 2568, 2647, 2736-2739, 2744, and 2798-2801 are complementary within nucleobases 5791-5826 of SEQ ID NO: 2.
[0307] Compounds 1239051, 1239052, 1239053, 1239054, 1270415, 1270416, 1270417, 1270418, 1270419, 1270565, 1270596, 1355720, 1411004-1411007, 1411013-1411016, 1418412-1418415, 1418426, 1423120-1423123, and 1423126 are complementary within nucleobases 5791-5826 of SEQ ID NO:2.
[0308] In certain embodiments, modified oligonucleotides complementary within nucleobases 5791-5826 of SEQ ID NO:2 achieve at least a 55% reduction in PRNP RNA in a standard in vitro cell assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 5791-5826 of SEQ ID NO:2 achieve an average of a 77% reduction in PRNP RNA in a standard in vitro cell assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 5791-5826 of SEQ ID NO:2 achieve an average of a 52% reduction in PRNP RNA in the cortex in a standard in vivo assay.
[0309] 3. Nucleic acid bases 14366 to 14410 of SEQ ID NO: 2 In certain embodiments, nucleobases 14366-14410 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary within nucleobases 14366-14410 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 17 nucleobases in length. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 19 nucleobases in length. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the modified oligonucleotide is a 5-10-5, 6-10-4, 4-10-6, 5-9-5, or 4-8-5 gapmer. In certain embodiments, the gapmer is an MOE gapmer. In certain embodiments, the gapmer is a mixed-wing gapmer. In certain embodiments, a mixed wing gapmer has, in 5' to 3' order, the sugar motif: eeeeeddddddddddkkeee, eeeeeeddddddddddkkee, or eeeeddddddddkkeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety, "k" represents a cEt sugar moiety, and "e" represents a 2'-MOE sugar moiety. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are in the following configuration in 5'→3' order: soosssssssssssooooss, soooosssssssssssoooss, soooossssssssssssoos, sooooossssssssssoos, sooooosssssssssoos, sooosssssssssooss, sooossssssssssoos.
[0310] The nucleobase sequences of SEQ ID NOs: 555, 632, 709, 786, 863, 940, 1017, 1862, 1939, 2017, 2094, 2171, 2257, 2334, 2407, 2408, 2488, 2508, 2543, 2612, 2659, 2677, 2757, 2766, and 2794-2797 are complementary within nucleobases 14366-14410 of SEQ ID NO: 2.
[0311] Compounds 1239543, 1239544, 1239545, 1239546, 1239547, 1239548, 1239549, 1239550, 1239551, 1239552, 1239553, 1239554, 1270516, 1270517, 1270 518, 1270519, 1270520, 1270521, 1270571, 1270640, 1355714, 1355734, 1373022, 1373031, 1373051, 1373061, 1418404 to 1418407, 1418421, and 1418424 are complementary within nucleobases 14366 to 14410 of SEQ ID NO:2.
[0312] In certain embodiments, modified oligonucleotides complementary within nucleobases 14366-14410 of SEQ ID NO:2 achieve at least a 44% reduction in PRNP RNA in a standard cell assay in vitro. A 62% average reduction in PRNP RNA is achieved in standard cell assays in vitro. In certain embodiments, modified oligonucleotides complementary within nucleobases 14366-14410 of SEQ ID NO: 2 achieve a 39% average reduction in PRNP RNA in the cortex in standard assays in vivo.
[0313] 4. Additional Hotspot Areas In certain embodiments, the ranges set forth in the table below include hotspot regions. Each hotspot region begins at a nucleobase of SEQ ID NO: 1 identified in the "Start Site of SEQ ID NO: 1" column and ends at a nucleobase of SEQ ID NO: 1 identified in the "Stop Site of SEQ ID NO: 1" column, and / or begins at a nucleobase of SEQ ID NO: 2 identified in the "Start Site of SEQ ID NO: 2" column and ends at a nucleobase of SEQ ID NO: 2 identified in the "Stop Site of SEQ ID NO: 2" column. In certain embodiments, modified oligonucleotides are complementary within any of hotspot regions 1-21, as defined in the table below. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are 17 nucleobases in length. In certain embodiments, modified oligonucleotides are 18 nucleobases in length. In certain embodiments, modified oligonucleotides are 19 nucleobases in length. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the modified oligonucleotide is a 5-10-5, 6-10-4, 4-10-6, 3-10-7, 7-10-3, 5-9-5, 5-8-5, 4-8-4, or 5-8-4 gapmer. In certain embodiments, the gapmer is an MOE gapmer. In certain embodiments, the gapmer is a mixed-wing gapmer. In certain embodiments, the mixed-wing gapmer has, in 5'→3' order, the sugar motifs eeeeeddddddddddkkeee, eeeeeeddddddddddkkee, eeeeedddddddddkkeee, eeeeddddddddddkkeee, or eeeeddddddddkkee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety, "k" represents a cEt sugar moiety, and "e" represents a 2'-MOE sugar moiety. In certain embodiments, the gapmer contains a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety.In certain embodiments, the 2'-substituted nucleoside is at the 2-position of the gap (5' to 3' order). In certain embodiments, a gapmer has, in 5' to 3' order, the sugar motifs eeeeedyddddddddeeeee or eeeeedyddddddeeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety, "k" represents a cEt sugar moiety, "e" represents a 2'-MOE sugar moiety, and "y" represents a 2'-OMe sugar moiety. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are, in 5'→3' order: sooosssssssssssooooss, soooosssssssssssoooss, soooossssssssssssooss, soooooosssssssssss. , ssooooosssssssssos, sooooossssssssssoos, sooooossssssssssoos, sooossssssssssooss, sooossssssssssooss, soooossssssssssooss, or sooossssssssssoos.
[0314] The nucleobase sequences of the compounds listed in the "Compound Number in Range" column of the table below are complementary to SEQ ID NO: 1 and / or SEQ ID NO: 2 within the designated hotspot region. The nucleobase sequences of the oligonucleotides listed in the "SEQ ID NO: in Range" column of the table below are complementary to the target sequences SEQ ID NO: 1 and / or SEQ ID NO: 2 within the specified hotspot region.
[0315] In certain embodiments, modified oligonucleotides complementary to nucleobases within the hotspot regions achieve at least a "minimum % in vitro reduction" (minimum % reduction relative to untreated control cells) in PRNP RNA in a standard in vitro cell assay, as shown in the table below. In certain embodiments, modified oligonucleotides complementary to nucleobases within the hotspot regions achieve at least a "minimum % reduction in in vitro" (minimum % reduction relative to untreated control cells) in PRNP RNA in a standard in vitro cell assay, as shown in the table below. Achieve an average "in vitro mean % reduction" (mean % reduction relative to untreated control cells) in PRNP RNA in standard in vitro cell assays. In certain embodiments, modified oligonucleotides complementary to nucleobases within the hotspot regions achieve a maximum "in vitro maximum % reduction" (maximum % reduction relative to untreated control cells) in PRNP RNA in standard in vitro cell assays, as shown in the table below. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4]
[0316] Non-limiting disclosure and incorporation by reference Each literature and patent publication cited within this specification is incorporated by reference in its entirety.
[0317] While certain compounds, compositions, and methods described herein have been described with specificity according to certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit such compounds. Each reference, GenBank accession number, etc. cited within this application is incorporated herein by reference in its entirety.
[0318] Although the sequence listing accompanying this application identifies each sequence as either "RNA" or "DNA" as appropriate, in reality these sequences may be used in any combination of chemical modifications. Modifications may be made. Those skilled in the art will readily understand that the use of terms such as "RNA" or "DNA" to describe modified oligonucleotides is arbitrary in certain cases. For example, an oligonucleotide containing a nucleoside containing a 2'-OH sugar moiety and a thymine base may be described as a DNA with a modified sugar (a 2'-OH instead of a single 2'-H in DNA) or as an RNA with a modified base (thymine (methylated uracil) instead of the uracil in RNA). Thus, the nucleic acid sequences provided herein (including, but not limited to, those in the sequence listing) are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA (including, but not limited to, such nucleic acids with modified nucleobases). By way of further example, and without limitation, an oligomeric compound having the nucleobase sequence "ATCGATCG" includes any oligomeric compound having such a nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds containing RNA bases, e.g., compounds having the sequence "AUCGAUCG," as well as compounds having some DNA bases and some RNA bases (e.g., "AUCGATCG"), as well as other modified nucleobases (e.g., "AT m CGAUCG" ( m C represents a cytosine base containing a methyl group at the 5-position. and oligomeric compounds having the formula:
[0319] Certain compounds (e.g., modified oligonucleotides) described herein possess one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that can be defined in terms of absolute stereochemistry as (R) or (S), α or β, e.g., with respect to sugar anomers, or (D) or (L), e.g., with respect to amino acids. Compounds provided herein depicted or described as having a particular stereoisomeric configuration include only the depicted compound. Compounds depicted herein that are depicted or described without a defined stereochemistry include all such possible isomers, including stereorandom and optically pure forms thereof, unless otherwise specified. Similarly, tautomeric forms of the compounds herein are included unless otherwise indicated. Unless otherwise indicated, compounds described herein are intended to include corresponding salt forms.
[0320] The compounds described herein include variations in which one or more atoms are replaced with non-radioactive or radioactive isotopes of the indicated elements. For example, compounds herein containing hydrogen atoms include: 1 Isotopic substitutions encompassed by the compounds herein include, but are not limited to, all possible deuterium substitutions for each H hydrogen atom. 1 Instead of H 2 H or 3 H, 12 Instead of C 13 C or 14 C. 14 Instead of N 15 N, 16 Instead of O 17 O or 18 O, and 32 Instead of S 33 S, 34 S, 35 S, or 36In certain embodiments, non-radioactive isotope substitution can impart new properties to the oligomeric compound that are beneficial for use as a therapeutic or research tool. In certain embodiments, radioactive isotope substitution can make the compound suitable for research or diagnostic purposes (e.g., imaging). [Example]
[0321] The following examples illustrate certain specific embodiments of the present disclosure, but are not limiting.Furthermore, when specific embodiments are presented, the inventors intend the general application of these specific embodiments.For example, the disclosure of an oligonucleotide having a specific motif provides rational support for other oligonucleotides having this motif or a similar motif.And, for example, when a specific high-affinity modification appears at a specific position, other high-affinity modifications at the same position are also considered suitable unless otherwise indicated.
[0322] Example Example 1: Effect of modified oligonucleotides on human PRNP RNA in vitro (single dose) Modified oligonucleotides complementary to human PRNP nucleic acid were synthesized and tested for their effect on PRNP RNA levels in vitro.
[0323] The modified oligonucleotides in the table below are 5-10-5 MOE gapmers with mixed internucleoside linkages. Gapmers are 20 nucleosides in length, with a central gap segment consisting of 10 2'-β-D-deoxynucleosides and 3' and 5' wings each consisting of five 2'-MOE-modified nucleosides. The sugar motif of the gapmer (5' to 3' order) is eeeeeddddddddddeeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar and "e" represents a 2'-MOE-modified ribosyl sugar. The internucleoside linkage motif of the gapmer (5' to 3' order) is sooosssssssssssooss, where "o" represents a phosphodiester internucleoside linkage and "s" represents a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methylcytosine.
[0324] "Start site" indicates the 5'-most nucleoside to which the gapmer is complementary within the human gene sequence. "Stop site" indicates the 3'-most nucleoside to which the gapmer is complementary within the human gene sequence. Most of the modified oligonucleotides listed in the table below are complementary to the human PRNP mRNA sequence designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM_000311.4) and / or the human PRNP genomic sequence designated herein as SEQ ID NO: 2 (GENBANK Accession No. NC_000020.11 (truncated from nucleotides 4683001-4705000)). In addition, one particular modified oligonucleotide is complementary to the human PRNP mRNA designated herein as SEQ ID NO: 3 (GENBANK Accession No. NM_001080123.2). "N / A" indicates that the modified oligonucleotide is not 100% complementary to that particular gene sequence.
[0325] Cultured A-431 cells at a density of 20,000 cells per well were treated with 4,000 nM of modified oligonucleotides by free uptake. After approximately 48 hours of treatment, total RNA was isolated from the cells and PRNP RNA levels were measured by quantitative real-time RT-PCR. RNA levels were measured using the human PRNP primer probe set RTS42354 (forward sequence CCTCTCCTCACGACCGA (referred to herein as SEQ ID NO: 21); reverse sequence CCCAGTGTTCCATCCTCCA (referred to herein as SEQ ID NO: 22); probe sequence CCACAAAGAGAACCAGCATCCAGCA (referred to herein as SEQ ID NO: 23)). In addition, mRNA levels modulated by the modified oligonucleotides described in Tables 12 and 13 herein were measured using an additional human PRNP primer probe set, RTS42359 (forward sequence AGTGGAACAAGCCGAGTAAG (referred to herein as SEQ ID NO: 24); reverse sequence CCTCATAGTCACTGCCGAAAT (referred to herein as SEQ ID NO: 25); probe sequence AACCAACATGAAGCACATGGCTGG (referred to herein as SEQ ID NO: 26). PRNP RNA levels were normalized using RIBOGREEN®. The results are shown in the table below. Results are normalized to PRNP RNA levels in untreated control cells (UTC). Values marked with an asterisk (*) were obtained from oligonucleotides complementary to the amplicon region of the primer probe set. Additional assays can be used to measure the potency and effectiveness of modified oligonucleotides complementary to the amplicon region. [Table 2-1] [Table 2-2] [Table 2-3] [Table 3-1] [Table 3-2] [Table 3-3] [Table 4-1] [Table 4-2] [Table 4-3] [Table 5-1] [Table 5-2] [Table 5-3] [Table 6-1] [Table 6-2] [Table 6-3] [Table 7-1] [Table 7-2] Table 8 PRNP RNA reduction [Table 8-1] [Table 8-2] Table 9 PRNP RNA reduction [Table 9-1] [Table 9-2] Table 10 PRNP RNA reduction [Table 10-1] [Table 10-2] Table 11 PRNP RNA reduction [Table 11-1] [Table 11-2] Table 12 PRNP RNA reduction [Table 12-1] [Table 12-2] Table 13 PRNP RNA reduction [Table 13-1] [Table 13-2] Table 14 PRNP RNA reduction [Table 14-1] [Table 14-2] Table 15 PRNP RNA reduction [Table 15-1] [Table 15-2] Table 16 PRNP RNA reduction [Table 16-1] [Table 16-2] Table 17 PRNP RNA reduction [Table 17-1] [Table 17-2] Table 18 PRNP RNA reduction [Table 18-1] [Table 18-2] Table 19 PRNP RNA reduction [Table 19-1] [Table 19-2] Table 20 PRNP RNA reduction [Table 20-1] [Table 20-2] Table 21 PRNP RNA reduction [Table 21-1] [Table 21-2] Table 22 PRNP RNA reduction [Table 22-1] [Table 22-2] Table 23 PRNP RNA reduction [Table 23-1] [Table 23-2] Table 24 PRNP RNA reduction [Table 24-1] [Table 24-2] Table 25 PRNP RNA reduction [Table 25-1] [Table 25-2] Table 26 PRNP RNA reduction [Table 26-1] [Table 26-2] Table 27 PRNP RNA reduction [Table 27-1] [Table 27-2] Table 28 PRNP RNA reduction [Table 28-1] [Table 28-2] Table 29 PRNP RNA reduction [Table 29-1] [Table 29-2] [Table 30]
[0326] Example 2: Effect of 5-10-5 MOE gapmers with mixed internucleoside linkages on human PRNP RNA in vitro (single dose) Modified oligonucleotides complementary to human PRNP nucleic acid were synthesized and tested for their effect on PRNP RNA levels in vitro.
[0327] The modified oligonucleotides in the table below are 5-10-5 MOE gapmers with mixed internucleoside linkages. Gapmers are 20 nucleosides in length, with a central gap segment consisting of 10 2'-β-D-deoxynucleosides and 3' and 5' wings each consisting of five 2'-MOE-modified nucleosides. The sugar motif of the gapmer (5' to 3' order) is eeeeeddddddddddeeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar and "e" represents a 2'-MOE-modified ribosyl sugar. The internucleoside linkage motif of the gapmer (5' to 3' order) is sooosssssssssssooss, where "o" represents a phosphodiester internucleoside linkage and "s" represents a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methylcytosine.
[0328] "Start site" indicates the 5'-most nucleoside to which the gapmer is complementary in the human sequence. "Stop site" indicates the 3'-most nucleoside to which the gapmer is complementary in the human sequence. Each modified oligonucleotide listed in the table below is complementary to the human PRNP nucleic acid sequence SEQ ID NO: 1 or SEQ ID NO: 2, as indicated. "N / A" indicates that the modified oligonucleotide is not 100% complementary to that particular nucleic acid. As shown below, modified oligonucleotides complementary to the nucleobase sequence of human PRNP reduced the amount of human PRNP RNA.
[0329] Cultured A-431 cells at a density of 20,000 cells per well were treated with 4,000 nM of modified oligonucleotides by free uptake. After a treatment period of approximately 48 hours, total RNA was isolated from the cells, and PRNP RNA levels were measured by quantitative real-time RT PCR using primer probe set RTS42354, as described in Example 1. PRNP RNA levels were normalized using RIBOGREEN®. The results are shown in the table below. Results were normalized to PRNP RNA levels in untreated control cells (UTC). Values marked with an asterisk (*) were obtained from oligonucleotides complementary to the amplicon region of the primer probe set. Additional assays can be used to measure the potency and effectiveness of modified oligonucleotides complementary to the amplicon region. [Table 31-1] [Table 31-2] [Table 32-1] [Table 32-2] [Table 32-3] [Table 33-1] [Table 33-2] [Table 33-3] [Table 34-1] [Table 34-2] [Table 34-3] [Table 35-1] [Table 35-2] [Table 35-3] [Table 36-1] [Table 36-2] [Table 36-3]
[0330] Example 3: Effect of modified oligonucleotides on human PRNP RNA in vitro (multiple doses) Selected modified oligonucleotides from the above examples were tested at various doses in A-431 cells. Cells were plated at a density of 10,000 cells per well and treated with various doses of modified oligonucleotides by free uptake, as specified in the table below. After a treatment period of approximately 48 hours, total RNA was isolated from the cells, and PRNP RNA levels were measured by quantitative real-time PCR using primer probe set RTS42354, as described in Example 1. PRNP RNA levels were normalized to RIBOGREEN®. Results are shown in the table below as percent PRNP RNA relative to untreated control cells (UTC). The half maximal inhibitory concentration (IC) of each modified oligonucleotide was 0.01. 50 ) is also shown. IC 50 was calculated using linear regression on a log / linear plot of the data in Excel. Modified oligonucleotides marked with an asterisk (*) are complementary to the amplicon region of the primer-probe set. Additional assays can be used to measure the potency and effectiveness of modified oligonucleotides complementary to the amplicon region. [Table 37] [Table 38] [Table 39] [Table 40] [Table 41] [Table 42] [Table 43] [Table 44]
[0331] Example 4: Design and synthesis of MOE gapmer-modified oligonucleotides complementary to human PRNP nucleic acid Modified oligonucleotides complementary to human PRNP nucleic acid were designed and synthesized.
[0332] "Start site" indicates the 5'-most nucleoside to which the gapmer is complementary within the human gene sequence. "Stop site" indicates the 3'-most nucleoside to which the gapmer is complementary within the human gene sequence. Most of the modified oligonucleotides listed in the table below are complementary to the human PRNP mRNA sequence designated herein as SEQ ID NO: 1 (described hereinabove) and / or the human PRNP genomic sequence designated herein as SEQ ID NO: 2 (described hereinabove). In addition, one particular modified oligonucleotide is complementary to the human PRNP mRNA designated herein as SEQ ID NO: 4 (EMSEMBL Accession No.: ENST00000424424.1). "N / A" indicates that the modified oligonucleotide is not 100% complementary to that particular gene sequence.
[0333] The modified oligonucleotides in the table below are 3-10-7 MOE gapmers with mixed PO / PS internucleoside linkages. Gapmers are 20 nucleosides in length, with a central gap segment of 10 2'-β-D-deoxynucleosides, a 5' wing segment of three 2'-MOE nucleosides, and a 3' wing segment of seven 2'-MOE nucleosides. The sugar motif of the gapmer (5' to 3' order) is eeeddddddddddeeeeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar and "e" represents a 2'-MOE-modified ribosyl sugar. Gapmers have an internucleoside linkage motif of (5'→3' order) soosssssssssssooooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine nucleoside is a 5-methylcytosine. [Table 45]
[0334] The modified oligonucleotides in the table below are 4-10-6 MOE gapmers with mixed PO / PS internucleoside linkages. Gapmers are 20 nucleosides in length, with a central gap segment of 10 2'-β-D-deoxynucleosides, a 5' wing segment of four 2'-MOE nucleosides, and a 3' wing segment of six 2'-MOE nucleosides. The sugar motif of the gapmer is (5'→3' order) eeeeddddddddddeeeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar and "e" represents a 2'-MOE-modified ribosyl sugar. Gapmers have an internucleoside linkage motif of (5'→3' order) soooossssssssssoooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine nucleoside is a 5-methylcytosine. [Table 46]
[0335] The modified oligonucleotides in Tables 47 and 48 below are 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages. Gapmers are 20 nucleosides in length, with a central gap segment of 10 2'-β-D-deoxynucleosides, a 5' wing segment of five 2'-MOE nucleosides, and a 3' wing segment of five 2'-MOE nucleosides. The sugar motif of the gapmer (5' to 3' order) is eeeeeddddddddddeeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar and "e" represents a 2'-MOE-modified ribosyl sugar. Gapmers have an internucleoside linkage motif of (5'→3' order) soooosssssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine nucleoside is a 5-methylcytosine. [Table 47-1] [Table 47-2] [Table 47-3] [Table 48]
[0336] The modified oligonucleotides in the table below are 6-10-4 MOE gapmers with mixed PO / PS internucleoside linkages. Gapmers are 20 nucleosides in length, with a central gap segment of 10 2'-β-D-deoxynucleosides, a 5' wing segment of six 2'-MOE nucleosides, and a 3' wing segment of four 2'-MOE nucleosides. The sugar motif of the gapmer (5' to 3' order) is eeeeeeddddddddddeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar and "e" represents a 2'-MOE-modified ribosyl sugar. Gapmers have an internucleoside linkage motif of (5'→3' order) soooooossssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine nucleoside is a 5-methylcytosine. [Table 49]
[0337] The modified oligonucleotides in the table below are 7-10-3MOE gapmers with mixed PO / PS internucleoside linkages. Gapmers are 20 nucleosides in length, with a central gap segment of 10 2'-β-D-deoxynucleosides, a 5' wing segment of seven 2'-MOE nucleosides, and a 3' wing segment of three 2'-MOE nucleosides. The sugar motif of the gapmer (5' to 3' order) is eeeeeeeddddddddddeee, where "d" represents a 2'-β-D-deoxyribosyl sugar and "e" represents a 2'-MOE-modified ribosyl sugar. Gapmers have an internucleoside linkage motif of (5'→3' order) ssooooossssssssssos, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine nucleoside is a 5-methylcytosine. [Table 50]
[0338] The modified oligonucleotides in the table below are 5-10-5 MOE gapmers with a 2'-OMe modified nucleoside at position 2 of the gap and mixed PO / PS internucleoside linkages. The gapmer is 20 nucleosides long, with the 5' wing segment consisting of five 2'-MOE nucleosides and the 3' wing segment consisting of five 2'-MOE nucleosides. The gap is 10 nucleosides long, with nucleosides containing 2'-β-D-deoxyribosyl sugar moieties at positions 1, 3, 4, 5, 6, 7, 8, 9, and 10 of the gap (counting from the 5' end) and a 2'-OMe nucleoside at position 2 of the gap (counting from the 5' end). The sugar motif of the mixed modified gapmer is (5'→3' order) eeeeedyddddddddeeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar, "y" represents a 2'-O-methylribosyl sugar, "k" represents a cEt sugar, and "e" represents a 2'-MOE sugar. Gapmers have an internucleoside linkage motif of (5'→3' order) soooosssssssssssooss, where "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage. All cytosine residues are 5-methylcytosines. [Table 51]
[0339] The modified oligonucleotides in the table below are 5-10-5 mixed MOE / cEt gapmers with mixed PO / PS internucleoside linkages. The gapmers are 20 nucleosides in length, with a central gap segment consisting of 10 2'-β-D-deoxynucleosides, a 5' wing segment consisting of five 2'-MOE nucleosides, and a 3' wing segment consisting of two cEt nucleosides and three 2'-MOE nucleosides. The sugar motif of the gapmer is (5'→3' order): eeeeeddddddd. The structure is dddkkeee, where "d" represents a 2'-β-D-deoxyribosyl sugar, "k" represents a cEt sugar, and "e" represents a 2'-MOE-modified ribosyl sugar. Gapmers have an internucleoside linkage motif of (5'→3' order) soooosssssssssssooss, where "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage. All cytosine residues are 5-methylcytosines. [Table 52]
[0340] The modified oligonucleotides in the table below are 6-10-4 mixed MOE / cEt gapmers with mixed PO / PS internucleoside linkages. The gapmers are 20 nucleosides long, with a central gap segment consisting of 10 2'-β-D-deoxynucleosides, a 5' wing segment consisting of six 2'-MOE nucleosides, and a 3' wing segment consisting of two cEt nucleosides and two 2'-MOE nucleosides. The sugar motif of the gapmer is (5'→3' order) eeeeeeddddddddddkkee, where "d" represents a 2'-β-D-deoxyribosyl sugar, "k" represents a cEt sugar, and "e" represents a 2'-MOE-modified ribosyl sugar. Gapmers have an internucleoside linkage motif of (5'→3' order) soooooossssssssssss, where "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage. All cytosine residues are 5-methylcytosines. [Table 53]
[0341] The modified oligonucleotides in the table below are 6-10-4 mixed MOE gapmers with a 2'-OMe modified nucleoside at position 2 of the gap and mixed PO / PS internucleoside linkages. The gapmer is 20 nucleosides long, the 5' wing segment consists of six 2'-MOE nucleosides, and the 3' wing segment consists of four 2'-MOE nucleosides. The gap is 10 nucleosides long, with a 2'-OMe modified nucleoside at position 2 of the gap and mixed PO / PS internucleoside linkages. The gap has nucleosides containing a 2'-β-D-deoxyribosyl sugar moiety at positions 1, 3, 4, 5, 6, 7, 8, 9, and 10 (counting from the 5' end) and a 2'-OMe nucleoside at position 2 (counting from the 5' end) of the gap. The sugar motif of a mixed modified gapmer is (5'→3' order) eeeeeedyddddddddeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar, "y" represents a 2'-O-methylribosyl sugar, "k" represents a cEt sugar, and "e" represents a 2'-MOE sugar. Gapmers have an internucleoside linkage motif of (5'→3' order) soooooossssssssssss, where "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage. All cytosine residues are 5-methylcytosines. [Table 54]
[0342] The modified oligonucleotides in the table below are 5-9-5MOE gapmers with mixed PO / PS internucleoside linkages. Gapmers are 19 nucleosides in length, with a central gap segment of nine 2'-β-D-deoxynucleosides, a 5' wing segment of five 2'-MOE nucleosides, and a 3' wing segment of five 2'-MOE nucleosides. The sugar motif of the gapmer is (5'→3' order) eeeeedddddddddeeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar and "e" represents a 2'-MOE-modified ribosyl sugar. Gapmers have an internucleoside linkage motif of (5'→3' order) sooooossssssssssoos, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine nucleoside is a 5-methylcytosine. [Table 55]
[0343] The modified oligonucleotides in the table below are 5-9-5MOE gapmers with mixed PO / PS internucleoside linkages. Gapmers are 19 nucleosides in length, with a central gap segment of nine 2'-β-D-deoxynucleosides, a 5' wing segment of five 2'-MOE nucleosides, and a 3' wing segment of five 2'-MOE nucleosides. The sugar motif of the gapmer is (5'→3' order) eeeeedddddddddeeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar and "e" represents a 2'-MOE-modified ribosyl sugar. Gapmers have an internucleoside linkage motif of (5'→3' order) sooooosssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine nucleoside is a 5-methylcytosine. [Table 56]
[0344] The modified oligonucleotides in the table below are 5-9-5 mixed MOE / cEt gapmers with mixed PO / PS internucleoside linkages. The gapmers are 19 nucleosides in length, with a central gap segment consisting of nine 2'-β-D-deoxynucleosides, a 5' wing segment consisting of five 2'-MOE nucleosides, and a 3' wing segment consisting of two cEt nucleosides and three 2'-MOE nucleosides. The sugar motif of the gapmer is (5'→3' order) eeeeedddddddddkkeee, where "d" represents a 2'-β-D-deoxyribosyl sugar, "k" represents a cEt sugar, and "e" represents a 2'-MOE-modified ribosyl sugar. Gapmers have an internucleoside linkage motif of (5'→3' order) sooooossssssssssoos, where "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage. All cytosine residues are 5-methylcytosines. [Table 57]
[0345] The modified oligonucleotides in the table below are 5-8-5MOE gapmers with mixed PO / PS internucleoside linkages. Gapmers are 18 nucleosides in length, with a central gap segment of eight 2'-β-D-deoxynucleosides, a 5' wing segment of five 2'-MOE nucleosides, and a 3' wing segment of five 2'-MOE nucleosides. The sugar motif of the gapmer is (5'→3' order) eeeeedddddddddkkeee, where "d" represents a 2'-β-D-deoxyribosyl sugar, and "e" represents a 2'-MOE-modified ribosyl sugar. Gapmers have an internucleoside linkage motif of (5'→3' order) soooosssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine nucleoside is a 5-methylcytosine. [Table 58]
[0346] The modified oligonucleotides in the table below are 5-8-5MOE gapmers with a 2'-OMe modified nucleoside at position 2 of the gap and mixed PO / PS internucleoside linkages. The gapmer is 18 nucleosides long, with the 5' wing segment consisting of five 2'-MOE nucleosides and the 3' wing segment consisting of five 2'-MOE nucleosides. The gap is 8 nucleosides long, with nucleosides containing 2'-β-D-deoxyribosyl sugar moieties at positions 1, 3, 4, 5, 6, 7, and 8 of the gap (counting from the 5' end) and a 2'-OMe nucleoside at position 2 of the gap (counting from the 5' end). The sugar motif of a gapmer is (5'→3' order) eeeeedyddddddeeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar, "y" represents a 2'-O-methylribosyl sugar, and "e" represents a 2'-MOE sugar. Gapmers have an internucleoside linkage motif of (5'→3' order) soooosssssssssooss, where "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage. All cytosine residues are 5-methylcytosines. [Table 59]
[0347] The modified oligonucleotides in the table below are 4-8-5 mixed MOE / cEt gapmers with mixed PO / PS internucleoside linkages. The gapmers are 17 nucleosides in length, with a central gap segment consisting of eight 2'-β-D-deoxynucleosides, a 5' wing segment consisting of four 2'-MOE nucleosides, and a 3' wing segment consisting of two cEt nucleosides and three 2'-MOE nucleosides. The sugar motif of the gapmer (5' to 3' order) is eeeeddddddddkkeee, where "d" represents a 2'-β-D-deoxyribosyl sugar, "k" represents a cEt sugar, and "e" represents a 2'-MOE-modified ribosyl sugar. Gapmers have an internucleoside linkage motif of (5'→3' order) soossssssssssooss, where "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage. All cytosine residues are 5-methylcytosines. [Table 60]
[0348] The modified oligonucleotides in the table below are 4-8-4 mixed MOE / cEt gapmers with mixed PO / PS internucleoside linkages. The gapmers are 17 nucleosides in length, with a central gap segment consisting of eight 2'-β-D-deoxynucleosides, a 5' wing segment consisting of four 2'-MOE nucleosides, and a 3' wing segment consisting of two cEt nucleosides and two 2'-MOE nucleosides. The sugar motif of the gapmer is (5'→3' order) eeeeddddddddkkee, where "d" represents a 2'-β-D-deoxyribosyl sugar, "k" represents a cEt sugar, and "e" represents a 2'-MOE-modified ribosyl sugar. Gapmers have an internucleoside linkage motif of (5'→3' order) soosssssssssoos, where "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage. All cytosine residues are 5-methylcytosines.
Table 61
[0349] Example 5: Activity of Modified Oligonucleotides Complementary to Human PRNP in Transgenic Mice The above-described modified oligonucleotides were tested in a human PRNP knock-in mouse model. Humanization of the PRNP gene was performed via CRISPR / Cas-9-mediated gene editing, which enabled the generation of a model with constitutive expression of the human PRNP gene. The targeting strategy was based on NCBI transcripts NM_011170.3 (mouse) and NM_000311.1 (human). The mouse genomic sequence from exon 1 (5'untranslated region (UTR)) to exon 3 (3'UTR) was replaced with the corresponding human sequence. A plasmid enabling the expression of Cas9 mRNA and specific gRNA, a plasmid containing a puromycin resistance cassette, and a plasmid containing the homologous region of the mouse PRNP gene and the replaced human region were co-transfected into the Taconic Biosciences C57BL / 6N Tac ES cell line. Homologous recombination clones were isolated using positive puromycin selection, and humanized alleles were obtained after Cas9-mediated gene editing. The C57BL / 6NTac-Prnp<em5804_E-D05(PRNP) strain was used in these experiments. Human PRNP RNA expression was observed in the brain and spinal cord.
[0350] Treatment The PRNP knock-in mice were divided into groups of 2 - 3 mice each. Each mouse was administered a single ICV bolus of 300 μg of the above-described modified oligonucleotide. A group of 2 - 4 mice was administered PBS as a negative control within each test. Also, in one test, the comparative compounds 169746, 169750, 169753, and 169764 described above in this specification and in WO2010 / 019270 were also tested.
[0351] RNA Analysis After two weeks of treatment, mice were sacrificed, and RNA was extracted from cortical brain tissue and spinal cord for RTPCR analysis to measure the amount of PRNP RNA using human primer probe set RTS42354 (described herein above) and primer probe set RTS42356 (forward sequence GGTGGTCTCACTCTTTCTTC (referred to herein as SEQ ID NO: 12); reverse sequence CCAGCATCTCAGGTCTACTCTA (referred to herein as SEQ ID NO: 13); probe sequence AATACCCTTGGCACTGATGGGCA (referred to herein as SEQ ID NO: 14)). Results are presented as a percent of human PRNP RNA relative to the PBS control, normalized to mouse cyclophilin A. Each study is represented in a separate table. Cyclophilin A was amplified using primer probe set m_cyclo24 (forward sequence TCGCCGCTTGCTGCA, herein referred to as SEQ ID NO: 18; reverse sequence ATCGGCCGTGATGTCGA, herein referred to as SEQ ID NO: 19; probe sequence CCATGGTCAACCCCACCGTGTTC, herein referred to as SEQ ID NO: 20). In some cases, RTPCR values were Values are not defined for a particular sample and are displayed as ND (not defined). Values marked with an (*) symbol indicate that the modified oligonucleotide is complementary to the amplicon region of the primer-probe set. Additional assays, including testing with a second primer-probe set, can be used to measure the potency and effectiveness of modified oligonucleotides complementary to the amplicon region.
[0352] As shown in the table below, treatment with modified oligonucleotides resulted in a reduction of PRNP RNA compared to the PBS control. [Table 62] [Table 63] [Table 64-1] Table 64-2 Table 65-1 Table 65-2 Table 66-1 Table 66-2 Table 67 Table 68-1 Table 68-2 Table 69-1 Table 69-2 Table 70-1 Table 70-2 Table 71 Table 72 Table 73 Table 74 Table 75
[0353] Example 6: Efficacy of modified oligonucleotides complementary to human PRNP in knock-in mice The above modified oligonucleotides were tested in the human PRNP knock-in mouse model as described above.
[0354] treatment PRNP knock-in mice were divided into groups of 3-4 mice. Each mouse received a single ICV bolus of modified oligonucleotide at the dose indicated in the table below. A group of 4 mice received PBS as a negative control in each study. Each table below represents an independent study.
[0355] RNA analysis After two weeks of treatment, mice were sacrificed, and RNA was extracted from cortical brain tissue, spinal cord, and brainstem for RTPCR analysis to measure PRNP RNA levels using human primer probe set RTS42356 (described hereinabove). In some cases, hippocampal PRNP RNA levels were also examined. Results are presented as a percentage of human PRNP RNA relative to the PBS control, normalized to mouse cyclophilin A. Cyclophilin A was amplified using primer probe set m_cyclo24 (described hereinabove). N / A indicates value not available.
[0356] As shown in the table below, treatment with modified oligonucleotides resulted in a reduction of PRNP RNA compared to the PBS control. [Table 76] [Table 77] [Table 78] [Table 79] [Table 80]
[0357] Example 7: Tolerance of modified oligonucleotides complementary to human PRNP in wild-type mice (3-hour study) The modified oligonucleotides described above were tested in wild-type female C57 / B16 mice to assess the tolerability of the oligonucleotides. One study also tested comparative compound number 169753, described hereinabove and in WO2010 / 019270. Each wild-type female C57 / B16 mouse received a single ICV dose of 700 μg of the modified oligonucleotide listed in the table below. Each treatment group consisted of 2-4 mice. Four mice were treated with 169753. A group of mice received PBS as a negative control in each study (identified in separate tables below). Three hours after injection, mice were evaluated according to seven different criteria. The criteria were: (1) mice were bright, alert, and responsive; (2) mice stood or crouched without stimulation; (3) mice showed any movement without stimulation; (4) mice showed forward movement after being lifted; (5) mice showed any movement after being lifted; (6) mice responded to a pinch by the tail; and (7) regular breathing. For each of the seven criteria, mice were given a subscore of 0 if they met the criterion and a subscore of 1 if they did not (functional observational global score, or FOB). After evaluating all seven criteria, the scores were summed for each mouse, and the summed score for each animal is reported individually. The results are shown in the table below. [Table 81] [Table 82] [Table 83] [Table 84] [Table 85] [Table 86] [Table 87] [Table 88] [Table 89] [Table 90] [Table 91] [Table 92] [Table 93] [Table 94]
[0358] Example 8: Tolerance of modified oligonucleotides complementary to human PRNP in rats at 3 hours post-administration (3 mg dose) The modified oligonucleotides described above were tested in rats to assess their tolerability. Sprague-Dawley rats were each administered a single intrathecal (IT) dose of 3 mg of the oligonucleotide listed in the table below. One study also tested comparative compound No. 169753, described hereinabove and in WO 2010 / 019270. Each treatment group consisted of 2-4 rats. A group of 4 rats was administered PBS as a negative control in each study (represented in separate tables below). Three hours after administration, each rat was assessed for movement in seven different body parts. The seven body parts were: (1) rat tail, (2) rat rear posture, (3) rat hind limbs, (4) rat hind paws, (5) rat front paws, (6) rat forward posture, and (7) rat head. For each of seven different body regions, each rat was given a subscore of 0 if the body region was moving and a subscore of 1 if the body region was paralyzed (functional observational global score, or FOB). After each of the seven body regions was assessed, the subscores were summed for each rat, and then a total score was reported for each individual. For example, if a rat's tail, head, and all other assessed body regions were moving 3 hours after an IT dose of 3 mg, the rat received a total score of 0. If another rat did not move its tail 3 hours after an IT dose of 3 mg, but all other assessed body regions were moving, the rat received a score of 1. [Table 95] [Table 96] [Table 97] [Table 98] [Table 99] [Table 100] [Table 101] [Table 102] [Table 103] [Table 104] [Table 105] [Table 106] [Table 107] [Table 108] [Table 109] [Table 110]
[0359] Example 9: Tolerability of modified oligonucleotides complementary to human PRNP in rats (long-term evaluation) In a separate study conducted under the same conditions, the modified oligonucleotides were tested in Sprague-Dawley rats to assess their long-term tolerability. Also tested was the comparative compound No. 169753, described herein above and in WO 2010 / 019270. Each Sprague-Dawley rat received a single intrathecally (IT) dose of 3 mg of oligonucleotide or PBS. Each animal was weighed and assessed weekly by a trained observer for adverse events. Adverse events were defined as neurological dysfunction not typical of PBS-treated control animals, including, but not limited to, abnormal limb extension, abnormal gait, tremors, respiratory abnormalities, paralysis, and spasticity. The onset of adverse events was defined as the week after dosing when dysfunction was first noted. Adverse events typically correlate with growth failure, as defined by a lack of weight gain / retention similar to that observed in PBS-treated animals. Animals treated with Compound No. 1238994, Compound No. 1373021, Compound No. 1373022, Compound No. 1373023, Compound No. 1373057, and Compound No. 1411016 experienced no adverse events during the study period, whereas each animal treated with comparative Compound No. 169753 experienced one or more adverse events by 5 weeks post-treatment.
[0360] Example 10: Human clinical trials using modified oligonucleotides complementary to human PRNP The safety, tolerability, pharmacokinetics, pharmacodynamics, and efficacy of modified oligonucleotides complementary to human PRNP will be evaluated in a clinical trial setting. Patient safety will be closely monitored throughout the study. Safety and tolerability assessments will include physical examinations, standard neurological assessments, and vital signs. These include signs, electrocardiograms, adverse events and concomitant medications, safety laboratory tests of cerebrospinal fluid, laboratory tests of plasma, and urinalysis. Scope of claims at the time of international application [Section 1] An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleic acid base sequence of the modified oligonucleotide is at least 90% complementary to an equal length portion of a PRNP nucleic acid, and the modified oligonucleotide comprises at least one modification selected from a modified sugar, a sugar surrogate, and a modified internucleoside linkage. [Section 2] An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases of any of SEQ ID NOs: 27-2744. [Section 3] An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, 16, 17, 18, or 19 nucleobases of any of SEQ ID NOs: 2745-2766. [Section 4] An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, 16, 17, or 18 nucleobases of any of SEQ ID NOs: 2767-2780. [Section 5] An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, 16, or 17 nucleobases of any of SEQ ID NOs: 2781-2802. [Section 6] An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, or 16 nucleobases of any of SEQ ID NOs: 2803-2806. [Section 7] 1. Oligomeric compounds, comprising modified oligonucleotides consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising a portion of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases, wherein said portion is one of the following: an isometric portion of nucleobases 5635 to 5677 of SEQ ID NO: 2; an isometric portion of nucleobases 5791 to 5826 of SEQ ID NO: 2; or An isometric portion of nucleic acid bases 14366 to 14410 of SEQ ID NO: 2 The oligomeric compound is complementary to [Section 8] 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 consecutive nucleobases, wherein said nucleobase sequence is selected from the group consisting of: Sequence numbers 530, 607, 684, 761, 838, 915, 1914, 1992, 2069, 2146, 2237, 2301, 2302, 2536, 2640, 2750, 2759, 2760, 2764, 2788-2793; SEQ ID NOs: 1225, 1302, 1379, 1456, 2240, 2307, 2308, 2383, 2471, 2537, 2568, 2647, 2736-2739, 2798-2801; or Sequence numbers 555, 632, 709, 786, 863, 940, 1017, 1862, 1939, 2017, 2094, 2171, 2257, 2334, 2407, 2408, 2488, 2508, 2543, 2612, 2659, 2677, 2757, 2766, 2794 to 2797 The oligomeric compound is selected from: [Section 9] 1. Oligomeric compounds, comprising modified oligonucleotides consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising a portion of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases, wherein said portion is one of the following: an isometric portion of nucleobases 4902 to 4929 of SEQ ID NO: 2; an isometric portion of nucleobases 5000 to 5026 of SEQ ID NO: 2; an isometric portion of nucleobases 5073 to 5100 of SEQ ID NO: 2; an isometric portion of nucleobases 5515 to 5559 of SEQ ID NO: 2; an isometric portion of nucleobases 5595 to 5632 of SEQ ID NO: 2; an isometric portion of nucleobases 5666 to 5690 of SEQ ID NO: 2; an isometric portion of nucleobases 5857 to 5881 of SEQ ID NO: 2; an isometric portion of nucleobases 9352 to 9377 of SEQ ID NO: 2; an isometric portion of nucleobases 11331 to 11358 of SEQ ID NO: 2; an isometric portion of nucleobases 16292 to 16328 of SEQ ID NO: 2; an isometric portion of nucleobases 17120 to 17151 of SEQ ID NO: 2; an isometric portion of nucleobases 17211 to 17241 of SEQ ID NO: 2; an isometric portion of nucleobases 17281 to 17331 of SEQ ID NO: 2; an isometric portion of nucleobases 17410 to 17445 of SEQ ID NO: 2; an isometric portion of nucleobases 17601 to 17641 of SEQ ID NO: 2; an isometric portion of nucleobases 17635 to 17670 of SEQ ID NO: 2; an isometric portion of nucleobases 17663 to 17712 of SEQ ID NO: 2; an isometric portion of nucleobases 17753 to 17781 of SEQ ID NO: 2; or Isometric portion of nucleic acid bases 17985 to 18016 of SEQ ID NO: 2 The oligomeric compound is complementary to [Section 10] 10. The oligomeric compound of claim 1, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, 85%, 90%, 95%, or 100% complementary to the nucleobase sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4, when measured across the entire nucleobase sequence of the modified oligonucleotide. [Section 11] 11. The oligomeric compound according to claim 1, wherein the modified oligonucleotide comprises at least one modified nucleoside. [Section 12] 12. The oligomeric compound of claim 11, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety. [Section 13] 13. The oligomeric compound of claim 12, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety. [Section 14] the modified oligonucleotide comprises at least one bicyclic sugar moiety having a 2'-4' bridge; 14. The oligomeric compound of claim 13, comprising at least one modified nucleoside, wherein the 2'-4' bridge is selected from -O-CH2- and -O-CH(CH3)-. [Section 15] 15. The oligomeric compound of any one of claims 11 to 14, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety. [Section 16] 18. The oligomeric compound of claim 17, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety, including a 2'-MOE or a 2'-OMe modified sugar. [Section 17] 17. The oligomeric compound of any of claims 11 to 16, wherein the modified oligonucleotide comprises at least one modified nucleoside that comprises a sugar surrogate. [Section 18] 16. The oligomeric compound of claim 15, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate selected from morpholino and PNA. [Section 19] 19. The oligomeric compound of any of claims 1 to 12 or 15 to 18, wherein the modified oligonucleotide does not contain a bicyclic sugar moiety. [Section 20] The modified oligonucleotide comprises: a 5' region consisting of 1 to 7 linked 5' region nucleosides; a central region consisting of 6 to 10 linked central region nucleosides; and 3' region consisting of 1 to 7 linked 3' region nucleosides and having a glycomotif comprising each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar; 20. The oligomeric compound according to claim 1. [Section 21] The modified oligonucleotide comprises: a 5' region consisting of four linked 5' region nucleosides; a central region consisting of eight linked central region nucleosides; and A 3' region consisting of four linked 3' region nucleosides and each of the 5' region nucleosides comprises a 2'-MOE modified sugar, each of the 3' region nucleosides comprises either a 2'-MOE modified sugar or a cEt modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar; 21. The oligomeric compound of claim 20. [Section 22] The modified oligonucleotide comprises: a 5' region consisting of four linked 5' region nucleosides; a central region consisting of eight linked central region nucleosides; and A 3' region consisting of five linked 3' region nucleosides and each of the 5' region nucleosides comprises a 2'-MOE modified sugar, each of the 3' region nucleosides comprises either a 2'-MOE modified sugar or a cEt modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar; 21. The oligomeric compound of claim 20. [Section 23] The modified oligonucleotide comprises: a 5' region consisting of five linked 5' region nucleosides; a central region consisting of eight linked central region nucleosides; and A 3' region consisting of five linked 3' region nucleosides and each of the 5' region and each of the 3' region nucleosides comprises a 2'-MOE modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar; 21. The oligomeric compound of claim 20. [Section 24] The modified oligonucleotide comprises: a 5' region consisting of five linked 5' region nucleosides; a central region consisting of nine linked central region nucleosides; and A 3' region consisting of five linked 3' region nucleosides and each of the 3' region nucleosides comprises either a 2'-MOE modified sugar or a cEt modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar; 21. The oligomeric compound of claim 20. [Section 25] The modified oligonucleotide comprises: a 5' region consisting of five linked 5' region nucleosides; a central region consisting of nine linked central region nucleosides; and A 3' region consisting of five linked 3' region nucleosides and each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar; 21. The oligomeric compound of claim 20. [Section 26] The modified oligonucleotide comprises: a 5' region consisting of six linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; and A 3' region consisting of four linked 3' region nucleosides and having a glycomotif comprising each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar; 21. The oligomeric compound of claim 20. [Section 27] The modified oligonucleotide comprises: a 5' region consisting of six linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; and A 3' region consisting of four linked 3' region nucleosides and having a glycomotif comprising each of the 3' region nucleosides comprises either a 2'-MOE modified sugar or a cEt modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar; 21. The oligomeric compound of claim 20. [Section 28] The modified oligonucleotide comprises: a 5' region consisting of five linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; and A 3' region consisting of five linked 3' region nucleosides and having a glycomotif comprising each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar; 21. The oligomeric compound of claim 20. [Section 29] The modified oligonucleotide comprises: a 5' region consisting of five linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; and A 3' region consisting of five linked 3' region nucleosides and having a glycomotif comprising each of the 3' region nucleosides comprises either a 2'-MOE modified sugar or a cEt modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar; 21. The oligomeric compound of claim 20. [Section 30] The modified oligonucleotide comprises: a 5' region consisting of four linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; and 3' region consisting of six linked 3' region nucleosides and having a glycomotif comprising each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar; 21. The oligomeric compound of claim 20. [Section 31] The modified oligonucleotide comprises: a 5' region consisting of three linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; and 3' region consisting of seven linked 3' region nucleosides and each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar; 21. The oligomeric compound of claim 20. [Section 32] The modified oligonucleotide comprises: a 5' region consisting of seven linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; and 3' region consisting of three linked 3' region nucleosides and each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar; 21. The oligomeric compound of claim 20. [Section 33] 33. The oligomeric compound according to any one of claims 20 to 32, wherein the 2'-deoxyribosyl sugar is a 2'-β-D-deoxyribosyl sugar. [Section 34] The modified oligonucleotide comprises: a 5' region consisting of 1 to 6 linked 5' region nucleosides; a central region consisting of 6 to 10 linked central region nucleosides; and 3' region consisting of 1 to 6 linked 3' region nucleosides and having a glycomotif comprising each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar; The central region has the following formula: (Nd)(Nx)(Nd)n wherein Nx is a 2'-OMe nucleoside and each Nd is a 2'-β-D-deoxynucleoside; n is 6 to 8; 20. The oligomeric compound according to claim 1. [Section 35] The modified oligonucleotide comprises: a 5' region consisting of five linked 5' region nucleosides; a central region consisting of eight linked central region nucleosides; and A 3' region consisting of five linked 3' region nucleosides and having a glycomotif comprising each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE modified sugar; The central region has the following formula: (Nd)(Nx)(Nd)n wherein Nx is a nucleoside that includes a 2'-OMe sugar and each Nd is a nucleoside that includes a 2'-deoxyribosyl sugar; n is 6, 35. The oligomeric compound of claim 34. [Section 36] The modified oligonucleotide comprises: a 5' region consisting of five linked 5' region nucleosides; a central region consisting of eight linked central region nucleosides; and A 3' region consisting of five linked 3' region nucleosides and having a glycomotif comprising each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE modified sugar; The central region has the following formula: (Nd)(Nx)(Nd)n wherein Nx is a nucleoside that includes a 2'-OMe sugar and each Nd is a nucleoside that includes a 2'-deoxyribosyl sugar; n is 6, 35. The oligomeric compound of claim 34. [Section 37] The modified oligonucleotide comprises: a 5' region consisting of five linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; and A 3' region consisting of five linked 3' region nucleosides and having a glycomotif comprising each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE modified sugar; The central region has the following formula: (Nd)(Nx)(Nd)n wherein Nx is a nucleoside that includes a 2'-OMe sugar and each Nd is a nucleoside that includes a 2'-deoxyribosyl sugar; n is 8, 35. The oligomeric compound of claim 34. [Section 38] 38. The oligomeric compound according to claim 34, wherein the 2'-deoxyribosyl sugar is a 2'-β-D-deoxyribosyl sugar. [Section 39] 39. The oligomeric compound of any one of claims 1 to 38, wherein said modified oligonucleotide comprises at least one modified internucleoside linkage. [Section 40] 40. The oligomeric compound of claim 39, wherein each internucleoside linkage of said modified oligonucleotide is a modified internucleoside linkage. [Section 41] 41. The oligomeric compound of claim 39 or 40, wherein at least one internucleoside linkage is a phosphorothioate internucleoside linkage. [Section 42] 42. The oligomeric compound of claim 39 or 41, wherein said modified oligonucleotide comprises at least one phosphodiester internucleoside linkage. [Section 43] 43. The oligomeric compound of any of claims 39, 41, or 42, wherein each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage. [Section 44] 44. The oligomeric compound of any of claims 1 to 43, wherein said modified oligonucleotide comprises at least one modified nucleobase. [Section 45] 45. The oligomeric compound of claim 44, wherein said modified nucleobase is 5-methylcytosine. [Section 46] 46. The oligomeric compound of any one of claims 1 to 45, wherein the modified oligonucleotide consists of 12 to 30, 12 to 22, 12 to 20, 14 to 20, 15 to 25, 16 to 20, 18 to 22, or 18 to 20 linked nucleosides. [Section 47] 47. The oligomeric compound of any one of claims 1-21, 33, 34, or 38-46, wherein said modified oligonucleotide consists of 16 linked nucleosides. [Section 48] 47. The oligomeric compound of any one of claims 1-20, 22, 33, 34, or 38-46, wherein said modified oligonucleotide consists of 17 linked nucleosides. [Section 49] 47. The oligomeric compound of any one of claims 1 to 20, 23, 33, 34 to 36, or 38 to 46, wherein the modified oligonucleotide consists of 18 linked nucleosides. [Section 50] 47. The oligomeric compound of any one of claims 1-20, 24, 25, 33, 34, or 38-46, wherein the modified oligonucleotide consists of 19 linked nucleosides. [Section 51] 47. The oligomeric compound of any one of claims 1-20, 26-34, or 37-46, wherein the modified oligonucleotide consists of 20 linked nucleosides. [Section 52] 40. The oligomeric compound of claim 39, wherein the modified oligonucleotide has the internucleoside linkage motif soossssssssssooooss, soooosssssssssssoooss, soooosssssssssssss, soooooosssssssssss, ssooooosssssssssss, sooooossssssssss, sooooosssssssss, sooooosssssssss, soooosssssssss, soooosssssssss, or sooossssssssssoos (where "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage). [Section 53] 53. The oligomeric compound according to any one of claims 1 to 52, comprising the modified oligonucleotide. [Section 54] 53. The oligomeric compound of any one of claims 1 to 52, comprising a conjugate group comprising a conjugate moiety and a conjugate linker. [Section 55] 55. The oligomeric compound of claim 54, wherein the conjugate group comprises a GalNAc cluster comprising 1 to 3 GalNAc ligands. [Section 56] 56. The oligomeric compound of claim 54 or 55, wherein the conjugate linker consists of a single bond. [Section 57] 55. The oligomeric compound of claim 54, wherein the conjugate linker is cleavable. [Section 58] 55. The oligomeric compound of claim 54, wherein the conjugate linker comprises 1 to 3 linker nucleosides. [Section 59] 59. The oligomeric compound of any of claims 54 to 58, wherein the conjugate group is attached to the modified oligonucleotide at the 5' end of the modified oligonucleotide. [Section 60] 59. The oligomeric compound of any of claims 54 to 58, wherein the conjugate group is attached to the modified oligonucleotide at the 3' end of the modified oligonucleotide. [Section 61] 61. The oligomeric compound of any one of claims 1 to 60, comprising a terminal group. [Section 62] 62. The oligomeric compound according to any one of claims 1 to 61, wherein the oligomeric compound is a single-stranded oligomeric compound. [Section 63] 63. The oligomeric compound of any one of claims 1 to 57 or 59 to 62, wherein the oligomeric compound does not contain a linker nucleoside. [Section 64] 64. An oligomeric duplex comprising the oligomeric compound of any of claims 1-61 or 63. [Section 65] 65. An antisense compound comprising or consisting of an oligomeric compound according to any one of claims 1 to 63 or an oligomeric duplex according to claim 64. [Section 66] 65. A pharmaceutical composition comprising an oligomeric compound according to any one of claims 1 to 63 or an oligomeric duplex according to claim 64, and a pharmaceutically acceptable carrier or diluent. [Section 67] 67. The pharmaceutical composition of claim 66, comprising a pharmaceutically acceptable diluent, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid. [Section 68] 68. The pharmaceutical composition of claim 67, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and phosphate buffered saline or artificial cerebrospinal fluid. [Section 69] A method comprising administering to an animal the pharmaceutical composition of any one of claims 66 to 68. [Section 70] A method for treating a disease associated with PRNP, comprising administering a therapeutically effective amount of the pharmaceutical composition of any one of claims 66 to 68 to an individual having or at risk of developing a disease associated with PRNP, thereby treating the disease associated with PRNP. [Section 71] A method for reducing PrP protein in the CSF of an individual having or at risk of developing a PRNP-related disease, the method comprising reducing PrP protein in the CSF with a therapeutically effective amount of the pharmaceutical composition described in any one of claims 66 to 68. [Section 72] The PrP protein is PrP C 72. The method of claim 71, wherein: [Section 73] The PrP protein is PrP Sc 72. The method of claim 71, wherein: [Section 74] The PrP protein is PrP C and PrP Sc 72. The method of claim 71, wherein both [Section 75] 72. The method of claim 70 or 71, wherein said administering is performed by intrathecal administration. [Section 76] 72. The method of claim 70 or claim 71, wherein the PRNP-associated disease is a neurodegenerative disease. [Section 77] 77. The method of claim 76, wherein the neurodegenerative disease is selected from prion diseases, Creutzfeldt-Jakob disease (CJD), variant Creutzfeldt-Jakob disease (vCJD), familial Creutzfeldt-Jakob disease (fCJD), Gerstmann-Sträussler-Scheinker syndrome, fatal familial insomnia, kuru, Alzheimer's disease, or Parkinson's disease. [Section 78] 78. The method of any of claims 70-77, wherein at least one symptom or feature of the neurodegenerative disease is ameliorated. [Section 79] 79. The method of claim 78, wherein the symptom or characteristic is any of spongiform changes in the brain, development of abnormal protein aggregates, neuronal loss, markers of neuronal loss, rapidly progressive dementia, or death. [Section 80] 66. A method for reducing PRNP RNA in a cell, comprising contacting the cell with an oligomeric compound described in any one of claims 1 to 63, an oligomeric duplex described in claim 64, or an antisense compound described in claim 65, thereby reducing PRNP RNA in the cell. [Section 81] 66. A method for reducing PrP protein in a cell, comprising contacting the cell with an oligomeric compound of any of claims 1-63, an oligomeric duplex of claim 64, or an antisense compound of claim 65, thereby reducing PrP in the cell. [Section 82] The PrP protein is PrP C 82. The method of claim 81, wherein: [Section 83] The PrP protein is PrP Sc 82. The method of claim 81, wherein: [Section 84] The PrP protein is PrP C and PrP Sc The method according to claim 81, Law. [Section 85] The method of any one of claims 80 to 84, wherein the cell is present in an animal. [Section 86] Modified oligonucleotides according to the following chemical structure: [ka] (SEQ ID NO: 1914), or a salt thereof. [Section 87] Modified oligonucleotides according to the following chemical structure: [ka] (SEQ ID NO: 1914). [Section 88] Modified oligonucleotides according to the following chemical structure: [ka] (SEQ ID NO: 1914), or a salt thereof. [Section 89] Modified oligonucleotides according to the following chemical structure: [ka] (SEQ ID NO: 1914). [Section 90] Modified oligonucleotides according to the following chemical structure: [ka] (SEQ ID NO: 1939), or a salt thereof. [Section 91] Modified oligonucleotides according to the following chemical structure: [ka] (SEQ ID NO: 1939). [Section 92] Modified oligonucleotides according to the following chemical structure: [ka] (SEQ ID NO: 2302), or a salt thereof. [Section 93] Modified oligonucleotides according to the following chemical structure: [ka] (SEQ ID NO: 2302). [Section 94] Modified oligonucleotides according to the following chemical structure: [ka] (SEQ ID NO: 2750), or a salt thereof. [Section 95] Modified oligonucleotides according to the following chemical structure: [ka] (SEQ ID NO: 2750). [Section 96] Modified oligonucleotides according to the following chemical structure: [ka] (SEQ ID NO: 2739), or a salt thereof. [Section 97] Modified oligonucleotides according to the following chemical structure: [ka] (SEQ ID NO: 2739). [Section 98] 97. The modified oligonucleotide of claim 86, 88, 90, 92, 94, or 96, which is a sodium salt of said chemical structure. [Section 99] The following chemical notations: Ges Teo m Ceo Aeo Tes Ads Ads Tds Tds Tds Tds m Cds Tds Tds Ads Geo m Ceo Tes Aes m A compound comprising a modified oligonucleotide according to Ce (SEQ ID NO: 1914), wherein A = adenine nucleobase mC=5-methylcytosine nucleobase G = guanine nucleobase T=thymine nucleobase e=2'-MOE modified sugar d = 2'-β-D deoxyribosyl sugar s = phosphorothioate internucleoside linkage o = phosphodiester internucleoside linkage) [Section 100] The following chemical notations: Ges Teo m Ceo Aeo Teo Aeo Ads Td s Tds Tds Tds m Cds Tds Tds Ads Gds m Ceo Tes Aes m A compound comprising a modified oligonucleotide according to Ce (SEQ ID NO: 1914), wherein A = adenine nucleobase m C=5-methylcytosine nucleobase G = guanine nucleobase T=thymine nucleobase e=2'-MOE modified sugar d = 2'-β-D deoxyribosyl sugar s = phosphorothioate internucleoside linkage o = phosphodiester internucleoside linkage) [Section 101] The following chemical notation: Ges m Ceo Teo Teo Aeo Teo Tds Ads Tds Tds m Cds Ads Tds Gds Tds Tds m CEO Tes m Ces m A compound comprising a modified oligonucleotide according to Ce (SEQ ID NO: 1939), wherein A = adenine nucleobase m C=5-methylcytosine nucleobase G = guanine nucleobase T=thymine nucleobase e=2'-MOE modified sugar d = 2'-β-D deoxyribosyl sugar s = phosphorothioate internucleoside linkage o = phosphodiester internucleoside linkage) [Section 102] The following chemical notations: Ges Teo Geo Teo m Ceo Aeo Tds Ads Ads Tds Tds Tds Tds m Cds Tds Tds Aeo Ges m A compound comprising a modified oligonucleotide according to Ces Te (SEQ ID NO: 2302), wherein: A = adenine nucleobase mC = 5-methylcytosine nucleobase G = guanine nucleobase T=thymine nucleobase e=2'-MOE modified sugar d = 2'-β-D deoxyribosyl sugar s = phosphorothioate internucleoside linkage o = phosphodiester internucleoside linkage) [Section 103] A compound comprising a modified oligonucleotide according to the following chemical designation: Ges Teo mCeo Aeo Teo Ads Ads Tds Tds Tds mCds Tds Tds Aes Geo mCeo Tes Ae (SEQ ID NO: 2750), wherein A = adenine nucleobase mC = 5-methylcytosine nucleobase G = guanine nucleobase T=thymine nucleobase e=2'-MOE modified sugar d = 2'-β-D deoxyribosyl sugar s = phosphorothioate internucleoside linkage o = phosphodiester internucleoside linkage) [Section 104] A compound comprising a modified oligonucleotide according to the following chemical designation: Aes mCeo Geo Teo mCes mCds Ads Tds Tds Tds mCds Tds Gds Tds Geo mCeo Tes Tes Te (SEQ ID NO: 2739), wherein A = adenine nucleobase mC = 5-methylcytosine nucleobase G = guanine nucleobase T=thymine nucleobase e=2'-MOE modified sugar d = 2'-β-D deoxyribosyl sugar s = phosphorothioate internucleoside linkage o = phosphodiester internucleoside linkage) [Section 105] 105. The compound of any one of claims 99 to 104, comprising the modified oligonucleotide covalently attached to a conjugate group. [Section 106] Item 107. A chiral enriched population of modified oligonucleotides according to any one of claims 86 to 105, wherein the chiral enriched population is enriched for modified oligonucleotides containing at least one specific phosphorothioate internucleoside linkage having a specific stereochemical configuration. 107. The chiral enriched population of claim 106, wherein the population is enriched for modified oligonucleotides containing at least one specific phosphorothioate internucleoside linkage having an (Sp) or (Rp) configuration. [Section 108] 107. The chiral enriched population of claim 106, wherein the population is enriched for modified oligonucleotides having a specific, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage. [Section 109] 107. The chiral enriched population of claim 106, wherein the population is enriched for modified oligonucleotides having an (Sp) or (Rp) configuration at each phosphorothioate internucleoside linkage. [Section 110] 107. The chiral enriched population of claim 106, wherein the population is enriched for modified oligonucleotides having an (Rp) configuration at one particular phosphorothioate internucleoside linkage and an (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages. [Section 111] 109. The chiral enriched population of claim 106 or 108, wherein the population is enriched for modified oligonucleotides having at least three consecutive phosphorothioate internucleoside linkages in the 5' to 3' direction in the Sp, Sp, and Rp configurations. [Section 112] 106. The population of modified oligonucleotides according to any one of claims 86 to 105, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are stereorandom. [Section 113] 113. A pharmaceutical composition comprising a population of modified oligonucleotides according to any one of claims 106 to 112 and a pharmaceutically acceptable carrier or diluent. [Section 114] A pharmaceutical composition according to any one of claims 86 to 105 and a pharmaceutically acceptable diluent or or carrier. [Section 115] Item 116. The pharmaceutical composition according to claim 114, further comprising a pharmaceutically acceptable diluent, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid. 116. The pharmaceutical composition of Claim 115, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and phosphate buffered saline or artificial cerebrospinal fluid.
Claims
[Claim 1] The invention described herein.