Pan-genotypic drugs against respiratory viruses and methods of using same

Pan-genotypic compositions targeting the PSL2 structure in IAV, IBV, and coronaviruses provide a broad-spectrum solution to inhibit these viruses, addressing drug resistance and pandemic threats.

JP2026042885APending Publication Date: 2026-03-11THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2026-01-05
Publication Date
2026-03-11

AI Technical Summary

Technical Problem

Current antiviral drugs for influenza A virus (IAV) are subtype-specific and face rising resistance issues, and there is a need for new therapeutic approaches to combat respiratory viruses like influenza B, coronavirus, and respiratory syncytial virus (RSV), particularly in the context of emerging pandemics.

Method used

Development of pan-genotypic compositions that target the conserved packaging stem loop 2 (PSL2) structure in the RNA of IAV, IBV, and coronaviruses, using oligonucleotides and locked nucleic acids (LNAs) to inhibit viral replication.

Benefits of technology

The compositions effectively inhibit a wide range of influenza A subtypes and other respiratory viruses by disrupting PSL2, demonstrating potential in treating and preventing infections and reducing drug resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026042885000001_ABST
    Figure 2026042885000001_ABST
Patent Text Reader

Abstract

Pan-genotypic drugs against respiratory viruses and methods of using same are provided. [Solution] Methods are provided for inhibiting respiratory viruses (i.e., viruses associated with respiratory disease, such as influenza A, influenza B, RSV, etc.) in a sample. Embodiments of the methods include contacting a sample containing viral RNA (vRNA) bearing a target motif with an effective amount of an agent that specifically binds to the target motif and inhibits the respiratory virus. Also provided are methods for treating or preventing a respiratory viral infection in a subject. Also provided are compounds and pharmaceutical compositions comprising oligonucleotide sequences complementary to target vRNA regions used in the subject methods.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] cross reference This application is a continuation-in-part of U.S. Patent Application No. 16 / 792,103, filed February 14, 2020, which is a continuation-in-part of U.S. Patent Application No. 16 / 081,818, filed August 31, 2018, which is a 371 national stage application of PCT / US2017 / 20241, filed March 1, 2017, and claims the benefit of U.S. Provisional Patent Application No. 62 / 302,548, filed March 2, 2016, all of which are incorporated herein by reference in their entireties.

[0002] This application also claims the benefit of U.S. Provisional Patent Application No. 62 / 992,659, filed March 20, 2020, which is incorporated herein by reference in its entirety. [Background technology]

[0003] Introduction Influenza A virus (IAV) is a segmented RNA virus that causes significant morbidity and mortality worldwide. All currently approved IAV antiviral drugs are targeted against viral proteins, are subtype-specific, and are challenged by rising antiviral resistance to all drug class members.

[0004] The IAV genome consists of eight single-stranded, negative-sense viral RNA (vRNA) segments that encode at least 14 known viral proteins. The vRNAs, along with the nucleoprotein (NP) and a heterotrimeric polymerase complex consisting of the PB2, PB1, and PA proteins, form the complete viral ribonucleoprotein (vRNP). For complete infection, IAV virions must incorporate at least one vRNP from each segment. Each vRNP interacts with at least one other partner to form a supramolecular complex likely maintained by intersegment RNA-RNA and / or protein-RNA interactions that are hypothesized to guide the packaging process.

[0005] An individual can be infected with influenza A virus alone and / or with other respiratory viruses, including, but not limited to, influenza B virus (IBV), coronavirus (Cov), respiratory syncytial virus (RSV), etc. IBV is a segmented RNA virus whose genome consists of eight segments of linear, negative-sense, single-stranded RNA.

[0006] Respiratory syncytial virus (RSV), also known as human respiratory syncytial virus (hRSV), is a negative-sense, single-stranded RNA virus. Patients infected with RSV are at increased risk of respiratory failure. It is a highly prevalent human respiratory viral pathogen.

[0007] Coronaviruses (CoVs) are enveloped RNA viruses that typically cause self-limiting respiratory tract infections in humans. However, over the past two decades, there have been life-threatening conditions caused by novel CoV strains, such as those found in the 2003 Severe Acute Respiratory Syndrome (SARS) pandemic, the 2012 Middle East Respiratory Syndrome (MERS), and most recently the 2019 CoV outbreak (SARS-CoV-2) that originated in Wuhan, China. New therapeutic approaches are critically needed to contain current and future pandemics. Summary of the Invention

[0008] Embodiments of the present disclosure provide pan-genotyping compositions designed to disrupt RNA structural elements of respiratory disease-associated viruses, such as IAV, IBV, RSV, and coronaviruses. These compositions disrupt an IAV RNA structural element called packaging stem loop 2 (PSL2), located within the 5' packaging signal region of genome segment PB2. Disruption of the PSL2 structure dramatically inhibits IAV. PSL2 is conserved across all influenza A subtypes tested.

[0009] Methods for inhibiting influenza A virus in a sample are provided. Embodiments of the methods include contacting a sample containing viral RNA (vRNA) having a PSL2 motif with an effective amount of an agent that specifically binds to the PSL2 motif to inhibit influenza A virus. In some cases, the vRNA is isolated from a virion or a cell. In some cases, the vRNA is in a virion. In some cases, the vRNA is in an infected cell. Also provided are methods for treating or preventing influenza A virus infection in a subject. Also provided are methods for screening candidate agents for the ability to inhibit influenza A virus in a cell, comprising contacting a sample with the candidate agent and determining whether the candidate agent specifically binds to the PSL2 motif of the vRNA. Compounds and pharmaceutical compositions comprising an oligonucleotide sequence complementary to a region of PB2 vRNA (or its complementary strand) for use in the subject methods are also provided.

[0010] Methods for inhibiting influenza B virus in a sample are provided. Embodiments of the methods include contacting a sample containing viral RNA (vRNA) bearing a motif with an effective amount of an agent that specifically binds to the RNA motif to inhibit influenza B virus. In some cases, the vRNA is isolated from a virion or a cell. In some cases, the vRNA is in a virion. In some cases, the vRNA is in an infected cell. Also provided are methods for treating or preventing influenza B virus infection in a subject. Also provided are methods for screening candidate agents for the ability to inhibit influenza B virus in a cell, comprising contacting a sample with the candidate agent and determining whether the candidate agent specifically binds to the RNA motif of the vRNA. Compounds and pharmaceutical compositions comprising an oligonucleotide sequence complementary to an IBV vRNA region for use in the subject methods are also provided. [Brief explanation of the drawings]

[0011] Those skilled in the art will understand that the drawings, described below, are for illustrative purposes only and are not intended to limit the scope of the present teachings in any way.

[0012] [Figure 1A] Figures 1A-1F show the RNA secondary structures of wild-type PB2 (SEQ ID NO: 1) and packaging mutant vRNAs, PB2m757 (SEQ ID NO: 2), m745 (SEQ ID NO: 3), 1918 pandemic (H1N1) (SEQ ID NO: 4), highly pathogenic avian (H5M=N1) (SEQ ID NO: 5), and 2009 swine (H1N1) (SEQ ID NO: 6). [Figure 1B] Figures 1A-1F show the RNA secondary structures of wild-type PB2 (SEQ ID NO: 1) and packaging mutant vRNAs, PB2m757 (SEQ ID NO: 2), m745 (SEQ ID NO: 3), 1918 pandemic (H1N1) (SEQ ID NO: 4), highly pathogenic avian (H5M=N1) (SEQ ID NO: 5), and 2009 swine (H1N1) (SEQ ID NO: 6). [Figure 1C]Figures 1A-1F show the RNA secondary structures of wild-type PB2 (SEQ ID NO: 1) and packaging mutant vRNAs, PB2m757 (SEQ ID NO: 2), m745 (SEQ ID NO: 3), 1918 pandemic (H1N1) (SEQ ID NO: 4), highly pathogenic avian (H5M=N1) (SEQ ID NO: 5), and 2009 swine (H1N1) (SEQ ID NO: 6). [Figure 1D-1F] Figures 1A-1F show the RNA secondary structures of wild-type PB2 (SEQ ID NO: 1) and packaging mutant vRNAs, PB2m757 (SEQ ID NO: 2), m745 (SEQ ID NO: 3), 1918 pandemic (H1N1) (SEQ ID NO: 4), highly pathogenic avian (H5M=N1) (SEQ ID NO: 5), and 2009 swine (H1N1) (SEQ ID NO: 6). [Figure 1G] Predicted RNA secondary structures conserved across coronavirus B viruses are shown. [Figure 2] Panels A and B show the reactivity of full-length PB2 vRNA. [Figure 3A] Figures 3A-3E show disruption of wild-type reactivity (SEQ ID NO: 7), PB2m744b (SEQ ID NO: 8), PB2m745 (SEQ ID NO: 9), PB2m55c (SEQ ID NO: 10), and PB2m757 (SEQ ID NO: 11) by packaging-deficient mutations. [Figure 3B] Figures 3A-3E show disruption of wild-type reactivity (SEQ ID NO: 7), PB2m744b (SEQ ID NO: 8), PB2m745 (SEQ ID NO: 9), PB2m55c (SEQ ID NO: 10), and PB2m757 (SEQ ID NO: 11) by packaging-deficient mutations. [Figure 3C] Figures 3A-3E show disruption of wild-type reactivity (SEQ ID NO: 7), PB2m744b (SEQ ID NO: 8), PB2m745 (SEQ ID NO: 9), PB2m55c (SEQ ID NO: 10), and PB2m757 (SEQ ID NO: 11) by packaging-deficient mutations. [Figure 3D] Figures 3A-3E show disruption of wild-type reactivity (SEQ ID NO: 7), PB2m744b (SEQ ID NO: 8), PB2m745 (SEQ ID NO: 9), PB2m55c (SEQ ID NO: 10), and PB2m757 (SEQ ID NO: 11) by packaging-deficient mutations. [Figure 3E]Figures 3A-3E show disruption of wild-type reactivity (SEQ ID NO: 7), PB2m744b (SEQ ID NO: 8), PB2m745 (SEQ ID NO: 9), PB2m55c (SEQ ID NO: 10), and PB2m757 (SEQ ID NO: 11) by packaging-deficient mutations. [Figure 4] The conservation of nucleotide sequences containing PSL2 structures is shown. [Figure 5A] 5A to 5D show two-dimensional mutation and map analysis of the PSL2 RNA secondary structure (FIG. 5C, SEQ ID NO: 12). [Figure 5B] 5A to 5D show two-dimensional mutation and map analysis of the PSL2 RNA secondary structure (FIG. 5C, SEQ ID NO: 12). [Figure 5C] 5A to 5D show two-dimensional mutation and map analysis of the PSL2 RNA secondary structure (FIG. 5C, SEQ ID NO: 12). [Figure 5D] 5A to 5D show two-dimensional mutation and map analysis of the PSL2 RNA secondary structure (FIG. 5C, SEQ ID NO: 12). [Figure 6] Panels A to B show the design of compensatory mutations for the PR8 PB2 mutant described above (Panel A, SEQ ID NO: 13). [Figure 7] Panels A-D show synonymous mutations of a single highly conserved codon in PR8 PB2 vRNA (Panel A, SEQ ID NOs: 14-15; Panel B, SEQ ID NOs: 16-23, top to bottom). [Figure 8] A table showing the nomenclature of PB2 globule packaging mutants and the corresponding sites of mutations is shown. [Figure 9A] 9A-9C show the effect of synonymous mutations on the PSL2 structures PB2m731 (SEQ ID NO: 24), PB2m751 (SEQ ID NO: 25), and PB2m748 (SEQ ID NO: 26). [Figure 9B] 9A-9C show the effect of synonymous mutations on the PSL2 structures PB2m731 (SEQ ID NO: 24), PB2m751 (SEQ ID NO: 25), and PB2m748 (SEQ ID NO: 26). [Figure 9C]9A-9C show the effect of synonymous mutations on the PSL2 structures PB2m731 (SEQ ID NO: 24), PB2m751 (SEQ ID NO: 25), and PB2m748 (SEQ ID NO: 26). [Figure 10] Panels AI show the effect of compensatory mutations in PR8 PB2 packaging-defective mutants on virus packaging and titer. [Figure 11] Panels AD show multidimensional chemical mapping of the PB2 packaging defective and compensatory mutant partners (Panel B, SEQ ID NO: 27). [Figure 12] Panels a to t show two-dimensional mutation map rescue analysis. [Figure 13] The design of primer sequences for two-dimensional mutation map rescue mutants is shown. The sequences correspond, from top to bottom, to SEQ ID NOs: 28 to 43. [Figure 14] Panels AB show that packaging-defective viruses decay in vivo. [Figure 15] Panels AD show the antiviral activity of locked nucleic acids targeting the PSL2 RNA structure (Panel A, SEQ ID NO: 44). [Figure 16A] Figures 16A-B show the analysis for LNA-RNA binding. [Figure 16B] Figures 16A-B show the analysis for LNA-RNA binding. [Figure 17] Panels AB show the percent survival and percent weight loss of mice over time following intranasal administration of a single dose of exemplary compound LNA9. [Figure 18] Panels A-D show the susceptibility of influenza virus to oseltamivir after serial passage under drug pressure. [Figure 19] Panels AC show the susceptibility of influenza viruses to the exemplary compound LNA9, including viruses after serial passage under drug pressure and drug-resistant viruses. [Figure 20]Antiviral effect of miRNA-directed LNAs designed to disrupt respiratory virus infection. Huh7 cells were pretreated with 25 nM miRNA-directed LNAs 12–24 h before infection with a 0.3 MOI of fully replicating BSL3 SARS-CoV-2-nLuc reporter virus. Luciferase signals were read 48 h postinfection. Results are presented as log10 luciferase signals. Samples were run in duplicate (N = 2) and controls in quadruplicate (N = 4). Statistical analysis was performed using GraphPad Prism software and calculated using a conventional one-way ANOVA with Dunnett's multiple comparison test between sample and scrambled LNA (Scr.LNA) control means. The positive control nucleoside analog EIDD-2801 (EIDD) was included as a positive control. [Figure 21] Huh7 cells were pretreated with 25 nM of the LNA combination (12.5 nM of each LNA = 25 nM total) 12–24 h prior to infection with a 0.3 MOI of fully replicating BSL3 SARS-CoV-2-nLuc reporter virus. Luciferase signals were read 48 h postinfection. Results are presented as log10 luciferase signals. Samples were run in duplicate (N = 2) and controls in quadruplicate (N = 4). Statistical analysis was performed using GraphPad Prism software and calculated using a conventional one-way ANOVA with Dunnett's multiple comparison test between sample and DMSO control means. The positive control nucleoside analog EIDD-2801 (EIDD) was included as a positive control. [Figure 22] In vivo efficacy of LNA combinations against respiratory viruses. Human ACE2 transgenic mice were treated with a single intranasal dose of vehicle, small molecule A, or LNA combinations 5 days before infection with a lethal challenge of SARS-CoV-2. After infection, animals were monitored daily by clinical score, with 1 being asymptomatic and higher scores indicating worsening clinical status. [Figure 23]ACE2-A549 cells were pretreated with 50 nM, 25 nM, or 5 nM of either CoV-2 plus-strand-targeted LNAs, CoV-2 minus-strand-targeted LNAs, or miRNA-directed LNAs 12–24 h before infection with a 0.3 MOI of fully replicating BSL3 SARS-CoV-2-nLuc reporter virus. Luciferase signals were read 48 h postinfection. Results are presented as log10 luciferase signals. Samples were run in six replicates (N = 6). Statistical analysis was performed using GraphPad Prism software and calculated using a conventional one-way ANOVA with Dunnett's multiple comparison test between sample and scrambled LNA (Scr.LNA) control means. The positive control nucleoside analog EIDD-2801 (EIDD) was included as a positive control. [Figure 24](a-b) Effect of intranasal LNA prophylactic treatment on survival of virus-infected mice. Kaplan-Meier survival plots. Mice (n = 7 mice / group) were intranasally administered a single dose of LNA9, scrambled LNA, or vehicle (mock treatment), followed by lethal inoculation with wild-type PR8 virus. (a) 20 μg of LNA was administered 3 days (day -3) or 1 day (day -1) before infection. (b) Treatment with a single 30 μg dose of LNA9 or vehicle control was performed 1 week prior. (c) Target sites of LNA9 and the newly designed LNA14 mapped onto the PSL2 structure. (d) Electrophoretic profiles of SHAPE analysis performed on untreated, scrambled LNA, LNA9, and LNA14 at a concentration of 100 nM in the presence of PR8 PB2 vRNA. Labeling with 1M7 SHAPE reagent is shown. (e) Kaplan-Meier survival plot of mice (n=7 mice / group) pretreated intranasally with a single 30 μg dose of LNA14 or vehicle control one week (day -7) before lethal PR8 infection. (f-h) A single 40 μg dose of LNA14 or vehicle was administered IN two weeks (day -14) before PR8 virus infection. (f) Kaplan-Meier survival plot. (g) Percent mouse body weight relative to day 0. (h) Clinical score. (i-l) Mice (n=7) were administered a single intranasal dose of 40 μg of LNA14 one week before 1 LD100 primary lethal PR8 virus infection (e). 65 days after the initial infection, surviving mice from (e), along with age-matched naive controls (n=7 / group), were challenged a second time with 10 LD100. (i) Challenge study timeline. (j) Percent mouse body weight relative to day 0. (k) Clinical score. (l) Kaplan-Meier survival curve. (m) Mice (n=10 / group) were infected with a lethal dose of PR8 wild-type virus. Three days after infection, mice received a single dose of 40 μg of LNA14, LNA9, scrambled LNA, or vehicle control by intravenous injection. Kaplan-Meier survival plot. DETAILED DESCRIPTION OF THE INVENTION

[0013] definition Before describing the exemplary embodiments in more detail, the following definitions are set forth to illustrate and define the meaning and scope of terms used in the description.

[0014] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY, 2D ED., John Wiley and Sons, New York (1994), and Hale & Markham, THE HARPER COLLINS DICTIONARY OF BIOLOGY, Harper Perennial, NY (1991) provides those of skill in the art with the general meaning of many of the terms used herein. Nevertheless, for clarity and ease of reference, certain terms are defined below.

[0015] It should be noted that as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. For example, the term "primer" refers to one or more primers, i.e., a single primer and multiple primers. It should further be noted that the claims may be drafted to exclude any optional element. Accordingly, this statement is intended to serve as a predicate for the use of exclusive terminology such as "solely" and "only" in connection with the recitation of claim elements or for the use of a "negative" limitation.

[0016] As used herein, the term "effective amount" refers to that amount of a substance (e.g., a drug of interest) that produces some desired local or systemic effect. The effective amount of a drug of interest will vary depending on a variety of factors, including, but not limited to, the weight and age of the subject, the condition being treated, the severity of the condition, the method of administration, etc., and can be readily determined, e.g., empirically using data such as that provided in the Experimental Section below.

[0017] The term "sample" as used herein refers to a material or mixture of materials, typically, but not necessarily, in fluid, i.e., aqueous, form, containing one or more components of interest. Samples can be derived from a variety of sources, such as from solid or fluid sources, such as biological samples or tissues isolated from an individual, including, but not limited to, plasma, serum, spinal fluid, semen, lymphatic fluid, external sections of skin, respiratory, intestinal, and urinary tracts, tears, saliva, milk, blood cells, tumors, organs, and also samples of in vitro cell culture components (including, but not limited to, conditioned medium resulting from the growth of cells in cell culture medium, cells suspected to be infected with a virus, recombinant cells, and cellular components). Components in a sample are referred to herein as "analytes." In many embodiments, a sample contains at least about 10 2 , 5x10 2 , 10 3 , 5x10 3 , 10 4 , 5x10 4 , 10 5 , 5x10 5 , 10 6 , 5x10 6 , 10 7 , 5x10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 or a complex sample containing more than one species of analyte.

[0018] Antibody fragments include portions of intact antibodies, such as the antigen-binding or variable region of an intact antibody. Examples of antibody fragments include Fab, Fab', F(ab')2, and Fv fragments, diabodies, linear antibodies (Zapata et al., Protein Eng. 8(10):1057-1062(1995)), single-chain antibody molecules, nanobodies, and multispecific and multifunctional antibodies formed from antibody fragments. Papain digestion of an antibody produces two identical antigen-binding fragments, called "Fab" fragments, each with a single antigen-binding site, and a residual "Fc" fragment, a name reflecting its ability to readily crystallize. Pepsin treatment generates an F(ab')2 fragment, which has two antigen-binding sites and is still capable of cross-linking antigen.

[0019] The terms "polypeptide" and "protein," used interchangeably herein, refer to polymeric forms of amino acids of any length and can include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides with modified peptide backbones. The term "fusion protein" or its grammatical equivalents refers to a protein composed of multiple polypeptide components, which are typically not joined in their native state but are typically joined by their respective amino and carboxyl termini via bonds, e.g., peptide bonds, to form a single contiguous polypeptide. Fusion proteins can be combinations of two, three, or even four or more different proteins. The term polypeptide includes fusion proteins, including, but not limited to, fusion proteins with heterologous amino acid sequences, fusions with heterologous and homologous leader sequences with or without an N-terminal methionine residue, immunologically tagged proteins, fusion proteins with a detectable fusion partner, e.g., fusion proteins containing a fluorescent protein, β-galactosidase, luciferase, etc., as a fusion partner. In addition, the term "protein" may further encompass post-translational modifications, including, but not limited to, glycosylation, phosphorylation, methylation, and acetylation.

[0020] Generally, polypeptides can be of any length, e.g., more than 2 amino acids, more than 4 amino acids, more than about 10 amino acids, more than about 20 amino acids, more than about 50 amino acids, more than about 100 amino acids, more than about 300 amino acids, usually up to about 500 or 1000 or more amino acids. A "peptide" is generally more than 2 amino acids, more than 4 amino acids, more than about 10 amino acids, more than about 20 amino acids, usually up to about 50 amino acids. In some embodiments, peptides are 5-30 amino acids in length.

[0021] The term "specific binding" refers to the ability of an agent to preferentially bind to a particular target (e.g., PSL2) present in a homogenous mixture of various analytes. In some cases, a specific binding interaction typically distinguishes between desired and undesired analytes in a sample by about 10-100 fold or more (e.g., about 1000 fold or more). Specific binding can include hybridization, polypeptide-nucleic acid interactions, or small molecule-nucleic acid interactions.

[0022] An "oligonucleotide" refers to a polymer of ribose and / or deoxyribose nucleoside subunits having from about 2 to about 200 consecutive subunits. The nucleoside subunits may be joined by various intersubunit linkages, including, but not limited to, phosphodiester, phosphotriester, alkylphosphonate (e.g., methylphosphonate), P3'→N5' phosphoramidate, N3'→P5' phosphoramidate, N3'→P5' thiophosphoramidate, phosphorodiamidite, and phosphorothioate linkages. In certain cases, the intersubunit linkages contain chiral atoms. Representative chiral intersubunit linkages include, but are not limited to, alkylphosphonate, phosphorodiamidite, and phosphorothioate. Furthermore, "oligonucleotide" includes chemical and biochemical modifications known to those skilled in the art, such as modifications to the sugar (e.g., 2' substitutions), base (see definition of "nucleoside" below), and / or 3' and 5' termini. In embodiments in which an oligonucleotide moiety contains multiple intersubunit linkages, each linkage can be formed using the same chemical or a mixture of linkage chemicals. In embodiments in which an oligonucleotide moiety contains multiple intersubunit linkages, one or more of the linkages can be chiral. Linkages with chiral atoms can be prepared as racemic mixtures or as separate enantiomers. The terms "oligonucleotide," "nucleic acid," "nucleic acid molecule," "nucleic acid fragment," "nucleic acid sequence or segment," or "polynucleotide" are used interchangeably, and can also be used interchangeably with gene, cDNA, DNA, and RNA encoded by a gene.

[0023] "Bicyclic nucleic acid" or "bridged nucleic acid" (BNA) refers to a modified RNA nucleotide in which the ribose moiety is modified with an extra bridge connecting the 2' oxygen and 4' carbon, thereby forming a bicyclic ring system. BNA monomers can contain 5-, 6-, or 7-membered bridge structures with a fixed 3'-endo structure. Bridged nucleic acids include, but are not limited to, locked nucleic acids (LNAs), ethylene-bridged nucleic acids (ENAs), and constrained ethyls (cEts). A "bridge" refers to a chain of atoms or valence bond connecting two bridgeheads, where a "bridgehead" is any backbone atom of a ring system (e.g., a ribose ring system) that is connected to three or more backbone atoms (excluding hydrogen). In some embodiments, the bridge in a BNA has 7 to 12 ring members and 1 to 4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. Unless otherwise specified, BNAs are optionally substituted with one or more substituents, including, but not limited to, alkyl, substituted alkyl, alkoxy, substituted alkoxy, hydroxy, amino, and halogen.

[0024] "Locked nucleic acids" (LNAs) are modified RNA nucleotides in which the ribose moiety is modified with an extra bridge connecting the 2' oxygen and 4' carbon, thereby forming a bicyclic ring system. The bridge "locks" the ribose in the 3'-endo structure often found in A-form duplexes. Locked nucleic acids are also encompassed by the terms "bicyclic nucleic acid" or "bridged nucleic acid" (BNA). LNA nucleotides can be mixed with any convenient nucleotide or nucleotide analog, such as DNA or RNA residues, in oligonucleotides if desired. LNAs hybridize with DNA or RNA according to Watson-Crick base pairing rules. Such oligomers can be chemically synthesized. Generally, the locked ribose conformation enhances base stacking and backbone preorganization, increasing the hybridization properties (melting temperature) of oligonucleotides. In some cases, the locked nucleic acid may be an α-l-locked nucleic acid (α-l-LNA), which is a stereoisomeric analog of locked nucleic acid (LNA) with inverted stereochemistry at the C2', C3', and C4' positions.

[0025] "Ethylene-bridged nucleic acid" (ENA) refers to an LNA-modified RNA nucleotide in which the ribose moiety is modified with an extra bridge containing two carbon atoms between the 2' oxygen and the 4' carbon (see, for example, Morita et al., Bioorganic Medicinal Chemistry, 2003, 11(10), 2211-2226). Ethylene-bridged nucleic acid is also encompassed by the term "bicyclic nucleic acid" or "bridged nucleic acid" (BNA).

[0026] "Constrained ethyl (cEt)" refers to an LNA-modified RNA nucleotide in which the ribose moiety is modified with an extra bridge connecting the 2' oxygen and 4' carbon, and the carbon atom of the bridge contains a methyl group. In some cases, the cEt is an (S) constrained ethyl. In other cases, the cEt is an (R) constrained ethyl (see, e.g., Pallan et al., Chem. Commun. (Camb)., 2012, 48(66), 8195-8197). Constrained ethyl nucleic acids are also encompassed by the terms "bicyclic nucleic acid" or "bridged nucleic acid" (BNA).

[0027] As used herein, the terms "2'-modified" or "2'-substituted" refer to a sugar that includes a substituent at the 2' position other than H or OH. 2'-modified nucleotides include moieties having a 2'-substituent selected from alkyl, allyl, amino, azido, fluoro, thio, O-alkyl, e.g., O-methyl, O-allyl, OCF, O-(CH)-O-CH (e.g., 2'-O-methoxyethyl (MOE)), O-(CH)SCH,)-(CH)-ONR, and O-CHC(O)-NR, where each R is independently selected from H, alkyl, and substituted alkyl.

[0028] The present disclosure encompasses isolated or substantially purified nucleic acid molecules and compositions containing these molecules. In the context of this disclosure, an "isolated" or "purified" DNA or RNA molecule is a DNA or RNA molecule that exists away from its natural environment and, therefore, is not a product of nature. An isolated DNA or RNA molecule can exist in purified form or can exist in a non-native environment, such as, for example, a transgenic host cell. For example, an "isolated" or "purified" nucleic acid molecule, or a biologically active portion thereof, is substantially free of other cellular material or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. In one embodiment, an "isolated" nucleic acid is free of sequences that naturally flank the nucleic acid in the genomic DNA of the organism from which the nucleic acid is derived (i.e., sequences located at the 5' and 3' ends of the nucleic acid). For example, in various embodiments, an isolated nucleic acid molecule may contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequence naturally adjacent to the nucleic acid molecule in the genomic DNA of the cell from which the nucleic acid is derived. Fragments and variants of the disclosed nucleotide sequences are also encompassed by the present disclosure. "Fragment" or "portion" refers to the full length or less than the full length of the nucleotide sequence. The siRNA of the present disclosure can be produced by any method known in the art, for example, by in vitro transcription, recombination, or synthetic means. In one example, siRNA can be produced in vitro by using a recombinant enzyme such as T7 RNA polymerase and a DNA oligonucleotide template.

[0029] "Small interfering" or "short interfering RNA" or siRNA is an RNA duplex of nucleotides targeted to a gene of interest. An "RNA duplex" refers to the structure formed by complementary pairing between two regions of an RNA molecule. An siRNA is "targeted" to a gene, and the nucleotide sequence of the duplex portion of the siRNA is complementary to the nucleotide sequence of the targeted gene. In some embodiments, the length of the siRNA duplex is less than 30 nucleotides. In some embodiments, the duplex can be 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, or 10 nucleotides long. In some embodiments, the duplex is 19-25 nucleotides long. The RNA duplex portion of an siRNA can be part of a hairpin structure. In addition to the duplex portion, the hairpin structure can contain a loop portion located between the two sequences forming the duplex. The loop can be of varying lengths. In some embodiments, the loop is 5, 6, 7, 8, 9, 10, 11, 12, or 13 nucleotides in length. The hairpin structure may also contain a 3' or 5' overhang portion. In some embodiments, the overhang is a 3' or 5' overhang that is 0, 1, 2, 3, 4, or 5 nucleotides in length.

[0030] The term "lipid" is used broadly herein to encompass substances that are soluble in organic solvents but have little, if any, solubility in water. The term lipid includes, but is not limited to, hydrocarbons, oils, fats (such as fatty acids and glycerides), sterols, steroids, and derivative forms of these compounds. Preferred lipids are fatty acids and their derivatives, hydrocarbons and their derivatives, and sterols, such as cholesterol. As used herein, the term lipid also includes amphipathic compounds containing both lipid and hydrophilic moieties. Fatty acids typically contain an even number of carbon atoms in a linear chain (generally 12-24 carbons), can be saturated or unsaturated, and can contain or be modified to contain various substituents. For brevity, the term "fatty acid" also encompasses fatty acid derivatives, such as fatty acid amides, produced, for example, by conjugation with modified termini of oligonucleotides.

[0031] Other definitions of terms may appear throughout this specification.

[0032] Detailed Description Before describing various embodiments, it is to be understood that the teachings of the present disclosure are not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present teachings will be limited only by the appended claims.

[0033] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described in any way. While the present teachings will be described in conjunction with various embodiments, it is not intended that the present teachings be limited to such embodiments. On the contrary, the present teachings encompass various alternatives, modifications, and equivalents, as will be appreciated by those skilled in the art.

[0034] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present teachings, some exemplary methods and materials are described herein.

[0035] The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the claims are not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates, which can be independently confirmed.

[0036] As will be apparent to those skilled in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has distinct components and features which may be readily separated from or combined with the features of any of the other various embodiments without departing from the scope or spirit of the present teachings. Any described method can be carried out in the order of events recited or in any other order which is logically possible.

[0037] All patents and publications referenced herein, including all sequences disclosed within such patents and publications, are expressly incorporated by reference.

[0038] Methods for modulating host microRNAs Host microRNAs can regulate a wide variety of physiological processes. In some cases, host microRNAs can regulate the fitness of coronaviruses, including influenza A, B, SARS, SARS-Cov-2, MERS, and other respiratory viruses. In some cases, the miRNA is microRNA 191 (miR191). In some cases, the miRNA is one of the following: miR-602, miR-6759, miR-6769, miR-4802, miR-942, miR-4462, miR-4696, miR-376c, miR-4433, miR-663, miR-10396, miR-4749, miR-6787, miR-4706, miR-3675, miR-6810 ... The miRNA may be, but is not limited to, one of the following: miR-6812, miR-663a, miR-381, miR-744, miR-4508, miR-4730, miR-6777, miR-10396, miR-4749, miR-6787, miR-4706, miR-3675, miR-6810, miR-3675, miR-6812, or miR-6796. In some cases, the miRNA may directly bind to influenza A virus RNA in virions or infected cells. In some cases, the miRNA may directly bind to influenza B virus RNA in virions or infected cells. In some cases, the miRNA may directly bind to coronavirus virus RNA, including SARS-CoV, SARS-CoV2, and MERS, in virions or infected cells. In some cases, the miRNA may directly bind to respiratory syncytial virus (RSV) RNA in virions or infected cells. In some cases, the miRNA may regulate a host cellular process that otherwise regulates the level of influenza A virus RNA in virions or infected cells. In some cases, the miRNA may regulate a host cellular process that otherwise regulates the level of influenza A virus RNA in virions or infected cells. In some cases, the miRNA may regulate a host cellular process that otherwise regulates the level of influenza B virus RNA in virions or infected cells.In some cases, the miRNA may regulate host cellular processes that otherwise regulate the levels of coronavirus viral RNA, including SARS-Cov, SARS-Cov2, and MERS viral RNA, in virions or infected cells. In some cases, the miRNA may regulate host cellular processes that otherwise regulate the levels of respiratory syncytial virus (RSV) RNA in virions or infected cells. In some cases, the conserved RNA secondary structure includes the presence of a miR191 binding site. In some cases, the subject agents or compositions are designed to sequester miR191 in CoV-transfected cells.

[0039] Methods for inhibiting influenza A virus As summarized above, embodiments of the present disclosure include pan-genotypic compositions designed to disrupt an IAV RNA structural element called packaging stem loop 2 (PSL2), located within the 5' packaging signal region of genome segment PB2. "Pan-genotypic" means that the composition is effective across a variety of different types of IAV in which the PSL2 structural element is conserved. In some cases, the subject compositions can be referred to as broad-spectrum. As used herein, the term "broad-spectrum" refers to the antiviral activity of a single moiety that is active against two or more different viruses, such as three or more, four or more, five or more, six or more, eight or more, or ten or more different viruses. The two or more different viruses can be selected from different viral subgroups (e.g., influenza A group 1 or influenza A group 2) or can be selected from within the same group (e.g., two or more of H1, H2, H5, H6, H8, and H9 group 1 influenza A viruses, or two or more of H3, H4, H7, and H10 group 2 influenza A viruses).

[0040] Disruption of the PSL2 structure dramatically inhibits IAV. PSL2 is conserved across all influenza A subtypes tested. Figure 1, panel a, shows an example of a PSL2 structure that can be targeted in the subject methods. Figure 4 shows the conservation of nucleotide sequences of interest that contain the PSL2 structure. In some cases, the subject compositions have broad-spectrum activity against IAV, such as activity against two or more IAVs selected from H1N1, H3N2, and H5N.

[0041] Aspects of the present disclosure include a method for inhibiting influenza A virus (IAV) in a sample. In some embodiments, the method includes contacting a sample containing viral RNA (vRNA) having a PSL2 motif with an effective amount of an agent that specifically binds to the PSL2 motif to inhibit influenza A virus. In some cases, the sample is in vitro. In certain cases, the sample is in vivo. The vRNA in the sample can be contained in a virion. In some cases, the vRNA is contained in a cell, such as a cell infected with a viral particle.

[0042] Aspects of the present disclosure include a method for inhibiting influenza A virus (IAV) in a cell. In some embodiments, the method includes contacting a cell containing viral RNA (vRNA) having a PSL2 motif with an effective amount of an agent that specifically binds to the PSL2 motif to inhibit the influenza A virus. In some cases, the cell is in vitro. In certain cases, the cell is in vivo.

[0043] In some embodiments, the vRNA in a sample (e.g., cells) comprises PB2 vRNA. As used herein, "PB2 vRNA" refers to a viral RNA (e.g., IAV RNA) that contains a conserved RNA structural element called packaging stem loop 2 (PSL2). Drugs can bind to specific sites in the PSL2 motif, disrupting the overall structure of the vRNA and thereby inhibiting the virus (see, e.g., Figure 14). In some cases, drugs inhibit the packaging ability of the vRNA, thereby inhibiting the virus. For example, Figure 1 shows the RNA secondary structures of wild-type PB2 and packaging mutant vRNAs.

[0044] In some embodiments, contacting a sample (e.g., cells) with an agent reduces the viral load by 1.5 or more, 2 or more, 2.5 or more, 3 or more, 3.5 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 log 10 or even greater titer loss, such as 1 log of virus 10 This results in a loss of titer of more than 100 mg / ml.

[0045] In some embodiments, contacting a sample (e.g., cells) with an agent reduces the viral load by 2.5 or more, 3 or more, 3.5 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 log 10 or even greater titer loss, such as a 2-log decrease in virus 10 In some embodiments, the agent is an oligonucleotide compound (e.g., as described herein) comprising a sequence complementary to the PSL2 motif of the vRNA, or a salt thereof.

[0046] In some cases of the methods, binding (e.g., via hybridization) of an oligonucleotide compound (e.g., one of the above sequences) to the PB2 vRNA region disrupts the overall secondary RNA structure of the PB2 vRNA. In some cases, binding of the oligonucleotide compound inhibits the packaging ability of the PB2 vRNA, thereby inhibiting the virus. In some cases, the subject compound targets at least a portion of the region defined by nucleotides 34-87 in the (-) sense representation of the 5'-end coding region of the PB2 vRNA. In some cases, the compound targets at least a portion of the region defined by nucleotides 1-14 in the (-) sense representation of the 5'-end coding region of the PB2 vRNA. In some cases of the methods, the method further includes recruiting an RNase to PSL2 to degrade the vRNA.

[0047] Aspects of the present disclosure include methods of treating or preventing influenza A virus infection in a subject. In some embodiments, the method comprises administering to a subject in need thereof a pharmaceutical composition comprising an effective amount of an active agent that binds to a PSL2 motif of viral RNA (vRNA) (e.g., as described herein). Thus, in some cases, the subject is infected with the virus. In particular cases, the subject is at risk of or suspected of being infected with the virus. In some embodiments, the vRNA is PB2 vRNA.

[0048] Any convenient protocol for administering an agent to a subject may be used. The particular protocol used may vary, for example, depending on the site of administration and whether the agent is, for example, an oligonucleotide, antibody, protein, peptide, or small molecule. For in vivo protocols, any convenient administration protocol may be used. Various protocols may be used depending on the identity and binding affinity of the agent, the desired response, the mode of administration (e.g., local or systemic, intraocular, periocular, retrobulbar, intramuscular, intravenous, intraperitoneal, subcutaneous, subconjunctival, intranasal, topical, ophthalmic, IVSC, IP, oral, etc.), half-life, cell number, or size of the graft bed or tissue. In some cases, cells are administered intranasally. In some cases, the agent is administered as an aerosol. In certain cases, the agent is administered via a nebulizer. In certain cases, the agent is administered via the assistance of a respiratory support device, including, but not limited to, noninvasive positive pressure ventilation or mechanical ventilation. In certain cases, the agent is administered intravenously. In certain other cases, the agent is administered subcutaneously. In certain cases, the agent is administered by intramuscular injection.

[0049] Pharmaceutical compositions containing the subject agents are also provided. Any convenient excipients, carriers, etc. can be utilized in the compositions. Pharmaceutically acceptable carriers used in the compositions can include non-aqueous sterile aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions, or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives, such as antimicrobials, antioxidants, chelating agents, and inert gases, can also be present. The pharmaceutical compositions can also be lyophilized for subsequent reconstitution and use. The compositions can include carriers as described herein. Examples of carriers that can be used include, but are not limited to, alum, microparticles, liposomes, and nanoparticles. Any convenient additive can be included in the subject compositions to enhance delivery of the subject active agent. Additives of interest include cellular uptake enhancers, carrier proteins, lipids, dendrimer carriers, carbohydrates, etc.

[0050] In some cases, the pharmaceutical composition further comprises one or more additional active agents of interest. Active agents of interest include additional oligonucleotide compounds of the present disclosure, and any convenient antiviral compound or drug of interest, including, but not limited to, amantadine, rimantadine, zanamivir, oseltamivir, peramivir, and the like.

[0051] Methods for inhibiting influenza B virus Embodiments of the present disclosure include pan-genotypic compositions designed to disrupt RNA structural elements of IBV, which may include regions of genome segment HA.

[0052] Aspects of the present disclosure include methods for inhibiting influenza B virus (IBV) in a sample. In some embodiments, the method includes contacting a sample containing viral RNA (vRNA) having an IBV RNA motif with an effective amount of an agent that specifically binds to the IBV HA motif to inhibit influenza B virus. In some cases, the sample is in vitro. In certain cases, the sample is in vivo. The vRNA in the sample can be contained in a virion. In some cases, the vRNA is contained in a cell, such as a cell infected with a viral particle.

[0053] Aspects of the present disclosure include methods for inhibiting influenza B virus (IBV) in cells. In some embodiments, the method includes contacting a cell containing viral RNA (vRNA) having an IBV RNA motif with an effective amount of an agent that specifically binds to the IBV RNA motif to inhibit influenza B virus. In some cases, the cell is in vitro. In certain cases, the cell is in vivo.

[0054] In some embodiments, contacting a sample (e.g., cells) with an agent reduces the viral load by 1.5 or more, 2 or more, 2.5 or more, 3 or more, 3.5 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 log 10 or even greater titer loss, such as 1 log of virus 10 This results in a loss of titer of more than 100 mg / ml.

[0055] In some embodiments, contacting a sample (e.g., cells) with an agent reduces the viral load by 2.5 or more, 3 or more, 3.5 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 log 10 or even greater titer loss, such as a 2-log decrease in virus 10 In some embodiments, the agent is an oligonucleotide compound (e.g., as described herein) that comprises a sequence complementary to an IBV RNA motif of the vRNA, or a salt thereof.

[0056] In some cases of the method, binding (e.g., via hybridization) of the oligonucleotide compound (e.g., one of the above sequences) to a region of the IBV vRNA disrupts the overall secondary RNA structure of the IBV vRNA. In some cases, binding of the oligonucleotide compound inhibits the packaging ability of the HA vRNA, thereby inhibiting the virus. In some cases of the method, the method further includes recruiting an RNase to the IBV vRNA to degrade the vRNA.

[0057] Aspects of the present disclosure include methods of treating or preventing influenza B virus infection in a subject. In some embodiments, the methods include administering to a subject in need thereof a pharmaceutical composition comprising an effective amount of an active agent that binds to an IBV HA RNA motif of viral RNA. Thus, in some cases, the subject is a subject infected with the virus. In certain cases, the subject is a subject at risk of or suspected of being infected with the virus.

[0058] Any convenient protocol for administering an agent to a subject may be used. The particular protocol used may vary, for example, depending on the site of administration and whether the agent is, for example, an oligonucleotide, antibody, protein, peptide, or small molecule. For in vivo protocols, any convenient administration protocol may be used. Various protocols may be used depending on the identity and binding affinity of the agent, the desired response, the mode of administration (e.g., local or systemic, intraocular, periocular, retrobulbar, intramuscular, intravenous, intraperitoneal, subcutaneous, subconjunctival, intranasal, topical, ophthalmic, IVSC, IP, oral, etc.), half-life, cell number, or size of the graft bed or tissue. In some cases, cells are administered intranasally. In some cases, the agent is administered as an aerosol. In certain cases, the agent is administered via a nebulizer. In certain cases, the agent is administered via the assistance of a respiratory support device, including, but not limited to, noninvasive positive pressure ventilation or mechanical ventilation. In certain cases, the agent is administered intravenously. In certain other cases, the agent is administered subcutaneously. In certain cases, the agent is administered by intramuscular injection.

[0059] Pharmaceutical compositions containing the subject agents are also provided. Any convenient excipients, carriers, etc. can be utilized in the compositions. Pharmaceutically acceptable carriers used in the compositions can include non-aqueous sterile aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions, or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives, such as antimicrobials, antioxidants, chelating agents, and inert gases, can also be present. The pharmaceutical compositions can also be lyophilized for subsequent reconstitution and use. The compositions can include carriers as described herein. Examples of carriers that can be used include, but are not limited to, alum, microparticles, liposomes, and nanoparticles. Any convenient additive can be included in the subject compositions to enhance delivery of the subject active agent. Additives of interest include cellular uptake enhancers, carrier proteins, lipids, dendrimer carriers, carbohydrates, etc.

[0060] In some cases, the pharmaceutical composition further comprises one or more additional active agents of interest. Active agents of interest include additional oligonucleotide compounds of the present disclosure, and any convenient antiviral compound or drug of interest, including, but not limited to, amantadine, rimantadine, zanamivir, oseltamivir, peramivir, and the like.

[0061] Methods for inhibiting respiratory syncytial virus (RSV) As summarized above, embodiments of the present disclosure include agents and compositions designed to disrupt the secondary structure of RSV RNA, which can inhibit the RSV virus.

[0062] Methods for inhibiting coronavirus (CoV) As summarized above, embodiments of the present disclosure include agents and compositions designed to disrupt coronavirus (CoV) RNA secondary structure. Disruption of CoV RNA secondary structure can inhibit CoV viruses. The agents and compositions are effective across a variety of different types of coronavirus (CoV), and RNA secondary structure is important in the viral life cycle. In some cases, the subject compositions can be referred to as broad-spectrum. As used herein, the term "broad-spectrum" refers to the antiviral activity of a single moiety that is active against two or more different viruses, such as three or more, four or more, five or more, six or more, eight or more, or ten or more different viruses. The two or more different viruses may be selected from different viral subgroups (e.g., human coronavirus 229E (HCoV-229E), human coronavirus OC43 (HCoV-OC43), SARS-CoV (the etiological agent of severe acute respiratory syndrome (SARS)), human coronavirus NL63 (HCoV-NL63, New Haven coronavirus), human coronavirus HKU1, MERS-CoV ("Middle East respiratory syndrome coronavirus" or MERS), and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) or COVID-19 (coronavirus disease 2019).

[0063] Disruption of CoV RNA secondary structures can dramatically inhibit CoVs. Figure 1G shows examples of predicted RNA secondary structures conserved across coronavirus B viruses that can be targeted in the subject methods. In some cases, the subject compositions have broad-spectrum activity against CoVs, such as activity against one or more CoVs selected from HCoV-299E, HCoV-OC43, SARS-CoV, HCoV-NL63, HKU1, MERS-CoV, and SARS-CoV-2 or COVID-19. In some cases, the target CoV is SARS-CoV. In some cases, the target CoV is MERS-CoV. In some cases, the subject compositions disrupt the conserved RNA secondary structures of the target CoV without inducing caspases or interferons.

[0064] Aspects of the present disclosure include methods for inhibiting coronavirus (CoV) in a sample. In some embodiments, the method includes contacting a sample containing viral RNA (vRNA) having a conserved RNA secondary structure of the CoV with an effective amount of an agent that specifically binds to the secondary structure to inhibit the CoV. In some embodiments, the method includes contacting a sample containing viral RNA (vRNA) having a conserved RNA secondary structure of the CoV with an effective amount of an agent that inhibits the interaction of the CoV with a host microRNA (miRNA). In some cases, the miRNA is microRNA191 (miR191). In some cases, the miRNA can be one of the following: miR663a, miR-381, miR-744, miR-4508, miR-4730, miR-6777, miR-10396, miR-4749, miR-6787, miR-4706, miR-3675, miR-6810, miR-3675, miR-6812, or miR-6796. In some cases, the conserved RNA secondary structure comprises the presence of a microRNA binding site. In some cases, the microRNA is miR-191. In some cases, the microRNA can be any of the microRNAs listed above that have predicted binding sites in viral RNA. In some cases, the subject agents or compositions are designed to sequester miR191 in cells transfected with CoV. In some cases, cells are transfected with a CoV 5'-terminal RNA segment linked to a luciferase reporter. In some cases, the CoV is SARS-CoV-2 or COVID-19.

[0065] In some cases, the sample is in vitro. In certain cases, the sample is in vivo. The vRNA in the sample may be contained in a virion. In some cases, the vRNA is contained in a cell, such as a cell infected with a virus.

[0066] Aspects of the present disclosure include methods for inhibiting coronavirus (CoV) in cells. Aspects of the present disclosure include methods for inhibiting coronavirus (CoV) in humans. In some embodiments, the method includes contacting a cell containing viral RNA (vRNA) having a conserved RNA secondary structure of the CoV with an effective amount of an agent that specifically binds to the secondary structure to inhibit the CoV. In some cases, the cell is in vitro. In certain cases, the cell is in vivo. In some embodiments, the agent (e.g., as described herein) can bind to a specific site in the conserved RNA secondary structure motif to disrupt the overall structure of the vRNA, thereby inhibiting the virus. In some cases, the agent inhibits the packaging ability of the vRNA, thereby inhibiting the virus.

[0067] Drugs Any convenient agent may be utilized as an agent of a target of interest (e.g., PSL2) in the subject methods and compositions, including, but not limited to, PSL-2 ligands, PSL2-binding antibodies, PSL2 scaffold protein binders, oligonucleotides, small molecules, and peptides, or fragments, variants, or derivatives thereof, or combinations of any of the foregoing.

[0068] Antibodies that may be used as drugs in connection with the present disclosure include monoclonal antibodies, polyclonal antibodies, bispecific antibodies, Fab antibody fragments, F(ab)2 antibody fragments, Fv antibody fragments (e.g., V H or V L), single-chain Fv antibody fragments, and dsFv antibody fragments. Furthermore, antibody molecules can be fully human, humanized, or chimeric. Antibodies that can be used in connection with the present disclosure can include any antibody variable region, mature or intact, attached to any immunoglobulin constant region. Minor variations in the amino acid sequence of an antibody or immunoglobulin molecule are encompassed by the present disclosure, provided that the amino acid sequence variation maintains 75% or more of the sequence, e.g., 80% or more, 90% or more, 95% or more, or 99% or more. Conservative amino acid substitutions are particularly contemplated. Conservative substitutions are those made within a family of amino acids that are related in their side chains. Whether an amino acid change results in a functional peptide can be determined by assaying the specific activity of the polypeptide derivative. In some embodiments, the agent is an antibody fragment (e.g., as described herein).

[0069] In some embodiments, the agent is a scaffold polypeptide binding agent. A scaffold refers to the underlying peptide framework (e.g., consensus sequence or structural motif) from which a polypeptide agent is derived. The underlying scaffold sequence includes fixed residues and variant residues that can confer various functions, such as specific binding to a target receptor, to the resulting polypeptide agent. Such structural motifs can be structurally characterized and compared as a combination of specific secondary and tertiary structural elements, or alternatively, as equivalent primary sequences of amino acid residues. Any convenient scaffold and scaffold polypeptide can be utilized as an agent in the subject methods. In some embodiments, such agents can be identified using recombinant screening methods, such as phage display screening. Scaffold polypeptide binding agents of interest include, but are not limited to, synthetic small proteins and recombinant small proteins, such as affibodies.

[0070] In some cases, the agent is a small molecule that binds to PSL2. Small molecules of interest include, but are not limited to, small organic or inorganic compounds having a molecular weight (MW) of more than 50 Da and less than about 2,500 Da, such as more than 50 Da and less than about 1,000 Da, or more than 50 Da and less than about 500 Da. "Small molecules" encompass numerous biological and chemical classes, including synthetic, semi-synthetic, or naturally occurring inorganic or organic molecules, including synthetic, recombinant, or naturally occurring polypeptides and nucleic acids. Small molecules of interest may contain functional groups necessary for structural interactions with proteins, particularly hydrogen bonding, and may include at least an amine, carbonyl, hydroxyl, or carboxyl group, and may contain at least two of the functional chemical groups. Small molecules may contain cyclic carbon or heterocyclic structures and / or aromatic or polyaromatic structures substituted with one or more of the above functional groups. Small molecules are also found among biomolecules including peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof.

[0071] Oligonucleotide Compounds In some embodiments, the agent is an oligonucleotide or a derivative thereof, or a salt thereof (e.g., a pharmaceutically acceptable salt). In some cases, the oligonucleotide is complementary to a specific segment of a target motif (e.g., as described herein). The complementary oligonucleotides used in the subject methods are, in some cases, at least five, such as at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, about twelve, at least thirteen, at least fourteen, at least fifteen, or more. In some cases, the complementary oligonucleotides are 75 nucleotides or less in length, such as 50 nucleotides or less, 45 nucleotides or less, 40 nucleotides or less, or 35 nucleotides or less, where the length is determined by the efficiency of inhibition, specificity, including the absence of cross-reactivity, etc. In some cases, the complementary oligonucleotides are 30 nucleotides or less in length, such as 25 nucleotides or less, 20 nucleotides or less, or 15 nucleotides or less, where the length is determined by the efficiency of inhibition, specificity, including the absence of cross-reactivity, etc. The present disclosure provides short oligonucleotides, for example, 7, 8-15, or 15-16 nucleotides in length, which can be potent and selective inhibitors of target function.

[0072] In some embodiments, the agent is an oligonucleotide compound or a salt thereof comprising at least five nucleoside subunits (e.g., at least 6, at least 7, at least 8, at least 9, at least 10, at least 12, at least 14, at least 16, at least 18, or at least 20) complementary to a target motif in a vRNA. In certain cases, the linkage of the oligonucleotide is a modified phosphate group, for example, in which one or more oxygen atoms of the phosphate are replaced with various substituents. Without being bound by any particular theory, such modifications can increase the resistance of the oligonucleotide to nucleolytic degradation. Examples of modified phosphate groups include, but are not limited to, phosphorothioate, phosphoroselenate, boranophosphate, boranophosphate ester, hydrogen phosphonate, phosphoramidite, alkyl or aryl phosphonate, and phosphotriester. In some cases, the linkage of the oligonucleotide is a modified phosphate group, in which one or more of the non-bridging phosphonate oxygen atoms in the linkage are replaced with S, Se, BR, or BR. a 3. Alkyl, substituted alkyl, aryl, substituted aryl, H, NR a 2 or OR b and R a is H, alkyl, substituted alkyl, aryl, or substituted aryl, and R bis H, alkyl, substituted alkyl, aryl, or substituted aryl. In certain cases, one or more bonds of the phosphorus atom of the oligonucleotide are chiral, e.g., asymmetric centers. The asymmetric phosphorus atom can have either the "R" configuration (referred to herein as Rp) or the "S" configuration (referred to herein as Sp). In certain embodiments, the linkage of the oligonucleotide contains one or more asymmetric phosphorus atoms with an enantiomeric excess of the Sp configuration of at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more. In certain other cases, the linkage of the oligonucleotide contains one or more asymmetric phosphorus atoms with an enantiomeric excess of the Rp configuration of at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more.

[0073] In certain embodiments, one or more of the linkages of the oligonucleotide are selected from methylphosphonate, P3'→N5' phosphoramidate, N3'→P5' phosphoramidate, N3'→P5' thiophosphoramidate, phosphorodithioate, and phosphorothioate linkages. In certain cases, one or more linkages of the oligonucleotide are phosphorothioate linkages. In certain cases, the phosphorus atom in one or more of the phosphorothioate linkages is chiral. In some cases, the chiral phosphorus atom in one or more phosphorothioate linkages has the Rp configuration. In some cases, the chiral phosphorus atom in one or more phosphorothioate linkages has the Sp configuration. In certain embodiments, the linkages of the oligonucleotide include one or more phosphorothioate linkages with an enantiomeric excess of the Sp configuration of at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more. In certain other embodiments, the oligonucleotide linkages comprise one or more phosphorothioates having an enantiomeric excess of the Rp configuration of at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more.

[0074] In certain cases, the oligonucleotide sequence is a bridged nucleic acid (e.g., as described herein). In certain cases, the oligonucleotide sequence includes one or more bridged nucleic acid nucleotides, such as two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, or more.

[0075] In certain cases, the oligonucleotide sequence is a locked nucleic acid, ie, the oligonucleotide sequence comprises one or more locked nucleic acid nucleotides, such as two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, or more.

[0076] In certain cases, the oligonucleotide sequence is an ethylene-bridged nucleic acid (ENA), in certain cases, the oligonucleotide sequence comprises one or more ENA nucleotides, such as 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, or more.

[0077] In certain cases, the oligonucleotide sequence is a constrained ethyl (cEt) nucleic acid. In certain cases, the oligonucleotide sequence comprises one or more cEt nucleotides, such as two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, or more. In certain cases, the oligonucleotide sequence comprises one or more (S)-constrained ethyl nucleic acids, such as two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, or more. In certain cases, the oligonucleotide sequence comprises one or more (R)-constrained ethyl nucleic acids, such as two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, or more. In certain cases, the oligonucleotide sequence comprises one or more ribose modifications. In some cases, the oligonucleotide sequence comprises one or more 2'-modified ribose sugars (also referred to herein as 2'-modified nucleotides). In certain cases, an oligonucleotide sequence comprises one or more 2'-modified nucleotides, such as two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, or more. 2'-modified nucleotides include, but are not limited to, moieties having a 2'-substituent selected from alkyl, allyl, amino, azido, fluoro, thio, O-alkyl, e.g., O-methyl, O-allyl, OCF, O-(CH)-O-CH (e.g., 2'-O-methoxyethyl (MOE)), O-(CH)SCH,)-(CH)-ONR, and O-CHC(O)-NR, where each R is independently selected from H, alkyl, and substituted alkyl. In certain cases, the oligonucleotide sequence includes one or more 2'-O-methoxyethyl (MOE) modifications, such as two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, or more.

[0078] In some embodiments, the agent is an oligonucleotide that includes at least five deoxyribonucleotide units (e.g., units complementary to a target motif, e.g., a PSL2 motif) (e.g., at least 6, at least 7, at least 8, at least 9, at least 10, at least 12, at least 14, at least 16, at least 18, at least 20) and is capable of recruiting an RNase. In some cases, the oligonucleotide recruits an RNase to catalyze the degradation of the target vRNA into smaller components. Any convenient method and moiety for recruiting an RNase can be incorporated into a subject agent (e.g., an oligonucleotide). In some cases, the oligonucleotide agent further includes a sequence that recruits an RNase of interest. Unless otherwise indicated, oligonucleotide sequences set forth herein are meant to include DNA sequences, RNA sequences (e.g., U can optionally be replaced with T), mixed RNA / DNA sequences, and analogs thereof, and it is understood that one or more nucleotides of the sequence are modified nucleotides such as BNA analogs, LNA analogs, ENA analogs, cEt analogs, 2'-modified analogs, and / or analogs in which one or more internucleoside linkages are replaced with non-naturally occurring linkages, such as, for example, phosphorothioate, phosphorodithioate, phosphoramidate, or thiophosphoramidate linkages. In embodiments in which one or more of the linkages of the oligonucleotide contain a chiral phosphorus atom, e.g., an asymmetric center, it will be understood that the asymmetric phosphorus atom can have either the "R" configuration (referred to herein as Rp) or the "S" configuration (referred to herein as Sp).

[0079] In some embodiments, the active agent is a compound comprising an oligonucleotide sequence comprising at least eight nucleoside subunits complementary to a region of PB2 vRNA, hi some embodiments, the active agent is a compound comprising an oligonucleotide sequence comprising at least eight and no more than 20 (e.g., no more than 15) nucleoside subunits complementary to a region of PB2 vRNA.

[0080] Specific regions of the endogenous PSL2 strand sequence are selected to be complemented by the oligonucleotide agent. Selection of specific sequences for oligonucleotides can be done empirically, using structural analysis (e.g., as described herein) to assay several candidate sequences for inhibition of the target IAV in vitro or in an animal model. A combination of oligonucleotides and sequences can also be used, with several regions of the target PSL2 selected for antisense complementation.

[0081] In some embodiments, the oligonucleotide is 5'ACCAAAAGAAT3' (SEQ ID NO: 45), 5'TGGCCATCAAT3' (SEQ ID NO: 46), 5'TAGCATACTTA3' (SEQ ID NO: 47), 5'CCAAAAGA3' (SEQ ID NO: 48), 5'CATACTTA3' (SEQ ID NO: 49), 5'CAGACACGACCAAAA3' (SEQ ID NO: 50), 5'TACTTACTGACAGCC3' (SEQ ID NO: 51), 5'AGACACGACCAAAAG3' (SEQ ID NO: 52), 5'ACCAAAAGAAT3' (SEQ ID NO: 53), 5'TGGCCATCAAT3' (SEQ ID NO: 54), 5'TAGCATACTTA3' (SEQ ID NO: 55), 5'CGACCAAAAGAATTC3' (SEQ ID NO: 56), 5'CGACCAAAAGAATTC3' (SEQ ID NO: 57), 5'GATGGCCATCAATTA3' (SEQ ID NO: 58), 5'GATGGCCATCAATTA3' (SEQ ID NO: 59), 5'TCTAGCATACTTACT3' (SEQ ID NO: 60), 5'TCTAGCATACTTACT3' (SEQ ID NO: 61), 5'GAATTCGGATGGCCA3' (SEQ ID NO: 62), 5'GGCCATCAATTAGTG3' (SEQ ID NO: 63), 5'TTCGGATGGCCATCA3' (SEQ ID NO: 64), 5'AGCCAGACAGCGA3' (SEQ ID NO: 65), and 5'GACAGCCAGACAGCA3' (SEQ ID NO: 66).

[0082] In certain embodiments, the oligonucleotide comprises the sequence 5'ACCAAAAGAAT3' (SEQ ID NO:45). In certain embodiments, the oligonucleotide comprises the sequence 5'TGGCCATCAAT3' (SEQ ID NO:46). In certain embodiments, the oligonucleotide comprises the sequence 5'TAGCATACTTA3' (SEQ ID NO:47). In certain embodiments, the oligonucleotide comprises the sequence 5'CCAAAAGA3' (SEQ ID NO:48). In certain embodiments, the oligonucleotide comprises the sequence 5'CATACTTA3' (SEQ ID NO:49). In certain embodiments, the oligonucleotide comprises the sequence 5'CAGACACGACCAAAA3' (SEQ ID NO:50). In certain embodiments, the oligonucleotide comprises the sequence 5'TACTTACTGACAGCC3' (SEQ ID NO:51). In certain embodiments, the oligonucleotide comprises the sequence 5'AGACACGACCAAAAG3' (SEQ ID NO:52). In certain embodiments, the oligonucleotide comprises the sequence 5'ACCAAAAGAAT3' (SEQ ID NO:53). In certain embodiments, the oligonucleotide comprises the sequence 5'TGGCCATCAAT3' (SEQ ID NO:54). In certain embodiments, the oligonucleotide comprises the sequence 5'TAGCATACTTA3' (SEQ ID NO:55). In certain embodiments, the oligonucleotide comprises the sequence 5'CGACCAAAAGAATTC3' (SEQ ID NO:56). In certain embodiments, the oligonucleotide comprises the sequence 5'CGACCAAAAGAATTC3' (SEQ ID NO:57). In certain embodiments, the oligonucleotide comprises the sequence 5'GATGGCCATCAATTA3' (SEQ ID NO:58). In certain embodiments, the oligonucleotide comprises the sequence 5'GATGGCCATCAATTA3' (SEQ ID NO:59). In certain embodiments, the oligonucleotide comprises the sequence 5'TCTAGCATACTTACT3' (SEQ ID NO:60). In certain embodiments, the oligonucleotide comprises the sequence 5'TCTAGCATACTTACT3' (SEQ ID NO:61). In certain embodiments, the oligonucleotide comprises the sequence 5'GAATTCGGATGGCCA3' (SEQ ID NO:62).In certain embodiments, the oligonucleotide comprises the sequence: 5'GGCCATCAATTAGTG3' (SEQ ID NO: 63). In certain embodiments, the oligonucleotide comprises the sequence: 5'TTCGGATGGCCATCA3' (SEQ ID NO: 64). In certain embodiments, the oligonucleotide comprises the sequence: 5'AGCCAGACAGCGA3' (SEQ ID NO: 65). In certain embodiments, the oligonucleotide comprises the sequence: 5'GACAGCCAGACAGCA3' (SEQ ID NO: 66).

[0083] In some embodiments, the oligonucleotide is 5'CGACCAAAAGAATT3' (SEQ ID NO: 98), and 5'GACCAAAAGAATTCGG3' (SEQ ID NO: 99).

[0084] In certain embodiments, the oligonucleotide comprises the sequence: 5'CGACCAAAAGAATT3' (SEQ ID NO: 98). In certain embodiments, the oligonucleotide comprises the sequence: 5'GACCAAAAGAATTCGG3' (SEQ ID NO: 99).

[0085] In some embodiments, the oligonucleotide is 5'AGCATACTTACTGACA3' (SEQ ID NO: 100), 5'CATACTTACTGACA3' (SEQ ID NO: 101), 5'ATACTTACTGACAG3' (SEQ ID NO: 102), 5'CATACTTACTGACAGC3' (SEQ ID NO: 103), 5'AGACAGCGACCAAAAG3' (SEQ ID NO: 104), and 5' ACAGCGACCAAAAG (SEQ ID NO: 105).

[0086] In certain embodiments, the oligonucleotide comprises the sequence: 5'AGCATACTTACTGACA3' (SEQ ID NO: 100). In certain embodiments, the oligonucleotide comprises the sequence: 5'CATACTTACTGACA3' (SEQ ID NO: 101). In certain embodiments, the oligonucleotide comprises the sequence: 5'ATACTTACTGACAG3' (SEQ ID NO: 102). In certain embodiments, the oligonucleotide comprises the sequence: 5'CATACTTACTGACAGC3' (SEQ ID NO: 103). In certain embodiments, the oligonucleotide comprises the sequence: 5'AGACAGCGACCAAAAG3' (SEQ ID NO: 104). In certain embodiments, the oligonucleotide comprises the sequence: 5'ACAGCGACCAAAAG (SEQ ID NO: 105).

[0087] In some embodiments, the oligonucleotide is 5'CAGCCAGACAGCGAC3' (SEQ ID NO: 106), 5'CAGCCAGACAGCGA3' (SEQ ID NO: 107), 5'ACAGCCAGACAGCGA3' (SEQ ID NO: 108), and 5'GACAGCCAGACAGCG3' (SEQ ID NO: 109).

[0088] In certain embodiments, the oligonucleotide comprises the sequence: 5'CAGCCAGACAGCGAC3' (SEQ ID NO: 106). In certain embodiments, the oligonucleotide comprises the sequence: 5'CAGCCAGACAGCGA3' (SEQ ID NO: 107). In certain embodiments, the oligonucleotide comprises the sequence: 5'ACAGCCAGACAGCGA3' (SEQ ID NO: 108). In certain embodiments, the oligonucleotide comprises the sequence: 5'GACAGCCAGACAGCG3' (SEQ ID NO: 109).

[0089] In some embodiments, the oligonucleotide is 5'GAATTCGGATGGCCA3' (SEQ ID NO: 62), 5'AGCCAGACAGCGA3' (SEQ ID NO: 65), 5'CATCAATTAGTGTCG3' (SEQ ID NO: 110), 5'CCATCAATTAGTGTCG3' (SEQ ID NO: 111), 5'GCCATCAATTAGTGTG3' (SEQ ID NO: 112), 5'AAGAATTCGGATGGC3' (SEQ ID NO: 113), 5'CAGACAGCGACCAA3' (SEQ ID NO: 114), and 5'TGACAGCCAGACAGC3' (SEQ ID NO: 115).

[0090] In certain embodiments, the oligonucleotide comprises the sequence: 5'GAATTCGGATGGCCA3' (SEQ ID NO: 62). In certain embodiments, the oligonucleotide comprises the sequence: 5'AGCCAGACAGCGA3' (SEQ ID NO: 65). In certain embodiments, the oligonucleotide comprises the sequence: 5'CATCAATTAGTGTCG3' (SEQ ID NO: 110). In certain embodiments, the oligonucleotide comprises the sequence: 5'CCATCAATTAGTGTCG3' (SEQ ID NO: 111). In certain embodiments, the oligonucleotide comprises the sequence: 5'GCCATCAATTAGTGTG3' (SEQ ID NO: 112). In certain embodiments, the oligonucleotide comprises the sequence: 5'AAGAATTCGGATGGC3' (SEQ ID NO: 113). In certain embodiments, the oligonucleotide comprises the sequence: 5'CAGACAGCGACCAA3' (SEQ ID NO: 114). In certain embodiments, the oligonucleotide comprises the sequence: 5'TGACAGCCAGACAGC3' (SEQ ID NO: 115). In some cases, binding (e.g., via hybridization) of an oligonucleotide compound (e.g., one of the above sequences) to a region of PB2 vRNA disrupts the overall secondary RNA structure of PB2 vRNA. In certain cases, binding of an oligonucleotide compound to a region of PB2 vRNA inhibits the packaging ability of PB2 vRNA, thereby inhibiting the virus.

[0091] In some embodiments, the oligonucleotide comprises a sequence selected from the following (COV2): 5'GGTGACATGGTACCACATATATCACGTC3' (SEQ ID NO: 192) 5'GACGTGATATATGTGGTACCATGTCACC3' (SEQ ID NO: 193) 5'GACGTGATATATGTGG3' (SEQ ID NO: 194) 5'CGTGATATATGTGGTA3' (SEQ ID NO: 195) 5'GATATGTGGTACCAT3' (SEQ ID NO: 196) 5'TGGTACCATGTCAC3' (SEQ ID NO: 197) 5'GTCACTAAGAAATCTGCTGCTGAGG3' (SEQ ID NO: 198) 5'CCTCAGCAGCAGATTTCTTAGTGAC3' (SEQ ID NO: 199) 5'CCTCAGCAGCAGATTT3' (SEQ ID NO: 200) 5'TCAGCAGCAGATTTC3' (SEQ ID NO: 201) 5'CAGCAGCAGATTTC3' (SEQ ID NO: 202) 5'CAGATTTCTTAGTGAC3' (SEQ ID NO: 203) 5'TGCTTACGGTTTCGTCCGTGTTGCA3' (SEQ ID NO: 204) 5'TGCAACACGGACGAAACCGTAAGCA3' (SEQ ID NO: 205) 5'TGCAACACGGACGAAA3' (SEQ ID NO: 206) 5'GCAACACGGACGAAAC3' (SEQ ID NO: 207) 5'ACACGGACGAAACCG3' (SEQ ID NO: 208) 5'GGACGAAACCCGTAA3' (SEQ ID NO: 209) 5'ACGAAACCGTAAGCA3' (SEQ ID NO: 210) 5'ACGAAACCGTAAGCA3' (SEQ ID NO: 211) 5'GCAACACGGACGAAAC3' (SEQ ID NO: 212) 5'GCAACACGGACGAAA3' (SEQ ID NO: 213) 5'GCAACACGGACGAAAC3' (SEQ ID NO: 214) 5'GCAACACGGACGAAAC3' (SEQ ID NO: 215) 5'GCAACACGGACGAAAC3' (SEQ ID NO: 216) 5'GCAACACGGACGAA3' (SEQ ID NO: 217) 5'ACACGGACGAAACCG3' (SEQ ID NO: 218) 5'ACACGGACGAAACCG3' (SEQ ID NO: 219) 5'AACACGGACGAAACCG3' (SEQ ID NO: 220) 5'AACACGGACGAAACCG3' (SEQ ID NO: 221) 5'ACGAAACCGTAAGCA3' (SEQ ID NO: 222) 5'ACGAAACCGTAAGCA3' (SEQ ID NO: 223) 5'ATAGGTCCAGACATGTTCC3' (SEQ ID NO: 224) 5'GGAACATGTCTGGACCTAT3' (SEQ ID NO: 225) 5'AACATGTCTGGACCTA3' (SEQ ID NO: 226) 5'ACATGTCTGGACCTAT3' (SEQ ID NO: 227) 5'TATGACTATGTCATATTCA3' (SEQ ID NO: 228) 5'AGTGAATATGACATAGTCATATT3' (SEQ ID NO: 229) 5'TGAATATGACATAGT3' (SEQ ID NO: 230) 5'AATATGACATAGTC3' (SEQ ID NO: 231) 5'GATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTG 3' (SEQ ID NO: 232) 5'CACAGATTTTAAAGTTCGTTTAGAGAACAGATCTACAAGAGATC3' (SEQ ID NO: 233) 5'CACAGATTTTAAAGTT3' (SEQ ID NO: 234) 5'CACAGATTTTAAAGTT3' (SEQ ID NO: 235) 5'CAGATTTTAAAGTTCG3' (SEQ ID NO: 236) 5'GATTTTAAAGTTCGT3' (SEQ ID NO: 237) 5'TAAAGTTCGTTTAGA3' (SEQ ID NO: 238) 5'AAAGTTCGTTTAGA3' (SEQ ID NO: 239) 5'TCGTTTAGAGAACAGAT3' (SEQ ID NO: 240) 5'AGAGAACAGATCTACA3' (SEQ ID NO: 241) 5'AGATCTACAAGAGA3' (SEQ ID NO: 242) 5'ATCTACAAGAGATC3' (SEQ ID NO: 243) 5'AGATTTTAAAGTTCGT3' (SEQ ID NO: 244) 5'GATTTTAAAGTTCGT3' (SEQ ID NO: 245) 5'GATTTTAAAGTTCGT3' (SEQ ID NO: 246) 5'AGATTTTAAAGTTCG3' (SEQ ID NO: 247) 5'TCGTTTAGAGAACAGAT3' (SEQ ID NO: 248) 5'TTCGTTTAGAGAACAG3' (SEQ ID NO: 249) 5'TTCGTTTAGAGAACAG3' (SEQ ID NO: 250) 5'GAGAAAACACACGTCCAACTCAGTTTGCCTG3' (SEQ ID NO: 251) 5'CAGGCAAACTGAGTTGGACGTGTGTTTTCTC3' (SEQ ID NO: 252) 5'CAGGCAAACTGAGTTG3' (SEQ ID NO: 253) 5'CAGGCAAACTGAGTTG3' (SEQ ID NO: 254) 5'CAGGCAAACTGAGT3' (SEQ ID NO: 255) 5'CAAACTGAGTTGGACG3' (SEQ ID NO: 256) 5'AAACTGAGTTGGAC3' (SEQ ID NO: 257) 5'AAACTGAGTTGGACGT3' (SEQ ID NO: 258) 5'GAGTTGGACGTGTGT3' (SEQ ID NO: 259) 5'TTGGACGTGTGTTTTC3' (SEQ ID NO: 260) 5'GGACGTGTGTTTTCTC3' (SEQ ID NO: 261) 5'GGTTTCGTCCGGGTGTGACCG3' (SEQ ID NO: 262) 5'TTTCGGTCACACCCGGACGAAACCTAGAT3' (SEQ ID NO: 263) 5'TTTCGGTCACACCCGG3' (SEQ ID NO: 264) 5'CGGTCACACCCGGACG3' (SEQ ID NO: 265) 5'TCACACCCGGACGAAA3' (SEQ ID NO: 266) 5'CACCCGGACGAAAC3' (SEQ ID NO: 267) 5'CACCCGGACGAAACC3' (SEQ ID NO: 268) 5'CACCCGGACGAAACCT3' (SEQ ID NO: 269) 5'CCGGACGAAACCTA3' (SEQ ID NO: 270) 5'CGGTCACACCCGGACGA3' (SEQ ID NO: 21) 5'CGGTCACACCCGGACG3' (SEQ ID NO: 272) 5'CGGTCACACCCGGACG3' (SEQ ID NO: 273) 5'CGGTCACACCCGGACG3' (SEQ ID NO: 274) 5'GTCACACCCGGACG3' (SEQ ID NO: 275) 5'GTCACACCCGGACG3' (SEQ ID NO: 276) 5'CACCCGGACGAAACC3' (SEQ ID NO: 277) 5'CACCCGGACGAAACC3' (SEQ ID NO: 278) 5'CACCCGGACGAAAC3' (SEQ ID NO: 279) 5'CACACCCGGACGAAAC3' (SEQ ID NO: 280) 5'CACACCCGGACGAAA3' (SEQ ID NO: 281) 5'CACACCCGGACGAA3' (SEQ ID NO: 282) 5'CGAGGCCACGCGGAGTACGATCGA3' (SEQ ID NO: 283) 5'ACTCGATCGTACTCCGCGTGGCCTCGGTGAA3' (SEQ ID NO: 284) 5'TCGATCGTACTCCGC3' (SEQ ID NO: 285) 5'TCGATCGTACTCCG3' (SEQ ID NO: 286) 5'ATCGTACTCCGCGTG3' (SEQ ID NO: 287) 5'ACTCGATCGTACTC3' (SEQ ID NO: 288) 5'CGTGGCCTCGGTGAA3' (SEQ ID NO: 289) 5'GTGGCCTCGGTGAA3' (SEQ ID NO: 290) 5'TAGTTAACTTTAATCTCACATAGCAATCTTTAATC3' (SEQ ID NO: 291) 5'GATTAAAGATTGCTATGTGAGATTAAAGTTAACTA3' (SEQ ID NO: 292) 5'GATTAAAGATTGCTAT3' (SEQ ID NO: 293) 5'TAAAGATTGCTATGTG3' (SEQ ID NO: 294) 5'AAGATTGCTATGTGAG3' (SEQ ID NO: 295) 5'GCTATGTGAGTTAAAG3' (SEQ ID NO: 296) 5'TATGTGAGTTAAAGTT3' (SEQ ID NO: 297) 5'TGTGAGTTAAAGTTAA3' (SEQ ID NO: 298) 5'CGTGCTACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAG3' (SEQ ID NO: 299) 5'CTGCGTAGAAGCCTTTTGGCAATGTTGTTCCTTGAGGAAGTTGTAGCACG 3' (SEQ ID NO: 300) 5'TCGTAGAAGCCTTTTG3' (SEQ ID NO: 301) 5'CGTAGAAGCCTTTTGGC3' (SEQ ID NO: 302) 5'TAGAAGCCTTTTGGCA3' (SEQ ID NO: 303) 5'AAGCCTTTTGGCAATG3' (SEQ ID NO: 304) 5'TTGGCAATGTTGTTCC3' (SEQ ID NO: 305) 5'GCAATGTTGTTCCT3' (SEQ ID NO: 306) 5'CTTGAGGAAGTTGT3' (SEQ ID NO: 307) 5'AGGAAGTTGTAGCACG3' (SEQ ID NO: 308) 5'GCCTATATGGAAGAGCCCTAATGTGTAAAATTAATTTTAGTAG3' (SEQ ID NO: 309) 5'CTACTAAAATTAATTTTACACATTAGGGCTCTTCCATATAGGC3' (SEQ ID NO: 310) 5'CTACTAAAATTAATT3' (SEQ ID NO: 311) 5'TACTAAAATTAATTT3' (SEQ ID NO: 312) 5'ACTAAAATTAATTT3' (SEQ ID NO: 313) 5'AATTAATTTTACACAT3' (SEQ ID NO: 314) 5'ATTTTACACATTAGGG3' (SEQ ID NO: 315) 5'TACACATTAGGGCTC3' (SEQ ID NO: 316) 5'ACATTAGGGCTCTTC3' (SEQ ID NO: 317) 5'TAGGGCTCTTCCATA3' (SEQ ID NO: 318) 5'GCTCTTCCATATAGG3' (SEQ ID NO: 319) 5'AGGTAAGATGGAGAGCCTT3' (SEQ ID NO: 320) 5'AAGGCTCTCCATCTTACCTTTCGG3' (SEQ ID NO: 321) 5'AAGGCTCTCCATCTTA3' (SEQ ID NO: 322) 5'AAGGCTCTCCATCT3' (SEQ ID NO: 323) 5'GCTCTCCATCTTACCT3' (SEQ ID NO: 324) 5'TCCATCTTACCTTTCG3' (SEQ ID NO: 325) 5'TGTGTAACATTAGGGAGG3' (SEQ ID NO: 326) 5'CCTCCCTAATGTTACACA3' (SEQ ID NO: 327) 5'CCTCCCTAATGTTACA3' (SEQ ID NO: 328) 5'CTCCCTAATGTTACAG3' (SEQ ID NO: 329) 5'CTCCCTAATGTTACAG3' (SEQ ID NO: 330) 5'TCATGTGGTAGTGTTGGTTTTA3' (SEQ ID NO: 331) 5'TAAAACCAACACTACCACATGA3' (SEQ ID NO: 332) 5'TAAAACCAACACTACC3' (SEQ ID NO: 333) 5'AAACCAACACTACCAC3' (SEQ ID NO: 334) 5'AAACCAACACTACCAC3' (SEQ ID NO: 335) 5'ACCAACACTACCACAT3' (SEQ ID NO: 336) 5'CAACACTACCACATGA3' (SEQ ID NO: 336)

[0092] In some embodiments, the oligonucleotide comprises a sequence selected from the following: (IAV PSL2(+) 5'TGTCAGTAAGTATG3' (SEQ ID NO: 337) 5'CTGGCTGTCAGTAAGT3' (SEQ ID NO: 338) 5'TCGCTGTCTGGCTGT3' (SEQ ID NO: 339) 5'CTTTTGGTCGCTGTCT3' (SEQ ID NO: 340) 5'CTTTTGGTCGCTGT3' (SEQ ID NO: 341) 5'TTGGTCGCTGTCTGGC3' (SEQ ID NO: 342) 5'TTGGTCGCTGTCTG3' (SEQ ID NO: 343) 5'GAATTCTTTTGGTCGC3' (SEQ ID NO: 344) 5'GAATTCTTTTGGTCG3' (SEQ ID NO: 345) 5'AATTCTTTTGGTCGC3' (SEQ ID NO: 346) 5'CGAATTCTTTTGGTCG3' (SEQ ID NO: 347) 5'ACACTAATTGATGGC3' (SEQ ID NO: 348) 5'AATTGATGGCCAT3' (SEQ ID NO: 349)

[0093] In some embodiments, the oligonucleotide comprises a sequence selected from the following: (IBV(-) 5'CCACAAAATGAAGGCA3' (SEQ ID NO: 350) 5'CACAAAATGAAGGCA3' (SEQ ID NO: 351) 5'CACAAAATGAAGGC3' (SEQ ID NO: 352) 5'CAATAATTGTACTA3' (SEQ ID NO: 353) 5'CAATAATTGTACTA3' (SEQ ID NO: 354) 5'CAATAATTGTACTA3' (SEQ ID NO: 355) 5'CAATAATTGTACTAC3' (SEQ ID NO: 356) 5'CAATAATTGTACTAC3' (SEQ ID NO: 357) 5'TGTACTACTCATGGTA3' (SEQ ID NO: 358) 5'TGTACTACTCATGGTA3' (SEQ ID NO: 359) 5'TGTACTACTCATGGTA3' (SEQ ID NO: 360) 5'GTACTACTCATGGT3' (SEQ ID NO: 361) 5'TTGTACTACTCATGG3' (SEQ ID NO: 362) 5'CATGGTAGTAACATC3' (SEQ ID NO: 363) 5'CTCATGGTAGTAACATC3' (SEQ ID NO: 364) 5'CTCATGGTAGTAACAT3' (SEQ ID NO: 365) 5'CTCATGGTAGTAACAT3' (SEQ ID NO: 366) 5'ACTCATGGTAGTAACA3' (SEQ ID NO: 367) 5'ACTCATGGTAGTAACA3' (SEQ ID NO: 368) 5'ACTCATGGTAGTAAC3' (SEQ ID NO: 369) 5'ACTCATGGTAGTAA3' (SEQ ID NO: 370) 5'CAATGCAGATCGAAT3' (SEQ ID NO: 371) 5'CAATGCAGATCGAAT3' (SEQ ID NO: 372) 5'GATTGCCTTCACGAAA3' (SEQ ID NO: 373) 5GATTGCCTTCACGAAA3' (SEQ ID NO: 374)

[0094] In some embodiments, the oligonucleotide comprises a sequence selected from the following: (IBV(+) 5'GCCTTCATTTTGTG3' (SEQ ID NO: 375) 5'ATTGCCTTCATTTTGT3' (SEQ ID NO: 376) 5'ATTGCCTTCATTTTGT3' (SEQ ID NO: 377) 5'TAGTACAATTATTGCC3' (SEQ ID NO: 378) 5'AGTACAATTATTGCC3' (SEQ ID NO: 379) 5'GTACAATTATTGCCTT3' (SEQ ID NO: 380) 5'ACCATGAGTAGTACA3' (SEQ ID NO: 381) 5'CATGAGTAGTACAAT3' (SEQ ID NO: 382) 5'GATGTTACTACCATGAG3' (SEQ ID NO: 383) 5'ATGTTACTACCATGAG3' (SEQ ID NO: 384) 5'CATTGGATGTTACTAC3' (SEQ ID NO: 385) 5'ATTGGATGTTACTACC3' (SEQ ID NO: 386) 5'ATTGGATGTTACTAC3' (SEQ ID NO: 387) 5'TTTCGTGAAGGCAATC3' (SEQ ID NO: 388) 5'TCGTGAAGGCAATC3' (SEQ ID NO: 389)

[0095] In some embodiments, the oligonucleotide comprises a sequence selected from the following (miRNA targeting sequences): 5'GGTTTCGTCCGTGTT3' (SEQ ID NO: 390) 5'GTTTCGTCCGTGTT3' (SEQ ID NO: 391) 5'GCTGTCGCCCGTGTC3' (SEQ ID NO: 392) 5'GCTGTCGCCCGTGTC3' (SEQ ID NO: 393) 5'GCTGTCGCCCGTGTC3' (SEQ ID NO: 394) 5'GCTGTCGCCCGTGT3' (SEQ ID NO: 395) 5'TTCGTCCGTG3' (SEQ ID NO: 396) 5'TTCGTCCGTG3' (SEQ ID NO: 397) 5'TTCGTCCGTG3' (SEQ ID NO: 398) 5'CCCACCCAC3' (SEQ ID NO: 399) 5'CCCACCCAC3' (SEQ ID NO: 400) 5'CCCACCCAC3' (SEQ ID NO: 401) 5'TTTCGTCCGT3' (SEQ ID NO: 402) 5'TTTCGTCCGT3' (SEQ ID NO: 403) 5'TTTCGTCCGT3' (SEQ ID NO: 404) 5'CCCCACCCAC3' (SEQ ID NO: 405) 5'CCCCACCCAC3' (SEQ ID NO: 406) 5'CCCCACCCAC3' (SEQ ID NO: 407) 5'TTTCGTCCGTGT3' (SEQ ID NO: 408) 5'TTTCGTCCGTGT3' (SEQ ID NO: 409) 5'TTTCGTCCGTGT3' (SEQ ID NO: 410) 5'TTCCATCCATGT3' (SEQ ID NO: 411) 5'TTCCATCCATGT3' (SEQ ID NO: 412) 5'TTCCATCCATGT3' (SEQ ID NO: 413) 5'TTCCATCCATGT3' (SEQ ID NO: 414) 5'GTTTCGTCCGTGTT3' (SEQ ID NO: 415) 5'GTTTCGTCCGTGTT3' (SEQ ID NO: 416) 5'GTTTCGTCCGTGTT3' (SEQ ID NO: 417) 5'GTTTCGGCCATGTG3' (SEQ ID NO: 418) 5'CGTCCGTGTT3' (SEQ ID NO: 419) 5'CGTCCGTGTT3' (SEQ ID NO: 420) 5'CGTCCGTGTT3' (SEQ ID NO: 421) 5'CGTCCGTGTT3' (SEQ ID NO: 422) 5'CCTCCGTGTC3' (SEQ ID NO: 423) 5'CCTCCGTGTC3' (SEQ ID NO: 424) 5'CCTCCGTGTC3' (SEQ ID NO: 425) 5'TCCGTGTTGC3' (SEQ ID NO: 426) 5'TCCGTGTTGC3' (SEQ ID NO: 427) 5'TCCGTGTTGC3' (SEQ ID NO: 428) 5'TCCGTCTTGC3' (SEQ ID NO: 429) 5'TCCGTCTTGC3 (SEQ ID NO: 430) 5'TCCGTTTGC3' (SEQ ID NO: 431) 5'TTTCGTCCGTGTT3' (SEQ ID NO: 432) 5'TTTCGTCCGTGTT3' (SEQ ID NO: 433) 5'TTTCCTCTATGTT3' (SEQ ID NO: 434) 5'TTTCCTCTATGTT3' (SEQ ID NO: 435) 5'GTTTCGTCCGTGT3' (SEQ ID NO: 436) 5'GGTTTCGTCCGTGTT3' (SEQ ID NO: 437) 5'GGTTTCGTCCGTGTT3' (SEQ ID NO: 438) 5'AAGTACGTCCTACTT3' (SEQ ID NO: 439) 5'GGTTTCGTCC3' (SEQ ID NO: 440) 5'GGTTTCGTCC3' (SEQ ID NO: 441) 5'TGGGTTTCGTCCGTT3' (SEQ ID NO: 442) 5'TTTTGGGATTCCGT3' (SEQ ID NO: 443) 5'GCTTTTGGGATTCCGT3' (SEQ ID NO: 444) 5'GCTTTTGGGATTCCGT3' (SEQ ID NO: 445) 5'AGCTGCTTTTGGGATT3' (SEQ ID NO: 446) 5'GAGCTGCTTTTGGGAT3' (SEQ ID NO: 447) 5'CTGCTTTTGGGATTCC3' (SEQ ID NO: 448) 5'TGCTTTTGGGATTC3' (SEQ ID NO: 449) 5'AGCTGCTTTTGGGATT3' (SEQ ID NO: 450) 5'AGCTGCTTTTGGGA3' (SEQ ID NO: 451) 5'CAGCTGCTTTTGGGAT3' (SEQ ID NO: 452) 5'AGCTGCTTTTGGGATT3' (SEQ ID NO: 453) 5'AGCTGCTTTTGGGA3' (SEQ ID NO: 454) 5'AGCTGCTTTTGGGA3' (SEQ ID NO: 455) 5'AGCTGCTTTTGGGATT3' (SEQ ID NO: 456) 5'TGCTTTTGGGATTC3' (SEQ ID NO: 457) 5'GCGGCGCCCCGCCT3' (SEQ ID NO: 458) 5'GCGGCGCCCCGCCT3' (SEQ ID NO: 459) 5'CGGTCCCGCGGCGCCCCGCCT3' (SEQ ID NO: 460) 5'TTTGGGCTTCCTCGCT3' (SEQ ID NO: 461) 5'TTTGGGCTTCCTCG3' (SEQ ID NO: 462) 5'TTTGGGCTTCCTCG3' (SEQ ID NO: 463) 5'TGGGCTTCCTCGCT3' (SEQ ID NO: 464) 5'ATATACTTTGGGCTTC3' (SEQ ID NO: 465) 5'ATATACTTTGGGCTTC3' (SEQ ID NO: 466) 5'ATATACTTTGGGCT3' (SEQ ID NO: 467) 5'ATATACTTTGGGCTT3' (SEQ ID NO: 468) 5'TAGCCCTAGCCCCGCA3' (SEQ ID NO: 469) 5'TAGCCCTAGCCCCGCA3' (SEQ ID NO: 470) 5'TAGCCCTAGCCCCG3' (SEQ ID NO: 471) 5'TGCTGTTAGCCCTA3' (SEQ ID NO: 472) 5'TGCTGTTAGCCCTA3' (SEQ ID NO: 473) 5'GTGTTAGCCCTAGCC3' (SEQ ID NO: 474) 5'GCGCCCAGCCCCGC3' (SEQ ID NO: 475) 5'GCGCCCAGCCCCGC3' (SEQ ID NO: 476) 5'CGCGCGCCCAGCCC3' (SEQ ID NO: 477) 5'CGCGCGCCCAGCCCCGC3' (SEQ ID NO: 478) 5'TGGCATGGAATGGG3' (SEQ ID NO: 479) 5'ATGGAATGGGCTCCGC3' (SEQ ID NO: 480) 5'ATGGAATGGGCTCC3' (SEQ ID NO: 481) 5'AATGGGCTCCGCCAG3' (SEQ ID NO: 482) 5'AATGGGCTCCGCCAG3' (SEQ ID NO: 483) 5'AATGGGCTCCGCCA3' (SEQ ID NO: 484) 5'AATGGGCTCCGCCA3' (SEQ ID NO: 485) 5'CTTACCCGAGGCGGTC3' (SEQ ID NO: 486) 5'TTACCCGAGGCGGT3' (SEQ ID NO: 487) 5'ACCGTACCTTACCCGA3' (SEQ ID NO: 488) 5'CGTACCTTACCCGA3' (SEQ ID NO: 489) 5'CTCCGAGCCCCGCC3' (SEQ ID NO: 490) 5'CCCGGCTCCGAGCCCCGCC3' (SEQ ID NO: 491) 5'TGGCCTGTCCCCGCA3' (SEQ ID NO: 492) 5'TGGCCTGTCCCCGCA3' (SEQ ID NO: 493) 5'GATGCCCTGGCCTG3' (SEQ ID NO: 494) 5'GATGCCCTGGCCTG3' (SEQ ID NO: 495) 5'GCAGCCAGCTCTAC3' (SEQ ID NO: 496) 5'GCAGCCAGCTCTAC3' (SEQ ID NO: 497) 5'AGCCAGCTCTACCC3' (SEQ ID NO: 498) 5'AGCTCTACCCCCGCCA3' (SEQ ID NO: 499) 5'AGCTCTACCCCCGCCA3' (SEQ ID NO: 500) 5'AAAGCAGCGCCCACTT3' (SEQ ID NO: 501) 5'ACTTCCTCCCCGCT3' (SEQ ID NO: 502) 5'CTACAGAAGCCCCATA3' (SEQ ID NO: 503) 5'CTACAGAAGCCCCATA3' (SEQ ID NO: 504) 5'GAAATCTCTACAGAAG3' (SEQ ID NO: 505) 5'GAAATCTCTACAGAAG3' (SEQ ID NO: 506) 5'TGATCCCTGTCCCCAT3' (SEQ ID NO: 507) 5'ATGCTGATCCCTGTC3' (SEQ ID NO: 508) 5'GCCATGCTGATCCCTGTCCCCAT3' (SEQ ID NO: 509) 5'CCATCTCACCCCAT3' (SEQ ID NO: 510) 5'GCTGCTCCTCCCCAT3' (SEQ ID NO: 511) 5'TCTCCAACCCCACAA3' (SEQ ID NO: 512) 5'CTCCAACCCCACAA3' (SEQ ID NO: 513) 5'CAGCCAGCTCTCCAA3' (SEQ ID NO: 514) 5'AGCCAGCTCTCCAA3' (SEQ ID NO: 515)

[0096] In some embodiments, the oligonucleotide comprises a sequence selected from the following (minus strand targeted LNA): 5'ATCTGTTCTCTAAACGA3' (SEQ ID NO: 516) 5'ATCTGTTCTCTAAACG3' (SEQ ID NO: 517) 5'AGATCTGTTCTCTAAA3' (SEQ ID NO: 518) 5'TCTCTAAACGAACTTT3' (SEQ ID NO: 519) 5'TCTCTAAACGAACTTT3' (SEQ ID NO: 520) 5'CTCTAAACGAACTTTA3' (SEQ ID NO: 521) 5'ACTTTAAAATCTGT3' (SEQ ID NO: 522) 5'GGTTTCGTCCGTGTT3' (SEQ ID NO: 523) 5'GGTTTCGTCCGTGTT3' (SEQ ID NO: 524) 5'GGTTTCGTCCGTGTT3' (SEQ ID NO: 525) 5'TGCTTACGGTTTCGTCC3' (SEQ ID NO: 526) 5'GTTTCGTCCGTGTTGC3' (SEQ ID NO: 527) 5'TAGGTTTCGTCCGG3' (SEQ ID NO: 528) 5'TCGTCCGGGTGTGA3' (SEQ ID NO: 529) 5'TTCGTCCGGGTGTGA3' (SEQ ID NO: 530) 5'TTTCGTCCGGGTGTGA3' (SEQ ID NO: 531) 5'AGGTTTCGTCCGGGT3' (SEQ ID NO: 532) 5'AGGTTTCGTCCGGG3' (SEQ ID NO: 533) 5'AGGTTTCGTCCGGGT3' (SEQ ID NO: 534) 5'TTTCGTCCGGGTGTG3' (SEQ ID NO: 535) 5'AGGCCACGCGGAGTA3' (SEQ ID NO: 536) 5'CACGCGGAGTACGATC3' (SEQ ID NO: 537)

[0097] The oligonucleotide sequences can contain any convenient number of DNA, RNA BNA, LNA, ENA, cEt, 2'-modified nucleotides, or other chemically modified nucleotides. In some cases of the oligonucleotide sequences described herein, the sequences are mixed RNA / DNA sequences. In some cases of the oligonucleotide sequences described herein, the sequences are mixed BNA / DNA sequences. In some cases of the oligonucleotide sequences described herein, the sequences are mixed BNA / RNA sequences. In some cases of the oligonucleotide sequences described herein, the sequences are mixed BNA / RNA sequences. In some cases of the oligonucleotide sequences described herein, the sequences are only BNA nucleotides. In some cases of the oligonucleotide sequences described herein, the sequences are mixed LNA / DNA sequences. In some cases of the oligonucleotide sequences described herein, the sequences are mixed LNA / RNA sequences. In some cases of the oligonucleotide sequences described herein, the sequences are only LNA nucleotides. In some cases of the oligonucleotide sequences described herein, the sequences are mixed ENA / DNA sequences. In some cases of the oligonucleotide sequences described herein, the sequences are mixed ENA / RNA sequences. In some cases of the oligonucleotide sequences described herein, the sequences are only ENA nucleotides. In some cases of the oligonucleotide sequences described herein, the sequences are mixed cEt / DNA sequences. In some cases of the oligonucleotide sequences described herein, the sequences are mixed cEt / RNA sequences. In some cases of the oligonucleotide sequences described herein, the sequences comprise only cEt nucleotides. In some cases of the oligonucleotide sequences described herein, the sequences are mixed 2'-modified nucleotides / DNA sequences. In some cases of the oligonucleotide sequences described herein, the sequences are mixed 2'-modified nucleotides / RNA sequences. In some cases of the oligonucleotide sequences described herein, the sequences comprise only 2'-modified nucleotides. In some cases of the oligonucleotide sequences described herein, the sequences comprise only DNA nucleotides. In some cases of the oligonucleotide sequences described herein, the sequences comprise only RNA nucleotides.

[0098] In certain cases, the subject oligonucleotides have one of the following arrangements of the types of nucleotides in the sequence (e.g., one of SEQ ID NOS: 45-66, or 98-115): A. ABA, ABABA, ABABABA, ABABABABA, B. BAB, BABAB, BABABAB, or BABABABAA, wherein each A is independently a sequence of modified nucleotides and each B is a sequence of DNA nucleotides. In certain cases, A is a sequence of modified nucleotides, and the ribose moiety is modified to include a modification selected from BNA, LNA, ENA, cEt, and 2'-modified nucleotides. In certain cases, each A is a sequence of 1 to 50 nucleotides, such as 1 to 40, 1 to 30, 1 to 20, 1 to 10, or 1 to 5. In certain cases, each B is a sequence of 1 to 50 nucleotides, such as 1 to 40, 1 to 30, 1 to 20, 1 to 10, or 1 to 5.

[0099] In certain cases, the subject oligonucleotides have one of the following arrangements of the types of nucleotides in the sequence (e.g., one of SEQ ID NOS: 45-66, or 98-115): (A) n1 , (A) n2 -(B) n3 -(A) n2 , (A)n4-(B) n5 -(A) n4 -(B) n5 -(A) n4 -(B) n5 -(A) n4 , or (A) n4 -(B) n5 -(A) n4 -(B)n5 -(A) n4 -(B) n5 -(A) n4 -(B) n5 -(A) n4 , wherein A is a modified nucleotide, B is a DNA nucleotide, n1 is 8 or more, n2 is 3 to 4, n3 is 6 to 8, n4 is 1 to 2, and n5 is 1 to 3. In certain cases, A is a modified nucleotide and the ribose moiety is modified to include a modification selected from BNA, LNA, ENA, cEt, and 2'-modified nucleotides.

[0100] In certain cases, the subject oligonucleotides have one of the following arrangements of the types of nucleotides in the sequence (e.g., one of SEQ ID NOS: 45-66, or 98-115): A, where A is a sequence of 8 or more LNA nucleotides; ABA, where B is a sequence of 6 to 8 DNA nucleotides and each A is a sequence of 3 to 4 LNA nucleotides; ABA, where B is a sequence of 7-8 DNA nucleotides and each A is a sequence of 4 LNA nucleotides; LDLDLDL, where each L is a sequence of 1 to 2 LNA nucleotides and each D is a sequence of 2 DNA nucleotides; LDLDLDL, where each L is a sequence of 1 to 2 LNA nucleotides and each D is a sequence of 1 to 2 DNA nucleotides; LDLDLDL, where each L is a sequence of 1 to 2 LNA nucleotides and each D is a sequence of 1 to 3 DNA nucleotides; LDLDLDLDL, where each L is a sequence of 1 to 2 LNA nucleotides and each D is a sequence of 1 to 3 DNA nucleotides; and LDLDLDLDL, where each L is a sequence of 1 to 2 LNA nucleotides and each D is a sequence of 1 to 2 DNA nucleotides.

[0101] The subject oligonucleotide sequences may further comprise one or more modified internucleoside linkages, such as phosphorothioate, phosphorodithioate, phosphoramidate, and / or thiophosphoramidate linkages. Non-naturally occurring internucleoside linkages may be included at any convenient position in the subject oligonucleotide sequences. In embodiments where the internucleoside linkage comprises a chiral phosphorus atom, e.g., an asymmetric center, the asymmetric phosphorus atom may have either the "R" configuration (referred to herein as Rp) or the "S" configuration (referred to herein as Sp). The subject oligonucleotide sequences comprising chiral phosphorus atoms may be prepared as racemic mixtures or as separate enantiomers.

[0102] In certain embodiments, the oligonucleotide has one of the following sequences, where uppercase letters indicate LNA nucleotides and lowercase letters indicate DNA nucleotides (ie, deoxyribonucleotide units): LNA1: 5'AccAaaAGaaT3' (SEQ ID NO: 67), LNA2: 5'TggCcATcaaT3' (SEQ ID NO: 68), LNA3: 5'TagCAtActtA3' (SEQ ID NO: 69), LNA4: 5'CCAAAAGA3' (SEQ ID NO: 70), LNA5:5'CATACTTA3' (SEQ ID NO: 71), LNA6: 5'CagaCaCGaCCaaAA3' (SEQ ID NO: 72), LNA7: 5'TAcTtaCTgaCagCC3' (SEQ ID NO: 73), LNA8: 5'AGACacgaccaAAAG3' (SEQ ID NO: 74), LNA9: 5'TACTtactgacaGCC3' (SEQ ID NO: 75), LNA9.2: 5'TACttactgacAGCC3' (SEQ ID NO: 76), LNA10: 5'ACCaaaagAAT3' (SEQ ID NO: 77), LNA11: 5'TGGccatcAAT3' (SEQ ID NO: 78), LNA12: 5'TAGcatacTTA3' (SEQ ID NO: 79), LNA13: 5'CgacCAaaAGaattC3' (SEQ ID NO: 80), LNA14: 5'CGACcaaaagaATTC3' (SEQ ID NO: 81), LNA15: 5'GaTGgCcATcaAttA3' (SEQ ID NO: 82), LNA16: 5'GATGgccatcaATTA3' (SEQ ID NO: 83), LNA17: 5'TcTAgCaTActTacT3' (SEQ ID NO: 84), LNA18: 5'TCTAgcatactTACT3' (SEQ ID NO: 85), LNA19: 5'GAAttcggatgGCCA3' (SEQ ID NO: 86), LNA20: 5'GGCCatcaattaGTG3' (SEQ ID NO: 87), LNA21: 5'TTCGgatggccaTCA3' (SEQ ID NO: 88), LNA22: 5'AGCCagacagCGA3' (SEQ ID NO: 89), and LNA23: 5'GACAgccagacaGCA3' (SEQ ID NO: 90).

[0103] It will be understood that for any of sequences LNA1 to LNA23 (SEQ ID NO: 67) to (SEQ ID NO: 90), one or more of the LNA nucleotides can be substituted with modified nucleotides selected from BNA nucleotides, ENA nucleotides, cEt nucleotides, and 2'-modified nucleotides. In certain cases, one, two, three, four, or more of the LNA nucleotides can be substituted with BNA nucleotides. In certain cases, one, two, three, four, or more of the LNA nucleotides can be substituted with ENA nucleotides. In certain cases, one, two, three, four, or more of the LNA nucleotides can be substituted with cEt nucleotides. In certain cases, one, two, three, four, or more of the LNA nucleotides can be substituted with 2'-modified nucleotides (e.g., substituted with MOE and other substituents described herein).

[0104] In certain embodiments, the oligonucleotide has one of the following sequences, where uppercase letters indicate LNA nucleotides and lowercase letters indicate DNA nucleotides (ie, deoxyribonucleotide units): LNA19: 5'GAAttcggatgGCCA3' (SEQ ID NO: 86), LNA22: 5'AGCCagacagCGA3' (SEQ ID NO: 89), LNA22.2: 5'CAGCcagacagCGAC3' (SEQ ID NO: 116), LNA22.3: 5'CAGccagacagCGAC3' (SEQ ID NO: 117), LNA22.5: 5'CAGccagacaGCGA3' (SEQ ID NO: 118), LNA22.6: 5'CAGccagacagCGA3' (SEQ ID NO: 119), LNA22.7: 5'CAGCcagacagCGA3' (SEQ ID NO: 120), LNA22.8: 5'ACAgccagacagCGA3' (SEQ ID NO: 121), LNA22.9: 5'ACAGccagacaGCGA3' (SEQ ID NO: 122), LNA22.10: 5'ACAgccagacaGCGA3' (SEQ ID NO: 123), LNA22.11: 5'GACAgccagacaGCG3' (SEQ ID NO: 124), LNA22.13: 5'GACagccagacaGCG3' (SEQ ID NO: 125), and LNA22.14: 5'GACAgccagacAGCG (SEQ ID NO: 126).

[0105] It will be understood that for sequences LNA19, or any of LNA22-LNA22.14 ((SEQ ID NO:86), (SEQ ID NO:89), and (SEQ ID NO:116) to (SEQ ID NO:126)), one or more of the LNA nucleotides can be substituted with modified nucleotides selected from BNA nucleotides, ENA nucleotides, cEt nucleotides, and 2'-modified nucleotides. In certain cases, one, two, three, four, or more of the LNA nucleotides can be substituted with BNA nucleotides. In certain cases, one, two, three, four, or more of the LNA nucleotides can be substituted with ENA nucleotides. In certain cases, one, two, three, four, or more of the LNA nucleotides can be substituted with cEt nucleotides. In certain cases, one, two, three, four, or more of the LNA nucleotides can be substituted with 2'-modified nucleotides (e.g., with MOE and other substituents described herein).

[0106] In certain embodiments, the oligonucleotide has one of the following sequences, where uppercase letters indicate LNA nucleotides and lowercase letters indicate DNA nucleotides (ie, deoxyribonucleotide units): LNA24: 5'CATcaattagtgTCG3' (SEQ ID NO: 127), LNA25: 5'CCAtcaattagtgTCG3' (SEQ ID NO: 128), LNA26: 5'GCCatcaattagtGTG3' (SEQ ID NO: 129), LNA27: 5'AAGAattcggaTGGC3' (SEQ ID NO: 130), LNA28: 5'CAGacagcgacCAA3' (SEQ ID NO: 131), and LNA29: 5'TGAcagccagacAGC3' (SEQ ID NO: 132).

[0107] It will be understood that for sequences LNA24 or any of LNA29 (SEQ ID NO: 127) to (SEQ ID NO: 132), one or more of the LNA nucleotides can be substituted with modified nucleotides selected from BNA nucleotides, ENA nucleotides, cEt nucleotides, and 2'-modified nucleotides. In certain cases, one, two, three, four, or more of the LNA nucleotides can be substituted with BNA nucleotides. In certain cases, one, two, three, four, or more of the LNA nucleotides can be substituted with ENA nucleotides. In certain cases, one, two, three, four, or more of the LNA nucleotides can be substituted with cEt nucleotides. In certain cases, one, two, three, four, or more of the LNA nucleotides can be substituted with 2'-modified nucleotides (e.g., substituted with MOE and other substituents described herein).

[0108] In certain embodiments, the oligonucleotide has the sequence LNA14, or a derivative thereof, as shown in Table 1, where a "+" before a letter indicates an LNA nucleotide or other chemically modified nucleotide (e.g., as described herein), and other letters indicate DNA nucleotides (i.e., deoxyribonucleotide units). [Table 1]

[0109] In certain embodiments, the oligonucleotide has the sequence LNA9, or a derivative thereof, as shown in Table 2, where a "+" before a letter indicates an LNA nucleotide or other chemically modified nucleotide (e.g., as described herein), and other letters indicate DNA nucleotides (i.e., deoxyribonucleotide units). [Table 2]

[0110] In certain embodiments, the oligonucleotide has the sequence LNA8a, or a derivative thereof, as shown in Table 3, where a "+" before a letter indicates an LNA nucleotide or other chemically modified nucleotide (e.g., as described herein), and other letters indicate DNA nucleotides (i.e., deoxyribonucleotide units). [Table 3]

[0111] In certain embodiments, the oligonucleotide has the sequence IAV-Pos, or a derivative thereof, as shown in Table 4, where a "+" before a letter indicates an LNA nucleotide or other chemically modified nucleotide (e.g., as described herein), and other letters indicate DNA nucleotides (i.e., deoxyribonucleotide units). [Table 4]

[0112] In certain embodiments, the oligonucleotide has the sequence IBV, or a derivative thereof, as shown in Table 5, where a "+" before a letter indicates an LNA nucleotide or other chemically modified nucleotide (e.g., as described herein), and other letters indicate DNA nucleotides (i.e., deoxyribonucleotide units). [Table 5]

[0113] In certain embodiments, the oligonucleotide has the sequence IBV-Pos, or a derivative thereof, as shown in Table 6, where a "+" before a letter indicates an LNA nucleotide or other chemically modified nucleotide (e.g., as described herein), and other letters indicate DNA nucleotides (i.e., deoxyribonucleotide units). [Table 6]

[0114] In certain embodiments, the oligonucleotide has the sequence Neg, or a derivative thereof, as shown in Table 7, where a "+" before a letter indicates an LNA nucleotide or other chemically modified nucleotide (e.g., as described herein), and other letters indicate DNA nucleotides (i.e., deoxyribonucleotide units). [Table 7-1] [Table 7-2]

[0115] In certain embodiments, the oligonucleotide has the sequence miR, or a derivative thereof, as shown in Table 8, where a "+" before a letter indicates an LNA nucleotide or other chemically modified nucleotide (e.g., as described herein), and other letters indicate DNA nucleotides (i.e., deoxyribonucleotide units). [Table 8-1] [Table 8-2] [Table 8-3] [Table 8-4] [Table 8-5]

[0116] In certain embodiments, the oligonucleotide has the sequence Cov, or a derivative thereof, as shown in Table 8, where a "+" before a letter indicates an LNA nucleotide or other chemically modified nucleotide (e.g., as described herein), and other letters indicate DNA nucleotides (i.e., deoxyribonucleotide units). [Table 9-1] [Table 9-2] [Table 9-3] [Table 9-4]

[0117] In certain embodiments, the oligonucleotide has one of the following sequences, where uppercase letters indicate LNA nucleotides and lowercase letters indicate DNA nucleotides (ie, deoxyribonucleotide units): a) LNA14: 5'CGACcaaaagaATTC3' (SEQ ID NO: 81); b) LNA14.5: 5'CGACcaaaagaATT3' (SEQ ID NO: 135); c) LNA14.8: 5'CGACcaaaagaaTTC3' (SEQ ID NO: 137); d) LNA14.28: 5'GACcaaaagaatTCGG3' (SEQ ID NO: 148); e) LNA14.30: 5'GACCaaaagaattCGG3' (SEQ ID NO: 149); f) LNA9: 5'TACTtactgacaGCC3' (SEQ ID NO: 75); g) LNA9.1: 5'AGCAtacttactGACA3' (SEQ ID NO: 159); h) LNA9.2a: 5'CATacttactgACA3' (SEQ ID NO: 160); i) LNA9.8: 5'ATActtactgACAG (SEQ ID NO: 164); j) LNA9.12:5'CATActtactgacAGC (SEQ ID NO: 167); k) LNA8a: 5'AGAcagcgaccaaAAG (SEQ ID NO: 188); l) LNA8a.1: 5'AGACagcgaccaAAAG (SEQ ID NO: 189), and m) LNA8a.2: 5'ACAGcgaccaAAAG (SEQ ID NO: 190).

[0118] In certain embodiments, the oligonucleotide has a sequence selected from (a) through (e). In certain cases, the oligonucleotide has a sequence selected from (f) through (j). In certain other cases, the oligonucleotide has a sequence selected from (k) through (m).

[0119] It will be understood that for any of sequences (a)-(m) or a sequence selected from any one of Tables 1-9, one or more of the LNA nucleotides can be substituted with modified nucleotides selected from BNA nucleotides, ENA nucleotides, cEt nucleotides, and 2'-modified nucleotides. In certain cases, one, two, three, four, or more of the LNA nucleotides can be substituted with BNA nucleotides. In certain cases, one, two, three, four, or more of the LNA nucleotides can be substituted with ENA nucleotides. In certain cases, one, two, three, four, or more of the LNA nucleotides can be substituted with cEt nucleotides. In certain cases, one, two, three, four, or more of the LNA nucleotides can be substituted with 2'-modified nucleotides (e.g., with MOE and other substituents described herein).

[0120] It will also be understood that for any of the above oligonucleotide sequences, one or more of the DNA nucleotides may be modified to provide a corresponding BNA, LNA, ENA, cEt, or 2'-modified nucleotide. In certain cases, one, two, three, four, or more of the DNA nucleotides may be substituted with BNA nucleotides. In certain cases, one, two, three, four, or more of the DNA nucleotides may be modified to provide a corresponding LNA nucleotide. In certain cases, one, two, three, four, or more of the DNA nucleotides may be modified to provide a corresponding ENA nucleotide. In certain cases, one, two, three, four, or more of the DNA nucleotides may be modified to provide a corresponding cEt nucleotide. In certain cases, one, two, three, four, or more of the DNA nucleotides may be modified to provide a corresponding 2'-modified nucleotide (e.g., as described herein).

[0121] Sequence variants of the above oligonucleotide sequences are also encompassed by the present disclosure. It is understood that in any of the sequences described herein, one, two, three, four or more of the nucleotides may be mutated to provide desirable properties, such as enhanced inhibitory activity, conjugation to a modifier, etc.

[0122] In some cases, any one of the sequences described herein (e.g., one of SEQ ID NOs: 45-907) is included within a longer sequence, e.g., including additional 5' and / or 3' nucleotides. In particular cases, the subject oligonucleotides are 75 nucleotides or less in length, such as 50 nucleotides or less, 40 nucleotides or less, or 35 nucleotides or less in length. In particular cases, the subject oligonucleotides are 30 nucleotides or less in length, such as 25 nucleotides or less, 20 nucleotides or less, 19 nucleotides or less, 18 nucleotides or less, 17 nucleotides or less, 16 nucleotides or less, 15 nucleotides or less, 14 nucleotides or less, 13 nucleotides or less, 12 nucleotides or less, 11 nucleotides or less, or 10 nucleotides or less.

[0123] In some cases, the subject oligonucleotide compounds include a sequence having a deletion relative to one of the sequences described herein (e.g., one of SEQ ID NOs: 45-907). For example, a sequence in which one, two, or three nucleotides are deleted from the 5' and / or 3' end of a sequence, e.g., one of SEQ ID NOs: 45-96. In some cases, the deleted sequence has one nucleotide missing from the 5' end of one of SEQ ID NOs: 45-907. In some cases, the deleted sequence has one nucleotide missing from the 3' end of one of SEQ ID NOs: 45-191. In some cases, the deleted sequence has two nucleotides missing from the 5' end of one of SEQ ID NOs: 45-907. In some cases, the deleted sequence has two nucleotides missing from the 3' end of one of SEQ ID NOs: 45-907.

[0124] In certain cases, the oligonucleotide comprises a sequence having at least 70% homology to any one of the sequences (SEQ ID NO:45) to (SEQ ID NO:907) (e.g., as defined herein). In certain cases, the oligonucleotide comprises a sequence having 70% or more homology to any one of the sequences (SEQ ID NO:45) to (SEQ ID NO:907), such as 75% or more, 80% or more, 85% or more, 90% or more, or more. In certain cases, the oligonucleotide comprises a sequence having 70-80% homology to any one of the sequences (SEQ ID NO:45) to (SEQ ID NO:907). In certain cases, the oligonucleotide comprises a sequence having 80%-90% homology to any one of the sequences (SEQ ID NO:45) to (SEQ ID NO:907). In certain cases, the oligonucleotide comprises a sequence having 90%-99% homology to any one of the sequences (SEQ ID NO:45) to (SEQ ID NO:907).

[0125] In certain cases, the oligonucleotide sequence may contain mutations designed to cover single nucleotide polymorphisms (SNPs) in the target PSL2 sequence. In some cases, the oligonucleotide is a modified version of LNA9 with a single mutation site that protects against PLS2 target sequences containing nucleotide changes with the LNA9 target sequence. It is understood that the SNP mutation of interest can be applied to any of the sequences described herein. The mutation sequence of interest is hereinafter referred to as: 5'TACTTACTGACAGTC3' (SEQ ID NO: 91), 5'TACTTACCGACAGCC3' (SEQ ID NO: 92), and Examples of the nucleotide sequence include, but are not limited to, 5'GGATTTCGGATGGCCA3' (SEQ ID NO: 93).

[0126] In certain embodiments, the oligonucleotide has one of the following sequences, where uppercase letters indicate LNA nucleotides and lowercase letters indicate DNA nucleotides: LNA9.G74C: 5'TACTtactgacaGTC3' (SEQ ID NO: 94), LNA9.T80C: 5'TACTtaccgacaGCC3' (SEQ ID NO: 95), and LNA19.U56C: 5'GGATttcggatggCCA3' (SEQ ID NO: 96).

[0127] It will be understood that for any of the sequences (SEQ ID NO:94) to (SEQ ID NO:96), or one or more of the LNA nucleotides, can be substituted with modified nucleotides selected from ENA nucleotides, cEt nucleotides, and 2'-modified nucleotides. In certain cases, one, two, three, four, or more of the LNA nucleotides can be substituted with ENA nucleotides. In certain cases, one, two, three, four, or more of the LNA nucleotides can be substituted with cEt nucleotides. In certain cases, one, two, three, four, or more of the LNA nucleotides can be substituted with 2'-modified nucleotides (e.g., substituted with MOE and other substituents described herein).

[0128] In certain cases, the oligonucleotide has a maximum length corresponding to a particular region of the PSL2 structure (e.g., the subregion corresponding to nucleotides 34 to 87). In certain cases, the oligonucleotide length is 20 nucleotides or less, such as 15 nucleotides or less, 14 nucleotides or less, 13 nucleotides or less, 12 nucleotides or less, 11 nucleotides or less, 10 nucleotides or less, 9 nucleotides or less, 8 nucleotides or less, 7 nucleotides or less, or less.

[0129] Oligonucleotides can be chemically synthesized by methods known in the art (see Wagner et al. (1993), supra, and Milligan et al., supra). Oligonucleotides can be chemically modified from their native phosphodiester structure to increase intracellular stability and binding affinity. Several such modifications, which alter the chemistry of the backbone, sugars, or heterocyclic bases, have been described in the literature.

[0130] Useful variations in backbone chemistry include phosphorothioates, phosphorodithioates in which both non-bridging oxygens are replaced with sulfur, phosphoramidates, alkylphosphotriesters, and boranophosphates. Achiral phosphate derivatives include 3'-O'-5'-S-phosphorothioates, 3'-S-5'-O-phosphorothioates, 3'-CH2-5'-O-phosphonates, 3'-NH-5'-O-phosphoramidates, and thiophosphoramidates. Peptide nucleic acids replace the entire ribose phosphodiester backbone with peptide bonds. Sugar modifications are also used to enhance stability and affinity. The α-anomer of deoxyribose can be used, with the base inverted relative to the natural β-anomer. In certain cases, the 2'-OH of the ribose sugar can be altered, for example, as described herein. The 2'-OH of the ribose sugar may be altered to form a 2'-O-methyl or 2'-O-allyl sugar, which provides resistance to degradation without affecting affinity. In certain cases, modification of the 2'-OH of the ribose sugar can improve toxicity. Modification of heterocyclic bases is necessary to maintain proper base pairing. Some useful substitutions include deoxyuridine for deoxythymidine, and 5-methyl-2'-deoxycytidine and 5-bromo-2'-deoxycytidine for deoxycytidine. 5-propynyl-2'-deoxyuridine and 5-propynyl-2'-deoxycytidine have been shown to increase affinity and biological activity when substituted for deoxythymidine and deoxycytidine, respectively.

[0131] Oligonucleotide agents can be derivatized with any convenient modifying agent, for example, by conjugation of the modifying agent to the 5' and / or 3' end of the oligonucleotide sequence. In some cases, the modifying agent is a moiety (e.g., a lipid) that enhances cellular uptake. Any convenient lipid can be conjugated to the subject oligonucleotide. In some cases, the modifying agent is a fatty acid attached to the 5' or 3' end via an optional linker. The lipid group can be an aliphatic hydrocarbon or fatty acid, including, but not limited to, hydrocarbon and fatty acid derivatives, such as saturated linear compounds having 14 to 20 carbons, such as myristic acid (tetradecanoic acid), palmitic acid (hexadecanoic acid), and stearic acid (octadecanoic acid), as well as their corresponding aliphatic hydrocarbon forms, tetradecane, hexadecane, and octadecane. Other examples of suitable lipid groups that can be used include sterols, such as cholesterol, and substituted fatty acids and hydrocarbons, particularly polyfluorinated forms of these groups. The range of lipid groups includes amine, amide, ester and derivatives such as carbamate derivatives.

[0132] In some cases, the modifying agent is an additional nucleic acid sequence having a desired activity (e.g., RNase recruitment as described herein). In certain cases, the modifying agent has specific binding activity that provides delivery of the oligonucleotide to a specific target, such as a cell-specific protein. In some cases, the modifying agent is an antibody of interest that specifically binds to a cell-specific target of interest. In certain cases, the antibody modifying agent specifically binds to a hemagglutinin (HA) target.

[0133] Oligonucleotide active agents can be utilized in any convenient form. In some cases, the oligonucleotide active agent is single-stranded. In some cases, the oligonucleotide active agent is double-stranded. In some cases, the oligonucleotide active agent is siRNA. In some cases, the oligonucleotide active agent is shRNA. In some cases, the oligonucleotide active agent is ssRNA. In some cases, one or more nucleotides of the ssRNA can be replaced with LNA nucleotides. In some cases, the oligonucleotide active agent is ssDNA. In some cases, one or more nucleotides of the ssDNA can be replaced with LNA nucleotides.

[0134] Treatment method An individual can be infected with influenza A virus alone and / or other respiratory viruses, including but not limited to influenza B virus (IBV), coronavirus (Cov), respiratory syncytial virus (RSV).

[0135] The present invention is particularly well suited for the prevention and / or treatment of respiratory infections and for functioning as a just-in-time vaccine. Additionally, the present invention can be co-administered with other vaccines to provide immediate protection during the period necessary for the other vaccines to be effective. Additionally, the present invention can be administered to vaccinated individuals who are at risk of exposure to vaccine-resistant variants. Additionally, the present invention can be administered to vaccinated individuals who are asymptomatic but can still transmit the virus.

[0136] The oligonucleotides described in the present invention can be used alone or in combination with other oligonucleotides to prevent and / or treat the respiratory viruses described herein.

[0137] Aspects of the present disclosure include methods for treating or preventing influenza A virus infection, influenza B, coronavirus, and respiratory syncytial virus (RSV) in a subject. The subject oligonucleotide compounds are used as a new class of antiviral therapeutics that can efficiently disrupt packaging and completely prevent otherwise fatal disease in vivo. As demonstrated in the Examples section, intranasal administration of exemplary oligonucleotide compounds in vivo resulted in potent antiviral effects and prevented lethal IAV infection in mice.

[0138] Aspects of the method include administering a therapeutically effective amount of a subject compound to a subject in need thereof to treat the subject for an infection or prevent an infection in the subject. A "therapeutically effective amount" refers to a concentration of a compound sufficient to induce a desired biological effect (e.g., treatment or prevention of a condition or disease, influenza A virus infection). "Treatment" means that at least an improvement in symptoms associated with the condition afflicting the host is achieved, where improvement is used broadly to refer to at least a reduction in a parameter associated with the condition being treated, e.g., the magnitude of the symptoms. Thus, treatment also includes situations in which a pathological condition, or at least the symptoms associated therewith, are completely inhibited, e.g., prevented from occurring, or arrested, e.g., terminated, such that the host is no longer afflicted with the condition, or at least the symptoms characterizing the condition. Thus, treatment includes (i) prevention, i.e., preventing clinical symptoms from developing, e.g., reducing the risk of developing clinical symptoms, including preventing the progression of disease to a deleterious state; (ii) inhibition, i.e., preventing the onset or further development of clinical symptoms, e.g., reducing or completely inhibiting active disease (e.g., infection); and / or (iii) palliative, i.e., causing regression of clinical symptoms. In the context of influenza A virus infection, the term "treating" includes any or all of reducing the number of viral cells in a patient sample, inhibiting viral cell replication, and ameliorating one or more symptoms associated with infection.

[0139] The subject to be treated may be one in need of treatment, and the host to be treated is a host suitable for treatment with the subject compound. In some embodiments, the subject is a subject suspected of having influenza A virus infection. In certain embodiments, the subject is diagnosed with influenza A virus infection. Thus, in some cases, the subject is a subject infected with a virus.

[0140] In certain cases, the subject is at risk of or suspected of being infected with the virus. In some embodiments, the vRNA is PB2 vRNA. The subject method can be used to prevent influenza A virus infection in a subject. "Prevention" means that a subject at risk of influenza A virus infection does not become infected despite being exposed to the virus under conditions that would normally lead to infection. In some cases, administration of a subject active agent (e.g., an oligonucleotide compound) protects the subject from infection for one week or more, such as two weeks or more, three weeks or more, one month or more, two months or more, or three months or more. Multiple doses of the subject compound can be administered according to the subject method to provide long-term protection against the subject form of infection. Timing and dosage can be readily determined using conventional methods.

[0141] In some cases, the subject treatment methods include determining or diagnosing whether a subject has an influenza A virus infection. The determining step can be carried out using any convenient method. In some cases, the determining step includes obtaining a biological sample from the subject and assaying the sample for the presence of viral cells. The sample can be a cell sample. The determining step can include identifying viral cells containing a particular mutation.

[0142] Thus, a variety of subjects may be suitable for treatment using the compounds and pharmaceutical compositions of the presently disclosed subject matter. As used herein, the terms "subject" and "host" are used interchangeably. Generally, such subjects are "mammals," with humans being the subjects of interest. Other subjects include domestic pets (e.g., dogs and cats), livestock (e.g., cows, pigs, goats, horses, etc.), rodents (e.g., mice, guinea pigs, and rats, e.g., animal models of disease), and non-human primates (e.g., chimpanzees and monkeys).

[0143] The amount of the subject compound to be administered can be determined using any convenient method, such that it is an amount sufficient to produce the desired effect in association with a pharmaceutically acceptable diluent, carrier, or vehicle. The specifications for the unit dosage forms of the present invention depend on the particular compound employed and the effect to be achieved, and the pharmacodynamics associated with each compound in the host.

[0144] Embodiments of the present disclosure include methods for treating or preventing coronavirus (CoV) infection. The subject oligonucleotide compounds are used as a new class of antiviral therapeutics that can efficiently disrupt CoV RNA secondary structure and thus treat or prevent CoV infection in a subject. In some cases, the subject oligonucleotide compounds can inhibit host miRNA interactions with CoV. In some cases, the subject oligonucleotide compounds are used as a new antiviral therapeutic that can efficiently disrupt CoV RNA secondary structure, disrupt packaging, and completely prevent otherwise fatal disease in vivo. In certain cases, the CoV is selected from HCoV-229E, HCoV-OC43, SARS-CoV, HCoV-NL63, HKU1, MERS-CoV, and SARS-CoV-2. In certain cases, the CoV is SARS-CoV-2.

[0145] Aspects of the method include administering a therapeutically effective amount of a subject compound to a subject in need thereof to treat the subject for an infection or prevent an infection in the subject. A "therapeutically effective amount" refers to a concentration of a compound sufficient to induce a desired biological effect (e.g., treatment or prevention of a condition or disease, influenza A, influenza B, coronavirus infection, or RSV infection). "Treatment" means achieving at least an improvement in symptoms associated with the condition afflicting the host, where improvement is used broadly to refer to at least a reduction in a parameter associated with the condition being treated, e.g., the magnitude of the symptoms. Thus, treatment also includes situations in which a pathological condition, or at least the symptoms associated therewith, are partially or completely inhibited, e.g., prevented from occurring, or arrested, e.g., terminated, such that the host is no longer afflicted with the condition, or at least the symptoms characterizing the condition. Thus, treatment includes (i) prevention, i.e., not allowing clinical symptoms to develop, e.g., reducing the risk of developing clinical symptoms, including preventing the progression of disease to a deleterious condition; (ii) inhibition, i.e., preventing the onset or further development of clinical symptoms, e.g., reducing or completely inhibiting active disease (e.g., infection); (iii) palliation, i.e., causing regression of clinical symptoms; (iv) preventing the need for a severe condition requiring hospitalization or intensive care unit (ICU); (v) shortening the length of hospitalization or ICU stay; (vi) preventing or reducing the need for assisted ventilation, including, but not limited to, supplemental oxygen, non-invasive positive pressure ventilation (CPAP and / or BPAP), mechanical ventilation; (vi) preventing or reducing the need for assisted cardiopulmonary bypass, such as an extracorporeal membrane oxygenation (ECMO) device; (vii) preventing the onset of multiple bacterial infections; and (viii) preventing death.In the context of influenza A, influenza B, and coronavirus (CoV) infections, the term "treating" includes any or all of reducing the number of viruses in the body, reducing the number of virus-infected cells in a patient, inhibiting intracellular and / or extracellular replication of the virus and virus-infected cells, and ameliorating one or more symptoms associated with the infection.

[0146] The subject to be treated may be one in need of treatment, and the host to be treated is one that is suitable for treatment with the subject compounds. In some embodiments, the subject is a subject suspected of having a coronavirus infection. In certain embodiments, the subject is diagnosed with a coronavirus infection. Thus, in some cases, the subject is a subject infected with the virus.

[0147] In certain cases, the subject is at risk of or suspected of being infected with the virus. The subject method can be used to prevent a subject from being infected with a coronavirus. "Prevention" means that a subject at risk of coronavirus infection is not infected, or, if infected, the severity of the infection is attenuated, despite being exposed to the virus under conditions that would normally result in infection. In some cases, administration of a subject active agent (e.g., an oligonucleotide compound) immediately protects the subject from infection for one week or more, such as two weeks or more, three weeks or more, one month or more, two months or more, or three months or more. Multiple doses of the subject compound can be administered according to the subject method to provide long-term protection against the subject form of infection. Timing and dosage can be readily determined using conventional methods.

[0148] In some cases, the subject treatment methods include determining or diagnosing whether a subject has a coronavirus infection. The determining step can be performed using any convenient method. In some cases, the determining step includes obtaining a biological sample from the subject and assaying the sample for the presence of intracellular and / or extracellular virus and virus-infected cells. The sample can be a cell sample. The determining step can include identifying intracellular and / or extracellular virus and virus-infected cells that contain a particular mutation.

[0149] In some embodiments, an effective dosage of a subject compound is from about 50 ng / ml to about 50 μg / ml (e.g., from about 50 ng / ml to about 40 μg / ml, from about 30 ng / ml to about 20 μg / ml, from about 50 ng / ml to about 10 μg / ml, from about 50 ng / ml to about 1 μg / ml, from about 50 ng / ml to about 800 ng / ml, from about 50 ng / ml to about 700 ng / ml, from about 50 ng / ml to about 600 ng / ml, from about 50 ng / ml to about 500 ng / ml, from about 50 ng / ml to about 400 ng / ml, from about 60 ng / ml to about 400 ng / ml, The effective volume is a mass concentration in the range of about 70 ng / ml to about 300 ng / ml, about 60 ng / ml to about 100 ng / ml, about 65 ng / ml to about 85 ng / ml, about 70 ng / ml to about 90 ng / ml, about 200 ng / ml to about 900 ng / ml, about 200 ng / ml to about 800 ng / ml, about 200 ng / ml to about 700 ng / ml, about 200 ng / ml to about 600 ng / ml, about 200 ng / ml to about 500 ng / ml, about 200 ng / ml to about 400 ng / ml, or about 200 ng / ml to about 300 ng / ml.

[0150] In some embodiments, an effective amount of a subject compound is from about 10 pg to about 100 mg, e.g., from about 10 pg to about 50 pg, from about 50 pg to about 150 pg, from about 150 pg to about 250 pg, from about 250 pg to about 500 pg, from about 500 pg to about 750 pg, from about 750 pg to about 1 ng, from about 1 ng to about 10 ng, from about 10 ng to about 50 ng, from about 50 ng to about 150 ng, from about 150 ng to about 250 ng, or from about 25 The amount ranges from 0 ng to about 500 ng, from about 500 ng to about 750 ng, from about 750 ng to about 1 μg, from about 1 μg to about 10 μg, from about 10 μg to about 50 μg, from about 50 μg to about 150 μg, from about 150 μg to about 250 μg, from about 250 μg to about 500 μg, from about 500 μg to about 750 μg, from about 750 μg to about 1 mg, from about 1 mg to about 50 mg, from about 1 mg to about 100 mg, or from about 50 mg to about 100 mg. The amount can be a single dose amount or a total daily amount. The total daily amount can be in the range of 10 pg to 100 mg, or 100 mg to about 500 mg, or 500 mg to about 1000 mg.

[0151] In some embodiments, a single dose of the subject compound is administered. In other embodiments, multiple doses of the subject compound are administered. When multiple doses are administered over a period of time, the subject compound may be administered twice daily (qid), daily (qd), every other day (qod), every third day, three times a week (tiw), or twice a week (biw) over a period of time. For example, the compound may be administered qid, qd, qod, tiw, or biw for a period of from one day to about two years or more. For example, the compound may be administered at any of the above frequencies for one week, two weeks, one month, two months, six months, one year, two years, or more, depending on various factors.

[0152] Any of a variety of methods may be used to determine whether a therapeutic method is effective. For example, a biological sample obtained from an individual treated with a subject method may be assayed for the presence and / or level of viral cells. Evaluating the effectiveness of a therapeutic method for a subject may include evaluating the subject before, during, and / or after treatment using any convenient method. Aspects of the subject methods further include evaluating the subject's therapeutic response to the treatment.

[0153] In some embodiments, the methods include assessing a subject's condition, including diagnosing or assessing one or more symptoms in the subject associated with the disease or condition of interest being treated (e.g., as described herein). In some embodiments, the methods include obtaining a biological sample from the subject and assaying the sample for, e.g., the presence of viral cells or components thereof associated with the disease or condition of interest (e.g., as described herein). The sample may be a cell sample. The assessing step of the subject methods may be performed one or more times before, during, and / or after administration of a subject compound using any convenient method. In certain cases, the assessing step includes identifying and / or quantitating viral cells. In certain cases, assessing the subject includes diagnosing whether the subject has a viral infection or symptoms thereof.

[0154] Screening Method Embodiments of the present disclosure also include screening assays configured to identify agents for use in the methods of the present disclosure, for example, as outlined above. Embodiments of the present disclosure include methods for screening candidate agents for the ability to inhibit influenza A virus in cells. In some cases, the method includes contacting a sample including viral RNA (vRNA) comprising a PSL2 motif with a candidate agent and determining whether the candidate agent specifically binds to the PSL2 motif. In some cases, an agent that specifically binds to a PSL2 motif treats a subject having an influenza A virus infection. In some cases, the method includes contacting a sample including viral RNA (vRNA) comprising a segment of influenza B genomic RNA with a candidate agent and determining whether the candidate agent specifically binds to the vRNA. In some cases, an agent that specifically binds to an HA motif treats a subject having an influenza B virus infection. By evaluating or determining is meant at least predicting that a given test compound has a desired activity, such that further testing of the compound in additional assays, such as animal models and / or clinical assays, may be desirable.

[0155] The candidate agent is selected from a small molecule, an oligonucleotide, an antibody, and a polypeptide. In some cases, the determining step includes detecting a cellular parameter, and a change in the parameter in the cell compared to a cell not contacted with the candidate agent indicates that the candidate agent specifically binds to the PSL2 motif. In some cases, the subject screening method is a method of RNA structure mapping, such as SHAPE analysis (selective 2'-hydroxyl acylation analyzed by primer extension). In particular cases, the candidate agent is an oligonucleotide.

[0156] Drug screening can be performed using in vitro models, genetically modified cells or animals, or purified PSL2 protein. Drug screening can identify ligands that compete with, modulate, or mimic the action of a lead drug. Drug screening identifies drugs that bind to specific sites in the PSL2 motif. A wide variety of assays can be used for this purpose, including labeled in vitro binding assays, electrophoretic mobility shift assays, immunoassays for protein binding, and the like. Knowledge of the three-dimensional structure of PSL2 derived from the structural studies described herein can also lead to the rational design of small drugs that specifically inhibit IAV activity.

[0157] The term "drug" as used herein describes any molecule, such as an oligonucleotide, protein, or pharmaceutical, that has the ability to bind to PSL2 and inhibit IAV. Generally, multiple assay mixtures are run in parallel at different drug concentrations to obtain differential responses to various concentrations. Typically, one of these concentrations serves as a negative control, i.e., at zero concentration or below the detection level.

[0158] Embodiments of the present disclosure also include screening assays configured to identify agents for use in the methods of the present disclosure, for example, as outlined above. Embodiments of the present disclosure include methods for screening candidate agents for their ability to inhibit coronavirus in cells. In some cases, the method includes contacting a sample containing viral RNA (vRNA) containing a conserved RNA secondary structure of a CoV with a candidate agent and determining whether the candidate agent specifically binds to the conserved RNA secondary structure motif. In some cases, an agent that specifically binds to the conserved RNA secondary structure motif treats a subject with a coronavirus infection. Evaluating or determining means at least predicting that a given test compound has a desired activity, such that further testing of the compound in additional assays, such as animal models and / or clinical assays, may be desirable.

[0159] Candidate agents encompass numerous chemical classes, such as oligonucleotides, antibodies, polypeptides, and organic molecules, e.g., small organic compounds having a molecular weight of more than 50 daltons and less than about 2,500 daltons. Candidate agents contain functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and typically contain at least an amine, carbonyl, hydroxyl, or carboxyl group, preferably at least two of the functional chemical groups. Candidate agents often contain cyclical carbon or heterocyclic structures and / or aromatic or polyaromatic structures substituted with one or more of the above functional groups. Candidate agents are also found among biomolecules, including peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs, or combinations thereof.

[0160] Candidate agents can be obtained from a wide variety of sources, including libraries of synthetic or natural compounds. Numerous means are available for the random and directed synthesis of a wide variety of organic compounds and biomolecules, including, for example, expression of randomized oligonucleotides and oligopeptides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant, and animal extracts are available or readily produced. Additionally, natural or synthetically produced libraries and compounds can be readily modified through conventional chemical, physical, and biochemical means and used to generate combinatorial libraries. Known pharmacological agents can be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, amidation, etc., to produce structural analogs. In certain embodiments, compounds of interest are those that cross the blood-brain barrier.

[0161] If the screening assay is a binding assay, one or more of the molecules can be conjugated to a member of a signal-producing system, such as a label, which can directly or indirectly provide a detectable signal. Various labels include, but are not limited to, radioisotopes, fluorescent substances, chemiluminescent substances, enzymes, specific binding molecules, particles, such as magnetic particles, etc. Specific binding molecules include pairs such as biotin and streptavidin, digoxin and antidigoxin, etc. For specific binding members, the complementary member is usually labeled with a molecule that provides detection according to known procedures.

[0162] Various other reagents may be included in the screening assay. These include reagents such as salts, neutral proteins (e.g., albumin), detergents, etc., used to promote optimal protein-protein binding and / or reduce nonspecific or background interactions. Reagents that improve assay efficiency, such as protease inhibitors, nuclease inhibitors, and antimicrobial agents, may be used. The component mixtures are added in any order that provides the required binding. Incubations are carried out at any suitable temperature, typically 4-40°C. Incubation periods are selected for optimal activity but can also be optimized to facilitate rapid, high-throughput screening. Typically, 0.1-1 hour is sufficient. [Example]

[0163] The following examples are presented to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention, nor are they intended to represent that the following experiments are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperatures, etc.), but some experimental error and deviation should be accounted for. Unless otherwise indicated, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Celsius, and pressure is at or near atmospheric. Standard abbreviations may be used, such as bp, base pairs; kb, kilobases; pl, picoliters; s or sec, seconds; min, minutes; h or hr, hours; aa, amino acids; kb, kilobases; bp, base pairs; nt, nucleotides; im, intramuscular; ip, intraperitoneal; sc, subcutaneous, etc.

[0164] Materials and Methods Cells and viruses: HEK293T and MDCK cells were obtained from American Type The virus was obtained from the Culture Collection (Manasass, VA) and maintained in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum and penicillin-streptomycin (Gibco). Influenza A / PR / 8 / 34 (PR8) H1N1 virus was generated using an eight-plasmid reverse genetic system. Tissue culture-adapted influenza A / Hong Kong / 8 / 68 (HK68) H3N2 virus was obtained from ATCC (ATCC-VR-1679). Viruses were grown and amplified in 10-day-old specific pathogen-free chicken embryos at 35°C (Charles River Laboratories, SPAEAS).

[0165] Plasmid construction and cloning: Plasmids containing wild-type PB2 segments from influenza viruses A / Puerto Rico / 8 / 34 (H1N1) [PR8], A / New York / 470 / 2004 (H3N2) [NY470], A / New York / 312 / 2001 (H1N1) [NY312], A / Brevigmission / 1 / 1918 (H1N1)

[1918] , A / California / 04 / 2009 (H1N1) [CA09], A / Vietnam / 03 / 2004 (H5N1) [VN1203], and A / Anhui / 1 / 2013 (H7N9) were used. For the generation of PR8 packaging mutant vRNAs, the Stratagene QuickChange XL site-directed mutagenesis kit (Stratagene) was used to mutagenize the pDZ plasmid containing the PB2 gene of PR8. The sequence of each mutant construct was confirmed by automated sequencing.

[0166] Reverse genetics and virus titration: Influenza A / Puerto Rico / 8 / 34 (PR8) virus was generated using an eight-plasmid reverse genetics system (Hoffman et al., 2000). Briefly, to produce recombinant PR8 virus, 10 6293T / MDCK cocultures of cells were transfected with 1 μg of each of eight segments contained within a plasmid utilizing a bidirectional dual POL I / II promoter system for simultaneous synthesis of genomic vRNA and mRNA using Lipofectamine 3000 (Invitrogen). Cells were harvested 24 h posttransfection and inoculated into the allantoic cavity of 10-day-old chicken embryos (Charles River, research-grade specific pathogen-free eggs). Rescue of recombinant viruses was assessed by hemagglutination activity. Each newly rescued virus was further plaque-titered, and mutations were confirmed by sequencing of the mutant gene. Plaque assays were performed on confluent MDCK cells as previously described (Szretter et al., 2006). Hemagglutination (HA) assays were performed at room temperature in 96-well round-bottom plates using 50 μl of virus dilution and 50 μl of a 0.5% turkey red blood cell suspension in phosphate-buffered saline (PBS).

[0167] Viral growth kinetics: The growth kinetics of PR8 virus was determined by inoculating 10-day-old chicken eggs with 100 plaque-forming units (PFU) of virus. 72 hours after inoculation, the virus titer in the allantoic fluid was determined by plaque titration on MDCK cells.

[0168] Isolation of packaged vRNA: To analyze packaged vRNA for PR8 mutant viruses, 10-day-old eggs were inoculated with approximately 1,000 PFU of recombinant virus and incubated for 72 hours. The allantoic fluid was harvested and the supernatant clarified by low-speed centrifugation. The clarified supernatant was then layered on a 30% sucrose cushion and ultracentrifuged at 30,000 RPM for 2.5 hours (Beckman Rotor SW41). The pelleted virus was resuspended in PBS and extracted with TRIzol (Invitrogen). The precipitated vRNA was resuspended in a final volume of 20 μl of 10 mM Tris-HCl (pH 8.0) and stored at -80°C.

[0169] qPCR analysis of packaged vRNA: Approximately 200 ng of extracted vRNA was reverse transcribed using a universal 3' primer (5'-AGGGCTCTTCGGCCAGCRAAAGCAGG) (SEQ ID NO: 97) and Superscript III reverse transcriptase (RT) (Invitrogen). The RT product was diluted 10,000-fold and used as a template for quantitative PCR (qPCR). Separate PCRs were then performed with segment-specific primers as previously described (Marsh et al., 2007). A 10 μl reaction mixture contained 1 μl of diluted RT product, 0.5 μM primer concentration, and SYBR Green ER dye, 200 μM deoxynucleoside triphosphates, heat-labile UDG, optimized SYBR Green Select Buffer, and SYBR Select Master Mix (Applied Biosystems), which contains AmpliTaq DNA Polymerase UP enzyme. Relative vRNA concentrations were determined by cycle threshold analysis, and total vRNA amounts were normalized by equalizing the levels of HA vRNA. The percentage of incorporation was then calculated relative to the level of wt vRNA packaging. Viral packaging results represent the mean level of vRNA incorporation ± standard deviation from two independent viral purifications; vRNA levels were quantified in triplicate (n = 6).

[0170] Mouse infection: Groups of 6-8 week-old female BALB / C mice (Jackson Laboratory) were lightly anesthetized with isoflurane and intranasally infected with 50 μl of 1000 PFU of wild-type mouse-adapted PR8 (H1N1) virus (ATCC), PB2 mutant PR8 recombinant virus, or sterile PBS. Animals were weighed daily and humanely sacrificed by day 10 or when weight loss exceeded 20%. All animal care and experimental procedures were in accordance with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals and approved by the Stanford University Administrative Panel on Laboratory Animal Care.

[0171] Design and preparation of locked nucleic acids (LNA): Oligonucleotides containing locked nucleic acids (LNA) were custom synthesized from Exiqon. Uppercase letters indicate LNAs. Lowercase letters indicate typical (unlocked) DNA nucleotides. All oligonucleotides contained phosphorothioate internucleoside linkages. LNAs were designed to be complementary to various sequences contained in the PSL2 structure of segment PB2. LNAs 8a and 9 were designed to contain a stretch of 6 to 8 DNA nucleotides for RNAse-H recruitment. The sequences of all LNAs are shown below. LNA1: 5'AccAaaAGaaT3' (SEQ ID NO: 67) LNA2: 5'TggCcATcaaT3' (SEQ ID NO: 68) LNA3: 5'TagCAtActtA3' (SEQ ID NO: 69) LNA4: 5'CCAAAAGA3' (SEQ ID NO: 70) LNA5: 5'CATACTTA3' (SEQ ID NO: 71) LNA6: 5'CagaCaCGaCCaaAA3' (SEQ ID NO: 72) LNA7: 5'TAcTtaCTgaCagCC3' (SEQ ID NO: 73) LNA8a: 5'AGAcagcgaccaaAAG3' - has RNase-H activity (SEQ ID NO: 188) LNA9: 5'TACTtactgacaGCC3' - has RNase-H activity (SEQ ID NO: 75) LNA9.2: 5'TACttactgacAGCC3' (SEQ ID NO: 76) LNA10: 5'ACCaaaagAAT3' (SEQ ID NO: 77) LNA11: 5'TGGccatcAAT3' (SEQ ID NO: 78) LNA12: 5'TAGcatacTTA3' (SEQ ID NO: 79) LNA13: 5'CgacCAaaAGaattC3' (SEQ ID NO: 80) LNA14: 5'CGACcaaaagaATTC3' (SEQ ID NO: 81) LNA15: 5'GaTGgCcATcaAttA3' (SEQ ID NO: 82) LNA16: 5'GATGgccatcaATTA3' (SEQ ID NO: 83) LNA17: 5'TcTAgCaTActTacT3' (SEQ ID NO: 84) LNA18: 5'TCTAgcatactTACT3' (SEQ ID NO: 85) LNA19: 5'GAAttcggatgGCCA3' (SEQ ID NO: 86) LNA20: 5'GGCCatcaattaGTG3' (SEQ ID NO: 87) LNA21: 5'TTCGgatggccaTCA3' (SEQ ID NO: 88) LNA22: 5'AGCCagacagCGA3' (SEQ ID NO: 89) LNA23: 5'GACAgccagacaGCA3' (SEQ ID NO: 90)

[0172] The following oligonucleotides were designed to cover single nucleotide polymorphisms (SNPs) in the PSL2 sequence. The following exemplary sequence is a modified version of LNA9 with a single mutation site that protects against several avian and bat strains whose PSL2 sequences contain nucleotide changes with the LNA9 target sequence. It should be understood that similar designs can be applied to any of the sequences described herein. LNA9.G74C: 5'TACTtactgacaGTC3' (SEQ ID NO: 94) LNA9.T80C: 5'TACTtaccgacaGCC3' (SEQ ID NO: 95) LNA19.U56C: 5'GGATttcggatggCCA3' (SEQ ID NO: 96)

[0173] Antiviral assay: LNAs were reconstituted in RNAse-free water at 100 μM, aliquoted, and stored at −20°C before single use. LNAs were transfected into cells using Lipofectamine 3000 (Life Technology) at final concentrations of 1 μM, 100 nM, 10 nM, and 1 nM according to the manufacturer's protocol. For preventative antiviral assays, LNAs were transfected into cells at 10 μM, 100 nM, 10 nM, and 1 nM 24 h before transfection with the indicated LNAs. 6 MDCK cells were seeded in 6-well plates. The cells were then infected with PR8 (H1N1) or HK68 (H3N2) virus at an MOI of 0.01 4, 2, or 1 hour after transfection. After infection, for therapeutic antiviral evaluation, MDCK cells were infected with PR8 or HK68 as described. LNAs were then transfected 4, 2, or 1 hour after infection. 48 hours after infection, supernatants were collected, and virus titers were determined by plaque assay.

[0174] Cellular SARS-CoV-2 replication assay: For the cell replication assay, LNA ASOs were reconstituted in RNase-free water at a 100 μM stock solution, aliquoted, and stored at -20°C prior to single use. One day before transfection, Huh-7, Vero E6, or ACE-A549 cells were seeded into 96-well clear-bottom plates at 60–70% confluency at the time of treatment with LNA ASOs or scrambled LNAs. LNA ASOs were transfected into cells at a final concentration of 25 nM or 100 nM using Lipofectamine 3000® (Life Technologies) according to the manufacturer's protocol. Cells were then infected with a SARS-CoV-2 reporter virus expressing nanoluciferase (SARS-CoV-2 nLUC) at an MOI of 0.3 for 1 hour, after which the virus was removed and fresh medium was added. Recombinant SARS-CoV-2 nLUC is an authentic, fully replicating virus in which ORF7 has been deleted and replaced with nLUC. Therefore, measuring nLUC expression is a surrogate marker of viral replication that allows for the screening of antiviral compounds.

[0175] In vitro transcription of vRNA: For each wild-type isolate (PR8, 1918, VN1203, NY470, NY312, CA09, and A / Anhui / 1 / 2013 H7N9) and PR8 packaging mutant clone, PB2 cDNA was amplified from the plasmid using segment-specific primers under the T7 promoter. The amplified cDNA was gel-purified using an Invitrogen DNA Gel Kit. vRNA was then generated by in vitro transcription using T7-MEGAscript. vRNA for SHAPE was purified using MEGAclear (Thermofisher, catalog no. AM1908), and purity and length were verified by capillary electrophoresis.

[0176] sf-SHAPE analysis of vRNA: PB2 vRNA was folded in 100 mM HEPES (pH = 8) (100 mM NaCl, 2.5 mM MgCl, 65°C for 1 min, room temperature cooling for 5 min, 37°C for 20–30 min). Acylation with NMIA (Wilkinson et al., 2006) for 2 min and reverse transcription (RT) primer extension were performed at 45°C for 1 min, 52°C for 25 min, and 65°C for 5 min, as previously described (Mortimer and Weeks, 2009). 6FAM was used for all labeled primers. Exceptions to these protocols were: (i) RNA was lysed rather than ethanol precipitated; Post-acylation RNA purification was performed using C&C columns (Zymo Research); (ii) the mixture was allowed to stand at room temperature for 2–5 min before and after adding SHAPE primer buffer, significantly enhancing RT transcription yields; (iii) DNA purification was performed using Sephadex G-50 size-exclusion resin in a 96-well format, followed by concentration by vacuum centrifugation to more significantly remove primers; and (iv) 2 pmol of RNA was used in a ddGTP RNA sequencing reaction.

[0177] An ABI 3100 Genetic Analyzer (50 cm capillary filled with POP6 matrix) was set to the following parameters: voltage 15 kV, T = 60°C, injection time = 15 s. Using the GeneScan program, data were acquired for each sample consisting of purified DNA resuspended in 9.75 ul of Hi-Di formamide with 0.25 ul of ROX500 internal size standard (ABI catalog 602912). PeakScanner parameters were set to the following: smoothing = none, window size = 25, size calling = local Southern, baseline window = 51, and peak threshold = 15. Fragments 250 and 340 were computationally excluded from the ROX500 standard (Akbari et al., 2008). Data from PeakScanner were then processed into SHAPE data using a custom program (Pang et al., 2011), FAST (Fast Analysis of SHAPE Traces). FAST uses a ddGTP ladder as an external sizing standard and a local Southern blot to automatically correct signal differences due to handling errors, adjust for signal attenuation, and convert fragment lengths to nucleotide positions (Pang et al., 2011 and Pang et al., 2012).

[0178] RNAstructure parameters: Slope and intercept parameters of 2.6 and -0.8 kcal / mol were initially tried, as suggested (Deigan et al., 2009), and smaller intercepts closer to 0.0 kcal / mol (e.g., approximately -0.3) were found to produce fewer optimal structures (within a maximum energy difference of 10%). This slight parameter difference may be due to the accurate fitting achieved between the experimental and reference datasets by the automated FAST algorithm. In the current implementation, FAST is integrated into RNAstructure, which requires Microsoft Foundation Classes (MFC). RNA structures were drawn and colored using RNAViz2 (De Rijk et al., 2003), and finalized in Adobe Illustrator.

[0179] Construct design, RNA synthesis, and chemical modification for mutation and mapping experiments: Double-stranded DNA templates were prepared by automated PCR assembly of DNA oligomers designed by MATLAB (NA_Thermo, available at "https: / / github.com / DasLab / NA_thermo") as previously described (Kladwang and Cordero et al., 2011). Constructs for mutation and mapping (M 2 ) contains all single mutations relative to their Watson-Crick counterparts. Compensatory mutations for mutation / rescue were designed based on base pairing in the proposed secondary structure (Tian et al., 2014). In vitro transcription reaction, RNA purification, and quantification steps were as previously described (Kladwang and Cordero et al., 2011). One-dimensional chemical mapping, mutation, and map (M 2), and mutation / rescue were performed in a 96-well format as previously described (Kladwang and VanLang et al., 2011; Kladwang and Cordero et al., 2011; Cordero et al., 2013). Briefly, RNA was heated and cooled to remove secondary structural heterogeneity, then properly folded and incubated with SHAPE reagent (5 mg / mL 1-methyl-7-nitroisatoic anhydride (1M7)) (Mortimer and Weeks, 2007). The modification reaction was quenched, and RNA was recovered using poly(dT) magnetic beads (Ambion) and FAM-labeled Tail2-A20 primer. RNA was washed twice with 70% ethanol (EtOH) and resuspended in ddH2O. Subsequently, reverse transcription to cDNA was performed, followed by heated NaOH treatment to remove RNA. The final cDNA library was recovered by magnetic bead separation, rinsed, eluted in Hi-Di formamide (Applied Biosystems) using a ROX-350 ladder, and loaded onto a capillary electrophoresis sequencer (ABI3100). Data processing, structural modeling, and data deposition: CE data were analyzed using the HiTRACE software package version 2.0 (both a MATLAB® toolbox and a web server are available (Yoon et al., 2011; Kim et al., 2013)). Trace alignment, baseline subtraction, sequence assignment, profile fitting, decay correction, and normalization were accomplished as previously described (Kim et al., 2009; Kladwang et al., 2014). Sequence assignment was performed manually with validation from the sequencing ladder. Data-driven secondary structure models were obtained using the Fold program in the RNAstructure package version 5.4 (Mathews et al., 2004) with pseudo-energy gradient and intercept parameters of 2.6 kcal / mol and -0.8 kcal / mol. 2The two-dimensional Z-score matrix and helix-wise bootstrapping confidence values ​​for the dataset were calculated as previously described (Tian et al., 2014; Kladwang and VanLang et al., 2011). The Z-score matrix was used as a base-pair-wise pseudo-free energy with slopes and intercepts of 1.0 kcal / mol and 0 kcal / mol. Secondary structure images were generated by VARNA (Darty et al., 2009). All chemical mapping datasets, including one-dimensional mapping, mutations and maps, and mutation / rescue, have been deposited in the RNA Mapping Database (http: / / rmdb.stanford.edu) (Cordero et al., 2012).

[0180] SHAPE analysis of LNA-targeted vRNA: DNA templates of PR8 segment PB2 were prepared by PCR assembly of DNA oligomers, and the in vitro transcription reaction, RNA purification, and quantification steps were performed as previously described (Kladwang and VanLang et al., 2011). One-dimensional SHAPE chemical mapping was performed in a 96-well plate format as described above, with the following exceptions: RNA was denatured and refolded as described, and 100 nM of each prepared LNA was added to the folded RNA and incubated with 5 mg / mL of SHAPE reagent 1M7 (1-methyl-7-nitroisatoic anhydride). Modification quenching, RNA recovery, resuspension, reverse transcription, cDNA sequencing, and data processing were performed as described (Kladwang and VanLang et al., 2011).

[0181] Example 1: SHAPE characterization of the IAV segment PB2 packaging signal identifies a conserved structure. We applied selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) and computational modeling to the IAV segment PB2 genomic vRNA to search for structured RNA domains. In vitro-transcribed full-length (-)-sense PB2 vRNA from strain A / Puerto Rico / 8 / 1934 (H1N1) "PR8" was examined using electrophilic SHAPE reagents, which fold in solution (Pang, 2011) and preferentially react with nucleotides present in a flexible, single-stranded state (Wilkinson et al., 2006) (Figure 1). This analysis revealed that much of the 2341-nt vRNA is largely unstructured (Figure 2). This is consistent with recent bioinformatics studies that found greater RNA secondary structure conservation in (+)-sense than in (-)-sense RNA for all segments, including PB2 (Priore et al., 2012; Moss et al., 2011). These previous studies did not analyze the terminal coding region (TCR) and instead stopped 80 nucleotides short of the PB2 5'TCR end. SHAPE-guided modeling suggested several sections of this region containing stable RNA secondary structures, most notably nucleotides 34–87 ((-) sense notation), a stem-loop motif designated herein as packaging stem-loop 2 (PSL2) (Figure 1A). This segment, through mutational analysis, contained a set of nucleotides previously implicated in PB2 packaging via an unidentified mechanism (Figure 1A–1B, see circled nucleotides) (Gao et al., 2012; Marsh et al., 2008; Liang et al., 2008; Gog et al., 2007). Supporting the hypothesis that these previous mutations act through disruption of PSL2 structure, SHAPE analysis of mutants revealed that all resulted in distinct conformations that abrogated wild-type PSL2 structure (Figure 1C, Figure 3). The 60-nucleotide region encompassing PSL2 exhibits nearly 100% sequence conservation at the single-nucleotide level between seasonal and pandemic strains of different subtypes and species origins (Fig. 4 ), suggesting the existence of strict biological requirements for maintaining an intact PSL2 structure.Because different downstream sequences within PB2 vRNA can alter the secondary structure of PSL2, we explored the structural conservation of PSL2 by performing SHAPE analysis on full-length wild-type PB2 vRNA isolated from various IAV strains and subtypes, including the highly pathogenic avian H5N1 and pandemic 1918 H1N1 strains. Despite the presence of two divergent nucleotides within the stem-loop and significant divergence in the flanking sequences, the PSL2 stem-loop structure was recovered in SHAPE-guided modeling of PB2 RNA across these diverse species and subtypes (Figures 1D–1F).

[0182] Figures 1A-1F show SHAPE chemical mapping performed on full-length (-)-sense wild-type PB2 vRNA. Color indicates SHAPE reactivity, which is proportional to the probability that a nucleotide is single-stranded. All structures are truncated to highlight the 5'-end sequence structure. ΔG free energy values ​​of the determined structures were generated by the RNAstructure modeling algorithm using the SHAPE pseudo-free energy parameter. (Figure 1A) Wild-type PB2 RNA secondary structure from strain A / Puerto Rico / 8 / 1934 "PR8" (H1N1). Color-coded circles correspond to nucleotide sites where synonymous mutations have been reported to affect PB2 packaging (Gao et al., 2012; Marsh et al., 2011). (Figure 1B) Packaging efficiency of the synonymous mutants in (Figure 1a) as determined by qPCR. Results were performed in triplicate. Error bars = ±SD. The boxes below indicate the mutant names and the corresponding mutational changes. Nucleotide numbering is shown in the genomic (-)-sense direction. (Figure 1C) SHAPE-determined structures of PB2 packaging-defective mutant vRNAs, m757 (G44C) and m745 (A80U). Black boxes indicate synonymous mutations. (Figures 1D-1F) SHAPE-determined structures of wild-type PB2 from pandemic and highly pathogenic strains, including different subtypes: (Figure 1D) 1918 pandemic (A / Brevigmission / 1 / 1918(H1N1)), (Figure 1E) highly pathogenic avian (A / Vietnam / 1203 / 2004(H5N1)), and (Figure 1F) 2009 pandemic "swine" (A / California / 04 / 2009(H1N1)).

[0183] Figure 2, panels A-B, show the SHAPE reactivity of full-length PB2 vRNA. (Figure 2, panel A) Average SHAPE reactivity as a function of nucleotide position (window bin size = 100 nt) for full-length (-)sense PB2 vRNA from IAV strain A / Puerto Rico / 8 / 1934 (H1N1). The PSL2 region (highlighted in blue, nt 34-86) encompasses the 5' packaging signal domain, which has a high density of conserved codons at the third position and has one of the lowest SHAPE reactivities within vRNA. The region following PSL2 is relatively unstructured but still contains another potential site for the presence of RNA structure, nucleotides 1400-1500. Interestingly, this second internal region was also predicted to contain structural elements by a 2011 bioinformatics study (Reference 19). (Figure 2, panel B) Zoomed-in view of the PSL2 region from (Figure 2a). Window bin size = 10 nt.

[0184] Figures 3A-3E show that packaging-deficient mutations disrupt wild-type SHAPE reactivity. Left: Mutant SHAPE reactivity plotted as a change relative to WT. Nucleotide numbering starts from the 5' end of the (-)sense vRNA. Orange bars indicate the site of mutation. Energy values ​​represent the ΔG free energy of the predicted structure generated by the RNA structure modeling algorithm using SHAPE pseudo-free energy parameters. Right: SHAPE-determined structure of the full-length (-)sense mutant PB2 vRNA from the PR8 strain (H1N1). Images are truncated and the 5' end region is highlighted. (Figure 3A) Wild-type. Packaging-deficient mutants: (Figure 3B) m744b (AG83, 85UA). (Figure 3C) m745 (A80U). (Figure 3D) m55c (CU35, 36UC). (Figure 3E) m757 (G44C).

[0185] Figure 4 shows the conservation of nucleotide sequences containing the PSL2 structure. Graphical representation of nucleic acid sequence alignment across various influenza A virus subtypes and strains ("weblogo." followed by "berkeley" followed by ".edu"). The overall height represents the sequence conservation at that nucleotide position, and the height of the symbols within each position indicates the relative frequency of each nucleotide at that site. Black box = PSL2 region. Sequences included in the alignment: highly pathogenic A / Brevig Mission / 1 / 1918 (H1N1), pandemic "swine flu" A / California / 04 / 2009 (H1N1), modern human A / New York / 470 / 2004 (H3N2), human A / Puerto Rico / 8 / 1934 (H1N1), highly pathogenic avian A / Vietnam / 03 / 2004 (H5N1), human A / Hong Kong / 8 / 1968 (H3N2), and human A / New York / 312 / 2001 (H1N1). RNA nucleotides are numbered in the (-) sense direction. Sequence alignment of the terminal 5' region of PB2 corresponding to the above sequences. Shaded blue boxes encompass PSL2 RNA secondary structure elements. Black dots indicate nucleotide positions of divergence.

[0186] Mutate and map strategy validates PSL2 structure and predicts novel packaging variants To further test the SHAPE analysis of PSL2 RNA structure and identify additional beneficial mutations required for in vivo testing, multidimensional chemical mapping (Kladwang and Das, 2010) methods were applied to the PSL2 segment. First, mutations and maps (M 2 ) measurements confirmed the disruption of chemical reactivity patterns upon systematic mutation of each stem residue (Figure 5A, see annotated regions), including changes at nucleotides previously found to be important for PB2 packaging (Marsh et al., 2008; Gog et al., 2007). 2Automated computational analysis based on the data recovered the SHAPE-induced PSL2 structure with high confidence (Figure 1C, Figure 3, Figure 5B-5D), further validating the structural model. Second, as a predictive test, we designed compensatory mutations to restore base pairs in the wild-type stem-loop structure disrupted by the initial packaging-defective mutation (Figure 6, panels A-B). These mutant rescuers indeed restored the PSL2 SHAPE pattern, providing base pair resolution for in vitro validation of the modeled structure and suggesting sequence variants for testing the role of PSL2 structure in vivo.

[0187] Figures 5A-5D show two-dimensional mutation and map (M2) analysis of the PSL2 RNA secondary structure. (Figure 5A) Systematic single-nucleotide mutation and resulting chemical accessibility mapping reveal interactions in the RNA's three-dimensional structure. Chemical accessibility plotted in grayscale (black = highest SHAPE reactivity) across 88 single mutations at single-nucleotide resolution in the PSL2 element from strain PR8 PB2. Reactivity peaks (left to right) correspond to nucleotides from the 5' to 3' ends of the PB2 RNA. Nucleotide sites corresponding to known packaging mutations (reported by Marsh et al., 2008) are indicated in blue on the right. Red arrows indicate significant packaging-defective mutation sites predicted by M2 analysis. (Figure 5B) Strong features of the mutation and map data were isolated by Z-score analysis (the number of standard deviations from the mean value at each residue). A Z-score was calculated for each nucleotide reactivity by subtracting the average reactivity of this nucleotide across all mutants and dividing by the standard deviation (output _Zscore_from_rdat in HiTRACE). Squares indicate secondary structure models derived from mutation and map data. Dark signals highlight evidence of structured nucleotide pairing. (Figure 5C) RNA secondary structure of the 5' packaging signal region (nt 30-93) derived from incorporating Z-scores into the RNA structure modeling algorithm: Bootstrap confidence estimates are given as percentage values ​​in green. Bootstrap values ​​provide a numerically accurate indicator of structural reliability. Low bootstrap confidence values ​​suggest the presence of alternative structural models. (Figure 5D) Bootstrap support values ​​for each base pair are shown as grayscale shading.

[0188] Figure 6 shows the design of compensatory mutations for the PR8 PB2 mutants described above. (Figure 6, Panel A) The synonymous mutants (m757, m745, and m55c) described above are mapped to the PSL2 structure. (Figure 6, Panel B) Compensatory mutations (m55c-comp, m745-comp, and m757-comp) were designed at sites predicted to restore wild-type PSL2 structure based on SHAPE and mutational and map chemistry analysis. Black boxed nucleotides indicate the sites of compensatory mutations. (-) Sense vRNA orientation is indicated. For mutations that required nonsynonymous changes to restore structure, the changes in the encoded protein sequence are shown.

[0189] To test whether the PSL2 stem-loop structure observed in solution is relevant to viral packaging in the cellular environment, we analyzed the same nine synonymous mutations reported by Gog et al., 2007 and Marsh et al., 2008 (Figures 1A-B, Figure 7, panel A), as well as the M 2 The four new synonymous mutations characterized by the analysis (Figure 7, panel B) were cloned into the pDZ plasmid containing the PR8 PB2 gene (Marsh et al., 2008; Liang et al., 2008; Gog et al., 2007) (Figure 8). The packaging efficiency of the nine known mutants in the current PR8 background was significantly higher than that of the WSN33 virus. 15 (Figure 7, panel C). Of these, mutants m55c, m757, m745, and m744b were predicted to exhibit the most significant impairment based on their location within the stem region of PSL2 (Figure 1C, Figures 3A-3F, Figure 7). In contrast, published mutations that do not affect PB2 packaging (e.g., m731) mapped to unstructured apical loops or fell outside PSL2 and did not alter its structural integrity (Figure 9A) (Marsh et al., 2008). 2Analysis identified three novel synonymous mutants (m74-1, m74-2, and m68) with significant effects on in vitro PSL2 structure (Figure 5A) that showed significant losses in PB2 packaging, whereas mutation sites that resulted in negligible changes in SHAPE reactivity compared to the wild-type PSL2 structure resulted in wild-type-like packaging efficiency levels (e.g., m56) (Figure 7, panel D).

[0190] Figure 7 shows synonymous mutations at a highly conserved single codon in PR8 PB2 vRNA. (Figure 7, Panel A) Previously published synonymous mutations involved in PB2 packaging. The top row is the parent PR8 vRNA sequence ((+)-sense orientation), and the mutated single nucleotide is bolded in red in the bottom row. The numbering and nomenclature of the introduced mutations are based on those reported by Marsh et al., 2008 and Gog et al., 2007. The yellow-highlighted region indicates the sequence containing the PSL2 structure. (Figure 7, Panel B) Design of primer sequences for cloning synonymous mutations identified from M2 analysis (see Supplementary Figure 4a) into the pDZ plasmid. Sequences are in the (+)-sense orientation. Highlighted nucleotides represent mutation sites. (Figure 7, Panels C-D) (Figure 7, Panel C) Packaging efficiency, which represents the ratio of mutant PB2 packaging to parent wild-type PB2 for previously published synonymous mutants, and (Figure 7, Panel D) M2 analysis identified synonymous mutants. Results from two independent experiments, assays were performed in triplicate (n=6). Error bars indicate the mean ± SD.

[0191] Figure 8 shows the nomenclature of PB2 packaging mutants and the corresponding mutation sites. A mutation nomenclature chart showing 1) previously published synonymous mutations involved in PB2 packaging (shown in blue) based on the reports of Marsh et al., 2008 and Gog et al., 2007, and 2) the names and sites of mutations from PSL2 structural design single mutants (shown in black) and double compensatory mutants (shown in red). The numbering and nomenclature of the introduced mutations are based on the genomic, (-)sense vRNA. Examples where mutations result in changes in protein coding are indicated by synonymous (SYN) or nonsynonymous (non-SYN) regions.

[0192] Figures 9A-9C show the effect of synonymous mutations on PSL2 structure. Left: Predicted RNA secondary structures of PB2 packaging mutants determined by sf-SHAPE analysis on full-length (-)sense PB2 vRNA from strain PR8. For clarity, the wild-type structure is shown in the box in the upper right corner. Right: SHAPE reactivity graphs are shown as the change in mutant reactivity relative to the wild-type. Energy values ​​and percent packaging efficiency are shown in the figure captions below. Mutants: (Figure 9A) m731. (Figure 9B) m751. (Figure 9C) m748. The percent packaging efficiency of PB2 integration for each of the aforementioned mutants is highlighted in blue.

[0193] Consistent with the proposed hierarchical role of PB2 in IAV packaging, compensatory mutations rescued viral packaging not only in segment PB2 (Figure 10, panels A–C; Figure 6, panels A–B) but also in other segments previously reported to be affected by deleterious mutations (Muramoto et al., 2006; Gao et al., 2012; Marsh et al., 2008) (Figure 10, panels D–F). In addition to restoring PB2 packaging, compensatory mutations resulted in complete or near-complete rescue of the viral titer loss caused by deletion mutations (Figure 10, panels G–I). Some nonsynonymous compensatory mutations were able to restore PB2 packaging better than others (m745-comp and m55c-comp compared to m757-comp) (Figure 10, panels A–C), likely reflecting incomplete restoration of PB2 protein function via exogenous addition. Some nonsynonymous mutations affected both PSL2 structure and protein sequence, thus requiring exogenous addition. The most penetrating test of PSL2 structure came from packaging experiments that did not require the addition of supplemental wild-type PB2 protein. Based on computational enumeration and multidimensional mutation rescue experiments (Tian et al., 2014), a single mutation rescue pair was discovered (m52 / m65, Figure 11, panels A-B; Figure 12, panels s; Figure 13) that is both synonymous and obviates the need for the addition of wild-type PB2 protein. Creating each mutation alone (m52 and m65) resulted in packaging efficiencies of PB2 incorporation below 4% and a 4-log 10 Losses in titer exceeding 2 log , previously reported for packaging-defective viruses (i.e., 2 log ). 10 ) (Figure 11, panels C-D; Figure 7, panel c; Figure 10). When introduced together into the double mutant m52 / 65-comp strain that restored PSL2 structure, the compensatory mutations restored both packaging efficiency and virus titer to wild-type levels, despite the altered sequence.

[0194] Figure 10, panels A–I, show the effects of compensatory mutations in PR8 PB2 packaging-deficient mutants on virus packaging and titer. (Figure 10, panels A–C) Packaging efficiency of packaging-deficient and compensatory mutant PB2 vRNA. For compensatory mutations requiring nonsynonymous changes, a wild-type PB2 protein expression plasmid was cotransfected during virus rescue. pWT = expression plasmid encoding wild-type PR8 PB2 protein. Values ​​given as the percentage of PB2 vRNA packaging compared to the wt parental PR8 virus. Results from two independent experiments; assays were performed in triplicate (n=6). (Figure panels D–F) Packaging efficiency of packaging-deficient and compensatory mutant viruses and their effects on packaging of other interacting segments, PB1, PA, NP, and MX. Assays were performed in triplicate (n=6). (Figure 10, panels G–I) Virus titer by plaque assay. Results are in PFU / mL; assays were performed in triplicate.

[0195] Figure 11 shows that multidimensional chemical mapping reveals novel PB2 packaging defect and compensatory mutation partners. (Figure 11, panel A) Electropherogram results from systematic single-nucleotide mutation mapping followed by rescue analysis of individual and compensatory double mutations (mutation map rescue) to test base pairing from 1D data-guided models and identify predicted successful synonymous PSL2 defect and compensatory mutant pairs. Chemical accessibility plotted in grayscale (black = highest SHAPE reactivity) across 88 single mutations at single-nucleotide resolution in the PSL2 element from strain PR8 PB2. Reactivity peaks (from left to right) correspond to nucleotides from the 5' to 3' ends of the PB2 RNA. For a complete list of mutation rescue pairs, see Figure 12. (Figure 11, panel B) Mutation design of single mutants m52 (G52U) and m65 (C65A) on the PSL2 structure, as well as the double m52 / 65 rescue pair. (Figure 11, panel C) Packaging efficiency of mutation and rescue pairs of synonymous single and double mutants. Values ​​given as percentage of PB2 vRNA packaging compared to the wt parental PR8 virus. Results from two independent experiments; assays were performed in triplicate (n=6). (Figure 11, panel D) Virus titer in PFU / mL, triplicate results. Error bars indicate mean ± SD.

[0196] Figure 12, panels a-t, show two-dimensional mutation map rescue (M2R) analysis. Mutation / rescue results validate the PSL2 RNA secondary structure. Electropherograms of SHAPE analysis using compensatory double mutations to test base pairing from 1D data-guided models and identify successful PSL2 deletion and compensation mutant pairs. Chemical accessibility plotted in grayscale (black = highest SHAPE reactivity) across 88 single mutations at single-nucleotide resolution in the PSL2 element from PR8 strain PB2. For each tested pairing, wild type, single mutant 1, single mutant 2, and a "quartet" of compensatory double mutants are grouped for comparison. (Figure 12, panels a-r) Nonsynonymous mutation and rescue pairs. All electropherograms without boxes are pairings where disruption and / or rescue was not observed. Blue boxes indicate successful deletion and rescue mutations. (Figure 12, panels 1-3) Double synonymous mutation and rescue pairs. Green boxes indicate successful synonymous deletion and rescue pairs. (Figure 12, panel t) Packaging efficiency of nonsynonymous mutations and rescue pairs. Values ​​given as percentage of PB2 vRNA packaging compared to the wt parental PR8 virus. Results from two independent experiments; assays were performed in triplicate (n=6). Error bars represent ±SD.

[0197] Figure 13 shows the design of primer sequences for two-dimensional mutation map rescue (M2R) mutants. From top to bottom, SEQ ID NOs: 28-43. Primer sequences used for QuickChange mutation cloning of M2R mutants into the pDZ plasmid. Sequences are in the (+) sense orientation. The left region indicates synonymous (Syn.) or nonsynonymous (Non-syn.) changes. Highlighted nucleotides = mutation site. The boxed mutant primer set indicates the double synonymous mutant partners, m52 and m65.

[0198] To test the relevance of PSL2 structure in an in vivo model, 6- to 8-week-old BALB / C mice were inoculated intranasally with 1000 PFU of wild-type PR8 virus or strains carrying mutations predicted to disrupt or restore PSL2 structure. Mice infected with the PSL2-disrupting m745 mutant strain (20% packaging efficiency) or the severely packaging-defective single mutant virus, m52 (<4% packaging efficiency), showed reduced or absent clinical signs of disease, either in terms of weight loss or survival, compared with PBS controls (Figure 14, panels A-B). Notably, inclusion of compensatory mutations restoring PSL2 structure rescued viral pathogenicity. Animals infected with m52 / 65-comp and m745-comp exhibited mortality profiles and survival curves comparable to those of mice infected with wild-type PR8 (Figure 14, panels A-B). Consistent with APLAC guidelines, all mice were humanely sacrificed when they reached a weight loss of more than 20%.

[0199] Figure 14, panels A-B, show that packaging-defective viruses decay in vivo. Percent weight loss and percent survival of mice infected with single PSL2-disrupted and compensatory PSL2-restoring double mutant viruses. Six- to eight-week-old BALB / C female mice were infected intranasally with 1000 PFU of PR8 wild-type (wt) virus, packaging-defective single mutant viruses m52 and m745, compensatory double mutant viruses m52 / 65 and m745-comp, or a PBS control. Mice were monitored daily for percent weight loss and percent survival relative to day 0. Results are presented as the average of two independent experiments with six mice per condition. (Figure 14, panel A) Percent weight loss. (Figure 14, panel B) Kaplan-Meir survival plots of individual cohorts shown in (Figure 14, panel A).

[0200] Example 2: Therapeutic design and targeting of PSL2 constructs inhibits IAV infection in vitro and in vivo. To explore the therapeutic potential of targeting PSL2-mediated viral packaging, nine locked nucleic acids (LNAs) containing phosphorothioate internucleoside linkages (Vester and Wengel, 2004) were designed against key residues predicted to disrupt the overall RNA secondary structure of the element, thereby inhibiting viral production (Figure 15, panel A). Two of the designed LNAs, LNA8a and LNA9, are identical in sequence to LNA6 and LNA7, respectively, but contain six to seven unmodified (unlocked) DNA nucleotides optimized for RNase-H activation (see, e.g., LNA6 / 8-RNaseH and LNA7 / 9-RNaseH, respectively). First, to assess the effect of LNA binding on PSL2 RNA secondary structure, we analyzed PB2 in the presence of LNAs. Toeprinting and SHAPE chemical mapping were performed on the vRNA. In support of the antiviral assay results, the sequence encoded by LNAs 6-9 showed the greatest ability to bind and disrupt the wild-type PSL2 structure (Figure 16).

[0201] Figure 15, panels A-D, show that locked nucleic acids targeting the PSL2 RNA structure exhibit potent antiviral activity in vitro and in vivo. (Figure 15, panel A) Location of complementary locked nucleic acids (LNAs) designed against various regions of the PSL2 structure. (Figure 15, panel B) To screen LNAs for antiviral activity, MDCK cells were pretreated with 100 nM of each indicated LNA for 1 hour by Lipofectamine transfection before infection with either PR8 (H1N1) virus or A / Hong Kong / 8 / 68 (H3N2) virus at an MOI of 0.01. Forty-eight hours after infection, supernatants were collected, and viral titers were determined by plaque assay. Results from two independent experiments were performed in triplicate (n=6). (Figure 15, panel C) Time course of pretreatment (RX) versus postinfection treatment with LNA9 at titrated concentrations (100 nM, 10 nM, 1 nM). WT+Lipo = infection with Lipofectamine control. Pretreatment: Confluent MDCK cells in 6-well plates were treated with LNA9 either 2 or 4 hours before infection. The treated supernatant was removed at the indicated time points, and the cells were infected with wtPR8 virus at 0.01 MOI for 1 hour. For post-infection treatment: MDCK cells were infected with PR8 virus at 0.01 MOI for 1 hour, after which the supernatant was replaced and the cells were treated with LNA9 either 2 or 4 hours after infection. Supernatants were collected 48 hours later, and virus titers were determined by plaque assay in triplicate. Figure 15, panel d, shows the effect of intranasal LNA treatment on the survival of virus-infected mice. Mice were intranasally administered 20 μg of LNA9, scrambled LNA, or PBS (uninfected control) 12 hours before infection with PR8 virus. All mice received two additional treatments at 8 hpi and 36 hpi (n=7 mice per condition).

[0202] As shown in Figure 15, panels A-D, the sequence tag "LNA8" refers to, for example, the sequence LNA8a (SEQ ID NO: 188) described herein. Additionally, in Figure 15, panels A-D, Figure 16A, and Figure 16B, LNA6 / 8 refers to, for example, the sequences LNA6 (SEQ ID NO: 72) and LNA8a (SEQ ID NO: 155) described herein.

[0203] Figures 16A-16B show SHAPE analysis of LNA-RNA binding. (Figure 16A) Electrophoretic profiles of SHAPE analysis performed on LNAs 1, 2, 4, 5, 6 / 8a, and 7 / 9 (100 nM) in the presence of PR8 PB2 vRNA. S1, a small molecule that interacts with Hepatitis C virus IRES RNA, was added as a control for RNA binding. Left column: unlabeled reaction without SHAPE reagent 1M7. Right: with labeling reagent. (Figure 16B) Electrophoretic profiles of SHAPE performed on LNA-vRNA combinations at titrated concentrations of LNA. For each LNA, the left set of columns is without labeling reagent.

[0204] In a first pilot experiment to determine the antiviral potential of LNA-mediated targeting of PSL2 across two different IAV subtypes, MDCK cells were pretreated with 100 nM of each LNA prior to infection with either wild-type PR8 (H1N1) virus or tissue culture-adapted A / Hong Kong / 8 / 68 (HK68) (H3N2) virus at an MOI of 0.01, delivered via Lipofectamine™ transfection for 1 hour. Forty-eight hours after infection, supernatants were collected and virus production was measured by plaque assay (Figure 15, panel B). LNAs directed solely against the upper loop of PSL2 (LNA1, LNA4) had little or no effect on virus titers. Similarly, LNA3 and LNA5, which target the 3' base of PSL2, also did not inhibit virus production. In contrast, nucleotide coverage of both the upper loop and mid-bulge by LNA6 was reduced by 2 log for PR8. 10This resulted in a loss of titer of more than 1000 (Figure 15, panels A-B). LNA8a, an RNase-H-activated copy of LNA6, produced even greater antiviral activity against both viruses, up to 3 logs. Most strikingly, LNA9, an RNase-H-activated copy of LNA7, possessed the most potent antiviral capacity, reducing virus production by nearly 5 logs and 4 logs against PR8 and HK68, respectively.

[0205] After identifying the optimal candidate LNA, we further investigated the treatment time course and concentration parameters of LNA9's antiviral activity. MDCK cells were treated with one dose of 10-fold diluted LNA9 either 2 or 4 hours before infection, or alternatively, 2 or 4 hours after infection with wild-type PR8 virus at an MOI of 0.01. Cells pretreated with LNA had the most potent antiviral response (>4 logs), and even the lowest dilution (1 nM) showed potent virus inhibition (>2 logs) (Figure 15, panel C). While there was a trend toward decreased antiviral activity with increasing postinfection treatment time, >3 logs of virus titer suppression was still achieved at the latest tested time point.

[0206] Example 3: In vivo efficacy studies: Extended single-dose prophylaxis Balb / C female mice (5 mice / group) were intranasally pretreated with a single dose of 20 μg LNA9 either 3 days (day -3) or 1 day (day -1) prior to infection with a lethal dose of wild-type PR8 virus. Mice were monitored daily for weight loss, clinical score, and survival. Figure 17, panel A, shows the percent survival of mice over time. Figure 17, panel B, shows the percent weight loss over time post-treatment.

[0207] A single dose of 20 μg of LNA9 administered three days prior to infection completely protected mice from fatal influenza disease. Untreated control mice were humanely sacrificed after an average of 5.5 days, when they had lost more than 25% of their body weight. In contrast, the pre-treated group showed minimal weight loss, few clinical signs of disease, and a complete recovery to pre-infection weight.

[0208] The results demonstrate that a single inhalable dose of LNA9 administered several days before infection can provide sustained protection against fatal disease, suggesting that the subject compounds could be used in prophylactic treatment during influenza outbreaks and pandemics.

[0209] Example 4: Susceptibility of influenza viruses to oseltamivir and LNA9 after serial passage in the presence of the drugs: a drug selection experiment Oseltamivir (Tamiflu) is the most widely used and stockpiled neuraminidase inhibitor (NAI) on the market. Like all NAIs, oseltamivir requires conformational rearrangement of the viral neuraminidase (NA) protein to accommodate the drug. Any mutation in the NA protein that affects this rearrangement reduces oseltamivir's binding affinity and therefore drug efficacy. In particular, the H274Y mutation (also known as the H275Y mutation, depending on nomenclature) is most commonly associated with oseltamivir resistance. Rapid selection of the H274Y mutation in immunocompromised patients can lead to clinical failure of the last-resort NAI drug peramivir, suggesting that the selection of multidrug-resistant viruses in immunocompromised hosts may be more common than previously believed. This, along with the recent widespread spread of oseltamivir- and NAI-resistant viruses, indicates the need to reevaluate the general use of NAIs. The development of new classes of antiviral drugs is essential to reduce the potential adverse impact of current and future influenza pandemics on human health.

[0210] The sequence region in segment PB2 containing the PSL2 stem loop is highly conserved across IAV subtypes, strains, and isolates from a wide range of host species, possibly reflecting a strict biological requirement for its conservation. SHAPE analysis of this region confirmed the conservation of PSL2 structure among seasonal and pandemic viruses of various subtypes and host origins, strongly suggesting that this structural element may be a novel pan-genotypic therapeutic target (hence, LNA9 has broad-spectrum potential against IAV isolates). In addition, because the subject LNAs are directed against highly conserved viral genomic RNA targets with apparently strong constraints on their mutational potential, the subject LNAs targeting PSL2 are expected to have a higher barrier to resistance development compared to NAIs.

[0211] The susceptibility of influenza viruses to LNA9 versus oseltamivir after serial passage under drug pressure was investigated. Oseltamivir had a starting IC of 41 nM against PR8 at passage 1 of drug treatment, as determined by plaque reduction assay. 50 With increasing amounts of drug, the IC of oseltamivir was 50 The IC jumped to 50 uM, 1000x. See Figure 18, panels A-D. In contrast, after 10 virus passages in the presence of LNA9, the IC 50 The concentration remained stable at 18-16 pM. Figure 19, panels A and B.

[0212] LNA9 can also be used to treat drug-resistant viruses. A drug-resistant mutant of the A / WSN / 33 (H1N1) virus was generated using a reverse genetic viral rescue system, mutating the NA gene to contain the H274Y resistance mutation. Against this virus, oseltamivir had an IC50 of 53 uM. 50Importantly, LNA9 maintained potency and efficacy against WSN H274Y virus at picomolar activity. Figure 19, panel C. This result provides strong evidence for therapeutic treatment of NAI-resistant viruses with PSL2-targeting LNAs. This result also highlights the activity of LNA9 against various IAV isolates.

[0213] Example 5: Antiviral Activity of miR-Targeting LNAs: We determined the in vitro antiviral efficacy of LNAs designed against microRNAs hypothesized to mediate respiratory virus replication. Individual LNAs designed to target microRNAs were transfected into Huh7 cells, followed by infection with fully replicating SARS-CoV-2-nLuc virus harboring a nanoluciferase reporter in ORF7. Forty-eight hours post-infection, the effect on replication was measured by luciferase activity compared to control cells treated with a negative control scrambled LNA (Scr.LNA) or the positive control nucleoside analog EIDD (Figure 20). LNAs targeting the frameshift element (FSE) region of the SARS-CoV-2 RNA genome had minimal effects on viral replication, while our anti-miR LNAs designed to sequester miR-191 significantly reduced viral replication by multiple logs. 10A reduction in the level of HIV-1-associated HIV-1 responses was observed. The degree of inhibition with anti-miRNAs was greater than that with the EIDD positive control. Furthermore, this degree of inhibition was observed at a 25 nanomolar concentration of LNA, while the EIDD positive control was used at a 5 micromolar concentration. Other microRNA-targeting LNAs with anti-respiratory virus activity have also been identified, including: LNA-602.1, LNA-602.6, LNA-6769-5P.3, LNA-6769-5P.6, LNA-942.3P.4, LNA -376c.3, LNA-4433b.1, LNA-191.1, LNA-191.2, LNA-191.3, LNA-191.4, LNA-1 91.8, LNA-191.8, LNA-19110, LNA-191.11, LNA-191.12, LNA-191.13, LNA-66 3.1, LNA-663.3, LNA-381.2, LNA-744.2, LNA-744.4, LNA-744.7, LNA-4508.1, LNA-4508.4, LNA-4730.2, LNA-4730.6, LNA-6777.4, LNA-10396.1, LNA-10396.2, LNA-4749.2, LNA-4749.4, LNA-4706.3, LNA-4706.4, LNA-3675.2, LNA-3675.3, LNA6810.1, LNA-6810.2, LNA-6810.3, LNA-6812.1, LNA-6796.1, and LNA-6796.3 have potent antiviral activity against SARS-CoV-2, all with an inhibition of viral replication of about 1 log or greater. These LNAs are listed in Table 8 above.

[0214] Example 6: Determine the in vitro antiviral efficacy of LNA combinations against respiratory viruses: Combining LNAs targeting a conserved SARS-CoV-2 RNA secondary structure with LNAs designed to sequester miR-191 leads to significant inhibition of viral replication. Using the assay described in Example 5 above, individual LNAs in combination demonstrated anti-respiratory virus activity (Figure 21).

[0215] Example 7: In vivo efficacy of LNA combinations against respiratory viruses. Human ACE2 transgenic mice were treated with a single intranasal dose of vehicle, small molecule A, or LNA combinations 5 days prior to infection with a lethal challenge of SARS-CoV-2. After infection, animals were monitored daily by clinical score, with 1 being asymptomatic and higher scores indicating worsening clinical status (Figure 21). LNA combinations inhibit respiratory virus infection in vivo.

[0216] Example 8: Antiviral activity of single microRNA-targeting LNAs, or LNAs targeting either the minus or plus strand of respiratory viruses. Using the assay described in Example 5, individual LNAs were shown to have anti-respiratory virus activity (Figure 22). Other LNAs with anti-respiratory virus activity have also been identified, including, but not limited to: Neg3.1, Neg8.2, Neg8.4, Neg10.1, Neg10.1, Neg12.2, Neg18.2, Neg18.3, Neg18.4, Cov8.5, Cov10.1, Cov11.3, Cov12.8, Cov13.9, Cov14.3, Cov16.3, Cov18.1, Cov1.1, Cov1.2, Cov1.4, Cov2.1, Cov2.2, Cov3.2, Cov3.2-2, Cov3.2-3, Cov3.2-4, Cov3.2-5, Cov3.2-6, Cov3.2-7, Cov4.1, Cov4.2, Cov6.4, Cov6.5, Cov6. 6, Cov6.7, Cov6.8, Cov6.9, Cov6.7-1, Cov6.7-2, Cov6.8, Cov6.9, Cov6.7-1, Cov6.7-2, Cov7.2, Cov7.7, C ov7.9, Cov8.1, Cov8.2, Cov8.3, Cov8.4, Cov8.5, Cov8.6, Cov8.2-1, Cov10.1, Cov10.4, Cov11.1, Cov11. 2, Cov11.3, Cov12.4, Cov12.5, Cov12.7, Cov12.8, Cov13.1, Cov13.4, Cov13.5, Cov13.6, Cov13.8, Cov13 Cov14.9, Cov14.1, Cov14.2, Cov14.3, Cov14.4, Cov16.1, Cov16.2, Cov16.3, Cov18.1, Cov18.5, IBV-LNA0.2, IBV-LNA4.4, IBV-LNA3.4, IBV-LNA2.5, and IBV-LNA1.5 have potent antiviral activity, all inhibiting viral replication by about 1 log or more. These LNAs are listed in Tables 7 and 9 above.

[0217] Example 9: LNAs that inhibit respiratory viruses can be used as just-in-time vaccines, as shown in Figure 23. (a-b) Effect of intranasal LNA prophylactic treatment on survival of virus-infected mice. Kaplan-Meier survival plots. Mice (n=7 mice / group) were administered a single dose of LNA9, scrambled LNA, or vehicle (mock treatment) intranasally, followed by lethal inoculation with wild-type PR8 virus. (a) Dose with 20 μg of LNA 3 days (day -3) or 1 day (day -1) before infection; (b) Treated 1 week prior with a single 30 μg dose of LNA9 or vehicle control. (c) Target sites of LNA9 and the newly designed LNA14 mapped onto the PSL2 structure. (d) Electrophoretic profile of SHAPE analysis performed on untreated, scrambled LNA, LNA9, and LNA14 at a concentration of 100 nM in the presence of PR8 PB2 vRNA. Labeling with 1M7 SHAPE reagent is shown. (e) Kaplan-Meier survival plot of mice (n=7 mice / group) pretreated intranasally with a single dose of 30 μg LNA14 or vehicle control 1 week (day −7) before lethal PR8 infection. (f-h) A single dose of 40 μg LNA14 or vehicle was administered IN 2 weeks (day −14) before PR8 virus infection. (f) Kaplan-Meier survival plot. (g) Percent mouse body weight relative to day 0. (h) Clinical score. (i-l) Mice (n=7) were administered a single intranasal dose of 40 μg LNA14 one week prior to a 1 LD100 primary lethal PR8 virus infection (e). Sixty-five days after the initial infection, surviving mice from (e) were challenged a second time with 10 LD100, along with age-matched naive controls (n=7 / group). (i) Challenge study timeline. (j) Percent mouse body weight relative to day 0. (k) Clinical score. (l) Kaplan-Meier survival curve. (m) Mice (n=10 / group) were infected with a lethal dose of PR8 wild-type virus. Three days after infection, mice were administered a single dose of 40 μg LNA14, LNA9, scrambled LNA, or vehicle control by intravenous injection. Kaplan-Meier survival plot.

[0218] References 1.M.J.Memoli,R.J.Hrabal,A.Hassantoufighi,M.C.Eichelberger,J.K.Taubenberger,Rapid selection of oseltamivir-and peramivir-resistant pandemic H1N1 virus during therapy in 2 immunocompromised hosts.Clin Infect Dis 50,1252-1255(2010);published online EpubMay 1(10.1086 / 651605). 2.R.Hai,M.Schmolke,V.H.Leyva-Grado,R.R.Thangavel,I.Margine,E.L.Jaffe,F.Krammer,A.Solorzano,A.Garcia-Sastre,P.Palese,N.M.Bouvier,Influenza A(H7N9)virus gains neuraminidase inhibitor resistance without loss of in vivo virulence or transmissibility.Nature communications 4,2854(2013)10.1038 / ncomms3854). 3.F.G.Hayden,M.D.de Jong,Emerging influenza antiviral resistance threats.J Infect Dis 203,6-10(2011);published online EpubJan 1(10.1093 / infdis / jiq012). 4.X.Liu,T.Li,Y.Zheng,K.W.Wong,S.Lu,H.Lu,Poor responses to oseltamivir treatment in a patient with influenza A(H7N9)virus infection.Emerging microbes & infections 2,e27(2013);published online EpubMay(10.1038 / emi.2013.30). 5.J.Parsons,M.P.Castaldi,S.Dutta,S.M.Dibrov,D.L.Wyles,T.Hermann,Conformational inhibition of the hepatitis C virus internal ribosome entry site RNA.Nat Chem Biol 5,823-825(2009);published online EpubNov(10.1038 / nchembio.217). 6.C.Romero-Lopez,A.Berzal-Herranz,Unmasking the information encoded as structural motifs of viral RNA genomes:a potential antiviral target.Rev Med Virol 23,340-354(2013);published online EpubNov(10.1002 / rmv.1756). 7.P.S.Palese,M.L.,Fields Virology.D.M.e.a.Knipe,Ed.,Orthomyxoviridae(Lippincott Williams & Wilkins,ed.5th,2007). 8.R.W.Compans,J.Content,P.H.Duesberg,Structure of the ribonucleoprotein of influenza virus.J Virol 10,795-800(1972);published online EpubOct( 9.ECHutchinson,JCvon Kirchbach,JRGog,P.Digard,Genome packaging in influenza A virus.J Gen Virol 91,313-328(2010); Rev Med Virol 20,380-391(2010);Structure of influenza virus ribonucleoprotein complexes and their packaging into virions. [ PMC free article ] [ PubMed ] [ Cross Ref ] 11.Y.Muramoto,A.Takada,K.Fujii,T.Noda,K.Iwatsuki-Horimoto,S.Watanabe,T.Horimoto,H.Kida,Y.Kawaoka,Hierarchy among viral RNA(vRNA)segments in their role in vRNA incorporation into influenza A virions.J Virol 80.2318–2325(2006);published online EpubMar(10.1128 / jvi.80.5.2318–2325.2006). [ PubMed ] 12.Q.Gao,YYChou,S.Doganay,R.Vafabakhsh,T.Ha,P.Palese,The influenza A virus PB2,PA,NP,and M segments play a pivotal role during genome packaging.J Virol 86,7043-7051(2012);published online EpubJul(10.1128 / jvi.00662-12). 13.G.A.Marsh,R.Rabadan,A.J.Levine,P.Palese,Highly conserved regions of influenza a virus polymerase gene segments are critical for efficient viral RNA packaging.J Virol 82,2295-2304(2008);published online EpubMar(10.1128 / jvi.02267-07). 14.E.Fournier,V.Moules,B.Essere,J.C.Paillart,J.D.Sirbat,C.Isel,A.Cavalier,J.P.Rolland,D.Thomas,B.Lina,R.Marquet,A supramolecular assembly formed by influenza A virus genomic RNA segments.Nucleic Acids Res 40,2197-2209(2012);published online EpubMar(10.1093 / nar / gkr985). 15.C.Gavazzi,C.Isel,E.Fournier,V.Moules,A.Cavalier,D.Thomas,B.Lina,R.Marquet,An in vitro network of intermolecular interactions between viral RNA segments of an avian H5N2 influenza A virus:comparison with a human H3N2 virus.Nucleic Acids Res 41,1241-1254(2013);published online EpubJan(10.1093 / nar / gks1181). 16.J.R.Gog,S.Afonso Edos,R.M.Dalton,I.Leclercq,L.Tiley,D.Elton,J.C.von Kirchbach,N.Naffakh,N.Escriou,P.Digard,Codon conservation in the influenza A virus genome defines RNA packaging signals.Nucleic Acids Res 35,1897-1907(2007)10.1093 / nar / gkm087). 17.W.N.Moss,S.F.Priore,D.H.Turner,Identification of potential conserved RNA secondary structure throughout influenza A coding regions.Rna 17,991-1011(2011);published online EpubJun(10.1261 / rna.2619511). 18.Y.Liang,T.Huang,H.Ly,T.G.Parslow,Mutational analyses of packaging signals in influenza virus PA,PB1,and PB2 genomic RNA segments.J Virol 82,229-236(2008);published online EpubJan(10.1128 / JVI.01541-07). 19.K.A.Wilkinson,E.J.Merino,K.M.Weeks,Selective 2’-hydroxyl acylation analyzed by primer extension(SHAPE):quantitative RNA structure analysis at single nucleotide resolution.Nature protocols 1,1610-1616(2006)10.1038 / nprot.2006.249). 20.P.S.Pang,M.Elazar,E.A.Pham,J.S.Glenn,Simplified RNA secondary structure mapping by automation of SHAPE data analysis.Nucleic Acids Res 39,e151(2011);published online EpubDec(10.1093 / nar / gkr773). 21.S.F.Priore,W.N.Moss,D.H.Turner,Influenza A virus coding regions exhibit host-specific global ordered RNA structure.PLoS One 7,e35989(2012)10.1371 / journal.pone.0035989). 22.W.Kladwang,R.Das,A mutate-and-map strategy for inferring base pairs in structured nucleic acids:proof of concept on a DNA / RNA helix.Biochemistry 49,7414-7416(2010);published online EpubSep 7(10.1021 / bi101123g). 23.S.Tian,P.Cordero,W.Kladwang,R.Das,High-throughput mutate-map-rescue evaluates SHAPE-directed RNA structure and uncovers excited states.Rna 20,1815-1826(2014);published online EpubNov(10.1261 / rna.044321.114). 24.B.Vester,J.Wengel,LNA(locked nucleic acid):high-affinity targeting of complementary RNA and DNA.Biochemistry 43,13233-13241(2004);published online EpubOct 26(10.1021 / bi0485732). 25.K.Klumpp,R.W.Ruigrok,F.Baudin,Roles of the influenza virus polymerase and nucleoprotein in forming a functional RNP structure.Embo J 16,1248-1257(1997);published online EpubMar 17(10.1093 / emboj / 16.6.1248). 26.R.Coloma,J.M.Valpuesta,R.Arranz,J.L.Carrascosa,J.Ortin,J.Martin-Benito,The structure of a biologically active influenza virus ribonucleoprotein complex.PLoS Pathog 5,e1000491(2009);published online EpubJun(10.1371 / journal.ppat.1000491). 27.F.Baudin,C.Bach,S.Cusack,R.W.Ruigrok,Structure of influenza virus RNP.I.Influenza virus nucleoprotein melts secondary structure in panhandle RNA and exposes the bases to the solvent.Embo J 13,3158-3165(1994);published online EpubJul 1( 28.T.Coelho,D.Adams,A.Silva,P.Lozeron,PNHawkins,T.Mant,J.Perez,J.Chiesa,S.Warrington,E.Tranter,M.Munisamy,R.Falzone,J.Harrop,J.Cehelsky,BRBettencourt,M.Geis sler,JSButler,A.Sehgal,REMeyers,Q.Chen,T.Borland,RMHutabarat,VAClausen,R.Alvarez,K.Fitzgerald,C.Gamba-Vitalo,SVNochur,AKVaishnaw,DWSah,JAGollob,OBSuhr,Safety and efficacy of RNAi therapy for transthyretin amyloidosis.N Engl J Med 369,819-829(2013);published online EpubAug 29(10.1056 / NEJMoa1208760). 29.K.Fitzgerald,M.Frank-Kamenetsky,S.Shulga-Morskaya,A.Liebow,BRBettencourt,JESutherland,RMHutabarat,VAClausen,V.Kars ten,J.Cehelsky,SVNochur,V.Kotelianski,J.Horton,T.Mant,J.Chiesa,J.Ritter,M.Munisamy,AKVaishnaw,JAGollob,A.Simon,Effect of an RNA interference drug on the synthesis of proprotein convertase subtilisin / kexin type 9(PCSK9)and the concentration of serum LDL cholesterol in healthy volunteers:a randomised,single-blind,placebo-controlled,phase 1 trial.Lancet 383,60-68(2014);published online EpubJan 4(10.1016 / S0140-6736(13)61914-5). 30.J.Gottlieb,M.R.Zamora,T.Hodges,A.W.Musk,U.Sommerwerk,D.Dilling,S.Arcasoy,J.DeVincenzo,V.Karsten,S.Shah,B.R.Bettencourt,J.Cehelsky,S.Nochur,J.Gollob,A.Vaishnaw,A.R.Simon,A.R.Glanville,ALN-RSV01 for prevention of bronchiolitis obliterans syndrome after respiratory syncytial virus infection in lung transplant recipients.J Heart Lung Transplant 35,213-221(2016);published online EpubFeb(10.1016 / j.healun.2015.08.012). 31.E.Hoffmann,G.Neumann,Y.Kawaoka,G.Hobom,R.G.Webster,A DNA transfection system for generation of influenza A virus from eight plasmids.Proc Natl Acad Sci U S A 97,6108-6113(2000);published online EpubMay 23(10.1073 / pnas.100133697). 32.K.J.Szretter,A.L.Balish,J.M.Katz,Influenza:propagation,quantification,and storage.Current protocols in microbiology Chapter 15,Unit 15G 11(2006);published online EpubDec(10.1002 / 0471729256.mc15g01s3). 33.G.A.Marsh,R.Hatami,P.Palese,Specific residues of the influenza A virus hemagglutinin viral RNA are important for efficient packaging into budding virions.J Virol 81,9727-9736(2007);published online EpubSep(10.1128 / jvi.01144-07). 34.S.A.Mortimer,K.M.Weeks,Time-resolved RNA SHAPE chemistry:quantitative RNA structure analysis in one-second snapshots and at single-nucleotide resolution.Nature protocols 4,1413-1421(2009)10.1038 / nprot.2009.126). 35.A.Akbari,G.Marthinsen,J.T.Lifjeld,F.Albregtsen,L.Wennerberg,N.C.Stenseth,K.S.Jakobsen,Improved DNA fragment length estimation in capillary electrophoresis.Electrophoresis 29,1273-1285(2008);published online EpubMar(10.1002 / elps.200700523). 36.P.S.Pang,E.A.Pham,M.Elazar,S.G.Patel,M.R.Eckart,J.S.Glenn,Structural map of a microRNA-122:hepatitis C virus complex.J Virol 86,1250-1254(2012);published online EpubJan(10.1128 / JVI.06367-11). 37.K.E.Deigan,T.W.Li,D.H.Mathews,K.M.Weeks,Accurate SHAPE-directed RNA structure determination.Proc Natl Acad Sci U S A 106,97-102(2009);published online EpubJan 6(10.1073 / pnas.0806929106). 38.P.De Rijk,J.Wuyts,R.De Wachter,RnaViz 2:an improved representation of RNA secondary structure.Bioinformatics 19,299-300(2003);published online EpubJan 22. 39.W.Kladwang,C.C.VanLang,P.Cordero,R.Das,A two-dimensional mutate-and-map strategy for non-coding RNA structure.Nature chemistry 3,954-962(2011);published online EpubDec(10.1038 / nchem.1176). 40.W.Kladwang,P.Cordero,R.Das,A mutate-and-map strategy accurately infers the base pairs of a 35-nucleotide model RNA.Rna 17,522-534(2011);published online EpubMar(10.1261 / rna.2516311). 41.P.Cordero,W.Kladwang,C.C.VanLang,R.Das,in RNA Folding(Methods in Molecular Biology),C.Waldsich,Ed.(2013),pp.in press. 42.S.A.Mortimer,K.M.Weeks,A fast-acting reagent for accurate analysis of RNA secondary and tertiary structure by SHAPE chemistry.J Am Chem Soc 129,4144-4145(2007);published online EpubApr 11(10.1021 / ja0704028). 43.S.Yoon,J.Kim,J.Hum,H.Kim,S.Park,W.Kladwang,R.Das,HiTRACE:high-throughput robust analysis for capillary electrophoresis.Bioinformatics 27,1798-1805(2011);published online EpubJul 1(10.1093 / bioinformatics / btr277). 44.H.Kim,P.Cordero,R.Das,S.Yoon,HiTRACE-Web:an online tool for robust analysis of high-throughput capillary electrophoresis.Nucleic Acids Research 41,W492-W498(2013);published online EpubJuly 1,2013(10.1093 / nar / gkt501). 45.J.Kim,S.Yu,B.Shim,H.Kim,H.Min,E.-Y.Chung,R.Das,S.Yoon,A robust peak detection method for RNA structure inference by high-throughput contact mapping.Bioinformatics 25,1137-1144(2009);published online EpubMay 1,2009(10.1093 / bioinformatics / btp110). 46.W.Kladwang,T.H.Mann,A.Becka,S.Tian,H.Kim,S.Yoon,R.Das,Standardization of RNA chemical mapping experiments.Biochemistry 53,3063-3065(2014);published online EpubMay 20(10.1021 / bi5003426). 47.D.H.Mathews,M.D.Disney,J.L.Childs,S.J.Schroeder,M.Zuker,D.H.Turner,Incorporating chemical modification constraints into a dynamic programming algorithm for prediction of RNA secondary structure.Proc Natl Acad Sci U S A 101,7287-7292(2004);published online EpubMay 11(10.1073 / pnas.0401799101). 48.K.Darty,A.Denise,Y.Ponty,VARNA:Interactive drawing and editing of the RNA secondary structure.Bioinformatics 25,1974-1975(2009);published online EpubAug 1(10.1093 / bioinformatics / btp250). 49. P. Cordero, JBLucks, R. Das, An RNA Mapping DataBase for curating RNA structure mapping experiments.Bioinformatics 28,3006-3008(2012);published online EpubNov 15(10.1093 / bioinformatics / bts554).

[0219] Although the foregoing invention has been described in some detail by way of illustration and example, for purposes of clarity of understanding, it will be readily apparent to those skilled in the art that certain changes and modifications can be made in light of the teachings of this invention without departing from the spirit or scope of the appended claims.

[0220] Accordingly, the foregoing merely illustrates the principles of the present invention. It will be appreciated that those skilled in the art will be able to devise various arrangements, not explicitly described or shown herein, which embody the principles of the present invention and are within its spirit and scope. Furthermore, all examples and conditional language set forth herein are intended primarily to aid the reader in understanding the principles of the present invention and the concepts the inventors contributed to furthering the art, and should not be construed as being limited to such specifically described examples and conditions. Furthermore, all statements herein describing principles, aspects, and embodiments of the present invention, as well as specific examples thereof, are intended to encompass both structural and functional equivalents thereof. Additionally, such equivalents are intended to include both currently known equivalents and future-developed equivalents, regardless of structure, i.e., any elements developed to perform the same function, regardless of structure. Thus, the scope of the present invention is not intended to be limited to the embodiments shown and described herein. Rather, the scope and spirit of the present invention are embodied by the accompanying embodiments.

[0221] Notwithstanding the appended claims, the disclosure set forth herein is also described by the following paragraphs. Item 1. An oligonucleotide compound comprising an oligonucleotide sequence complementary to a PB2 vRNA region, wherein the region comprises nucleotides 34 to 87 in (-) sense notation of the 5'-end coding region of PB2 vRNA, or a salt thereof. Item 2. The compound according to Item 1, comprising an oligonucleotide sequence comprising at least eight nucleoside subunits complementary to a region of PB2 vRNA. Item 3. The compound according to Item 1 or 2, wherein the oligonucleotide is complementary to a region of the packaging stem loop 2 (PSL2) motif in the PB2 vRNA region. Item 4. The compound according to any one of Items 1 to 3, wherein the oligonucleotide comprises an internucleoside linkage selected from phosphorothioate, phosphorodithioate, phosphoramidate, and thiophosphoramidate linkages. Item 5. The compound according to any one of Items 1 to 4, wherein all of the internucleoside bonds of the oligonucleotide are selected from phosphorothioate, phosphorodithioate, phosphoramidate, thiophosphoramidate, and phosphodiester bonds. Item 6. The compound according to Item 4 or 5, wherein the internucleoside bond of the oligonucleotide is chiral. Item 7. The compound according to any one of Items 1 to 5, wherein the oligonucleotide comprises a bridged nucleic acid (BNA) nucleotide. Item 8. The compound according to any one of Items 1 to 5, wherein the oligonucleotide comprises a locked nucleic acid (LNA) nucleotide. Item 9. The compound according to any one of Items 1 to 5, wherein the oligonucleotide comprises an ethylene-bridged nucleic acid (ENA) nucleotide. Item 10. The compound according to any one of Items 1 to 5, wherein the oligonucleotide comprises a constrained ethylnucleic acid (cEt) nucleotide. Item 11. The compound according to any one of Items 1 to 5, wherein the oligonucleotide comprises a 2'-modified nucleotide. Item 12. The oligonucleotide is 5'ACCAAAAGAAT3' (SEQ ID NO: 45), 5'TGGCCATCAAT3' (SEQ ID NO: 46), 5'TAGCATACTTA3' (SEQ ID NO: 47), 5'CCAAAAGA3' (SEQ ID NO: 48), 5'CATACTTA3' (SEQ ID NO: 49), 5'CAGACACGACCAAAA3' (SEQ ID NO: 50), 5'TACTTACTGACAGCC3' (SEQ ID NO: 51), 5'AGACACGACCAAAAG3' (SEQ ID NO: 52), 5'ACCAAAAGAAT3' (SEQ ID NO: 53), 5'TGGCCATCAAT3' (SEQ ID NO: 54), 5'TAGCATACTTA3' (SEQ ID NO: 55), 5'CGACCAAAAGAATTC3' (SEQ ID NO: 56), 5'CGACCAAAAGAATTC3' (SEQ ID NO: 57), 5'GATGGCCATCAATTA3' (SEQ ID NO: 58), 5'GATGGCCATCAATTA3' (SEQ ID NO: 59), 5'TCTAGCATACTTACT3' (SEQ ID NO: 60), 5'TCTAGCATACTTACT3' (SEQ ID NO: 61), 5'GAATTCGGATGGCCA3' (SEQ ID NO: 62), 5'GGCCATCAATTAGTG3' (SEQ ID NO: 63), 5'TTCGGATGGCCATCA3' (SEQ ID NO: 64), 5'AGCCAGACAGCGA3' (SEQ ID NO: 65), 5'GACAGCCAGACAGCA3' (SEQ ID NO: 66), 5'CGACCAAAAGAATT3' (SEQ ID NO: 98), 5'GACCAAAAGAATTCGG3' (SEQ ID NO: 99), 5'AGCATACTTACTGACA3' (SEQ ID NO: 100), 5'CATACTTACTGACA3' (SEQ ID NO: 101), 5'ATACTTACTGACAG3' (SEQ ID NO: 102), 5'CATACTTACTGACAGC3' (SEQ ID NO: 103), 5'AGACAGCGACCAAAAG3' (SEQ ID NO: 104), 5'ACAGCGACCAAAAG (SEQ ID NO: 105), 5'CAGCCAGACAGCGAC3' (SEQ ID NO: 106), 5'CAGCCAGACAGCGA3' (SEQ ID NO: 107), 5'ACAGCCAGACAGCGA3' (SEQ ID NO: 108), 5'GACAGCCAGACAGCG3' (SEQ ID NO: 109), 5'CATCAATTAGTGTCG3' (SEQ ID NO: 110), 5'CCATCAATTAGTGTCG3' (SEQ ID NO: 111), 5'GCCATCAATTAGTGTG3' (SEQ ID NO: 112), 5'AAGAATTCGGATGGC3' (SEQ ID NO: 113), 5'CAGACAGCGACCAA3' (SEQ ID NO: 114), Item 12. The compound according to any one of items 1 to 11, comprising a sequence selected from the group consisting of: 5'TGACAGCCAGACAGC3' (SEQ ID NO: 115). Item 13. The oligonucleotide is 5'GAATTCGGATGGCCA3' (SEQ ID NO: 62), 5'AGCCAGACAGCGA3' (SEQ ID NO: 65), 5'CGACCAAAAGAATT3' (SEQ ID NO: 98), 5'GACCAAAAGAATTCGG3' (SEQ ID NO: 99), 5'AGCATACTTACTGACA3' (SEQ ID NO: 100), 5'CATACTTACTGACA3' (SEQ ID NO: 101), 5'ATACTTACTGACAG3' (SEQ ID NO: 102), 5'CATACTTACTGACAGC3' (SEQ ID NO: 103), 5'AGACAGCGACCAAAAG3' (SEQ ID NO: 104), 5'ACAGCGACCAAAAG (SEQ ID NO: 105), 5'CAGCCAGACAGCGAC3' (SEQ ID NO: 106), 5'CAGCCAGACAGCGA3' (SEQ ID NO: 107), 5'ACAGCCAGACAGCGA3' (SEQ ID NO: 108), 5'GACAGCCAGACAGCG3' (SEQ ID NO: 109), 5'CATCAATTAGTGTCG3' (SEQ ID NO: 110), 5'CCATCAATTAGTGTCG3' (SEQ ID NO: 111), 5'GCCATCAATTAGTGTG3' (SEQ ID NO: 112), 5'AAGAATTCGGATGGC3' (SEQ ID NO: 113), 5'CAGACAGCGACCAA3' (SEQ ID NO: 114), and 5'TGACAGCCAGACAGC3' (SEQ ID NO: 115). Item 14. The compound according to Item 12, comprising an oligonucleotide having at least 70% sequence identity with a sequence selected from (SEQ ID NOs: 45 to 66) and (SEQ ID NOs: 98 to 115). Item 15. The compound according to Item 14, comprising an oligonucleotide having at least 80% sequence identity with a sequence selected from (SEQ ID NOs: 45 to 66) and (SEQ ID NOs: 98 to 115). Item 16. The compound according to Item 15, comprising an oligonucleotide having at least 90% sequence identity with a sequence selected from (SEQ ID NOs: 45 to 66) and (SEQ ID NOs: 98 to 115). Clause 17. The compound of clause 12, wherein one or more of the nucleotides of the oligonucleotide is a modified nucleotide (eg, as described herein). Item 18. The compound according to Item 12, wherein one or more of the nucleotides of the oligonucleotide is a bridged nucleic acid (BNA) nucleotide. Item 19. The compound according to Item 12, wherein all nucleotides of the oligonucleotide are locked nucleic acid (LNA) nucleotides. Item 20. The compound according to Item 12, wherein one or more of the nucleotides of the oligonucleotide is an ethylene-bridged nucleic acid (ENA) nucleotide. Item 21. The compound according to Item 12, wherein one or more of the nucleotides of the oligonucleotide is a constrained ethyl nucleotide (cEt) nucleotide. Item 22. The compound according to Item 12, wherein one or more of the nucleotides of the oligonucleotide comprises a 2'-modified nucleotide. Item 23. The oligonucleotide, LNA1: 5'AccAaaAGaaT3' (SEQ ID NO: 67), LNA2: 5'TggCcATcaaT3' (SEQ ID NO: 68), LNA3: 5'TagCAtActtA3' (SEQ ID NO: 69), LNA4: 5'CCAAAAGA3' (SEQ ID NO: 70), LNA5:5'CATACTTA3' (SEQ ID NO: 71), LNA6: 5'CagaCaCGaCCaaAA3' (SEQ ID NO: 72), LNA7: 5'TAcTtaCTgaCagCC3' (SEQ ID NO: 73), LNA8: 5'AGACacgaccaAAAG3' (SEQ ID NO: 74), LNA9: 5'TACTtactgacaGCC3' (SEQ ID NO: 75), LNA9.2: 5'TACttactgacAGCC3' (SEQ ID NO: 76), LNA10: 5'ACCaaaagAAT3' (SEQ ID NO: 77), LNA11: 5'TGGccatcAAT3' (SEQ ID NO: 78), LNA12: 5'TAGcatacTTA3' (SEQ ID NO: 79), LNA13: 5'CgacCAaaAGaattC3' (SEQ ID NO: 80), LNA14: 5'CGACcaaaagaATTC3' (SEQ ID NO: 81), LNA15: 5'GaTGgCcATcaAttA3' (SEQ ID NO: 82), LNA16: 5'GATGgccatcaATTA3' (SEQ ID NO: 83), LNA17: 5'TcTAgCaTActTacT3' (SEQ ID NO: 84), LNA18: 5'TCTAgcatactTACT3' (SEQ ID NO: 85), LNA19: 5'GAAttcggatgGCCA3' (SEQ ID NO: 86), LNA20: 5'GGCCatcaattaGTG3' (SEQ ID NO: 87), LNA21: 5'TTCGgatggccaTCA3' (SEQ ID NO: 88), LNA22: 5'AGCCagacagCGA3' (SEQ ID NO: 89), LNA23: 5'GACAgccagacaGCA3' (SEQ ID NO: 90), LNA9.G74C: 5'TACTtactgacaGTC3' (SEQ ID NO: 91), and LNA9.T80C: 5'TACTtaccgacaGCC3' (SEQ ID NO: 92), 13. The compound of paragraph 12, wherein uppercase letters indicate LNA nucleotides and lowercase letters indicate DNA nucleotides. Item 24. The oligonucleotide, LNA19: 5'GAAttcggatgGCCA3' (SEQ ID NO: 86), LNA22: 5'AGCCagacagCGA3' (SEQ ID NO: 89), LNA22.2: 5'CAGCcagacagCGAC3' (SEQ ID NO: 116), LNA22.3: 5'CAGccagacagCGAC3' (SEQ ID NO: 117), LNA22.5: 5'CAGccagacaGCGA3' (SEQ ID NO: 118), LNA22.6: 5'CAGccagacagCGA3' (SEQ ID NO: 119), LNA22.7: 5'CAGCcagacagCGA3' (SEQ ID NO: 120), LNA22.8: 5'ACAgccagacagCGA3' (SEQ ID NO: 121), LNA22.9: 5'ACAGccagacaGCGA3' (SEQ ID NO: 122), LNA22.10: 5'ACAgccagacaGCGA3' (SEQ ID NO: 123), LNA22.11: 5'GACAgccagacaGCG3' (SEQ ID NO: 124), LNA22.13: 5'GACagccagacaGCG3' (SEQ ID NO: 125), and Item 13. The compound of item 12, comprising a sequence selected from LNA22.14:5'GACAgccagacAGCG (SEQ ID NO: 126). Item 25. The oligonucleotide, LNA24: 5'CATcaattagtgTCG3' (SEQ ID NO: 127), LNA25: 5'CCAtcaattagtgTCG3' (SEQ ID NO: 128), LNA26: 5'GCCatcaattagtGTG3' (SEQ ID NO: 129), LNA27: 5'AAGAattcggaTGGC3' (SEQ ID NO: 130), LNA28: 5'CAGacagcgacCAA3' (SEQ ID NO: 131), and Item 13. The compound of item 12, comprising a sequence selected from LNA29:5'TGAcagccagacAGC3' (SEQ ID NO: 132). Item 26. The oligonucleotide, LNA14: 5'CGACcaaaagaATTC3' (SEQ ID NO: 81), LNA14.5: 5'CGACcaaaagaATT3' (SEQ ID NO: 135), LNA14.8: 5'CGACcaaaagaaTTC3' (SEQ ID NO: 137), LNA14.28: 5'GACcaaaagaatTCGG3' (SEQ ID NO: 148), LNA14.30: 5'GACCaaaagaattCGG3' (SEQ ID NO: 149), LNA9: 5'TACTtactgacaGCC3' (SEQ ID NO: 75), LNA9.1: 5'AGCAtacttactGACA3' (SEQ ID NO: 159), LNA9.2a: 5'CATacttactgACA3' (SEQ ID NO: 160), LNA9.8: 5'ATActtactgACAG (SEQ ID NO: 164), LNA9.12: 5'CATActtactgacAGC (SEQ ID NO: 167), LNA8a: 5'AGAcagcgaccaaAAG (SEQ ID NO: 188), LNA8a.1: 5'AGACagcgaccaAAAG (SEQ ID NO: 189), and 13. The compound of clause 12, comprising a sequence selected from LNA8a.2:5'ACAGcgaccaAAAG (SEQ ID NO: 190). Item 27. The compound according to any one of items 23 to 26, comprising an oligonucleotide having at least 70% sequence identity with a sequence selected from (SEQ ID NOs: 67 to 92) and (SEQ ID NOs: 116 to 191). Item 28. The compound according to Item 27, comprising an oligonucleotide having at least 80% sequence identity with a sequence selected from (SEQ ID NOs: 67 to 92) and (SEQ ID NOs: 116 to 191). Item 29. The compound according to Item 28, comprising an oligonucleotide having at least 90% sequence identity with a sequence selected from (SEQ ID NOs: 67 to 92) and (SEQ ID NOs: 116 to 191). Item 30. The compound according to any one of Items 1 to 29, wherein the oligonucleotide comprises at least five deoxyribonucleotide units and is capable of recruiting RNase. Item 31. The compound according to any one of items 1 to 30, wherein binding of the compound to a region of PB2 vRNA disrupts the overall secondary RNA structure of PB2 vRNA. Item 32. The compound according to any one of Items 1 to 30, wherein binding of the compound to a region of PB2 vRNA inhibits the packaging ability of PB2 vRNA. Item 33. The compound according to any one of items 1 to 32, wherein the compound is an oligonucleotide conjugate having enhanced cellular uptake. Item 34. The compound according to Item 33, wherein the compound is an oligonucleotide-lipid conjugate. Item 35. The compound according to any one of Items 1 to 33, wherein the compound is an oligonucleotide conjugate with a cell-specific protein. Item 36. A method for inhibiting influenza A virus in a cell, comprising contacting a sample containing viral RNA (vRNA) having a PSL2 motif with an effective amount of an agent that specifically binds to the PSL2 motif to inhibit influenza A virus. Item 37. The method according to Item 36, wherein the agent is an oligonucleotide compound or a salt thereof comprising at least eight nucleoside subunits complementary to the PSL2 motif of vRNA. Item 38. The method according to Item 36 or 37, wherein the drug is the oligonucleotide compound according to any one of Items 1 to 35. Item 39. The method according to any one of Items 36 to 38, wherein the vRNA in the sample is PB2 vRNA. Item 40. Contacting the sample with the agent reduces the number of viruses by at least 1 log 10 40. The method according to any one of items 36 to 39, wherein the method results in a loss of titer of the antibody. Item 41. Contacting the sample with the agent reduces the number of viruses by at least 2 log 10 40. The method according to any one of items 36 to 39, wherein the method results in a loss of titer of the antibody. Item 42. The method according to any one of Items 36 to 41, wherein the agent disrupts the overall structure of the PSL2 motif of vRNA. Paragraph 43. The method of any one of paragraphs 36 to 41, wherein the agent inhibits the packaging ability of the PSL2 motif in vRNA. Clause 44. The method of any one of clauses 36 to 41, wherein the vRNA is isolated from virions or cells. Item 45. The method of any one of Items 36 to 41, wherein the vRNA is contained in a virion or an infected cell. Item 46. The method according to any one of claims 36 to 45, wherein the sample is in vitro. Item 47. The method according to any one of claims 36 to 41 or 45, wherein the sample is in vivo. Item 48. A method for treating or preventing influenza A virus infection in a subject, comprising administering to a subject in need of treatment or prevention of influenza A virus infection a pharmaceutical composition comprising an effective amount of an active agent that specifically binds to the PSL2 motif of viral RNA (vRNA). Clause 49. The method of clause 48, wherein the vRNA is PB2 vRNA. Clause 50. The method of clause 48 or 49, wherein the active agent is a compound comprising an oligonucleotide sequence comprising at least eight nucleoside subunits that are complementary to a region of PB2 vRNA. Item 51. The method according to any one of Items 48 to 50, wherein the drug is the oligonucleotide compound according to any one of Items 1 to 35. Paragraph 52. The method of any one of paragraphs 48 to 51, wherein the subject is at risk for influenza A virus infection and administration of the oligonucleotide compound protects the subject from infection for one week or more (e.g., two weeks or more, three weeks or more, one month or more, two months or more, three months or more, etc.). Clause 53. The method of Clause 52, wherein administering comprises administering an effective dose of the oligonucleotide compound weekly, biweekly, or monthly. Item 54. The administration reduces the number of viruses in the subject's sample by at least 1 log 10 54. The method of any one of items 48 to 53, wherein the method results in a loss of titer. Item 55. The administration reduces the number of viruses in the subject's sample by at least 2 log 10 54. The method of any one of items 48 to 53, wherein the method results in a loss of titer. Clause 56. The method of any one of clauses 48 to 53, wherein the active agent is an oligonucleotide conjugate with enhanced cellular uptake. Clause 57. The method of any one of clauses 48 to 55, wherein the active agent is an oligonucleotide conjugate with a cell-specific protein. Item 58. The method according to any one of Items 48 to 55, wherein the pharmaceutical composition comprises a cellular uptake enhancer. Clause 59. The method of any one of clauses 48 to 55, wherein the pharmaceutical composition further comprises an additional active agent selected from a second oligonucleotide active agent and an antiviral agent. Item 60. The method of any one of Items 48 to 55, wherein the active agent is siRNA, shRNA, antisense RNA, or antisense DNA. Paragraph 61. The method of any one of paragraphs 48 to 55, wherein the subject is at risk for influenza A virus infection and the method prevents infection. Item 62. The method of any one of Items 48 to 55, wherein the subject is diagnosed with or suspected of having an influenza A virus infection, and the method treats the infection. Paragraph 63. A method for screening candidate agents for their ability to inhibit influenza A virus in a cell, the method comprising: contacting a sample containing viral RNA (vRNA) containing a PSL2 motif with a candidate drug; determining whether the candidate agent specifically binds to the PSL2 motif; A method in which an agent that specifically binds to the PSL2 motif inhibits influenza A virus in cells. Clause 64. The method of clause 63, wherein the candidate agent is selected from a small molecule, a nucleic acid, and a polypeptide. Clause 65. The method of clause 64, wherein the determining step includes detecting a cellular parameter, and a change in the parameter in the cell compared to a cell not contacted with the candidate agent indicates that the candidate agent specifically binds to the PSL2 motif. Clause 66. The method of any one of clauses 63 to 65, wherein the agent that specifically binds to the PSL2 motif treats a subject with an influenza A virus infection. Item 67. A method for treating or preventing a respiratory viral infection in a subject, comprising: A method comprising administering to a subject in need of treatment or prevention of a respiratory viral infection a pharmaceutical composition comprising an effective amount of an active agent that specifically binds to a target motif in the subject's viral RNA (vRNA) or miRNA that associates with the target motif. Item 68. The method according to Item 67, wherein the agent is an oligonucleotide compound comprising a sequence selected from the group consisting of SEQ ID NOs: 45 to 907. Clause 69. The method of clause 68, wherein the method comprises administering two or more sequences selected from the group consisting of SEQ ID NOs: 45-907. Clause 70. The method of Clause 69, wherein the two or more sequences are directed to different respiratory viruses. Paragraph 71. The method of any one of paragraphs 67 to 70, wherein the subject is at risk for a respiratory viral infection and administration of the oligonucleotide compound protects the subject from the infection for one week or more (e.g., two weeks or more, three weeks or more, one month or more, two months or more, three months or more, etc.). Clause 72. The method of Clause 71, wherein administering comprises administering an effective dose of the oligonucleotide compound weekly, biweekly, or monthly. Item 73. The administration reduces the number of viruses in the subject's sample by at least 1 log 10 73. The method of any one of paragraphs 67 to 72, wherein the method results in a loss of titer of the antibody. Clause 74. The method of any one of clauses 67 to 73, wherein the subject is at risk for a respiratory viral infection and the method prevents the infection. Paragraph 75. The method of any one of paragraphs 67 to 73, wherein the subject is diagnosed with or suspected of having a respiratory viral infection, and the method treats the infection.

[0222] In at least some of the above-described embodiments, one or more elements used in an embodiment may be used interchangeably in another embodiment unless such substitution is technically feasible. Those skilled in the art will appreciate that various other omissions, additions, and modifications may be made to the methods and structures described above without departing from the scope of the claimed subject matter. All such modifications and variations are intended to fall within the scope of the subject matter defined by the appended claims.

[0223] In general, it will be understood by those skilled in the art that the terms used herein, particularly in the appended claims (e.g., the body of the appended claims), are generally intended as "open" terms (e.g., the term "comprises" should be interpreted as "including, but not limited to," the term "having" should be interpreted as "having at least," the term "including" should be interpreted as "including, but not limited to," etc.). It will be further understood by those skilled in the art that where a specific number of introduced claim recitations is intended, such intention will be explicitly recited in the claim; in the absence of such recitation, such intention does not exist. For example, as an aid to understanding, the appended claims below may include the use of the introductory phrases "at least one" and "one or more" to introduce claim recitations. However, the use of such phrases should not be interpreted as meaning that the introduction of a claim recitation with the indefinite article "a" or "an" limits a particular claim that includes such introduced claim recitation to embodiments that include only one such recitation. The same claim includes the introductory phrase "one or more" or "at least one" and an indefinite article such as "a" or "an" (e.g., "a" and / or "an" means "at least one" or "one or more"); the same applies to the use of definite articles used to introduce claim recitations. Additionally, even if a specific number of recitations in an introduced claim is explicitly recited, those skilled in the art will recognize that such recitation should be interpreted to mean at least the recited number (e.g., the bare recitation of "two recitations" without other modifiers means at least two recitations, or two or more recitations). Furthermore, when a convention similar to "at least one of A, B, and C, etc." is used, such a configuration is generally intended in the sense that one skilled in the art would understand the convention (e.g., "a system having at least one of A, B, and C" includes, but is not limited to, systems having only A, only B, only C, both A and B, both A and C, both B and C, and / or both A, B, and C, etc.).When a convention similar to "at least one of A, B, or C, etc." is used, such a configuration is generally intended in the sense that one of ordinary skill in the art would understand the convention (e.g., "a system having at least one of A, B, or C" includes, but is not limited to, systems having only A, only B, only C, both A and B, both A and C, both B and C, and / or both A, B, and C, etc.). It will be further understood by those of ordinary skill in the art that virtually any disjunction and / or phrase presenting two or more alternative terms, whether in the specification, claims, or drawings, should be understood to contemplate the possibility of including one of the terms, either of the terms, or both terms. For example, the phrase "A or B" would be understood to include the possibilities of "A" or "B" or "A and B."

[0224] Additionally, when features or aspects of the present disclosure are described in terms of a Markush group, those skilled in the art will recognize that the present disclosure is also thereby described in terms of any individual members or subgroups of members of the Markush group.

[0225] As will be understood by those skilled in the art, for any and all purposes, including in terms of providing a written description, all ranges disclosed herein also encompass any and all possible subranges and combinations of subranges. Any recited range can be readily recognized as fully descriptive and allowing the same range to be divided into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third, upper third, etc. As will also be understood by those skilled in the art, all terms such as "up to," "at least," "greater than," "less than," etc., refer to ranges that are inclusive of the recited numbers and that can subsequently be broken down into subranges as discussed above. Finally, as will be understood by those skilled in the art, a range includes each individual member. Thus, for example, a group having 1 to 3 items refers to groups having 1, 2, or 3 items. Similarly, a group having 1 to 5 items refers to groups having 1, 2, 3, 4, or 5 items, etc.

[0226] Although the foregoing invention has been described in some detail by way of illustration and example, for purposes of clarity of understanding, it will be readily apparent to those skilled in the art that certain changes and modifications can be made in light of the teachings of this invention without departing from the spirit or scope of the appended claims.

[0227] Accordingly, the foregoing merely illustrates the principles of the present invention. It will be appreciated that those skilled in the art will be able to devise various arrangements, not explicitly described or shown herein, which embody the principles of the present invention and are within its spirit and scope. Furthermore, all examples and conditional language set forth herein are intended primarily to aid the reader in understanding the principles of the present invention and the concepts the inventors contributed to furthering the art, and should not be construed as being limited to such specifically described examples and conditions. Furthermore, all statements herein describing principles, aspects, and embodiments of the present invention, as well as specific examples thereof, are intended to encompass both structural and functional equivalents thereof. Additionally, such equivalents are intended to include both currently known equivalents and future-developed equivalents, regardless of structure, i.e., any elements developed to perform the same function, regardless of structure. Furthermore, nothing disclosed herein is intended to be dedicated to the public, regardless of whether such disclosure is expressly recited in the claims.

[0228] Accordingly, the scope of the present invention is not intended to be limited to the exemplary embodiments shown and described herein. Rather, the scope and spirit of the present invention is embodied by the appended claims. In the claims, 35 U.S.C. 112(f) or 35 U.S.C. 112(6) is expressly defined as being invoked for a limitation in a claim only if the precise phrase "means for" or the precise phrase "step for" appears at the beginning of such limitation in the claim; if such precise phrases are not used in the limitation in the claim, 35 U.S.C. 112(f) or 35 U.S.C. 112(6) is not invoked. In certain embodiments, for example, the following are provided: (Item 1) An oligonucleotide compound or a salt thereof, comprising an oligonucleotide sequence comprising at least eight nucleoside subunits complementary to a region of the packaging stem loop 2 (PSL2) motif of PB2 viral RNA (vRNA) or a mutant thereof, wherein the oligonucleotide compound inhibits virus production. (Item 2) 2. The compound according to claim 1, wherein the oligonucleotide comprises internucleoside linkages selected from phosphorothioate, phosphorodithioate, phosphoramidate, and thiophosphoramidate linkages. (Item 3) 3. The compound according to item 2, wherein the oligonucleotide comprises one or more chiral internucleoside linkages. (Item 4) 2. The compound of claim 1, wherein the oligonucleotide comprises a bridged nucleic acid (BNA) nucleotide. (Item 5) 5. The compound according to item 4, wherein the BNA nucleotide is selected from the group consisting of locked nucleic acid (LNA) nucleotides, ethylene-bridged nucleic acid (ENA) nucleotides, and constrained ethyl (cEt) nucleotides. (Item 6) 2. The compound of claim 1, wherein the oligonucleotide comprises one or more 2'-modified nucleotides. (Item 7) the oligonucleotide is 5'ACCAAAAGAAT3' (SEQ ID NO: 45), 5'TGGCCATCAAT3' (SEQ ID NO: 46), 5'TAGCATACTTA3' (SEQ ID NO: 47), 5'CCAAAAGA3' (SEQ ID NO: 48), 5'CATACTTA3' (SEQ ID NO: 49), 5'CAGACACGACCAAAA3' (SEQ ID NO: 50), 5'TACTTACTGACAGCC3' (SEQ ID NO: 51), 5'AGACACGACCAAAAG3' (SEQ ID NO: 52), 5'ACCAAAAGAAT3' (SEQ ID NO: 53), 5'TGGCCATCAAT3' (SEQ ID NO: 54), 5'TAGCATACTTA3' (SEQ ID NO: 55), 5'CGACCAAAAGAATTC3' (SEQ ID NO: 56), 5'CGACCAAAAGAATTC3' (SEQ ID NO: 57), 5'GATGGCCATCAATTA3' (SEQ ID NO: 58), 5'GATGGCCATCAATTA3' (SEQ ID NO: 59), 5'TCTAGCATACTTACT3' (SEQ ID NO: 60), 5'TCTAGCATACTTACT3' (SEQ ID NO: 61), 5'GAATTCGGATGGCCA3' (SEQ ID NO: 62), 5'GGCCATCAATTAGTG3' (SEQ ID NO: 63), 5'TTCGGATGGCCATCA3' (SEQ ID NO: 64), 5'AGCCAGACAGCGA3' (SEQ ID NO: 65), 5'GACAGCCAGACAGCA3' (SEQ ID NO: 66), 5'CGACCAAAAGAATT3' (SEQ ID NO: 98), 5'GACCAAAAGAATTCGG3' (SEQ ID NO: 99), 5'AGCATACTTACTGACA3' (SEQ ID NO: 100), 5'CATACTTACTGACA3' (SEQ ID NO: 101), 5'ATACTTACTGACAG3' (SEQ ID NO: 102), 5'CATACTTACTGACAGC3' (SEQ ID NO: 103), 5'AGACAGCGACCAAAAG3' (SEQ ID NO: 104), 5'ACAGCGACCAAAAG (SEQ ID NO: 105), 5'CAGCCAGACAGCGAC3' (SEQ ID NO: 106), 5'CAGCCAGACAGCGA3' (SEQ ID NO: 107), 5'ACAGCCAGACAGCGA3' (SEQ ID NO: 108), 5'GACAGCCAGACAGCG3' (SEQ ID NO: 109), 5'CATCAATTAGTGTCG3' (SEQ ID NO: 110), 5'CCATCAATTAGTGTCG3' (SEQ ID NO: 111), 5'GCCATCAATTAGTGTG3' (SEQ ID NO: 112), 5'AAGAATTCGGATGGC3' (SEQ ID NO: 113), 5'CAGACAGCGACCAA3' (SEQ ID NO: 114), and 5'TGACAGCCAGACAGC3' (SEQ ID NO: 115), 2. The compound of claim 1, wherein the oligonucleotide comprises one or more modified nucleic acids (e.g., BNA, LNA, ENA, cEt, or 2' modifications). (Item 8) the oligonucleotide is 5'GAATTCGGATGGCCA3' (SEQ ID NO: 62), 5'AGCCAGACAGCGA3' (SEQ ID NO: 65), 5'CGACCAAAAGAATT3' (SEQ ID NO: 98), 5'GACCAAAAGAATTCGG3' (SEQ ID NO: 99), 5'AGCATACTTACTGACA3' (SEQ ID NO: 100), 5'CATACTTACTGACA3' (SEQ ID NO: 101), 5'ATACTTACTGACAG3' (SEQ ID NO: 102), 5'CATACTTACTGACAGC3' (SEQ ID NO: 103), 5'AGACAGCGACCAAAAG3' (SEQ ID NO: 104), 5'ACAGCGACCAAAAG (SEQ ID NO: 105), 5'CAGCCAGACAGCGAC3' (SEQ ID NO: 106), 5'CAGCCAGACAGCGA3' (SEQ ID NO: 107), 5'ACAGCCAGACAGCGA3' (SEQ ID NO: 108), 5'GACAGCCAGACAGCG3' (SEQ ID NO: 109), 5'CATCAATTAGTGTCG3' (SEQ ID NO: 110), 5'CCATCAATTAGTGTCG3' (SEQ ID NO: 111), 5'GCCATCAATTAGTGTG3' (SEQ ID NO: 112), 5'AAGAATTCGGATGGC3' (SEQ ID NO: 113), 5'CAGACAGCGACCAA3' (SEQ ID NO: 114), and 5'TGACAGCCAGACAGC3' (SEQ ID NO: 115). (Item 9) 2. The compound according to item 1, comprising an oligonucleotide sequence having at least 70% sequence identity with a sequence selected from (SEQ ID NOs: 45 to 66) and (SEQ ID NOs: 98 to 115). (Item 10) 9. The compound according to item 8, wherein the oligonucleotide comprises at least five deoxyribonucleotide units and is capable of recruiting RNase. (Item 11) the oligonucleotide is LNA19: 5'GAAttcggatgGCCA3' (SEQ ID NO: 86), LNA22: 5'AGCCagacagCGA3' (SEQ ID NO: 89), LNA22.2: 5'CAGCcagacagCGAC3' (SEQ ID NO: 116), LNA22.3: 5'CAGccagacagCGAC3' (SEQ ID NO: 117), LNA22.5: 5'CAGccagacaGCGA3' (SEQ ID NO: 118), LNA22.6: 5'CAGccagacagCGA3' (SEQ ID NO: 119), LNA22.7: 5'CAGCcagacagCGA3' (SEQ ID NO: 120), LNA22.8: 5'ACAgccagacagCGA3' (SEQ ID NO: 121), LNA22.9: 5'ACAGccagacaGCGA3' (SEQ ID NO: 122), LNA22.10: 5'ACAgccagacaGCGA3' (SEQ ID NO: 123), LNA22.11: 5'GACAgccagacaGCG3' (SEQ ID NO: 124), LNA22.13: 5'GACagccagacaGCG3' (SEQ ID NO: 125), LNA22.14: 5'GACAgccagacAGCG (SEQ ID NO: 126), LNA24: 5'CATcaattagtgTCG3' (SEQ ID NO: 127), LNA25: 5'CCAtcaattagtgTCG3' (SEQ ID NO: 128), LNA26: 5'GCCatcaattagtGTG3' (SEQ ID NO: 129), LNA27: 5'AAGAattcggaTGGC3' (SEQ ID NO: 130), LNA28: 5'CAGacagcgacCAA3' (SEQ ID NO: 131), LNA29: 5'TGAcagccagacAGC3' (SEQ ID NO: 132), LNA14.5: 5'CGACcaaaagaATT3' (SEQ ID NO: 135), LNA14.8: 5'CGACcaaaagaaTTC3' (SEQ ID NO: 137), LNA14.28: 5'GACcaaaagaatTCGG3' (SEQ ID NO: 148), LNA14.30: 5'GACCaaaagaattCGG3' (SEQ ID NO: 149), LNA9.1: 5'AGCAtacttactGACA3' (SEQ ID NO: 159), LNA9.2a: 5'CATacttactgACA3' (SEQ ID NO: 160), LNA9.8: 5'ATActtactgACAG (SEQ ID NO: 164), LNA9.12: 5'CATActtactgacAGC (SEQ ID NO: 167), LNA8a: 5'AGAcagcgaccaaAAG (SEQ ID NO: 188), LNA8a.1: 5'AGACagcgaccaAAAG (SEQ ID NO: 189), and LNA8a.2: 5'ACAGcgaccaAAAG (SEQ ID NO: 190), 8. The compound according to item 7, wherein upper case letters indicate LNA nucleotides and lower case letters indicate DNA nucleotides. (Item 12) 2. The compound according to item 1, comprising an oligonucleotide sequence having at least 70% sequence identity with a sequence selected from LNA1 to LNA29 (SEQ ID NOs: 67 to 92 and SEQ ID NOs: 116 to 191). (Item 13) 1. A method of inhibiting influenza A virus in a cell, comprising: A method comprising contacting a sample containing viral RNA (vRNA) having a PSL2 motif with an effective amount of the oligonucleotide compound described in item 1. (Item 14) Contacting the sample with an agent reduces the number of viruses by at least 1 log 10 or the agent disrupts the overall structure of the PSL2 motif of the vRNA. (Item 15) 14. The method of claim 13, wherein the vRNA is isolated from a virion or a cell. (Item 16) 1. A method of treating or preventing influenza A virus infection in a subject, comprising: A method comprising administering to a subject in need of treatment or prevention of influenza A virus infection a pharmaceutical composition comprising an effective amount of the oligonucleotide compound described in item 1. (Item 17) 17. The method of claim 16, wherein the subject is at risk for influenza A virus infection and the administration of the oligonucleotide compound protects the subject from infection for one week or more. (Item 18) 18. The method of claim 17, wherein said administering comprises administering an effective dose of said oligonucleotide compound weekly, biweekly, or monthly. (Item 19) 17. The method of claim 16, wherein the pharmaceutical composition further comprises an additional active agent selected from a second oligonucleotide active agent and an antiviral agent. (Item 20) Item 17. The method of item 16, wherein the subject has been diagnosed with or is suspected of having an influenza A virus infection.

Claims

1. A pharmaceutical composition comprising an oligonucleotide compound having the sequence shown in 5'ATGCTGATCCCTGTC3' (sequence number 508) or a salt thereof, and a pharmaceutically acceptable diluent, carrier or vehicle.

2. The pharmaceutical composition of claim 1, wherein the oligonucleotide comprises at least one internucleoside bond selected from phosphorothioate, phosphorodithioate, phosphoramidate, and thiophosphoramidate bonds.

3. The pharmaceutical composition described in claim 2, wherein the oligonucleotide contains at least one phosphorothioate bond.

4. The pharmaceutical composition described in claim 3, wherein all of the internucleoside bonds are phosphorothioate bonds.

5. The pharmaceutical composition of claim 1, wherein the oligonucleotide comprises one or more 2'-modified nucleotides.

6. The pharmaceutical composition described in claim 5, wherein the oligonucleotide contains at least one LNA nucleotide.

7. The pharmaceutical composition described in claim 6, wherein the oligonucleotide comprises a plurality of LNA nucleotides.

8. A pharmaceutical composition comprising an oligonucleotide compound or a salt thereof having the sequence shown in 5'ATGCtgatccctGTC3' (sequence number 784), wherein capital letters indicate LNA nucleotides and lowercase letters indicate DNA nucleotides, and a pharmaceutically acceptable diluent, carrier or vehicle.

9. The pharmaceutical composition of claim 8, wherein the oligonucleotide comprises at least one phosphorothioate internucleoside linkage.

10. The pharmaceutical composition described in claim 9, wherein all of the internucleoside linkages are phosphorothioate linkages.