RNAi agents and compositions for inhibiting expression of apolipoprotein C-III (APOC3)

Abstract

Provided are novel APOC3 RNA interference (RNAi) agents that can selectively and efficiently inhibit the expression of the APOC3 gene, and compositions containing the novel APOC3-specific RNAi agents for the treatment of diseases associated with elevated triglyceride (TG) levels. [Solution] The present disclosure features an RNAi agent for inhibiting expression of the human APOC3 gene, the RNAi agent comprising a sense strand and an antisense strand. Also described herein is a composition comprising or consisting of an RNAi agent capable of inhibiting expression of the APOC3 gene, wherein the APOC3 RNAi agent comprises or consists of a sense strand and an antisense strand, and the composition further comprises at least one pharmaceutically acceptable excipient.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 62 / 720,434, filed August 21, 2018, U.S. Provisional Patent Application No. 62 / 643,927, filed March 16, 2018, and U.S. Provisional Patent Application No. 62 / 556,818, filed September 11, 2017, the entire contents of each of which are incorporated herein by reference.

[0002] Sequence Listing This application contains a Sequence Listing which has been submitted in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy is entitled 30655_SeqList and is 195kb in size.

[0003] FIELD OF THE INVENTION The present disclosure relates to RNA interference (RNAi) agents, e.g., double-stranded RNAi agents, compositions comprising apolipoprotein C-III RNAi agents, and methods of use thereof, for the inhibition of apolipoprotein C-III gene expression. [Background technology]

[0004] Apolipoprotein C-III (APOC3, also known as apoC-III, APOC-III, and APO C-III), encoded by the human apolipoprotein C-III gene, has recently emerged as a promising target for the treatment of diseases associated with hypertriglyceridemia. Elevated serum triglyceride (TG) levels have been identified as an independent risk factor for cardiovascular disease and a contributing factor to the development of atherosclerosis. Individuals with severe hypertriglyceridemia (often >1000 mg / dL) are also at risk for recurrent pancreatitis. Triglycerides are primarily transported in the blood as the major components of very-low-density lipoproteins (VLDL) and chylomicron particles, known as TG-rich lipoproteins. Lipoproteins consist of a hydrophobic triacylglycerol and cholesteryl ester core and a hydrophilic outer layer of phospholipids, cholesterol, and apoproteins. APOC3 is one of these apoproteins.

[0005] APOC3 is primarily synthesized in the liver and plays an important role in the production, metabolism, and clearance of TG-rich lipoproteins from plasma. Several gain-of-function polymorphisms have been identified in the promoter region of the APOC3 gene, which are hypothesized to be contributing factors to the development of hypertriglyceridemia (e.g., Wang, Y., et al., Association of Apolipoprotein C3 Genetic Polymorphisms with the Risk of Ischemic Stroke in the Northern Chinese Han Population, 11 PLoS One e0163910 (2016); Li, Y., et al., Apolipoprotein C3 gene variants and the risk of coronary heart disease: A meta-analysis 9 Meta Gene 104-109 (2016). Increased APOC3 synthesis in the liver promotes the secretion of TG-rich VLDL. Furthermore, excess APOC3 inhibits the activity of lipoprotein lipase and hepatic lipase, further increasing serum TG levels by slowing the catabolism of TG-rich lipoproteins. Furthermore, elevated APOC3 also slows the hepatic clearance of TG-rich lipoproteins and their remnants by preventing them from binding to hepatic receptors. Several large genetic studies have reported that individuals with loss-of-function mutations in APOC3 exhibit lower triglyceride levels and a reduced incidence of cardiovascular disease (e.g., Bernelot-Moens, SJ, et al., Inhibition of ApoCIII: the next PCSK9? 25 Curr Opin Lipidol 418-422 (2014); Saleheen, D., et al., Human knockouts and phenotypic analysis in a cohort with a high rate of consanguinity, 544 Nature 235-239 (2017).

[0006] Currently, hypertriglyceridemia is often treated with fibrates in moderate cases or in combination with statins; however, in most cases, the reduction in serum TG is slight. Furthermore, in patients with very severe hypertriglyceridemia due to a single genetic cause (e.g., patients with familial chylomicronemia syndrome), available therapeutic agents are often ineffective because disease-causing mutations result in dysfunctional lipoprotein lipase, and functional lipoprotein lipase is required for optimal response to standard treatment. Effective therapeutic agents that can provide substantial TG-lowering effects are needed for the treatment of diseases in which APOC3 may play a role, such as hypertriglyceridemia-induced pancreatitis, metabolic syndrome, type II diabetes, familial chylomicronemia syndrome, familial partial lipodystrophy, obesity, hyperlipidemia, hypertriglyceridemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, cardiovascular disease, coronary artery disease, and other metabolic disorders and diseases. Certain other APOC3-specific RNA interference (RNAi) agents have been shown to inhibit the expression of APOC3 gene expression, for example, in International Patent Application Publication No. WO2016 / 011123A1 to Weiler et al., which is incorporated herein by reference in its entirety. However, the APOC3 RNAi agents disclosed herein have not been previously disclosed or known, and provide highly potent and efficient inhibition of APOC3 gene expression. [Prior art documents] [Patent documents]

[0007] [Patent Document 1] International Publication No. 2016 / 011123 [Non-patent literature]

[0008] [Non-Patent Document 1] Wang, Y., et al., Association of Apolipoprotein C3 Genetic Polymorphisms with the Risk of Ischemic Stroke in the Northern Chinese Han Population, 11 PLoS One e0163910 (2016) [Non-patent document 2] Li, Y., et al., Apolipoprotein C3 gene variants and the risk of coronary heart disease: A meta-analysis 9 Meta Gene 104-109 (2016) [Non-patent document 3] Bernelot Moens, SJ, et al., Inhibition of ApoCIII: the next PCSK9? 25 Curr Opin Lipidol 418-422 (2014) [Non-patent document 4] Saleheen, D., et al., Human knockouts and phenotypic analysis in a cohort with a high rate of consanguinity, 544 Nature 235-239 (2017) Summary of the Invention [Means for solving the problem]

[0009] Abstract There is a need for novel APOC3 RNA interference (RNAi) agents (also referred to herein as RNAi agents, RNAi triggers, or triggers) that can selectively and efficiently inhibit the expression of the APOC3 gene.Furthermore, there is a need for compositions containing novel APOC3-specific RNAi agents, particularly for the treatment of diseases associated with elevated triglyceride (TG) levels.

[0010] Generally, the present disclosure features APOC3 gene-specific RNAi agents, compositions comprising APOC3 RNAi agents, and methods for inhibiting the expression of APOC3 gene in vitro and / or in vivo using APOC3 RNAi agents and compositions comprising the APOC3 RNAi agents described herein.The APOC3 RNAi agents disclosed herein can selectively and efficiently reduce or inhibit the expression of APOC3 gene, thereby reducing TG level and / or cholesterol level in subjects, for example, human or animal subjects.

[0011] The described APOC3 RNAi agents can be used in methods for therapeutic treatment (including prophylactic and preventative treatment) of conditions and diseases associated with elevated TG levels and / or elevated cholesterol levels, including, but not limited to, obesity, hyperlipidemia, hypertriglyceridemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, cardiovascular disease, coronary artery disease, hypertriglyceridemia-induced pancreatitis, metabolic syndrome, type II diabetes, familial chylomicronemia syndrome, familial partial lipodystrophy, and other metabolic-related disorders and diseases. The RNAi agent can selectively reduce APOC3 gene expression, thereby particularly reducing TG level and / or cholesterol level in the subject.The method disclosed herein comprises administering one or more APOC3 RNAi agents to the subject, for example, human or animal subject, by any suitable method known in the art, such as subcutaneous injection or intravenous administration.

[0012] In one aspect, the present disclosure features an RNAi agent for inhibiting the expression of human APOC3 gene, the RNAi agent comprising a sense strand and an antisense strand.Also described herein is a composition comprising or consisting of an RNAi agent capable of inhibiting the expression of APOC3 gene, wherein the APOC3 RNAi agent comprises or consists of a sense strand and an antisense strand, and the composition further comprises at least one pharmaceutically acceptable excipient.The compositions described herein, comprising one or more of the disclosed APOC3 RNAi agents, can selectively and efficiently reduce the expression of APOC3 gene.A composition comprising one or more APOC3 RNAi agents can be administered to a subject, such as a human or animal subject, for the treatment (including preventive treatment or inhibition) of symptoms and diseases associated with elevated TG levels, elevated cholesterol and / or enhanced APOC3 expression.

[0013] The APOC3 RNAi agents described herein comprise a sense strand (also referred to as a passenger strand) and an antisense strand (also referred to as a guide strand). The sense strand and antisense strand may be partially, substantially, or fully complementary to one another. The sense and antisense strands of the RNAi agents described herein may each be 16-30 nucleotides in length. In some embodiments, the sense and antisense strands are independently 17-26 nucleotides in length. The sense and antisense strands may be the same length or different lengths. In some embodiments, the sense and antisense strands are independently 21-26 nucleotides in length. In some embodiments, the sense and antisense strands are independently 21-24 nucleotides in length. In some embodiments, both the sense and antisense strands are 21 nucleotides in length. In some embodiments, the sense and / or antisense strands are independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. The RNAi agents described herein inhibit the expression of one or more APOC3 genes in vivo or in vitro upon delivery to cells that express APOC3.

[0014] The sense strand of the APOC3 RNAi agent described herein comprises at least 16 consecutive nucleotides that have at least 85% identity to the core stretch sequence of the same number of nucleotides in APOC3 mRNA (also referred to herein as "core stretch" or "core sequence"). In some embodiments, the sense strand core stretch that has at least 85% identity to the sequence of APOC3 mRNA is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the sense strand core stretch that has at least 85% identity to the sequence of APOC3 mRNA is 19 nucleotides in length. In some embodiments, this sense strand core stretch is 17 nucleotides in length.

[0015] The antisense strand of APOC3 RNAi agent comprises at least 16 consecutive nucleotides with at least 85% complementarity with the core stretch of the same number of nucleotides in APOC3 mRNA and the core stretch of the same number of nucleotides in the corresponding sense strand.In some embodiments, the antisense strand core stretch that has at least 85% complementarity with the sequence of APOC3 mRNA or the corresponding sense strand is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.In some embodiments, this antisense strand core stretch is 19 nucleotides in length.In some embodiments, this antisense strand core stretch is 17 nucleotides in length.

[0016] In some embodiments, an APOC3 RNAi agent disclosed herein targets a portion of the APOC3 gene having a sequence of any of the sequences disclosed in Table 1.

[0017] Examples of APOC3 RNAi agent sense and antisense strands that may be included in the APOC3 RNAi agents disclosed herein are provided in Tables 3, 4, and 5. Examples of APOC3 RNAi agent duplexes are provided in Tables 3 and 6. Examples of 19-nucleotide core stretch sequences consisting of or included in the sense and antisense strands of the APOC3 RNAi agents disclosed herein are provided in Table 2.

[0018] In another aspect, the present disclosure features a method for delivering APOC3 RNAi agents to liver cells in a subject, such as a mammal, in vivo. Also described herein is a composition for use in such a method. One or more APOC3 RNAi agents can be delivered to target cells or tissues using any oligonucleotide delivery technology known in the art. Nucleic acid delivery methods include, but are not limited to, encapsulation in liposomes, iontophoresis, or incorporation into other vehicles such as hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres, proteinaceous vectors, or Dynamic Polyconjugate™ (DPC) (see, for example, WO2000 / 053722, WO2008 / 0022309, WO2011 / 104169, and WO2012 / 083185, each of which is incorporated herein by reference).

[0019] In some embodiments, the APOC3 RNAi agent is delivered to target cells or tissues by covalently linking the RNAi agent to a targeting group such as an asialoglycoprotein receptor ligand or by conjugating the RNAi agent to a targeting group. In some embodiments, the asialoglycoprotein receptor ligand comprises, consists of, or essentially consists of galactose or a galactose derivative cluster. In some embodiments, the APOC3 RNAi agent is linked to a targeting ligand comprising the galactose derivative N-acetyl-galactosamine. In some embodiments, the galactose derivative cluster comprises an N-acetyl-galactosamine trimer or an N-acetyl-galactosamine tetramer. In some embodiments, the galactose derivative cluster is an N-acetyl-galactosamine trimer or an N-acetyl-galactosamine tetramer. In some embodiments, the APOC3 RNAi agent conjugated to a targeting ligand comprising N-acetyl-galactosamine is selectively internalized by liver cells, particularly hepatocytes, either by receptor-mediated endocytosis or other means. Examples of targeting groups useful for delivering RNAi agents are disclosed, for example, in International Patent Application Publication Nos. WO2018 / 044350 and WO2017 / 156012, the contents of each of which are incorporated herein by reference in their entirety.

[0020] The targeting group can be linked to the 3' or 5' end of the sense strand or antisense strand of the APOC3 RNAi agent.In some embodiments, the targeting group is linked to the 3' or 5' end of the sense strand.In some embodiments, the targeting group is linked to the 5' end of the sense strand.In some embodiments, the targeting group is internally linked to the nucleotide on the sense strand and / or antisense strand of the RNAi agent.In some embodiments, the targeting group is linked to the RNAi agent via a linker.

[0021] A targeting group, with or without a linker, can be linked to the 5' or 3' end of any of the sense and / or antisense strands disclosed in Tables 2, 3, 4, and 5. A linker, with or without a targeting group, can be attached to the 5' or 3' end of any of the sense and / or antisense strands disclosed in Tables 2, 3, 4, and 5.

[0022] In some embodiments, compositions comprising one or more APOC3 RNAi agents having a double-stranded sequence disclosed in Table 6 are described herein.

[0023] In a further aspect, described herein are pharmaceutical compositions comprising one or more of the described APOC3 RNAi agents, optionally in combination with one or more additional (i.e., second, third, etc.) therapeutic agents. In some embodiments, pharmaceutical compositions comprising one or more of the described APOC3 RNAi agents, optionally in combination with one or more additional (i.e., second, third, etc.) therapeutic agents, can be formulated in a pharmaceutically acceptable carrier or diluent. In some embodiments, these compositions can be administered to a subject, such as a mammal. In some embodiments, the mammal is a human.

[0024] In some embodiments, the compositions described herein comprise a combination or cocktail of at least two APOC3 RNAi agents with different nucleotide sequences.In some embodiments, two or more different APOC3 RNAi agents are each separately and independently linked to a targeting group.In some embodiments, two or more different APOC3 RNAi agents are each linked to a targeting group that comprises or consists of a targeting ligand that comprises one or more moieties that target asialoglycoprotein receptor.In some embodiments, two or more different APOC3 RNAi agents are each linked to a targeting group that comprises or consists of a targeting ligand that comprises one or more galactose derivatives.In some embodiments, two or more different APOC3 RNAi agents are each linked to a targeting group that comprises or consists of a targeting ligand that comprises one or more N-acetyl-galactosamine.

[0025] In another aspect, the disclosure features a method for inhibiting the expression of the APOC3 gene in a subject, the method comprising administering to the subject or cells of the subject an amount of an APOC3 RNAi agent capable of inhibiting the expression of the APOC3 gene, wherein the APOC3 RNAi agent comprises a sense strand and an antisense strand, and the antisense strand comprises any one of the antisense strand nucleotide sequences in Table 2, Table 3, or Table 4. In some embodiments, a composition for delivering an APOC3 RNAi agent to liver cells, particularly hepatocytes, in vivo is described, the composition comprising the APOC3 RNAi agent conjugated to a targeting group. In some embodiments, the targeting group is an asialoglycoprotein receptor ligand.

[0026] In some embodiments, disclosed herein are methods for inhibiting expression of the APOC3 gene, comprising administering to a subject or a cell of a subject an amount of an APOC3 RNAi agent capable of inhibiting expression of the APOC3 gene, wherein the APOC3 RNAi agent comprises a sense strand and an antisense strand, and wherein the sense strand comprises any one of the sense strand nucleotide sequences in Table 2, Table 3, or Table 5. Also described herein are compositions for use in such methods.

[0027] In a further aspect, the disclosure features methods for treating (including preventative or prophylactic treatment) a disease or symptom caused by elevated TG levels and / or elevated cholesterol levels, the methods comprising administering to a subject in need thereof an APOC3 RNAi agent having an antisense strand comprising any of the sequences in Tables 2, 3, or 4. In some embodiments, described herein are methods for treating (including preventative or prophylactic treatment) a disease or symptom caused by elevated TG levels and / or elevated cholesterol levels, the methods comprising administering to a subject in need thereof an APOC3 RNAi agent having a sense strand comprising any of the sequences in Tables 2, 3, or 5. Also described herein are compositions for use in such methods.

[0028] Also described are methods for treating a human subject having or at risk of developing a pathological condition (e.g., a condition or disease) mediated at least in part by APOC3 gene expression, the method comprising administering to the subject a therapeutically effective amount of an APOC3 RNAi agent and / or an APOC3 RNAi agent-containing composition. The method of treating a subject with an APOC3 RNAi agent and / or an APOC3 RNAi agent-containing composition can be optionally combined with one or more steps of administering one or more additional (i.e., second, third, etc.) therapeutic agents or treatments. The APOC3 RNAi agent and the additional therapeutic agent can be administered in a single composition, or they can be administered separately. The additional therapeutic agent can be another APOC3 RNAi agent (e.g., an APOC3 RNAi agent targeting a different sequence within the APOC3 gene). The additional therapeutic agent can be a small molecule drug, an antibody, an antibody fragment, and / or an aptamer. In some embodiments, the one or more additional therapeutic agents is a statin such as atorvastatin, fluvastatin, pravastatin, pitavastatin, rosuvastatin, or simvastatin.

[0029] In some embodiments, the described APOC3 RNAi agent is optionally combined with one or more additional therapeutic agents, wherein the one or more additional therapeutic agents are administered separately in a dosage form separate from the RNAi agent (e.g., the APOC3 RNAi agent is administered by subcutaneous injection, while the additional therapeutic agents involved in the method of treatment dosing regimen are administered orally). In some embodiments, the described APOC3 RNAi agent is administered to a subject in need thereof via subcutaneous injection, and one or more optional additional therapeutic agents are administered orally, together providing a treatment regimen for diseases and conditions associated with elevated TG and / or cholesterol levels. In some embodiments, the described APOC3 RNAi agent is administered to a subject in need thereof via subcutaneous injection, and one or more optional additional therapeutic agents are administered via another subcutaneous injection. In some embodiments, the APOC3 RNAi agent and one or more additional therapeutic agents are combined in a single dosage form (e.g., a "cocktail" formulated into a single composition for subcutaneous injection). The APOC3 RNAi agent, with or without one or more additional therapeutic agents, can be combined with one or more excipients to form a pharmaceutical composition.

[0030] In some embodiments, disclosed herein are methods for inhibiting expression of the APOC3 gene, the method comprising administering to a cell or a subject an APOC3 RNAi agent comprising a sense strand comprising, consisting of, or consisting essentially of any of the sequences in Tables 2, 3, or 5. In some embodiments, disclosed herein are methods for inhibiting expression of the APOC3 gene, the method comprising administering to a cell or a subject an APOC3 RNAi agent comprising a sense strand comprising, consisting of, or consisting essentially of any of the sequences in Table 5 and an antisense strand comprising, consisting of, or consisting essentially of any of the sequences in Table 4.

[0031] In some embodiments, disclosed herein are methods of inhibiting expression of the APOC3 gene in a cell or a subject, the method comprising administering to the cell or subject an APOC3 RNAi agent comprising a sense strand comprising the nucleobase sequence of any of the sequences in Table 5 and an antisense strand comprising the nucleobase sequence of any of the sequences in Table 4. In other embodiments, disclosed herein are methods of inhibiting expression of the APOC3 gene, the method comprising administering to the subject an APOC3 RNAi agent comprising a sense strand consisting of a modified sequence of any of the modified sequences in Table 5 and an antisense strand consisting of a modified sequence of any of the modified sequences in Table 4.

[0032] In some embodiments, the composition described is for delivering APOC3 RNAi agent to liver cell, particularly hepatocyte, in vivo, and comprises the APOC3 RNAi agent conjugated with targeting group.In some embodiments, the targeting group is asialoglycoprotein receptor ligand (i.e., the ligand comprises the compound that has affinity for asialoglycoprotein receptor).In some embodiments, the targeting group comprises N-acetyl-galactosamine.

[0033] In some embodiments, disclosed herein are methods for inhibiting expression of the APOC3 gene in a cell, the method comprising administering one or more APOC3 RNAi agents having a double-stranded duplex structure described in Table 6.

[0034] In some embodiments, a method for treating (including prophylactic or preventative treatment) a disease, disorder, or symptom caused by elevated TG levels and / or elevated cholesterol levels is provided, comprising administering to a subject in need thereof a therapeutically effective amount of an APOC3 mRNA comprising an antisense strand that is at least partially complementary to a portion of an APOC3 mRNA having a sequence in Table 1. Disclosed herein is a method for treating (including preventive or preventative treatment) a disease or symptom caused by elevated TG levels and / or elevated cholesterol levels, comprising administering to a subject in need thereof a therapeutically effective amount of an APOC3 RNAi agent comprising an antisense strand comprising any of the sequences in Table 2, 3, or 4, and a sense strand comprising any of the sequences in Table 2, 3, or 5, which is at least partially complementary to the antisense strand. Disclosed herein is a method for treating (including preventive or preventative treatment) a disease or symptom caused by elevated TG levels and / or elevated cholesterol levels, comprising administering to a subject in need thereof a therapeutically effective amount of an APOC3 RNAi agent comprising a sense strand comprising any of the sequences in Table 2, 3, or 5, and an antisense strand comprising any of the sequences in Table 2, 3, or 4, which is at least partially complementary to the sense strand.

[0035] In some embodiments, disclosed herein are methods for inhibiting expression of the APOC3 gene in a cell, the method comprising administering to the cell an APOC3 RNAi agent comprising an antisense strand that is at least partially complementary to a portion of the APOC3 mRNA having a sequence in Table 1. In some embodiments, disclosed herein are methods for inhibiting expression of the APOC3 gene in a cell, the method comprising administering to the cell an APOC3 RNAi agent comprising an antisense strand that is any of the sequences in Tables 2, 3, or 4, and a sense strand that is at least partially complementary to the antisense strand, the sense strand comprising any of the sequences in Tables 2, 3, or 5. In some embodiments, disclosed herein are methods for inhibiting expression of the APOC3 gene in a cell, the method comprising administering to the cell an APOC3 RNAi agent comprising a sense strand that is any of the sequences in Tables 2, 3, or 5, and an antisense strand that is at least partially complementary to the sense strand.

[0036] In some embodiments, disclosed herein are compositions for inhibiting expression of the APOC3 gene in a cell, the method comprising administering a composition comprising an APOC3 RNAi agent having a double-stranded duplex structure as described in Table 6.

[0037] In some embodiments, the present disclosure provides a composition for delivering APOC3 RNAi agent to liver cells in vivo, the composition comprises the APOC3 RNAi agent conjugated or linked to targeting group.In some embodiments, the targeting group is asialoglycoprotein receptor ligand.In some embodiments, the present disclosure provides a composition for delivering APOC3 RNAi agent to liver cells in vivo, the composition comprises the APOC3 RNAi agent linked to N-acetyl-galactosamine targeting ligand.

[0038] APOC3 RNAi agent disclosed herein is designed to target specific position (SEQ ID NO: 1) on APOC3 gene.As defined herein, antisense strand sequence is designed to target the APOC3 gene at a given position on gene, when the 5'-end nucleobase of antisense strand is aligned with the position that is 19 nucleotides downstream (towards the 3' end) from the position on gene when base-pairing with gene.For example, as illustrated in Table 1 and 2 herein, the antisense strand sequence that is designed to target the APOC3 gene at position 438 needs the 5'-end nucleobase of antisense strand to be aligned with position 456 of APOC3 gene when base-pairing with gene.

[0039] As provided herein, an APOC3 RNAi agent does not require that the nucleobase at position 1 (5'→3') of the antisense strand be complementary to the gene, provided there is at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) between the antisense strand and the gene over a core stretch sequence of at least 16 contiguous nucleotides. For example, for an APOC3 RNAi agent disclosed herein that is designed to target position 438 of the APOC3 gene, the 5'-terminal nucleobase of the antisense strand of the APOC3 RNAi agent must align with position 456 of the gene; however, the 5'-terminal nucleobase of the antisense strand may, but need not, be complementary to position 456 of the APOC3 gene, provided there is at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) between the antisense strand and the gene over a core stretch sequence of at least 16 contiguous nucleotides. In particular, as shown by the various examples disclosed herein, the specific binding site of the gene by the antisense strand of the APOC3 RNAi agent (e.g., whether the APOC3 RNAi agent is designed to target the APOC3 gene at position 438, 506, 432, or another position) is an important factor in the level of inhibition achieved by the APOC3 RNAi agent.

[0040] The use of APOC3 RNAi agents provides a method for therapeutic (including preventive) treatment of diseases / disorders associated with elevated TG and / or cholesterol levels and / or enhanced or elevated APOC3 expression.The described APOC3 RNAi agents mediate RNA interference to inhibit the expression of one or more genes required for the production of APOC3.APOC3 RNAi agents can also be used to treat or prevent various diseases or disorders, including obesity, hyperlipidemia, hypertriglyceridemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, cardiovascular disease, coronary artery disease, hypertriglyceridemia-mediated pancreatitis, metabolic syndrome, type II diabetes, familial chylomicronemia syndrome, familial partial lipodystrophy, and other metabolic disorders and diseases.Furthermore, a composition for in vivo delivery of APOC3 RNAi agents to liver cells is described.

[0041] The pharmaceutical composition comprising one or more APOC3 RNAi agents can be administered in several ways, depending on whether local or systemic treatment is desired.Administration can be, but is not limited to, intravenous, intraarterial, subcutaneous, intraperitoneal, subdermal (for example, by implanted device) and intraparenchymal administration.In some embodiments, the pharmaceutical composition described herein is administered by subcutaneous injection.

[0042] In some embodiments, the present disclosure provides a composition for delivering APOC3 RNAi agent to liver cells in vivo, the composition comprises the APOC3 RNAi agent conjugated or linked to targeting group.In some embodiments, the targeting group is asialoglycoprotein receptor ligand.In some embodiments, the present disclosure provides a composition for delivering APOC3 RNAi agent to liver cells in vivo, the composition comprises the APOC3 RNAi agent linked to targeting group comprising N-acetyl-galactosamine.

[0043] In some embodiments, the APOC3 RNAi agents described herein are (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), each of which is defined herein in Table 7. ), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s.

[0044] In some embodiments, the APOC3 RNAi agents described herein are (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), each of which is defined herein in Table 7. , (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s, containing one targeting group at the 5' end of the sense strand.

[0045] The described APOC3 RNAi agent and / or the composition comprising the APOC3 RNAi agent can be used in the method for the therapeutic treatment of the disease or condition caused by the increase of TG level.Such method comprises administering the APOC3 RNAi agent described herein to a subject, for example, a human or animal subject.In some embodiments, one or more of the described APOC3 RNAi agents are administered to a subject, such as a mammal, in a pharmaceutically acceptable carrier or diluent.In some embodiments, the mammal is a human.

[0046] The APOC3 RNAi agent disclosed herein can be incorporated into a composition comprising one or more of the disclosed APOC3 RNAi agents and at least one pharmaceutically acceptable excipient.In some embodiments, the composition disclosed herein comprising one or more of the disclosed APOC3 RNAi agents and at least one pharmaceutically acceptable excipient is a pharmaceutical composition.

[0047] In some embodiments, compositions comprising one or more disclosed APOC3 RNAi agents and at least one pharmaceutically acceptable excipient may further comprise one or more additional therapeutic agents or treatments.

[0048] In some embodiments, the compositions described herein comprising one or more APOC3 RNAi agents are packaged in a kit, container, pack, dispenser, pre-filled syringe, or vial. In some embodiments, the compositions described herein are administered parenterally.

[0049] In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising a nucleobase sequence that differs by zero or one nucleobase from the nucleotide sequence (5'→3')UCACUGAGAAUACUGUCCCUC (SEQ ID NO: 3). In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')UCACUGAGAAUACUGUCCCUC (SEQ ID NO: 3), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising a nucleobase sequence that differs by zero or one nucleobase from the nucleotide sequence (5'→3')UCACUGAGAAUACUGUCCCUC (SEQ ID NO: 3), wherein SEQ ID NO: 3 is located at positions 1-21 (5'→3') of the antisense strand.

[0050] In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising, a modified nucleotide sequence differing by no more than one nucleotide from the nucleotide sequence (5'→3')usCfsasCfuGfagaauAfcUfgUfcCfcUfsc (SEQ ID NO: 2) (where a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage), and the sense strand is at least substantially complementary to the antisense strand. As will be apparent to one of skill in the art, the inclusion of phosphorothioate linkages shown in the modified nucleotide sequences disclosed herein replaces phosphodiester linkages typically present in oligonucleotides (see, e.g., Figures 1A-1I, which show all internucleoside linkages). In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising the nucleotide sequence (5'→3')usCfsasCfuGfagaauAfcUfgUfcCfcUfsc (SEQ ID NO: 2) (wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage), and wherein the sense strand is at least substantially complementary to the antisense strand.

[0051] In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising a nucleobase sequence that differs by zero or one nucleobase from the nucleotide sequence (5'→3')UCACUGAGAAUACUGUCCCGU (SEQ ID NO: 5). In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')UCACUGAGAAUACUGUCCCGU (SEQ ID NO: 5), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising a nucleobase sequence that differs by zero or one nucleobase from the nucleotide sequence (5'→3')UCACUGAGAAUACUGUCCCGU (SEQ ID NO: 5), wherein SEQ ID NO: 5 is located at positions 1-21 (5'→3') of the antisense strand.

[0052] In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising, a modified nucleotide sequence differing by no more than one nucleotide from the nucleotide sequence (5'→3')usCfsasCfuGfagaauAfcUfgUfcCfcGfsu (SEQ ID NO: 4) (where a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage), and the sense strand is at least substantially complementary to the antisense strand. As will be apparent to one of skill in the art, the inclusion of phosphorothioate linkages shown in the modified nucleotide sequences disclosed herein replaces phosphodiester linkages typically present in oligonucleotides (see, e.g., Figures 1A-1I, which show all internucleoside linkages). In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising the nucleotide sequence (5'→3')usCfsasCfuGfagaauAfcUfgUfcCfcGfsu (SEQ ID NO: 4) (wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage), and wherein the sense strand is at least substantially complementary to the antisense strand.

[0053] In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising, a modified nucleotide sequence differing by no more than one nucleotide from the nucleotide sequence (5'→3')usCfsascugagaauAfcUfgUfcCfcUfsc (SEQ ID NO: 6) (wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage), and the sense strand is at least substantially complementary to the antisense strand. As will be apparent to one of skill in the art, the inclusion of phosphorothioate linkages shown in the modified nucleotide sequences disclosed herein replaces phosphodiester linkages typically present in oligonucleotides (see, e.g., Figures 1A-1I, which show all internucleoside linkages). In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising the nucleotide sequence (5'→3')usCfsascugagaauAfcUfgUfcCfcUfsc (SEQ ID NO: 6) (wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage), and wherein the sense strand is at least substantially complementary to the antisense strand.

[0054] In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising a nucleobase sequence that differs by zero or one nucleobase from the nucleotide sequence (5'→3')UUCUUGUCCAGCUUUAUUGGC (SEQ ID NO: 8). In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')UUCUUGUCCAGCUUUAUUGGC (SEQ ID NO: 8), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising a nucleobase sequence that differs by zero or one nucleobase from the nucleotide sequence (5'→3')UUCUUGUCCAGCUUUAUUGGC (SEQ ID NO: 8), wherein SEQ ID NO: 8 is located at positions 1-21 (5'→3') of the antisense strand.

[0055] In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising, a modified nucleotide sequence differing by no more than one nucleotide from the nucleotide sequence (5'→3')usUfscsUfuGfuCfcAfgCfuUfuAfuUfgGfsc (SEQ ID NO: 7) (wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage), and wherein the sense strand is at least substantially complementary to the antisense strand. In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising the nucleotide sequence (5'→3')usUfscsUfuGfuCfcAfgCfuUfuAfuUfgGfsc (SEQ ID NO: 7) (wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage), and wherein the sense strand is at least substantially complementary to the antisense strand.

[0056] In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising, a nucleobase sequence that differs by zero or one nucleobase from the nucleotide sequence (5'→3') AGAAUACUGUCCCUUUUAGGG (SEQ ID NO: 10). In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising, a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3') AGAAUACUGUCCCUUUUAGGG (SEQ ID NO: 10), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising, a nucleobase sequence that differs by zero or one nucleobase from the nucleotide sequence (5'→3') AGAAUACUGUCCCUUUUAGGG (SEQ ID NO: 10), wherein SEQ ID NO: 10 is located at positions 1-21 (5'→3') of the antisense strand.

[0057] In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising, a modified nucleotide sequence differing by no more than one nucleotide from the nucleotide sequence (5'→3')asGfsasAfuAfcUfgUfcCfcUfuUfuAfgGfsg (SEQ ID NO: 9) (wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage), and wherein the sense strand is at least substantially complementary to the antisense strand. In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising the nucleotide sequence (5'→3')asGfsasAfuAfcUfgUfcCfcUfuUfuAfgGfsg (SEQ ID NO: 9) (wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage), and wherein the sense strand is at least substantially complementary to the antisense strand.

[0058] In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising, a nucleobase sequence that differs by zero or one nucleobase from the nucleotide sequence (5'→3') AGAAUACUGUCCCUUUUAAGC (SEQ ID NO: 12). In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising, a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3') AGAAUACUGUCCCUUUUAAGC (SEQ ID NO: 12), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising, a nucleobase sequence that differs by zero or one nucleobase from the nucleotide sequence (5'→3') AGAAUACUGUCCCUUUUAAGC (SEQ ID NO: 12), wherein SEQ ID NO: 12 is located at positions 1-21 (5'→3') of the antisense strand.

[0059] In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising, a modified nucleotide sequence differing by no more than one nucleotide from the nucleotide sequence (5'→3')asGfsasAfuAfcUfgUfcCfcUfuUfuAfaGfsc (SEQ ID NO: 11) (wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage), and wherein the sense strand is at least substantially complementary to the antisense strand. In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising the nucleotide sequence (5'→3')asGfsasAfuAfcUfgUfcCfcUfuUfuAfaGfsc (SEQ ID NO: 11) (wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage), and wherein the sense strand is at least substantially complementary to the antisense strand.

[0060] In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising a nucleobase sequence that differs by zero or one nucleobase from the nucleotide sequence (5'→3')UGAGAAUACUGUCCCUUUGCC (SEQ ID NO: 14). In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')UGAGAAUACUGUCCCUUUGCC (SEQ ID NO: 14), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising a nucleobase sequence that differs by zero or one nucleobase from the nucleotide sequence (5'→3')UGAGAAUACUGUCCCUUUGCC (SEQ ID NO: 14), wherein SEQ ID NO: 14 is located at positions 1-21 (5'→3') of the antisense strand.

[0061] In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising, a modified nucleotide sequence differing by no more than one nucleotide from the nucleotide sequence (5'→3')usGfsasGfaAfuAfcUfgUfcCfcUfuUfgcsc (SEQ ID NO: 13) (wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage), and wherein the sense strand is at least substantially complementary to the antisense strand. In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising the nucleotide sequence (5'→3')usGfsasGfaAfuAfcUfgUfcCfcUfuUfgcsc (SEQ ID NO: 13) (wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage), and wherein the sense strand is at least substantially complementary to the antisense strand.

[0062] In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising a nucleobase sequence that differs by 0 or 1 nucleobase from the nucleotide sequence (5'→3')UCACUGAGAAUACUGUCCCUC (SEQ ID NO: 3) and a sense strand consisting essentially of, or comprising a nucleobase sequence that differs by 0 or 1 nucleobase from the nucleotide sequence (5'→3')GAGGGACAGUAUUCUCAGUIA (SEQ ID NO: 16). (I represents an inosine nucleotide) In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')UCACUGAGAAUACUGUCCCUC (SEQ ID NO: 3), wherein all or substantially all of the nucleotides are modified nucleotides, and a sense strand consisting essentially of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')GAGGGACAGUAUUCUCAGUIA (SEQ ID NO: 16), wherein all or substantially all of the nucleotides are modified nucleotides.

[0063] In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising a nucleobase sequence that differs by 0 or 1 nucleobase from the nucleotide sequence (5'→3')UCACUGAGAAUACUGUCCCGU (SEQ ID NO: 5), and a sense strand consisting essentially of, or comprising a nucleobase sequence that differs by 0 or 1 nucleobase from the nucleotide sequence (5'→3')ACGGGACAGUAUUCUCAGUIA (SEQ ID NO: 18). (I represents an inosine nucleotide.) In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')UCACUGAGAAUACUGUCCCGU (SEQ ID NO: 5), wherein all or substantially all of the nucleotides are modified nucleotides, and a sense strand consisting essentially of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')ACGGGACAGUAUUCUCAGUIA (SEQ ID NO: 18), wherein all or substantially all of the nucleotides are modified nucleotides.

[0064] In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising, a nucleobase sequence differing by zero or one nucleobase from the nucleotide sequence (5'→3')UCACUGAGAAUACUGUCCCUC (SEQ ID NO: 3), and a sense strand consisting essentially of, or comprising, a nucleobase sequence differing by zero or one nucleobase from the nucleotide sequence (5'→3')GAGGGACAGUAUUCUCAGUGA (SEQ ID NO: 21). In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising, a nucleotide sequence differing by no more than one nucleotide from the nucleotide sequence (5'→3')UCACUGAGAAUACUGUCCCUC (SEQ ID NO: 3), wherein all or substantially all of the nucleotides are modified nucleotides, and a sense strand consisting essentially of, or comprising, a nucleotide sequence differing by no more than one nucleotide from the nucleotide sequence (5'→3')GAGGGACAGUAUUCUCAGUGA (SEQ ID NO: 21), wherein all or substantially all of the nucleotides are modified nucleotides.

[0065] In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising a nucleobase sequence differing by zero or one nucleobase from the nucleotide sequence (5'→3')UUCUUGUCCAGCUUUAUUGGC (SEQ ID NO: 8) and a sense strand consisting essentially of, or comprising a nucleobase sequence differing by zero or one nucleobase from the nucleotide sequence (5'→3')GCCAAUAAAGCUGGACAAGAA (SEQ ID NO: 23). In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising a nucleotide sequence differing by no more than one nucleotide from the nucleotide sequence (5'→3')UUCUUGUCCAGCUUUAUUGGC (SEQ ID NO: 8), wherein all or substantially all of the nucleotides are modified nucleotides, and a sense strand consisting essentially of, or comprising a nucleotide sequence differing by no more than one nucleotide from the nucleotide sequence (5'→3')GCCAAUAAAGCUGGACAAGAA (SEQ ID NO: 23), wherein all or substantially all of the nucleotides are modified nucleotides.

[0066] In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising a nucleobase sequence differing by zero or one nucleobase from the nucleotide sequence (5'→3')UUCUUGUCCAGCUUUAUUGGC (SEQ ID NO: 8) and a sense strand consisting essentially of, or comprising a nucleobase sequence differing by zero or one nucleobase from the nucleotide sequence (5'→3')GCCAAUAAAICUGGACAAGAA (SEQ ID NO: 25). In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising a nucleotide sequence differing by no more than one nucleotide from the nucleotide sequence (5'→3')UUCUUGUCCAGCUUUAUUGGC (SEQ ID NO: 8), wherein all or substantially all of the nucleotides are modified nucleotides, and a sense strand consisting essentially of, or comprising a nucleotide sequence differing by no more than one nucleotide from the nucleotide sequence (5'→3')GCCAAUAAAICUGGACAAGAA (SEQ ID NO: 25), wherein all or substantially all of the nucleotides are modified nucleotides.

[0067] In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising a nucleobase sequence that differs by 0 or 1 nucleobase from the nucleotide sequence (5'→3') AGAAUACUGUCCCUUUUAGGG (SEQ ID NO: 10) and a sense strand consisting essentially of, or comprising a nucleobase sequence that differs by 0 or 1 nucleobase from the nucleotide sequence (5'→3') CCCUAAAAGGGACAGUAUUCU (SEQ ID NO: 27). In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')AGAAUACUGUCCCUUUUAGGG (SEQ ID NO: 10), wherein all or substantially all of the nucleotides are modified nucleotides, and a sense strand consisting essentially of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')CCCUAAAAGGGACAGUAUUCU (SEQ ID NO: 27), wherein all or substantially all of the nucleotides are modified nucleotides.

[0068] In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising a nucleobase sequence that differs by 0 or 1 nucleobase from the nucleotide sequence (5'→3') AGAAUACUGUCCCUUUUAAGC (SEQ ID NO: 12) and a sense strand consisting essentially of, or comprising a nucleobase sequence that differs by 0 or 1 nucleobase from the nucleotide sequence (5'→3') GCUUAAAAGGGACAGUAUUCU (SEQ ID NO: 29). In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3') AGAAUACUGUCCCUUUUAAGC (SEQ ID NO: 12), wherein all or substantially all of the nucleotides are modified nucleotides, and a sense strand consisting essentially of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3') GCUUAAAAGGGACAGUAUUCU (SEQ ID NO: 29), wherein all or substantially all of the nucleotides are modified nucleotides.

[0069] In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising, a nucleobase sequence differing by zero or one nucleobase from the nucleotide sequence (5'→3')UGAGAAUACUGUCCCUUUGCC (SEQ ID NO: 14) and a sense strand consisting essentially of, or comprising, a nucleobase sequence differing by zero or one nucleobase from the nucleotide sequence (5'→3')GGCAAAGGGACAGUAUUCUCA (SEQ ID NO: 31). In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising, a nucleotide sequence differing by no more than one nucleotide from the nucleotide sequence (5'→3')UGAGAAUACUGUCCCUUUGCC (SEQ ID NO: 14), wherein all or substantially all of the nucleotides are modified nucleotides, and a sense strand consisting essentially of, or comprising, a nucleotide sequence differing by no more than one nucleotide from the nucleotide sequence (5'→3')GGCAAAGGGACAGUAUUCUCA (SEQ ID NO: 31), wherein all or substantially all of the nucleotides are modified nucleotides.

[0070] In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usCfsasCfuGfagaauAfcUfgUfcCfcUfsc (SEQ ID NO: 2), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3')gagggacaGfUfAfuucucaguia (SEQ ID NO: 15), where a, c, g, i, and u represent 2'-O-methyladenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage. In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usCfsasCfuGfagaauAfcUfgUfcCfcUfsc (SEQ ID NO: 2), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3')gagggacaGfUfAfuucucaguia (SEQ ID NO: 15), wherein the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises N-acetyl-galactosamine.

[0071] In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usCfsasCfuGfagaauAfcUfgUfcCfcGfsu (SEQ ID NO: 4), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3')acgggacaGfUfAfuucucaguia (SEQ ID NO: 17), where a, c, g, i, and u represent 2'-O-methyladenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage. In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usCfsasCfuGfagaauAfcUfgUfcCfcGfsu (SEQ ID NO: 4), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3')acgggacaGfUfAfuucucaguia (SEQ ID NO: 17), wherein the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises N-acetyl-galactosamine.

[0072] In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usCfsascugagaauAfcUfgUfcCfcUfsc (SEQ ID NO: 6), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3')gagggacaGfuAfuUfcucaguia (SEQ ID NO: 19), where a, c, g, i, and u represent 2'-O-methyladenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage. In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usCfsascugagaauAfcUfgUfcCfcUfsc (SEQ ID NO: 6), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3')gagggacaGfuAfuUfcucaguia (SEQ ID NO: 19), wherein the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises N-acetyl-galactosamine.

[0073] In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usCfsasCfuGfagaauAfcUfgUfcCfcUfsc (SEQ ID NO: 2), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3')gagggacaGfUfAfuucucaguga (SEQ ID NO: 20), where a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage. In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usCfsasCfuGfagaauAfcUfgUfcCfcUfsc (SEQ ID NO: 2), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3')gagggacaGfUfAfuucucaguga (SEQ ID NO: 20), wherein the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises N-acetyl-galactosamine.

[0074] In some embodiments, the APOC3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usUfscsUfuGfuCfcAfgCfuUfuAfuUfgGfsc (SEQ ID NO: 7), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3')gccaauaaAfGfCfuggacaagaa (SEQ ID NO: 22), where a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage. The RNAi agent comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usUfscsUfuGfuCfcAfgCfuUfuAfuUfgGfsc (SEQ ID NO: 7), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3')gccaauaaAfGfCfuggacaagaa (SEQ ID NO: 22), wherein the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence, and wherein the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises N-acetyl-galactosamine.

[0075] In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usUfscsUfuGfuCfcAfgCfuUfuAfuUfgGfsc (SEQ ID NO: 7), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3')gccaauaaAfIfCfuggacaagaa (SEQ ID NO: 24), where a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, If, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, inosine, or uridine, respectively; and s represents a phosphorothioate linkage. In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usUfscsUfuGfuCfcAfgCfuUfuAfuUfgGfsc (SEQ ID NO: 7), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3')gccaauaaAfIfCfuggacaagaa (SEQ ID NO: 24), wherein the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises N-acetyl-galactosamine.

[0076] In some embodiments, the APOC3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3') asGfsasAfuAfcUfgUfcCfcUfuUfuAfgGfsg (SEQ ID NO: 9), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3') cccuaaaaGfGfGfacaguauucu (SEQ ID NO: 26), where a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage. The RNAi agent comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')asGfsasAfuAfcUfgUfcCfcUfuUfuAfgGfsg (SEQ ID NO: 9), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3')cccuaaaaGfGfGfacaguauucu (SEQ ID NO: 26), wherein the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence, and wherein the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises N-acetyl-galactosamine.

[0077] In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3') asGfsasAfuAfcUfgUfcCfcUfuUfuAfaGfsc (SEQ ID NO: 11), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3') gcuuaaaaGfGfGfacaguauucu (SEQ ID NO: 28), where a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage. In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')asGfsasAfuAfcUfgUfcCfcUfuUfuAfaGfsc (SEQ ID NO: 11), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3')gcuuaaaaGfGfGfacaguauucu (SEQ ID NO: 28), wherein the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises N-acetyl-galactosamine.

[0078] In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usGfsasGfaAfuAfcUfgUfcCfcUfuUfgcsc (SEQ ID NO: 13), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3')ggcaaaggGfAfCfaguauucuca (SEQ ID NO: 30), where a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage. In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usGfsasGfaAfuAfcUfgUfcCfcUfuUfgcsc (SEQ ID NO: 13), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3')ggcaaaggGfAfCfaguauucuca (SEQ ID NO: 30), wherein the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises N-acetyl-galactosamine.

[0079] In some embodiments, the APOC3 RNAi agent disclosed herein has the following nucleotide sequence (5'→3'): [ka] and an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs by zero or one nucleotide from one of the APOC3 RNAi agents, and the APOC3 RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; and all or substantially all of the nucleotides in both the antisense strand and the sense strand are modified nucleotides.

[0080] In some embodiments, the APOC3 RNAi agent disclosed herein has the following nucleotide sequence (5'→3'): [ka] wherein the APOC3 RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; all or substantially all of the nucleotides in both the antisense strand and the sense strand are modified nucleotides; the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence; the sense strand also comprises a targeting ligand covalently linked to the 5' end; and the targeting ligand comprises N-acetyl-galactosamine.

[0081] In some embodiments, the APOC3 RNAi agent disclosed herein has the following nucleotide sequence (5'→3'): [ka] wherein the APOC3 RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; all or substantially all of the nucleotides in both the antisense strand and the sense strand are modified nucleotides; the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence; the sense strand also comprises a targeting ligand covalently linked to the 5' end; the targeting ligand comprises N-acetyl-galactosamine, and each of the antisense strand sequences is located at positions 1-21 of the antisense strand.

[0082] In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand and a sense strand, wherein the antisense strand and the sense strand have the following nucleotide sequence (5'→3') pair: [ka] [ka] wherein all or substantially all of the nucleotides in both the antisense and sense strands are modified nucleotides.

[0083] In some embodiments, an APOC3 RNAi agent disclosed herein comprises an antisense strand and a sense strand, wherein the antisense strand and the sense strand have the following nucleotide sequence (5'→3') pair: [ka] wherein all or substantially all of the nucleotides in both the antisense strand and the sense strand are modified nucleotides; the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence; the sense strand also comprises a targeting ligand covalently linked to the 5' end; and the targeting ligand comprises N-acetyl-galactosamine.

[0084] In some embodiments, the APOC3 RNAi agent disclosed herein has the following nucleotide sequence (5'→3'): [ka] (wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage), wherein the APOC3 RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand, and wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides.

[0085] In some embodiments, the APOC3 RNAi agent disclosed herein has the following nucleotide sequence (5'→3'): [ka] wherein the APOC3 RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; all or substantially all of the nucleotides of the sense strand are modified nucleotides; all or substantially all of the nucleotides of both the antisense strand and the sense strand are modified nucleotides; the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence; the sense strand also comprises a targeting ligand covalently linked to the 5' end; and the targeting ligand comprises N-acetyl-galactosamine.

[0086] In some embodiments, the APOC3 RNAi agents disclosed herein comprise the following nucleotide sequence pair (5'→3'): [ka] (wherein a, c, g, i, and u represent 2'-O-methyladenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, If, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, inosine, or uridine, respectively; and s represents a phosphorothioate linkage), including antisense and sense strands consisting of, consisting essentially of, or comprising modified nucleotide sequences differing by 0 or 1 nucleotide from one of the following:

[0087] In some embodiments, the APOC3 RNAi agents disclosed herein comprise the following nucleotide sequence pair (5'→3'): [ka] [ka] (wherein a, c, g, i, and u represent 2'-O-methyladenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, If, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, inosine, or uridine, respectively; and s represents a phosphorothioate linkage), wherein the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises N-acetyl-galactosamine.

[0088] In some embodiments, an APOC3 RNAi agent disclosed herein comprises (5'→3'): [ka] and an antisense strand comprising a nucleobase sequence that differs by 0 or 1 nucleobase from the nucleotide sequence selected from the group consisting of:

[0089] In some embodiments, an APOC3 RNAi agent disclosed herein comprises (5'→3'): [ka] and an antisense strand comprising a nucleobase sequence that differs by 0 or 1 nucleobase from a nucleotide sequence selected from the group consisting of: wherein all or substantially all of the nucleotides are modified nucleotides.

[0090] In some embodiments, an APOC3 RNAi agent disclosed herein comprises (5'→3'): [ka] and an antisense strand comprising a nucleobase sequence that differs by 0 or 1 nucleobase from a nucleotide sequence selected from the group consisting of: wherein all or substantially all of the nucleotides are modified nucleotides, and wherein SEQ ID NO:49, SEQ ID NO:53, SEQ ID NO:57, SEQ ID NO:58, or SEQ ID NO:106 are located at nucleotide positions 1 to 19 (5'→3') of the antisense strand, respectively.

[0091] In some embodiments, the APOC3 RNAi agents disclosed herein each comprise (5'→3'): [ka] [ka] The nucleotide sequence pair includes an antisense strand and a sense strand that contain a nucleobase sequence that differs by 0 or 1 nucleobase from the nucleotide sequence pair selected from the group consisting of:

[0092] In some embodiments, the APOC3 RNAi agents disclosed herein each comprise (5'→3'): [ka] and an antisense strand and a sense strand comprising a nucleobase sequence that differs by 0 or 1 nucleobase from a nucleotide sequence pair selected from the group consisting of: wherein all or substantially all of the nucleotides are modified nucleotides.

[0093] As used herein, the terms "oligonucleotide" and "polynucleotide" each refer to a polymer of linked nucleosides, which may or may not independently be modified.

[0094] As used herein, "RNAi agent" (also referred to as "RNAi trigger") refers to a composition containing an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that can degrade or inhibit (e.g., under appropriate conditions) translation of a messenger RNA (mRNA) transcript of a target mRNA in a sequence-specific manner. As used herein, an RNAi agent can operate via the RNA interference mechanism (i.e., inducing RNA interference by interacting with the RNA interference pathway machinery (RNA-induced silencing complex or RISC) in mammalian cells) or any alternative mechanism or pathway. Although RNAi agents, as that term is used herein, are considered to operate primarily via the RNA interference mechanism, the disclosed RNAi agents are not constrained by or limited to any particular pathway or mechanism of action. RNAi agents disclosed herein include sense and antisense strands and include, but are not limited to, short (or small) interfering RNAs (siRNAs), double-stranded RNAs (dsRNAs), microRNAs (miRNAs), short hairpin RNAs (shRNAs), and Dicer substrates. The antisense strand of the RNAi agent described herein is at least partially complementary to the targeted mRNA (i.e., APOC3 mRNA). The RNAi agent may contain one or more modified nucleotides and / or one or more non-phosphodiester linkages.

[0095] As used herein, the terms "silencing," "reducing," "inhibiting," "downregulating," or "knockdown," when referring to the expression of a given gene, mean that expression of the gene, as measured by the level of RNA transcribed from the gene or the level of polypeptide, protein, or protein subunit translated from the mRNA, is decreased in a cell, group of cells, tissue, organ, or subject in which the gene is transcribed, when the cell, group of cells, tissue, organ, or subject is treated with an RNAi agent as described herein, compared to a second cell, group of cells, tissue, organ, or subject that is not so treated.

[0096] As used herein, the terms "sequence" and "nucleotide sequence" mean a sequence or order of nucleic acid bases or nucleotides written with a sequence of letters using standard nomenclature.

[0097] As used herein, "base," "nucleotide base," or "nucleobase" refers to a heterocyclic pyrimidine or purine compound that is a component of nucleotide, including the primary purine bases adenine and guanine, and the primary pyrimidine bases cytosine, thymine, and uracil. Nucleobases can be further modified to include, but are not limited to, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases (see, for example, Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008). The synthesis of such modified nucleobases (including phosphoramidite compounds containing modified nucleobases) is known in the art.

[0098] As used herein, and unless otherwise indicated, the term "complementary" when used to describe a first nucleobase or nucleotide sequence (e.g., an RNAi agent sense strand or a target mRNA) in relation to a second nucleobase or nucleotide sequence (e.g., an RNAi agent antisense strand or a single-stranded antisense oligonucleotide) refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize (form base-pair hydrogen bonds under mammalian physiological conditions (or similar conditions in vitro)) with an oligonucleotide or polynucleotide comprising the second nucleotide sequence to form a double-stranded or double-helical structure under certain standard conditions. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include natural or modified nucleotides or nucleotide mimics, at least to the extent that the above hybridization requirements are met. Sequence identity or complementarity is independent of modifications. For example, as defined herein, a and Af are complementary to U (or T) and identical to A for purposes of determining identity or complementarity.

[0099] As used herein, "perfectly complementary" or "fully complementary" means that in a hybridized pair of nucleic acid base or nucleotide sequence molecules, all (100%) of the bases in a contiguous sequence of a first oligonucleotide hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may include all or a portion of the first or second nucleotide sequence.

[0100] As used herein, "partially complementary" means that in a hybridized pair of nucleic acid base or nucleotide sequence molecules, at least 70%, but not all, of the bases in a contiguous sequence of a first oligonucleotide hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may include all or a portion of the first or second nucleotide sequence.

[0101] As used herein, "substantially complementary" means that in a hybridized pair of nucleic acid or nucleotide sequence molecules, at least 85%, but not all, of the bases in a contiguous sequence of a first oligonucleotide hybridize to the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may include all or a portion of the first or second nucleotide sequence.

[0102] As used herein, the terms "complementary," "fully complementary," "partially complementary," and "substantially complementary" are used in reference to nucleobase or nucleotide matches between the sense and antisense strands of an RNAi agent, or between the antisense strand of an RNAi agent and the sequence of APOC3 mRNA.

[0103] As used herein, the term "substantially identical" or "substantial identity" applied to a nucleic acid sequence means that a nucleotide sequence (or a portion of a nucleotide sequence) has at least about 85% sequence identity or higher, for example, at least 90%, at least 95%, or at least 99% identity, compared to a reference sequence. The percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window. The percentage is calculated by determining the number of positions where the same type of nucleobase is present in both sequences, obtaining the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. The invention disclosed herein encompasses nucleotide sequences that are substantially identical to those disclosed herein.

[0104] As used herein, the terms "treat," "treatment," and the like refer to methods or steps taken to provide relief from or a reduction in the number, severity, and / or frequency of one or more symptoms of a disease in a subject. As used herein, "treat" and "treatment" may include preventative treatment, management, prophylactic treatment, and / or inhibition or reduction of the number, severity, and / or frequency of one or more symptoms of a disease in a subject.

[0105] As used herein, the phrase "introducing into a cell" when referring to an RNAi agent means functionally delivering the RNAi agent into a cell.The phrase "functionally delivering" means delivering the RNAi agent into a cell in a manner that allows the RNAi agent to have the expected biological activity, for example, sequence-specific inhibition of gene expression.

[0106] Unless otherwise stated, symbols used herein [ka] The use of means that any group or groups can be attached thereto in accordance with the scope of the invention described herein.

[0107] As used herein, the term "isomers" refers to compounds that have identical molecular formulae but differ in the nature or sequence of bonding of their atoms or the arrangement of their atoms in space. Isomers that differ in the arrangement of their atoms in space are called "stereoisomers." Stereoisomers that are not mirror images of one another are called "diastereoisomers," and stereoisomers that are non-superimposable mirror images are called "enantiomers" or sometimes optical isomers. A carbon atom bonded to four non-identical substituents is called a "chiral center."

[0108] As used herein, unless specifically identified in a structure as having a particular conformation, for each structure in which asymmetric centers exist and thus give rise to enantiomers, diastereomers, or other stereoisomeric configurations, each structure disclosed herein is intended to represent all such possible isomers, including its optically pure and racemic forms. For example, a structure disclosed herein is intended to encompass mixtures of diastereomers as well as single stereoisomers.

[0109] As used in the claims of this specification, the phrase "consisting of The phrase "consisting essentially of" excludes any element, step, or ingredient not specified in the claim. As used in the claims herein, the phrase "consisting essentially of" limits the claim to the specified materials or steps and those that do not materially affect the basic and novel characteristics of the claimed invention.

[0110] Those skilled in the art will readily understand and appreciate that the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or S atoms) in a protonated or deprotonated state depending on the environment in which the compound or composition is placed. Thus, as used herein, the structures disclosed herein contemplate that certain functional groups, such as, for example, OH, SH, or NH, may be protonated or deprotonated. The disclosure herein is intended to encompass the disclosed compounds and compositions regardless of their protonation state based on the environment (e.g., pH), as will be readily understood by those skilled in the art.

[0111] As used herein, the term "linked" or "conjugated," when referring to a connection between two compounds or molecules, means that the two compounds or molecules are joined by a covalent bond. Unless otherwise stated, the terms "linked" and "conjugated," as used herein, may refer to a connection between a first compound and a second compound with or without any intervening atom or group of atoms.

[0112] As used herein, the term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to." The term "or" is used herein to mean, and is used interchangeably with, the term "and / or," unless context clearly indicates otherwise.

[0113] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art.Methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, and suitable methods and materials are described below.All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety.In case of conflict, the present specification, including definitions, will control.In addition, materials, methods, and examples are merely illustrative and are not intended to be limiting.

[0114] Other objects, features, aspects, and advantages of the present invention will become apparent from the following detailed description, the accompanying drawings, and the claims. [Brief explanation of the drawings]

[0115] [Figure 1-1]Figure 1A is a schematic diagram of the modified sense and antisense strands of APOC3 RNAi agent AD05251 (see Tables 4-6) conjugated to a tridentate N-acetyl-galactosamine-containing targeting ligand having the (NAG37)s structure (see Table 7). Figure 1A discloses SEQ ID NOs: 2 and 501.

[0116] In Figures 1A-1I, the following abbreviations are used: a, c, g, i, and u are 2'-O-methyl modified nucleotides (for i, the nucleobase is hypoxanthine (i.e., the base of an inosine nucleotide)); Af, Cf, Gf, If, and Uf are 2'-fluoro modified nucleotides (for I, the nucleobase is hypoxanthine (i.e., the base of an inosine nucleotide)); p is a phosphodiester bond; s is a phosphorothioate bond; invAb is an inverted abasic (deoxyribose) residue (see Table 7); and (NAG37)s is a tridentate N-acetyl-galactosamine targeting ligand having the structure shown in Table 7.

[0117] Figure 1B is a schematic diagram of the modified sense and antisense strands of APOC3 RNAi agent AD05876 (see Tables 4-6) conjugated to a tridentate N-acetyl-galactosamine-containing targeting ligand having the (NAG37)s structure (see Table 7). Figure 1B discloses SEQ ID NOs: 4 and 572.

[0118] Figure 1C is a schematic diagram of the modified sense and antisense strands of the APOC3 RNAi agent AD05769 (see Tables 4-6) conjugated to a tridentate N-acetyl-galactosamine-containing targeting ligand having the (NAG37)s structure (see Table 7). Figure 1C discloses SEQ ID NOs: 6 and 557.

[0119] [Figure 1-2]Figure ID is a schematic diagram of the modified sense and antisense strands of APOC3 RNAi agent AD05169 (see Tables 4-6) conjugated to a tridentate N-acetyl-galactosamine-containing targeting ligand having the (NAG37)s structure (see Table 7). Figure ID discloses SEQ ID NOs: 2 and 482.

[0120] Figure 1E is a schematic diagram of the modified sense and antisense strands of the APOC3 RNAi agent AD05220 (see Tables 4-6) conjugated to a tridentate N-acetyl-galactosamine-containing targeting ligand having the (NAG37)s structure (see Table 7). Figure 1E discloses SEQ ID NOs: 7 and 494.

[0121] Figure 1F is a schematic diagram of the modified sense and antisense strands of APOC3 RNAi agent AD05547 (see Tables 4-6) conjugated to a tridentate N-acetyl-galactosamine-containing targeting ligand having the (NAG37)s structure (see Table 7). Figure 1F discloses SEQ ID NOs: 7 and 545.

[0122] [Figure 1-3] Figure 1G is a schematic diagram of modified sense and antisense strands of APOC3 RNAi agent AD05299 (see Tables 4-6) conjugated to a tridentate N-acetyl-galactosamine-containing targeting ligand having the (NAG37)s structure (see Table 7). Figure 1G discloses SEQ ID NOs: 9 and 521.

[0123] Figure 1H is a schematic diagram of modified sense and antisense strands of APOC3 RNAi agent AD05223 (see Tables 4-6) conjugated to a tridentate N-acetyl-galactosamine-containing targeting ligand having the (NAG37)s structure (see Table 7). Figure 1H discloses SEQ ID NOs: 11 and 497.

[0124] Figure 1I is a schematic diagram of modified sense and antisense strands of APOC3 RNAi agent AD05171 (see Tables 4-6) conjugated to a tridentate N-acetyl-galactosamine-containing targeting ligand having the (NAG37)s structure (see Table 7). Figure 1A discloses SEQ ID NOs: 13 and 483.

[0125] [Figure 2A] 2A-2D are chemical structural representations of APOC3 RNAi agent AD05251, which contains a tridentate N-acetyl-galactosamine-containing targeting ligand (having the (NAG37)s structure) conjugated at the 5' end of the sense strand, shown as the free acid. [Figure 2B] Same as above. [Figure 2C] Same as above. [Figure 2D] Same as above.

[0126] [Figure 3A] 3A-3D are chemical structural representations of APOC3 RNAi agent AD05251, which includes a tridentate N-acetyl-galactosamine-containing targeting ligand (having the (NAG37)s structure) conjugated at the 5' end of the sense strand, shown as the sodium salt. [Figure 3B] Same as above. [Figure 3C] Same as above. [Figure 3D] Same as above.

[0127] [Figure 4A] 4A-4D are chemical structural representations of APOC3 RNAi agent AD05876, which includes a tridentate N-acetyl-galactosamine-containing targeting ligand (having the (NAG37)s structure) conjugated at the 5' end of the sense strand, shown as the free acid. [Figure 4B] Same as above. [Figure 4C] Same as above. [Figure 4D] Same as above.

[0128] [Figure 5A]5A-5D are chemical structural representations of APOC3 RNAi agent AD05876, which includes a tridentate N-acetyl-galactosamine-containing targeting ligand (having the (NAG37)s structure) conjugated at the 5' end of the sense strand, shown as the sodium salt. [Figure 5B] Same as above. [Figure 5C] Same as above. [Figure 5D] Same as above.

[0129] [Figure 6A] 6A-6D are chemical structural representations of APOC3 RNAi agent AD05220, which includes a tridentate N-acetyl-galactosamine-containing targeting ligand (having the (NAG37)s structure) conjugated at the 5' end of the sense strand, shown as the free acid. [Figure 6B] Same as above. [Figure 6C] Same as above. [Figure 6D] Same as above.

[0130] [Figure 7A] 7A-7D are chemical structural representations of APOC3 RNAi agent AD05220, which includes a tridentate N-acetyl-galactosamine-containing targeting ligand (having the (NAG37)s structure) conjugated at the 5' end of the sense strand, shown as the sodium salt. [Figure 7B] Same as above. [Figure 7C] Same as above. [Figure 7D] Same as above. DETAILED DESCRIPTION OF THE INVENTION

[0131] Detailed Description RNAi agents Described herein are RNAi agents for inhibiting expression of the APOC3 gene (also referred to herein as APOC3 RNAi agents or APOC3 RNAi triggers). Each APOC3 RNAi agent includes a sense strand and an antisense strand. The sense strand and antisense strand may each be 16-30 nucleotides in length. The sense and antisense strands may be the same length or different lengths. In some embodiments, the sense and antisense strands are each independently 17-27 nucleotides in length. In some embodiments, the sense and antisense strands are each independently 17-21 nucleotides in length. In some embodiments, the sense and antisense strands are each 21-26 nucleotides in length. In some embodiments, the sense and antisense strands are each 21-24 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length, while the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides in length, while the antisense strand is about 23 nucleotides in length. In some embodiments, sense strand is 23 nucleotides long, and antisense strand is 21 nucleotides long.In some embodiments, both sense strand and antisense strand are 21 nucleotides long.In some embodiments, the sense strand and antisense strand of RNAi agent are each independently 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 nucleotides long.In some embodiments, double-stranded RNAi agent has a duplex length of about 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides.

[0132] In some embodiments, the region of perfect, substantial, or partial complementarity between the sense strand and the antisense strand is 16 to 26 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides in length and is located at or near the 5' end of the antisense strand (e.g., this region can be separated from the 5' end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides that are not perfect, substantial, or partial complementarity).

[0133] The sense strand and antisense strand each contain a core stretch (also referred to herein as a "core sequence" or "core stretch sequence") that is 16 to 23 nucleotides in length. The antisense strand core stretch is 100% (perfectly) complementary or at least about 85% (substantially) complementary to a nucleotide sequence present in the APOC3 mRNA target (e.g., sometimes referred to as a target sequence). The sense strand core stretch sequence is 100% (perfectly) complementary or at least about 85% (substantially) complementary to the core stretch sequence in the antisense strand; thus, the sense strand core stretch sequence is typically perfectly identical or at least about 85% identical to the nucleotide sequence present in the APOC3 mRNA target (target sequence). The sense strand core stretch sequence may be the same length as the corresponding antisense core sequence, or may be a different length. In some embodiments, the antisense strand core stretch sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the sense strand core stretch sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.

[0134] Examples of sense and antisense strand nucleotide sequences used to form APOC3 RNAi agents are provided in Tables 2, 3, 4, and 5. Examples of RNAi agent duplexes comprising the sense and antisense strand sequences in Tables 2, 4, and 5 are shown in Table 6.

[0135] The sense and antisense strands of APOC3 RNAi agent are annealed to form a double strand.The sense and antisense strands of APOC3 RNAi agent can be partially, substantially, or completely complementary to each other.In the complementary double-stranded region, the core stretch sequence of the sense strand is at least 85% complementary or 100% complementary to the core stretch sequence of the antisense strand. In some embodiments, the sense strand core stretch sequence contains a sequence of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that is at least 85% or 100% complementary to a corresponding 16, 17, 18, 19, 20, 21, 22, or 23 nucleotide sequence of the antisense strand core stretch sequence (i.e., the sense and antisense core stretch sequences of an APOC3 RNAi agent have a region of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that are at least 85% base-paired or 100% base-paired).

[0136] In some embodiments, the antisense strand of an APOC3 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2, Table 3, or Table 4. In some embodiments, the sense strand of an APOC3 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2, Table 3, or Table 5.

[0137] The sense strand and / or the antisense strand may optionally and independently contain an additional 1, 2, 3, 4, 5, or 6 nucleotides (extension) at the 3' end, 5' end, or both the 3' and 5' ends of the core stretch sequence. If present, the additional nucleotides of the antisense strand may or may not be complementary to the corresponding sequence in the APOC3 mRNA. If present, the additional nucleotides of the antisense strand may or may not be complementary to the corresponding sequence in the APOC3 mRNA. It may or may not be identical to the corresponding sequence in the mRNA. If present, the additional nucleotides of the antisense strand may or may not be complementary to the corresponding additional nucleotides of the sense strand, if present.

[0138] As used herein, an extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5' and / or 3' end of the sense strand core stretch sequence and / or the antisense strand core stretch sequence. The extended nucleotides on the sense strand may or may not be complementary to any of the nucleotides in the core stretch sequence or the extended nucleotides in the corresponding antisense strand. Conversely, the extended nucleotides on the antisense strand may or may not be complementary to any of the nucleotides in the core stretch sequence or the extended nucleotides in the corresponding sense strand. In some embodiments, both the sense and antisense strands of an RNAi agent contain 3' and 5' extensions. In some embodiments, one or more of the 3' extended nucleotides of one strand are base-paired with one or more 5' extended nucleotides of the other strand. In other embodiments, one or more of the 3' extended nucleotides of one strand are not base-paired with one or more 5' extended nucleotides of the other strand. In some embodiments, an APOC3 RNAi agent has an antisense strand with a 3' extension and a sense strand with a 5' extension. In some embodiments, the extended nucleotide is not paired and forms a protrusion.As used herein, " protrusion " refers to one or more unpaired nucleotide stretches located at the end of sense strand or antisense strand, which do not form part of hybridized or double-stranded part of the RNAi agent disclosed herein.

[0139] In some embodiments, the APOC3 RNAi agent comprises an antisense strand having a 3' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, the APOC3 RNAi agent comprises an antisense strand having a 3' extension of 1, 2, or 3 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprises a uracil or thymidine nucleotide or a nucleotide complementary to the corresponding APOC3 mRNA sequence.

[0140] In some embodiments, the 3'-end of the antisense strand comprises an abasic residue (Ab), which can also be referred to as an "abasic site" or "abasic nucleotide." An abasic residue (Ab) is a nucleotide or nucleoside that lacks a nucleobase at the 1' position of the sugar moiety (see, for example, U.S. Patent No. 5,998,203). In some embodiments, Ab or AbAb can be added to the 3'-end of the antisense strand.

[0141] In some embodiments, the sense strand or antisense strand, as used herein, may include an "end cap," a non-nucleotide compound or other moiety that can be incorporated into one or more ends of the strand of an RNAi agent disclosed herein, which in some instances can provide the RNAi agent with certain beneficial properties, such as protection against exonuclease degradation. In some embodiments, an inverted abasic residue (invAb) is added to the end cap (see Table 76). (See, for example, F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16). End caps are commonly known in the art and include, for example, an inverted abasic residue and a carbon chain such as a terminal C3, C6, or C12 group. In some embodiments, the end cap is present at the 5' end, the 3' end, or both the 5' and 3' ends of the sense strand.

[0142] In some embodiments, the APOC3 RNAi agent comprises a sense strand with a 3' extension of 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprise adenosine, uracil, or thymidine nucleotides, AT dinucleotides, or nucleotides corresponding to nucleotides in the APOC3 mRNA sequence. In some embodiments, the 3' sense strand extension comprises or consists of one of the following sequences, but is not limited to: T, UT, TT, UU, UUT, TTT, or TTTT (listed from 5' to 3', respectively).

[0143] In some embodiments, the 3' end of the sense strand may include an additional abasic residue or an inverted abasic end cap. In some embodiments, a UUAb, UAb, or Ab is added to the 3' end of the sense strand.

[0144] In some embodiments, one or more inverted abasic residues (invAb) are added to the 3' end of the sense strand. In some embodiments, one or more inverted abasic residues or inverted abasic sites are inserted between the targeting ligand and the nucleobase sequence of the sense strand of the RNAi agent. In some embodiments, the inclusion of one or more inverted abasic residues or inverted abasic sites at or near the end or ends of the sense strand of the RNAi agent can enhance the activity or other desirable properties of the RNAi agent.

[0145] In some embodiments, the APOC3 RNAi agent comprises a sense strand having a 5' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides is a uracil or adenosine nucleotide or an APOC3 In some embodiments, the sense strand 5' extension comprises nucleotides corresponding to nucleotides in the mRNA sequence, including, but not limited to, the following sequences: CA, AUAGGC, AUAGG, AUAG, AUA, A, AA, AC, GCA, GGCA, GGC, UAUCA, UAUC, UCA, UAU, U, UU (listed from 5' to 3', respectively). The sense strand may have a 3' extension and / or a 5' extension.

[0146] In some embodiments, the 5' end of the sense strand may contain one or more additional abasic residues (e.g., (Ab) or (AbAb)). In some embodiments, one or more inverted abasic residues (invAb) are added to the 5' end of the sense strand. In some embodiments, one or more inverted abasic residues can be inserted between the targeting ligand and the nucleobase sequence of the sense strand of an RNAi agent. In some embodiments, the inclusion of one or more inverted abasic residues at or near the end or ends of the sense strand of an RNAi agent can enable enhanced activity or other desirable properties of the RNAi agent. In some embodiments, abasic (deoxyribose) residues can be replaced with ribitol (abasic ribose) residues.

[0147] In some embodiments, the 3' end of the antisense strand core stretch sequence or the 3' end of the antisense strand sequence may comprise an inverted abasic residue (invAb (see Table 7)).

[0148] Examples of sequences used in forming an APOC3 RNAi agent are provided in Tables 2, 3, 4, and 5. In some embodiments, the antisense strand of an APOC3 RNAi agent comprises any of the sequences in Tables 2, 3, or 4. In certain embodiments, an APOC3 The antisense strand of the RNAi agent comprises or consists of any one of the modified sequences in Table 4. In some embodiments, the antisense strand of the APOC3 RNAi agent comprises the sequence of nucleotides (from the 5' end to the 3' end) 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24 of any of the sequences in Table 2 or 4. In some embodiments, the sense strand of the APOC3 RNAi agent comprises the sequence of any of the sequences in Table 2 or 5. In some embodiments, the sense strand of an APOC3 RNAi agent comprises the sequence of nucleotides (from the 5' end to the 3' end) 1-18, 1-19, 1-20, 1-21, 1-22, 1-23, 1-24, 1-25, 1-26, 2-19, 2-20, 2-21, 2-22, 2-23, 2-24, 3-20, 3-21, 3-22, 3-23, 3-24, 4-21, 4-22, 4-23, 4-24, 5-22, 5-23, or 5-24 of any of the sequences in Table 2 or 5. In certain embodiments, the sense strand of an APOC3 RNAi agent comprises or consists of a modified sequence of any one of the modified sequences in Table 5.

[0149] In some embodiments, the sense and antisense strands of an RNAi agent described herein contain the same number of nucleotides. In some embodiments, the sense and antisense strands of an RNAi agent described herein contain different numbers of nucleotides. In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of an RNAi agent form blunt ends. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of an RNAi agent form blunt ends. In some embodiments, both ends of an RNAi agent form blunt ends. In some embodiments, neither end of an RNAi agent is blunt. As used herein, "blunt end" refers to the ends of a double-stranded RNAi agent where the terminal nucleotides of the two annealed strands are complementary (form complementary base pairs).

[0150] In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of an RNAi agent form a frayed end. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of an RNAi agent form a frayed end. In some embodiments, both ends of an RNAi agent form frayed ends. In some embodiments, neither end of an RNAi agent is a frayed end. As used herein, a frayed end refers to the end of a double-stranded RNAi agent where the terminal nucleotides of the two annealed strands are paired (i.e., do not form an overhang) but are not complementary (i.e., form a non-complementary pair). In some embodiments, one or more unpaired nucleotides at the end of one strand of a double-stranded RNAi agent form an overhang. The unpaired nucleotides may be in the sense strand or the antisense strand, creating a 3' or 5' overhang. In some embodiments, the RNAi agent contains a blunt end and a frayed end, a blunt end and a 5' overhang, a blunt end and a 3' overhang, a frayed end and a 5' overhang, a frayed end and a 3' overhang, two 5' overhangs, two 3' overhangs, a 5' overhang and a 3' overhang, two frayed ends, or two blunt ends. Typically, if present, the overhangs are located at the 3' end of the sense strand, the antisense strand, or both the sense and antisense strands.

[0151] Modified nucleotides, when used in various polynucleotide or oligonucleotide constructs, can retain the activity of these compounds while simultaneously increasing the serum stability of the compounds in cells, and can also minimize the potential for activating interferon activity in humans upon administration of the polynucleotide or oligonucleotide construct.

[0152] In some embodiments, the APOC3 RNAi agent is prepared or provided as a salt, mixed salt, or free acid.In some embodiments, the APOC3 RNAi agent is prepared as a sodium salt.Such forms that are well known in the art are within the scope of the invention disclosed herein.

[0153] Modified nucleotides In some embodiments, an APOC3 RNAi agent contains one or more modified nucleotides. As used herein, a "modified nucleotide" is a nucleotide other than a ribonucleotide (2'-hydroxyl nucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides include, but are not limited to, deoxyribonucleotides, nucleotide mimics, abasic nucleotides (referred to herein as Ab), 2'-modified nucleotides, 3'-3' linked (inverted) nucleotides (referred to herein as invdN, invN, invn), nucleotides containing modified nucleobases, bridged nucleotides, peptide nucleic acids (PNAs), 2',3'-seco nucleotide mimics (unlocked nucleobase analogs, referred to herein as N UNA or NUNA), locked nucleotides (referred to herein as N LNA or NLNA), 3'-O-methoxy (2' internucleoside linkage) nucleotides (referred to herein as 3'-OMen), 2'-F-arabinonucleotides (referred to herein as NfANA or Nf ANAnucleotides (represented herein as 5Me-Nf), 5'-Me, 2'-fluoro nucleotides (represented herein as 5Me-Nf), morpholino nucleotides, vinylphosphonate deoxyribonucleotides (represented herein as vpdN), vinylphosphonate-containing nucleotides, and cyclopropylphosphonate-containing nucleotides (cPrpN). 2'-modified nucleotides (i.e., nucleotides having a group other than a hydroxyl group at the 2' position of the five-membered sugar ring) include, but are not limited to, 2'-O-methyl nucleotides (represented herein as a lowercase "n" in nucleotide sequences), 2'-deoxy-2'-fluoro nucleotides (also referred to herein as 2'-fluoro nucleotides and represented herein as Nf), 2'-deoxy nucleotides (represented herein as dN), 2'-methoxyethyl (2'-O-2-methoxylethyl) nucleotides (also referred to herein as 2'-MOE and represented herein as NM), 2'-amino nucleotides, and 2'-alkyl nucleotides. All positions in a given compound do not need to be uniformly modified.On the contrary, more than one modification can be incorporated into a single APOC3 RNAi agent, or even into its single nucleotide.The sense strand and antisense strand of APOC3 RNAi agent can be synthesized and / or modified by methods known in the art.The modification at one nucleotide is independent of the modification at another nucleotide.

[0154] Modified nucleobases include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 2-methyl- ... These include synthetic and natural nucleobases such as uracil, 5-halouracil, cytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-sulfhydryl, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine and 3-deazaadenine.

[0155] In some embodiments, all or substantially all of the nucleotides of an RNAi agent are modified nucleotides.As used herein, an RNAi agent in which substantially all of the nucleotides present are modified nucleotides is an RNAi agent that has 4 or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides in both the sense strand and the antisense strand that are ribonucleotides (i.e., unmodified).As used herein, a sense strand in which substantially all of the nucleotides present are modified nucleotides is a sense strand that has 2 or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand that are unmodified ribonucleotides.As used herein, an antisense strand in which substantially all of the nucleotides present are modified nucleotides is an antisense strand that has 2 or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand that are unmodified ribonucleotides.In some embodiments, one or more nucleotides of an RNAi agent are unmodified ribonucleotides.

[0156] Modified internucleoside linkages In some embodiments, one or more nucleotides of an APOC3 RNAi agent are linked by a non-canonical bond or backbone (ie, a modified internucleoside bond or a modified backbone). Modified internucleoside linkages or backbones include, but are not limited to, phosphorothioate groups (represented herein as a lowercase "s"), chiral phosphorothioates, thiophosphonates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, alkylphosphonates (e.g., methylphosphonate or 3'-alkylenephosphonate), chiral phosphonates, phosphinates, phosphoramidates (e.g., 3'-aminophosphoamidate, aminoalkylphosphoamidate, or thionophosphoamidate), thionoalkyl-phosphonates, thionoalkylphosphotriesters, morpholino linkages, boranophosphates with normal 3'-5' linkages, 2'-5' linked analogs of boranophosphates, or boranophosphates with inverted polarity in which adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. In some embodiments, the modified internucleoside linkage or backbone lacks a phosphorus atom. Modified internucleoside linkages lacking a phosphorus atom include, but are not limited to, short-chain alkyl or cycloalkyl intersugar linkages, mixed heteroatom and alkyl or cycloalkyl intersugar linkages, or one or more short-chain heteroatom or heterocyclic intersugar linkages. In some embodiments, modified internucleoside backbones include, but are not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamic acid backbones, methyleneimino and methylenehydrazino backbones, sulfonic acid and sulfonamide backbones, amide backbones, and other backbones with mixed N, O, S, and CH2 moieties.

[0157] In some embodiments, the sense strand of an APOC3 RNAi agent may contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, the antisense strand of an APOC3 RNAi agent may contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or both the sense strand and the antisense strand may independently contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. The sense strand of the RNAi agent may contain 1, 2, 3, or 4 phosphorothioate linkages, the antisense strand of the APOC3 RNAi agent may contain 1, 2, 3, or 4 phosphorothioate linkages, or both the sense and antisense strands may independently contain 1, 2, 3, or 4 phosphorothioate linkages.

[0158] In some embodiments, the sense strand of the APOC3 RNAi agent contains at least two phosphorothioate internucleoside linkages. In some embodiments, at least two phosphorothioate internucleoside linkages are located between nucleotides 1 to 3 from the 3' end of the sense strand. In some embodiments, one phosphorothioate internucleoside linkage is located at the 5' end of the sense strand, and another phosphorothioate linkage is located at the 3' end of the sense strand. In some embodiments, two phosphorothioate internucleoside linkages are located at the 5' end of the sense strand, and another phosphorothioate linkage is located at the 3' end of the sense strand. In some embodiments, the sense strand does not contain any phosphorothioate internucleoside linkages between nucleotides, but does contain one, two, or three phosphorothioate linkages between the terminal nucleotides at both the 5' and 3' ends, and an optional inverted abasic residue end cap. In some embodiments, the targeting ligand is linked to the sense strand via a phosphorothioate linkage.

[0159] In some embodiments, the antisense strand of an APOC3 RNAi agent contains four phosphorothioate internucleoside linkages. In some embodiments, the four phosphorothioate internucleoside linkages are located between nucleotides 1-3 from the 5' end of the antisense strand and between nucleotides 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5' end of the antisense strand. In some embodiments, three phosphorothioate internucleoside linkages are located between positions 1-4 from the 5' end of the antisense strand, and a fourth phosphorothioate internucleoside linkage is located between positions 20-21 from the 5' end of the antisense strand. In some embodiments, the APOC3 RNAi agent contains at least three or four phosphorothioate internucleoside linkages in the antisense strand.

[0160] In some embodiments, an APOC3 RNAi agent contains one or more modified nucleotides and one or more modified internucleoside linkages. In some embodiments, a 2'-modified nucleoside is combined with a modified internucleoside linkage.

[0161] APOC3 RNAi agents In some embodiments, an APOC3 RNAi agent disclosed herein targets an APOC3 gene at or near the location of the APOC3 gene shown in Table 1. In some embodiments, the antisense strand of an APOC3 RNAi agent disclosed herein comprises a core stretch sequence that is fully, substantially, or at least partially complementary to the sequence of a target APOC3 19-mer disclosed in Table 1.

[0162] [Table 1]

[0163] In some embodiments, an APOC3 RNAi agent comprises an antisense strand in which position 19 of the antisense strand (5'→3') can base pair with position 1 of a 19-mer target sequence disclosed in Table 1. In some embodiments, an APOC3 RNAi agent comprises an antisense strand in which position 1 of the antisense strand (5'→3') can base pair with position 19 of a 19-mer target sequence disclosed in Table 1.

[0164] In some embodiments, an APOC3 RNAi agent comprises an antisense strand in which position 2 of the antisense strand (5'→3') can base pair with position 18 of a 19-mer target sequence disclosed in Table 1. In some embodiments, an APOC3 RNAi agent comprises an antisense strand in which positions 2 through 18 of the antisense strand (5'→3') can base pair with each of the complementary bases located from positions 18 through 2 of a 19-mer target sequence disclosed in Table 1.

[0165] For the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (5'->3'-end) can be perfectly complementary to the APOC3 gene, or can be non-complementary to the APOC3 gene. In some embodiments, the nucleotide at position 1 of the antisense strand (5'->3'-end) is U, A, or dT. In some embodiments, the nucleotide at position 1 of the antisense strand (5'->3'-end) forms an A:U or U:A base pair with the sense strand.

[0166] In some embodiments, the antisense strand of an APOC3 RNAi agent comprises (from the 5' end to the 3' end) a sequence of 2 to 18 or 2 to 19 nucleotides of any of the antisense strand sequences in Table 2, Table 3, or Table 4. In some embodiments, the sense strand of an APOC3 RNAi agent comprises (from the 5' end to the 3' end) a sequence of 1 to 17, 1 to 18, or 2 to 18 nucleotides of any of the sense strand sequences in Table 2, Table 3, or Table 5.

[0167] In some embodiments, an APOC3 RNAi agent comprises (i) an antisense strand comprising (from the 5' end to the 3' end) a sequence of 2 to 18 or 2 to 19 nucleotides of any of the antisense strand sequences in Table 2, Table 3, or Table 4, and (ii) a sense strand comprising (from the 5' end to the 3' end) a sequence of 1 to 17 or 1 to 18 nucleotides of any of the sense strand sequences in Table 2, Table 3, or Table 5.

[0168] In some embodiments, the APOC3 RNAi agent comprises a 19-mer core nucleotide sequence shown in Table 2 below.

[0169] [Table 2-1] [Table 2-2] [Table 2-3]

[0170] The sense and antisense strands of an APOC3 RNAi agent that comprises or consists of a nucleotide sequence in Table 2 may be modified or unmodified nucleotides. In some embodiments, an APOC3 RNAi agent having sense and antisense strand sequences that comprise or consist of a nucleotide sequence in Table 2 is entirely or substantially entirely modified nucleotides.

[0171] In some embodiments, the antisense strand of an APOC3 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2. In some embodiments, the sense strand of an APOC3 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2.

[0172] As used herein, each N listed in the sequences disclosed in Table 2 can be independently selected from any and all nucleobases (including those found in both modified and unmodified nucleotides). In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have a nucleobase that is complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have a nucleobase that is not complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have a nucleobase that is the same as the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have a different nucleobase from the N nucleotide at the corresponding position on the other strand.

[0173] The antisense strand of certain modified APOC3 RNAi agents, as well as their underlying unmodified nucleobase sequences, are provided in Tables 3 and 4. The sense strand of certain modified APOC3 RNAi agents, as well as their underlying unmodified nucleobase sequences, are provided in Tables 3 and 5. In forming an APOC3 RNAi agent, each of the nucleotides in each of the underlying base sequences listed in Tables 3, 4, and 5 and Table 2 above may be a modified nucleotide.

[0174] APOC3 RNAi agent described herein is formed by annealing antisense strand and sense strand.Under the condition that the two sequences have at least 85% complementary region over the sequence of 16, 17, 18, 19, 20 or 21 consecutive nucleotides, the sense strand that contains the sequence listed in Table 2, Table 3 or Table 5 can be hybridized with any antisense strand that contains the sequence listed in Table 2, Table 3 or Table 4.

[0175] In some embodiments, the antisense strand of an APOC3 RNAi agent comprises the nucleotide sequence of any of the sequences in Table 2, Table 3, or Table 4.

[0176] In some embodiments, an APOC3 RNAi agent comprises or consists of a duplex having the sense and antisense nucleobase sequences of any of the sequences in Table 2, Table 3, Table 4, or Table 5.

[0177] Examples of antisense strands containing modified nucleotides are provided in Table 4. Examples of sense strands containing modified nucleotides are provided in Table 5. Further examples of antisense and sense strands containing modified nucleotides are provided in Table 3.

[0178] As used in Tables 3, 4, and 5, the following notations are used to denote modified nucleotides, targeting groups, and linking groups: [Table 46-1] [Table 46-2] [Table 46-3]

[0179] Those skilled in the art will readily understand that, unless otherwise indicated by the sequence (e.g., by a phosphorothioate linkage "s"), nucleotide monomers, when present in an oligonucleotide, are linked to one another by 5'-3'-phosphodiester bonds. As those skilled in the art will clearly understand, the inclusion of phosphorothioate linkages shown in the modified nucleotide sequences disclosed herein replaces the phosphodiester linkages typically present in oligonucleotides (see, e.g., Figures 1A-1I, which illustrate all internucleoside linkages). Furthermore, those skilled in the art will readily understand that the terminal nucleotide at the 3' end of a given oligonucleotide sequence typically has a hydroxyl (-OH) group at the 3' position of each of the given monomers ex vivo in place of a phosphate moiety. Furthermore, as those skilled in the art will readily understand and appreciate, while the phosphorothioate chemical structures shown herein typically show an anion on the sulfur atom, the invention disclosed herein encompasses all phosphorothioate tautomers and / or diastereomers (e.g., when the sulfur atom bears a double bond and the anion is an oxygen atom). Unless expressly indicated otherwise herein, such understanding of those skilled in the art will be used when describing the APOC3 RNAi agents and compositions of APOC3 RNAi agents disclosed herein.

[0180] Certain examples of targeting groups and linking groups for use with the APOC3 RNAi agents disclosed herein are provided below in Table 7. More specifically, the targeting groups and linking groups are as follows: (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG31), (NAG32), (NAG33), (NAG34), (NAG35), (NAG36), (NAG37), (NAG37), (NAG38), (NAG39), (NAG39), (NAG39), (NAG31), (NAG32), (NAG33), (NAG34), (NAG35), (NAG36), (NAG37), (NAG38), (NAG39), (NAG39), (NAG39), (NAG39), (NAG31), (NAG32), (NAG33), (NAG34), (NAG35), (NAG35), (NAG36), (NAG37), (NAG38), (NAG39), (NAG39), (NAG39), (NAG39), (NAG30), (NAG31), (NAG32), (NAG33), (NAG34), (NAG35), (NAG35), (NAG36), (NAG37), (NAG38), (NAG39), (NAG39), (NAG39), (NAG31), (NAG32), (NAG33), (NAG34), (NAG34), (NAG35), (NAG35), (NA 0)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s, the chemical structures of which are provided below in Table 7. Each sense and / or antisense strand may have any targeting or linking group listed herein, as well as other targeting or linking groups conjugated to the 5' and / or 3' ends of the sequence.

[0181] [Table 3-1] [Table 3-2] [Table 3-3]

[0182] [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4] [Table 4-5]

[0183] [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4] [Table 5-5] [Table 5-6] [Table 5-7] [Table 5-8]

[0184] APOC3 RNAi agent described herein is formed by annealing antisense strand and sense strand.Under the condition that the two sequences have at least 85% complementary region over the sequence of 16, 17, 18, 19, 20 or 21 consecutive nucleotides, the sense strand that contains the sequence listed in Table 2, Table 3 or Table 5 can be hybridized with any antisense strand that contains the sequence listed in Table 2, Table 3 or Table 4.

[0185] In some embodiments, the antisense strand of an APOC3 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 4. In some embodiments, the sense strand of an APOC3 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 5.

[0186] In some embodiments, the antisense strand of an APOC3 RNAi agent comprises the nucleotide sequence of any of the sequences in Table 2, Table 3, or Table 4. The antisense strand of an RNAi agent comprises the sequence of nucleotides (from the 5' end to the 3' end) 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24, 1-25, 2-25, 1-16, or 2-16 of any of the sequences in Table 2, Table 3, or Table 4. In certain embodiments, the antisense strand of an APOC3 RNAi agent comprises or consists of a modified sequence of any one of the modified sequences in Table 4. In certain embodiments, the antisense strand of an APOC3 RNAi agent comprises or consists of a modified sequence of any one of the modified sequences in Table 3.

[0187] In some embodiments, the sense strand of an APOC3 RNAi agent comprises the nucleotide sequence of any of the sequences in Table 2, Table 3, or Table 5. In some embodiments, the sense strand of an APOC3 RNAi agent comprises a sequence of nucleotides (from the 5' end to the 3' end) 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, 4-24, 1-25, 2-25, 3-25, 4-25, 1-26, 2-26, 3-26, or 4-26 of any of the sequences in Table 2, Table 3, or Table 5. In certain embodiments, the sense strand of an APOC3 RNAi agent comprises or consists of the modified sequence of any one of the modified sequences in Table 5. In certain embodiments, the sense strand of an APOC3 RNAi agent comprises or consists of the modified sequence of any one of the modified sequences in Table 3.

[0188] For the APOC3 RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (from the 5' end to the 3' end) may be perfectly complementary to the APOC3 gene, or may be non-complementary to the APOC3 gene. In some embodiments, the nucleotide at position 1 of the antisense strand (from the 5' end to the 3' end) is U, A, or dT (or modified versions thereof). In some embodiments, the nucleotide at position 1 of the antisense strand (from the 5' end to the 3' end) forms an A:U or U:A base pair with the sense strand.

[0189] In some embodiments, the antisense strand of an APOC3 RNAi agent comprises (from the 5' end to the 3' end) a sequence of 2 to 18 or 2 to 19 nucleotides of any of the antisense strand sequences in Table 2 or Table 4. In some embodiments, the sense strand of an APOC3 RNAi agent comprises (from the 5' end to the 3' end) a sequence of 1 to 17 or 1 to 18 nucleotides of any of the sense strand sequences in Table 2 or Table 5.

[0190] In some embodiments, an APOC3 RNAi agent comprises (i) an antisense strand comprising (from the 5' end to the 3' end) a sequence of 2 to 18 or 2 to 19 nucleotides of any of the antisense strand sequences in Table 2, Table 3, or Table 4, and (ii) a sense strand comprising (from the 5' end to the 3' end) a sequence of 1 to 17 or 1 to 18 nucleotides of any of the sense strand sequences in Table 2, Table 3, or Table 5.

[0191] A sense strand containing a sequence listed in Table 2, Table 3, or Table 5 can be hybridized to any antisense strand containing a sequence listed in Table 2, Table 3, or Table 4, provided that the two sequences have a region of at least 85% complementarity over a sequence of 16, 17, 18, 19, 20, or 21 contiguous nucleotides. In some embodiments, an APOC3 RNAi agent has a sense strand consisting of a modified sequence of any of the modified sequences in Table 5, and an antisense strand consisting of a modified sequence of any of the modified sequences in Table 4. Representative sequence pairs are illustrated by the duplex ID numbers shown in Tables 3 and 6.

[0192] In some embodiments, the APOC3 RNAi agent comprises any of the duplexes represented by any of the duplex ID numbers presented herein. In some embodiments, the APOC3 RNAi agent consists of any of the duplexes represented by any of the duplex ID numbers presented herein. In some embodiments, the APOC3 RNAi agent comprises the sense and antisense strand nucleotide sequences of any of the duplexes represented by any of the duplex ID numbers presented herein. In some embodiments, the APOC3 RNAi agent comprises the sense and antisense strand nucleotide sequences of any of the duplexes represented by any of the duplex ID numbers presented herein, and a targeting group and / or linking group, wherein the targeting group and / or linking group are covalently linked (i.e., conjugated) to the sense strand or the antisense strand. In some embodiments, the APOC3 RNAi agent comprises the sense and antisense strand modified nucleotide sequences of any of the duplexes represented by any of the duplex ID numbers presented herein. In some embodiments, the APOC3 RNAi agent comprises a sense strand and an antisense strand-modified nucleotide sequence of either a duplex represented by any of the duplex ID numbers presented herein and a targeting group and / or linking group, wherein the targeting group and / or linking group is covalently linked to the sense strand or the antisense strand.

[0193] In some embodiments, an APOC3 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 2, Table 3, or Table 6, and comprises an asialoglycoprotein receptor ligand targeting group.

[0194] In some embodiments, an APOC3 RNAi agent comprises an antisense strand and a sense strand having a nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 2, Table 3, or Table 6, and is selected from the group consisting of (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG30), (NAG31), (NAG32), (NAG33), (NAG34), (NAG35), (NAG36), (NAG37), (NAG38), (NAG39), (NAG40), (NAG41), (NAG42), (NAG43), (NAG44), (NAG45), (NAG46), (NAG47), (NAG47), (NAG48), (NAG48), (NAG49), (NAG50), (NAG51), (NAG52), (NAG53), (NAG54), (NAG55), (NAG56), (NAG57), (NAG58), (NAG59), (NAG60), (NAG61), (NAG62), (NAG63), (NAG64), (NAG65), (NAG66), (NAG67), (NAG68), (NAG69), (NAG70), (NAG71), (NAG72), (NAG73), (NAG74), (NAG75), (NAG76), (NAG77), (NAG78), (NAG79), (NAG80), (NAG81), (NAG82), (NAG83), (NAG84), (NAG85 39), (NAG39)s, (NAG ...

[0195] In some embodiments, an APOC3 RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense strand and / or sense strand nucleotide sequences of any of the duplexes in Table 2, Table 3, or Table 6.

[0196] In some embodiments, an APOC3 RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense strand and / or sense strand nucleotide sequences of any of the duplexes in Table 2, Table 3, or Table 6, and comprises an asialoglycoprotein receptor ligand targeting group.

[0197] In some embodiments, the APOC3 RNAi agent comprises any of the duplexes in Table 2, Table 3, or Table 6.

[0198] In some embodiments, the APOC3 RNAi agent consists of any of the duplexes in Table 2, Table 3, or Table 6.

[0199] [Table 6-1] [Table 6-2] [Table 6-3]

[0200] In some embodiments, the APOC3 RNAi agent is prepared or provided as a salt, mixed salt, or free acid. The RNAi agents described herein inhibit or knock down the expression of one or more APOC3 genes in vivo upon delivery to cells that express the APOC3 gene.

[0201] Targeting Groups, Linking Groups, and Delivery Vehicles In some embodiments, the APOC3 RNAi agent is conjugated to one or more non-nucleotide groups, including, but not limited to, a targeting group, a linking group, a delivery polymer, or a delivery vehicle. The non-nucleotide group can enhance the targeting, delivery, or binding of the RNAi agent. Examples of targeting groups and linking groups are provided in Table 7. The non-nucleotide group may be covalently linked to the 3' and / or 5' end of either the sense strand and / or the antisense strand. In some embodiments, the APOC3 RNAi agent contains a non-nucleotide group linked to the 3' and / or 5' end of the sense strand. In some embodiments, the non-nucleotide group is linked to the 5' end of the sense strand of the APOC3 RNAi agent. The non-nucleotide group may be linked directly or indirectly to the RNAi agent via a linker / linking group. In some embodiments, the non-nucleotide group is linked to the RNAi agent via a labile, cleavable, or reversible bond or linker.

[0202] In some embodiments, the non-nucleotide group enhances the pharmacokinetics or biodistribution properties of the RNAi agent or conjugate to which it is attached, improving cell- or tissue-specific distribution and cell-specific uptake of the RNAi agent or conjugate. In some embodiments, the non-nucleotide group enhances endocytosis of the RNAi agent.

[0203] A targeting group or targeting moiety can enhance the pharmacokinetics or biodistribution properties of the conjugate or RNAi agent to which it is attached, thereby improving the cell-specific distribution and cell-specific uptake of the conjugate or RNAi agent. A targeting group can be monovalent, bivalent, trivalent, tetravalent, or have higher valency with respect to the target to which it is directed. Representative targeting groups include, but are not limited to, compounds with affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics with affinity for cell surface molecules. In some embodiments, the targeting group is linked to the RNAi agent using a linker such as a PEG linker, or in some cases, one, two, or three abasic and / or ribitol (abasic ribose) residues, which can serve as a linker. In some embodiments, the targeting group comprises a galactose derivative cluster.

[0204] APOC3 RNAi agents described herein can be synthesized with a reactive group, such as an amine group, at the 5' end, which can then be used to attach to a targeting group using methods typical in the art.

[0205] In some embodiments, the targeting group comprises an asialoglycoprotein receptor ligand. As used herein, an asialoglycoprotein receptor ligand is a ligand containing a compound that has affinity for the asialoglycoprotein receptor, which is highly expressed on hepatocytes. In some embodiments, the asialoglycoprotein receptor ligand comprises or consists of one or more galactose derivatives. As used herein, the term galactose derivative includes both galactose and derivatives of galactose that have affinity for the asialoglycoprotein receptor equal to or higher than the affinity of galactose. Galactose derivatives include, but are not limited to, galactose, galactosamine, N-formylgalactosamine, N-acetylgalactosamine, N-propionylgalactosamine, Nn-butanoylgalactosamine, and N-isobutanoylgalactosamine (see, for example, ST Iobst and K. Drickamer, JBC, 1996, 271, 6686). Galactose derivatives and clusters of galactose derivatives useful for in vivo targeting of oligonucleotides and other molecules to the liver are known in the art (see, e.g., Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al., 1982, J. Biol. Chem., 257, 939-945).

[0206] Galactose derivatives have been used to target molecules to hepatocytes in vivo through their binding to the asialoglycoprotein receptor expressed on the surface of hepatocytes. Binding of asialoglycoprotein receptor ligands to asialoglycoprotein receptors facilitates cell-specific targeting to hepatocytes and endocytosis of molecules into hepatocytes. Asialoglycoprotein receptor ligands can be monomeric (e.g., having a single galactose derivative) or polymeric (e.g., having multiple galactose derivatives). Galactose derivatives or galactose derivative clusters can be attached to the 3' or 5' end of the sense or antisense strand of an RNAi agent using methods known in the art. The preparation of targeting groups such as galactose derivative clusters is described, for example, in International Patent Application Publication No. WO2018 / 044350 to Arrowhead Pharmaceuticals, Inc. and International Patent Application Publication No. WO2017 / 156012 to Arrowhead Pharmaceuticals, Inc., the entire contents of both of which are incorporated herein by reference.

[0207] As used herein, a galactose derivative cluster includes a molecule having two to four terminal galactose derivatives. The terminal galactose derivative is attached to the molecule through its C-1 carbon. In some embodiments, the galactose derivative cluster is a galactose derivative trimer (also called a tri-antennary galactose derivative or a trivalent galactose derivative). In some embodiments, the galactose derivative cluster includes N-acetyl-galactosamine. In some embodiments, the galactose derivative cluster includes three N-acetyl-galactosamines. In some embodiments, the galactose derivative cluster is a galactose derivative tetramer (also called a tetra-antennary galactose derivative or a tetravalent galactose derivative). In some embodiments, the galactose derivative cluster includes four N-acetyl-galactosamines.

[0208] As used herein, a galactose derivative trimer contains three galactose derivatives, each linked to a central branch point. As used herein, a galactose derivative tetramer contains four galactose derivatives, each linked to a central branch point. The galactose derivatives can be linked to the central branch point through the C-1 carbon of the sugar. In some embodiments, the galactose derivatives are linked to the branch point via a linker or spacer. In some embodiments, the linker or spacer is a flexible hydrophilic spacer, such as a PEG group (see, for example, U.S. Pat. No. 5,885,968; Biessen et al. J. Med. Chem. 1995 Vol. 39 p. 1538-1546). In some embodiments, the PEG spacer is a PEG3 spacer. The branch point can be any small molecule that allows for the attachment of three galactose derivatives and further allows for the attachment of the branch point to an RNAi agent. Examples of branch point groups are di-lysine or diglutamate. The linkage of the branch point to the RNAi agent can occur through a linker or spacer. In some embodiments, the linker or spacer includes a flexible hydrophilic spacer, such as, but not limited to, a PEG spacer. In some embodiments, the linker includes a rigid linker, such as a cyclic group. In some embodiments, the galactose derivative comprises or consists of N-acetyl-galactosamine. In some embodiments, the galactose derivative cluster comprises a galactose derivative tetramer, which can be, for example, an N-acetyl-galactosamine tetramer.

[0209] The present disclosure also provides a pharmaceutical composition for delivering APOC3 RNAi agent to liver cells in vivo.Such pharmaceutical composition can comprise APOC3 RNAi agent conjugated to galactose derivative cluster.In some embodiments, galactose derivative cluster comprises galactose derivative trimer, which can be N-acetyl-galactosamine trimer, or galactose derivative tetramer, which can be N-acetyl-galactosamine tetramer.

[0210] Targeting groups include, but are not limited to, (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29 ... (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), and (NAG39)s. Other targeting groups, including galactose cluster targeting ligands, are known in the art.

[0211] In some embodiments, a linking group is conjugated to the RNAi agent. The linking group facilitates covalent linking of the agent to a targeting group, delivery polymer, or delivery vehicle. The linking group can be linked to the 3' or 5' end of the sense or antisense strand of the RNAi agent. In some embodiments, the linking group is linked to the sense strand of the RNAi agent. In some embodiments, the linking group is conjugated to the 5' or 3' end of the sense strand of the RNAi agent. In some embodiments, the linking group is conjugated to the 5' end of the sense strand of the RNAi agent. Examples of linking groups include, but are not limited to, reactive groups such as primary amines and alkynes, alkyl groups, abasic nucleotides, ribitol (abasic ribose), and / or PEG groups.

[0212] A linker or linking group is a connection between two atoms that connects one chemical group or segment of interest (such as an RNAi agent) to another chemical group or segment of interest (such as a targeting group or delivery polymer) via one or more covalent bonds. A labile linkage contains a labile bond. The linkage may optionally include a spacer that increases the distance between the two connected atoms. The spacer can further add flexibility and / or length to the linkage. Spacers include, but are not limited to, alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, aralkenyl groups, and aralkynyl groups, each of which may contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and saccharides. Spacer groups are well known in the art, and the foregoing list is not intended to limit the scope of the description.

[0213] Any of the APOC3 RNAi agent nucleotide sequences listed in Tables 2, 3, 4, or 5, whether modified or unmodified, can contain a 3' or 5' targeting group or linking group. Any of the APOC3 RNAi agent sequences listed in Tables 4 or 5 or otherwise described herein that contain a 3' or 5' targeting group or linking group can alternatively contain no 3' or 5' targeting group or linking group, or a different 3' or 5' targeting group or linking group, including, but not limited to, those shown in Table 7. Any of the APOC3 RNAi agent duplexes listed in Tables 2, 3, or 6, whether modified or unmodified, can further include a targeting group or linking group, including, but not limited to, those shown in Table 7, and the targeting group or linking group can be attached to the 3' or 5' end of either the sense strand or the antisense strand of the APOC3 RNAi agent duplex.

[0214] Examples of targeting groups and linking groups are provided in Table 7. Table 5 provides several embodiments of APOC3 RNAi agent sense strands with targeting groups or linking groups attached to the 5' or 3' end.

[0215] Table 7-1 Table 7-2 Table 7-3 Table 7-4 Table 7-5 Table 7-6 Table 7-7 Table 7-8 Table 7-9 Table 7-10 Table 7-11 Table 7-12 Table 7-13 Table 7-14 Table 7-15 Table 7-16 Table 7-17 [Table 7-18]

[0216] In each of the above structures in Table 7, NAG includes N-acetyl-galactosamine or another galactose derivative that one of skill in the art would understand to be attached in light of the above structure and the description provided herein. For example, in some embodiments, NAG in the structures provided in Table 7 has the following structure: [ka] is expressed by

[0217] Each (NAGx) may be linked to the APOC3 RNAi agent via a phosphate group (in the case of (NAG25), (NAG30), and (NAG31)), or a phosphorothioate group (in the case of (NAG25)s, (NAG29)s, (NAG30)s, (NAG31)s, or (NAG37)s), or another linking group. [ka]

[0218] Other linking groups known in the art may also be used.

[0219] In some embodiments, RNAi agents can be delivered to cells or tissues using a delivery vehicle. A delivery vehicle is a compound that improves the delivery of RNAi agents to cells or tissues. A delivery vehicle can include or consist of a polymer, such as, but not limited to, an amphiphilic polymer, a membrane-active polymer, a peptide, a melittin peptide, a melittin-like peptide (MLP), a lipid, a reversibly modified polymer or peptide, or a reversibly modified membrane-active polyamine. In some embodiments, RNAi agents can be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs, or other delivery systems available in the art. RNAi agents can also be chemically conjugated to targeting groups, lipids (including but not limited to cholesterol and cholesteryl derivatives), nanoparticles, polymers, liposomes, micelles, DPCs (see, e.g., WO2000 / 053722, WO2008 / 0022309, WO2011 / 104169, and WO2012 / 083185, WO2013 / 032829, WO2013 / 158141, each of which is incorporated herein by reference), or other delivery systems available in the art.

[0220] Pharmaceutical Compositions and Formulations The APOC3 RNAi agents disclosed herein can be prepared as pharmaceutical compositions or formulations. In some embodiments, pharmaceutical compositions contain at least one APOC3 RNAi agent. These pharmaceutical compositions are particularly useful for inhibiting the expression of target mRNA in target cells, cell groups, tissues, or organisms. The pharmaceutical compositions can be used to treat subjects with diseases or disorders that would benefit from a reduction in the level of target mRNA or inhibition of target gene expression. The pharmaceutical compositions can be used to treat subjects at risk of developing diseases, disorders, or conditions that would benefit from a reduction in the level of target mRNA or inhibition of target gene expression. In one embodiment, a method includes administering an APOC3 RNAi agent linked to a targeting ligand described herein to a subject to be treated. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and / or delivery polymers) are added to a pharmaceutical composition containing an APOC3 RNAi agent to form a pharmaceutical formulation suitable for in vivo delivery to a subject, including a human.

[0221] The pharmaceutical compositions comprising APOC3 RNAi agents and the methods disclosed herein can reduce the level of target mRNA in a cell, a group of cells, a group of cells, a tissue, or a subject, including inhibiting the expression of APOC3 mRNA in a subject by administering to the subject a therapeutically effective amount of the APOC3 RNAi agent described herein. In some embodiments, the subject has previously been identified as having pathogenic upregulation of a target gene in a target cell or tissue.

[0222] In some embodiments, the described pharmaceutical compositions comprising an APOC3 RNAi agent are used to treat or manage clinical findings associated with elevated TG levels and / or overexpression of APOC3 mRNA in a subject. In some embodiments, a therapeutically (including prophylactically) effective amount of one or more of the pharmaceutical compositions is administered to a subject in need of such treatment (including preventing or managing symptoms, diseases, or disorders). In some embodiments, administration of any of the disclosed APOC3 RNAi agents can be used to reduce the number, severity, and / or frequency of disease symptoms in a subject.

[0223] The pharmaceutical compositions described that comprise APOC3 RNAi agents can be used to treat at least one symptom in a subject with a disease or disorder that benefits from reducing or inhibiting the expression of APOC3 mRNA.In some embodiments, the symptoms are treated by administering to the subject a therapeutically effective amount of one or more pharmaceutical compositions that comprise APOC3 RNAi agents.In other embodiments, the symptoms are prevented by administering to the subject a prophylactically effective amount of one or more APOC3 RNAi agents.

[0224] The administration route is the route by which the APOC3 RNAi agent comes into contact with the body.Generally, the methods of administering drugs, oligonucleotides and nucleic acids for the treatment of mammals are well known in the art and can be applied to the administration of the compositions described herein.The APOC3 RNAi agent disclosed herein can be administered by any suitable route in a preparation that is appropriately adjusted for a specific route.Thus, the pharmaceutical compositions described herein can be administered by injection, for example, intravenously, intramuscularly, intradermally, subcutaneously, intraarticularly or intraperitoneally.In some embodiments, the pharmaceutical compositions described herein are administered via subcutaneous injection.

[0225] Pharmaceutical compositions comprising the APOC3 RNAi agents described herein can be delivered to cells, cell groups, tissues, or subjects using oligonucleotide delivery techniques known in the art. Generally, any suitable method (in vitro or in vivo) recognized in the art for delivering nucleic acid molecules can be adapted for use with the compositions described herein. For example, delivery can be by local administration (e.g., direct injection, implantation, or topical administration), systemic administration, or subcutaneous, intravenous, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal, and intrathecal), intramuscular, transdermal, airway (aerosol), nasal, oral, rectal, or topical (including buccal and sublingual) administration. In some embodiments, the compositions are administered via subcutaneous or intravenous infusion or injection.

[0226] Thus, in some embodiments, the pharmaceutical compositions described herein comprise one or more pharmaceutically acceptable excipients. The pharmaceutical compositions described herein are formulated for administration to a subject.

[0227] As used herein, a pharmaceutical composition or medicament comprises a pharmacologically effective amount of at least one of the therapeutic compounds described and one or more pharmaceutically acceptable excipients. A pharmaceutically acceptable excipient (excipient) is a substance other than the active pharmaceutical ingredient (API, therapeutic product, e.g., APOC3 RNAi agent) that is intentionally included in a drug delivery system. The excipient does not exert, or is not intended to exert, a therapeutic effect at the intended dosage. An excipient may a) aid in the processing of the drug delivery system during manufacturing; b) protect, support, or enhance the stability, bioavailability, or patient acceptability of the API; c) aid in product identification; and / or d) act to enhance any other attribute of the overall safety or efficacy of the delivery of the API during storage or use. A pharmaceutically acceptable excipient may or may not be an inert substance.

[0228] Excipients include, but are not limited to, absorption enhancers, anti-adherents, anti-foaming agents, antioxidants, binders, buffers, carriers, coatings, colors, delivery enhancers, delivery polymers, dextran, dextrose, diluents, disintegrants, emulsifiers, bulking agents, fillers, flavorings, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salt, solvents, sugars, suspending agents, sustained release matrices, sweeteners, thickeners, isotonicity agents, vehicles, water repellents, and wetting agents.

[0229] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor® EL™ (BASF, Parsippany, NJ), or phosphate-buffered saline (PBS). Suitable carriers should be stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. In many cases, it is preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

[0230] Sterile injection solution can be prepared by incorporating the active compound in the required amount in suitable solvent with one or combination of the above-listed components as needed, and then sterilizing and filtering.Generally, dispersion is prepared by incorporating the active compound into a sterile vehicle that contains basic dispersion medium and other necessary components from above-listed.For the preparation of sterile powder for sterile injection solution, preparation method includes vacuum drying and freeze-drying, which produces the powder of active ingredient and any other desired components from its previously sterile-filtered solution.

[0231] Formulations suitable for intra-articular administration may be in the form of a sterile aqueous preparation of the drug, which may be in microcrystalline form, for example, in the form of an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymer systems may also be used to present the drug for both intra-articular and intraocular administration.

[0232] Active compounds can be prepared with carriers that protect the compound from rapid elimination from the body, such as controlled-release formulations, including implants and microencapsulated delivery systems.Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid.The method for preparing such formulations will be clear to those skilled in the art.Liposomal suspensions can also be used as pharmaceutically acceptable carriers.They can be prepared according to the method known to those skilled in the art, for example, as described in U.S. Patent No. 4,522,811.

[0233] APOC3 RNAi agent can be formulated into compositions in unit dosage form for ease of administration and uniform dosage.Unit dosage form refers to a physically separate unit that is suitable as a single dosage for the subject to be treated; each unit contains a predetermined amount of active compound calculated to produce desired therapeutic effect associated with required pharmaceutical carrier.The specification for unit dosage form of the present disclosure is determined and directly depends on the unique characteristics of active compound and the therapeutic effect that it wants to achieve, and the inherent limitation in the art of combining this active compound for individual treatment.

[0234] Pharmaceutical compositions may contain other additional ingredients that are commonly found in pharmaceutical compositions.Such additional ingredients include, but are not limited to, antipruritic agents, astringents, local anesthetics, analgesics, antihistamines, or anti-inflammatory agents (e.g., acetaminophen, NSAIDs, diphenhydramine, etc.).It is also envisioned that cells, tissues, or isolated organs that express or contain the RNAi agent defined herein can be used as "pharmaceutical compositions".As used herein, "pharmacologically effective amount," "therapeutically effective amount," or simply "effective amount" refers to the amount of RNAi agent that produces pharmacological, therapeutic, or preventive results.

[0235] In some embodiments, the methods disclosed herein further comprise administering a second therapeutic agent or treatment in addition to administering an RNAi agent disclosed herein. In some embodiments, the second therapeutic agent is another APOC3 RNAi agent (e.g., an APOC3 RNAi agent that targets a different sequence within the APOC3 target). In other embodiments, the second therapeutic agent may be a small molecule drug, an antibody, an antibody fragment, or an aptamer.

[0236] Generally, an effective amount of an active compound ranges from about 0.1 to about 100 mg / kg body weight / day, e.g., from about 1.0 to about 50 mg / kg body weight / day. In some embodiments, an effective amount of an active compound ranges from about 0.25 to about 5 mg / kg body weight / dose. In some embodiments, an effective amount of an active ingredient ranges from about 0.5 to about 4 mg / kg body weight / dose. The amount administered may also depend on variables such as the patient's overall health, the relative biological potency of the compound being delivered, the drug formulation, the presence and type of excipients in the formulation, and the route of administration. It should also be understood that in some cases, the initial dosage administered may be increased beyond the upper limit to rapidly achieve desired blood or tissue levels, or in some cases, the initial dosage may be less than the optimal dosage.

[0237] For the treatment of a disease or to form a medicament or composition for the treatment of a disease, the pharmaceutical compositions described herein comprising an APOC3 RNAi agent can be combined with an excipient or with a second therapeutic agent or treatment, including, but not limited to, a second or other RNAi agent, a small molecule drug, an antibody, an antibody fragment, a peptide, and / or an aptamer.

[0238] When added to a pharmaceutically acceptable excipient or adjuvant, the described APOC3 RNAi agents can be packaged in kits, containers, packs, or dispensers. The pharmaceutical compositions described herein may also be packaged in pre-filled syringes or vials.

[0239] Methods of Treatment and Inhibition of Expression The APOC3 RNAi agent disclosed herein can be used to treat subjects (e.g., humans or other mammals) with diseases or disorders that benefit from the administration of compounds.In some embodiments, the RNAi agent disclosed herein can be used to treat subjects (e.g., humans) with diseases or disorders that benefit from the reduction and / or inhibition of APOC3 mRNA expression, such as obesity, hyperlipidemia, hypertriglyceridemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, cardiovascular disease, coronary artery disease, hypertriglyceridemia-mediated pancreatitis, metabolic syndrome, type II diabetes, familial chylomicronemia syndrome, familial partial lipodystrophy, and / or other metabolic-related disorders and diseases, or subjects at risk of developing symptoms associated therewith.

[0240] The subject is administered with any one or more therapeutically effective amounts of RNAi agents.The subject can be a human, a patient, or a human patient.The subject can be an adult, an adolescent, a child, or an infant.The administration of the pharmaceutical composition described herein can be to a human or an animal.

[0241] In some embodiments, the APOC3 RNAi agents described herein are used to treat subjects with APOC3-related diseases or disorders. In some embodiments, the APOC3 RNAi agents described herein are used to treat subjects who would benefit from reduced and / or inhibited APOC3 gene expression. In some embodiments, the described APOC3 RNAi agents are used to treat (including preventatively) at least one symptom or pathological condition mediated at least in part by APOC3 gene expression. A subject is administered a therapeutically effective amount of any one or more of the described RNAi agents. In some embodiments, a subject is administered a prophylactically effective amount of any one or more of the described RNAi agents, thereby preventing at least one symptom.

[0242] In certain embodiments, the present invention provides methods for treating a disease, disorder, condition, or pathology mediated at least in part by APOC3 expression in a patient in need thereof, comprising administering to the patient any of the APOC3 RNAi agents described herein.

[0243] In some embodiments, APOC3 RNAi agents are used to treat or manage the clinical manifestations of subjects with APOC3-related diseases or disorders.The subjects are administered a therapeutically effective amount of one or more of the APOC3 RNAi agents or compositions containing APOC3 RNAi agents described herein.In some embodiments, the method comprises administering to the subject to be treated a composition comprising the APOC3 RNAi agent described herein.

[0244] In some embodiments, the gene expression level and / or mRNA level of the APOC3 gene in a subject administered with a described APOC3 RNAi agent is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 95%, 96%, 97%, 98%, 99%, or more than 99% compared to the subject before administration of the APOC3 RNAi agent or a subject that has not received the APOC3 RNAi agent. The gene expression level, protein level, and / or mRNA level in the subject is reduced in cells, cell groups, and / or tissues of the subject.

[0245] In some embodiments, the protein level of APOC3 in a subject administered a described APOC3 RNAi agent is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more than 99% compared to the subject before administration of the APOC3 RNAi agent or a subject that has not received the APOC3 RNAi agent. The protein level in the subject is reduced in the subject's cells, cell populations, tissues, blood, and / or other bodily fluids.

[0246] In some embodiments, triglyceride (TG) levels in a subject administered a described APOC3 RNAi agent are reduced by at least about 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more than 99% compared to the subject before administration of the APOC3 RNAi agent or to a subject not administered the APOC3 RNAi agent. TG levels in a subject may be reduced in the subject's cells, cell groups, tissues, blood, and / or other bodily fluids.

[0247] In some embodiments, the total cholesterol level in a subject to whom a described APOC3 RNAi agent has been administered is reduced by at least about 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more than 99% compared to the subject before administration of the APOC3 RNAi agent or compared to a subject not administered the APOC3 RNAi agent. In some embodiments, the low-density lipoprotein (LDL) cholesterol level in a subject administered a described APOC3 RNAi agent is reduced by at least about 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more than 99% compared to the subject before administration of the APOC3 RNAi agent or to a subject not administered the APOC3 RNAi agent. The total cholesterol level and / or LDL cholesterol level in a subject may be reduced in the subject's cells, cell groups, tissues, blood, and / or other bodily fluids.

[0248] The reduction of gene expression, mRNA, APOC3 protein level, TG level, cholesterol level and LDL cholesterol level can be evaluated by any method known in the art.As used herein, the reduction or decrease of APOC3 mRNA level and / or protein level is collectively referred to herein as the reduction or decrease of APOC3, or the inhibition or reduction or knockdown of the expression of APOC3.The examples described herein illustrate known methods for evaluating the inhibition of APOC3 gene expression.

[0249] Cells, tissues, organs, and non-human organisms Contemplated herein is the cell, tissue, organ and non-human organism that comprises at least one of the APOC3 RNAi agents described herein.Cell, tissue, organ or non-human organism is produced by delivering RNAi agent to cell, tissue, organ or non-human organism.

[0250] The embodiments and clauses provided above will now be illustrated with the following non-limiting examples. [Example]

[0251] Example 1 Synthesis of APOC3 RNAi agents The APOC3 RNAi agent duplexes shown above in Tables 3 and 6 were synthesized according to the following general procedure.

[0252] A. Synthesis. The sense and antisense strands of the APOC3 RNAi agent were synthesized on a solid phase using the phosphoramidite technique used in oligonucleotide synthesis. Depending on the scale, either a MerMade96E® (Bioautomation), a MerMade12® (Bioautomation), or an OP Pilot 100 (GE Healthcare) was used. Synthesis was carried out on a solid support made of controlled pore glass (CPG, 500 Å or 600 Å, obtained from Prime Synthesis, Aston, PA, USA). All RNAs and 2'-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA). Specifically, the following 2'-O-methyl phosphoramidites were used: (5'-O-dimethoxytrityl-N 6 -(Benzoyl)-2'-O-methyl-adenosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite, 5'-O-dimethoxy-trityl-N 4 -(acetyl)-2'-O-methyl-cytidine-3'-O-(2-cyanoethyl-N,N-diisopropyl-amino)phosphoramidite, (5'-O-dimethoxytrityl-N 2-(isobutyryl)-2'-O-methyl-guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, and 5'-O-dimethoxytrityl-2'-O-methyl-uridine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite. The 2'-deoxy-2'-fluoro-phosphoramidite carried the same protecting groups as the 2'-O-methylamidite. 5'-Dimethoxytrityl-2'-O-methyl-inosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite was purchased from Glen Research (Virginia) or Hongene Biotech. Inverted abasic (3'-O-dimethoxytrityl-2'-deoxyribose-5'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite was purchased from ChemGenes (Wilmington, MA, USA). 5'-(4,4'-dimethoxytrityl)-2',3'-seco-uridine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite was also purchased from Thermo Fisher Scientific or Hongene Biotech. 5'-O-dimethoxytrityl-N 2 ,N 6 -(Phenoxyacetate)-2′-O-methyl-diaminopurine-3′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite was purchased from ChemGenes or Hongene Biotech.

[0253] The targeting ligand-containing phosphoramidite was dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM). All other amidites were dissolved in anhydrous acetonitrile (50 mM) or anhydrous dimethylformamide with the addition of molecular sieves (3 Å). 5-benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as the activator solution. Coupling times were 12 min (RNA), 15 min (targeting ligand), 90 s (2'OMe), and 60 s (2'F). To introduce the phosphorothioate bond, a 100 mM solution of 3-phenyl-1,2,4-dithiazolin-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used. Unless specifically identified as a "naked" RNAi agent without a targeting ligand, each of the APOC3 RNAi agent duplexes synthesized and tested in the following examples utilized N-acetyl-galactosamine as the "NAG" in the targeting ligand chemical structures depicted in Table 7.

[0254] B. Cleavage and deprotection of the support-bound oligomer. After finalization of the solid-phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40 wt% methylamine and 28% ammonium hydroxide solution (Aldrich) in water for 1.5 hours at 30°C. The solution was evaporated and the solid residue was reconstituted in water (see below).

[0255] C. Purification. The crude oligomer was purified by anion-exchange HPLC using a TSKgel SuperQ-5PW, 13 μm column and a Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0, containing 20% ​​acetonitrile, and buffer B was the same as buffer A supplemented with 1.5 M sodium chloride. UV traces at 260 nm were recorded. Appropriate fractions were pooled and then run on a size-exclusion HPLC using a GE Healthcare XK 26 / 40 column packed with Sephadex G-25 fine, using filtered DI water or a running buffer of 100 mM ammonium bicarbonate, pH 6.7, and 20% acetonitrile.

[0256] D. Annealing. Complementary strands were mixed to form RNAi agents by combining equimolar RNA solutions (sense and antisense) in 1x phosphate-buffered saline (Corning, Cellgro). Some RNAi agents were lyophilized and stored at -15 to -25°C. The duplex concentration was determined by measuring the absorbance of the solution in 1x phosphate-buffered saline on a UV-Vis spectrophotometer. The absorbance of the solution at 260 nm was then multiplied by the conversion factor and dilution factor to determine the duplex concentration. Unless otherwise noted, all conversion factors were 0.037 mg / (mL·cm). For some experiments, the conversion factor was calculated from the experimentally determined extinction coefficient.

[0257] Example 2 In vitro testing of APOC3 RNAi agents The candidate sequence duplexes shown in Table 3 above were tested in vitro. APOC3 RNAi agents were prepared according to the procedures described in Example 1.

[0258] In vitro evaluation of APOC3 RNAi agents was performed by transfection of HuH7 cells, a human hepatocellular carcinoma cell line. Cells were seeded at approximately 7,500 cells / well in a 96-well format and transfected with each of the 65 APOC3 RNAi agent duplexes shown in Table 3 at three concentrations (10 nM, 1 nM, and 0.1 nM) using LipoFectamine RNAiMax (Thermo Fisher) transfection reagent. Relative expression of each APOC3 RNAi agent was determined by qRT-PCR by comparing the expression level of APOC3 mRNA to an endogenous control and normalized to untreated HuH7 cells (ΔΔC ), as shown in Table 8. T Thus, for duplex ID number 56_1, the average relative expression of 0.126 at 1 nM indicates 87.4% APOC3 gene knockdown.

[0259] [Table 8-1] [Table 8-2] [Table 8-3]

[0260] Example 3 APOC3-SEAP mouse model Six- to eight-week-old female C57BL / 6 albino mice were transiently transfected in vivo with the plasmid via hydrodynamic tail vein injection at least 15 days before administration of the APOC3 RNAi agent or control. The plasmid contained the APOC3 cDNA sequence (GenBank NM_000040.1 (SEQ ID NO: 1)) inserted into the 3'UTR of the SEAP (secreted human placental alkaline phosphatase) reporter gene. 50 μg of the plasmid containing the APOC3 cDNA sequence was injected into the mice via the tail vein in Ringer's solution at a total volume of 10% of the animal's body weight to generate the APOC3-SEAP model mice. The solution was injected through a 27-gauge needle for 5–7 seconds as previously described (Zhang G et al., "High levels of foreign gene expression in hepatocytes after tail vein injection of naked plasmid DNA," Human Gene Therapy 1999 Vol. 10, pp. 1735–1737). Inhibition of APOC3 expression by the APOC3 RNAi agent resulted in simultaneous inhibition of SEAP expression, which was measured. On day −1, serum SEAP expression levels were measured using the Phospha-Light™ SEAP Reporter Gene Assay System (Invitrogen), and mice were grouped according to their mean SEAP levels.

[0261] Analysis: SEAP levels may be measured at various time points both before and after administration of the APOC3 RNAi agent.

[0262] i) Serum collection: Mice were anesthetized with 2-3% isoflurane, and blood samples were collected from the submandibular region into serum separator tubes (Sarstedt AG & Co., Numbrecht, Germany). Blood was allowed to clot for 20 minutes at ambient temperature. The tubes were centrifuged at 8,000 × g for 3 minutes, and serum was separated and stored at 4°C.

[0263] ii) Serum SEAP levels: Serum was collected and measured using the Phospha-Light™ SEAP Reporter Gene Assay System (Invitrogen) according to the manufacturer's instructions. To account for non-treatment-related declines in APOC3 expression in this model, serum SEAP levels for each animal were normalized to a control group of saline-injected mice. First, the SEAP level for each animal at a given time point was divided by the pre-treatment expression level for that animal (day -1) to determine a "normalized to pre-treatment" expression ratio. Expression at a specific time point was then normalized to the control group by dividing the "normalized to pre-treatment" ratio for each individual animal by the average "normalized to pre-treatment" ratio for all mice in the saline control group. Alternatively, in some examples described herein, serum SEAP levels for each animal were assessed by normalizing to pre-treatment levels only.

[0264] Example 4 In vivo testing of APOC3 RNAi agents in APOC3-SEAP mice The APOC3-SEAP mouse model described in Example 3 above was used. On day 1, each mouse received 5 mg / kg (mpk) of the APOC3 RNAi agent, 3 mg / kg of APOC3 A single subcutaneous administration of 200 μl containing either the RNAi agent or 200 μl of phosphate buffered saline without the APOC3 RNAi agent used as a control was given according to Table 9 below.

[0265] [Table 9]

[0266] Each of the APOC3 RNAi agents contained a modified nucleotide conjugated at the 5' end of the sense strand to a targeting ligand (tridentate ligand) containing three N-acetyl-galactosamine groups having the modified sequence described in the double-stranded structure herein (see Tables 4, 5, 6, and 7 for specific modification and structural information regarding the APOC3 RNAi agents).

[0267] Injections were performed between the skin and muscle of the loose skin in the neck and shoulder area (i.e., subcutaneous injection). Three mice per group were tested (n=3). Serum was collected on days 8, 15, 22, and 29, and SEAP expression levels were determined according to the procedure described in Example 3 above. Data from the experiment are shown in Table 10 below, with the mean SEAP reflecting the normalized average value of SEAP.

[0268] [Table 10]

[0269] Each of the APOC3 RNAi agents in each of the treatment groups (i.e., Groups B-M) demonstrated a substantial reduction in SEAP compared to the saline control (Group A) at all measured time points. For example, the APOC3 RNAi agent AD04815 demonstrated an approximately 97.4% reduction in SEAP (0.026) at 22 days after a single injection of 5.0 mg / kg.

[0270] Example 5 APOC3 transgenic mouse model To assess and evaluate the in vivo effects of certain other APOC3 RNAi agents, APOC3 transgenic mice were purchased and used (The Jackson Laboratory, 006907-B6; CBA-Tg(APOC3)3707Bres / J). For APOC3 transgenic mice, human APOC3 protein levels in serum were measured using a Cobas® Integra 400 (Roche Diagnostics) according to the manufacturer's recommendations.

[0271] For normalization, the APOC3 level for each animal at a given time point was divided by the expression level before treatment for that animal to determine a "normalized to pre-treatment" expression ratio. In some examples reported herein, expression at a particular time point was also normalized to the vehicle control group by dividing the "normalized to pre-treatment" ratio for each individual animal by the average "normalized to pre-treatment" ratio for all mice in the vehicle control group. This resulted in expression at each time point normalized to expression in the control group.

[0272] APOC3 levels may be measured at various times both before and after administration of the APOC3 RNAi agent. Unless otherwise noted herein, mice were anesthetized with 2-3% isoflurane, and blood samples were collected from the submandibular region into serum separator tubes (Sarstedt AG & Co., Numbrecht, Germany). Blood was allowed to clot for 20 minutes at ambient temperature. The tubes were centrifuged at 8,000 × g for 3 minutes, and serum was separated and stored at 4°C.

[0273] Example 6 In vivo testing of APOC3 RNAi agents in APOC3 transgenic mice The APOC3 transgenic mouse model described above in Example 5 was used. On day 1, each mouse received a single subcutaneous dose of 200 μl of the respective RNAi agent or control (D5W) dissolved in D5W (5% dextrose in water), with the dose groups shown in Table 11 below.

[0274] [Table 11]

[0275] Each of the APOC3 RNAi agents was conjugated to a targeting ligand containing three N-acetyl-galactosamines (i.e., a tridentate NAG ligand) having the modified sequences and NAG structures described herein (see Tables 4, 5, 6, and 7 for specific modification and structural information regarding the APOC3 RNAi agents used in Example 6).

[0276] Injections were performed between the skin and muscle of the loose skin in the neck and shoulder area (i.e., subcutaneous injection). Three mice per group were tested (n=3). Serum was collected from mice on days 8, 15, 22, and 29, including day -1 (pre-dose blood draw after 4-hour fasting). Before each collection, mice were fasted for 4 hours. APOC3 expression levels were determined according to the procedure described in Example 5 above. The data are shown in Table 12 below, with mean APOC3 reflecting the normalized average value of APOC3 protein expressed in serum.

[0277] [Table 12]

[0278] Each of the APOC3 RNAi agents in each of the treatment groups (i.e., Groups B-M) showed a reduction in APOC3 compared to the control (Group A) at the time points measured. For example, the APOC3 RNAi agent AD05223 showed an approximately 94% reduction (0.062) at Day 15 after a single 2.0 mg / kg dose on Day 1.

[0279] Example 7 In vivo testing of APOC3 RNAi agents in APOC3 transgenic mice The APOC3 transgenic mouse model described above in Example 5 was used. On day 1, each mouse received a single subcutaneous dose of 200 μl of the respective RNAi agent or control (D5W) dissolved in D5W (5% dextrose in water) according to the dosing groups shown in Table 13 below.

[0280] [Table 13]

[0281] Each of the APOC3 RNAi agents contained a modified nucleotide conjugated at the 5' end of the sense strand to a targeting ligand (tridentate ligand) containing three N-acetyl-galactosamine groups, with the modified sequence described in the double-stranded structure herein (see Tables 4, 5, 6, and 7 for specific modification and structural information regarding the APOC3 RNAi agents).

[0282] Injections were performed between the skin and muscle of the loose skin in the neck and shoulder area (i.e., subcutaneous injection). Three mice per group were tested (n=3). Serum was collected from mice on days 8, 15, 22, and 29, including day -1 (pre-dose blood draw after 4-hour fasting). Before each collection, mice were fasted for 4 hours. APOC3 expression levels were determined according to the procedure described in Example 5 above. Data from day 8 of the experiment are shown in Table 14 below, with mean APOC3 reflecting the normalized average value of APOC3 protein expressed in serum.

[0283] [Table 14]

[0284] Each of the APOC3 RNAi agents in each of the dosing groups (i.e., groups 2 to 11) showed a reduction in APOC3 protein levels compared to the control (group 1) on days 8 and 15. In particular, APOC3 RNAi agents AD05251 and AD05169 (each having an antisense strand sequence designed to target position 438 of the APOC3 gene (i.e., SEQ ID NO: 1)), and APOC3 RNA agent AD05220 (having an antisense strand sequence designed to target position 506 of the APOC3 gene) showed particularly strong inhibitory effects (see, e.g., groups 4, 7, and 11 in Table 14 above).

[0285] Example 8 In vivo testing of APOC3 RNAi agents in APOC3 transgenic mice The APOC3 transgenic mouse model described above in Example 5 was used. On day 1, each mouse received a single subcutaneous dose of 200 μl of the respective RNAi agent or control (D5W) dissolved in D5W (5% dextrose in water) according to the dosing groups shown in Table 13 below.

[0286] [Table 15-1] [Table 15-2]

[0287] Each of the APOC3 RNAi agents contained a modified nucleotide conjugated at the 5' end of the sense strand to a targeting ligand (tridentate ligand) containing three N-acetyl-galactosamine groups having the modified sequence described in the double-stranded structure herein (see Tables 4, 5, 6, and 7 for specific modification and structural information regarding the APOC3 RNAi agents).

[0288] Injections were performed between the skin and muscle of the loose skin in the neck and shoulder area (i.e., subcutaneous injection). Three mice per group were tested (n=3), except for group 1 (D5W vehicle), where four mice were tested (n=4). Serum was collected on days -1 (pre-dose blood collection after a 4-hour fast), 8, 15, 22, and 29. Mice were fasted for 4 hours before each collection. APOC3 expression levels were determined according to the procedure described in Example 5 above. Serum triglycerides, high-density lipoprotein (HDL), low-density lipoprotein (LDL), and total cholesterol were also measured on a Cobas® Integra 400 (Roche Diagnostics) according to the manufacturer's recommendations.

[0289] APOC3 protein, triglyceride, HDL, and total cholesterol levels were normalized for each animal. For normalization, the APOC3 protein, triglyceride, HDL, LDL, and total cholesterol levels for each animal at a given time point were divided by that animal's pre-treatment expression level (in this case, day -1) to determine a "normalized to pre-treatment" expression ratio. Expression at a particular time point was then normalized to the vehicle control group by dividing the "normalized to pre-treatment" ratio for each individual animal by the average "normalized to pre-treatment" ratio for all mice in the vehicle control group. This resulted in expression at each time point normalized to control expression. The data from the experiment are shown in Tables 16-20 below.

[0290] [Table 16]

[0291] [Table 17]

[0292] [Table 18]

[0293] [Table 19]

[0294] [Table 20]

[0295] Each of the APOC3 RNAi agents in each of the dosing groups (i.e., Groups 2-16) demonstrated a reduction in APOC3 protein levels, triglyceride levels, total cholesterol levels, and LDL levels compared to the control (Group 1). For example, a single 0.5 mg / kg dose of the APOC3 RNAi agent AD05251 (Group 7) demonstrated an approximately 86% reduction in APOC3 protein levels (0.138), an approximately 70% reduction in triglyceride levels (0.294), an approximately 47% reduction in total cholesterol levels (0.533), and an approximately 31% reduction in LDL levels (0.688) at Day 22. Furthermore, as expected, administration of AD05251 demonstrated an increase in HDL levels at Day 22 (see, e.g., Table 19 above).

[0296] Example 9 In vivo dose-response study of APOC3 RNAi agents in APOC3 transgenic mice The APOC3 transgenic mouse model described above in Example 5 was used. On day 1, each mouse received a single subcutaneous dose of 200 μl of the respective RNAi agent or control (D5W) dissolved in D5W (5% dextrose in water) according to the dosing groups shown in Table 21 below.

[0297] [Table 21-1] [Table 21-2]

[0298] Each of the APOC3 RNAi agents contained a modified nucleotide conjugated at the 5' end of the sense strand to a targeting ligand (tridentate ligand) containing three N-acetyl-galactosamine groups having the structure (NAG37)s (see Tables 4, 5, 6, and 7 for specific modification and structural information for the APOC3 RNAi agents).

[0299] Injections were performed between the skin and muscle of the loose skin in the neck and shoulder area (i.e., subcutaneous injection). Four mice per group were tested. Serum was collected on day -1 (pre-dose blood collection after a 4-hour fast) and days 8, 15, 22, 29, and 36. Mice were fasted for 4 hours before each collection. Serum APOC3 expression levels, triglycerides, high-density lipoprotein (HDL), low-density lipoprotein (LDL), and total cholesterol were measured using a Cobas® Integra 400 (Roche Diagnostics) according to the manufacturer's recommendations.

[0300] The APOC3 protein, triglyceride, HDL, and total cholesterol levels for each animal were normalized. For normalization, the APOC3 protein, triglyceride, HDL, LDL, and total cholesterol levels for each animal at a given time point were divided by the pre-treatment expression level for that animal (in this case, day -1) to determine a "normalized to pre-treatment" expression ratio. The data from the experiment are shown in Tables 22-26 below.

[0301] [Table 22]

[0302] [Table 23]

[0303] [Table 24]

[0304] [Table 25]

[0305] [Table 26]

[0306] Each of the APOC3 RNAi agents tested demonstrated a dose response with respect to the reduction of APOC3 protein levels, triglyceride levels, total cholesterol levels, and LDL levels.

[0307] Example 10 In vivo dose-response study of APOC3 RNAi agents in APOC3 transgenic mice The APOC3 transgenic mouse model described above in Example 5 was used. On day 1, each mouse received a single subcutaneous dose of 200 μl of the respective RNAi agent or control vehicle (D5W) dissolved in D5W (5% dextrose in water) according to the dosing groups shown in Table 27 below.

[0308] [Table 27-1] [Table 27-2]

[0309] Each of the APOC3 RNAi agents contained a modified nucleotide conjugated at the 5' end of the sense strand to a targeting ligand (tridentate ligand) containing three N-acetyl-galactosamine groups having the modified sequence described in the double-stranded structure herein (see Tables 4, 5, 6, and 7 for specific modification and structural information regarding the APOC3 RNAi agents).

[0310] The APOC3 RNAi agents tested in Example 10 contained nucleotide sequences designed to target different positions on the APOC3 gene (i.e., SEQ ID NO: 1). More specifically, groups 2 to 4 (i.e., APOC3 RNAi agents AD05891, AD05892, and AD05893) contained antisense strand sequences designed to target position 248 of the APOC3 gene; group 5 (i.e., APOC3 RNAi agent AD05894) contained antisense strand sequences designed to target position 263 of the APOC3 gene; groups 6 to 7 (i.e., APOC3 RNAi agents AD05895 and AD05896) contained antisense strand sequences designed to target position 422 of the APOC3 gene; group 8 (i.e., APOC3 RNAi agent AD05897) contained antisense strand sequences designed to target position 246 of the APOC3 gene; and groups 9 to 10 (i.e., APOC3 RNAi agents AD05898, AD05899, AD05891, AD05892, and AD05893) contained antisense strand sequences designed to target position 248 of the APOC3 gene. RNAi agents AD05889 and AD05890) contained antisense strand sequences designed to target position 168 of the APOC3 gene; and groups 11 to 22 (i.e., APOC3 RNAi agents AD05876, AD05877, AD05878, AD05878, AD05880, AD05882, AD05884, AD05885, AD05886, AD05887, AD05888, and AD05769) contained antisense strand sequences designed to target position 438 of the APOC3 gene.

[0311] Injections were performed between the skin and muscle of the loose skin in the neck and shoulder area (i.e., subcutaneous injection). Three mice per group were tested (n=3). Serum was collected on day -1 (pre-administration blood collection after 4-hour fasting), and on days 8 and 15. Additional serum samples were collected on days 22 and 29 for mice administered certain RNAi agents that showed relatively high inhibitory activity, as well as mice administered the vehicle control. Mice were fasted for 4 hours before each collection. Serum APOC3 expression levels, triglycerides, high-density lipoprotein (HDL), low-density lipoprotein (LDL), and total cholesterol were measured using a Cobas® Integra 400 (Roche Diagnostics) according to the manufacturer's recommendations.

[0312] The APOC3 protein, triglyceride, HDL, and total cholesterol levels for each animal were normalized. For normalization, the APOC3 protein, triglyceride, HDL, LDL, and total cholesterol levels for each animal at a given time point were divided by the pre-treatment expression level for that animal (in this case, day -1) to determine a "normalized to pre-treatment" expression ratio. The data from the experiment are shown in Tables 28-32 below.

[0313] [Table 28-1] [Table 28-2]

[0314] [Table 29-1] [Table 29-2]

[0315] [Table 30-1] [Table 30-2]

[0316] [Table 31-1] [Table 31-2]

[0317] [Table 32-1] [Table 32-2]

[0318] As shown in Tables 28-32 above, the RNAi agents in groups 2-10 (i.e., RNAi agents having antisense strands designed to target the APOC3 gene at positions 248, 263, 422, 246, and 168) exhibited relatively limited inhibitory effects, especially when compared with the RNAi agents in groups 11-22, all of which contained antisense strand nucleotide sequences designed to target position 438 of the APOC3 gene. Furthermore, among those RNAi agents containing sequences targeting position 438 of the APOC3 gene, group 11 (AD05876) and group 22 (AD05769) exhibited the highest inhibitory effects on APOC3 protein levels, triglycerides, and total cholesterol levels.

[0319] Example 11 In vivo testing of APOC3 RNAi agents in APOC3 transgenic mice The APOC3 transgenic mouse model described above in Example 5 was used. On day 1, each mouse received a single subcutaneous dose of 200 μl of the respective RNAi agent or control vehicle (D5W) dissolved in D5W (5% dextrose in water) according to the dosing groups shown in Table 33 below.

[0320] [Table 33-1] [Table 33-2]

[0321] Each of the APOC3 RNAi agents contained a modified nucleotide conjugated at the 5' end of the sense strand to a targeting ligand (tridentate ligand) containing three N-acetyl-galactosamine groups having the modified sequence described in the double-stranded structure herein (see Tables 4, 5, 6, and 7 for specific modification and structural information regarding the APOC3 RNAi agents).

[0322] The APOC3 RNAi agents tested in Example 11 contained nucleotide sequences designed to target different positions on the APOC3 gene (i.e., SEQ ID NO: 1). More specifically, Group 2 (i.e., APOC3 RNAi agent AD05260) contained an antisense strand sequence designed to target position 58 of the APOC3 gene; Group 3 (i.e., APOC3 RNAi agent AD05221) contained an antisense strand sequence designed to target position 246 of the APOC3 gene; Groups 4 to 7 (i.e., APOC3 Groups 8-12 (i.e., APOC3 RNAi agents AD05167, AD05168, AD05171, AD05258, and AD05259) contained antisense strand sequences designed to target position 434 of the APOC3 gene; groups 13-15 (i.e., APOC3 RNAi agents AD05169, AD05239, and AD05251) contained antisense strand sequences designed to target position 438 of the APOC3 gene; and group 16 (i.e., APOC3 RNAi agent AD05220) contained antisense strand sequences designed to target position 506 of the APOC3 gene.

[0323] Injections were performed between the skin and muscle of the loose skin in the neck and shoulder area (i.e., subcutaneous injection). Three mice per group were tested (n=3). Serum was collected on day -1 (pre-administration blood collection after 4-hour fasting), and on days 8 and 15. Additional serum samples were collected on days 22 and 29 for mice administered certain RNAi agents that showed relatively high inhibitory activity, as well as mice administered the vehicle control. Mice were fasted for 4 hours before each collection. Serum APOC3 expression levels, triglycerides, high-density lipoprotein (HDL), low-density lipoprotein (LDL), and total cholesterol were measured using a Cobas® Integra 400 (Roche Diagnostics) according to the manufacturer's recommendations.

[0324] The APOC3 protein, triglyceride, HDL, and total cholesterol levels for each animal were normalized. For normalization, the APOC3 protein, triglyceride, HDL, LDL, and total cholesterol levels for each animal at a given time point were divided by the pre-treatment expression level for that animal (in this case, day -1) to determine a "normalized to pre-treatment" expression ratio. The data from the experiment are shown in Tables 34-38 below.

[0325] [Table 34]

[0326] [Table 35]

[0327] [Table 36]

[0328] [Table 37]

[0329] [Table 38]

[0330] Example 12 In vivo testing of APOC3 RNAi agents in cynomolgus monkeys APOC3 RNAi agents were evaluated in cynomolgus monkeys. On day 1, cynomolgus monkey (Macaca fascicularis) primates (also referred to herein as "cynos") received a single subcutaneous injection of 0.3 mL / kg (approximately 2-3 mL volume, depending on animal weight) containing 3.0 mg / kg of APOC3 RNAi agent AD05876 formulated in saline. APOC3 RNAi agent AD05876 contained modified nucleotides and tridentate N-acetyl-galactosamine targeting ligands ((NAG37)s) conjugated to the 5' end of the sense strand, as shown in Tables 4, 5, 6, and 7.

[0331] Two cynomolgus monkeys were studied (n=2). Liver biopsies were taken on days -8 (pre-dose), 29, and 50. An additional liver biopsy was taken on day 15 for one of the monkeys.

[0332] On each biopsy collection day, monkeys were anesthetized, and ultrasound-guided liver biopsies were performed to extract two or three liver tissue samples of approximately 1 mm x 4 mm in size.The biopsy samples were then homogenized, and the APOC3 mRNA levels in the livers of cynomolgus monkeys were measured by RT-qPCR.The obtained values ​​were then normalized to the APOC3 mRNA measurements before administration (in this case, on day -8).The obtained mRNA data are shown in Tables 39 and 40 below.

[0333] [Table 39]

[0334] [Table 40-1] [Table 40-2]

[0335] All cynomolgus monkeys treated with AD05876 showed significant reductions in liver-specific APOC3 mRNA compared to pre-treatment measurements at all time points measured. At day 29, for example, the first cynomolgus monkey had an approximately 87.5% reduction in APOC3 mRNA (0.125), while the second cynomolgus monkey had an approximately 88.8% reduction (0.112) compared to pre-treatment levels.

[0336] Example 13 In vivo testing of APOC3 RNAi agents in rhesus monkeys fed a high fructose corn syrup (HFCS) diet APOC3 RNAi agent AD05876 was further evaluated in rhesus monkeys fed a high fructose corn syrup (HFCS) diet. The monkeys were fed a HFCS diet for 37 days prior to dosing. These animals were known to experience an increase in plasma triglycerides of more than 180 mg / dL when fed a HFCS diet. On day 1 and again on day 29, four rhesus monkeys were administered subcutaneous injections containing 4.0 mg / kg of APOC3 RNAi agent AD05876 formulated in saline (n=4). Two additional rhesus monkeys were administered normal saline control. APOC3 RNAi agent AD05876 contained modified nucleotides and contained an N-acetyl-galactosamine targeting ligand conjugated to the 5' end of the sense strand, as shown in Tables 4, 5, 6, and 7.

[0337] Both fed and fasting blood samples were collected for analysis, and fasting serum samples were analyzed on days -8 (pre-dose), 8, and 15. Monkeys were fasted overnight before each collection. Serum APOC3 protein levels were measured by ELISA assay (R&D Systems) according to the manufacturer's recommendations. Serum triglycerides, total cholesterol, high-density lipoprotein (HDL), and low-density lipoprotein (LDL) were measured on a Cobas® Integra 400 (Roche Diagnostics) according to the manufacturer's recommendations.

[0338] The APOC3 protein, triglyceride, total cholesterol, HDL, and LDL levels of each animal were normalized. For normalization, the APOC3 protein, triglyceride, HDL, and total cholesterol levels for each animal at a given time point were divided by the pre-treatment expression level in that animal (in this case, day -8) to determine the "normalized to pre-treatment" expression ratio.

[0339] Data from the studies described in this Example are presented below in Tables 41-45.

[0340] [Table 41]

[0341] [Table 42]

[0342] [Table 43-1] [Table 43-2]

[0343] [Table 44]

[0344] [Table 45]

[0345] Rhesus monkeys administered AD05876 at a dosage level of 4.0 mg / kg showed a decrease in APOC3 protein compared to pre-treatment measurements at each time point. Furthermore, substantial decreases in both triglyceride and total cholesterol levels were also observed. For example, in one animal, triglycerides were reduced by approximately 89% on day 22, and as shown in Table 42 above, the mean triglyceride level was reduced by approximately 60% on day 22 (0.395). Furthermore, the mean HDL level increased by approximately 47% on day 22 (see Table 44 (1.465)), with one animal having a 2.2-fold increase in HDL levels.

[0346] Other embodiments While the present invention has been described in conjunction with its detailed description, it is to be understood that the description is intended to illustrate, but not to limit, the scope of the invention, which is defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims. The present invention provides, for example, the following items. (Item 1) An RNAi agent for inhibiting the expression of the APOC3 gene, an antisense strand comprising at least 17 contiguous nucleotides that differ by 0 or 1 nucleotide from any one of the sequences provided in Table 2, Table 3, or Table 4; and a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand an RNAi agent comprising: (Item 2) 2. The RNAi agent of item 1, wherein the antisense strand comprises nucleotides 2 to 18 of any one of the sequences provided in Table 2, Table 3, or Table 4. (Item 3) 3. The RNAi agent of claim 1 or 2, wherein the sense strand comprises a nucleotide sequence of at least 17 contiguous nucleotides that differs by 0 or 1 nucleotide from any one of the sense strand sequences provided in Table 2, Table 3, or Table 5, and the sense strand has a region of at least 85% complementarity over 17 contiguous nucleotides with the antisense strand. (Item 4) 4. The RNAi agent of any of items 1 to 3, wherein at least one nucleotide of the RNAi agent is a modified nucleotide or comprises a modified internucleoside linkage. (Item 5) 4. The RNAi agent of any one of items 1 to 3, wherein all or substantially all of the nucleotides of the sense and / or antisense strand of the RNAi agent are modified nucleotides. (Item 6) 6. The RNAi agent of any one of items 4 or 5, wherein the modified nucleotide is selected from the group consisting of 2'-O-methyl nucleotides, 2'-fluoro nucleotides, 2'-deoxynucleotides, 2',3'-seco nucleotide mimics, locked nucleotides, 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted 2'-O-methyl nucleotides, inverted 2'-deoxynucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, vinylphosphonate deoxyribonucleotides, cyclopropylphosphonate deoxyribonucleotides, and 3'-O-methyl nucleotides. (Item 7) 6. The RNAi agent of item 5, wherein all or substantially all of the modified nucleotides are either 2'-O-methyl nucleotides or 2'-fluoro nucleotides. (Item 8) 8. The RNAi agent of any one of items 1 to 7, wherein the antisense strand comprises the nucleotide sequence of any one of the modified antisense strand sequences provided in Table 3 or Table 4. (Item 9) 9. The RNAi agent of item 8, wherein the antisense strand comprises the nucleotide sequence of any one of the modified antisense strand sequences provided in Table 4. (Item 10) 10. The RNAi agent of any one of items 1 to 9, wherein the sense strand comprises the nucleotide sequence of any one of the modified sense strand sequences provided in Table 3 or Table 5. (Item 11) 2. The RNAi agent of item 1, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 4, and the sense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 5. (Item 12) 12. The RNAi agent of any one of items 1 to 11, which is linked to a targeting ligand. (Item 13) 13. The RNAi agent of item 12, wherein the targeting ligand comprises N-acetyl-galactosamine. (Item 14) The targeting ligand is (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG32), (NAG33), (NAG34), (NAG35), (NAG36), (NAG37), (NAG38), (NAG39), (NAG39), (NAG39), (NAG39), (NAG40), (NAG41), (NAG42), (NAG43), (NAG44), (NAG45), (NAG46), (NAG47), (NAG48), (NAG49 ...9), (NAG50), (NAG50), (NAG51), (NAG52), (NAG53), (NAG54), (NAG55), (NAG55), (NAG56), (NAG57), (NAG57), (NAG58), (NAG59), (NAG59), (NAG60), (NAG61), (NAG62), (NAG63), (NAG64), (NAG65), (NAG66), (NAG67), (NAG67), (NAG68), (NAG69), (NAG69), (NAG70), (NAG71), (NAG72), (NA 14. The RNAi agent of claim 12 or 13, comprising a structure selected from the group consisting of: (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s. (Item 15) 15. The RNAi agent of item 14, wherein the targeting ligand comprises the structure of (NAG37) or (NAG37)s. (Item 16) 16. The RNAi agent of any one of items 12 to 15, wherein the targeting ligand is conjugated to the sense strand. (Item 17) 17. The RNAi agent of item 16, wherein the targeting ligand is conjugated to the 5' end of the sense strand. (Item 18) 18. The RNAi agent according to any one of items 1 to 17, wherein the sense strand is 18 to 30 nucleotides in length and the antisense strand is 18 to 30 nucleotides in length. (Item 19) 19. The RNAi agent according to item 18, wherein the sense strand and the antisense strand are each 18 to 27 nucleotides in length. (Item 20) 20. The RNAi agent according to item 19, wherein the sense strand and the antisense strand are each 18 to 24 nucleotides in length. (Item 21) 21. The RNAi agent of item 20, wherein the sense strand and the antisense strand are each 21 nucleotides in length. (Item 22) 22. The RNAi agent of item 21, having two blunt ends. (Item 23) 23. The RNAi agent of any one of items 1 to 22, wherein the sense strand comprises one or two end caps. (Item 24) 24. The RNAi agent of any one of items 1 to 23, wherein the sense strand comprises one or two inverted abasic residues. (Item 25) 2. The RNAi agent of item 1, comprising a sense strand and an antisense strand that form a duplex having the structure of any one of the duplexes in Table 3 or Table 6. (Item 26) The following nucleotide sequence (5'→3'): [ka] 2. The RNAi agent of claim 1, comprising an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from one of the above by 0 or 1 nucleotide. (Item 27) the sense strand having the following nucleotide sequence (5'→3'): [ka] (where I represents an inosine nucleotide) 27. The RNAi agent of item 26, consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from one of the above by 0 or 1 nucleotide. (Item 28) 28. The RNAi agent of item 26 or 27, wherein all or substantially all of the nucleotides of both the antisense strand and the sense strand are modified nucleotides. (Item 29) 29. The RNAi agent of any one of items 26 to 28, wherein the sense strand further comprises an inverted abasic residue at the 3' and 5' ends of the nucleotide sequence. (Item 30) 30. The RNAi agent of any one of paragraphs 26 to 29, wherein the sense strand of the RNAi agent is linked to a targeting ligand. (Item 31) 31. The RNAi agent of item 30, wherein the targeting ligand has affinity for an asialoglycoprotein receptor. (Item 32) 32. The RNAi agent of claim 31, wherein the targeting ligand comprises N-acetyl-galactosamine. (Item 33) The following nucleotide sequence (5'→3'): [ka] (wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate bond.) 2. The RNAi agent of claim 1, comprising an antisense strand comprising, consisting of, or consisting essentially of a modified nucleotide sequence that differs from one of the above by 0 or 1 nucleotide, and wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides. (Item 34) the sense strand having the following nucleotide sequence (5'→3'): [ka] (wherein a, c, g, i, and u represent 2'-O-methyladenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, If, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, inosine, or uridine, respectively; and s represents a phosphorothioate bond.) 34. The RNAi agent of item 33, comprising, consisting of, or consisting essentially of a modified nucleotide sequence that differs from one of the above by 0 or 1 nucleotide. (Item 35) 35. The RNAi agent of claim 33 or 34, wherein the sense strand further comprises an inverted abasic residue at the 3' end and / or 5' end of the nucleotide sequence. (Item 36) 36. The RNAi agent of any one of paragraphs 33 to 35, wherein the sense strand of the RNAi agent is linked to a targeting ligand. (Item 37) 37. The RNAi agent of item 36, wherein the targeting ligand has affinity for the asialoglycoprotein receptor. (Item 38) 38. The RNAi agent of item 37, wherein the targeting ligand comprises N-acetyl-galactosamine. (Item 39) The RNAi agent described in item 1 has a double-stranded structure selected from the group consisting of AD05251 (sequence numbers 2 and 501); AD05876 (sequence numbers 4 and 572); AD05769 (sequence numbers 6 and 557); AD05169 (sequence numbers 2 and 482); AD05220 (sequence numbers 7 and 494); AD05547 (sequence numbers 7 and 545); AD05299 (sequence numbers 9 and 521); AD05223 (sequence numbers 11 and 497); and AD05171 (sequence numbers 13 and 483). (Item 40) Item 41. The RNAi agent according to Item 39, having a double-stranded structure selected from the group consisting of AD05251 (SEQ ID NOs: 2 and 501) and AD05876 (SEQ ID NOs: 4 and 572). 41. A composition comprising the RNAi agent of any of items 1 to 40, including a pharmaceutically acceptable excipient. (Item 42) 42. The composition of claim 41, wherein the RNAi agent is conjugated to a targeting ligand. (Item 43) 43. The composition of claim 42, wherein the targeting ligand comprises n-acetyl-galactosamine. (Item 44) 44. The composition of claim 43, wherein the targeting ligand is selected from the targeting ligands in Table 7. (Item 45) 45. The composition of any one of items 41 to 44, further comprising a second RNAi agent for inhibiting expression of APOC3. (Item 46) 45. The composition of any one of items 41 to 44, further comprising one or more additional therapeutic agents. (Item 47) 47. A method for inhibiting expression of the APOC3 gene in a cell, the method comprising introducing into the cell an effective amount of the RNAi agent of any one of items 1 to 40 or the composition of any one of items 41 to 46. (Item 48) 48. The method of item 47, wherein the cell is in a subject. (Item 49) 49. The method of claim 48, wherein the subject is a human subject. (Item 50) 50. The method of any one of items 47 to 49, wherein the APOC3 gene expression is inhibited by at least about 30%. (Item 51) 47. A method for treating an APOC3-related disease or disorder, comprising administering to a human subject in need thereof a therapeutically effective amount of the composition of any one of items 41 to 46. (Item 52) 52. The method of claim 51, wherein the disease is a cardiometabolic disease. (Item 53) Item 53. The method of item 52, wherein the disease is hypertriglyceridemia, obesity, hyperlipidemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, cardiovascular disease, coronary artery disease, hypertriglyceridemia-induced pancreatitis, metabolic syndrome, type II diabetes, familial chylomicronemia syndrome, or familial partial lipodystrophy. (Item 54) 54. The method of any one of paragraphs 51 to 53, wherein the RNAi agent is administered at a dose of about 0.05 mg / kg human subject body weight to about 5.0 mg / kg human subject body weight. (Item 55) 54. The method of any of paragraphs 51 to 53, wherein the RNAi agent is administered in two or more doses. (Item 56) 54. The method of any of items 51 to 53, wherein the dose is administered by subcutaneous injection. (Item 57) 47. A method for lowering triglyceride levels in a subject, comprising administering to the subject an effective amount of the composition of any one of items 41 to 46. (Item 58) 47. A method for lowering cholesterol levels in a subject, comprising administering to the subject an effective amount of the composition of any one of items 41 to 46. (Item 59) 47. A method for reducing low density lipoprotein (LDL) levels in a subject, comprising administering to the subject an effective amount of the composition of any one of items 41 to 46. (Item 60) 41. Use of the RNAi agent of any one of items 1 to 40 for the treatment of a disease, disorder, or condition mediated at least in part by APOC3 gene expression. (Item 61) 47. Use of the composition of any one of items 41 to 46 for the treatment of a disease, disorder, or condition mediated at least in part by APOC3 gene expression, elevated triglyceride levels, or elevated cholesterol levels. (Item 62) 47. Use of a composition according to any one of items 41 to 46 for the manufacture of a medicament for the treatment of a disease, disorder or condition mediated at least in part by APOC3 gene expression. (Item 63) 64. Use according to any one of items 60 to 63, wherein the disease is hypertriglyceridemia, obesity, hyperlipidemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, cardiovascular disease, coronary artery disease, hypertriglyceridemia-induced pancreatitis, metabolic syndrome, type II diabetes, familial chylomicronemia syndrome, or familial partial lipodystrophy.

Claims

[Claim 1] The invention as set forth in the drawings.

Images