Pathogen-resistant animals with modified CD163 gene
Genetic modification of animals to inhibit CD163 function using CRISPR/Cas9 techniques addresses the inadequacies of PRRSV vaccines, enhancing resistance to PRRSV infection and reducing disease incidence.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-10-23
- Publication Date
- 2026-03-17
AI Technical Summary
Current vaccines for porcine reproductive and respiratory syndrome virus (PRRSV) are inadequate due to strain variability and immune system stimulation issues, and there is a lack of reliable techniques to identify persistently infected pigs, making control efforts difficult and costly.
Genetically modify animals to introduce chromosomal sequences that reduce or eliminate CD163 protein function, using CRISPR/Cas9 or other gene editing techniques to inhibit PRRSV entry and replication, thereby producing pathogen-resistant animals.
The modified animals exhibit increased resistance to PRRSV infection, reducing susceptibility and clinical symptoms, and provide a cost-effective alternative to vaccination strategies.
Smart Images

Figure 2026048623000001_ABST
Abstract
Description
[Technical Field]
[0001] The present invention relates to non-human animals and their offspring that contain at least one modified chromosomal sequence in the gene encoding the CD163 protein. The invention further relates to animal cells containing such modified chromosomal sequences. The animals and cells have increased resistance to pathogens, including porcine reproductive and respiratory syndrome virus (PRRSV). The animals and their offspring have chromosomal modifications of the CD163 gene, thereby inhibiting PRRSV entry and replication, and the resulting animals exhibit resistance to diseases and syndromes caused by the virus. The invention further relates to breeding methods for producing pathogen-resistant animals and populations of animals produced using such methods. The invention also relates to methods for gene editing of CD163, including direct injection of embryos, and the development of animals, founder animals, and strains that are resistant to pathogens such as PRRSV. [Background technology]
[0002] Porcine reproductive and respiratory syndrome virus (PRRSV) belongs to the group of mammalian arteriviruses (which also include mouse lactate dehydrogenase virus, monkey hemorrhagic fever virus, and equine arteritis virus). Arteriviruses share important characteristics associated with viral pathogenicity, including macrophage targeting and the ability to cause severe disease and persistent infection. Clinical disease syndromes caused by PRRSV infection were first reported in the United States in 1987 (Keffaber, 1989) and later in Europe in 1990 (Wensvoort et al., 1991). PRRSV infection results in respiratory illness, such as cough and fever, reproductive failure in late pregnancy, and reduced growth capacity. The virus is also involved in various multimicrobial disease syndrome interactions while maintaining asymptomatic infection throughout life (Rowland et al., 2012).
[0003] Since its emergence, PRRS has become the most important disease affecting commercial pigs in North America, Europe, and Asia, with Australia and Antarctica being the only continents free from the disease. In North America alone, losses associated with PRRSV are estimated to cost producers $664 million annually (Holtkamp et al., 2013). In 2006, a more severe form of the disease, known as highly pathogenic PRRS (HP-PRRS), killed pig populations across China. Genetic diversity has limited the development of vaccines needed to effectively control and eliminate the disease. Genetic selection against natural resistance is a possible option, but the results have been limited to date (Boddicker et al., 2014).
[0004] Molecular comparisons between North American and European viruses classify all PRRSV isolates into one of two genotypes, type 2 or type 1. Although the two genotypes share only about 70% identity at the nucleotide level (Nelsen et al., 1999), both share CD163-positive cell tropism, establish long-term infection, and produce similar clinical signs.
[0005] CD163 is a 130 kDa type 1 membrane protein consisting of nine scavenger receptor cysteine-rich (SRCR) domains (Fabriek et al., 2005). Porcine CD163 contains 17 exons encoding a peptide signal sequence, followed by nine SRCR domains, two linker domains (also called prolineserine threonine (PST) domains, located after SRCR6 and SRCR9), and a cytoplasmic domain, followed by a short cytoplasmic end. Surface expression of CD163 is restricted to cells of the monocyte-macrophage lineage. The protein was first identified in human tissues for its ability to bind to the hemoglobin-haptoglobin (HbHp) complex (Kristiansen et al., 2001). HbHp capture is the primary function of CD163, located at SRCR3 (Madsen et al., 2004). Metabolites released by macrophages after HbHp degradation include bilirubin, CO, and free iron. One important function of CD163 is the prevention of oxidative toxicity caused by free hemoglobin (Kristiansen et al., 2001; Soares et al., 2009).
[0006] CD163 was first described as a receptor for PRRSV by Calvert et al. (2007). Transfection of non-tolerant cell lines with CD163 cDNA from various species, including monkeys, humans, dogs, and mice, can make the cells tolerant to PRRSV infection (Calvert et al., 2007). In addition to CD163, a second receptor protein, CD169 (also known as sialoadhesin or SIGLEC1), was identified as the primary PRRSV receptor involved in the formation of initial interactions with the GP5-matrix(M) heterodimer, the main protein on the surface of virions (Delputte et al., 2002). In this model, subsequent interactions between CD163 and the GP2,3,4 heterotrimer within the endosomal compartment mediate decoating and the release of the viral genome into the cytoplasm (Van Breedam et al., 2010, Allende et al., 1999). Previous models explaining PRRSV infection in alveolar macrophages identified SIGLEC1 (CD169) as the primary viral receptor on the surface of macrophages; however, SIGLEC1 - / - Prior studies using pigs showed no difference in viral replication compared to wild-type pigs (Prather et al., 2013). These results supported previous in vitro studies showing that PRRSV-resistant cell lines lacking surface CD169 and CD163 supported viral replication after transfection with the CD163 plasmid (Welch et al., 2010).
[0007] Many characteristics of PRRSV, both in terms of pathogenicity (particularly at the molecular level) and zoonotic epidemiology, are poorly understood, thus making control efforts difficult. Currently, producers often vaccinate pigs against PRRSV using modified live attenuated strains or inactivated virus vaccines; however, current vaccines often do not provide satisfactory protection. This is due to both strain variability and inadequate stimulation of the immune system. In addition to concerns about the efficacy of available PRRSV vaccines, modified live vaccines currently in use can persist in individual pigs and pig herds, and there is strong evidence that mutations can accumulate, as demonstrated in pathogenic field isolates after experimental infection of pigs (Rowland et al., Virology, 259:262-266 (1999)) (Mengeling et al., Am. J. Vet. Res, 60(3): 334-340 (1999)). Furthermore, it has been shown that the vaccine virus is excreted in the semen of vaccinated boars (Christopher-Hennings et al., Am. J. Vet. Res, 58(1): 40-45 (1997)). As an alternative to vaccination, some experts advocate a “test and elimination” strategy in breeding populations (Dee and Molitor, Vet. Rec., 143:474-476 (1998)). The success of this strategy depends on the elimination of all pigs acutely or persistently infected with PRRSV, followed by strict control to prevent reintroduction of the virus. Much of the difficulty and cost associated with this strategy stems from the fact that little is known about the pathogenesis of persistent PRRSV infection, and therefore there are no reliable techniques for identifying persistently infected pigs.
[0008] As described above, there is a need in this field for the development of strategies to induce PRRSV resistance in animals. [Overview of the project]
[0009] Provided are non-human animals, their progeny, and animal cells comprising at least one modified chromosomal sequence in a gene encoding a CD163 protein.
[0010] Also provided is a breeding method for producing an animal or strain with reduced susceptibility to infection by a pathogen. The method comprises genetically modifying an oocyte or sperm cell to introduce a modified chromosomal sequence in a gene encoding a CD163 protein into at least one of the oocyte and sperm cell, and fertilizing the oocyte with the sperm cell to produce a fertilized egg comprising the modified chromosomal sequence in a gene encoding a CD163 protein. Alternatively, the method comprises genetically modifying a fertilized egg to introduce a modified chromosomal sequence in a gene encoding a CD163 protein into the fertilized egg. The method further comprises transplanting the fertilized egg into a surrogate female animal (wherein progeny animals are produced by pregnancy and normal delivery), screening the progeny animals for susceptibility to the pathogen, and selecting progeny animals with reduced susceptibility to the pathogen as compared to animals not comprising the modified chromosomal sequence in a gene encoding a CD163 protein.
[0011] Also provided is a population of animals produced by the breeding method.
[0012] Further provided is a method for increasing the resistance of domestic animals to infection by a pathogen. The method comprises genetically editing at least one chromosomal sequence derived from a gene encoding a CD163 protein, whereby the production or activity of CD163 protein is reduced as compared to the production or activity of CD63 protein in a domestic animal not comprising an edited chromosomal sequence in a gene encoding a CD163 protein.
[0013] The modification of the chromosomal sequence in a gene encoding a CD163 protein provided herein reduces the susceptibility of an animal, progeny, cell, or population (e.g., a porcine animal, progeny, cell, or population) to a pathogen (e.g., a virus such as porcine reproductive and respiratory syndrome virus (PRRSV)).
[0014] In any of the animals, progeny, cells, populations, and methods provided herein, a modified chromosomal sequence can result in the production of a CD163 protein that is substantially non-functional by the animal, progeny, cell, or population.
[0015] In any of the animals, progeny, cells, populations, and methods provided herein, the modified chromosomal sequence can include an in-frame deletion in the gene encoding the CD163 protein.
[0016] In any of the porcine animals, offspring, cells, populations, and methods provided herein, the modified chromosome sequence may include SEQ ID NO:118. Alternatively, alterations to the chromosomal sequence in the gene encoding the CD163 protein may include: an 11-base pair deletion from nucleotide 3,137 to nucleotide 3,147 compared to the reference sequence SEQ ID NO:47; a 2-base pair insertion between nucleotides 3,149 and 3,150 compared to the reference sequence SEQ ID NO:47, and a 377-base pair deletion from nucleotides 2,573 to nucleotide 2,949 on the same allele compared to the reference sequence SEQ ID NO:47; a 124-base pair deletion from nucleotide 3,024 to nucleotide 3,147 compared to the reference sequence SEQ ID NO:47; a 123-base pair deletion from nucleotide 3,024 to nucleotide 3,146 compared to the reference sequence SEQ ID NO:47; a 1-base pair insertion between nucleotide 3,147 and nucleotide 3,148 compared to the reference sequence SEQ ID NO:47; Compared to NO:47, there is a 130-base pair deletion from nucleotide 3,030 to nucleotide 3,159; compared to reference sequence SEQ ID NO:47, there is a 132-base pair deletion from nucleotide 3,030 to nucleotide 3,161; compared to reference sequence SEQ ID NO:47, there is a 1,506-base pair deletion from nucleotide 1,525 to nucleotide 3,030; compared to reference sequence SEQ ID NO:47, there is a 7-base pair insertion between nucleotide 3,148 and nucleotide 3,149; compared to reference sequence SEQ ID NO:47, there is a 1,280-base pair deletion from nucleotide 2,818 to nucleotide 4,097; compared to reference sequence SEQ ID NO:47, there is a 1,373-base pair deletion from nucleotide 2,724 to nucleotide 4,096; compared to reference sequence SEQ ID NO:47, there is a 1,467-base pair deletion from nucleotide 2,431 to nucleotide 3,897;Compared to the reference sequence SEQ ID NO:47, there is a 1930 base pair deletion from nucleotide 488 to nucleotide 2,417, where the deleted sequence is replaced by a 12 base pair insertion starting at nucleotide 488, and a further 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172; a 28 base pair deletion from nucleotide 3,145 to nucleotide 3,172; a 1387 base pair deletion from nucleotide 3,145 to nucleotide 4,531; a 1382 base pair deletion from nucleotide 3,113 to nucleotide 4,494; where the deleted sequence is replaced by an 11 base pair insertion starting at nucleotide 3,113; reference sequence SEQ ID Compared to NO:47, a 1720 base pair deletion from nucleotide 2,440 to nucleotide 4,160; compared to reference sequence SEQ ID NO:47, a 452 base pair deletion from nucleotide 3,015 to nucleotide 3,466; or any combination thereof.
[0017] Nucleic acids are also provided. The nucleic acid molecule comprises a nucleotide sequence selected from the group consisting of: (a) a nucleotide sequence comprising SEQ ID NO:47; (b) a nucleotide sequence having at least 80% sequence identity with respect to the sequence of SEQ ID NO:47, wherein the nucleotide sequence comprises at least one substitution, insertion, or deletion with respect to SEQ ID NO:47; and (c) a cDNA sequence of (a) or (b).
[0018] For example, a nucleic acid molecule may include: (a) a nucleotide sequence having at least 87.5% sequence identity with respect to the sequence of SEQ ID NO:47, wherein the nucleotide sequence includes at least one substitution, insertion, or deletion with respect to SEQ ID NO:47; or (b) the cDNA sequence of (a).
[0019] Further nucleic acids are also provided. These nucleic acids may include SEQ ID NO: 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 118, or 119.
[0020] Any of the nucleic acid molecules can be isolated.
[0021] Other purposes and features will be partially revealed and partially pointed out below. [Brief explanation of the drawing]
[0022] [Figure 1] This panel shows targeting vectors and CRISPR used to modify CD163. Panel A shows wild-type exons 7, 8, and 9 of the CD163 gene targeted for modification using CRISPR. Panel B shows a targeting vector designed to replace porcine exon 7 (the porcine domain SRCR5 of CD163) with DNA encoding human SRCR8 of CD163L. This targeting vector was used in transfection along with drug selection by G418. PCR primers for long-range left-arm and right-arm assays are labeled with arrows for 1230, 3752, 8791, 7765, and 7775. Panel C shows the same targeting vector as shown in Panel B, but with the Neo cassette removed. This targeting vector was used to target intracellular CD163 that is already resistant to neomycin. Primers used in small deletion assays are indicated with arrows and labeled with GCD163F and GCD163R. Panel D highlights the exons targeted by CRISPR. The locations of CRISPR10, 131, 256, and 282 are indicated by downward arrows on exon 7. The CRISPR numbers represent the base pair numbers from the intron-exon junctions of intron 6 and exon 7. [Figure 2]This panel shows the targeting vector and CRISPR used to modify CD1D. Panel A shows wild-type exons 3, 4, 5, 6, and 7 of the CD1D gene targeted for CRISPR modification. Panel B shows a targeting vector designed to replace exon 3 with the selectable marker Neo. This targeting vector was used in combination with CRISPR to modify CD1D. PCR primers for long-range left-arm and right-arm assays are labeled with arrows for 3991, 4363, 7373, and 12806. Panel C shows the exons targeted by CRISPR. The positions of CRISPR 4800, 5350, 5620, and 5626 are represented by downward arrows for exon 3. Primers used in small deletion assays are indicated by arrows and labeled with GCD1DF and GCD1DR. [Figure 3]This shows the creation of CD163 and CD1D knockout pigs using CRISPR / Cas9 and SCNT. A) Targeted deletion of CD163 in somatic cells after transfection with CRISPR / Cas9 and donor DNA. A 6545 base pair (bp) band is obtained in the wild-type (WT) genotype. Lanes 1-6 represent six different colonies from single transfection with CRISPR10 and Cas9 and donor DNA containing Neo. Lanes 1, 4, and 5 show large homozygous deletions of 1500-2000 bp. Lane 2 represents a smaller homozygous deletion. Lanes 3 and 6 represent either WT alleles and small deletions or biallelic modifications of both alleles. The exact modification of each colony was determined solely by sequencing of the colonies used for SCNT. Faint WT bands in some lanes may represent cross-contamination of fetal fibroblasts from adjacent WT colonies. NTC = No-template control. B) Targeted deletion of CD1D in somatic cells after transfection with CRISPR / Cas9 and donor DNA. An 8729 bp band is obtained in the WT genotype. Lanes 1-4 represent colonies with 500-2000 bp deletions of CD1D. Lane 4 appears to be a WT colony. NTC = No Template Control. C) Image of a CD163 knockout pig generated by SCNT during the study. This male piglet contains a homozygous 1506 bp deletion of CD163. D) Image of a CD1D piglet generated during the study. These piglets contain a 1653 bp deletion of CD1D. E) Genotypes of two SCNT littermates containing a 1506 bp deletion of CD163. Lanes 1-3 (littermate 63) and 1-4 (littermate 64) represent the genotype for each piglet from each littermate. Sows indicate recipient females of SCNT embryos, and WT represents the WT control. NTC = No Template Control. F) Genotypes of two SCNT littermates containing a 1653bp deletion in CD1D. Lanes 1-7 (littermate 158) and 1-4 (littermate 159) represent the genotype of each piglet. [Figure 4]This paper demonstrates the effects of the CRISPR / Cas9 system in pig embryos. A) Frequency of blastocyst formation after injection of different concentrations of the CRISPR / Cas9 system into zygotes. The toxicity of the CRISPR / Cas9 system was lowest at 10 ng / μl. B) When introduced into zygotes, the CRISPR / Cas9 system successfully inhibits eGFP expression in blastocysts. Original magnification x4. C) Types of mutations on eGFP produced using the CRISPR / Cas9 system: WT genotype (SEQ ID NO: 16), #1 (SEQ ID NO: 17), #2 (SEQ ID NO: 18), and #3 (SEQ ID NO: 19). [Figure 5] This shows the effect of the CRISPR / Cas9 system on targeting CD163 in pig embryos. A) Examples of mutations created on CD163 by the CRISPR / Cas9 system: WT genotype (SEQ ID NO: 20), #1-1 (SEQ ID NO: 21), #1-4 (SEQ ID NO: 22), and #2-2 (SEQ ID NO: 23). All embryos examined by DNA sequencing showed mutations on CD163 (18 / 18). CRISPR131 is highlighted in bold. B) Sequence reading data of homozygous deletions induced by the CRISPR / Cas9 system. The image shows #1-4 from panel A carrying a 2bp deletion on CD163. [Figure 6]This shows the effect of the CRISPR / Cas9 system when two types of CRISPR are introduced. A) PCR amplification of CD163 in blastocysts injected with CRISPR / Cas9 as a zygote. Lanes 1, 3, 6, and 12 show designed deletions between two different CRISPRs. B) PCR amplification of CD1D in blastocysts injected with CRISPR / Cas9 as a zygote. CD1D had a lower deletion frequency (3 / 23) compared to CD163, as determined by gel electrophoresis; lanes 1, 8, and 15 show clear deletions in CD1D. C) The CRISPR / Cas9 system successfully targeted two genes when the system was provided with two CRISPRs targeting CD163 and eGFP. Modifications of CD163 and eGFP are shown: CD163WT (SEQ ID NO: 24), CD163#1 (SEQ ID NO: 25), CD163#2 (SEQ ID NO: 26), CD163#3 (SEQ ID NO: 27), eGFPWT (SEQ ID NO: 28), eGFP#1-1 (SEQ ID NO: 29), eGFP#1-2 (SEQ ID NO: 30), eGFP#2 (SEQ ID NO: 31), and eGFP#3 (SEQ ID NO: 32). [Figure 7]This image shows CD163 knockout pigs prepared by a CRISPR / Cas9 system injected into a zygote. A) PCR amplification of CD163 from the knockout pigs; clear signs of deletion were detected in littermates 67-2 and 67-4. B) Image of the CD163 knockout pigs with their surrogate mother. All animals are healthy and show no signs of abnormality. C) Genotype of the CD163 knockout pigs. The wild-type (WT) sequence is shown as SEQ ID NO:33. Two animals (from littermates 67-1 (SEQ ID NO:34) and 67-3 (SEQ ID NO:37)) carry homozygous deletions or insertions in CD163. The other two animals (from littermates 67-2 and 67-4) possessed both allele variants of CD163: #67-2A1 (SEQ ID NO: 35), #67-2A2 (SEQ ID NO: 36), #67-4A1 (SEQ ID NO: 38), and #67-4a2 (SEQ ID NO: 39). The deletion was induced by introducing two different CRISPR-Cas9 systems. Animals derived from zygote injection for CD163 did not exhibit mosaic genotypes. [Figure 8] This image shows CD1D knockout pigs produced by a CRISPR / Cas9 system injected into a zygote. A) PCR amplification of CD1D from knockout pigs; 166-1 shows a mosaic genotype for CD1D. 166-2, 166-3, and 166-4 show no size changes for the amplicons, but amplicon sequencing revealed modifications. WT FF = wild-type fetal fibroblasts. B) PCR amplification of a long-range assay showed a clear deletion of one allele in piglets 166-1 and 166-2. C) Image of a CD1D knockout pig with its surrogate mother. D) Sequence data of CD1D knockout pigs; WT (SEQ ID NO:40), #166-1.1 (SEQ ID NO:41), #166-1.2 (SEQ ID NO:42), #166-2 (SEQ ID NO:43), #166-3.1 (SEQ ID NO:44), #166-3.2 (SEQ ID NO:45), and #166-4 (SEQ ID NO:46). The atg start codon in exon 3 is shown in bold and in lowercase. [Figure 9] This report describes the clinical signs during acute PRRSV infection. It includes results from daily assessments of respiratory signs and fever in patients with CD163+ / + (n=6) and CD163- / - (n=3). [Figure 10] This shows the histopathological diagnosis of lung tissue during acute PRRSV infection. Representative micrographs of H and E stained tissue from wild-type and knockout pigs. The left panel shows mononuclear cell edema and infiltration. The right panel, from a knockout pig, shows the lung structure of a normal lung. [Figure 11] The data shows various genotypes of viremia. Note that the CD163- / - piglet data is located along the X-axis. [Figure 12] This shows antibody production in null, wild-type, and uncharacterized allergenic pigs. [Figure 13-1] This shows the cell surface expression of CD163 in individual pigs. Lines appearing to the right in the uncharacterized A, uncharacterized B, and CD163+ / + panels represent CD163 antibody, while lines appearing to the left in these panels represent antibody-free control (background). Note that in CD163- / - animals, CD163 staining overlaps with the background control, and CD163 staining in the uncharacterized alleles is roughly intermediate between WT levels and background (this is on a logarithmic scale, and therefore less than approximately 10%). [Figure 13-2] This shows the cell surface expression of CD163 in individual pigs. Lines appearing to the right in the uncharacterized A, uncharacterized B, and CD163+ / + panels represent CD163 antibody, while lines appearing to the left in these panels represent antibody-free control (background). Note that in CD163- / - animals, CD163 staining overlaps with the background control, and CD163 staining in the uncharacterized alleles is roughly intermediate between WT levels and background (this is on a logarithmic scale, and therefore less than approximately 10%). [Figure 13-3]This shows the cell surface expression of CD163 in individual pigs. Lines appearing to the right in the uncharacterized A, uncharacterized B, and CD163+ / + panels represent CD163 antibody, while lines appearing to the left in these panels represent antibody-free control (background). Note that in CD163- / - animals, CD163 staining overlaps with the background control, and CD163 staining in the uncharacterized alleles is roughly intermediate between WT levels and background (this is on a logarithmic scale, and therefore less than approximately 10%). [Figure 13-4] This shows the cell surface expression of CD163 in individual pigs. Lines appearing to the right in the uncharacterized A, uncharacterized B, and CD163+ / + panels represent CD163 antibody, while lines appearing to the left in these panels represent antibody-free control (background). Note that in CD163- / - animals, CD163 staining overlaps with the background control, and CD163 staining in the uncharacterized alleles is roughly intermediate between WT levels and background (this is on a logarithmic scale, and therefore less than approximately 10%). [Figure 14] The levels of CD169 on alveolar macrophages from three representative pigs and an antibody-free control are shown (FITC-labeled anti-CD169). [Figure 15] Various genotypes of viremia are observed. Note that the Δ43 amino acid piglet data is located along the X axis. [Figure 16-1] The genome sequence of wild-type CD163 exons 7-10, used as the reference sequence (SEQ ID NO: 47), is shown. The sequence includes the portion from 3000 bp upstream of exon 7 to the final base of exon 10. The underlined regions indicate the positions of exons 7, 8, 9, and 10, respectively. [Figure 16-2]The genome sequence of wild-type CD163 exons 7-10, used as the reference sequence (SEQ ID NO: 47), is shown. The sequence includes the portion from 3000 bp upstream of exon 7 to the final base of exon 10. The underlined regions indicate the positions of exons 7, 8, 9, and 10, respectively. [Figure 17] This figure shows several CD163 gene modifications, the predicted protein product for each modification, and the relative macrophage expression for each modification, as measured by the level of surface CD163 on porcine alveolar macrophages (PAMs). Black regions indicate introns, and white regions indicate exons. Shaded regions indicate the hCD163L1 exon 11 mimetic, a homolog of porcine exon 7. Gray regions indicate synthetic introns with the PGK Neo construct. [Figure 18] The diagrams of the porcine CD163 protein and gene sequence are shown. A) CD163 protein SRCR (oval) and PST (square) domains shown with their corresponding gene exons. B) Comparison of porcine CD163 SRCR5 (SEQ ID NO: 120) with the human CD163L1 SRCR8 (SEQ ID NO: 121) homolog. [Figure 19-1] Representative results for the surface expression of CD163 and CD169 on PAMs from wild-type and CD163-modified pigs are shown. Panel AE shows the results for the CD163 gene modification shown in Figure 17. Pooled data for d7(1467) and d7(1280) are shown in Panel D. [Figure 19-2] Representative results for the surface expression of CD163 and CD169 on PAMs from wild-type and CD163-modified pigs are shown. Panel AE shows the results for the CD163 gene modification shown in Figure 17. Pooled data for d7(1467) and d7(1280) are shown in Panel D. [Figure 20] This shows serum haptoglobin levels in wild-type and CD163-modified pigs. [Figure 21] This study demonstrates relative tolerance of wild-type and HL11m PAM to infection by type 2 PRRSV isolates. [Figure 22] This shows infection with type 1 and type 2 PRRSV isolates from CD163-modified pigs. [Figure 23] This shows the viral load in wild-type (WT) and CD163-modified pigs infected with type 2 virus. [Modes for carrying out the invention]
[0023] Methods for producing animals and gene-edited animals that have modifications to the CD163 gene and are resistant to PRRSV and other related respiratory viral infections are provided herein. The animals have chromosomal modifications (insertions or deletions) that inactivate or otherwise regulate CD163 gene activity. CD163 is required for PRRSV entry into cells and viral replication. Therefore, null CD163 animals exhibit resistance to PRRSV infection upon exposure. These animals can be produced using any of many protocols that utilize gene editing.
[0024] Methods for producing porcine animals are also provided herein, comprising introducing into porcine animal cells or porcine embryos a substance that specifically binds to a target site on a cell's chromosome and causes double-strand DNA breaks, or otherwise inactivates or reduces the activity of the CD163 gene or protein therein, using gene editing methods, such as clustered and regularly arranged short palindromic sequence repeats (CRISPR) / Cas systems, transcription activator-like effector nucleases (TALENs), zinc finger nucleases (ZFNs), recombinase fusion proteins, or meganucleases.
[0025] The use of one or more specific CD163 loci in cooperation with polypeptides capable of cleaving and / or incorporating specific nucleic acid sequences within the CD163 locus is also described herein. Examples of the use of the CD163 locus in cooperation with polypeptides or RNA capable of cleaving and / or incorporating the CD163 locus include polypeptides selected from the group consisting of zinc finger proteins, meganucleases, TAL domains, TALENs, RNA-guided CRISPR / Cas recombinases, leucine zippers, and others known to those skilled in the art. Specific examples include chimeric ("fusion") proteins containing site-specific DNA-binding domain polypeptides and cleavage domain polypeptides (e.g., nucleases), such as ZFN proteins containing zinc finger polypeptides and FokI nuclease polypeptides. Polypeptides containing DNA-binding domains that specifically bind to the CD163 gene are described herein. Such polypeptides may also contain a nuclease (cleavage) domain or half-domain (e.g., a homing endonuclease, e.g., a homing endonuclease having a modified DNA-binding domain) and / or a ligase domain, so that the polypeptide can induce targeted double-strand breaks and / or promote recombination of the target nucleic acid at the cleavage site. The DNA-binding domain targeting the CD163 locus may be a DNA-cleavage functional domain. The polypeptide can be used to introduce exogenous nucleic acids into the genome of a host organism (e.g., a certain animal species) at one or more CD163 loci. The DNA-binding domain may contain a zinc finger protein having one or more zinc fingers (e.g., 2, 3, 4, 5, 6, 7, 8, 9 or more zinc fingers), which has been engineered to bind to any sequence within the CD163 gene (non-naturally derived). Any of the zinc finger proteins described herein may bind to a target site within the coding sequence or adjacent sequence of the target gene (e.g., a promoter or other expression element). Zinc finger proteins can bind to target sites in the CD163 gene.
[0026] definition Units, prefixes, and symbols may be shown in their SI-approved forms. Unless otherwise specified, nucleic acids are written from left to right in a 5' to 3' orientation, and amino acid sequences are written from left to right in an amino to carboxyl orientation. Numerical ranges enumerated in this specification include the digit defining the range and each integer within the defined range. Amino acids may be referred to herein by either their commonly known three-letter symbols or the single-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Committee. Nucleotides may similarly be referred to by their commonly accepted single-letter codes. Unless otherwise specified, software, electrical, and electronics terms used herein are as defined in The New IEEE Standard Dictionary of Electrical and Electronics Term (5th edition, 1993). The terms defined below are further defined by referring to this specification as a whole.
[0027] As will be understood by those skilled in the art, for any and all purposes, and especially in terms of providing written detail, all ranges enumerated herein also include any and all possible subranges and combinations thereof, as well as the individual values, in particular integer values, that constitute those ranges. Each enumerated range includes each specific value, integer, decimal, or identity within its range. Any enumerated range can be readily recognized as sufficiently describing and enabling the decomposition of the same range into at least equal 1 / 2, 1 / 3, 1 / 4, 1 / 5, or 1 / 10. As a non-limiting example, each range described herein can readily be decomposed into a lower third, a middle third, an upper third, and so on.
[0028] When introducing elements of the present invention or its preferred embodiments, the articles “a, an,” “the,” and “the said” are intended to mean that there is one or more of those elements. The terms “include,” “contain,” and “have” are intended to be inclusive and mean that there may be additional elements other than those listed.
[0029] The terms “and / or” mean any one of the items, any combination of the items, or all of the items to which the term relates. The phrase “one or more” will be readily understood by those skilled in the art, especially when read in the context of its use.
[0030] A "binding protein" is a protein that can bind to another molecule. Binding proteins can, for example, bind to DNA molecules (DNA-binding proteins), RNA molecules (RNA-binding proteins), and / or protein molecules (protein-binding proteins). In the case of protein-binding proteins, they can bind to themselves (forming homodimers, homotrimers, etc.) and / or to one or more molecules of one or more different proteins. A binding protein can have more than one type of binding activity. For example, zinc finger proteins have DNA-binding, RNA-binding, and protein-binding activity.
[0031] The term “conserved modified variant” applies to both amino acids and nucleic acid sequences. For a given nucleic acid sequence, “conserved modified variant” refers to a nucleic acid that codes for an identical or conserved modified variant of the amino acid sequence. Due to the degeneracy of the genetic code, a large number of functionally identical nucleic acids code for any given protein. For example, the codons GCA, GCC, GCG, and GCU all code for the amino acid alanine. Thus, at all positions where alanine is identified by the codon, the codon can be changed to any of the corresponding codons described without altering the encoded polypeptide. Such nucleic acid mutations are “silent mutations” and represent one species of conserved modified mutation. All nucleic acid sequences herein that code for polypeptides also describe all possible silent mutations of the nucleic acid by reference to the genetic code.
[0032] Those skilled in the art will recognize that each codon in a nucleic acid (except as listed below: AUG (which is usually the sole codon for methionine); and UGG (which is usually the sole codon for tryptophan)) can be modified to obtain a functionally identical molecule. Therefore, each silent mutation in the nucleic acid encoding the polypeptide of the present invention is implicit in each described polypeptide sequence and falls within the scope of the invention.
[0033] With respect to amino acid sequences, those skilled in the art will recognize that any substitution, deletion, or deletion of a single amino acid or a few amino acids in the encoded sequence of a nucleic acid, peptide, polypeptide, or protein sequence is a "conserved modification variant" if the modification is a substitution of an amino acid with a chemically similar amino acid. Thus, for example, any number of amino acid residues selected from the group of integers from 1 to 15 can be modified in this way. For example, modifications of 1, 2, 3, 4, 5, 7, or 10 are possible.
[0034] Conservative modified variants typically provide similar biological activity to the unmodified polypeptide sequences from which they originate. For example, substrate specificity, enzyme activity, or ligand / receptor binding are generally at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% of that of the native protein relative to its native substrate. Conservative substitution tables that provide functionally similar amino acids are well known in the art.
[0035] The following six groups each contain amino acids that are conserved substitutions with each other: [1] alanine (A), serine (S), threonine (T); [2] aspartic acid (D), glutamic acid (E); [3] asparagine (N), glutamine (Q); [4] arginine (R), lysine (K); [5] isoleucine (I), leucine (L), methionine (M), valine (V); and [6] phenylalanine (F), tyrosine (Y), tryptophan (W). See also Creighton (1984) Proteins WH Freeman and Company.
[0036] The term "CRISPR" refers to "clustered, regularly arranged short palindromic sequence repeats." The term "Cas9" refers to "CRISPR-related protein 9." The term "CRISPR / Cas9" or "CRISPR / Cas9 system" refers to a programmable nuclease system for genetic engineering, which comprises the Cas9 protein or its derivatives, and one or more non-coding RNAs and transactivating RNAs (tracrRNAs) for Cas9 that can provide the function of CRISPR RNA (crRNA). crRNAs and tracrRNAs can be used individually or combined to generate "guide RNAs" (gRNAs). The crRNA or gRNA provides a sequence complementary to a genomic target. The CRISPR / Cas9 system is further described below.
[0037] In this specification, any reference to a deletion in a nucleotide sequence from nucleotide x to nucleotide y means that all nucleotides within that range, including x and y, have been deleted. Therefore, for example, the phrase "11 base pair deletions from nucleotide 3,137 to nucleotide 3,147 compared to SEQ ID NO: 47" means that each of the nucleotides from nucleotide 3,317 to 3,147, including nucleotides 3,317 and 3,147, has been deleted.
[0038] "Disease resistance" is a characteristic of an animal in which the animal avoids disease symptoms resulting from animal-pathogen interactions, such as the interaction between a pig and PRRSV. That is, the pathogen is prevented from causing animal disease and associated disease symptoms, or instead results in a reduction in the incidence and / or severity of clinical signs or a reduction in clinical symptoms. Those skilled in the art will recognize that the compositions and methods disclosed herein can be used in conjunction with other compositions and methods available in the art to protect animals from pathogen attacks.
[0039] The terms "encode" or "encoded" for a particular nucleic acid mean that it contains information for translation into a specific protein. Protein-coding nucleic acids may or may not contain intervening sequences (e.g., introns) within their coding region (e.g., cDNA). The information encoding the protein is identified by the use of codons. Typically, amino acid sequences are encoded by nucleic acids using a "universal" genetic code. When nucleic acids are synthetically prepared or modified, known codon selections from the intended host on which the nucleic acid is expressed are available.
[0040] In this specification, “gene editing,” “gene-edited,” “genetically edited,” and “gene-editing effector” refer to the use of homing techniques using naturally derived or artificially engineered nucleases (also known as “molecular scissors,” “homing endonucleases,” or “targeting endonucleases”). Nucleases generate specific double-strand breaks (DSBs) at desired locations within the genome, which, in some cases, utilize endogenous cellular mechanisms to repair the induced breaks through the natural processes of homologous recombination (HR) and / or non-homologous end joining (NHEJ). Examples of gene-editing effectors include zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), clustered and regularly arranged short palindromic sequence repeats / CAS9 (CRISPR / Cas9) systems, and meganucleases (e.g., meganucleases redesigned as homing endonucleases). These terms also include the use of gene transfer procedures and techniques, such as those in which the modification is a deletion or a fairly small insertion (typically less than 20 nt) and / or does not involve the introduction of DNA from an exotic species. The term also encompasses offspring animals, such as those produced by sexual mating or asexual reproduction from the initial gene-edited animal.
[0041] In this specification, "heterogeneity" with respect to nucleic acids means that they originate from an alien species, or, if from the same species, are substantially modified from their native form in composition and / or genomic locus by planned human intervention. For example, promoters operably linked to heterogeneous structural genes originate from a different species than the structural gene, or, if from the same species, one or both are substantially modified from their original forms. Heterogeneous proteins may originate from an alien species, or, if from the same species, are substantially modified from their original forms by planned human intervention.
[0042] In this specification, "homing DNA technology," "homing technology," and "homing endonuclease" encompass any mechanism that targets a specific molecule to a specific DNA sequence, including zinc finger (ZF) proteins, activator-like effectors (TALEs), meganucleases, and the CRISPR / Cas9 system.
[0043] The terms “increased resistance” and “reduced susceptibility” as used herein mean, but are not limited to, a statistically significant reduction in the incidence and / or severity of clinical signs or symptoms associated with infection by a pathogen. For example, “increased resistance” or “reduced susceptibility” may refer to a statistically significant reduction in the incidence and / or severity of clinical signs or symptoms associated with infection by PRRSV in animals containing at least one modified chromosome sequence in the gene encoding the CD163 protein, compared to control animals with an unmodified chromosome sequence. The term “statistically significant reduction in clinical symptoms” means, but is not limited to, that the incidence of at least one clinical symptom in the edited group of subjects is at least 10%, preferably at least 20%, more preferably at least 30%, even more preferably at least 50%, and even more preferably at least 70% lower than in the unedited control group after exposure to the infectious pathogen.
[0044] In this specification, the term "knock-in" means the replacement of an endogenous gene with an introduced gene or the same endogenous gene having one or more structural modifications, while the transcriptional regulation of the endogenous gene is preserved.
[0045] "Knockout" refers to the disruption of a gene's structure or regulatory mechanism. Knockout can be achieved through homologous recombination of targeting vectors, substitution vectors, or hit-and-run vectors, or through random insertion of gene trap vectors, resulting in complete, partial, or conditioned loss of gene function.
[0046] The term “animal” includes any non-human animal, e.g., domesticated animal (e.g., livestock). The term “livestock” includes any animal traditionally raised in livestock farming, e.g., pig, cattle (e.g., beef or dairy), sheep, goats, horses (e.g., horses or donkeys), buffalo, camels, or birds (e.g., chickens, turkeys, ducks, geese, guinea fowl, or chicks). The term “livestock” does not include rats, mice, or other rodents.
[0047] In this specification, the term “mutation” includes any alteration of the nucleotide sequence of a polynucleotide, such as a gene or coding DNA sequence (CDS), compared to a wild-type sequence. This term includes, but is not limited to, substitutions, insertions, frameshifts, deletions, inversions, translocations, duplications, splice-donor site mutations, and point mutations.
[0048] In this specification, “operably linked” includes a reference to a functional linkage between two nucleic acid sequences, for example, a promoter sequence and a second sequence, where the promoter sequence initiates and mediates the transcription of the DNA sequence corresponding to the second sequence. In general, "operably linked" means that the linked nucleic acid sequences are in close proximity and, if necessary, link two protein-coding regions in close proximity and within the same reading frame.
[0049] In this specification, “polynucleotide” includes references to deoxyribopolynucleotides, ribopolynucleotides, or conserved modified variants; the term may also refer to its analogues that possess the essential properties of natural ribonucleotides in that they hybridize to substantially the same nucleotide sequences as naturally occurring nucleotides under stringent hybridization conditions and / or enable translation to the same amino acids as naturally occurring nucleotides. Polynucleotides can be full-length or partial sequences of natural or heterologous structures or regulatory genes. Unless otherwise noted, the term includes references to specific sequences and their complementary sequences. Thus, DNA or RNA with backbone modifications for stability or other reasons is a “polynucleotide” as the term intends herein. Furthermore, to give just two examples, DNA or RNA containing abnormal bases, e.g., inosine, or modified bases, e.g., tritylated bases, is a polynucleotide as the term is used herein. It will be recognized that a wide variety of modifications have been made to DNA and RNA to serve many useful purposes known to those skilled in the art.
[0050] As used herein, the term polynucleotide encompasses such chemically, enzymatically, or metabolically modified forms of polynucleotides, as well as the chemical forms of DNA and RNA specific to viruses and cells, such as, among other things, simple and complex cells.
[0051] The terms “polypeptide,” “peptide,” and “protein” are used interchangeably herein and refer to polymers of amino acid residues. These terms may also apply to conserved modified variants and amino acid polymers, in which case one or more amino acid residues are the corresponding naturally occurring amino acids, as well as artificial chemical analogs of naturally occurring amino acid polymers. An essential property of such analogs of naturally occurring amino acids is that, when incorporated into a protein, the protein reacts specifically to antibodies induced against the same protein, except that it is composed entirely of naturally occurring amino acids.
[0052] The terms “polypeptide,” “peptide,” and “protein” also include modifications, including, but are not limited to, glycosylation, lipid attachment, sulfation, γ-carboxylation, hydroxylation, and ADP-ribosylation of glutamate residues. As is well known, and as mentioned above, it will be recognized that polypeptides are not necessarily perfectly linear. For example, polypeptides may be branched as a result of ubiquitination, and they may be circular, branched or unbranched, as a result of post-translational events, including natural processing events and events caused by human manipulation that do not occur naturally. Circular, branched, and branched circular polypeptides can, moreover, be synthesized by non-translational natural processes and by fully synthetic methods. Furthermore, this invention intends both methionine-containing and methionine-free amino-terminal variants of the proteins of the invention.
[0053] In this specification, “reduction in the incidence and / or severity of clinical signs” or “reduction in clinical symptoms” means, but is not limited to, a reduction in the number of infected subjects in a group, a reduction or elimination of subjects exhibiting clinical signs of infection, or a reduction in the severity of any clinical signs present in one or more subjects, compared to wild-type infection. For example, these terms include a reduction in any clinical signs of infection, pulmonary pathology, viremia, antibody production, reduced pathogen burden, reduced pathogen shedding, reduced pathogen transmission, or any clinical signs that are symptoms of PRRSV. Preferably, these clinical signs are reduced by at least 10% in one or more animals of the invention compared to subjects infected without modification in the CD163 gene. More preferably, the clinical signs are reduced by at least 20%, preferably at least 30%, more preferably at least 40%, and even more preferably at least 50% in subjects of the invention.
[0054] The terms “residue,” “amino acid residue,” or “amino acid” are used interchangeably herein and refer to amino acids incorporated into proteins, polypeptides, or peptides (collectively, “proteins”). Amino acids may be naturally occurring amino acids and, unless otherwise limited, may include non-natural analogs of naturally occurring amino acids that can function similarly to naturally occurring amino acids.
[0055] The term "selective hybridization" includes references to the hybridization of one nucleic acid sequence to another nucleic acid sequence or other biologics under stringent hybridization conditions. When using a hybridization-based detection system, a nucleic acid probe complementary to a reference nucleic acid sequence is selected, and then, through the selection of appropriate conditions, the probe and reference sequence selectively hybridize or bind to each other to form a double-stranded molecule.
[0056] The terms "stringent conditions" or "stringent hybridization conditions" refer to conditions under which a probe hybridizes to its target sequence to a degree large enough to be detectable compared to other sequences (e.g., at least twice as much as the background). Stringent conditions are sequence-dependent and will vary depending on the context. By controlling the stringency of hybridization and / or washing conditions, it is possible to identify target sequences that are 100% complementary to the probe (homologous probing).
[0057] Alternatively, stringency conditions can be adjusted to introduce some mismatch in the sequences, thereby detecting a lower degree of similarity (heterogeneous probing). Generally, probes are less than approximately 1000 nucleotides in length, and optionally less than 500 nucleotides.
[0058] Typically, stringent conditions are a salt concentration of less than 1.5 M Na ions at pH 7.0–8.3, typically 0.01–1.0 M Na ion concentration (or other salt), and a temperature of at least approximately 30°C for short probes (e.g., 10–50 nucleotides) and at least approximately 60°C for long probes (e.g., over 50 nucleotides). Stringent conditions can also be achieved by adding destabilizers, such as formamide. Specificity is typically a function of post-hybridization washing, with the ionic strength and temperature of the final washing solution being key factors. For DNA / DNA hybrids, the thermal melting point (Tm) can be approximated by the formula from Meinkoth and Wahl, Anal. Biochem., 138: 267–284 (1984):T m [℃] = 81.5 + 16.6(logM) + 0.41(%GC) - 0.61(%form) - 500 / L; where M is the molar concentration of monovalent cations, %GC is the percentage of guanosine and cytosine nucleotides in the DNA, %form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid expressed in base pairs. m Tm is the temperature at which 50% of the complementary target sequence hybridizes to a perfectly matched probe (under specified ionic strength and pH). Tm is reduced by approximately 1°C for each 1% mismatch; therefore, Tm, hybridization, and / or washing conditions can be adjusted to hybridize to sequences of desired identity. For example, if sequences with >90% identity are required, T m The temperature can be reduced by 10°C. Generally, stringent conditions involve a specified ionic strength and pH for a specific sequence and its complement. m It is selected to be approximately 5°C lower. However, significant stringent conditions are T m Hybridization and / or washing can be performed at temperatures 1-4°C lower; moderate stringent conditions are suitable. mHybridization and / or washing can be used at temperatures 6 - 10°C lower; low stringency conditions are T m Hybridization and / or washing can be used at temperatures 11 - 20°C lower. Using the formula, hybridization and washing compositions, and the desired T m one of ordinary skill in the art will understand that variations in the stringency of the hybridization and / or wash solution are essentially described. Extensive guidance regarding nucleic acid hybridization can be found in Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology--Hybridization with Nucleic Acid Probes, Part I, Chapter 2 “Overview of principles of hybridization and the strategy of nucleic acid probe assays”, Elsevier, New York (1993); and Current Protocols in Molecular Biology, Chapter 2, Ausubel, et al., Eds., Greene Publishing and Wiley-Interscience, New York (1995).
[0059] A "TALE DNA-binding domain" or "TALE" is a polypeptide containing one or more TALE repeat domains / units. The repeat domains are involved in the binding of the TALE to its congenerally targeted DNA sequence. A single "repeat unit" (also called a "repeat") is typically 33–35 amino acids long and exhibits at least some sequence homology to other TALE repeat sequences within naturally occurring TALE proteins. Zinc fingers and TALE-binding domains can be "engineered" to bind to predetermined nucleotide sequences, for example, by manipulating the recognition helix region of a naturally occurring zinc finger or TALE protein (by changing one or more amino acids). Thus, engineered DNA-binding proteins (zinc fingers or TALEs) are non-naturally occurring proteins. Non-limiting examples of methods for manipulating DNA-binding proteins are design and selection. Engineered DNA-binding proteins are proteins that do not occur naturally, and their design / composition is primarily due to rational decision-making criteria. Rational decision-making criteria for design include substitution rules and the application of computerized algorithms to process information in databases storing information on existing ZFP and / or TALE design and binding data. For example, see U.S. Patents 6,140,081; 6,453,242; and 6,534,261; also see WO98 / 53058; WO98 / 53059; WO98 / 53060; WO02 / 016536 and WO03 / 016496 and U.S. Patent Publication 20110301073.
[0060] In this specification, “vector” includes references to nucleic acids into which polynucleotides can be inserted, which can be used in the transfection of host cells. Vectors are often replicons. Expression vectors enable the transcription of the nucleic acids into which they are inserted.
[0061] "Wild type" refers to animals that have not been genetically edited or otherwise genetically modified, and blastocysts, embryos, or cells derived therefrom, and typically includes inbred and uninbred strains developed from naturally occurring species.
[0062] A "zinc finger DNA-binding protein" (or binding domain) is a protein, or a domain within a larger protein, that binds to DNA in a sequence-specific manner via one or more zinc fingers (regions of amino acid sequences within a binding domain whose structure is stabilized by the coordination of zinc ions). The term zinc finger DNA-binding protein is often abbreviated as zinc finger protein or ZFP.
[0063] "Selected" zinc finger proteins, or TALEs, are proteins not found naturally, and their generation is primarily due to empirical processes, such as phage display, interaction trapping, or hybrid selection. See, for example, U.S. Patent Nos. 5,789,538; 5,925,523; 6,007,988; 6,013,453; 6,200,759; WO95 / 19431; WO96 / 06166; WO98 / 53057; WO98 / 54311; WO00 / 27878; WO01 / 60970; WO01 / 88197; WO02 / 099084; and U.S. Patent Publication No. 20110301073.
[0064] The following terms are used to describe the sequence relationship between the polynucleotide / polypeptide and the reference polynucleotide / polypeptide of the present invention: (a) “reference sequence”, (b) “comparison window”, (c) “sequence identity”, and (d) “percentage of sequence identity”.
[0065] (a) In this specification, “reference sequence” is a defined sequence used as a basis for sequence comparison with the polynucleotide / polypeptide of the present invention. The reference sequence may be a subset or the whole of a particular sequence; for example, it may be a full-length cDNA or a segment of a gene sequence, or a complete cDNA or gene sequence.
[0066] (b) In this specification, “comparison window” includes a reference to a specific adjacent segment of a polynucleotide / polypeptide sequence, where the polynucleotide / polypeptide sequence may be compared to a reference sequence, and a portion of the polynucleotide / polypeptide sequence within the comparison window may contain additions or deletions (i.e., gaps) compared to the reference sequence (which does not contain additions or deletions) for optimal alignment of the two sequences. Generally, the comparison window is the length of at least 20 adjacent nucleotide / amino acid residues, and can optionally be 30, 40, 50, 100, or more. Those skilled in the art will understand that a gap penalty is typically introduced and subtracted from the number of matches in order to avoid high similarity to the reference sequence due to the inclusion of gaps in the polynucleotide / polypeptide sequence.
[0067] Methods for aligning sequences for comparison are well known in the art. Optimal alignment of sequences for comparison can be achieved by the local homology algorithm of Smith and Waterman, Adv. Appl. Math. 2: 482 (1981); the homology alignment algorithm of Needleman and Wunsch, J. Mol. Biol. 48: 443 (1970); the similarity search method of Pearson and Lipman, Proc. Natl. Acad. Sci. 85: 2444 (1988); and computerized execution of these algorithms, including, but not limited to, the following: CLUSTAL;GAP, BESTFIT, BLAST, FASTA, and TFASTA in the PC / Gene program by Intelligenetics, Mountain View, California, and related programs in the GCG Wisconsin Genetics Software Package, version 10 (available from Accelrys Inc., 9685 Scranton Road, San Diego, California, USA). The CLUSTAL program is well described in Higgins and Sharp, Gene 73: 237-244 (1988); Higgins and Sharp, CABIOS 5: 151-153 (1989); Corpet, et al., Nucleic Acids Research 16: 10881-90 (1988); Huang, et al., Computer Applications in the Biosciences 8: 155-65 (1992), and Pearson, et al., Methods in Molecular Biology 24: 307-331 (1994).
[0068] The BLAST family of programs that can be used for database similarity searches include: BLASTN for nucleotide query sequences against nucleotide database sequences; BLASTX for nucleotide query sequences against protein database sequences; BLASTP for protein query sequences against protein database sequences; TBLASTN for protein query sequences against nucleotide database sequences; and TBLASTX for nucleotide query sequences against nucleotide database sequences. See Current Protocols in Molecular Biology, Chapter 19, Ausubel, et al., Eds., Greene Publishing and Wiley-Interscience, New York (1995); Altschul et al., J. Mol. Biol., 215: 403-410 (1990); and Altschul et al., Nucleic Acids Res. 25: 3389-3402 (1997). Software for performing BLAST analysis is publicly available, for example, through the National Center for Biotechnology Information (ncbi.nlm.nih.gov / ). This algorithm is fully described in numerous publications. For example, see: Altschul SF et al., Gapped BLAST and PSI-BLAST: A New Generation Protein Database Search Program, 25 NUCLEIC ACIDS RES. 3389 (1997); National Center for Biotechnology Information, THE NCBI HANDBOOK [INTERNET], CHAPTER 16: The BLAST Sequence Analysis Tool (McEntyre J, Ostell J, eds., 2002), available at http: / / www.ncbi.nlm.nih.gov / books / NBK21097 / pdf / ch16.pdf.The BLASTP program for amino acid sequences is also fully described (see Henikoff & Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915).
[0069] In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Nat'l. Acad. Sci. USA 90: 5873-5877 (1993)). Many low-complexity filtering programs can be used to reduce such low-complexity alignments. For example, the SEG (Wooten and Federhen, Comput. Chem., 17: 149-163 (1993)) and XNU (Claverie and States, Comput. Chem., 17: 191-201 (1993)) low-complexity filters can be used alone or in combination.
[0070] Unless otherwise noted, the nucleotide and protein identity / similarity values provided herein are calculated using GAP (GCG version 10) with default values. GAP (Global Alignment Program) can also be used to compare the polynucleotides or polypeptides of the present invention with reference sequences. GAP uses the Needleman and Wunsch algorithm (J. Mol. Biol. 48: 443-453, 1970) to find the alignment of two whole sequences that maximizes the number of matches and minimizes the number of gaps. GAP represents one member of the family of best alignments. Many members of this family may exist, but other members do not possess better properties. GAP exhibits four forms of advantages for alignment: properties, ratios, identity, and similarity. Property is the metric that is maximized to align the sequences. Ratio is the property divided by the number of bases in the shorter segment. Percent identity is the percentage of symbols that actually match. Percent similarity is the percentage of symbols that are similar. Symbols directly opposite a gap are ignored. Similarity is scored if the scoring matrix value for a pair of symbols is greater than or equal to a similarity threshold of 0.50. The scoring matrix used in version 10 of the Wisconsin Genetics Software Package is BLOSUM62 (see Henikoff & Henikoff (1989) Proc. Natl. Acad. Sci. USA 89: 10915).
[0071] Multiple alignment of sequences can be performed using the CLUSTAL alignment method (Higgins and Sharp (1989) CABIOS. 5: 151-153) with default parameters (gap penalty=10, gap length penalty=10). Default parameters for pairwise alignment using the CLUSTAL method include KTUPLE1, gap penalty=3, window=5, and preserved diagonal=5.
[0072] (c) In this specification, “sequence identity” or “identity” in relation to two nucleic acid or polypeptide sequences includes a reference to residues in two sequences that are identical when aligned for maximum correspondence across a specific comparison window. When the percentage of sequence identity is used in reference to proteins, it is recognized that non-identical residue positions are often differed by conserved amino acid substitutions, in which case the amino acid residue is replaced by another amino acid residue having similar chemical properties (e.g., charge or hydrophobicity), and thus the functional properties of the molecule do not change. If sequences differ by a conserved substitution, the percentage sequence identity may be adjusted upward to compensate for the conserved nature of the substitution. Sequences differing by such a conserved substitution are said to have “sequence similarity” or “similarity.” Means for making this adjustment are well known to those skilled in the art. Typically, this involves scoring the conserved substitution as a partial mismatch rather than a total mismatch, thereby increasing the percentage sequence identity. Thus, for example, if identical amino acids are given a score of 1 and non-conservative substitutions are given a score of 0, then conservative substitutions are given a score between 0 and 1. The scoring of conservative substitutions can be calculated using the Meyers and Miller algorithm, Computer Applic. Biol. Sci., 4: 11-17 (1988), and can be performed, for example, in the program PC / GENE (Intelligenetics, Mountain View, California, USA).
[0073] (d) In this specification, “percentage of sequence identity” means a value determined by comparing two optimally aligned sequences across a comparison window, where some of the polynucleotide sequences within the comparison window may include additions or deletions (i.e., gaps) compared to a reference sequence (which does not include additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions in which the same nucleic acid base or amino acid residue occurs in both sequences, obtaining the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity.
[0074] Animals and cells with modified chromosomal sequences in the gene encoding the CD163 protein CD163 has 17 exons, and the protein consists of an extracellular region with nine scavenger receptor cysteine-rich (SRCR) domains, a transmembrane segment, and a short cytoplasmic end. Several different variants result from differential splicing of a single gene (Ritter et al. 1999a; Ritter et al. 1999b). Many of these variations are explained by the length of the cytoplasmic end.
[0075] CD163 has many important functions, including its role as a haptoglobin-hemoglobin scavenger receptor. Since the heme group can be highly toxic, the elimination of free hemoglobin from the blood is a key function of CD163 (Kristiansen et al. 2001). CD163 has a cytoplasmic terminal that promotes endocytosis. Mutations at this terminal reduce haptoglobin-hemoglobin complex uptake (Nielsen et al. 2006). Other functions of CD163 include erythroblast adhesion (SRCR2), TWEAK receptor (SRCR1-4 & 6-9), bacterial receptor (SRCR5), African swine virus receptor (Sanchez-Tones et al. 2003), and a potential role as an immune modulator (described in Van Gorp et al. 2010a). Given these important functions, it was previously thought that complete knockout of CD163 would result in animals that are either unviable or severely immunocompromised (see, for example, PCT Publication 2012 / 158828).
[0076] CD163 is a member of the cysteine-rich (SRCR) scavenger receptor superfamily and consists of an intracellular domain and nine extracellular SRCR domains. In humans, endocytosis of CD163-mediated hemoglobin-heme uptake via SRCR3 protects cells from oxidative stress (Schaer et al., 2006a; Schaer et al., 2006b; Schaer et al., 2006c). CD163 also functions as a receptor for tumor necrosis factor-like weak inducers of apoptosis (TWEAK: SRCR1-4 & 6-9), a pathogen receptor (African swine cholera virus; bacteria: SRCR2), and a receptor for erythroblast binding (SRCR2).
[0077] CD163 plays a role in infections by many different pathogens, and therefore the invention is not limited to animals with reduced susceptibility to PRRSV infection, but includes animals with reduced susceptibility to any pathogen that depend on CD163 for either infection into cells or subsequent replication and / or persistence in cells. The PRRSV infection process begins with initial binding to heparan sulfate on the surface of alveolar macrophages. Prior to 2013, it was thought that a secure binding to sialoadhesin (SIGLEC1, also known as CD169 or SN) then occurred. The virus is then internalized by clatherin-mediated endocytosis. Another molecule, CD163, then facilitates the decoating of the virus in endosomes (Van Breedam et al. 2010a). The viral genome is released, and cells are infected.
[0078] Animals and their offspring and cells containing at least one modified chromosomal sequence, e.g., an insertion or deletion ("INDEL") in the gene encoding the CD163 protein (which gives animals improved or complete resistance to infection by a pathogen (e.g., PRRSV)) are described herein. The applicant has demonstrated that CD163 is a definitive gene in PRRSV infection and has produced founder-resistant animals and strains.
[0079] This disclosure provides genetically modified animals, their offspring, or animal cells comprising at least one altered chromosomal sequence in the gene encoding the CD163 protein. This invention does not involve inactivation or editing of the SIGLEC1 (CD169) gene (which was previously considered critical for PRRSV resistance).
[0080] Edited chromosome sequences may include integrated sequences that are (1) inactivated, (2) modified, or (3) null mutations. Inactivated chromosome sequences are modified so that CD163 protein function is impaired, reduced, or eliminated in relation to PRRSV infection. Thus, genetically edited animals containing inactivated chromosome sequences may be called “knockout” or “conditional knockout.” Similarly, genetically edited animals containing integrated sequences may be called “knock-in” or “conditional knock-in.” Furthermore, genetically edited animals containing modified chromosome sequences may include target point mutations or other modifications, thus producing modified protein products. Briefly, the process may include introducing at least one RNA molecule encoding a target zinc finger nuclease and, optionally, at least one accessory polynucleotide into an embryo or cell. The method further comprises incubating embryos or cells and expressing zinc finger nucleases, and the double-strand breaks introduced into the target chromosome sequence by the zinc finger nucleases are repaired by either error-prone non-homologous end-joining DNA repair processes or homologous recombination DNA repair processes. Methods for editing chromosome sequences encoding germline development-related proteins using targeted zinc finger nuclease technology are rapid, accurate, and highly efficient.
[0081] Alternatively, the process may involve using the CRISPR / Cas9 system to modify the genome sequence. To use Cas9 to modify the genome sequence, the protein can be delivered directly to the cell. Alternatively, the mRNA encoding Cas9 can be delivered to the cell, or the gene providing expression for the Cas9 encoding mRNA can be delivered to the cell. In addition, target-specific crRNAs and tracrRNAs can be delivered directly to the cell, or target-specific gRNAs(s) can be delivered to the cell (these RNAs may, instead, be generated by genes constructed to express these RNAs). The selection of designed target sites for crRNAs / gRNAs is well known in this art. Discussions on gRNA construction and cloning can be found at http: / / www.genome-engineering.org / crispr / wp-content / uploads / 2014 / 05 / CRISPR-Reagent-Description-Rev20140509.pdf.
[0082] At least one CD163 locus can be used as a target site for site-directed editing. Site-directed editing may include the insertion of an exogenous nucleic acid (e.g., a nucleic acid containing a nucleotide sequence encoding the polypeptide of interest) or the deletion of a nucleic acid from the locus. For example, the incorporation of an exogenous nucleic acid and / or the deletion of a portion of a genomic nucleic acid can modify the locus so that a disrupted (i.e., CD163 protein activity reduced) CD163 gene is produced.
[0083] Non-human animals, offspring of such animals, and animal cells containing at least one modified chromosomal sequence in the gene encoding the CD163 protein are provided herein.
[0084] A non-human animal or its offspring or animal cell is provided, containing at least one modified chromosome sequence in the gene encoding the CD163 protein. The modified chromosome sequence causes the animal, its offspring, or cell to produce a substantially non-functional CD163 protein.
[0085] Another non-human animal or its offspring or animal cells are provided, which contain at least one modified chromosomal sequence in the gene encoding the CD163 protein. The modified chromosomal sequence contains an in-frame deletion in the gene encoding the CD163 protein.
[0086] A pig animal or its offspring or pig cells containing at least one modified chromosome sequence in the gene encoding the CD163 protein is provided. The modified chromosome sequence includes (a) SEQ ID NO: 118; or (b) modifications selected from the following group: an 11-base pair deletion between nucleotides 3,137 and 3,147 compared to the reference sequence SEQ ID NO: 47; a 2-base pair insertion between nucleotides 3,149 and 3,150 compared to the reference sequence SEQ ID NO: 47, and a 377-base pair deletion between nucleotides 2,573 and 2,949 on the same allele compared to the reference sequence SEQ ID NO: 47; a 124-base pair deletion between nucleotides 3,024 and 3,147 compared to the reference sequence SEQ ID NO: 47; a 123-base pair deletion between nucleotides 3,024 and 3,146 compared to the reference sequence SEQ ID NO: 47; a 1-base pair insertion between nucleotides 3,147 and 3,148 compared to the reference sequence SEQ ID NO: 47; Compared to NO:47, there is a 130-base pair deletion from nucleotide 3,030 to nucleotide 3,159; compared to reference sequence SEQ ID NO:47, there is a 132-base pair deletion from nucleotide 3,030 to nucleotide 3,161; compared to reference sequence SEQ ID NO:47, there is a 1,506-base pair deletion from nucleotide 1,525 to nucleotide 3,030; compared to reference sequence SEQ ID NO:47, there is a 7-base pair insertion between nucleotide 3,148 and nucleotide 3,149; compared to reference sequence SEQ ID NO:47, there is a 1,280-base pair deletion from nucleotide 2,818 to nucleotide 4,097; compared to reference sequence SEQ ID NO:47, there is a 1,373-base pair deletion from nucleotide 2,724 to nucleotide 4,096; compared to reference sequence SEQ ID NO:47, there is a 1,467-base pair deletion from nucleotide 2,431 to nucleotide 3,897;Compared to the reference sequence SEQ ID NO:47, there is a 1930 base pair deletion from nucleotide 488 to nucleotide 2,417, where the deleted sequence is replaced by a 12 base pair insertion starting at nucleotide 488, and a further 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172; a 28 base pair deletion from nucleotide 3,145 to nucleotide 3,172; a 1387 base pair deletion from nucleotide 3,145 to nucleotide 4,531; a 1382 base pair deletion from nucleotide 3,113 to nucleotide 4,494; where the deleted sequence is replaced by an 11 base pair insertion starting at nucleotide 3,113; reference sequence SEQ ID Compared to NO:47, there is a deletion of 1720 base pairs from nucleotide 2,440 to nucleotide 4,160; compared to reference sequence SEQ ID NO:47, there is a deletion of 452 base pairs from nucleotide 3,015 to nucleotide 3,466; and combinations thereof.
[0087] Modification of the chromosome sequence in the gene encoding the CD163 protein reduces the susceptibility of animals, offspring, or cells to infection by pathogens (e.g., viruses such as PRRSV) compared to animals, offspring, or cells that do not contain the modified chromosome sequence in the CD163 protein-coding gene.
[0088] For example, altering the chromosomal sequence in the gene encoding the CD163 protein can reduce the susceptibility of animals, offspring, or cells to type 1 PRRSV virus, type 2 PRRSV virus, or both type 1 and type 2 PRRSV viruses.
[0089] Modification of the chromosomal sequence in the gene encoding the CD163 protein may reduce the susceptibility of animals, offspring, or cells to PRRSV isolates selected from the group consisting of NVSL97-7895, KS06-72109, P129, VR2332, CO90, AZ25, MLV-ResPRRS, KS62-06274, KS483 (SD23983), CO84, SD13-15, Lelystad, 03-1059, 03-1060, SD01-08, 4353PZ, and combinations thereof.
[0090] The animal or offspring may be an embryo, juvenile, or adult. Similarly, cells may include embryonic cells, cells derived from juvenile animals, or cells derived from adult animals.
[0091] Animals or offspring may include domesticated animals. Similarly, cells may include cells derived from domesticated animals. Domesticated animals may include livestock animals such as pigs, cattle (e.g., beef or dairy cattle), sheep, goats, horses (e.g., horses or donkeys), buffalo, camels, or birds (e.g., chickens, turkeys, ducks, geese, guinea fowl, or chicks). Domesticated animals are preferably cattle or pigs, most preferably pigs.
[0092] Animals or their offspring may include genetically edited animals. Cells may include genetically edited cells.
[0093] Animals or cells can be genetically edited using homing endonucleases. Homing endonucleases can be naturally occurring endonucleases, but preferably are reasonably designed, non-naturally occurring homing endonucleases, which have a DNA recognition sequence designed to target a chromosomal sequence in the gene encoding the CD163 protein. Thus, homing endonucleases can be designed homing endonucleases. Homing endonucleases can include, for example, clustered and regularly arranged short palindromic sequence repeats (CRISPR) / Cas9 systems, transcription activator-like effector nucleases (TALENs), zinc finger nucleases (ZFNs), recombinase fusion proteins, meganucleases, or combinations thereof. The animals or cells are preferably animals or cells genetically edited using a CRISPR / Cas9 system.
[0094] Genetically edited animals, their offspring, or genetically edited cells preferably exhibit increased resistance to pathogens (e.g., viruses such as PRRSV) compared to non-edited animals.
[0095] For example, genetically edited animals may exhibit increased resistance to type 1 PRRSV virus, type 2 PRRSV virus, or both type 1 and type 2 PRRSV viruses.
[0096] Genetically edited animals may exhibit increased resistance to PRRSV isolates selected from the group consisting of NVSL97-7895, KS06-72109, P129, VR2332, CO90, AZ25, MLV-ResPRRS, KS62-06274, KS483 (SD23983), CO84, SD13-15, Lelystad, 03-1059, 03-1060, SD01-08, 4353PZ, and combinations thereof.
[0097] Animals, offspring, or cells can be heterozygous for a modified chromosome sequence. Alternatively, animals, offspring, or cells can be homozygous for a modified chromosome sequence.
[0098] In animals, offspring, or cells, a modified chromosome sequence may include an insertion, a deletion, or a combination thereof in a gene encoding the CD163 protein. For example, a modified chromosome sequence may include a deletion (e.g., an in-frame deletion) in a gene encoding the CD163 protein. Alternatively, a modified chromosome sequence may include an insertion in a gene encoding the CD163 protein.
[0099] Insertions or deletions can reduce CD163 protein production or activity compared to animals, offspring, or cells lacking the insertion or deletion.
[0100] Insertions or deletions can result in the production of substantially non-functional CD163 protein by animals, offspring, or cells. “Substantially non-functional CD163 protein” means that the level of CD163 protein in animals, offspring, or cells is undetectable, or, if detectable, at least approximately 90% lower than the level observed in animals, offspring, or cells without the insertion or deletion.
[0101] If the animal, offspring, or cells include a pig animal, offspring, or cells, the modified chromosome sequence may include modifications in exon 7 of the gene encoding the CD163 protein, exon 8 of the gene encoding the CD163 protein, an intron adjacent to exon 7 or exon 8 of the gene encoding the CD163 protein, or a combination thereof. The modified chromosome sequence preferably includes a modification in exon 7 of the gene encoding the CD163 protein.
[0102] Modifications in exon 7 of the gene encoding the CD163 protein may include deletions (e.g., in-frame deletions in exon 7). Alternatively, modifications in exon 7 of the gene encoding the CD163 protein may include insertions.
[0103] In pigs, offspring, or cells, the modified chromosome sequence may contain SEQ ID NO:118. Alternatively, the modified chromosome sequence may contain modifications selected from the following group: an 11-base pair deletion between nucleotides 3,137 and 3,147 compared to the reference sequence SEQ ID NO:47; a 2-base pair insertion between nucleotides 3,149 and 3,150 compared to the reference sequence SEQ ID NO:47, and a 377-base pair deletion between nucleotides 2,573 and 2,949 on the same allele compared to the reference sequence SEQ ID NO:47; a 124-base pair deletion between nucleotides 3,024 and 3,147 compared to the reference sequence SEQ ID NO:47; a 123-base pair deletion between nucleotides 3,024 and 3,146 compared to the reference sequence SEQ ID NO:47; a 1-base pair insertion between nucleotides 3,147 and 3,148 compared to the reference sequence SEQ ID NO:47; Compared to NO:47, there is a 130-base pair deletion from nucleotide 3,030 to nucleotide 3,159; compared to reference sequence SEQ ID NO:47, there is a 132-base pair deletion from nucleotide 3,030 to nucleotide 3,161; compared to reference sequence SEQ ID NO:47, there is a 1,506-base pair deletion from nucleotide 1,525 to nucleotide 3,030; compared to reference sequence SEQ ID NO:47, there is a 7-base pair insertion between nucleotide 3,148 and nucleotide 3,149; compared to reference sequence SEQ ID NO:47, there is a 1,280-base pair deletion from nucleotide 2,818 to nucleotide 4,097; compared to reference sequence SEQ ID NO:47, there is a 1,373-base pair deletion from nucleotide 2,724 to nucleotide 4,096; compared to reference sequence SEQ ID NO:47, there is a 1,467-base pair deletion from nucleotide 2,431 to nucleotide 3,897;Compared to the reference sequence SEQ ID NO:47, there is a 1930 base pair deletion from nucleotide 488 to nucleotide 2,417, where the deleted sequence is replaced by a 12 base pair insertion starting at nucleotide 488, and a further 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172; a 28 base pair deletion from nucleotide 3,145 to nucleotide 3,172; a 1387 base pair deletion from nucleotide 3,145 to nucleotide 4,531; a 1382 base pair deletion from nucleotide 3,113 to nucleotide 4,494; where the deleted sequence is replaced by an 11 base pair insertion starting at nucleotide 3,113; reference sequence SEQ ID Compared to NO:47, a 1720 base pair deletion from nucleotide 2,440 to nucleotide 4,160; compared to reference sequence SEQ ID NO:47, a 452 base pair deletion from nucleotide 3,015 to nucleotide 3,466; or a combination thereof.
[0104] For example, the modification may include an 11-base pair deletion between nucleotides 3,137 and 3,147 compared to the reference sequence SEQ ID NO:47.
[0105] The modification may include a two-base pair insertion between nucleotides 3,149 and 3,150 compared to the reference sequence SEQ ID NO:47, and a 377-base pair deletion between nucleotides 2,573 and 2,949 on the same allele compared to the reference sequence SEQ ID NO:47.
[0106] The modification may include a 124-base pair deletion from nucleotide 3,024 to nucleotide 3,147 compared to the reference sequence SEQ ID NO:47.
[0107] The modification may include a 123-base pair deletion from nucleotide 3,024 to nucleotide 3,146 compared to the reference sequence SEQ ID NO:47.
[0108] Modifications may include a single base pair insertion between nucleotides 3,147 and 3,148 compared to the reference sequence SEQ ID NO:47.
[0109] The modification may include a 130-base pair deletion from nucleotide 3,030 to nucleotide 3,159 compared to the reference sequence SEQ ID NO:47.
[0110] The modification may include a 132-base pair deletion from nucleotide 3,030 to nucleotide 3,161 compared to the reference sequence SEQ ID NO:47.
[0111] The modification may include a 1506 base pair deletion from nucleotide 1,525 to nucleotide 3,030 compared to the reference sequence SEQ ID NO:47.
[0112] The modification may include a 7-base pair insertion between nucleotides 3,148 and 3,149 compared to the reference sequence SEQ ID NO:47.
[0113] The modification may include a 1280 base pair deletion from nucleotide 2,818 to nucleotide 4,097 compared to the reference sequence SEQ ID NO:47.
[0114] The modification may include a deletion of 1373 base pairs, from nucleotide 2,724 to nucleotide 4,096, compared to the reference sequence SEQ ID NO:47.
[0115] The modification may include a deletion of 1,467 base pairs, from nucleotide 2,431 to nucleotide 3,897, compared to the reference sequence SEQ ID NO:47.
[0116] The modification may include a 1930 base pair deletion from nucleotide 488 to nucleotide 2,417 compared to the reference sequence SEQ ID NO:47, where the deleted sequence is replaced by a 12 base pair insertion beginning at nucleotide 488, as well as a further 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 compared to the reference sequence SEQ ID NO:47.
[0117] The modification may include a 28-base pair deletion between nucleotides 3,145 and 3,172 compared to the reference sequence SEQ ID NO:47.
[0118] The modification may include a deletion of 1387 base pairs, from nucleotide 3,145 to nucleotide 4,531, compared to the reference sequence SEQ ID NO:47.
[0119] The modification may include a 1382 base pair deletion from nucleotide 3,113 to nucleotide 4,494 compared to the reference sequence SEQ ID NO:47, where the deleted sequence is replaced by an 11-base pair insertion starting at nucleotide 3,113.
[0120] The modification may include a 1720 base pair deletion from nucleotide 2,440 to nucleotide 4,160 compared to the reference sequence SEQ ID NO:47.
[0121] The modification may include a 452-base pair deletion from nucleotide 3,015 to nucleotide 3,466 compared to the reference sequence SEQ ID NO:47.
[0122] Pig animals, offspring, or cells may contain any combination of the above insertions and deletions.
[0123] SEQ ID NO:47 provides the nucleotide sequence for the region of the wild-type pig CD163 gene, starting 3000 base pairs (bp) upstream of exon 7 and extending to the last base of exon 10. SEQ ID NO:47 is used as the reference sequence herein and is shown in Figure 16.
[0124] If a pig animal, its offspring, or a cell contains a dinucleotide insertion between nucleotides 3,149 and 3,150 compared to the reference sequence SEQ ID NO:47, the dinucleotide insertion may include an insertion of dinucleotide AG.
[0125] If a pig animal, its offspring, or a cell contains a single base pair insertion between nucleotides 3,147 and 3,148 compared to the reference sequence SEQ ID NO:47, the single base pair insertion may include an insertion of a single adenine residue.
[0126] If a pig animal, offspring, or cell contains a 7-base pair insertion between nucleotides 3,148 and 3,149 compared to the reference sequence SEQ ID NO:47, the 7-base pair insertion may include the sequence TACTACT (SEQ ID NO:115).
[0127] If a pig, its offspring, or cell contains a 1930 base pair deletion from nucleotide 488 to nucleotide 2,417 compared to the reference sequence SEQ ID NO:47, where the deleted sequence is replaced by a 12 base pair insertion beginning at nucleotide 488, and also contains a further 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 compared to the reference sequence SEQ ID NO:47, the 12 base pair insertion may include the sequence TGTGGAGAATTC (SEQ ID NO:116).
[0128] A pig animal, offspring, or cell may contain a 1382 base pair deletion from nucleotide 3,113 to nucleotide 4,494 compared to the reference sequence SEQ ID NO:47, where the deletion sequence is replaced by an 11-base pair insertion beginning at nucleotide 3,113, and the 11-base pair insertion may include the sequence AGCCAGCGTGC (SEQ ID NO:117).
[0129] If the modified chromosomal sequence in the gene encoding the CD163 protein contains a deletion, the deletion preferably contains an in-frame deletion. An in-frame deletion is a deletion that does not cause a shift in the triplet reading frame and thus has an internal deletion of one or more amino acids, but yields an untruncated protein product. Assuming splicing occurs correctly, an in-frame mutation is obtained from the deletion of three or more three-base pairs within an exon.
[0130] For porcine animals and cells, the following indices described herein are predicted to be in-frame deletions, since deletions within exon 7 of the porcine CD163 gene are multiples of 3: a 1506 base pair deletion from nucleotide 1,525 to nucleotide 3,030 compared to the reference sequence SEQ ID NO: 47; a 1930 base pair deletion from nucleotide 488 to nucleotide 2,417 compared to the reference sequence SEQ ID NO: 47, where the deleted sequence is replaced by a 12 base pair insertion beginning at nucleotide 488, and there is also a further 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 compared to the reference sequence SEQ ID NO: 47; a 1373 base pair deletion from nucleotide 2,724 to nucleotide 4,096 compared to the reference sequence SEQ ID NO: 47; Compared to NO:47, there is a deletion of 123 base pairs from nucleotide 3,024 to nucleotide 3,146; compared to reference sequence SEQ ID NO:47, there is a deletion of 1,467 base pairs from nucleotide 2,431 to nucleotide 3,897; compared to reference sequence SEQ ID NO:47, there is a deletion of 1,387 base pairs from nucleotide 3,145 to nucleotide 4,531; compared to reference sequence SEQ ID NO:47, there is a deletion of 1,382 base pairs from nucleotide 3,113 to nucleotide 4,494, where the deleted sequence is replaced by an 11-base pair insertion starting at nucleotide 3,113; and compared to reference sequence SEQ ID NO:47, there is a deletion of 1,720 base pairs from nucleotide 2,440 to nucleotide 4,160.
[0131] Therefore, in porcine animals, offspring, and cells, insertions or deletions in the gene encoding the CD163 protein may include in-frame deletions in exon 7 selected from the following group: a 1506 base pair deletion from nucleotide 1,525 to nucleotide 3,030 compared to the reference sequence SEQ ID NO: 47; a 1930 base pair deletion from nucleotide 488 to nucleotide 2,417 compared to the reference sequence SEQ ID NO: 47, where the deleted sequence is replaced by a 12 base pair insertion beginning at nucleotide 488, and there is a further 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 compared to the reference sequence SEQ ID NO: 47; a 1373 base pair deletion from nucleotide 2,724 to nucleotide 4,096 compared to the reference sequence SEQ ID NO: 47; a 123 base pair deletion from nucleotide 3,024 to nucleotide 3,146 compared to the reference sequence SEQ ID NO: 47; Compared to NO:47, there is a deletion of 1467 base pairs from nucleotide 2,431 to nucleotide 3,897; compared to reference sequence SEQ ID NO:47, there is a deletion of 1387 base pairs from nucleotide 3,145 to nucleotide 4,531; compared to reference sequence SEQ ID NO:47, there is a deletion of 1382 base pairs from nucleotide 3,113 to nucleotide 4,494, where the deleted sequence is replaced by an 11-base pair insertion starting at nucleotide 3,113; compared to reference sequence SEQ ID NO:47, there is a deletion of 1720 base pairs from nucleotide 2,440 to nucleotide 4,160; and combinations thereof.
[0132] Pig animals, offspring, or cells may contain insertions or deletions selected from the following groups: a two-base-pair insertion between nucleotides 3,149 and 3,150 compared to the reference sequence SEQ ID NO: 47, and a 377-base-pair deletion between nucleotides 2,573 and 2,949 compared to the reference sequence SEQ ID NO: 47 on the same allele; a 28-base-pair deletion between nucleotides 3,145 and 3,172 compared to the reference sequence SEQ ID NO: 47; a 452-base-pair deletion between nucleotides 3,015 and 3,466 compared to the reference sequence SEQ ID NO: 47; and combinations thereof.
[0133] For example, a pig, its offspring, or a cell may contain a two-base pair insertion between nucleotides 3,149 and 3,150 compared to the reference sequence SEQ ID NO:47, and a 377-base pair deletion between nucleotides 2,573 and 2,949 in the same allele compared to the reference sequence SEQ ID NO:47.
[0134] Pig animals, offspring, or cells may contain a 28-base pair deletion between nucleotides 3,145 and 3,172 compared to the reference sequence SEQ ID NO:47.
[0135] Pig animals, offspring, or cells may contain 452 base pair deletions from nucleotide 3,015 to nucleotide 3,466 compared to the reference sequence SEQ ID NO:47.
[0136] Pig animals, offspring, or cells may contain any combination of the modified chromosome sequences described herein.
[0137] For example, a pig animal, offspring, or cell may contain: a 7-base pair insertion between nucleotides 3,148 and 3,149 in one allele of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO:47; and an 11-base pair deletion between nucleotides 3,137 and 3,147 in another allele of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO:47.
[0138] Pig animals, offspring, or cells may contain: a 7-base pair insertion between nucleotides 3,148 and 3,149 in one allele of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO:47; and a 1382-base pair deletion between nucleotides 3,113 and 4,494 in the other allele of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO:47, where the deleted sequence is replaced by an 11-base pair insertion beginning at nucleotide 3,113.
[0139] Pig animals, offspring, or cells may contain: SEQ ID NO: 118 in one allele of the gene encoding the CD163 protein; and an 11-base pair deletion from nucleotide 3,137 to nucleotide 3,147 in the other allele of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO: 47.
[0140] Pig animals, offspring, or cells may contain: SEQ ID NO: 118 in one allele of the gene encoding the CD163 protein; and a 2-base pair insertion between nucleotides 3,149 and 3,150, and a 377-base pair deletion between nucleotides 2,573 and 2,949, compared to the reference sequence SEQ ID NO: 47, in the other allele of the gene encoding the CD163 protein.
[0141] Pig animals, offspring, or cells may contain: a 1280 base pair deletion from nucleotide 2,818 to nucleotide 4,097 in one allele of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO:47; and an 11 base pair deletion from nucleotide 3,137 to nucleotide 3,147 in the other allele of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO:47.
[0142] Pig animals, offspring, or cells may contain: a 1280 base pair deletion from nucleotide 2,818 to nucleotide 4,097 in one allele of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO:47; and a 2 base pair insertion between nucleotides 3,149 and 3,150, and a 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 in the other allele of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO:47.
[0143] Pig animals, offspring, or cells may include: in one allele of the gene encoding the CD163 protein, a 1930 base pair deletion from nucleotide 488 to nucleotide 2,417 compared to the reference sequence SEQ ID NO:47, where the deleted sequence is replaced by a 12 base pair insertion beginning at nucleotide 488, as well as a further 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 compared to the reference sequence SEQ ID NO:47; and in the other allele of the gene encoding the CD163 protein, a 2 base pair insertion between nucleotides 3,149 and 3,150 compared to the reference sequence SEQ ID NO:47, and a 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 compared to the reference sequence SEQ ID NO:47.
[0144] Pig animals, offspring, or cells may contain: SEQ ID NO: 118 in one allele of the gene encoding the CD163 protein; and in the other allele of the gene encoding the CD163 protein, a 1930 base pair deletion from nucleotide 488 to nucleotide 2,417 compared to the reference sequence SEQ ID NO: 47, where the deleted sequence is replaced by a 12 base pair insertion beginning at nucleotide 488, as well as a further 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 compared to the reference sequence SEQ ID NO: 47.
[0145] Pig animals, offspring, or cells may include: in one allele of the gene encoding the CD163 protein, a 1930 base pair deletion from nucleotide 488 to nucleotide 2,417 compared to the reference sequence SEQ ID NO:47, where the deleted sequence is replaced by a 12 base pair insertion beginning at nucleotide 488, as well as a further 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 compared to the reference sequence SEQ ID NO:47; and in the other allele of the gene encoding the CD163 protein, an 11 base pair deletion from nucleotide 3,137 to nucleotide 3,147 compared to the reference sequence SEQ ID NO:47.
[0146] Pig animals, offspring, or cells may contain: a 1,467 base pair deletion from nucleotide 2,431 to nucleotide 3,897 in one allele of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO:47; and a 2 base pair insertion between nucleotides 3,149 and 3,150, and a 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 in the other allele of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO:47.
[0147] Pig animals, offspring, or cells may contain: a 1,467 base pair deletion from nucleotide 2,431 to nucleotide 3,897 in one allele of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO:47; and an 11 base pair deletion from nucleotide 3,137 to nucleotide 3,147 in the other allele of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO:47.
[0148] A pig animal, offspring, or cell containing any of the insertions or deletions described above may contain a chromosomal sequence outside the insertion or deletion that has a high degree of sequence identity with SEQ ID NO:47. Therefore, for example, a pig animal, offspring, or cell may contain a chromosomal sequence in the region of the chromosomal sequence outside the insertion or deletion that has at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, at least 99.9%, or 100% sequence identity with SEQ ID NO:47.
[0149] Pig animals, offspring, or cells may contain chromosomal sequences including SEQ ID NO:98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 118, or 119. As further described in the following examples, SEQ ID NO.98-114 and 119 provide nucleotide sequences for regions corresponding to the wild-type porcine CD163 region provided by SEQ ID NO:47, including insertions or deletions in the porcine CD163 chromosomal sequences described herein. SEQ ID NO:118 provides a sequence for a region corresponding to the wild-type porcine CD163 region provided by SEQ ID NO:47, where exon 7 is replaced with a synthetic exon encoding a homolog of SRCR8 of human CD163-like protein 1 (hCD163L1).
[0150] For example, a pig, offspring, animal, or cell may contain a chromosomal sequence including SEQ ID NO: 98, 101, 105, 109, 110, 112, 113, or 114. SEQ ID NO: 98, 101, 105, 109, 110, 112, 113, and 114 provide nucleotide sequences for in-frame deletions in exon 7 of the pig CD163 chromosome sequence.
[0151] As another example, a pig animal, its offspring, or a cell may contain a chromosomal sequence with SEQ ID NO: 103, 111, or 119.
[0152] A pig animal, its offspring, or a cell may contain an 11-base pair deletion in one allele of the gene encoding the CD163 protein and a 2-base pair insertion and a 377-base pair deletion in the other allele of the gene encoding the CD163 protein.
[0153] A pig animal, its offspring, or a cell may contain a 124-base pair deletion in one allele of the gene encoding the CD163 protein and a 123-base pair deletion in the other allele of the gene encoding the CD163 protein.
[0154] Pig animals, their offspring, or cells may contain single-base pair insertions.
[0155] A pig animal, its offspring, or a cell may contain a 130-base pair deletion in one allele of the gene encoding the CD163 protein and a 132-base pair deletion in the other allele of the gene encoding the CD163 protein.
[0156] Pig animals, their offspring, or cells may contain a 1506 base pair deletion.
[0157] A pig animal, its offspring, or a cell may contain a 7-base pair insertion.
[0158] A pig animal, its offspring, or a cell may contain a 1280 base pair deletion in one allele of the gene encoding the CD163 protein and a 1373 base pair deletion in the other allele of the gene encoding the CD163 protein.
[0159] A pig animal, its offspring, or a cell may contain a 1467 base pair deletion.
[0160] Pig animals, offspring, or cells may contain a 1930-base pair intron 6 deletion from nucleotide 488 to nucleotide 2,417, and a 12-base pair insertion at nucleotide 4,488 in exon 7, plus an additional 129-base pair deletion.
[0161] A pig animal, its offspring, or a cell may contain a 28-base pair deletion in one allele of the gene encoding the CD163 protein and a 1387-base pair deletion in the other allele of the gene encoding the CD163 protein.
[0162] A pig animal, its offspring, or a cell may contain a 1382 base pair deletion and an 11 base pair insertion in one allele of the gene encoding the CD163 protein, and a 1720 base pair deletion in the other allele of the gene encoding the CD163 protein.
[0163] Any cell containing at least one modified chromosome sequence in the gene encoding the CD163 protein may include a sperm cell. Alternatively, any of these cells may include an egg cell (e.g., a fertilized egg).
[0164] Any cell containing at least one modified chromosome sequence in the gene encoding the CD163 protein can be a somatic cell. For example, any such cell can be a fibroblast (e.g., a fetal fibroblast).
[0165] Nucleic acid targeting at the CD163 locus Site-specific integration of exogenous nucleic acids at the CD163 locus can be achieved by any technique known to those skilled in the art. For example, integration of exogenous nucleic acids at the CD163 locus may include contacting a cell (e.g., an isolated cell or a cell in a tissue or organism) with a nucleic acid molecule containing the exogenous nucleic acid. Such a nucleic acid molecule may include a nucleotide sequence adjacent to the exogenous nucleic acid that promotes homologous recombination between the nucleic acid molecule and at least one CD163 locus. The nucleotide sequence adjacent to the exogenous nucleic acid that promotes homologous recombination may be complementary to an endogenous nucleotide at the CD163 locus. Alternatively, the nucleotide sequence adjacent to the exogenous nucleic acid that promotes homologous recombination may be complementary to a previously integrated exogenous nucleotide. Multiple exogenous nucleic acids can be integrated at a single CD163 locus, for example, by gene stacking.
[0166] Nucleic acid integration at the CD163 locus may be facilitated (e.g., catalyzed) by the host cell's endogenous cellular mechanisms, for example, but not limited to, endogenous DNA and endogenous recombinase enzymes. Alternatively, nucleic acid integration at the CD163 locus may be facilitated by one or more factors (e.g., polypeptides) provided to the host cell. For example, nucleases, recombinases, and / or ligase polypeptides may be provided (independently or as part of a chimeric polypeptide) by contacting the polypeptide with the host cell or by expressing the polypeptide within the host cell. Thus, a nucleic acid comprising a nucleotide sequence encoding at least one nuclease, recombinase, and / or ligase polypeptide may be introduced into the host cell simultaneously with or subsequently to the nucleic acid site-specifically integrated at the CD163 locus, where at least one nuclease, recombinase, and / or ligase polypeptide is expressed from its nucleotide sequence within the host cell.
[0167] DNA-binding polypeptide Site-directed integration can be achieved, for example, by using factors that can recognize and bind to specific nucleotide sequences in the genome of a host organism. For example, many proteins contain polypeptide domains that can recognize and bind to DNA in a site-directed manner. The DNA sequence recognized by a DNA-binding polypeptide can be called a “target” sequence. A polypeptide domain that can recognize and bind to DNA in a site-directed manner generally functions independently to fold accurately and bind to DNA in a site-directed manner, even if the domain is expressed in a polypeptide other than the protein from which it was originally isolated. Similarly, target sequences for recognition and binding by DNA-binding polypeptides can generally be recognized and bound to such polypeptides, even if they are located in large DNA structures (e.g., chromosomes), especially if the site where the target sequence is located is known to be reachable by soluble cellular proteins (e.g., genes).
[0168] DNA-binding polypeptides identified from naturally occurring proteins typically bind to distinct nucleotide sequences or motifs (e.g., consensus recognition sequences), but many methods exist and are known in the art for modifying many such DNA-binding polypeptides to recognize different nucleotide sequences or motifs. Examples of DNA-binding polypeptides include, but are not limited to, zinc finger DNA-binding domains; leucine zippers; UPA DNA-binding domains; GAL4; TAL; LexA; Tet repressors; LacI; and steroid hormone receptors.
[0169] For example, DNA-binding polypeptides can be zinc fingers. Individual zinc finger motifs can be designed to target and specifically bind to any of a broad range of DNA sites. Standard Cys2His2 (and non-standard Cys3His) zinc finger polypeptides bind to DNA by inserting an α-helix into the major groove of the target DNA double helix. DNA recognition by zinc fingers is modular; each finger primarily contacts three consecutive base pairs in the target, and two or three key residues in the polypeptide mediate the recognition. By including multiple zinc finger DNA-binding domains in a targeting endonuclease, the DNA-binding specificity of the targeting endonuclease can be further increased (and thus the specificity of any gene regulatory effect conferred thereby can also be increased). See, for example, Urnov et al. (2005) Nature 435:646-51. Therefore, one or more zinc finger DNA-binding polypeptides can be engineered to interact with DNA sequences unique within the host cell's genome when introduced into a host cell by a targeting endonuclease.
[0170] Preferably, zinc finger proteins are non-natural in that they are engineered to bind to selective target sites. For example, Beerli et al. (2002) Nature Biotechnol. 20:135-141; Pabo et al. (2001) Ann. Rev. Biochem. 70:313-340; Isalan et al. (2001) Nature Biotechnol. 19:656-660; Segal et al. (2001) Curr. Opin. Biotechnol. 12:632-637; Choo et al. (2000) Curr. Opin. Struct. Biol. See 10:411-416; US Patent Nos. 6,453,242; 6,534,261; 6,599,692; 6,503,717; 6,689,558; 7,030,215; 6,794,136; 7,067,317; 7,262,054; 7,070,934; 7,361,635; 7,253,273; and US Patent Publications 2005 / 0064474; 2007 / 0218528; and 2005 / 0267061.
[0171] Manipulated zinc finger-binding domains can possess novel binding specificity compared to naturally occurring zinc finger proteins. Manipulation methods include, but are not limited to, rational design and the selection of various types. Rational design methods include, for example, the use of databases containing triplet (or quadruplet) nucleotide sequences and individual zinc finger amino acid sequences, where each triplet or quadruplet nucleotide sequence is associated with one or more amino acid sequences of zinc fingers that bind to a particular triplet or quadruplet sequence. See, for example, U.S. Patents 6,453,242 and 6,534,261.
[0172] Exemplary selection methods, such as phage displays and two-hybrid systems, are disclosed in U.S. Patents 5,789,538; 5,925,523; 6,007,988; 6,013,453; 6,410,248; 6,140,466; 6,200,759; and 6,242,568; as well as WO98 / 37186; WO98 / 53057; WO00 / 27878; WO01 / 88197 and GB2,338,237. In addition, enhanced binding specificity to zinc finger binding domains is described, for example, in WO02 / 077227.
[0173] In addition, as disclosed in these and other references, zinc finger domains and / or multi-finger zinc finger proteins may be linked together using any suitable linker sequence (e.g., including linkers with a length of 5 or more amino acids). For example linker sequences with a length of 6 or more amino acids, see also U.S. Patents 6,479,626; 6,903,185; and 7,153,949. The proteins described herein may contain any combination of suitable linkers between the individual zinc fingers of the protein.
[0174] Selection of target sites: Methods for designing and constructing ZFPs and fusion proteins (and polynucleotides encoding them) are known to those skilled in the art and are described in detail below: U.S. Patent Nos. 6,140,0815; 789,538; 6,453,242; 6,534,261; 5,925,523; 6,007,988; 6,013,453; 6,20 No. 0,759; WO95 / 19431; WO96 / 06166; WO98 / 53057; WO98 / 54311; WO00 / 27878; WO01 / 60970; WO01 / 88197; WO02 / 099084; WO98 / 53058; WO98 / 53059; WO98 / 53060; WO02 / 016536 and WO03 / 016496.
[0175] In addition, as disclosed in these and other references, zinc finger domains and / or multi-finger zinc finger proteins may be linked together using a suitable linker sequence (e.g., including linkers with a length of 5 or more amino acids). For example linker sequences with a length of 6 or more amino acids, see also U.S. Patents 6,479,626; 6,903,185; and 7,153,949. The proteins described herein may contain any combination of suitable linkers between the individual zinc fingers of the protein.
[0176] Alternatively, the DNA-binding polypeptide is the DNA-binding domain derived from GAL4. GAL4 is a modular transactivator in Saccharomyces cerevisiae, but it also acts as a transactivator in many other organisms. See, for example, Sadowski et al. (1988) Nature 335:563-4. In this regulatory system, the expression of genes encoding enzymes in the galactose metabolic pathway in S. cerevisiae is strictly controlled by available carbon sources. Johnston (1987) Microbiol. Rev. 51:458-76. The transcriptional regulation of these metabolic enzymes is mediated by the interaction between the positive regulatory protein, GAL4, and a 17bp symmetric DNA sequence to which GAL4 specifically binds (upstream activation sequence (UAS)).
[0177] Natural GAL4 consists of 881 amino acid residues and has a molecular weight of 99 kDa. GAL4 contains functionally independent domains, and the combination of their activities is responsible for GAL4's activity in vivo. Ma and Ptashne (1987) Cell 48:847-53; Brent and Ptashne (1985) Cell 43(3 Pt 2):729-36. The N-terminal 65 amino acids of GAL4 contain the GAL4 DNA-binding domain. Keegan et al. (1986) Science 231:699-704; Johnston (1987) Nature 328:353-5. Sequence-specific binding requires the presence of a divalent cation coordinated by six Cys residues in the DNA-binding domain. The domain containing the coordinated cation interacts with and recognizes the conserved CCG triplet at each end of the 17 bpUAS through direct contact with the main groove of the DNA helix. Marmorstein et al. (1992) Nature 356:408-14. The DNA-binding function of a protein positions the C-terminal transcriptional activity domain near the promoter, and thus the activity domain can be directed towards transcription.
[0178] Additional DNA-binding polypeptides that can be used include, but are not limited to, the following: binding sequences derived from the AVRBS3-inducible gene; consensus binding sequences derived from the AVRBS3-inducible gene or synthetic binding sequences manipulated therefrom (e.g., UPA DNA-binding domain); TAL; LexA (e.g., Brent & Ptashne (1985), see above); LacR (e.g., Labow et al. (1990) Mol. Cell. Biol. 10:3343-56; Baim et al. (1991) Proc. Natl. Acad. Sci. USA 88(12):5072-6); steroid hormone receptors (Ellliston et al. (1990) J. Biol. Chem. 265:11517-121); Mutant Tet repressors that bind to the tet operator sequence when tetracycline (Tc) is present but not when it is absent; the DNA-binding domain of NF-κB; and components of the regulatory system described in Wang et al. (1994) Proc. Natl. Acad. Sci. USA 91(17):8180-4 (which uses a fusion of GAL4, hormone receptor, and VP16).
[0179] One or more DNA-binding domains of nucleases used in the methods and compositions described herein may include naturally occurring or engineered (non-naturally occurring) TAL effector DNA-binding domains. See, for example, U.S. Patent Publication 2011 / 0301073.
[0180] Alternatively, nucleases may contain a CRISPR / Cas system. Such a system may include a CRISPR (clustered and regularly arranged short palindromic sequence repeat) locus (encoding the RNA component of the system) and a Cas (CRISPR-related) locus (encoding a protein) (Jansen et al., 2002. Mol. Microbiol. 43: 1565-1575; Makarova et al., 2002. Nucleic Acids Res. 30: 482-496; Makarova et al., 2006. Biol. Direct 1: 7; Haft et al., 2005. PLoS Comput. Biol. 1: e60). In microbial hosts, the CRISPR locus contains the Cas gene and a non-coding RNA element that can program the specificity of CRISPR-mediated nucleic acid cleavage.
[0181] Type II CRISPR is one of the most well-characterized systems, performing targeted DNA double-strand breaks in essentially four steps. First, two non-coding RNAs, a pre-crRNA array and a tracrRNA, are transcribed from the CRISPR locus. Second, the tracrRNA hybridizes to the repeat region of the pre-crRNA, mediating processing to a mature crRNA containing the individual spacer sequences of the pre-crRNA. Third, the mature crRNA:tracrRNA complex directs Cas9 to the target DNA via Wastson-Crick base pairing between the spacer on the crRNA and the protospacer on the target DNA adjacent to the protospacer-adjacent motif (PAM), an additional requirement for target recognition. Finally, Cas9 mediates the cleavage of the target DNA, generating a double-strand break within the protospacer.
[0182] In the use of the CRISPR / Cas system for creating targeted insertions and deletions, two non-coding RNAs (crRNA and TracrRNA) can be replaced by a single RNA called a guide RNA (gRNA). The activity of the CRISPR / Cas system involves three steps: (i) insertion of an exogenous DNA sequence into the CRISPR array to prevent future attacks in a process called "adaptation," (ii) expression of related proteins, as well as expression and processing of the array, followed by (iii) RNA-mediated interference of foreign nucleic acids. In bacterial cells, several Cas proteins are involved in the innate functions of the CRISPR / Cas system, playing a role in functions such as the insertion of foreign DNA.
[0183] Cas proteins can be “functional derivatives” of naturally occurring Cas proteins. “Functional derivatives” of naturally occurring sequence polypeptides are compounds that share common qualitative and biological properties with the naturally occurring sequence polypeptide. “Functional derivatives” include, but are not limited to, fragments of natural sequences and derivatives of natural sequence polypeptides and their fragments, provided that they share common biological activity with the corresponding natural sequence polypeptide. The biological activity intended herein is the ability of the functional derivative to hydrolyze DNA substrates into fragments. The term “derivative” encompasses both amino acid sequence variants of polypeptides, covalent modifications, and fusions thereof. Preferred derivatives of Cas polypeptides or their fragments include, but are not limited to, variants, fusions, and covalent modifications of Cas proteins or their fragments. Cas proteins (including Cas proteins or their fragments), and derivatives of Cas proteins or their fragments, are available from cells or can be synthesized chemically or by a combination of these two procedures. The cells may be cells that naturally produce Cas protein, or cells that naturally produce Cas protein and produce endogenous Cas protein at higher expression levels, or cells that have been genetically engineered to produce Cas protein from exogenously introduced nucleic acids (which encode the same or different Cas as endogenous Cas). In some cases, cells that do not naturally produce Cas protein are genetically engineered to produce it.
[0184] DNA-binding polypeptides can specifically recognize and bind to target nucleotide sequences contained within the genomic nucleic acids of a host organism. In some cases, several distinct cases of the target nucleotide sequence may be found in the host genome. The target nucleotide sequence may be rare within the organism's genome (e.g., there may be about 10, about 9, about 8, about 7, about 6, about 5, about 4, about 3, about 2, or fewer than about 1 copies of the target sequence in the genome). For example, the target nucleotide sequence may be located at a specific site within the organism's genome. The target nucleotide sequence may, for example, be randomly distributed across the genome with respect to one another; located in different linkage groups within the genome; located in the same linkage group; located on different chromosomes; located on the same chromosome; located in the genome at sites where they are expressed under similar conditions in the organism (e.g., under the control of the same, or substantially functionally identical, regulatory factors); and located in close proximity to one another within the genome (e.g., the target sequence may be contained within nucleic acids incorporated as concatemers at genomic loci).
[0185] Targeting end nuclease A DNA-binding polypeptide that specifically recognizes and binds to a target nucleotide sequence is a chimeric polypeptide, and can be incorporated within the chimeric polypeptide to provide specific binding to the target sequence. For example, such a chimeric polypeptide may include, for example, nucleases, recombinases, and / or ligase polypeptides, but are not limited to those described above. Chimeric polypeptides containing DNA-binding polypeptides and nucleases, recombinases, and / or ligase polypeptides may also include other functional polypeptide motifs and / or domains, for example, but are not limited to: spacer sequences positioned between functional polypeptides within the chimeric protein; leader peptides; peptides that cause the fusion protein to target an organelle (e.g., the nucleus); polypeptides that are cleaved by cellular enzymes; peptide tags (e.g., Myc, His, etc.); and other amino acid sequences that do not interfere with the function of the chimeric polypeptide.
[0186] Functional polypeptides within a chimeric polypeptide (e.g., DNA-binding polypeptides and nuclease polypeptides) can be operationally linked. Functional polypeptides within a chimeric polypeptide can be operationally linked by their expression from single polynucleotides encoding functional polypeptides linked together in-frame, at least, to produce a chimeric gene encoding a chimeric protein. Alternatively, functional polypeptides within a chimeric polypeptide can be operationally linked by other means, such as crosslinking independently expressed polypeptides.
[0187] DNA-binding polypeptides or guide RNAs that specifically recognize and bind to a target nucleotide sequence can be incorporated into native isolated proteins (or their variants), where the native isolated protein or its variants also contain nuclease polypeptides (and may also contain recombinase and / or ligase polypeptides). Examples of such isolated proteins include TALENs, recombinases (e.g., Cre, Hin, Tre, and FLP recombinases), RNA guide CRISPR / Cas9, and meganucleases.
[0188] In this specification, the term “targeting endonuclease” refers to native or engineered isolated proteins and their variants comprising a DNA-binding polypeptide or guide RNA and a nuclease polypeptide, as well as chimeric polypeptides comprising a DNA-binding polypeptide or guide RNA and a nuclease. Any targeting endonuclease comprising a DNA-binding polypeptide or guide RNA that specifically recognizes and binds to a target nucleotide sequence contained within the CD163 locus (for example, because the target sequence is contained in the native sequence of the locus, or because the target sequence is introduced into the locus, for example, by recombination) may be used.
[0189] Some examples of suitable chimeric polypeptides include, but are not limited to, combinations of polypeptides such as: zinc finger DNA-binding polypeptides; FokI nuclease polypeptides; TALE domains; leucine zippers; transcription factor DNA-binding motifs; and, for example, but are not limited to, TALEN, recombinases (e.g., Cre, Hin, RecA, Tre, and FLP recombinases), RNA-guided CRISPR / Cas9, DNA recognition and / or cleavage domains isolated from meganucleases; and others known to those skilled in the art. Specific examples include chimeric proteins containing site-specific DNA-binding polypeptides and nuclease polypeptides. Chimeric polypeptides can be manipulated by methods known to those skilled in the art to alter the recognition sequence of the DNA-binding polypeptide contained within the chimeric polypeptide so that the chimeric polypeptide targets a specific nucleotide sequence of interest.
[0190] Chimeric polypeptides may include a DNA-binding domain (e.g., zinc finger, TAL-effector domain, etc.) and a nuclease (cleavage) domain. The cleavage domain may be heterogeneous with respect to a DNA-binding domain, e.g., a zinc finger DNA-binding domain and a nuclease-derived cleavage domain, or a TALEN DNA-binding domain and a cleavage domain, or a meganuclease DNA-binding domain and a cleavage domain from a different nuclease. Heterogeneous cleavage domains can be obtained from any endonuclease or exonuclease. Exemplary endonucleases from which cleavage domains can be derived include, but are not limited to, restriction endonucleases and homing endonucleases. See, for example, 2002–2003 Catalogue, New England Biolabs, Beverly, Mass.; and Belfort et al. (1997) Nucleic Acids Res. 25:3379–3388. Additional enzymes that cleave DNA are known (e.g., 51 nuclease; mung bean nuclease; pancreatic DNAse I; micrococcal nuclease; yeast HO endonuclease; see also Linn et al. (eds.) Nucleases, Cold Spring Harbor Laboratory Press, 1993). One or more of these enzymes (or their functional fragments) can be used as sources of cleavage domains and cleavage half-domains.
[0191] Similarly, the cleavage half-domains can originate from any nuclease or a portion thereof as specified above, and dimerization is required for cleavage activity. Generally, if a fusion protein contains cleavage half-domains, two fusion proteins are required for cleavage. Alternatively, a single protein containing two cleavage half-domains may be used. The two cleavage half-domains can originate from the same endonuclease (or its functional fragment), or each cleavage half-domain can originate from a different endonuclease (or its functional fragment). In addition, the target sites for the two fusion proteins are preferably positioned such that the cleavage half-domains are spatially localized relative to each other by the binding of the two fusion proteins to their individual target sites, thereby allowing the cleavage half-domains to form a functional cleavage domain, for example, by dimerization. Thus, the near ends of the target sites can be separated by only 5-8 nucleotides or 15-18 nucleotides. However, any integer number of nucleotides or nucleotide pairs can be interposed between the two target sites (e.g., 2-50 nucleotide pairs or more). Generally, the cleavage site is located between the target sites.
[0192] Restriction endonucleases (restriction enzymes) are present in many species and can sequence-specifically bind to DNA (at the recognition site) and cleave the DNA at or near the binding site, for example, thereby incorporating one or more exogenous sequences (donor / transgenes) at or near the binding (target) site. Certain restriction enzymes (e.g., IIS type) cleave DNA at a site separated from the recognition site and have separable binding and cleavage domains. For example, the IIS type enzyme FokI catalyzes a double-strand break of DNA at 9 nucleotides from the recognition site on one strand and 13 nucleotides from the recognition site on the other. See, for example, U.S. Patents 5,356,802; 5,436,150 and 5,487,994; and Li et al. (1992) Proc. Natl. Acad. Sci. USA 89:4275-4279; Li et al. (1993) Proc. Natl. Acad. Sci. USA 90:2764-2768; Kim et al. (1994a) Proc. Natl. Acad. Sci. USA 91:883-887; Kim et al. (1994b) J. Biol. Chem. 269:31,978-31,982. Thus, the fusion protein may contain at least one cleavage domain (or cleavage half-domain) derived from an IIS-type restriction enzyme and one or more zinc finger-binding domains (which may or may not be manipulated).
[0193] An exemplary IIS-type restriction enzyme (whose cleavage domain is separable from its binding domain) is FokI. This particular enzyme is active as a dimer. Bitinaite et al. (1998) Proc. Natl. Acad. Sci. USA 95: 10,570-10,575. Therefore, for the purposes of this disclosure, the portion of the FokI enzyme used in the disclosed fusion protein is considered to be the cleavage half-domain. Thus, in targeted double-strand breaks and / or targeted substitution of cell sequences using zinc finger-FokI fusions, two fusion proteins (each containing a FokI cleavage half-domain) can be used to reconstitute a catalytically active cleavage domain. Alternatively, a single polypeptide molecule containing a DNA-binding domain and two FokI cleavage half-domains can also be used.
[0194] A cleavage domain or cleavage half-domain can be any portion of a protein that retains cleavage activity or the ability to multimerize (e.g., dimerize) to form a functional cleavage domain.
[0195] An exemplary IIS-type restriction enzyme is described in U.S. Patent Publication 2007 / 0134796. Additional restriction enzymes also include separable binding and cleavage domains, which are intended in this disclosure. See, for example, Roberts et al. (2003) Nucleic Acids Res. 31:418-420.
[0196] The cleavage domain may contain one or more manipulated cleavage half-domains (also called dimerization domain variants) that minimize or prevent homodimerization, as described, for example, in U.S. Patent Publications 2005 / 0064474; 2006 / 0188987 and 2008 / 0131962.
[0197] Alternatively, nucleases can be constructed in vivo using so-called "cleavage enzyme" techniques at nucleic acid target sites (see, for example, U.S. Patent Publication No. 20090068164). The components of such cleavage enzymes may be expressed on separate expression constructs or linked together in a single open reading frame, in which case the individual components are separated by, for example, a self-cleaving 2A peptide or IRES sequence. The components may be individual zinc finger-binding domains or meganuclease nucleic acid-binding domains.
[0198] Zinc finger nuclease Chimeric polypeptides can include custom-designed zinc finger nucleases (ZFNs) that can be engineered to deliver targeted site-specific double-strand DNA breaks (which may incorporate exogenous nucleic acids or donor DNA) (see U.S. Patent Publication 2010 / 0257638). ZFNs are chimeric polypeptides comprising a nonspecific cleavage domain and a zinc finger DNA-binding domain polypeptide derived from a restriction endonuclease (e.g., FokI). For example, Huang et al. (1996) J. Protein Chem. 15:481-9; Kim et al. (1997a) Proc. Natl. Acad. Sci. USA 94:3616-20; Kim et al. (1996) Proc. Natl. Acad. Sci. USA 93:1156-60; Kim et al. (1994) Proc Natl. Sci. USA 91:883-7; Kim et al. (1997b) Proc. Natl. Acad. Sci. USA 94:12875-9; Kim et al. (1997c) Gene 203:43-9; Kim et al. (1998) Biol. Chem. 379:489-95; Nahon and Raveh (1998) Nucleic Acids Res. See 26:1233-9; Smith et al. (1999) Nucleic Acids Res. 27:674-81. ZFNs may contain non-standard zinc finger DNA-binding domains (see US Patent Publication 2008 / 0182332). FokI restriction endonucleases must dimerize via their nuclease domain to cleave DNA and introduce double-strand breaks. Consequently, ZFNs containing a nuclease domain derived from such endonucleases also require dimerization of the nuclease domain to cleave target DNA.Mani et al. (2005) Biochem. Biophys. Res. Commun. 334:1191-7; Smith et al. (2000) Nucleic Acids Res. 28:3361-9. ZFN dimerization may be promoted by two adjacent, oppositely oriented DNA-binding sites. Ibid.
[0199] A method for site-directed integration of exogenous nucleic acids into at least one CD163 locus in a host may involve introducing a ZFN into host cells, where the ZFN recognizes and binds to a target nucleotide sequence, where the target nucleotide sequence is located within at least one CD163 locus in the host. In some cases, the target nucleotide sequence is not located anywhere other than at least one CD163 locus in the host genome. For example, the DNA-binding polypeptide of the ZFN may be engineered to recognize and bind to a target nucleotide sequence identified within at least one CD163 locus (e.g., by sequencing the CD163 locus). A method for site-specific integration of an exogenous nucleic acid into at least one host CD163 performance locus, comprising introducing a ZFN into a host cell, may also comprise introducing an exogenous nucleic acid into a cell, where the recombination of the exogenous nucleic acid into the host nucleic acid containing at least one CD163 locus is facilitated by site-specific recognition and binding to the target sequence of the ZFN (and subsequent cleavage of the nucleic acid containing the CD163 locus).
[0200] Optional exogenous nucleic acids for integration at the CD163 locus Exogenous nucleic acids for integration at the CD163 locus include: exogenous nucleic acids for site-specific integration at at least one CD163 locus, e.g., ORFs; nucleic acids comprising a nucleotide sequence encoding a targeting endonuclease; and vectors comprising at least one of either or both of the above. Thus, a particular nucleic acid includes a nucleotide sequence encoding a polypeptide, a structural nucleotide sequence, and / or a DNA-binding polypeptide recognition and binding site.
[0201] Arbitrary exogenous nucleic acid molecules for site-directed integration As described above, the insertion of an exogenous sequence (also called a “donor sequence,” “donor,” or “transgene”) is provided, for example, for polypeptide expression, modification of a mutant gene, or increased expression of a wild-type gene. It will be readily apparent that the donor sequence is typically not identical to the genomic sequence at the site where it is placed. The donor sequence may contain a non-homologous sequence adjacent to two homologous regions, enabling efficient homologous recombination repair (HDR) at the target site. In addition, the donor sequence may contain a vector molecule containing a sequence that is not homologous to the target region in cellular chromatin. The donor molecule may contain several discontinuous cellular chromatin homologous regions. For example, in a targeted insertion of a sequence not normally present in the target region, the sequence may be present in the donor nucleic acid molecule and adjacent to a region homologous to the sequence in the target region.
[0202] Donor polynucleotides can be DNA or RNA, single-stranded or double-stranded, and can be introduced into cells in linear or circular form. See, for example, U.S. Patent Publications 2010 / 0047805, 2011 / 0281361, 2011 / 0207221, and 2013 / 0326645. When introduced in linear form, the donor sequence ends can be protected by methods known to those skilled in the art (e.g., from exonuclease degradation). For example, one or more dideoxynucleotide residues may be added to the 3' end of the linear molecule, and / or self-complementary oligonucleotides may be ligated to one or both ends. See, for example, Chang et al. (1987) Proc. Natl. Acad. Sci. USA 84:4959-4963; Nehls et al. (1996) Science 272:886-889. Additional methods for protecting exogenous polynucleotides from degradation include, but are not limited to, the addition and modification of terminal amino groups and internucleotide bonds, such as the use of phosphorothioates, phosphoramidates, and O-methylribose or deoxyribose residues.
[0203] Polynucleotides can be introduced into cells as part of a vector molecule containing additional sequences, such as genes encoding replication origins, promoters, and antibiotic resistance. Furthermore, donor polynucleotides can be introduced as naked nucleic acids, as nucleic acids complexed with active agents such as liposomes or poloxamers, or delivered by viruses (e.g., adenoviruses, AAVs, herpesviruses, retroviruses, lentiviruses, and integrase-deficient lentiviruses (IDLVs)).
[0204] Donors are generally integrated such that their expression is driven by the endogenous promoter of the integration site, i.e., the promoter that drives the expression of the endogenous gene into which the donor is integrated (e.g., CD163). However, it will be clear that donors may include promoters and / or enhancers, such as constitutive promoters or inducible or tissue-specific promoters.
[0205] Furthermore, although not required for expression, exogenous sequences may also include transcriptional or translational regulatory sequences, such as promoters, enhancers, insulators, intrasequence ribosome entry sites, sequences encoding the 2A peptide, and / or polyadenylation signals.
[0206] Exogenous nucleic acids that can be incorporated into at least one CD163 locus in a site-specific manner to modify the CD163 locus include, but are not limited to, nucleic acids containing a nucleotide sequence encoding the target polypeptide; nucleic acids containing agricultural genes; nucleic acids containing a nucleotide sequence encoding an RNAi molecule; or nucleic acids that disrupt the CD163 gene.
[0207] Exogenous nucleic acids can be incorporated at the CD163 locus to modify the CD163 locus, where the nucleic acid contains a nucleotide sequence encoding the target polypeptide, and thus the nucleotide sequence is expressed from the CD163 locus in the host. In some examples, the target polypeptide (e.g., an exogenous protein) is expressed in commercial quantities from the nucleotide sequence encoding the target polypeptide. In such examples, the target polypeptide may be extracted from host cells, tissues, or biomass.
[0208] Nucleic acid molecules containing nucleotide sequences encoding targeting endonucleases The nucleotide sequence encoding a targeting endonuclease can be manipulated by manipulating (e.g., ligation) the native nucleotide sequence encoding the polypeptide contained within the targeting endonuclease. For example, the nucleotide sequence of a gene encoding a protein containing a DNA-binding polypeptide can be examined to identify the nucleotide sequence of the gene corresponding to the DNA-binding polypeptide, and that nucleotide sequence can be used as an element of the nucleotide sequence encoding a targeting endonuclease containing the DNA-binding polypeptide. Alternatively, the amino acid sequence of a targeting endonuclease can be used, for example, to deduce the nucleotide sequence encoding the targeting endonuclease according to the degeneracy of the genetic code.
[0209] In an exemplary nucleic acid molecule containing a nucleotide sequence encoding a targeting endonuclease, the last codon of the first polynucleotide sequence encoding the nuclease polypeptide and the first codon of the second polynucleotide sequence encoding the DNA-binding polypeptide can be separated by any number of nucleotide triplets, for example, without encoding an intron or "STOP". Similarly, the last codon of the nucleotide sequence encoding the first polynucleotide sequence encoding the DNA-binding polypeptide and the first codon of the second polynucleotide sequence encoding the nuclease polypeptide can be separated by any number of nucleotide triplets. The last codon of the first polynucleotide sequence encoding the nuclease polypeptide (i.e., the 3' end in the nucleic acid sequence) and the second polynucleotide sequence encoding the DNA-binding polypeptide can be fused in phase-register with the first codon of a further polynucleotide coding sequence that is directly adjacent to it or separated from it by a short peptide sequence, for example, encoded by a synthetic nucleotide linker (for example, a nucleotide linker that can be used to achieve fusion). Examples of such further polynucleotide sequences include, but are not limited to, tags, targeting peptides, and enzymatic cleavage sites. Similarly, the first codon at the very 5' end (in the nucleic acid sequence) of the first and second polynucleotide sequences can be phase-matched and fused with the last codon of a further polynucleotide coding sequence that is directly adjacent to it or separated from it by a short peptide sequence.
[0210] The sequence that isolates the polynucleotide sequence encoding the functional polypeptide (e.g., DNA-binding polypeptide and nuclease polypeptide) within the targeting endonuclease can be composed of, for example, any sequence; therefore, the encoded amino acid sequence is unlikely to significantly alter the translation of the targeting endonuclease. Due to the independent nature of known nuclease polypeptides and known DNA-binding polypeptides, the intervening sequence will not interfere with the individual functions of these structures.
[0211] Other knockout methods Using various other techniques known in the art, genes can be inactivated to create knockout animals and / or nucleic acid constructs can be introduced into animals to create founder animals and generate animal strains, where the knockout or nucleic acid construct is incorporated into the genome. Such techniques, though not limited to them, include pronuclear microinjection (US Patent No. 4,873,191), retrovirus-mediated gene transfer into germline (Van der Putten et al. (1985) Proc. Natl. Acad. Sci. USA 82, 6148-1652), gene targeting to embryonic stem cells (Thompson et al. (1989) Cell 56, 313-321), embryonic electroporation (Lo (1983) Mol. Cell. Biol. 3, 1803-1814), and sperm-mediated gene transfer (Lavitrano et al. (2002) Proc. Natl. Acad. Sci. USA 99, 14230-14235; Lavitrano et al. (2006) Reprod. Fert. Develop. 18, Examples include in vitro transformation of somatic cells, e.g., cumulus oophorus or mammary cells, or adult, fetal, or embryonic stem cells, followed by nuclear transfer (Wilmut et al. (1997) Nature 385, 810-813; and Wakayama et al. (1998) Nature 394, 369-374). Pronuclear microinjection, sperm-mediated gene transfer, and somatic cell nuclear transfer are particularly useful techniques. A genomically modified animal is one in which all of its cells, including its germline cells, have genetic modifications. If a method is used to create an animal that is mosaic in the genetic modification, the animal may be inbred, and genomically modified offspring may be selected. Genomic modification can occur if the cells are modified in the blastocyst stage, for example, by using cloning to create a mosaic animal, or if a single cell is modified. Animals modified to not mature sexually can be homozygous or heterozygous for the modification, depending on the specific approach used.When a specific gene is inactivated by knockout modification, homozygosity is usually required. When a specific gene is inactivated by RNA interference or a dominant-negative strategy, heterozygosity is often sufficient.
[0212] Typically, in embryo / zygote microinjection, a nucleic acid construct or mRNA is introduced into the fertilized egg; a one- or two-cell fertilized egg is used as a nuclear structure containing sperm head and egg-derived genetic material visible within the cytoplasm. Pronuclear stage fertilized eggs are available in vitro or in vivo (i.e., surgically retrieved from the oviduct of a donor animal). In vitro fertilized eggs can be prepared as follows: For example, pig ovaries can be collected at the slaughterhouse and maintained at 22-28°C during transport. The ovaries can be washed and isolated for follicular aspiration, and follicles ranging from 4-8 mm can be aspirated under vacuum using an 18-gauge needle into a 50 mL cone centrifuge tube. Follicular fluid and aspirated oocytes can be rinsed through a prefilter with commercially available TL-HEPES (Minitube, Verona, Wis.). Selected oocytes surrounded by dense cumulus masses can be placed in TCM-199 oocyte maturation medium (Minitube, Verona, Wis.) supplemented with 0.1 mg / mL cysteine, 10 ng / mL epidermal growth factor, 10% porcine follicular fluid, 50 μM 2-mercaptoethanol, 0.5 mg / mL cAMP, 10 IU / mL pregnant mare serum gonadotropin (PMSG), and human chorionic gonadotropin (hCG), respectively, for approximately 22 hours at 38.7°C and 5% CO2 in humidified air. The oocytes can then be transferred to fresh TCM-199 maturation medium (without cAMP, PMSG, or hCG) and incubated for a further 22 hours. The mature oocytes can be removed from their cumulus masses by vortexing them in 0.1% hyaluronidase for 1 minute.
[0213] In pigs, mature oocytes can be fertilized in 500 μl of Minitube PORCPRO IVF medium (Minitube, Verona, Wis.) in a Minitube 5-well fertilization dish. For in vitro fertilization (IVF), newly collected or frozen boar semen can be washed and resuspended in PORCPRO IVF medium up to 400,000 sperm. Sperm concentration can be analyzed by computer-assisted semen analysis (SPERMVISION, Minitube, Verona, Wis.). Final in vitro sperm injection can be performed by boars with a final concentration of approximately 40 motile sperm / oocytes per 10 μl volume. All fertilized oocytes can be incubated at 38.7°C in a 5.0% CO2 atmosphere for 6 hours. Six hours after sperm injection, prospective zygotes can be washed twice in NCSU-23 and transferred to 0.5 mL of the same medium. This system can routinely produce 20-30% blastocysts in most boars with a polyspermy sperm injection rate of 10-30%.
[0214] Linearized nucleic acid constructs or mRNA can be injected into one of the pronuclei or into the cytoplasm. The injected embryos can then be implanted into a female recipient (e.g., in the fallopian tube of the female recipient) and developed within the female recipient to produce transgenic or gene-edited animals. In particular, in vitro fertilized embryos can be centrifuged at 15,000 × g for 5 minutes to allow lipid sedimentation, enabling visualization of the pronuclei. The embryos can be injected using an Eppendorf FEMTOJET injector and cultured until blastocyst formation. The rates and characteristics of embryonic cleavage and blastocyst formation can be recorded.
[0215] Embryos can be surgically implanted into the uterus of an asynchronous recipient. Typically, 100–200 (e.g., 150–200) embryos can be placed in the ampulla-isthmus junction of the fallopian tube using a 5.5-inch TOMCAT® catheter. Real-time ultrasound monitoring of pregnancy can be performed after surgery.
[0216] In somatic cell nuclear transfer, transgenic or gene-edited cells containing the above-mentioned nucleic acid constructs, such as embryonic blastomeres, fetal fibroblasts, adult ear fibroblasts, or granulosa cells, can be introduced into enucleated oocytes to establish a composite cell. Oocytes can be enucleated by partially incising the zona pellucida near the polar body and then extruding the cytoplasm through the incision area. Typically, an injection pipette with a sharp, oblique tip is used to inject the transgenic or gene-edited cells into the enucleated oocyte arrested in meiosis II. In some conferences, an oocyte arrested in meiosis II is referred to as an oocyte. After creating a pig or bovine embryo (e.g., by fusing and activating oocytes), the embryo is transplanted into the fallopian tube of a female recipient approximately 20–24 hours after activation. See, for example, Cibelli et al. (1998) Science 280, 1256-1258 and U.S. Patents 6,548,741, 7,547,816, 7,989,657, or 6,211,429. In pigs, female recipients can check for pregnancy approximately 20-21 days after embryo transfer.
[0217] Using standard breeding techniques, animals homozygous for the inactivating gene derived from the initial heterozygous founder animal can be produced. However, homozygosity may not be necessary. The gene-edited pigs described herein can be bred together with other pigs of interest.
[0218] As soon as gene-edited animals are created, inactivation of endogenous nucleic acids can be evaluated using standard techniques. Initial screening can be achieved by Southern blot analysis to determine whether inactivation has occurred. For a description of Southern blot analysis, see sections 9.37–9.52 of Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, 2nd edition, Cold Spring Harbor Press, Plainview;NY. Polymerase chain reaction (PCR) techniques can also be used in initial screening. PCR is a procedure or technique in which a target nucleic acid is amplified. Generally, it is used to design oligonucleotide primers in which the sequence information from or beyond the edge of the target region is identical or similar to the sequence of the reverse strand of the template being amplified. PCR can be used to amplify specific sequences from DNA and RNA (including sequences from whole-genomic DNA or whole-cellular RNA). Primers are typically 14–40 nucleotides long, but can range in length from 10 to several hundred nucleotides. PCR is described, for example, in PCR Primer: A Laboratory Manual, ed. Dieffenbach and Dveksler, Cold Spring Harbor Laboratory Press, 1995. Nucleic acids can also be amplified by ligase chain reaction, strand displacement amplification, auto-persistent sequence replication, or nucleic acid sequence-based amplification. See, for example, Lewis (1992) Genetic Engineering News 12,1; Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87:1874; and Weiss (1991) Science 254:1292. At the blastocyst stage, embryos can be processed individually for analysis by PCR, Southern hybridization, and splinkerette PCR (see, for example, Dupuy et al. Proc Natl Acad Sci USA (2002) 99:4495).
[0219] Interfering RNA Various interfering RNA (RNAi) systems are known. Double-stranded RNA (dsRNA) induces sequence-specific degradation of homologous gene transcripts. RNA-induced silencing complexes (RISCs) metabolize dsRNA into small 21-23 nucleotide interfering RNAs (siRNAs). RISCs include double-stranded RNAse (dsRNAse, e.g., Dicer) and ssRNAse (e.g., Argonaut 2 or Ago2). RISCs utilize the antisense strand as a guide to find cleavable targets. Both siRNAs and microRNAs (miRNAs) are known. Methods for inactivating genes in genetically edited animals involve inducing RNA interference on target genes and / or nucleic acids so that the expression of the target gene and / or nucleic acid is reduced.
[0220] For example, exogenous nucleic acid sequences can induce RNA interference with nucleic acids encoding polypeptides. For instance, double-stranded small interfering RNA (siRNA) or small hairpin RNA (shRNA) homologous to target DNA can be used to reduce the expression of that DNA. Constructs for siRNA can be made as described, for example, in Fire et al. (1998) Nature 391:806; Romano and Masino (1992) Mol. Microbiol. 6:3343; Cogoni et al. (1996) EMBO J. 15:3153; Cogoni and Masino (1999) Nature 399:166; Misquitta and Paterson (1999) Proc. Natl. Acad. Sci. USA 96:1451; and Kennerdell and Carthew (1998) Cell 95:1017. Constructs for shRNA can be prepared as described by McIntyre and Fanning (2006) BMC Biotechnology 6:1. Generally, shRNA is transcribed as a single-stranded RNA molecule containing a complementary region, which can anneal and form a small hairpin.
[0221] The probability of finding a single, individual functional siRNA or miRNA oriented to a specific gene is high. While the predictive power of a specific siRNA sequence is, for example, about 50%, many interfering RNAs can be generated with good certainty that at least one of them is effective.
[0222] In vitro cells, in vivo cells, or genetically edited animals, such as livestock, expressing RNAi directed to the gene encoding CD163 may be used. The RNAi may be selected from the group consisting of, for example, siRNA, shRNA, dsRNA, RISC, and miRNA.
[0223] Guidance system Induction systems can be used to inactivate the CD163 gene. Various induction systems are known that allow for spatial and temporal control of gene inactivation. Some have been proven functional in vivo in pigs.
[0224] One example of an induction system is the tetracycline (tet)-on promoter system, which can be used to regulate nucleic acid transcription. In this system, a mutant Tet repressor (TetR) is fused to the activation domain of the herpes simplex virus VP16 transactivator protein to produce a tetracycline-regulated transcription activator (tTA), which is regulated by tet or doxycycline (dox). In the absence of antibiotics, transcription is minimal, while in the presence of tet or dox, transcription is induced. Another induction system is the ecdysone or rapamycin system. Ecdysone is an insect molting hormone, and its production is regulated by a heterodimer of the ecdysone receptor and the product of the ultraspiral gene (USP). Expression is induced by treatment with ecdysone or an analogue of ecdysone, such as muristerone A. The active ingredient administered to an animal to activate an induction system is called an inducer.
[0225] Tetracycline induction systems and Cre / loxP recombinase systems (constitutive or inducible) are among the more commonly used induction systems. Tetracycline induction systems involve tetracycline regulatory transactivators (tTA) / reverse tTA (rtTA). Methods for using these systems in vivo involve creating two lines of genetically edited animals. One animal line expresses the activator (tTA, rtTA, or Cre recombinase) under the control of a selected promoter. Animals of the other line express the receptor, in which case the expression of the gene of interest (or the gene to be modified) is under the control of the target sequence for the tTA / rtTA transactivator (or adjacent to the loxP sequence). Crossing the two animals provides control over gene expression.
[0226] The tetracycline-dependent regulatory system (tet system) relies on two components: a tetracycline-regulated transactivator (tTA or rtTA) and a tTA / rtTA-dependent promoter that controls the expression of downstream cDNA in a tetracycline-dependent manner. In the absence of tetracycline or its derivatives (e.g., doxycycline), tTA binds to the tetO sequence, enabling transcriptional activation of the tTA-dependent promoter. However, in the presence of doxycycline, tTA cannot interact with its target, and transcription does not occur. The tet system using tTA is called tet-OFF, because tetracycline or doxycycline allows for downregulation of transcription. Administration of tetracycline or its derivatives allows for temporal control of transgene expression in vivo. rtTA is a variant of tTA that is non-functional in the absence of doxycycline but requires the presence of a ligand for transactivation. Therefore, this tet system is called tet-ON. The tet system is used in vivo for the inducible expression of several transgenes that encode, for example, reporter genes, oncogenes, or proteins involved in signaling cascades.
[0227] The Cre / lox system utilizes Cre recombinase, which catalyzes site-specific recombination via crossover between two distant Cre recognition sequences, i.e., loxP sites. A DNA sequence introduced between the two loxP sequences (called floxed DNA) is cleaved by Cre-mediated recombination. Control of Cre expression in transgenic and / or gene-edited animals, either spatially (by tissue or cell-specific promoters) or temporally (by induction systems), allows for control of DNA cleavage between the two loxP sites. One application is for conditional gene inactivation (conditional knockout). Another application is for protein overexpression, where a floxed stop codon is inserted between the promoter sequence and the target DNA. The genetically edited animal expresses Cre and does not express the transgene until the floxed stop codon is cleaved. This system has been applied to tissue-specific carcinogenesis and has been used to control antigen receptor expression in B lymphocytes. Inducible Cre recombinases have also been developed. Inducible Cre recombinase is activated only by the administration of an exogenous ligand. Inducible Cre recombinase is a fusion protein containing the original Cre recombinase and a specific ligand-binding domain. The functional activity of Cre recombinase depends on the external ligand that can bind to this specific domain within the fusion protein.
[0228] In vitro cells, in vivo cells, or genetically edited animals, such as livestock animals, containing the CD163 gene under the control of an induction system may be used. The genetic modification of the animals may be genomic or mosaic. The induction system may be selected from, for example, the group consisting of Tet-On, Tet-Off, Cre-lox, and Hif1α.
[0229] Vectors and nucleic acids Various nucleic acids can be introduced for cell knockout purposes, for gene inactivation, to obtain gene expression, or for other purposes. In this specification, the term nucleic acid includes DNA, RNA, and nucleic acid analogs, as well as nucleic acids that are double-stranded or single-stranded (i.e., sense or antisense single-stranded). Nucleic acid analogs can be modified, for example, at the base moiety, sugar moiety, or phosphate backbone to improve the stability, hybridization, or solubility of nucleic acids. Modifications at the base moiety include deoxyuridine for deoxythymidine, and 5-methyl-2'-deoxycytidine and 5-bromo-2'-deoxycytidine for deoxycytidine. Modifications at the sugar moiety include modification of the 2'-hydroxyl group of ribose sugars to form 2'-O-methyl or 2'-O-allyl sugars. The deoxyribose phosphate backbone can be modified to produce morpholino nucleic acids (in which case each base portion is 6-membered and linked to a morpholino ring) or peptide nucleic acids (in which case the deoxyribose phosphate backbone is replaced by a pseudo-peptide backbone, and 4 bases are retained). See Summerton and Weller (1997) Antisense Nucleic Acid Drug Dev. 7(3):187; and Hyrup et al. (1996) Bioorgan. Med. Chem. 4:5. In addition, the deoxyribose phosphate backbone can be replaced with, for example, a phosphorothioate or phosphorodithioate backbone, a phosphoramidite, or an alkylphosphotryester backbone.
[0230] The target nucleic acid sequence can be operably ligated to a regulatory region, such as a promoter. The regulatory region may be a porcine regulatory region or derived from another species. In this specification, operably ligated means the arrangement of a regulatory region to a nucleic acid sequence that enables or promotes the transcription of the target nucleic acid.
[0231] Any type of promoter can be operably linked to a target nucleic acid sequence. Examples of promoters include, but are not limited to, tissue-specific promoters, constitutive promoters, inductive promoters, and promoters that are responsive or unresponsive to specific stimuli. A suitable tissue-specific promoter may result in preferential expression of nucleic acid transcripts in β-cells, for example, the human insulin promoter. Other tissue-specific promoters may result in preferential expression in hepatocytes or cardiac tissue, for example, the albumin or α-myosin heavy chain promoters, respectively. Promoters that promote the expression of nucleic acid molecules without significant tissue or time specificity (i.e., constitutive promoters) may be used. For example, β-actin promoters, e.g., chicken β-actin gene promoter, ubiquitin promoter, miniCAGs promoter, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter, or 3-phosphoglycerate kinase (PGK) promoter, as well as viral promoters, e.g., herpes simplex virus thymidine kinase (HSV-TK) promoter, SV40 promoter, or cytomegalovirus (CMV) promoter may be used. For example, a fusion of the chicken β-actin gene promoter and the CMV enhancer can be used as a promoter. See, for example, Xu et al. (2001) Hum. Gene Ther. 12:563; and Kiwaki et al. (1996) Hum. Gene Ther. 7:821.
[0232] Additional regulatory regions that may be useful in a nucleic acid construct include, but are not limited to, polyadenylation sequences, translational regulatory sequences (e.g., intrasequence ribosome entry segments, IRESs), enhancers, inducers, or introns. While such regulatory regions may not be essential, they can increase expression by influencing transcription, mRNA stability, translation efficiency, etc. Such regulatory regions can be included in the nucleic acid construct to achieve optimal nucleic acid expression in the desired cell(s). However, sufficient expression can sometimes be achieved without such additional elements.
[0233] Nucleic acid constructs encoding signal peptides or selectable markers may be used. Signal peptides can be used to direct the encoded polypeptide to a specific cellular location (e.g., the cell surface). Non-limiting examples of selectable markers include puromycin, ganciclovir, adenosine deaminase (ADA), aminoglycoside phosphotransferase (neo, G418, APH), dihydrofolate reductase (DHFR), hygromycin-B-phosphotransferase (phosphtransferase), thymidine kinase (TK), and xanthine-guanine phosphoribosyltransferase (XGPRT). Such markers are useful for selecting stable transformants under culture. Other selectable markers include fluorescent polypeptides, such as green fluorescent protein or yellow fluorescent protein.
[0234] Sequences encoding selectable markers can be flanked by recognition sequences for recombinases such as Cre or Flop. For example, a selectable marker can be flanked by a loxP recognition site (a 34 bp recognition site recognized by Cre recombinase) or an FRT recognition site, so that the selectable marker can be excised from the construct. For a re-examination of Cre / lox techniques, see Orban, et al., Proc. Natl. Acad. Sci. (1992) 89:6861 and Brand and Dymecki, Dev. Cell (2004) 6:7. Transposons containing Cre- or Flop-activatable transgenes interrupted by a selectable marker gene can also be used to obtain animals with conditional expression of the transgene. For example, the promoter driving marker / transgene expression can be either ubiquitous or tissue-specific, thereby obtaining ubiquitous or tissue-specific expression of the marker in F0 animals (e.g., pigs). Tissue-specific activation of a transgene can be achieved, for example, by crossing pigs that ubiquitously express a marker-disrupting transgene with pigs that express Cre or Flp in a tissue-specific manner, or by crossing pigs that ubiquitously express a marker-disrupting transgene with pigs that express Cre or Flp recombinase. Regulated expression of the transgene or controlled excision of the marker enables the expression of the transgene.
[0235] Exogenous nucleic acids can encode polypeptides. A nucleic acid sequence encoding a polypeptide may include a tag sequence encoding a “tag” designed to facilitate subsequent operations of the encoded polypeptide (e.g., localization or detection). The tag sequence can be inserted into the nucleic acid sequence encoding the polypeptide so that the encoded tag is located at either the carboxyl or amino terminus of the polypeptide. Non-limiting examples of encoded tags include glutathione S-transferase (GST) and FLAG® tag (Kodak, New Haven, Conn.).
[0236] Nucleic acid constructs can be methylated using SssI CpG methylase (New England Biolabs, Ipswich, Mass.). Generally, nucleic acid constructs can be incubated with S-adenosylmethionine and SssI CpG methylase in buffer at 37°C. Hypermethylation can be confirmed by assaying with agarose gel electrophoresis after incubation of the construct with one unit of HinP1I endonuclease at 37°C for 1 hour.
[0237] Nucleic acid constructs can be introduced into any type of embryonic, fetal, or adult animal cell, such as germ cells (e.g., oocytes or eggs), progenitor cells, adult or embryonic stem cells, primordial germ cells, kidney cells (e.g., PK-15 cells), islet cells, β-cells, hepatocytes, or fibroblasts (e.g., cutaneous fibroblasts), using a variety of techniques. Non-limiting examples of techniques include transposon systems, recombinant viruses that can infect cells, or liposomes or other non-viral methods, such as electroporation, microinjection, or calcium phosphate precipitation, which can deliver nucleic acids to cells.
[0238] In transposon systems, the transcription unit of the nucleic acid construct, i.e., the regulatory region operably linked to the exogenous nucleic acid sequence, is adjacent to the reverse repeat of the transposon. Several transposon systems, for example, Sleeping Beauty (see U.S. Patent No. 6,613,752 and U.S. Patent Publication No. 2005 / 0003542); Frog Prince (Miskey et al. (2003) Nucleic Acids Res. 31:6873); Tol2 (Kawakami (2007) Genome Biology 8(Suppl.1):S7); Minos (Pavlopoulos et al. (2007) Genome Biology 8(Suppl.1):S2); Hsmar1 (Miskey et al. (2007)) Mol Cell Biol. 27:4589); and Passport have been developed for introducing nucleic acids into cells, including mouse, human, and porcine cells. Sleeping Beauty transposons are particularly useful. Transposases can be delivered as proteins encoded on the same nucleic acid construct as the exogenous nucleic acid, introduced on separate nucleic acid constructs, or provided as mRNA (e.g., in vitro transcription and capped mRNA).
[0239] Insulator elements can also be included in nucleic acid constructs to maintain the expression of exogenous nucleic acids and to prevent unwanted transcription of host genes. See, for example, U.S. Patent Publication 2004 / 0203158. Typically, insulator sequences are adjacent to both sides of a transcription unit and within the reverse repeats of a transposon. Non-limiting examples of insulator sequences include matrix-attached region-(MAR) type insulator sequences and boundary type insulator sequences. See, for example, U.S. Patents 6,395,549, 5,731,178, 6,100,448, and 5,610,053, and U.S. Patent Publication 2004 / 0203158.
[0240] Nucleic acids can be incorporated into vectors. A vector is a broad term encompassing any specific DNA segment designed to move from a carrier into a target DNA. A vector may also be called an expression vector or vector system, and is a set of components required to cause DNA insertion into a genome or other target DNA sequence, such as an episome, plasmid, or actually a viral / phage DNA segment. Vector systems used for gene delivery in animals, e.g., viral vectors (e.g., retroviruses, adeno-associated viruses, and embedded phage viruses), and non-viral vectors (e.g., transposons), have two basic components: 1) a vector consisting of DNA (or RNA reverse-transcribed into cDNA) and 2) a transposase, recombinase, or other integrase enzyme that recognizes both the vector and the DNA target sequence and inserts the vector into the target DNA sequence. A vector most often contains one or more expression cassettes, which contain one or more expression regulatory sequences, where each expression regulatory sequence is a DNA sequence that controls and regulates the transcription and / or translation of another DNA sequence, or mRNA.
[0241] Many different types of vectors are known. For example, plasmids and viral vectors, such as retroviral vectors, are known. Mammalian expression plasmids typically have a replication start site, a suitable promoter and an optional enhancer, a required ribosome binding site, a polyadenylation site, splice donor and acceptor sites, a transcription termination sequence, and a 5' adjacent non-transcription sequence. Examples of vectors include: plasmids (which may also be carriers of other types of vectors), adenoviruses, adeno-associated viruses (AAV), lentiviruses (e.g., modified HIV-1, SIV, or FIV), retroviruses (e.g., ASV, ALV, or MoMLV), and transposons (e.g., Sleeping Beauty, P-element, Tol-2, Frog Prince, piggyBac).
[0242] In this specification, the term nucleic acid refers to both RNA and DNA, including, for example, cDNA, genomic DNA, synthetic (e.g., chemically synthesized) DNA, and naturally occurring and chemically modified nucleic acids, such as synthetic bases or other backbones. Nucleic acid molecules can be double-stranded or single-stranded (i.e., sense or antisense single-stranded).
[0243] Founder animals, animal lineages, traits, and reproduction Founder animals can be produced by cloning and other methods described herein. Founders can be homozygous for genetic modification, as in the case of zygotes or primary cells undergoing homozygous modification. Similarly, heterozygous founders can also be produced. Founders are preferably heterozygous in animals containing at least one modified chromosome sequence in the gene encoding the CD163 protein. Founders may be genomically modified, meaning that all cells undergo modification in their genome. Founders can be mosaicistic for modification, as can occur when a vector is introduced into one of several cells in an embryo, typically at the blastocyst stage. Progeny of mosaic animals can be tested to identify genomically modified progeny. An animal lineage is established when a pool of animals is created in which heterozygous or homozygous progeny consistently express the modification and can be bred sexually or by assisted reproductive technology.
[0244] In livestock, many alleles are known to be associated with various traits, such as production traits, body type traits, processability traits, and other functional traits. Those skilled in the art are familiar with monitoring and quantifying these traits, e.g., Visscher et al., Livestock Production Science, 40 (1994) 123-137, U.S. Patents 7,709,206, US2001 / 0016315, US2011 / 0023140, and US2005 / 0153317. Animal strains may include traits selected from a group of traits consisting of production traits, body type traits, processability traits, fertility traits, maternal traits, and disease resistance traits. Further traits include the expression of recombinant gene products.
[0245] Animals possessing one or more desired traits can be modified to prevent their sexual maturation. Since animals are infertile until maturity, sexual maturation can be regulated as a means of controlling the dissemination of animals. Animals bred or modified to possess one or more traits can thus be offered to recipients with reduced risk of the recipient breeding the animals and monopolizing the value of the traits. For example, the genome of an animal can be genetically modified, where the modification involves inactivation of a sexual maturation gene, where the sexual maturation gene in the wild-type animal expresses a factor of selectivity for sexual maturation. The animal can be treated by administering a compound that treats the deficiency caused by the loss of expression of the gene that induces sexual maturation in the animal.
[0246] Breeding of animals requiring the administration of compounds to induce sexual maturity can, for convenience, be achieved in a treatment facility. Treatment facilities can implement standardized protocols with well-controlled strains, efficiently producing consistent animals. The animal progeny can be distributed to multiple locations where they are reared. Farms and farmers (including ranches and ranch owners) can thus order a desired number of progeny having a specific range of age and / or weight and / or traits, and have them delivered at a desired time and / or location. Recipients, for example, farmers, can then rear the animals and deliver them to market as they wish.
[0247] Genetically modified livestock animals possessing inactivation maturation genes can be delivered to (e.g., one or more locations, multiple farms). The animals can have an age of approximately 1 to 180 days. The animals can have one or more traits (e.g., expressing a desired trait, a high-value trait, a novel trait, or a recombinant trait).
[0248] Methods for increasing the resistance of animals to breeding and infection, and animal populations. A breeding method for producing animals or strains with reduced susceptibility to infection by a pathogen is provided herein. The method comprises genetically modifying an oocyte or spermatocyte to introduce a modified chromosomal sequence in the gene encoding the CD163 protein into at least one of the oocyte and spermatocyte, and fertilizing the oocyte with a spermatocyte to produce an embryo containing the modified chromosomal sequence in the gene encoding the CD163 protein. Alternatively, the method comprises genetically modifying an embryo to introduce a modified chromosomal sequence in the gene encoding the CD163 protein into the embryo. The method further comprises implanting the embryo into a surrogate female animal (where offspring are produced by pregnancy and full term); screening the offspring for susceptibility to the pathogen; and selecting offspring with reduced susceptibility to the pathogen compared to animals that do not contain the modified chromosomal sequence in the gene encoding the CD163 protein.
[0249] An alternative breeding method is provided for producing animals or strains with reduced susceptibility to infection by a pathogen. The method comprises genetically modifying an oocyte or spermatocyte to introduce a modified chromosomal sequence in the gene encoding the CD163 protein into at least one of the oocyte and spermatocyte, and fertilizing the oocyte with a spermatocyte to produce an embryo containing the modified chromosomal sequence in the gene encoding the CD163 protein. Alternatively, the method comprises genetically modifying an embryo to introduce a modified chromosomal sequence in the gene encoding the CD163 protein into the embryo. The method further comprises implanting the embryo into a surrogate female animal (where offspring are produced by pregnancy and full term); screening the offspring for susceptibility to the pathogen; and selecting offspring with reduced susceptibility to the pathogen compared to animals without the modified chromosomal sequence in the gene encoding the CD163 protein. The modified chromosomal sequence results in the production of substantially non-functional CD163 protein by the offspring.
[0250] Further breeding methods are provided for producing animals or strains with reduced susceptibility to infection by pathogens. The method comprises genetically modifying an oocyte or spermatocyte to introduce a modified chromosomal sequence in the gene encoding the CD163 protein into at least one of the oocyte and spermatocyte, and fertilizing the oocyte with a spermatocyte to produce an embryo containing the modified chromosomal sequence in the gene encoding the CD163 protein. Alternatively, the method comprises genetically modifying an embryo to introduce a modified chromosomal sequence in the gene encoding the CD163 protein into the embryo. The method further comprises implanting the embryo into a surrogate female animal (where offspring are produced by pregnancy and full term); screening the offspring for susceptibility to pathogens; and selecting offspring with reduced susceptibility to pathogens compared to animals that do not contain the modified chromosomal sequence in the gene encoding the CD163 protein. The modified chromosomal sequence comprises an in-frame deletion in the gene encoding the CD163 protein.
[0251] The pathogen preferably includes a virus, such as PRRSV.
[0252] For example, modifications can reduce susceptibility to type 1 PRRSV virus, type 2 PRRSV virus, or both type 1 and type 2 PRRSV viruses.
[0253] The modification may reduce susceptibility to PRRSV isolates selected from the group consisting of NVSL97-7895, KS06-72109, P129, VR2332, CO90, AZ25, MLV-ResPRRS, KS62-06274, KS483 (SD23983), CO84, SD13-15, Lelystad, 03-1059, 03-1060, SD01-08, 4353PZ, and combinations thereof.
[0254] The animal can be an embryo, juvenile, or adult.
[0255] The animals may include domesticated animals. Domesticated animals may include livestock animals such as pigs, cattle (e.g., beef cattle or dairy cows), sheep, goats, horses (e.g., horses or donkeys), buffalo, camels, or birds (e.g., chickens, turkeys, ducks, geese, guinea fowl, or chicks). Domesticated animals are preferably cattle or pigs, most preferably pigs.
[0256] The step of genetically modifying an oocyte, sperm cell, or fertilized egg can include genetic editing of the oocyte, sperm cell, or fertilized egg. Genetic editing can include the use of a homing endonuclease. The homing endonuclease is a naturally derived endonuclease, but preferably is a rationally designed, non-naturally derived homing endonuclease having a DNA recognition sequence designed to target a chromosomal sequence in the gene encoding the CD163 protein. Thus, the homing endonuclease can be a designed homing endonuclease. The homing endonuclease can include, for example, a clustered regularly interspaced short palindromic repeat (CRISPR) / Cas9 system, a transcription activator-like effector nuclease (TALEN), a zinc finger nuclease (ZFN), a recombinase fusion protein, a meganuclease, or a combination thereof). Genetic editing preferably includes the use of a CRISPR / Cas9 system.
[0257] The oocyte, sperm cell, or fertilized egg can be heterozygous for the modified chromosomal sequence. Alternatively, the oocyte, sperm cell, or fertilized egg can be homozygous for the modified chromosomal sequence.
[0258] The modified chromosomal sequence can include an insertion in the gene encoding the CD163 protein, a deletion in the gene encoding the CD163 protein, or a combination thereof. For example, the modified chromosomal sequence includes a deletion (e.g., an in-frame deletion) in the gene encoding the CD163 protein. Alternatively, the modified chromosomal sequence can include an insertion in the gene encoding the CD163 protein.
[0259] The insertion or deletion can reduce CD163 protein production or activity as compared to CD163 protein production or activity in an animal lacking the insertion or deletion.
[0260] Insertions or deletions can result in the production of substantially non-functional CD163 protein by animals. “Substantially non-functional CD163 protein” means that the level of CD163 protein in animals, offspring, or cells is undetectable, or, if detectable, at least about 90% lower than the level observed in animals, offspring, or cells without the insertion or deletion.
[0261] If the animal is a pig, the modified chromosome sequence may include modifications in exon 7 of the gene encoding the CD163 protein, exon 8 of the gene encoding the CD163 protein, introns adjacent to exon 7 or exon 8 of the gene encoding the CD163 protein, or combinations thereof. Preferably, the modified chromosome sequence includes modifications in exon 7 of the gene encoding the CD163 protein.
[0262] Modifications in exon 7 of the gene encoding the CD163 protein may include deletions (e.g., in-frame deletions in exon 7). Alternatively, modifications in exon 7 of the gene encoding the CD163 protein may include insertions.
[0263] If the animal is a pig, the modified chromosome sequence may include: (a) SEQ ID NO: 118; or (b) modifications selected from the following group: 11 base pair deletions from nucleotides 3,137 to 3,147 compared to the reference sequence SEQ ID NO: 47; 2 base pair insertions between nucleotides 3,149 and 3,150 compared to the reference sequence SEQ ID NO: 47, and 377 base pair deletions from nucleotides 2,573 to 2,949 on the same allele compared to the reference sequence SEQ ID NO: 47; 124 base pair deletions from nucleotides 3,024 to 3,147 compared to the reference sequence SEQ ID NO: 47; 123 base pair deletions from nucleotides 3,024 to 3,146 compared to the reference sequence SEQ ID NO: 47; 1 base pair insertions between nucleotides 3,147 and 3,148 compared to the reference sequence SEQ ID NO: 47; Compared to NO:47, there is a 130-base pair deletion from nucleotide 3,030 to nucleotide 3,159; reference sequence SEQ ID NO:47; a 132-base pair deletion from nucleotide 3,030 to nucleotide 3,161; a 1506-base pair deletion from nucleotide 1,525 to nucleotide 3,030; a 7-base pair insertion between nucleotide 3,148 and nucleotide 3,149; a 1280-base pair deletion from nucleotide 2,818 to nucleotide 4,097; a 1373-base pair deletion from nucleotide 2,724 to nucleotide 4,096; a 1467-base pair deletion from nucleotide 2,431 to nucleotide 3,897; reference sequence SEQ ID Compared to NO:47, there is a 1930 base pair deletion from nucleotide 488 to nucleotide 2,417, where the deleted sequence is replaced by a 12 base pair insertion starting at nucleotide 488, as well as a further 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172, compared to the reference sequence SEQ ID NO:47;Compared to reference sequence SEQ ID NO:47, a 28-base pair deletion from nucleotide 3,145 to nucleotide 3,172; a 1387-base pair deletion from nucleotide 3,145 to nucleotide 4,531; a 1382-base pair deletion from nucleotide 3,113 to nucleotide 4,494, where the deleted sequence is replaced by an 11-base pair insertion starting at nucleotide 3,113; a 1720-base pair deletion from nucleotide 2,440 to nucleotide 4,160; a 452-base pair deletion from nucleotide 3,015 to nucleotide 3,466; or a combination thereof.
[0264] If a porcine animal contains a two-base pair insertion between nucleotides 3,149 and 3,150 compared to the reference sequence SEQ ID NO:47, the two-base pair insertion may include an insertion of dinucleotide AG.
[0265] If a pig animal contains a single base pair insertion between nucleotides 3,147 and 3,148 compared to the reference sequence SEQ ID NO:47, the single base pair insertion may include an insertion of a single adenine residue.
[0266] If a pig animal contains a 7-base pair insertion between nucleotides 3,148 and 3,149 compared to the reference sequence SEQ ID NO:47, the 7-base pair insertion may include the sequence TACTACT (SEQ ID NO:115).
[0267] If a pig contains a 1930 base pair deletion from nucleotide 488 to nucleotide 2,417 compared to the reference sequence SEQ ID NO:47, where the deleted sequence is replaced by a 12 base pair insertion beginning at nucleotide 488, and there is also a further 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 compared to the reference sequence SEQ ID NO:47, the 12 base pair insertion may include the sequence TGTGGAGAATTC (SEQ ID NO:116).
[0268] The porcine animal contains a 1382 base pair deletion from nucleotide 3,113 to nucleotide 4,494 compared to the reference sequence SEQ ID NO:47, where the deletion sequence is replaced by an 11-base pair insertion starting at nucleotide 3,113, which may include the sequence AGCCAGCGTGC (SEQ ID NO:117).
[0269] If the modified chromosomal sequence in the gene encoding the CD163 protein contains a deletion, the deletion preferably contains an in-frame deletion. Therefore, if the animal is a pig, the insertion or deletion in the gene encoding the CD163 protein may include an in-frame deletion in exon 7, selected from the following group: a 1506 base pair deletion from nucleotide 1,525 to nucleotide 3,030 compared to the reference sequence SEQ ID NO: 47; a 1930 base pair deletion from nucleotide 488 to nucleotide 2,417 compared to the reference sequence SEQ ID NO: 47, where the deleted sequence is replaced by a 12 base pair insertion beginning at nucleotide 488, and there is also a further 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 compared to the reference sequence SEQ ID NO: 47; a 1373 base pair deletion from nucleotide 2,724 to nucleotide 4,096 compared to the reference sequence SEQ ID NO: 47; a 123 base pair deletion from nucleotide 3,024 to nucleotide 3,146 compared to the reference sequence SEQ ID NO: 47; Compared to NO:47, there is a deletion of 1467 base pairs from nucleotide 2,431 to nucleotide 3,897; compared to reference sequence SEQ ID NO:47, there is a deletion of 1387 base pairs from nucleotide 3,145 to nucleotide 4,531; compared to reference sequence SEQ ID NO:47, there is a deletion of 1382 base pairs from nucleotide 3,113 to nucleotide 4,494, where the deleted sequence is replaced by an 11-base pair insertion starting at nucleotide 3,113; compared to reference sequence SEQ ID NO:47, there is a deletion of 1720 base pairs from nucleotide 2,440 to nucleotide 4,160; and combinations thereof.
[0270] If the animal is a pig, the insertion or deletion may be selected from the following group: a two-base-pair insertion between nucleotides 3,149 and 3,150 compared to the reference sequence SEQ ID NO: 47, and a 377-base-pair deletion between nucleotides 2,573 and 2,949 compared to the reference sequence SEQ ID NO: 47 on the same allele; a 28-base-pair deletion between nucleotides 3,145 and 3,172 compared to the reference sequence SEQ ID NO: 47; a 452-base-pair deletion between nucleotides 3,015 and 3,466 compared to the reference sequence SEQ ID NO: 47; and combinations thereof.
[0271] For example, a modified chromosome sequence may contain a two-base pair insertion between nucleotides 3,149 and 3,150 compared to the reference sequence SEQ ID NO:47, and a 377-base pair deletion between nucleotides 2,573 and 2,949 on the same allele compared to the reference sequence SEQ ID NO:47.
[0272] The modified chromosome sequence may contain a 28-base pair deletion between nucleotides 3,145 and 3,172 compared to the reference sequence SEQ ID NO:47.
[0273] The modified chromosome sequence can contain 452 base pair deletions from nucleotide 3,015 to nucleotide 3,466 compared to the reference sequence SEQ ID NO:47.
[0274] The modified chromosome sequence may include any combination of the modified chromosome sequences described herein.
[0275] For example, a modified chromosome sequence may include: a 7-base pair insertion between nucleotides 3,148 and 3,149 in one allele of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO:47; and an 11-base pair deletion between nucleotides 3,137 and 3,147 in another allele of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO:47.
[0276] The modified chromosome sequence may include: a 7-base pair insertion between nucleotides 3,148 and 3,149 in one allele of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO:47; and a 1382-base pair deletion from nucleotides 3,113 to 4,494 in the other allele of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO:47, where the deleted sequence is replaced by an 11-base pair insertion beginning at nucleotide 3,113.
[0277] The modified chromosome sequence may include: SEQ ID NO: 118 in one allele of the gene encoding the CD163 protein; and an 11-base pair deletion from nucleotide 3,137 to nucleotide 3,147 in the other allele of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO: 47.
[0278] The modified chromosome sequence may include: SEQ ID NO: 118 in one allele of the gene encoding the CD163 protein; and in the other allele of the gene encoding the CD163 protein, a two-base pair insertion between nucleotides 3,149 and 3,150, and a 377-base pair deletion from nucleotides 2,573 to 2,949, compared to the reference sequence SEQ ID NO: 47.
[0279] The modified chromosomal sequence can include the following: in one allele of the gene encoding the CD163 protein, a 1280-base pair deletion from nucleotide 2,818 to nucleotide 4,097 compared to the reference sequence SEQ ID NO:47; and in another allele of the gene encoding the CD163 protein, an 11-base pair deletion from nucleotide 3,137 to nucleotide 3,147 compared to the reference sequence SEQ ID NO:47.
[0280] The modified chromosomal sequence can include the following: in one allele of the gene encoding the CD163 protein, a 1280-base pair deletion from nucleotide 2,818 to nucleotide 4,097 compared to the reference sequence SEQ ID NO:47; and in another allele of the gene encoding the CD163 protein, a 2-base pair insertion between nucleotides 3,149 and 3,150, and a 377-base pair deletion from nucleotide 2,573 to nucleotide 2,949 compared to the reference sequence SEQ ID NO:47.
[0281] The modified chromosomal sequence can include the following: in one allele of the gene encoding the CD163 protein, a 1930-base pair deletion from nucleotide 488 to nucleotide 2,417 compared to the reference sequence SEQ ID NO:47, where the deleted sequence is replaced by a 12-base pair insertion starting at nucleotide 488, and there is an additional 129-base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 compared to the reference sequence SEQ ID NO:47; and in another allele of the gene encoding the CD163 protein, a 2-base pair insertion between nucleotides 3,149 and 3,150, and a 377-base pair deletion from nucleotide 2,573 to nucleotide 2,949 compared to the reference sequence SEQ ID NO:47.
[0282] The modified chromosome sequence may include: SEQ ID NO: 118 in one allele of the gene encoding the CD163 protein; and in the other allele of the gene encoding the CD163 protein, a 1930 base pair deletion from nucleotide 488 to nucleotide 2,417 compared to the reference sequence SEQ ID NO: 47, where the deleted sequence is replaced by a 12 base pair insertion beginning at nucleotide 488, as well as a further 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 compared to the reference sequence SEQ ID NO: 47.
[0283] The modified chromosome sequence may include: in one allele of the gene encoding the CD163 protein, a 1930 base pair deletion from nucleotide 488 to nucleotide 2,417 compared to the reference sequence SEQ ID NO:47, where the deleted sequence is replaced by a 12 base pair insertion beginning at nucleotide 488, as well as a further 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 compared to the reference sequence SEQ ID NO:47; and in the other allele of the gene encoding the CD163 protein, an 11 base pair deletion from nucleotide 3,137 to nucleotide 3,147 compared to the reference sequence SEQ ID NO:47.
[0284] The modified chromosome sequence may include: a 1,467 base pair deletion from nucleotide 2,431 to nucleotide 3,897 in one allele of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO:47; and a 2-base pair insertion between nucleotides 3,149 and 3,150, and a 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 in the other allele of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO:47.
[0285] The modified chromosome sequence may include: a 1467 base pair deletion from nucleotide 2,431 to nucleotide 3,897 in one allele of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO:47; and an 11 base pair deletion from nucleotide 3,137 to nucleotide 3,147 in the other allele of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO:47.
[0286] Modified chromosome sequences containing either insertions or deletions as described above may contain chromosome sequences outside the insertion or deletion that have a high degree of sequence identity with SEQ ID NO:47. Therefore, for example, oocytes, spermatophores, or fertilized eggs may contain chromosome sequences in the region of the chromosome sequence outside the insertion or deletion that have at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, at least 99.9%, or 100% sequence identity with SEQ ID NO:47.
[0287] The modified chromosome sequences may include chromosome sequences containing SEQ ID NO:98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 118, or 119. As further described in the following examples, SEQ ID NO.98-114 and 119 provide nucleotide sequences for regions corresponding to the wild-type porcine CD163 region provided by SEQ ID NO:47, including insertions or deletions in the porcine CD163 chromosome sequences described herein. SEQ ID NO:118 provides a sequence for a region corresponding to the wild-type porcine CD163 region provided by SEQ ID NO:47, where exon 7 is replaced with a synthetic exon encoding a homolog of SRCR8 of human CD163-like protein 1 (hCD163L1).
[0288] For example, a modified chromosome sequence may include a chromosome sequence containing SEQ ID NO: 98, 101, 105, 109, 110, 112, 113, or 114. SEQ ID NO: 98, 101, 105, 109, 110, 112, 113, or 114 provides nucleotide sequences for in-frame deletions in exon 7 of the porcine CD163 chromosome sequence.
[0289] As another example, a modified chromosome sequence may include chromosome sequences with SEQ ID NO: 103, 111, or 119.
[0290] The modified chromosome sequence may include an 11-base pair deletion in one allele of the gene encoding the CD163 protein and a 2-base pair insertion and a 377-base pair deletion in the other allele of the gene encoding the CD163 protein.
[0291] The modified chromosome sequence may include a 124-base pair deletion in one allele of the gene encoding the CD163 protein and a 123-base pair deletion in the other allele of the gene encoding the CD163 protein.
[0292] Modified chromosome sequences can include single-base pair insertions.
[0293] The modified chromosome sequence may include a 130-base pair deletion in one allele of the gene encoding the CD163 protein and a 132-base pair deletion in the other allele of the gene encoding the CD163 protein.
[0294] The modified chromosome sequence may contain a 1506 base pair deletion.
[0295] Modified chromosome sequences can include 7-base pair insertions.
[0296] The modified chromosome sequence may include a 1280 base pair deletion in one allele of the gene encoding the CD163 protein and a 1373 base pair deletion in the other allele of the gene encoding the CD163 protein.
[0297] The modified chromosome sequence may contain a 1467 base pair deletion.
[0298] The modified chromosome sequence may include a 1930-base pair intron 6 deletion from nucleotide 488 to nucleotide 2,417, as well as a 12-base pair insertion at nucleotide 4,488 in exon 7 and an additional 129-base pair deletion.
[0299] The modified chromosome sequence may include a 28-base pair deletion in one allele of the gene encoding the CD163 protein and a 1387-base pair deletion in the other allele of the gene encoding the CD163 protein.
[0300] The modified chromosome sequence may include a 1382 base pair deletion and an 11 base pair insertion in one allele of the gene encoding the CD163 protein, and a 1720 base pair deletion in the other allele of the gene encoding the CD163 protein.
[0301] In any of the breeding methods, the selected animal can be used as a founder animal.
[0302] In any of the breeding methods, fertilization may include artificial insemination.
[0303] Animal populations produced by any of the breeding methods are also provided. The animal populations are preferably resistant to infection by pathogens, such as viruses, including PRRSV. For example, a population can be resistant to infection by type 1 PRRSV virus, type 2 PRRSV, or both type 1 and type 2 PRRSV viruses. A population can also be resistant to infection by PRRSV isolates selected from the group consisting of NVSL97-7895, KS06-72109, P129, VR2332, CO90, AZ25, MLV-ResPRRS, KS62-06274, KS483 (SD23983), CO84, SD13-15, Lelystad, 03-1059, 03-1060, SD01-08, 4353PZ, and combinations thereof.
[0304] Methods for increasing the resistance of livestock animals to pathogen infection are also provided. The method involves genetically editing at least one chromosomal sequence derived from the gene encoding the CD163 protein, thereby reducing CD163 protein production or activity compared to CD63 protein production or activity in livestock animals that do not contain the edited chromosomal sequence in the gene encoding the CD163 protein. The pathogen preferably includes a virus (e.g., PRRSV).
[0305] Another method is provided to increase the resistance of livestock animals to pathogen infection. The method involves genetically editing at least one chromosomal sequence derived from the gene encoding the CD163 protein, so that the livestock animal produces a substantially non-functional CD163 protein.
[0306] Another method is provided for increasing the resistance of livestock animals to pathogen infection. The method comprises genetically editing at least one chromosomal sequence derived from the gene encoding the CD163 protein to introduce an in-frame deletion, wherein CD163 protein production or activity in the livestock animals is reduced compared to CD63 protein production or activity in livestock animals that do not contain the edited chromosomal sequence in the gene encoding the CD163 protein. The in-frame deletion may be, for example, any of the in-frame deletions described herein.
[0307] nucleic acid A nucleic acid is provided. The nucleic acid molecule may include a nucleotide sequence selected from the group consisting of: (a) a nucleotide sequence containing SEQ ID NO:47; (b) a nucleotide sequence having at least 80% sequence identity with respect to the sequence of SEQ ID NO:47, wherein the nucleotide sequence contains at least one substitution, insertion, or deletion with respect to SEQ ID NO:47; and (c) a cDNA sequence of (a) or (b).
[0308] Alternatively, the nucleic acid may include: (a) a nucleotide sequence having at least 87.5% sequence identity with respect to the sequence of SEQ ID NO:47, wherein the nucleotide sequence includes at least one substitution, insertion, or deletion with respect to SEQ ID NO:47; and (b) the cDNA sequence of (a).
[0309] Any of the nucleic acid molecules described herein can be isolated nucleic acid molecules.
[0310] For example, isolated nucleic acids may contain a nucleotide sequence including SEQ ID NO:47.
[0311] Alternatively, the nucleic acid may contain a nucleotide sequence having at least 80% sequence identity with respect to the sequence of SEQ ID NO:47, wherein the nucleotide sequence contains at least one substitution, insertion, or deletion relative to SEQ ID NO:47. The nucleic acid may contain a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 99.9% sequence identity with respect to the sequence of SEQ ID NO:47, wherein the nucleotide sequence contains at least one substitution, insertion, or deletion relative to SEQ ID NO:47.
[0312] The nucleic acid molecule preferably has at least 87.5% sequence identity with respect to the sequence of SEQ ID NO:47, where the nucleotide sequence includes at least one substitution, insertion, or deletion relative to SEQ ID NO:47.
[0313] Substitutions, insertions, or deletions are preferably used to reduce or eliminate CD163 protein production or activity compared to nucleic acids that do not contain substitutions, insertions, or deletions.
[0314] Nucleic acids may include SEQ ID NO: 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 118, or 119.
[0315] For example, nucleic acids may include SEQ ID NO: 98, 101, 105, 109, 110, 112, 113, or 114.
[0316] For example, nucleic acids may include SEQ ID NO: 103, 111, or 119.
[0317] Nucleic acids can include cDNA.
[0318] Further nucleic acids are provided. These nucleic acids may include SEQ ID NO: 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 118, or 119. For example, a nucleic acid may include SEQ ID NO: 98, 101, 105, 109, 110, 112, 113, or 114. Another example is a nucleic acid that may include SEQ ID NO: 103, 111, or 119.
[0319] Having described the invention in detail, it should be clear that modifications and alterations are possible without departing from the scope of the invention as defined in the attached claims.
[0320] Examples The following non-limiting embodiments are provided to further illustrate the present invention.
[0321] Example 1: Use of the CRISPR / Cas9 system to create genetically modified pigs from in vitro derived oocytes and embryos Recent reports describing homing endonucleases, such as zinc finger nucleases (ZFNs), activator-like effector nucleases (TALENs), and components in clustered and regularly arranged short palindromic sequence repeats (CRISPR) / CRISPR-related (Cas9) systems suggest that genetic engineering (GE) in pigs is now more efficient. Targeted homing endonucleases induce double-strand breaks (DSBs) at specific locations within the genome, which can lead to random mutations stimulating either non-homologous end joining (NHEJ) or homologous recombination (HR) if donor DNA is provided. Targeted genomic modification by HR can be achieved by homing endonucleases when donor DNA is provided along with the target nuclease. After introducing specific modifications in somatic cells, these cells were used to create GE pigs by SCNT for various purposes. Therefore, homing endonucleases are useful tools for creating GE pigs. Among different homing endonucleases, the CRISPR / Cas9 system, adapted from prokaryotes where it is used as a defense mechanism, is considered a viable approach. In nature, the Cas9 system requires three components: an RNA (approximately 20 bases) containing a region complementary to the target sequence (cis-repressor RNA [crRNA]), an RNA (trans-activating crRNA [tracrRNA]) containing a region complementary to the crRNA, and Cas9, the enzyme protein component in this complex. A single guide RNA (gRNA) can be constructed to play the roles of the base-paired crRNA and tracrRNA. The gRNA / protein complex can scan the genome and catalyze DSBs at regions complementary to the crRNA / gRNA. Unlike other engineered nucleases, only short oligomers need to be designed to construct the reagents required to target the target gene, whereas a series of cloning steps are required to assemble ZFNs and TALENs.
[0322] Unlike current standard methods for gene disruption, the use of engineered nucleases offers the opportunity to use zygotes as initiation material for GE. Standard methods for gene disruption in livestock include HR in cultured cells and subsequent embryo reconstruction by somatic cell nuclear transfer (SCNT). Since cloned animals produced by SCNT sometimes show signs of developmental disorders, progeny of SCNT / GE founders are typically used in studies to avoid confounding SCNT abnormalities and phenotypes that can occur when founder animals are used for experiments. Given the longer gestation period and higher housing costs in pigs compared to rodents, reducing the need for breeding offers time and cost advantages. Recent reports have demonstrated that direct injection of ZFNs and TALENs into pig zygotes can disrupt endogenous genes and produce piglets with desired mutations. However, only about 10% of the piglets showed biallelic alterations of the target gene, and some showed mosaic genotypes. Recent studies have demonstrated that the CRISPR / Cas9 system can induce mutations in developing embryos, enabling the creation of genetically modified (GE) pigs with greater efficiency than ZFNs or TALENs. However, GE pigs produced using the CRISPR / Cas9 system also exhibited mosaic genotypes. In addition, all of the above studies used zygotes induced in vivo for the experiments, which requires intensive labor and a large number of sows to obtain a sufficient number of zygotes.
[0323] This example describes an efficient approach using the CRISPR / Cas9 system in the production of genetically modified (GE) pigs by both in vitro-induced zygote injection and somatic cell modification, followed by SCNT. Two endogenous genes (CD163 and CD1D) and one transgene (eGFP) were targeted, and only in vitro-induced oocytes or zygotes were used for SCNT or RNA injection, respectively. CD163 is thought to be required for proliferative infection by porcine reproductive and respiratory syndrome virus, a virus known to cause significant economic losses in the pig industry. CD1D is thought to be a non-classical major histocompatibility complex protein and is involved in the presentation of lipid antigens to invariant natural killer T cells. Pigs lacking these genes were designed to serve as models for agriculture and biomedicine. The eGFP transgene was used as a target for preliminary proof-of-concept experiments and method optimization.
[0324] material and method Chemicals and reagents Unless otherwise noted, all chemicals used in this study were purchased from Sigma.
[0325] Design of gRNAs for constructing specific CRISPR The guide RNA was designed for a region within exon 7 of CD163 that is specific to wild-type CD163 and not present in the domain swap targeting vector (described below), so that CRISPR would yield a DSB within wild-type CD163 rather than in the domain swap targeting vector. There were only four positions where the targeting vector could introduce single nucleotide polymorphisms (SNPs) that alter the S. pyogenes (Spy) protospacer adjacent motif (PAM). All four targets were selected, including: (SEQ ID NO:1)GGAAACCCAGGCTGGTTGGAgGG(CRISPR10), (SEQ ID NO:2)GGAACTACAGTGCGGCACTGtGG(CRISPR131), (SEQ ID NO:3)CAGTAGCACCCCGCCCTGACgGG(CRISPR256) and (SEQ ID NO:4)TGTAGCCACAGCAGGGACGTcGG(CRISPR282). PAM can be identified by the bolded text in each gRNA.
[0326] In the CD1D mutation, the search for CRISPR targets was arbitrarily limited to the coding strand within the first 1000 bp of the primary transcript. However, RepeatMasker
[26] ("pig" repeat library) identified a repeat element starting at base 943 of the primary transcript. The search for CRISPR targets was then limited to the first 942 bp of the primary transcript. The search was further limited to the first 873 bp of the primary transcript, because the last Spy PAM is located at base 873. The first target (CRISPR4800) was selected because it overlapped with the start codon located at base 42 in the primary transcript (CCAGCCTCGCCCAGCGACATgGG (SEQ ID NO: 5)). Two additional targets (CRISPR5620 and 5626) were selected. This was because it was the most distal to the first selection within the arbitrarily selected region (CTTTCATTTATCTGAACTCAgGG (SEQ ID NO: 6) and TTATCTGAACTCAGGGTCCCcGG (SEQ ID NO: 7)). These targets overlap. In relation to the start codon, the most proximal Spy PAM was located in a simple sequence containing a highly homopolymerized sequence determined by visual assessment. The fourth target (CRISPR5350) was selected because, in relation to the first target selection, it was the most proximal target that did not contain a highly homopolymerized region (CAGCTGCAGCATATATTTAAgGG (SEQ ID NO: 8)). The specificity of the designed crRNA was confirmed by searching for similar porcine sequences in GenBank. Oligonucleotides (Table 1) were annealed and cloned into a p330X vector containing two expression cassettes, human codon-optimized S. pyogenes (hSpy)Cas9 and chimeric guide RNA. P330X was digested using BbsI (New England Biolabs) according to the Zhang lab protocol (http: / / www.addgene.org / crispr / zhang / ).
[0327] To target eGFP, two specific gRNAs targeting the eGFP coding sequence were designed within the first 60 bp of the eGFP start codon. Both eGFP1 and eGFP2 gRNAs were located on the antisense strand, and eGFP1 directly targeted the start codon. The eGFP1 gRNA sequence was CTCCTCGCCCTTGCTCACCAtGG (SEQ ID NO: 9), and the eGFP2 gRNA sequence was GACCAGGATGGGCACCACCCcGG (SEQ ID NO: 10). [Table 1]
[0328] Synthesis of donor DNA for CD163 and CD1D genes Both porcine CD163 and CD1D were amplified from DNA isolated from fetal fibroblasts by PCR, and these were used for subsequent transfection to ensure isogenic matching between the targeting vector and the transfected cell line. Briefly, a 9538 bp fragment of CD163 was amplified using LA taq (Clontech) with forward primer CTCTCCCTCACTCTAACCTACTT (SEQ ID NO: 11) and reverse primer TATTTCTCTCACATGGCCAGTC (SEQ ID NO: 12). The fragment was the DNA sequence identified and used to construct a domain-swap targeting vector (Figure 1). This vector contained 33 point mutations within exon 7 and would therefore encode the same amino acid sequence as human CD163L derived from exon 11. The substitution exon was 315 bp. In addition, subsequent introns were replaced with modified myostatin intron B containing a selectable marker gene that can be removed by Cre recombinase (Cre), and normal splicing was previously demonstrated when the loxP site was retained (Wells, unpublished results). The long arm of the construct was 3469 bp and contained a domain swap DS exon. The short arm was 1578 bp and contained exons 7 and 8 (Figure 1, panel B). Using this plasmid, we attempted to replace the coding region of exon 7 in the initial transfection experiment, enabling the selection of a targeting event by a selectable marker (G418). If targeting occurs, the marker can be removed by Cre recombinase. The CD163DS targeting vector was then modified for use with cell lines already containing the SIGLEC1 gene, which was disrupted in Neo and could not be removed by Cre. In this targeting vector, the Neo cassette, loxP, and myostatin intron B were removed, leaving only the DS exon along with the WT length and short arm (Figure 1, Panel C).
[0329] The genome sequence for porcine CD1D was amplified using LA taq with forward primer CTCTCCCTCACTCTAACCTACTT (SEQ ID NO: 13) and reverse primer GACTGGCCATGTGAGAGAAATA (SEQ ID NO: 14) to obtain an 8729 bp fragment. This fragment was a DNA sequence, which was used to construct the targeting vector shown in Figure 2. The Neo cassette was under the control of a phosphoglycerol kinase (PGK) promoter and flanked a loxP sequence (introduced for selection). The construct had a long arm of 4832 bp and a short arm of 3563 bp and contained exons 6 and 7. If successful HR occurs, exons 3, 4, and 5 are removed and replaced with the Neo cassette. If NHEJ repair occurs incorrectly, exon 3 will be destroyed.
[0330] Fetal fibroblast collection Fetal pig tissue was collected on day 35 of gestation, and cell lines were constructed. Two wild-type (WT) male and female fetal fibroblast cell lines were established from large white domestic crossbreeds. Male and female fetal fibroblasts previously modified to include the Neo cassette (SIGLEC1- / -genetics) were also used in these studies. Fetal fibroblasts with minor modifications were collected as described; tissue from each fetus was minced and digested at 38.5°C for 5 hours in 20 ml of digestion medium (Dulbecco's modified Eagle medium [DMEM] containing L-glutamine and 1 g / L D-glucose [Cellgro], supplemented with 200 units / ml collagenase and 25 Knitz units / ml DNAseI). After digestion, fetal fibroblasts were washed and cultured with DMEM, 15% fetal bovine serum (FBS), and 40 μg / ml gentamicin. After overnight incubation, the cells were typsinized, aliquoted, frozen in FBS containing 10% dimethyl sulfoxide at -80°C, and stored in liquid nitrogen.
[0331] Cell transfection and genotyping Transfection conditions were essentially as previously reported. Donor DNA was always used in a constant amount of 1 μg, along with various amounts of CRISPR / Cas9 plasmid (listed below). Donor DNA was linearized with MLUI(CD163)(NEB) or AFLII(CD1D)(NEB) before transfection. The sex of the established cell lines was determined by PCR before transfection, as previously described. Both male and female cell lines were transfected, and genomic modification data were analyzed together between transfections. Fetal fibroblast cell lines of similar passage numbers (2-4) were cultured for 2 days in DMEM containing L-glutamine and 1 g / L D-glucose (Cellgro), supplemented with 15% FBS, 2.5 ng / ml basic fibroblast growth factor, and 10 mg / ml gentamicin, and grown to a concentration density of 75%-85%. Fibroblasts were washed with phosphate-buffered saline (PBS) (Life Technologies) and treated with trypsin. Immediately after detachment, the cells were rinsed with electroporation medium (75% cytosalts [120 mM KCl, 0.15 mM CaCl2, 10 mM K2HPO4, pH 7.6, 5 mM MgCl2]) and 25% Opti-MEM (Life Technologies). Cell concentration was quantified using a hemocytometer. The cells were pelleted at 600 × g for 5 minutes and placed in electroporation medium at a rate of 1 × 10⁶. 6The cells were resuspended at the specified concentration. For each electroporation, 200 μl of cells were used in a 2 mm gap cuvette and administered with 3 (1 msec) square wave pulses at 250 V using a BTX ECM2001. After electroporation, the cells were resuspended in the DMEM medium. For selection, 600 μg / ml of G418 (Life Technologies) was added 24 hours after transfection, and the medium was changed on day 7. Colonies were harvested on day 14 after transfection. Fetal fibroblasts were seeded at 10,000 cells / plate when G418 selection was used, and 50 cells / plate when G418 selection was not used. Fetal fibroblast colonies were collected by applying a 10 mm autoclaved cloning cylinder sealed around each colony with autoclaved vacuum grease. Colonies were rinsed with PBS and recovered with trypsin; then resuspended in DMEM medium. A portion (1 / 3) of the resuspended colonies was transferred to a 96-well PCR plate, and the remaining (2 / 3) cells were cultured in one well of a 24-well plate. The cell pellet was resuspended in 6 μl of lysis buffer (40 mM Tris, pH 8.9, 0.9% Triton X-100, 0.4 mg / ml proteinase K [NEB]), incubated at 65°C for 30 minutes for cell lysis, and then incubated at 85°C for 10 minutes to inactivate proteinase K.
[0332] PCR screening for DS and large and small deletions Detection of HR repair. Long-range PCR was used to identify mutations on either CD163 or CD1D. Three different PCR assays were used to identify HR events: PCR amplification of a region in the donor DNA extending from the CD163 or CD1D sequence to the endogenous CD163 or CD1D sequence on either the right or left side, and long-range PCR amplified a large region of CD163 or CD1D encompassing the designed donor DNA. An increase in the size of the PCR product, either 1.8kb (CD1D) or 3.5kb (CD163), resulting from the addition of an exogenous Neo sequence, was considered evidence of HR repair of the gene. All PCR conditions were 33 cycles of initial denaturation at 95°C for 2 minutes, followed by 30 seconds at 94°C, 30 seconds at 50°C, and 7-10 minutes at 68°C. LA taq was used for all assays as recommended by the manufacturer. Primers are shown in Table 2. [Table 2]
[0333] Small Deletion Assay (NHEJ). Small deletions were determined by PCR amplification of CD163 or CD1D adjacent to a protruding cutting site introduced by the CRISPR / Cas9 system. The amplicon sizes were 435 bp and 1244 bp for CD163 and CD1D, respectively. Lysates derived from embryonic and fetal fibroblast cells were PCR amplified using LA taq. The PCR conditions for the assay were 95°C for 2 minutes for initial denaturation, followed by 33 cycles at 94°C for 30 seconds, 56°C for 30 seconds, and 72°C for 1 minute. For genotyping of transfected cells, insertions and deletions (INDELs) were identified by separating PCR amplicons by agarose gel electrophoresis. For embryonic genotyping, the obtained PCR products were subsequently sequenced, and small deletions were identified using the forward primers used in PCR. Primer information is shown in Table 3. [Table 3]
[0334] Somatic cell nuclear transfer (SCNT) To produce SCNT embryos, either sow-derived oocytes (ART, Inc.) or young sow-derived oocytes were used from local slaughterhouses. Sow-derived oocytes were transported overnight in maturation medium (TCM-199 containing 2.9 mM Hepes, 5 μg / ml insulin, 10 ng / ml epidermal growth factor [EGF], 0.5 μg / ml porcine follicle-stimulating hormone [p-FSH], 0.91 mM pyruvate, 0.5 mM cysteine, 10% porcine follicular fluid, and 25 ng / ml gentamicin) and transferred to fresh medium after 24 hours. After 40–42 hours of maturation, cumulus cells were removed from the oocytes by vortexing in the presence of 0.1% hyaluronidase. Young sow-derived oocytes were matured for in vitro fertilization (IVF) as described below. During the procedure, oocytes were placed in a working medium (TCM-199 [Life Technologies]) supplemented with 7.0 μg / ml cytochalasin B, containing 0.6 mM NaHCO3, 2.9 mM Hepes, 30 mM NaCl, 10 ng / ml gentamicin, and 3 mg / ml BSA, with a molar osmotic concentration of 305 mOsm. The polar bodies were removed along with a portion of the adjacent cytoplasm (possibly including a metaphase II plate), and donor cells were placed in the perivitelline space using a thin glass capillary. The reconstructed embryos were then fused in fusion medium (0.3 M mannitol, 0.1 mM CaCl2, 0.1 mM MgCl2, and 0.5 mM Hepes) using a BTX Electro Cell Manipulator (Harvard Apparatus) with 2DC pulses (1-second intervals) at 1.2 kV / cm for 30 lsec. After fusion, the fused embryos were fully activated with 200 μM thimerosal for 10 minutes in darkness and with 8 mM dithiothreitol for 30 minutes. The embryos were then incubated for 14–16 hours in modified porcine zygote medium PZM3-MU1 with 0.5 μM Scriptaid (S7817; Sigma-Aldrich), a histone deacetylase inhibitor, as previously described.
[0335] In vitro fertilization (IVF) For IVF, ovaries from pre-pubescent young sows were obtained from a slaughterhouse (Farmland Foods Inc.). Immature oocytes were aspirated from medium-sized (3-6 mm) follicles using an 18-gauge subcutaneous needle attached to a 10 ml syringe. Oocytes with uniformly dense cytoplasm and intact surrounding cumulus cells were then selected for maturation. Approximately 50 cumulus-oocyte complexes were placed in wells containing 500 μl of maturation medium, TCM-199 (Invitrogen), with 3.05 mM glucose, 0.91 mM sodium pyruvate, 0.57 mM cysteine, 10 ng / ml EGF, 0.5 μg / ml progesterone (LH), 0.5 μg / ml FSH, 10 ng / ml gentamicin (APP Pharm), and 0.1% polyvinyl alcohol, at 38.5°C, 5% CO2, in humidified air for 42-44 hours. At the end of maturation, surrounding cumulus cells were removed from the oocytes by vortexing for 3 minutes in the presence of 0.1% hyaluronidase. Subsequently, oocytes matured in vitro were placed in groups of 25-30 in 50 μl drops of IVF medium (modified Tris buffer medium containing 113.1 mM NaCl, 3 mM KCl, 7.5 mM CaCl2, 11 mM glucose, 20 mM Tris, 2 mM caffeine, 5 mM sodium pyruvate, and 2 mg / ml bovine serum albumin [BSA]). One 100 μl frozen semen pellet was thawed in 3 ml of Dulbecco's PBS supplemented with 0.1% BSA. Either frozen WT or fresh eGFP semen was washed by centrifugation at 650°C 3 g for 20 minutes in 60% Percoll and then for 10 minutes in modified Tris buffer medium. In some cases, newly collected semen heterozygous for the previously described eGFP transgene was washed three times in PBS. The semen pellet was then prepared in IVF medium, 0.5 × 10⁶ times. 6 The sperm was resuspended to a cell / ml concentration. 50 microliters of semen suspension were introduced into droplets containing oocytes. Gametes were co-incubated for 5 hours at 38.5°C in an atmosphere of air containing 5% CO2. Post-fertilization, embryos were incubated in PZM3-MU1 at 38.5°C in air containing 5% CO2.
[0336] Embryo transfer Embryos prepared to produce GE CD163 or CD1D pigs were implanted in surrogate mothers on either day 1 (SCNT) or day 6 (zygote injection) after initial male acceptance. In the case of day 6 implantation, the zygotes were cultured for an additional 5 days in PZM3-MU1 in the presence of 10 ng / ml ps48 (Stemgent, Inc.). The embryos were surgically implanted into the ampulla-isthmus junction of the surrogate mother's fallopian tube.
[0337] In vitro RNA synthesis for the CRISPR / Cas9 system Template DNA for in vitro transcription was amplified using PCR (Table 4). The CRISPR / Cas9 plasmid used for cell transfection experiments served as a template for PCR. To express Cas9 in zygotes, Cas9 mRNA was synthesized using the mMESSAGE mMACHINE Ultra Kit (Ambion). Subsequently, a poly(A) signal was added to the Cas9 mRNA using the Poly(A) tailing kit (Ambion). CRISPR guide RNA was synthesized using MEGAshortscript (Ambion). Synthetic RNA characteristics were visualized on a 1.5% agarose gel, then diluted to a final concentration of 10 ng / μl (both gRNA and Cas9), and dispensed into 3 μl aliquots. [Table 4]
[0338] Microinjection in the assembled CRISPR / Cas9 system Cas9-encoding messenger RNA and gRNA were introduced into the cytoplasm of fertilized oocytes 14 hours post-fertilization using a FemtoJet microinjector (Eppendorf) (intended zygotes). Microinjection was performed in working medium on a heated stage of a Nikon inverted microscope (Nikon Corporation; Tokyo, Japan). The injected zygotes were transferred to PZM3-MU1 containing 10 ng / ml ps48 until further use.
[0339] statistical analysis Colonies with modified genomes were classified as number 1, and colonies without genome modifications were classified as number 0. The difference was determined using PROC GLM (SAS), and a P-value of 0.05 was considered significant. The mean was calculated as least squares mean. Data are expressed as number mean ± SEM.
[0340] result CRISPR / Cas9-mediated knockout of CD163 and CD1D in somatic cells The efficiency of four different CRISPR plasmids targeting CD163 (guide 10, 131, 256, and 282) was tested with a donor DNA dose of 2 μg / μl (Table 5). CRISPR282 resulted in significantly more average colony formation than CRISPR10 and 256 treatments (P<0.05). From the long-range PCR assays described above, large deletions ranging from 503 bp to 1506 bp were found instead of the originally intended HR-mediated DS (Figure 3, Panel A). This was unexpected, as previous reports using other DNA editing systems had shown much smaller deletions of 6–333 bp using ZFN in pigs. CRISPR10 and a mixture of all four CRISPRs resulted in a higher number of colonies with modified genomes than CRISPR256 and 282 (Table 5, P<0.002). Transfection with plasmids containing CRISPR10 and Neo but not homologous to CD163 did not yield colonies exhibiting large deletions. Interestingly, a single-alele deletion was also detected when donor DNA was introduced without CRISPR. This assay likely underestimates the mutagenesis rate, as any potentially small deletions detected by sequencing in transfected somatic cells that were not detected on the agarose gel were not screened. [Table 5] *The 4+ Donor DNA mixture represents an equal mixture of 0.5 μg of each CRISPR and 1 μg of donor DNA. The donor DNA treatment serves as a control without CRISPR, and the 10+ Neo treatment shows that the large deletions observed in the CRISPR treatment were only present when CD163 donor DNA was also present. †To estimate CRISPR toxicity, ANOVA was performed by comparing the average number of colonies per plate and for the percentage of colonies with modified genomes. The P-values were 0.025 and 0.0002, respectively. n / a = There were no replications for this treatment, and therefore statistical analysis was not performed. A colony with ‡HR represents a partial HR event. a-c Superscripts indicate significant differences between treatments for both the average number of colonies per plate and the percentage of colonies with modified genomes (P<0.05).
[0341] The initial goal was to obtain a domain swap (DS) targeting event for CD163 using HR, but CRISPR did not increase the efficiency of targeting CD163. It should be noted that various combinations of this targeting vector were used by HR to modify CD163 by traditional transfection, resulting in 0 targeting events after screening 3399 colonies (Whitworth and Prather, unpublished results). Two pigs with complete DS were obtained from HR containing all 33 mutations that were attempted to be introduced by transfection using CRISPR10 and a DS targeting vector as donor DNA.
[0342] Next, the efficiency of CRISPR / Cas9-induced mutation without drug selection was tested; the fetal fibroblast cell lines used in this study already had Neo-resistance cassette integration and SIGLEC1 knockout. We also tested whether the ratio of CRISPR / Cas9 to donor DNA increased genomic modification or produced toxic effects at high concentrations. CRISPR131 was chosen for this trial because previous experiments had yielded a high total colony count and an increased percentage of colonies with modified genomes. Increasing the amount of CRISPR131 DNA from 3:1 to 20:1 did not have a significant effect on fetal fibroblast viability. The percentage of colonies with genomic modification by NHEJ did not differ significantly between various CRISPR concentrations, but the highest number of NHEJ was observed at a 10:1 ratio (Table 6, P=0.33). No HR was observed even at the highest ratio of CRISPR DNA to donor DNA (20:1). [Table 6] a There was a significant difference (P>0.05) between treatments in the percentage of colonies with NHEJ repair. b There was no significant difference in the number of genome-modified colonies with increasing CRISPR concentration (P>0.33).
[0343] Based on this experience, we attempted targeted disruption of CD1D in somatic cells. Four different CRISPRs were designed and tested in both male and female cells. CD1D modifications were detectable from three of the applied CRISPRs, but the use of CRISPR5350 did not yield CD1D modifications with deletions large enough to be detected by agarose gel electrophoresis (Table 7). Interestingly, although donor DNA was provided, no genetic modifications were obtained by HR. However, large deletions similar to those observed in the CD163 knockout experiment were observed (Figure 3, Panel B). When CRISPR / Cas9 was not used with donor DNA, targeted CD1D modifications with large deletions were not detected. CD1D modifications from CRISPR / Cas9-guided targeting were 4 / 121 and 3 / 28 in male and female colonies of cells, respectively. Only INDELs detectable by agarose gel electrophoresis were included in the transfection data. [Table 7]
[0344] Production of CD163 and CD1D pigs using SCNTs with GE cells Cells exhibiting CD163 or CD1D modifications were used for SCNT to generate CD163 and CD1D knockout pigs (Figure 3). Seven embryo transfers (CD163, Table 8), six embryo transfers (without CD163-Neo), and five embryo transfers (CD1D) were performed on recipient young sows using SCNT embryos derived from male and female fetal fibroblasts transfected with the CRISPR / Cas9 system. Six recipient young sows (CD163), two (without CD163-Neo), and four (CD1D) (Table 9) maintained pregnancy to birth, achieving pregnancy rates of 85.7%, 33.3%, and 80%, respectively. Of the CD163 recipients, five gave birth to healthy piglets by cesarean section. One piglet (O044) was born spontaneously. The number of piglets ranged from 1 to 8. Four pigs were euthanized due to postnatal growth defects. One piglet was euthanized due to severe cleft palate. All remaining piglets appeared healthy (Figure 3, Panel C). Two littermates of male piglets obtained from fetal fibroblasts transfected with CRISPR10 and donor DNA, as described in Figure 3, Panel B, had a 30 bp deletion in exon 7 adjacent to CRISPR10 and an additional 1476 bp deletion in the preceding intron, thus the CD163 intron 6 / exon 7 junction was removed (Figure 3, Panel E). Genotypes and predicted translations are summarized in Table 10. One male piglet and one female littermate (four piglets) were obtained from CD163-Neo-free transfection of pre-modified SIGLEC1 cells. All five piglets were double knockout for SIGLEC1 and CD163. Male piglets had biallelic alterations of CD163, with a 28 bp deletion and partial deletion of exon 7 on one allele, and a 1387 bp deletion on the other allele, including a complete deletion of exon 8 and the preceding intron, thus eliminating the intron-exon junction. Female piglets had biallelic mutations of CD163, including a 1382 bp deletion and 11 bp insertion on one allele and a 1720 bp deletion of CD163 on the other allele. A summary of the CD163 alterations and predicted translations can be found in Table 10.A summary of CD1D modifications and predicted translations by CRISPR modifications can be found in Table 11. Briefly, 1 female and 2 male piglets were born in a litter of 13 piglets. One piglet died shortly after birth. Twelve of the 13 piglets contained biallele or homozygous deletions of CD1D (Figure 3, Panel F). One piglet was wild-type (WT). [Table 8] * The CD163 CRISPR NT lineage represents embryos produced by NT using transfected fetal fibroblast lines. CRISPR-injected embryos were IVF embryos injected with CD163 guide RNA along with CAS9 RNA at the one-cell stage. The CD163 CRISPR NT-Neo-free fetal lineage represents embryos produced by NT using previously modified fetal fibroblasts that were already Neo-resistant lines modified by transfection, without the use of selectable markers. †MU represents aspirated and matured young sow oocytes, as described in the IVF section of Materials and Methods at the University of Missouri. ART represents purchased and matured sow oocytes, as described in the SCNT section of Materials and Methods. [Table 9] * The CD1D CRISPR NT strain refers to embryos produced using transfection-modified fetal fibroblast strains. CRISPR-injected embryos were IVF embryos injected with CD1D guide RNA along with CAS9 RNA at the one-cell stage. †MU represents aspirated and matured young sow oocytes, as described in the IVF section of Materials and Methods at the University of Missouri. ART represents purchased and matured sow oocytes, as described in the SCNT section of Materials and Methods. [Table 10] TIFF2026048623000012.tif235160 TIFF2026048623000013.tif238160 * KO, knockout ** The piglets were euthanized, so they were not included. †The SEQ ID NO. in this column indicates the SEQ ID NO. for the sequence that indicates INDEL for SEQ ID NO:47. a The inserted sequence was TACTACT (SEQ ID NO: 115). b The inserted sequence was AG. c The inserted sequence was a single adenine (A) residue. d The inserted sequence was TGTGGAGAATTC (SEQ ID NO: 116). e The inserted sequence was AGCCAGCGTGC (SEQ ID NO: 117). [Table 11] * KO, knockout
[0345] Efficiency of the CRISPR / Cas9 system in porcine conjugates Based on targeted disruption of CD163 and CD1D in somatic cells using the CRISPR / Cas9 system, this approach was applied to porcine embryogenesis. First, the efficacy of the CRISPR / Cas9 system in developing embryos was tested. The eGFP-targeting CRISPR / Cas9 system was introduced into zygotes fertilized with semen from heterozygous boars for the eGFP transgene. After injection, subsequent embryos expressing eGFP were monitored. Various concentrations of the CRISPR / Cas9 system were tested, and the cytotoxicity of the delivered CRISPR / Cas9 system was observed (Figure 4, Panel A); embryonic development after CRISPR / Cas9 injection was lower compared to the control. However, all concentrations of CRISPR / Cas9 tested were effective in generating eGFP modifications, as no embryos expressing eGFP were found in the CRISPR / Cas9 injection group (Figure 4, Panel B); 67.7% of uninjected control embryos turned green, indicating eGFP expression. Genotyping of individual blastocysts allowed for the identification of small mutations near the CRISPR binding site (Figure 4, Panel C). Based on toxicity and efficacy, 10 ng / μl of gRNA and Cas9 mRNA were used for the following experiments.
[0346] When a CRISPR / Cas9 component designed to target CD163 was introduced into a prospective zygote, targeted gene modification was observed in subsequent blastocysts. Genotyping of individual blastocysts for CD163 mutations revealed specific mutations in all embryos (100% GE efficiency). More importantly, while homozygous or biallelic mutations were found in embryos (8 / 18 and 3 / 18, respectively) (Figure 5), mosaic (single-allelic mutation) genotypes were also detected (4 / 18 embryos). Injecting 2 ng / μl Cas9 and 10 ng / μl CRISPR into several embryos from this pool (8 / 10) showed no difference in mutagenesis efficiency. Next, based on the in vitro results, two CRISPRs representing different gRNAs were introduced to disrupt CD163 or CD1D during embryogenesis, inducing specific deletions of the target gene. As a result, it was possible to successfully introduce the designed deletions of CD163 and CD1D by introducing the two guides. A designed deletion is defined as a deletion that removes the genomic sequence between the two introduced guides. Of the embryos that received two CRISPRs targeting CD163, all but one showed targeted modification of CD163. In addition, 5 / 13 embryos were found to have a designed deletion on CD163 (Figure 6, Panel A), and 10 / 13 embryos appeared to have CD163 modification in either homozygous or biallelic manner. Targeting CD1D with two CRISPRs was also effective, as all embryos (23 / 23) showed modification of CD1D. However, a designed deletion of CD1D could only be found in two embryos (2 / 23) (Figure 6, Panel B). Of the 23 embryos, five were also found to have mosaic genotypes, while the remaining embryos had either homozygous or biallelic modification of CD1D. Finally, we tested whether multiple genes could be targeted by the CRISPR / Cas9 system within the same embryo. For this purpose, targeting of both CD163 and eGFP was performed in zygotes fertilized with heterozygous eGFP sperm.Genotyping of blastocysts derived from injected embryos revealed that CD163 and eGFP were successfully targeted during embryogenesis. Sequencing results demonstrated that multiple genes can be targeted by introducing multiple CRISPR sequences together with Cas9 (Figure 6, Panel C).
[0347] Generation of CD163 and CD1D mutants from CRISPR / Cas9-injected conjugates Building on the success of previous in vitro studies, several CRISPR / Cas9-injected zygotes were created, and 46–55 blastocysts were implanted per recipient (this number has been shown to be effective in producing pigs from in vitro-induced embryos). Four embryo transfers were performed, with two each for CD163 and CD1D, and pregnancies were obtained for each modification. Four healthy piglets carrying the modification on CD163 were produced (Table 8). All 67 piglets from recipient sow IDO083 showed homozygosity or biallelic modification of CD163 (Figure 7). Two piglets showed the designed deletion of CD163 by the two delivered CRISPRs. All piglets were healthy. In CD1D, four piglets were also produced in a single pregnancy (166 piglets from recipient sow identification number O165): one female and three males (Table 9). One piglet (166-1) carried a mosaic mutation in CD1D, including a 362 bp deletion with complete removal of exon 3 containing the start codon (Figure 8). Another piglet had a 6 bp insertion, with a 2 bp mismatch on one allele and a large deletion on the other. Two additional piglets had biallelic single bp insertions. No mosaic mutations were detected for CD163.
[0348] Essay The increased efficiency of GE pig generation can have broad implications by providing more GE pigs for agricultural and biomedical purposes. The data described above demonstrate that GE pigs with specific mutations can be generated with high efficiency using the CRISPR / Cas9 system. The CRISPR / Cas9 system was successfully applied to genetically modify both somatic cells and preimplantation embryos.
[0349] When the CRISPR / Cas9 system was introduced into somatic cells, it successfully induced targeted disruption of target genes by NHEJ, but did not increase the targeting ability by HR. The targeting efficiency of individual CRISPR / Cas9 in somatic cells varied, indicating that guide design may affect targeting efficiency. Specifically, when CRISPR5350 and Cas9 were introduced into somatic cells, no target modification of CD1D was observed. This suggests that designing multiple gRNAs and validating their efficiencies before generating pigs may be beneficial. The reason for the lack of HR repair in the presence of donor DNA remains unclear. After screening 886 colonies transfected with CRISPR and donor DNA (both CD163 and CD1D), only one colony had evidence of a partial HR event. The results demonstrate that the CRISPR / Cas9 system worked with the introduced donor DNA to induce unexpectedly large deletions on target genes, but did not increase HR efficiency for these two specific targeting vectors. However, the specific mechanism for observing large deletions remains unknown. Previous reports from our group suggested that donor DNA can be effectively used with ZFNs to induce HR repair. Similarly, increased targeting efficiency was observed when donor DNA was used with the CRISPR / Cas9 system, but complete HR repair was not observed. In previous studies using ZFNs, it was observed that target modification may occur through a combination of HR and NHEJ, as partial recombination of introduced donor DNA was observed after ZFN-induced DSBs. One explanation is that the HR and NHEJ pathways are not independent but can act together to complete the repair process after homing endonuclease-induced DSBs. Higher CRISPR concentrations improved targeting efficiency in somatic cells, but no statistically significant differences were observed in these experimental results.This suggests that CRISPR is a limiting factor in the CRISPR / Cas9 system, but further verification is needed. GE pigs were successfully generated by SCNT using target cells. This demonstrates that the application of CRISPR / Cas9 does not affect the ability of cells to be cloned. A few piglets were euthanized due to health problems; however, this is rare in SCNT-derived piglets.
[0350] When the CRISPR / Cas9 system was introduced into developing embryos by zygote injection, nearly 100% of embryos and pigs contained INDEL in the target gene, demonstrating the technique's high effectiveness during embryogenesis. The efficiency observed in this study exceeded the frequencies reported in other studies using homing endonucleases during embryogenesis. The decrease in the number of embryos reaching the blastocyst stage suggests that the CRISPR / Cas9 concentration introduced in this study may be toxic to the embryos. Further optimization of the delivery system could increase embryo viability and thus improve the overall efficiency of the process. The nearly 100% mutagenesis rate observed here differed from previous reports in CRISPR / Cas9-mediated knockout in pigs; however, the difference in efficiency between studies can be attributed to the combination of selected guides and targets. In this study, lower concentrations of CRISPR / Cas9 (10 ng / μl each) were effective in inducing mutations in developing embryos and producing GE pigs. The concentrations were lower than those previously reported in porcine zygotes (125 ng / μl Cas9 and 12.5 ng / μl CRISPR). Lower concentrations of CRISPR / Cas9 components may be beneficial to developing embryos, as introducing excess nucleic acids into developing embryos can be toxic. Some mosaic genotypes were observed in CRISPR / Cas9-injected embryos from in vitro assays; however, only one piglet produced by this approach had a mosaic genotype. Potentially, injection of CRISPR / Cas9 components may be more effective than the introduction of other homing endonucleases, as mosaic genotypes are considered a major hurdle to using the CRISPR / Cas9 system in zygotes. Another advantage of using the CRISPR / Cas9 system, as demonstrated by these results, is that CD163 knockout pigs generated from IVF-induced zygotes injected with the CRISPR / Cas9 system were not lost, whereas a few piglets obtained from SCNTs were euthanized a few days later.This suggests that the technology not only avoided the need for SCNTs to produce knockout pigs, but also overcame common health problems associated with SCNTs. Now that the injection of CRISPR / Cas9 mRNA into zygotes has been optimized, further experiments would likely involve the simultaneous injection of donor DNA as well.
[0351] This study demonstrates that introducing two CRISPRs together with Cas9 into a zygote can induce chromosomal deletions in developing embryos, resulting in the production of pigs with intended deletions, specifically, deletions between the two CRISPR guides. These designed deletions can be beneficial because they allow for the specification of deletion size rather than relying on random events caused by NHEJ. Specifically, in the case of multiples of 3 nucleotide insertions / deletions caused by homing endonucleases, mutations may rather result in low-phenotypic mutations because no frameshift occurs. However, introducing two CRISPRs makes it possible to induce larger deletions, which would increase the likelihood of producing non-functional proteins. Interestingly, the CD1D CRISPR was designed to cover a larger area in the genome than the CD163; while the distance between CD163 CRISPR10 and 131 was 124 bp, for CD1D, the distance between CRISPR4800 and 5350 was 550 bp. Longer distances between CRISPRs were less effective in creating deletions, as shown in this study. However, this study includes only limited observations, and the efficacy of individual CRISPRs (not addressed here) needs to be considered; therefore, further research is needed to examine the relationship between the distance between CRISPRs and the probability of causing the intended deletion.
[0352] The CRISPR / Cas9 system was also effective in simultaneously targeting two genes within the same embryo, with the only extra step being the introduction of one additional CRISPR and crRNA. This demonstrates the ease with which multiple genes can be disrupted compared to other homing endonucleases. These results suggest that this technique could be used to target gene groups or gene families that have proven difficult to determine the role of individual genes unless all genes are disrupted, potentially exhibiting compensatory effects. From the results, it is demonstrated that the CRISPR / Cas9 technique can be applied to produce GE pigs by increasing the efficiency of gene targeting in somatic cells and by direct zygote injection.
[0353] Example 2: Increased resistance to PRRSV in pigs with modified chromosomal sequences in the gene encoding the CD163 protein. Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) devastated the pig industry for a quarter of the century. Speculations regarding the mode of viral entry included both SIGLEC1 and CD163. While SIGLEC1 knockout did not affect the response to viral exposure, this embodiment shows that CD163-null animals do not exhibit the clinical signs of infection, pulmonary pathology, viremia, or antibody production, all characteristic of PRRSV infection. Not only are PRRSV entry mediators identified; strategies to prevent significant economic losses and animal morbidity are described if similarly constructed animals are allowed to participate in the food supply.
[0354] material and method Genotyping Genotyping was based on both DNA and mRNA sequencing. The male parent's genotype had an 11bp deletion in one allele, which, when translated, predicted 45 amino acids to domain 5, resulting in an immature stop codon at amino acid 64. In the other allele, there was a 2bp addition in exon 7 and a 377bp deletion in the intron preceding exon 7, which, when translated, predicted the first 49 amino acids of domain 5, resulting in an immature stop code at amino acid 85. One sow had a 7bp addition in one allele, which, when translated, predicted the first 48 amino acids of domain 5, resulting in an immature stop codon at amino acid 70. The other alleles were not characterized (A) because there was no band derived from exon 7 by either PCR or long-range 6.3kbPCR. The other three sows were clones and had a 129bp deletion in exon 7, which is predicted to be a deletion of 43 amino acids derived from domain 5. Other alleles were not characterized (B).
[0355] The propagation of PRRSV in culture and the production of viral inoculum for infecting pigs are included in the approved IBC application 973. The reference strain of PRRSV, isolate NVSL97-7895 (GenBank # AF325691 2001-02-11), was propagated as described in the approved IBC protocol 973. This laboratory isolate has been used in experimental studies for approximately 20 years (Ladinig et al., 2015). A second isolate was used for the second trial, KS06-72109, as previously described (Prather et al., 2013).
[0356] Pig infection by PRRSV A standardized infection protocol for PRRSV was used for infecting pigs. Approximately 10 doses were administered to 3-week-old piglets. 4The pigs were inoculated with TCID50 PRRS virus (administered via intramuscular (IM) and intranasal (IN) routes). The pigs were monitored daily, and those showing symptoms of the disease were treated according to the recommendations of the CMG veterinarian. Pigs showing severe distress and at risk of succumbing to infection were humanely euthanized, and samples were collected. Staff and veterinarians were not informed of the pigs' genetic status to eliminate bias in evaluation or treatment. PRRSV is present in bodily fluids during infection; therefore, blood samples were collected and stored at -80°C until measured to determine the amount or degree of viremia in each pig. At the end of the experiment, the pigs were weighed, humanely euthanized, and tissues were collected, fixed in 10% buffered formalin, embedded in paraffin, and processed for histopathological diagnosis by a committee-certified pathologist.
[0357] Phenotypic scoring of exposed pigs The phenotypes of the pigs were scored daily in a blind manner as follows: Which of the following describes the pig's attitude? Attitude score: 0: BAR, 1: QAR, 2: Slightly depressed, 3: Depressed, 4: Near death. Which of these describes the pig's condition? Health score: 1: Abnormally emaciated, 2: Thin, 3: Ideal, 4: Fat, 5: Excessive fat / obese. What is the rectal temperature of a pig? Normal body temperature 101.6~103.6°F (considered a fever) > (104°F). Is there lameness (grade)? Which limb? Evaluate the limb for joint swelling and hoof lesions (check the bottom and sides of the hoof). Lameness score: 1: No lameness, 2: Slightly uneven gait, some joint contractures but no lameness, 3: Mild lameness, slight limp while walking, 4: Moderate lameness, noticeable limp including toe-touching, 5: Severe lameness, no weight bearing on limbs, requires encouragement to stand / walk. Is there difficulty breathing (grade)? Is there open-mouth breathing? Is there nasal discharge (color, amount: mild / moderate / severe)? Have you noticed any coughing in the animal? Is there eye discharge? Respiration score:0: Normal, 1: Mild dyspnea and / or tachypnea when stressed (handling), 2: Mild dyspnea and / or tachypnea at rest, 3: Moderate dyspnea and / or tachypnea when stressed (handling), 4: Moderate dyspnea and / or tachypnea at rest, 5: Severe dyspnea and / or tachypnea when stressed (handling), 6: Severe dyspnea and / or tachypnea at rest. Is there evidence of diarrhea (grade) or vomiting? Is there blood or mucus? Diarrhea score: 0: No noticeable stool, 1: Normal stool, 2: Soft stool but with form (soft cream yogurt consistency, cow dung-like), 3: Brown / yellowish-brown liquid diarrhea with particulate fecal matter, 4: Brown / yellowish-brown liquid diarrhea without particulate fecal matter, 5: Liquid diarrhea that looks like water.
[0358] This scoring system was developed by Dr. Megan Niederwerder at KSU and is based on the following publications: Halbur et al., 1995; Merck; Miao et al., 2009; Patience and Thacker, 1989; Winckler and Willen, 2001. Scores and temperatures were analyzed using ANOVA, which involved separating individuals based on genotype as a treatment.
[0359] Measurement of PRRSV viremia Viremia was determined by two approaches. Viral titration was performed by adding serum in 1:10 serial dilutions to confluent MARC-145 cells in a 96-well plate. Serum was diluted in Eagle's Minimum Essential Medium supplemented with 8% fetal bovine serum, penicillin, streptomycin, and amphotericin B, as previously described (Prather et al., 2013). After 4 days of incubation, cells were examined for the presence of cytopathic effects by microscopy. The highest dilution showing cytopathic effects was scored as the titration endpoint. Total RNA was isolated from serum using the Life Technologies MagMAX-96 viral RNA isolation kit to measure viral nucleic acid. Reverse transcription polymerase chain reaction was performed on a CFX-96 real-time PCR system (Bio-Rad) using the Tetracore EZ-PRRSV MPX 4.0 kit, according to the manufacturer's instructions. Each reactant (25 μl) contained 5.8 μl of serum-derived RNA. Calibration curves were constructed by preparing serial dilutions of RNA controls supplied by the kit (Tetracore). The number of templates per PCR is reported.
[0360] SIGLEC1 and CD163 staining of PAM cells Porcine alveolar macrophages (PAMs) were collected by resecting the lung and filling it with approximately 100 ml of cold phosphate-buffered saline. After collecting the phosphate-buffered saline wash, the cells were pelletized, resuspended in 5 ml of cold phosphate-buffered saline, and stored on ice. Approximately 10 7The PAM cells were incubated on ice for 30 minutes in phosphate-buffered saline diluted with 5 ml of various antibodies (anti-porcine CD169 (clone 3B11 / 11; AbD Serotec); anti-porcine CD163 (clone 2A10 / 11; AbDSerotec)) along with 5% fetal bovine serum and 0.1% sodium azide. The cells were washed and resuspended in fluorescein isothiocyanate (FITC) conjugated goat anti-mouse IgG (Life Technologies) diluted in staining buffer at a 1 / 100 dilution, and incubated on ice for 30 minutes. 4 The cells were analyzed using a FACSCalibur flow cytometer and Cell Quest software (Becton Dickinson).
[0361] Measurement of PRRSV-specific Ig To measure PRRSV-specific Ig, recombinant PRRSV N protein was expressed in bacteria (Trible et al., 2012) and conjugated to magnetic Luminex beads using a kit (Luminex Corporation). The N protein-conjugated beads were diluted to 2,500 beads / 50 μl in phosphate-buffered saline containing 10% goat serum and placed in the wells of a 96-well round-bottom polystyrene plate. The serum was diluted 1:400 in phosphate-buffered saline containing 10% goat serum, and 50 μl was added to two wells of a plate. The plates were incubated at room temperature for 30 minutes with gentle shaking. Next, the plates were washed with phosphate-buffered saline containing 10% goat serum (3×), and 50 μl of biotin-SP conjugate affinity purified goat anti-porcine secondary antibody (IgG, Jackson ImmunoResearch) or biotin-labeled affinity purified goat anti-porcine IgM (KPL) (diluted to 2 μg / ml in phosphate-buffered saline containing 10% goat serum) was added. After 30 minutes of incubation, the plates were washed (3×), and then 50 μl of streptavidin-conjugate phycoerythrin (2 μg / ml in phosphate-buffered saline containing 10% goat serum (Moss, Inc.)) was added. The plates were washed after 30 minutes, and the microspheres were resuspended in 100 μl of phosphate-buffered saline containing 10% goat serum and analyzed using MAGPIX and Luminex xPONENT 4.2 software. Mean fluorescence intensity (MFI) is reported.
[0362] result Mutations in CD163 were generated in Example 1 using CRISPR / Cas9 technology as described above. Several founder animals were generated from zygote injection and somatic cell nuclear transfer. Some of these founders were mated to produce offspring for study. A single founder male was mated with a female having two genotypes. Founder male (67-1) had an 11bp deletion in exon 7 on one allele and a 2bp addition in exon 7 on the other allele (and a 377bp deletion in the preceding intron), resulting in a null animal (CD163- / - It was predicted that one founder female (65-1) had a 7bp addition in exon 7 of one allele and an uncharacterized corresponding allele, and was therefore predicted to be heterozygous for the knockout (CD163). - / ? The second founder female genotype (three cloned animals) contained an allele that had not yet been characterized and an allele with a 129 bp deletion in exon 7. This deletion is predicted to be a 43 amino acid deletion in domain 5. Crossing these animals resulted in all piglets inheriting either a null allele from the boar and one of the 43 amino acid deletion or uncharacterized allele from the sow. In addition to the wild-type piglet that served as a positive control for viral exposure, this generated four additional genotypes (Table 8). [Table 12]
[0363] At weaning, gene-edited piglets and wild-type piglets of the same age were transported to Kansas State University for PRRSV exposure. PRRSV exposure was carried out as previously described (Prather et al., 2013). Piglets were brought to the exposure facility at 3 weeks of age and maintained as a single group. All experiments were initiated after approval of facility animal use and the Biosafety Committee. After acclimatization, the pigs were exposed to PRRSV isolate NVSL97-7895 (Ladinig et al., 2015), grown on MARC-145 cells (Kim et al., 1993). The pigs were exposed for approximately 10 weeks. 5 TCID 50The pigs were exposed to the virus. Half of the inoculation material was delivered intramuscularly, and the other half intranasally. All infected pigs were maintained as a single group, which allowed for continuous exposure to the virus from infected individuals in the same cage. Blood samples were collected at various days up to 35 days post-infection and at the end of the study, on day 35. The pigs were necropped, and tissues were fixed in 10% buffered formalin, embedded in paraffin, and processed for histopathological diagnosis. PRRSV-related clinical signs recorded during the infection process included tachypnea, loss of appetite, lethargy, and fever. The results for clinical signs over the study period are summarized in Figure 9. As expected, wild-type (CD163+ / +) pigs showed early signs of PRRSV infection, which peaked between day 5 and day 14 and persisted within the group for the remainder of the study. The percentage of feverish pigs peaked at approximately day 10. In contrast, null (CD163- / -) piglets showed no evidence of clinical signs throughout the entire study period. Respiratory signs during acute PRRSV infection are reflected in significant histopathological changes in the lungs (Table 9). Infection in wild-type pigs showed a histopathological diagnosis consistent with PRRS, including interstitial edema with mononuclear cell infiltration (Figure 10). In contrast, there was no evidence of lung changes in null (CD163- / -) pigs. The sample size for the various genotypes was small; nevertheless, the mean scores were 3.85 (n=7) for wild-type, 1.75 (n=4) for uncharacterized A, 1.33 (n=3) for uncharacterized B, and 0 (n=3) for null (CD163- / -). [Table 13]
[0364] Peak clinical signs correlated with PRRSV levels in the blood. Viral nucleic acid was measured by isolating total RNA from serum, followed by amplification of PRRSV RNA using a commercially available reverse transcriptase real-time PRRSV PCR test (Tetracore, Rockville, MD). Calibration curves were constructed by preparing serial dilutions of PRRSV RNA controls supplied in RT-PCR kits, and results were standardized as template count / 50 μl PCR reaction. PRRSV isolates followed the process for PRRSV viremia in wild-type CD163+ / + pigs (Figure 11). Viremia became apparent on day 4, peaked on day 11, and decreased until the end of the study. In contrast, viral RNA was CD163 - / - In pigs, no antibodies were detected at any point during the study period. Consistent with viremia, antibody production in null and uncharacterized allergenic pigs was detectable up to 14 and increased up to 28. No antibody production was observed in null animals (Figure 12). Collectively, these data indicate that wild-type pigs supported PRRSV replication and produced clinical signs consistent with PRRS. In contrast, knockout pigs did not produce viremia or clinical signs, even when the pigs were inoculated and constantly exposed to infected individuals in the same pen.
[0365] At the end of the study, porcine alveolar macrophages were removed by lung lavage and stained for surface expression of SIGLEC1 (CD169, clone 3B11 / 11) and CD163 (clone 2A10 / 11) as previously described (Prather et al., 2013). Relatively high levels of CD163 expression were detected on CD163+ / + wild-type animals (Figure 13). In contrast, CD163- / - pigs showed only background-level anti-CD163 staining, thus confirming the knockout phenotype. Expression levels for another macrophage marker, CD169, were similar in both wild-type and knockout pigs (Figure 14). Other macrophage surface markers, e.g., MHCII and CD172, were the same for both genotypes (data not shown).
[0366] Although the sample size was small, wild-type pigs tended to gain less weight throughout the experiment compared to the other three genotypes (uncharacterized A 1.32 kg ± 0.17, n=4; uncharacterized B 1.20 kg ± 0.16, n=3; Null 1.21 kg ± 0.16, n=3) (average daily weight gain 0.81 kg ± 0.33, n=7).
[0367] In the second trial, six wild-type pigs, six Δ43 amino acid pigs, and six pigs with an uncharacterized allele (B) were exposed to KS06-72109 as described above, except that the piglets were inoculated with the allele. Similar to the NVSL data, the wild-type and uncharacterized B piglets developed viremia. However, Δ43 amino acid pigs did not develop viremia with KS06 (Figure 15; Table 7).
[0368] Meaning and conclusion The disease most clinically relevant to the pig industry is PRRS. While vaccination programs have been successful in preventing or controlling most porcine pathogens, PRRSV has proven to be more challenging. Here, CD163 has been identified as an entry mediator for this virus strain. The founder boar was created by injecting CRISPR / Cas9 into a zygote (Whitworth et al., 2014), and therefore has no transgene. In addition, one allele from a sow (also created using CRISPR / Cas9) does not contain the transgene. Thus, piglet #40 has a 7bp addition in one allele and an 11bp deletion in the other, but does not possess the transgene. These virus-resistant alleles of CD163 represent a small genome edit, considering that the porcine genome is approximately 2.8 billion bp (Groenen et al., 2012). If similarly created animals are introduced into the food supply, significant economic losses could be prevented.
[0369] Example 3: Increased resistance to genotype 1 porcine reproductive PRRS virus in pigs having CD163 SRCR domain 5 replaced with human CD163-like homology SRCR domain 8. CD163 is considered the primary receptor for porcine reproductive and respiratory syndrome virus (PRRSV). In this study, pigs were genetically modified (GM) to have one of the following genotypes: complete knockout (KO) of CD163, deletion within CD163 scavenger receptor cysteine-rich (SRCR) domain 5, or replacement of SRCR domain 5 with a synthetic exon encoding a homolog of the human CD163-like (hCD163L1) SRCR8 domain (domain swap). Immunophenotyping of porcine alveolar macrophages (PAMs) showed that pigs with KO or SRCR domain 5 deletion did not express CD163, and PAMs did not support PRRSV infection. PAMs from pigs with the hCD163L1 domain 8 homolog expressed CD163 and supported type 2 replication, but did not support type 1 genotype viruses. Similar results were obtained when CD163-modified pigs were infected with representative type 1 and type 2 viruses. The results indicate a clear difference between PRRSV genotypes in their recognition of the CD163 molecule, even though type 1 and type 2 viruses require CD163 as a receptor and may be considered genetically and phenotypic similar at some levels.
[0370] material and method Genome modification of the porcine CD163 gene Experiments involving animals and viruses were conducted in accordance with the Federation of Animal Science Societies Guide for the Care and Use of Agricultural Animals in Research and Teaching, the USDA Animal Welfare Act and Regulations, and were approved by the Kansas State University and University of Missouri Institutional Laboratory Animal Committees and Institutional Biosafety Committees. Mutations in CD163 used in this study were generated using the CRISPR / Cas9 technology described above in previous examples. The mutations are illustrated in Figure 17. The illustrated genomic region shown in Figure 17 extends from intron 6 to intron 8 of the porcine CD163 gene. The introns and exons illustrated in Figure 17 are not drawn to scale. Predicted protein products are shown to the right of each genomic structure. Relative macrophage expression, measured by the level of surface CD163 on PAM, is shown at the far right of Figure 17. Black regions indicate introns (indict); white regions indicate exons; shaded regions indicate the hCD163L1 exon 11 mimic, homolog of buta exon 7; and gray regions indicate synthetic introns with the PGK Neo construct, as shown in Figure 17.
[0371] The CD163 gene construct KO-d7(11), shown in Figure 17, has an 11-base pair deletion in exon 7 from nucleotide 3,137 to nucleotide 3,147. The CD163 gene construct KO-i7(2) has a 2-base pair insertion between nucleotides 3,149 and 3,150 in exon 7, as well as a 377-base pair deletion in the upstream intron of exon 7 from nucleotide 2,573 to nucleotide 2,949. These edits are predicted to cause frameshift mutations and immature stop codons, resulting in only partial translation of SRCR5 and a KO phenotype. Three other mutations produced deletions in exon 7. First, d7(129) has a 129-base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172. The d7(129) construct also has a deletion in exon 6 from nucleotide 488 to nucleotide 2,417, where the deleted sequence is replaced by a 12 bp insertion. The other two deletion constructs, d7(1467) and d7(1280), have complete deletions in exons 7 and 8, as shown in Figure 17. d7(1467) has a 1,467 base pair deletion from nucleotide 2,431 to nucleotide 3,897, and d7(1280) has a 1,280 base pair deletion from nucleotide 2,818 to nucleotide 4,097. In these deletion constructs, the other CD163 exons remained intact.
[0372] The final construct, HL11m, shown in Figure 17, was generated using a targeting event that involved deleting exon 7 and replacing it with a synthetic exon encoding the homolog of SRCR8 in human CD163-like protein 1 (hCD163L1 domain 8 is encoded by hCD163L1 exon 11). The SRCR8 peptide sequence was constructed by altering 33 nucleotides in the porcine exon 7 sequence. A neomycin cassette was included in the synthetic exon to enable screening for modification. SEQ ID NO:118 provides the nucleotide sequence for the HL11m construct in the region corresponding to the same region in reference sequence SEQ ID NO:47.
[0373] Figure 18 provides diagrams of the porcine CD163 protein and gene. The CD163 protein SCRC (oval) and PST (square) domains, along with their corresponding gene exons, are shown in panel A of Figure 18. A peptide sequence comparison of porcine CD163 SRCR5 (SEQ ID NO: 120) and human CD163 SRCR8 homolog (SEQ ID NO: 121) is shown in panel B of Figure 18. The diagrams are based on GenBank acceptance numbers AJ311716 (porcine CD163) and GQ397482 (hCD163-L1).
[0374] virus Table 14 lists the panel of viruses used in this example. Isolates were grown on MARC-145 cells and titrated (Kim et al., 1993). For titration, each virus was serially diluted 1:10 in MEM supplemented with 7% FBS, Pen-Strep (80 units / ml and 80 μg / ml, respectively), 3 μg / ml FUNGIZONE (amphotericin B), and 25 mM HEPES. The diluted samples were added in four strips to confluent MARC-145 cells in a 96-well plate to a final volume of 200 μl / well and incubated at 37°C in 5% CO2 for 4 days. The titration endpoint was identified as the last well exhibiting cytopathic effect (CPE). 50% tissue culture infectious dose (TCID) 50The values ( / ml) were calculated using the method previously described (Reed and Muench 1938). [Table 14] * NA, unavailable
[0375] Infection of alveolar macrophages Macrophage preparation and infection were carried out as previously described (Gaudreault, et al., 2009 and Patton, et al., 2008). Lungs were removed from euthanized pigs and washed by pouring 100 ml of cold phosphate-buffered saline (PBS) into the trachea. The trachea was clamped and the lungs were gently massaged. Alveolar contents were poured into a 50 ml centrifuge tube and stored on ice. Porcine alveolar macrophages (PAMs) were precipitated by centrifugation at 1200 × g for 10 minutes at 4°C. The pellet was resuspended in cold sterile PBS and washed once. The cell pellet was resuspended in frozen medium containing 45% RPMI1640, 45% fetal bovine serum (FBS), and 10% dimethyl sulfoxide (DMSO) and stored in liquid nitrogen until use. Frozen cells were thawed on ice, counted, and placed in medium (RPMI1640; RPMI-FBS supplemented with 10% FBS, PenStrep, and FUNGIZONE) at a rate of 5 × 10 5 Adjusted to cells / ml. Approximately 10 3PAM / well was added to a 96-well plate and incubated overnight at 37°C in 5% CO2. Cells were gently washed to remove non-adherent cells. 1:10 serial dilutions of the virus were added to three wells. After overnight incubation, cells were washed with PBS and fixed with 80% acetone for 10 minutes. After drying, the wells were stained with PRRSV N-protein specific SDOW-17mAb (Rural Technologies Inc.) diluted 1:1000 in PBS (PBS-FG; Sigma Aldrich) containing 1% fish gelatin. After incubation at 37°C for 30 minutes, cells were washed with PBS and stained with ALEXAFLUOR488-labeled anti-mouse IgG (Thermofisher Scientific) diluted 1:200 in PBS-FG. Plates were incubated in the dark at 37°C for 30 minutes, washed with PBS, and observed under a fluorescence microscope. 50% tissue culture infectious dose (TCID) 50 The values for ) / ml were calculated according to the method previously described (Reed and Muench 1938).
[0376] Measurement of CD169 and CD163 surface expression on PAM Staining for surface expression of CD169 and CD163 was performed as previously described (Prather et al., 2013). Approximately 1 × 10⁻⁶ 6PAM was placed in a 12 mm × 75 mm polystyrene flow cytometry (FACS) tube and incubated in 1 ml of PBS containing 10% normal mouse serum to block the Fc receptor for 15 minutes at room temperature. Cells were pelleted by centrifugation and resuspended in 5 μl of FITC conjugate mouse anti-porcine CD169 mAb (clone 3B11 / 11; AbD Serotec) and 5 μl of PE conjugate mouse anti-porcine CD163 mAb (clone: 2A10 / 11, AbD Serotec). After 30 minutes of incubation, cells were washed twice with PBS containing 1% bovine serum albumin (BSA Fraction V; Hyclone) and immediately analyzed on a BD LSR Fortessa flow cytometer (BD Biosciences) using FCS Express5 software (De Novo Software). A minimum of 10,000 cells were analyzed for each sample.
[0377] Measurement of PRRS viremia RNA was isolated from 50 μl of serum using the Ambion MagMAX96 virus isolation kit (Applied Biosystems) according to the manufacturer's instructions. PRRSV RNA was quantified using the EZ-PRRSV MPX4.0 Real Time RT-PCR target-specific reagent (Tetracore) as performed according to the manufacturer's instructions. Each plate was designed for use with the RT-PCR reagent and contained Tetracore quantification standards and control sets. PCR was performed on a CFX96 Touch Real-Time PCR detection system (Bio-Rad) in a 96-well format using the recommended cycling parameters. PCR assay results were log 10 The PRRSV RNA copy number / 50 μl reaction volume is reported, which approximates the copy number / ml of serum. The area under the curve (AUC) for viremia over time was calculated using GraphPad Prism version 6.00 for Windows.
[0378] Measurement of PRRSV antibody Microsphere fluorescence immunoassay (FMIA) for the detection of antibodies against PRRSV nucleocapsid (N) protein was performed as previously described (Stephenson et al., 2015). Recombinant PRRSV N protein was conjugated to carboxylated Luminex MAGPLEX polystyrene microsphere beads according to the manufacturer's instructions. For FMIA, approximately 2500 antigen-coated beads suspended in 50 μL PBS (PBS-GS) containing 10% goat serum were placed in each well of a 96-well polystyrene round-bottom plate. The serum was diluted 1:400 in PBS-GS and 50 μL was added to each well. The plate was wrapped in foil and incubated at room temperature for 30 minutes with gentle shaking. The plate was placed on a magnet and the beads were washed three times with 190 μL of PBS-GS. For IgG detection, 50 μl of biotin-SP conjugate affinity purified goat anti-porcine secondary antibody (IgG, Jackson ImmunoResearch) was diluted to 2 μg / ml in PBS-GS, and 100 μl was added to each well. The plates were incubated at room temperature for 30 minutes, washed three times, and then 50 μl of streptavidin conjugate phycoerythrin (2 μg / ml in PBS-GS; SAPE) was added. After 30 minutes, the microspheres were washed, resuspended in 100 μl of PBS-GS, and analyzed using a MAGPIX instrument (LUMINEX) and LUMINEX xPONENT 4.2 software. Mean fluorescence intensity (MFI) was calculated using a minimum of 100 microsphere beads.
[0379] Measurement of haptoglobin (HP) The amount of Hp in serum was measured using a porcine-specific Hp ELISA kit (Genway Biotech Inc.), and the procedure was carried out according to the manufacturer's instructions. Serum samples were diluted 1:10,000 in 1X diluent solution, pipetted in double strips onto a pre-coated anti-porcine Hp 96-well ELISA plate, incubated at room temperature for 15 minutes, and then washed three times. Anti-Hp-HRP conjugate was added to each well and incubated in the dark at room temperature for 15 minutes. The plate was washed, and 100 μl of chromogenic substrate solution was added to each well. After incubation in the dark for 10 minutes, 100 μl of stop solution was added to each well. The plate was read at 450 nm on a Fluostar Omega filter-based microplate reader (BMG Labtech).
[0380] result Phenotypic characteristics of PAM derived from CD163 gene-modified pigs We gated mononuclear subpopulations of cells using the forward and lateral scattering properties of cells in lung lavage material. Representative CD169 and CD163 staining results for different genetic modifications shown in Figure 17 are presented in Figure 19. In the representative example presented in panel A of Figure 19, over 91% of PAMs from WT pigs were positive for both CD169 and CD163. Results for the 12 WT pigs used in this study showed a mean of 85+ / -8% double-positive cells. As shown in panel B of Figure 19, PAMs from CD163 KO pigs did not show evidence of CD163 but retained normal surface levels of CD169. CD163 polypeptides from d7(1467) and d7(1280) deletion genotypes were predicted to generate modified CD163 polypeptides immobilized on the PAM surface, but immunostaining results did not show surface expression of CD163 (see Figure 19, panel D). Since Mab 2A10 recognizes epitopes located in the first three SRCR domains, the absence of detection was not a result of a deletion of the immunoreactive epitope. The d7(129) genotype was predicted to have a 43-amino acid deletion in SRCR5 (see Figure 17). In the examples presented in panel C of Figure 19, only 2.4% of cells were in the double-positive quadrant. Analysis of PAMs from nine d7(129) pigs used in this study showed a percentage of double-positive cells ranging from 0% to 3.6% (mean = 0.9%). CD169 surface expression remained similar to that of WT PAMs. For the purposes of this study, all pigs with KO, d7(1467), d7(1280), and d7(129) genotypes were classified as having a CD163-null phenotype.
[0381] CD163 modification containing the hCD163L1 domain 8 peptide sequence HL11m is shown on PAM. + and CD169 +The study showed dual expression of CD169 (Panel E, Figure 19). However, in all HL11m pigs analyzed in this study, surface expression of CD163 was significantly reduced compared to WT PAM. CD163 levels were located on a contiguous spectrum, ranging from undetectable CD163 to moderate levels in some pigs. In the example shown in Panel E, Figure 19, approximately 60% of cells were in the double-positive quadrant, and 40% of cells stained for CD169 only. Analysis of PAM from a total of 24 HL11m pigs revealed that 38+ / -12% of PAM cells were positive for CD169 only, and 54+ / -14% were double-positive (CD169). + CD163 + It was shown that this was the case.
[0382] Circulating haptoglobin levels in WT and CD163-modified pigs As a capture molecule, CD163 is responsible for removing the HbHp complex from the blood (Fabriek, et al., 2005; Kristiansen et al., 2001; and Madsen et al., 2004). Serum Hp levels provide a convenient method for determining the overall functional characteristics of CD163-expressing macrophages. Hp levels in serum from WT, HL11m, and CD163-null pigs were measured at 3–4 weeks of age, immediately before PRRSV infection. Results presented in Figure 20 show that serum from WT pigs had the lowest Hb levels (mean A450 = 23 + / - 0.18, n = 10). The mean and standard deviation for each group were WT, 0.23+ / -0.18, n=10; HL11m, 1.63+ / -0.8, n=11; and 2.06+ / -0.57, n=9, the null group. The null group consisted of genotypes that did not express CD163 (CD163 null phenotype pigs). Hp measurements were performed on single ELISA plates. There were no significant differences among groups with the same letter (p>0.05, Kruskal-Wallis one-way ANOVA and Dunnett post-hoc test). The mean A450 values for WT pigs were significantly different from those of HL11m and CD163-null pigs (p<0.05). The mean A450 values were lower in the HL11m group compared to the CD163 null group (A450=1.6+ / -0.8 vs. 2.1+ / -0.6), but the difference was not statistically significant. Since the interaction between HbHp and CD163 occurs via SRCR3 (Madsen et al., 2004), the increased circulating Hp in HL11m pigs compared to WT pigs is unlikely to be a result of reduced affinity of CD163 for Hb / Hp, but CD163 + This resulted in a reduction in the number of macrophages, as well as a reduction in CD163 expression on the remaining macrophages (see panel E in Figure 19).
[0383] PAM infection by type 1 and type 2 viruses Tolerance of CD163-modified pigs to PRRSV was first evaluated by infecting PAM cells in vitro with a population of 6 type 1 and 9 type 2 PRRSV isolates (see Table 14 for a list of viruses). Viruses within the population represent different genotypes, as well as differences in nucleotide and peptide sequences, pathogenesis, and year of isolation. The data presented in Table 15 show results from experiments using PAMs from three pigs for each CD163 genotype group. The listed viruses correspond to the PRRSV isolates listed in Table 14. Results are presented as the mean + / - standard deviation of the percentage of infected PAMs. CD163 null PAMs were derived from pigs expressing the d7(129) allele (see Figures 17 and 19 for the CD163 gene construct and CD163 expression on PAMs, respectively). [Table 15]
[0384] As expected, WT PAMs were infected with all viruses. In contrast, CD163 null phenotype pigs were negative for infection with all viruses. Significant differences were observed in the response of PAMs derived from HL11m pigs. Type 1 viruses were unable to infect HL11m PAMs; on the other hand, all viruses in a group of type 2 viruses infected HL11m PAMs, albeit at a much lower percentage compared to WT PAMs.
[0385] Tolerance was also evaluated by comparing the viral titration endpoints between WT and HL11m PAM for the same type 2 virus. The results for two WT and two HL11m pigs are shown (Figure 21). 10 TCID 50 The values were calculated based on infection of macrophage cultures with the same viral sample. The infection results represent two different pigs from each genotype. The viruses used for infection are listed in Table 14. Log for PAM from HL11m pigs. 10 TCID 50The values were 1-3 log lower compared to WT PAM infected with the same virus. The only exception was infection with a modified live virus vaccine strain. In summary, the results suggest that PAM derived from HL11m pigs have reduced susceptibility or tolerance to infection with type 2 virus.
[0386] Infection by modified CD163 swine viruses type 1 and type 2 WT (circular), HL11m (square), and CD163 null (triangular) pigs were infected with representative type 1 (SD13-15) (Figure 22, Panel A, left graph) and type 2 (NVSL97-7895) (Figure 22, Panel A, right graph) viruses. Null phenotype pigs were derived from KO and d(1567) alleles (see Figure 17). Pigs from the three genotypes inoculated with the same virus were mixed in a single enclosure, allowing for continuous exposure of CD163-modified pigs to the virus excreted from WT individuals in the same enclosure. The number of pigs infected with representative type 1 virus was as follows: WT (n=4), HL11m (n=5), and null (n=3); and for type 2 virus, it was as follows: WT (n=4), HL11m (n=4), and null (n=3). As shown in Figure 22, CD163 null pigs infected with either type 1 or type 2 virus were negative for viremia at all time points and did not convert to antibodies. As expected, WT pigs were proliferatively infected and tested positive for both viruses 7 days post-infection. 6They had mean viremia levels that reached the template / 50 μl PCR reaction. By day 14, all WT pigs were seroconverted (see Figure 22, Panel B). Consistent with PAM infection results (Table 15), the five HL11m pigs infected with type 1 virus showed no evidence of viremia or PRRSV antibodies. All HL11m pigs infected with type 2 isolate, NVSL, supported infection and became seroconverted (Figure 22, Panel B). The presence of reduced tolerance in HL11m pigs was unclear. Mean viremia in three of the four HL11m pigs was similar to that of WT pigs. However, in one HL11m pig, #101 (white square in the right graph of Panel A, Figure 22), viremia was significantly reduced compared to other pigs in the HL11m genotype group. The explanation for the 3-4 log reduction in viremia in pig #101 remained unclear, but it suggested that some HL11m pigs may be less tolerant to PRRSV, supporting the in vitro PAM infection outcome (Table 15). Since all pigs were inoculated with the same amount of virus and kept mixed with WT pigs, the lower viremia in pig #101 was not a result of receiving a lower amount of virus or lower exposure to the virus. Flow cytometry of macrophages showed that CD163 expression in pig #101 was comparable to that of other HL11m pigs (data not shown). There were no differences in the exon 11 mimicry sequences.
[0387] Additional viral infection tests were performed using two viruses, NVSL97-7895 and KS06-72109. The results are shown in Figure 23. Pigs were followed for 35 days post-infection, and data were reported as area under the curve (AUC) for viremia measurements taken at 3, 7, 11, 14, 21, 28, and 35 days post-infection. As shown in Figure 23, for NVSL, the mean AUC for 7 WT pigs infected with NVSL was 168+ / -8, compared to 165+ / -15 for 7 HL11m pigs. For KS06, the mean AUC for 6 WT and 6 HL11m pigs was 156+ / -9 and 163+ / -13, respectively. There were no statistically significant differences between WT and HL11m pigs for both viruses (p>0.05). In summary, the results showed that HL11m pigs could not support infection with type 1 PRRSV but retained tolerance to infection with type 2 virus. Even if there was a reduction in PMRSV tolerance in PAM derived from HL11m pigs infected with type 2 isolates in vitro, this difference did not translate to the pigs. In the results shown in Figure 23, viral load was determined by calculating the area under the curve (AUC) for each pig over a 35-day infection period. AUC calculations were performed at 0, 4, 7, 10, 14, 21, 28, and 35 days post-infection. 10 The analysis was performed using PCR viremia testing. The horizontal line indicates the mean and standard deviation. Symbols: WT = wild-type pig, HL11 = HL11m genotype pig; Null = CD163 null genotype.
[0388] Essay CD163 is a macrophage surface protein that plays a crucial role in capturing excess Hb from the blood and regulating inflammation in response to tissue damage. It also functions as a viral receptor. CD163 is involved in both pro-inflammatory and anti-inflammatory responses (Van Gorp et al., 2010). CD163-positive macrophages are incorporated into selectively activated M2 macrophages (generally described as having high phagocytic and anti-inflammatory properties). M2 macrophages are involved in cleansing and repair after mechanical tissue damage or infection (Stein et al., 1992). In terms of anti-inflammatory capacity, CD163 expression is upregulated by anti-inflammatory proteins, such as IL-10 (Sulahian, et al., 2002). During inflammation, CD163 reduces inflammation by reducing oxidation through the removal of circulating heme from the blood. Heme degradation products, such as biliverdin, bilirubin, and nitric oxide, are potent anti-inflammatory molecules (Soares and Bach, 2009 and Jeney et al., 2002). In terms of pro-inflammatory capabilities, cross-linking of CD163 on the surface of macrophages by anti-CD163 antibodies or bacteria leads to the local release of inflammatory cytokines, such as IL-6, GM-CSF, TNFα, and IL-1β (Van den Heuvel et al., 1999 and Fabriek et al., 2009).
[0389] GM pigs lacking CD163 cannot support the replication of type 2 PRRSV isolates (Whitworth et al., 2016). In this study, in vitro infection tests demonstrated the resistance of CD163-null phenotypic macrophages to a broad population of type 1 and type 2 PRRSV isolates, and potentially extended this resistance to all PRRSV isolates (Table 15). The resistance of CD163-null phenotypic macrophages to type 1 and type 2 viruses was confirmed in vivo (Figures 22 and 23). Based on these results, the contribution of other PRRSV receptors previously described in the literature (Zhang and Yoo, 2015) can be ruled out. For example, Shanmukhappa et al. (2007) showed that non-tolerant BHK cells transfected with the CD151 plasmid acquired the ability to support PRRSV replication, and incubation with a polyclonal anti-CD151 antibody significantly reduced infection of MARC-145 cells. In addition, SJPL, a monkey cell line originally developed for use in propagating swine influenza virus, was previously shown to support PRRSV replication (Provost, et al., 2012). Key characteristics of the SJPL cell line included the presence of CD151 and the absence of sialoadhesin and CD163. Taken together, these data provided strong evidence that the presence of CD151 alone is sufficient to support PRRSV replication. Results from this study showing macrophages with a CD163 null phenotype and the absence of PRRSV infection in pigs indicate that CD151 as another receptor for PRRSV is not biologically relevant.
[0390] Viral proteins GP2a and GP4 (which form part of the GP2a, GP3, GP4 heterotrimer complex on the PRRSV surface) can be co-precipitated with CD163 from plasmid-transfected cells in a pull-down assay (Das, et al., 2009). Presumably, GP2 and GP4 interact with one or more CD163 SRCR domains. An in vitro infectivity assay incorporating a porcine CD163 cDNA backbone, including a domain swap between porcine SRCR5 and homologs derived from hCD163-L1 SRCR8, further localized the region used by type 1 virus to SRCR5 (Van Gorp, et al., 2010). It is intriguing to hypothesize that the stable interaction between GP2 / GP4 and CD163 occurs via SRCR5. Additional viral glycoproteins, e.g., GP3 and GP5, may further stabilize the virus-receptor complex or function as co-receptor molecules. The requirement for SRCR5 was investigated in this study by infecting macrophages and pigs with the HL11m allele (reconstructed with a CD163L1 SRCR8 domain swap by creating a 33bp substitution in porcine exon 7). The HL11m allele also contained a neomycin cassette for the selection of cells positive for the genetic modification (Figure 17). Although at reduced levels compared to WT PAM, HL11m pigs expressed CD163 on PAM (Figure 19, compare panels A and E). The reduced expression was likely due to the presence of the neomycin cassette, which was located between the exon 11 mimite and the subsequent intron. HL11m pigs were not tolerant to infection with type 1 virus, confirming the importance of SRCR5. However, HL11m macrophages and HL11m pigs did not support infection with type 2 virus. Based on viral titration and percentage infection results, PAMs derived from HL11m pigs showed an overall decrease in viral tolerance compared to WT macrophages (Table 15 and Figure 17).The reduced tolerance may be due to a decrease in the level of CD163 on HL11m macrophages, along with a decrease in the virus's affinity for the modified CD163 protein. Assuming that type 2 virus requires SRCR5 and L1 SRCR8 can function as a suitable substitution, the lower affinity may be explained by the difference in peptide sequences between human SRCR8 and porcine SRCR5 (see Figure 18, Panel B). However, the reduced tolerance of PAM did not transfer to pigs. The mean viremia in HL11m pigs was not significantly different from that in wild-type pigs (Figure 23). In addition to PAM, PRRSV infection of intravascular, septal, and lymphoid tissue macrophages contributes to viremia (Lawson et al., 1997 and Morgan et al., 2014). The potential contribution of these and other CD163-positive cell populations in maintaining overall viral load in HL11m pigs is worth further investigation.
[0391] Even though the CD163 plasmid with SRCR domain deletion was stably expressed in HEK cells (Van Gorp et al., 2010), the deletions of exons 7 and 8 in d7(1467) and d7(1280) resulted in the absence of detectable surface expression of CD163 (Figure 19, Panel D). Since the 2A10 mAB used for flow cytometry recognizes three N-terminal SRCR domains (Van Gorp et al., 2010), and possibly domains 7 and 8 (Sanchez, et al., 1999), the lack of detection was not due to the removal of the 2A10 epitope in the mutant protein. Small amounts of CD163 expression were detectable on some d7(129) pig-derived PAM (see Figure 19, Panel C), but the amount of expressed protein was not sufficient to support PRRSV infection in PAM or pigs. The absence of CD163 expression in exon 7 and 8 deletion mutants is not fully understood, but it is likely a result of mRNA and / or protein degradation.
[0392] In 2003, CD163 was identified as a receptor for African swine cholera virus (ASFV; Sanchez-Torres et al., 2003). This conclusion was based on observations that infected macrophages have a mature CD163-positive phenotype, and that anti-CD163 antibodies, such as 2A10, block ASFV infection of macrophages in vitro. It has not been determined whether CD163-positive swine swine are resistant to ASFV infection.
[0393] Cell culture models incorporating modifications to the PRRSV receptor provided valuable insights into the mechanisms of PRRSV entry, replication, and pathogenesis. One unique aspect of this study was the implementation of parallel in vivo experiments using receptor-modified pigs. This research has significant implications for the potential to develop preventive therapies against one of the most serious diseases constantly faced by the global pig industry.
[0394] The examples disclosed herein are provided for illustrative purposes only and are not intended to limit the scope of the invention.
[0395] Considering the above, it will be clear that several objectives of the invention are achieved and other advantageous results can be obtained.
[0396] Since various modifications are possible in the above products and methods without departing from the scope of the invention, it is intended that all matters included in the above description and shown in the accompanying drawings [or drawings] be construed as merely illustrative and not limiting. References Allende R, et al., 1999. North American and European porcine reproductive and respiratory syndrome viruses differ in non-structural protein coding regions. J. Gen. Virol. 80: 307-315. Bauer BK, et al., Arginine supplementation in vitro increases porcine embryo development and affects mRNA transcript expression. Reprod Fertil Dev 2011; 23:107. Beaton BP, et al., Compound transgenics: recombinase- mediated gene stacking. In: Pinkert CA (ed.). Transgenic Animal Technology: A Laboratory Handbook, 3rd ed. Waltham, MA: Elsevier; 2014:565-578. Benfield DA, et al., 1992. Characterization of swine infertility and respiratory syndrome (SIRS) virus (Isolate ATCC VR-2332). J Vet Diag Invest 4:127-133. Boddicker, et al., 2014. Genome-wide association and genomic prediction for host response to porcine reproductive and respiratory syndrome virus infection. Genetics, selection, evolution : GSE 46, 18. Borg NA, et al., CD1d-lipid- antigen recognition by the semi-invariant NKT T-cell receptor. Nature 2007; 448:44-49. Brinster RL, et al., Factors affecting the efficiency of introducing foreign DNA into mice by microinjecting eggs. Proc Natl Acad Sci U S A 1985; 82:4438-4442. Calvert JG, et al., 2007. CD163 expression confers susceptibility to porcine reproductive and respiratory syndrome viruses. J Virol. 81:7371-7379. Carter DB, et al., Phenotyping of transgenic cloned piglets. Cloning Stem Cells 2002; 4:131-145. Cong L, et al., Multiplex genome engineering using CRISPR / Cas systems. Science 2013; 339:819-823. Dai Y, et al., Targeted disruption of the alpha1,3-galactosyltransferase gene in cloned pigs. Nat Biotechnol 2002; 20:251-255. Das PB, et al., 2009. The minor envelope glycoproteins GP2a and GP4 of porcine reproductive and respiratory syndrome virus interact with the receptor CD163. J Virol. 84:1731-40. Delputte PL, et al., 2002. Involvement of the matrix protein in attachment of porcine reproductive and respiratory syndrome virus to a heparin-like receptor on porcine alveolar macrophages. J Virol. 76:4312-4320. Etzerodt, A., et al., 2013. Plasma clearance of hemoglobin and haptoglobin in mice and effect of CD163 gene targeting disruption. Antioxidants & redox signaling 18, 2254-2263. Etzerodt, A., et al., 2013. CD163 and inflammation: biological, diagnostic, and therapeutic aspects. Antioxidants & redox signaling 18, 2352-2363. Fabriek BO, et al., 2005. The macrophage scavenger receptor CD163. Immunobiology. 210:153-160. Fabriek BO, et al., 2009. The macrophage scavenger receptor CD163 functions as an innate immune sensor for bacteria. Blood. 113:887-892. Gaj T, et al., ZFN, TALEN, and CRISPR / Cas- based methods for genome engineering. Trends Biotechnol 2013; 31: 397-405. Gaudreault N, et al., 2009. Factors affecting the permissiveness of porcine alveolar macrophages for porcine reproductive and respiratory syndrome virus. Archiv Virol. 154:133-136. Graversen, J.H., et al., 2012. Targeting the hemoglobin scavenger receptor CD163 in macrophages highly increases the anti-inflammatory potency of dexamethasone. Molecular therapy : the journal of the American Society of Gene Therapy 20, 1550-1558. Groenen, M.A., et al., 2012. Analyses of pig genomes provide insight into porcine demography and evolution. Nature 491, 393-398. Hai T, et al., One-step generation of knockout pigs by zygote injection of CRISPR / Cas system. Cell Res 2014; 24: 372-375. Halbur, P.G., et al., 1995. Comparison of the pathogenicity of two US porcine reproductive and respiratory syndrome virus isolates with that of the Lelystad virus. Veterinary pathology 32, 648-660. Hammer RE, et al., Production of transgenic rabbits, sheep and pigs by microinjection. Nature 1985; 315:680-683. Hauschild J, et al., Efficient generation of a biallelic knockout in pigs using zinc-finger nucleases. Proc Natl Acad Sci U S A 2011; 108:12013-12017. Holtkamp, D.J., et al., 2013. Assessment of the economic impact of porcine reprodutive and respiratory syndrome virus on United States pork producers. Journal of Swine Health and Production 21, 72-84. Hwang WY, et al., Efficient genome editing in zebrafish using a knockout pigs via zinc-finger nucleases and nuclear transfer cloning. Cell Res 2011; 21:979-982. Hwang WY, et al., Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol 2013; 31:227-229. Jeney V, et al., 2002. Pro-oxidant and cytotoxic effects of circulating heme. Blood. 100:879-887. Keffaber, K.K., 1989. Reproductive failure of unknown etiology. American Association of Swine Practitioners Newsletter 1, 1-10. Kim, H.S., et al.,1993. Enhanced replication of porcine reproductive and respiratory syndrome (PRRS) virus in a homogeneous subpopulation of MA-104 cell line. Arch Virol 133, 477-483. Kristiansen M, et al., 2001. Identification of the haemoglobin scavenger receptor. Nature. 409:198-201. Kwon DN, et al., Production of biallelic CMP-Neu5Ac hydroxylase knock-out pigs. Sci Rep 2013; 3:1981. Ladinig, A., et al., 2015. Pathogenicity of three type 2 porcine reproductive and respiratory syndrome virus strains in experimentally inoculated pregnant gilts. Virus Res 203, 24-35. Lai L, et al., Production of alpha-1,3-galactosyltransferase knockout pigs by nuclear transfer cloning. Science 2002; 295:1089-1092. Lai L, et al., Creating genetically modified pigs by using nuclear transfer. Reprod Biol Endocrinol 2003; 1:82. Lai L, et al., Production of cloned pigs by using somatic cells as donors. Cloning Stem Cells 2003; 5:233-241. Lawson SR, et al.,1997. Porcine reproductive and respiratory syndrome virus infection of gnotobiotic pigs: sites of virus replication and co-localization with MAC-387 staining at 21 days post-infection. Virus Res. 51:105-113. Lee K, et al., Engraftment of human iPS cells and allogeneic porcine cells into pigs with inactivated RAG2 and accompanying severe combined immunodeficiency. Proc Natl Acad Sci U S A 2014; 111:7260-7265. Lee K, et al., Piglets produced from cloned blastocysts cultured in vitro with GM-CSF. Mol Reprod Dev 2013; 80: 145-154. Li D, et al., Heritable gene targeting in the mouse and rat using a CRISPR-Cas system. Nat Biotechnol 2013; 31:681-683. Lillico SG, et al., Live pigs produced from genome edited zygotes. Sci Rep 2013; 3:2847. Machaty Z, et al., Complete activation of porcine oocytes induced by the sulfhydryl reagent, thimerosal. Biol Reprod 1997; 57:1123-1127. Madsen M, et al., 2004. Molecular characterization of the haptoglobin-hemoglobin receptor CD163. Ligand binding properties of the scavenger receptor cysteine-rich domain region. J Biol Chem. 279:51561-51567. Merck, The Merck Veterinary Manual. http: / / www.merckmanuals.com / vet / appendixes / reference_guides / normal_rectal_temperature_ranges.html. Miao, Y.L., et al., 2009. Centrosome abnormalities during porcine oocyte aging. Environmental and molecular mutagenesis 50, 666-671. Morgan SB, et al., 2014. Pathology and Virus Distribution in the Lung and Lymphoid Tissues of Pigs Experimentally Inoculated with Three Distinct Type 1 PRRS Virus Isolates of Varying Pathogenicity. Transbound Emerg Dis. Nov 10. pp 1-11. Nelsen CJ, et al., 1999. Porcine reproductive and respiratory syndrome virus comparison: divergent evolution on two continents. J. Virol. 73, 270-280. Neumann EJ, et al., Assessment of the economic impact of porcine reproductive and respiratory syndrome on swine production in the United States. J Am Vet Med Assoc 2005; 227:385-392. Niu Y, et al., Generation of gene-modified Cynomolgus monkey via Cas9 / RNA-mediated gene targeting in one-cell embryos. Cell 2014; 156:836-843. Patience, J.F., et al.,1989. Swine Nutrition Guide, in: Center, P.S. (Ed.), University of Saskatchewan, Saskatoon, CA, pp. 149-171. Patton JP, et al., 2008. Modulation of CD163 receptor expression and replication of porcine reproductive and respiratory syndrome virus in porcine macrophages. Virus Res. 140: 161-171. Prather RS, et al., An intact sialoadhesin (Sn / SIGLEC1 / CD169) is not required for attachment / internalization of the porcine reproductive and respiratory syndrome virus. J Virol 2013; 87:9538-9546. Prather, R.S., et al., 2013. An intact sialoadhesin (Sn / SIGLEC1 / CD169) is not required for attachment / internalization of the porcine reproductive and respiratory syndrome virus. J Virol 87, 9538-9546. Provost C, et al., 2012. Identification of a new cell line permissive to porcine reproductive and respiratory syndrome virus infection and replication which is phenotypically distinct from MARC-145 cell line. Virol J. 9:267. Reed JL, et al., 1938. A simple method of estimating fifty percent endpoints. The American Journal of Hygiene 27:493-497. Ross JW, et al., Optimization of square-wave electroporation for transfection of porcine fetal fibroblasts. Transgenic Res 2010; 19:611-620. Rowland, R.R., et al., 2012. Control of porcine reproductive and respiratory syndrome (PRRS) through genetic improvements in disease resistance and tolerance. Frontiers in genetics 3, 260. Sanchez C, et al., 1999. The porcine 2A10 antigen is homologous to human CD163 and related to macrophage differentiation. Journal of Immunology 162:5230-5237. Sanchez-Torres C, et al., 2003. Expression of porcine CD163 on monocytes / macrophages correlates with permissiveness to African swine fever infection. Arch Virol. 148:2307-2323. Schaer, C.A., et al., 2006a. Constitutive endocytosis of CD163 mediates hemoglobin-heme uptake and determines the noninflammatory and protective transcriptional response of macrophages to hemoglobin. Circulation research 99, 943-950. Schaer, D.J., et al., 2006b. CD163 is the macrophage scavenger receptor for native and chemically modified hemoglobins in the absence of haptoglobin. Blood 107, 373-380. Schaer, D.J., et al., 2006c. Hemophagocytic macrophages constitute a major compartment of heme oxygenase expression in sepsis. European journal of haematology 77, 432-436. Shanmukhappa, K, et al., 2007. Role of CD151, A tetraspanin, in porcine reproductive and respiratory syndrome virus infection. Virol J. 4:62. Shimozawa N, et al., Abnormalities in cloned mice are not transmitted to the progeny. Genesis 2002; 34:203-207. Smit, AFA, et al., RepeatMasker Open-3.0. 1996-2010. Current Version: open-4.0.5 (RMLib: 20140131 and Dfam: 1.2). http: / / www.repeatmasker.org>. CD163: accessed July 25, 2014; CD1D: accessed August 27, 2013. Soares MP, et al., 2009. Heme oxygenase-1: from biology to therapeutic potential. Trends Mol Med. 15:50-58. Stein M, et al.,1992. Interleukin 4 potently enhances murine macrophage mannose receptor activity: a marker of alternative immunologic macrophage activation. J Exp Med. 176:287-292. Stephenson R, et al., 2015. Multiplex serology for common viral infections in feral pigs in Hawaii between 2007 and 2010. Accepted for publication. J Wildlife Dis 51:239-2343. Sulahian TH1, et al., 2002. 2002. Human monocytes express CD163, which is upregulated by IL-10 and identical to p155. Cytokine. 2000 12:1312-1321. Terns MP, et al., CRISPR-based adaptive immune systems. Curr Opin Microbiol 2011; 14:321-327. Trible, B.R., et al., 2012. Recognition of the different structural forms of the capsid protein determines the outcome following infection with porcine circovirus type 2. J Virol 86, 13508-13514. U.S. Department of Agriculture and U.S. Department of Health and Human Services. Dietary Guidelines for Americans, 2010. 7th Edition, Van Breedam W, et al., Porcine reproductive and respiratory syndrome virus entry into the porcine macrophage. J Gen Virol 2010; 91:1659-1667. Van Breedam, W., et al., 2010. Porcine reproductive and respiratory syndrome virus entry into the porcine macrophage. J Gen Virol 91, 1659-1667. Van den Heuvel MM, et al., 1999. Regulation of CD 163 on human macrophages: cross-linking of CD163 induces signaling and activation. J Leukoc Biol. 66:858-866. van den Hoff MJ, et al., Electroporation in ‘intracellular’ buffer increases cell survival. Nucleic Acids Res 1992; 20:2902. Van Gorp, H., et al., 2010. Scavenger receptor CD163, a Jack-of-all-trades and potential target for cell-directed therapy. Mol Immunol 47, 1650-1660. Van Gorp H, et al., 2010. Identification of the CD163 protein domains involved in infection of the porcine reproductive and respiratory syndrome virus. J Virol. 84:3101-3105. Walters EM, et al., Advancing swine models for human health and diseases. Mo Med 2013; 110:212-215. Wang H, et al., One-step generation of mice carrying mutations in multiple genes by CRISPR / Cas-mediated genome engineering. Cell 2013; 153: 910-918. Welch SK, et al., 2010. A brief review of CD163 and its role in PRRSV infection. Virus Res. 154:98-103. Wells, K.D., et al., 2014. Use of the CRISPR / Cas9 system to produce genetically engineered pigs from in vitro-derived oocytes and embryos. Biol Reprod 91, 78. Wensvoort, G., et al., 1991. Mystery swine disease in The Netherlands: the isolation of Lelystad virus. Veterinary Quarterly 13, 121-130. Whitworth KM, et al., 2016. CD163 facilitates both entry and replication of porcine reproductive and respiratory syndrome virus. Nature Biotech. 34:20-22. Whitworth KM, et al., Method of oocyte activation affects cloning efficiency in pigs. Mol Reprod Dev 2009;76:490-500. Whitworth KM, et al., Activation method does not alter abnormal placental gene expression and development in cloned pigs. Mol Reprod Dev 2010; 77:1016-1030. Whitworth KM, et al., Scriptaid corrects gene expression of a few aberrantly reprogrammed transcripts in nuclear transfer pig blastocyst stage embryos. Cell Reprogram 2011; 13:191-204. Whitworth, K.M., et al., 2014. Use of the CRISPR / Cas9 system to produce genetically engineered pigs from in vitro-derived oocytes and embryos. Biol Reprod 91, 78. Whyte JJ, et al., Genetic modifications of pigs for medicine and agriculture. Mol Reprod Dev 2011; 78:879-891. Whyte JJ, et al., Gene targeting with zinc finger nucleases to produce cloned eGFP knockout pigs. Mol Reprod Dev 2011; 78:2. Wiedenheft B, et al., RNA-guided genetic silencing systems in bacteria and archaea. Nature 2012; 482:331-338. Winckler, C., et al., 2001. The reliability and repeatability of a lameness scoring system for use as an indicator of welfare in dairy cattle. Acta Agricultura Scandinavica Section A. Animal Science, 103-107. Yang D, et al., Generation of PPARgamma mono-allelic knockout pigs via zinc-finger nucleases and nuclear transfer cloning. Cell Res 2011; 21:979-982. Yoshioka K, et al., Birth of piglets derived from porcine zygotes cultured in a chemically defined medium. Biol Reprod 2002; 66:112-119. Zhang Q, et al., 2015. PRRS virus receptors and their role for pathogenesis. Vet Microbiol. 177:229-241. Zhao J, et al., Histone deacetylase inhibitors improve in vitro and in vivo developmental competence of somatic cell nuclear transfer porcine embryos. Cell Reprogram 2010; 12:75-83. Zhao J, et al., Significant improvement in cloning efficiency of an inbred miniature pig by histone deacetylase inhibitor treatment after somatic cell nuclear transfer. Biol Reprod 2009; 81:525-530.
Table 16
Claims
1. A non-human animal or its offspring or animal cell containing at least one modified chromosome sequence in the gene encoding the CD163 protein.
2. The modification reduces the susceptibility of the animal, offspring, or cell to infection by a pathogen compared to
3. The pathogen comprises a virus, the animal, offspring, or cell according to claim 2.
4. The animal, offspring, or cell according to claim 3, wherein the virus comprises porcine reproductive and respiratory syndrome virus (PRRSV).
5. The modification reduces the susceptibility of the animal, offspring, or cell to type 1 PRRSV virus, type 2 PRRSV virus, or both type 1 and type 2 PRRSV viruses, according to claim 4.
6. The modification reduces the sensitivity of the animal, offspring, or cell to a PRRSV isolate selected from the group consisting of NVSL97-7895, KS06-72109, P129, VR2332, CO90, AZ25, MLV-ResPRRS, KS62-06274, KS483 (SD23983), CO84, SD13-15, Lelystad, 03-1059, 03-1060, SD01-08, 4353PZ, and combinations thereof, according to claim 5.
7. The animal, offspring, or cell according to any one of claims 1 to 6, wherein the animal or offspring is an embryo, juvenile, or adult, or the cell comprises an embryonic cell, a cell derived from a juvenile animal, or a cell derived from an adult animal.
8. The animal, offspring, or cell according to any one of claims 1 to 7, wherein the animal or offspring includes a domesticated animal, or the cell includes a cell derived from a domesticated animal.
9. The animal, offspring, or cell according to claim 8, wherein the aforementioned animal being raised includes domesticated animals.
10. The animal, offspring, or cell according to claim 9, wherein the livestock animal is selected from the group consisting of pigs, cattle, sheep, goats, horses, buffalo, camels, or birds.
11. The bovine animal includes beef cattle or dairy cattle, the animal, offspring, or cell according to claim 10.
12. The animal, offspring, or cell according to claim 10, wherein the aforementioned avian animal includes a chicken, a turkey, a duck, a goose, a guinea fowl, or a chick.
13. The aforementioned equine animal includes a horse or a donkey, the animal, offspring, or cell according to claim 10.
14. The animal, offspring, or cell according to claim 10, wherein the livestock animal is a cattle or a pig.
15. The animal, offspring, or cell according to claim 14, wherein the livestock animal is a pig.
16. The animal, offspring, or cell according to any one of claims 1 to 15, wherein the animal or offspring includes a genetically edited animal or offspring, and the cell includes a genetically edited cell.
17. The animal, offspring, or cell according to claim 16, wherein the animal or cell is genetically edited using a homing endonuclease.
18. The homing endonuclease comprises a designed homing endonuclease, as described in claim 17, the animal, offspring, or cell.
19. The homing endonuclease comprises a clustered and regularly arranged short palindromic sequence repeat (CRISPR) / Cas9 system, a transcription activator-like effector nuclease (TALEN), a zinc finger nuclease (ZFN), a recombinase fusion protein, a meganuclease, or a combination thereof, according to claim 17 or 18, an animal, offspring, or cell.
20. The animal, offspring, or cell according to any one of claims 16 to 19, wherein the animal or cell has been genetically edited using the CRISPR / Cas9 system.
21. The animal, offspring, or cell according to any one of claims 16 to 20, wherein the edited animal, offspring, or cell exhibits increased resistance to PRRSV compared to the unedited animal.
22. The animal, offspring, or cell according to any one of claims 1 to 21, wherein the animal, offspring, or cell is heterozygous with respect to the modified chromosome sequence.
23. The animal, offspring, or cell according to any one of claims 1 to 21, wherein the animal, offspring, or cell is homozygous with respect to the modified chromosome sequence.
24. The modified chromosome sequence comprises an insertion in the gene encoding the CD163 protein, a deletion in the gene encoding the CD163 protein, or a combination thereof, as described in any one of claims 1 to 23, the animal, offspring, or cell.
25. The animal, offspring, or cell according to claim 24, wherein the modified chromosome sequence includes a deletion in the gene encoding the CD163 protein.
26. The animal, offspring, or cell according to claim 24 or 25, wherein the deletion includes an in-frame deletion.
27. The animal, offspring, or cell according to any one of claims 24 to 26, wherein the modified chromosome sequence includes an insertion in the gene encoding the CD163 protein.
28. The modified chromosome sequence causes a reduction in CD163 protein production or activity compared to that in animals, offspring, or cells lacking the modified chromosome sequence, according to any one of claims 1 to 27, the animal, offspring, or cell.
29. The animal, offspring, or cell according to any one of claims 1 to 28, wherein the modified chromosome sequence results in the production of a substantially non-functional CD163 protein by the animal, offspring, or cell.
30. The porcine animal, offspring, or cell according to any one of claims 15 to 29, wherein the modified chromosome sequence includes modifications in exon 7 of the gene encoding the CD163 protein, exon 8 of the gene encoding the CD163 protein, an intron adjacent to exon 7 or exon 8 of the gene encoding the CD163 protein, or a combination thereof.
31. The porcine animal, offspring, or cell according to claim 30, wherein the modified chromosome sequence includes a modification in exon 7 of the gene encoding the CD163 protein.
32. The porcine animal, offspring, or cell according to claim 31, wherein the modification in exon 7 of the gene encoding the CD163 protein includes a deletion.
33. The porcine animal, offspring, or cell according to claim 32, wherein the deletion includes an in-frame deletion in exon 7.
34. The porcine animal, offspring, or cell according to any one of claims 31 to 33, wherein the modification in exon 7 of the gene encoding the CD163 protein includes an insertion.
35. The aforementioned modified chromosome sequence is (a) SEQ ID NO: 118; or (b) Modifications selected from the group consisting of the following: Compared to the reference sequence SEQ ID NO: 47, there is a deletion of 11 base pairs from nucleotide 3,137 to nucleotide 3,147; Compared to the reference sequence SEQ ID NO: 47, there is a two-base pair insertion between nucleotides 3,149 and 3,150, and on the same allele, compared to the reference sequence SEQ ID NO: 47, there is a 377-base pair deletion from nucleotide 2,573 to nucleotide 2,949; Compared to the reference sequence SEQ ID NO: 47, there is a 124-base pair deletion from nucleotide 3,024 to nucleotide 3,147; Compared to the reference sequence SEQ ID NO: 47, there is a 123-base pair deletion from nucleotide 3,024 to nucleotide 3,146; Compared to the reference sequence SEQ ID NO: 47, a single base pair insertion occurred between nucleotides 3,147 and 3,148; Compared to the reference sequence SEQ ID NO: 47, there is a deletion of 130 base pairs from nucleotide 3,030 to nucleotide 3,159; Compared to the reference sequence SEQ ID NO: 47, there is a 132-base pair deletion from nucleotide 3,030 to nucleotide 3,161; Compared to the reference sequence SEQ ID NO: 47, there is a deletion of 1506 base pairs from nucleotide 1,525 to nucleotide 3,030; Compared to the reference sequence SEQ ID NO: 47, a 7-base pair insertion occurred between nucleotides 3,148 and 3,149; Compared to the reference sequence SEQ ID NO: 47, there is a deletion of 1280 base pairs from nucleotide 2,818 to nucleotide 4,097; Compared to the reference sequence SEQ ID NO: 47, there is a deletion of 1373 base pairs from nucleotide 2,724 to nucleotide 4,096; Compared to the reference sequence SEQ ID NO: 47, there is a deletion of 1467 base pairs from nucleotide 2,431 to nucleotide 3,897; Compared to the reference sequence SEQ ID NO: 47, the deletion comprises 1930 base pairs from nucleotide 488 to nucleotide 2,417, the deleted sequence being replaced by a 12-base-pair insertion beginning at nucleotide 488, and a further 129 base-pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172, compared to the reference sequence SEQ ID NO: 47; Compared to the reference sequence SEQ ID NO: 47, there is a 28-base pair deletion from nucleotide 3,145 to nucleotide 3,172; Compared to the reference sequence SEQ ID NO: 47, there is a deletion of 1387 base pairs from nucleotide 3,145 to nucleotide 4,531; Compared to the reference sequence SEQ ID NO: 47, there is a deletion of 1382 base pairs from nucleotide 3,113 to nucleotide 4,494, wherein the deleted sequence is replaced by an 11-base pair insertion beginning at nucleotide 3,113; Compared to the reference sequence SEQ ID NO: 47, there is a deletion of 1720 base pairs from nucleotide 2,440 to nucleotide 4,160; Compared to the reference sequence SEQ ID NO: 47, there is a 452-base pair deletion from nucleotide 3,015 to nucleotide 3,466; and their combinations, A porcine animal, offspring, or cell according to any one of claims 30 to 34, including the porcine animal, offspring, or cell according to any one of claims 30 to 34.
36. The porcine animal, offspring, or cell according to claim 35, wherein, compared to the reference sequence SEQ ID NO: 47, the two-base pair insertion between nucleotides 3,149 and 3,150 includes the insertion of dinucleotide AG.
37. The porcine animal, offspring, or cell according to claim 35, wherein, compared to the reference sequence SEQ ID NO: 47, the one-base pair insertion between nucleotides 3,147 and 3,148 comprises the insertion of a single adenine residue.
38. The porcine animal, offspring, or cell according to claim 35, wherein, compared to the reference sequence SEQ ID NO: 47, the seven-base pair insertion between nucleotides 3,148 and 3,149 comprises the sequence TACTACT (SEQ ID NO: 115).
39. The porcine animal, offspring, or cell according to claim 35, wherein the animal, offspring, or cell contains the 1,930 base pair deletions from nucleotide 488 to nucleotide 2,417 compared to the reference sequence SEQ ID NO: 47, wherein the deleted sequence is replaced by a 12 base pair insertion beginning at nucleotide 488, and there is a further 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 compared to the reference sequence SEQ ID NO: 47, wherein the 12 base pair insertion comprises the sequence TGTGGAGAATTC (SEQ ID NO: 116).
40. The porcine animal, offspring, or cell according to claim 35, wherein the animal, offspring, or cell contains the 1382 base pair deletions from nucleotide 3,113 to nucleotide 4,494 compared to the reference sequence SEQ ID NO: 47, the deleted sequence is replaced by an 11-base pair insertion beginning at nucleotide 3,113, the 11-base pair insertion comprising the sequence AGCCAGCGTGC (SEQ ID NO: 117).
41. The aforementioned deletion is, Compared to the reference sequence SEQ ID NO: 47, the aforementioned 1,506 base pair deletions are present from nucleotide 1,525 to nucleotide 3,030; Compared to the reference sequence SEQ ID NO: 47, the deletion comprises the aforementioned 1930 base pairs from nucleotide 488 to nucleotide 2,417, wherein the deleted sequence is replaced by a 12 base pair insertion beginning at nucleotide 488, and also includes a further 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172, compared to the reference sequence SEQ ID NO: 47; Compared to the reference sequence SEQ ID NO: 47, the aforementioned 1373 base pair deletions are present from nucleotide 2,724 to nucleotide 4,096; Compared to the reference sequence SEQ ID NO: 47, the aforementioned 123 base pair deletions from nucleotide 3,024 to nucleotide 3,146; Compared to the reference sequence SEQ ID NO: 47, the aforementioned 1467 base pair deletions are found from nucleotide 2,431 to nucleotide 3,897; Compared to the reference sequence SEQ ID NO: 47, the aforementioned 1387 base pair deletions are found from nucleotide 3,145 to nucleotide 4,531; Compared to the reference sequence SEQ ID NO: 47, the deletion comprises 1382 base pairs from nucleotide 3,113 to nucleotide 4,494, wherein the deleted sequence is replaced by an 11-base pair insertion beginning at nucleotide 3,113; Compared to the reference sequence SEQ ID NO: 47, the aforementioned 1720 base pair deletions are present from nucleotide 2,440 to nucleotide 4,160; and their combinations, The porcine animal, offspring, or cell according to claim 35, comprising an in-frame deletion in exon 7, selected from the group consisting of the following.
42. The aforementioned insertion or deletion is Compared to the reference sequence SEQ ID NO: 47, the aforementioned two-base pair insertion between nucleotides 3,149 and 3,150, and the aforementioned 377-base pair deletion between nucleotides 2,573 and 2,949 in the same allele, compared to the reference sequence SEQ ID NO: 47; Compared to the reference sequence SEQ ID NO: 47, the aforementioned 28 base pair deletions are present from nucleotide 3,145 to nucleotide 3,172; Compared to the reference sequence SEQ ID NO: 47, the aforementioned 452 base pair deletions are present from nucleotide 3,015 to nucleotide 3,466; and their combinations A porcine animal, offspring, or cell according to claim 35 or 36, selected from the group consisting of the following.
43. The porcine animal, offspring, or cell according to claim 42, wherein the animal, offspring, or cell comprises the two-base-pair insertion between nucleotides 3,149 and 3,150, and the 377-base-pair deletion between nucleotides 2,573 and 2,949, in the same allele, compared to the reference sequence SEQ ID NO:
47.
44. The porcine animal, offspring, or cell according to claim 42, wherein the animal, offspring, or cell contains the 28 base pair deletions from nucleotide 3,145 to nucleotide 3,172 compared to the reference sequence SEQ ID NO:
47.
45. The porcine animal, offspring, or cell according to claim 42, wherein the animal, offspring, or cell contains the 452 base pair deletions from nucleotide 3,015 to nucleotide 3,466 compared to the reference sequence SEQ ID NO:
47.
46. The aforementioned animal, offspring, or cell, In one allele of the gene encoding the CD163 protein, the seven-base pair insertion between nucleotide 3,148 and nucleotide 3,149 compared to the reference sequence SEQ ID NO: 47; and In other alleles of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO: 47, the 11 base pair deletions from nucleotide 3,137 to nucleotide 3,147 A porcine animal, offspring, or cell according to claim 35 or 38, comprising:
47. The aforementioned animal, offspring, or cell, In one allele of the gene encoding the CD163 protein, the seven-base pair insertion between nucleotide 3,148 and nucleotide 3,149 compared to the reference sequence SEQ ID NO: 47; and In another allele of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO: 47, there is a 1382 base pair deletion from nucleotide 3,113 to nucleotide 4,494, wherein the deleted sequence is replaced by an 11-base pair insertion beginning at nucleotide 3,113. A porcine animal, offspring, or cell according to any one of claims 35, 38, 40, and 41, comprising:
48. The aforementioned animal, offspring, or cell, In one allele of the gene encoding the CD163 protein, SEQ ID NO: 118; and In other alleles of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO: 47, the 11 base pair deletions from nucleotide 3,137 to nucleotide 3,147 The porcine animal, offspring, or cell according to claim 35, including the above.
49. The aforementioned animal, offspring, or cell, In one allele of the gene encoding the CD163 protein, SEQ ID NO: 118; and In other alleles of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO: 47, the aforementioned two-base pair insertion between nucleotides 3,149 and 3,150, and compared to the reference sequence SEQ ID NO: 47, the aforementioned 377-base pair deletion from nucleotide 2,573 to nucleotide 2,949. A porcine animal, offspring, or cell according to any one of claims 35, 36, 42, and 43, including the following:
50. The aforementioned animal, offspring, or cell, In one allele of the gene encoding the CD163 protein, the 1280 base pair deletions from nucleotide 2,818 to nucleotide 4,097 compared to the reference sequence SEQ ID NO: 47; and In other alleles of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO: 47, the 11 base pair deletions from nucleotide 3,137 to nucleotide 3,147 The porcine animal, offspring, or cell according to claim 35, including the above.
51. The aforementioned animal, offspring, or cell, In one allele of the gene encoding the CD163 protein, the 1280 base pair deletions from nucleotide 2,818 to nucleotide 4,097 compared to the reference sequence SEQ ID NO: 47; and In other alleles of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO: 47, the aforementioned two-base pair insertion between nucleotides 3,149 and 3,150, and compared to the reference sequence SEQ ID NO: 47, the aforementioned 377-base pair deletion from nucleotide 2,573 to nucleotide 2,949. A porcine animal, offspring, or cell according to any one of claims 35, 36, 42, and 43, including the following:
52. The aforementioned animal, offspring, or cell, In one allele of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO: 47, there is a 1930 base pair deletion from nucleotide 488 to nucleotide 2,417, wherein the deleted sequence is replaced by a 12 base pair insertion beginning at nucleotide 488, and there is a further 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 compared to the reference sequence SEQ ID NO: 47; and In other alleles of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO: 47, the aforementioned two-base pair insertion between nucleotides 3,149 and 3,150, and compared to the reference sequence SEQ ID NO: 47, the aforementioned 377-base pair deletion from nucleotide 2,573 to nucleotide 2,949. A porcine animal, offspring, or cell according to any one of claims 35, 36, 39, 41, 42, and 43, comprising:
53. The aforementioned animal, offspring, or cell, In one allele of the gene encoding the CD163 protein, SEQ ID NO: 118; and In another allele of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO: 47, there is a 1930 base pair deletion from nucleotide 488 to nucleotide 2,417, wherein the deleted sequence is replaced by a 12 base pair insertion beginning at nucleotide 488, and there is a further 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 compared to the reference sequence SEQ ID NO:
47. A porcine animal, offspring, or cell according to any one of claims 35, 39, and 41, comprising:
54. The aforementioned animal, offspring, or cell, In one allele of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO: 47, there is a 1930 base pair deletion from nucleotide 488 to nucleotide 2,417, wherein the deleted sequence is replaced by a 12 base pair insertion beginning at nucleotide 488, and there is a further 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 compared to the reference sequence SEQ ID NO: 47; and In other alleles of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO: 47, the 11 base pair deletions from nucleotide 3,137 to nucleotide 3,147 A porcine animal, offspring, or cell according to any one of claims 35, 39, and 41, comprising:
55. The aforementioned animal, offspring, or cell, In one allele of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO: 47, the 1467 base pair deletions from nucleotide 2,431 to nucleotide 3,897; and In other alleles of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO: 47, the aforementioned two-base pair insertion between nucleotides 3,149 and 3,150, and compared to the reference sequence SEQ ID NO: 47, the aforementioned 377-base pair deletion from nucleotide 2,573 to nucleotide 2,949. A porcine animal, offspring, or cell according to any one of claims 35, 36, and 41-43, including the following:
56. The aforementioned animal, offspring, or cell, In one allele of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO: 47, the 1467 base pair deletions from nucleotide 2,431 to nucleotide 3,897; and In other alleles of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO: 47, the 11 base pair deletions from nucleotide 3,137 to nucleotide 3,147 A porcine animal, offspring, or cell according to claim 35 or 41, comprising:
57. The porcine animal, offspring, or cell according to any one of claims 35 to 56, wherein the animal, offspring, or cell includes a chromosomal sequence having at least 80% sequence identity with SEQ ID NO: 47 in the region of the chromosomal sequence outside the insertion or deletion.
58. The porcine animal, offspring, or cell according to claim 57, wherein the animal, offspring, or cell contains a chromosome sequence having at least 85% sequence identity with SEQ ID NO: 47 in the region of the chromosome sequence outside the insertion or deletion.
59. The porcine animal, offspring, or cell according to claim 57, wherein the animal, offspring, or cell contains a chromosome sequence having at least 90% sequence identity with SEQ ID NO: 47 in the region of the chromosome sequence outside the insertion or deletion.
60. The porcine animal, offspring, or cell according to claim 57, wherein the animal, offspring, or cell contains a chromosome sequence having at least 95% sequence identity with SEQ ID NO: 47 in the region of the chromosome sequence outside the insertion or deletion.
61. The porcine animal, offspring, or cell according to claim 57, wherein the animal, offspring, or cell contains a chromosome sequence having at least 98% sequence identity with SEQ ID NO: 47 in the region of the chromosome sequence outside the insertion or deletion.
62. The porcine animal, offspring, or cell according to claim 57, wherein the animal, offspring, or cell contains a chromosome sequence having at least 99% sequence identity with SEQ ID NO: 47 in the region of the chromosome sequence outside the insertion or deletion.
63. The porcine animal, offspring, or cell according to claim 57, wherein the animal, offspring, or cell contains a chromosome sequence having at least 99.9% sequence identity with SEQ ID NO: 47 in the region of the chromosome sequence outside the insertion or deletion.
64. The porcine animal, offspring, or cell according to claim 57, wherein the animal, offspring, or cell contains a chromosome sequence having 100% sequence identity with SEQ ID NO: 47 in the region of the chromosome sequence outside the insertion or deletion.
65. The porcine animal, offspring, or cell according to any one of claims 35 to 64, wherein the animal, offspring, or cell comprises a chromosome sequence including SEQ ID NO: 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 118, or 119.
66. A pig animal, offspring, or cell according to claim 65, comprising a chromosome sequence including SEQ ID NO: 98, 101, 105, 109, 110, 112, 113, or 114.
67. A porcine animal, offspring, or cell according to claim 65, comprising a chromosome sequence including SEQ ID NO: 103, 111, or 119.
68. The aforementioned animal, offspring, or cell, In one allele of the gene encoding the CD163 protein, the 11 base pair deletion; and In other alleles of the gene encoding the CD163 protein, the two base pair insertion and the 377 base pair deletion A porcine animal, offspring, or cell according to any one of claims 35, 36, 42, 43, 57-65, and 67, including the following:
69. The aforementioned animal, offspring, or cell, The 124 base pair deletion in one allele of the gene encoding the CD163 protein; and The 123 base pair deletion in another allele of the gene encoding the CD163 protein A porcine animal, offspring, or cell according to any one of claims 35, 41, and 57-66, comprising:
70. The porcine animal, offspring, or cell according to any one of claims 35, 37, and 57-65, wherein the animal, offspring, or cell includes the single base pair insertion.
71. The aforementioned animal, offspring, or cell, The 130 base pair deletion in one allele of the gene encoding the CD163 protein; and The 132 base pair deletion in another allele of the gene encoding the CD163 protein A porcine animal, offspring, or cell according to any one of claims 35 and 57-65, comprising:
72. The porcine animal, offspring, or cell according to any one of claims 35, 41, and 57-66, wherein the animal, offspring, or cell comprises the 1506 base pair deletion.
73. The animal, offspring, or cell according to any one of claims 35, 38, and 57-65, wherein the animal, offspring, or cell includes the seven-base pair insertion.
74. The aforementioned animal, offspring, or cell, The 1280 base pair deletion in one allele of the gene encoding the CD163 protein; and The 1373 base pair deletion in another allele of the gene encoding the CD163 protein A porcine animal, offspring, or cell according to any one of claims 35, 41, and 57-66, comprising:
75. The animal, offspring, or cell according to any one of claims 35, 41, and 57-66, wherein the animal, offspring, or cell comprises the 1467 base pair deletion.
76. The porcine animal, offspring, or cell according to any one of claims 35, 39, 41, and 57-66, wherein the animal, offspring, or cell comprises a 1930 base pair intron 6 deletion from nucleotide 488 to nucleotide 2,417, and a 12 base pair insertion at nucleotide 4,488 in exon 7 and an additional 129 base pair deletion.
77. The aforementioned animal, offspring, or cell, The 28-base pair deletion in one allele of the gene encoding the CD163 protein; and The 1387 base pair deletion in another allele of the gene encoding the CD163 protein A porcine animal, offspring, or cell according to any one of claims 35, 41, 42, 44, and 57-66, comprising:
78. The aforementioned animal, offspring, or cell, In one allele of the gene encoding the CD163 protein, the 1382 base pair deletion and the 11 base pair insertion; and In other alleles of the gene encoding the CD163 protein, the 1720 base pair deletion A porcine animal, offspring, or cell according to any one of claims 35, 40, 41, and 57-66, including the following:
79. The cell according to any one of claims 1 to 78.
80. A non-human animal according to any one of claims 1 to 78.
81. The offspring according to any one of claims 1 to 78.
82. The cell according to any one of claims 1 to 79, wherein the cell is a sperm cell.
83. The cell according to any one of claims 1 to 79, wherein the cell is an egg cell.
84. The cell according to claim 83, wherein the egg cell is a fertilized egg.
85. The cell according to any one of claims 1 to 79, wherein the cell is a somatic cell.
86. The cell according to claim 85, wherein the somatic cell includes a fibroblast.
87. The cells according to claim 86, wherein the fibroblasts include fetal fibroblasts.
88. Genetically modifying an oocyte or sperm cell to introduce a modified chromosome sequence in the gene encoding the CD163 protein into at least one of the oocyte and sperm cell, fertilizing the oocyte with the sperm cell, and producing a fertilized egg containing the modified chromosome sequence in the gene encoding the CD163 protein; or Genetically modifying a fertilized egg so that a modified chromosomal sequence in the gene encoding the CD163 protein is introduced into the fertilized egg; The aforementioned fertilized egg is implanted into a surrogate female animal, and offspring are produced through pregnancy and full-term birth; Screening the offspring animals for susceptibility to pathogens; and To select offspring animals that exhibit reduced susceptibility to the pathogen compared to animals that do not contain the modified chromosome sequence in the gene encoding the CD163 protein. A breeding method for producing animals or strains with reduced susceptibility to infection by pathogens, including [specific pathogens].
89. The method according to claim 88, wherein the pathogen includes a virus.
90. The method according to claim 89, wherein the virus includes PRRSV.
91. The method according to claim 90, wherein the modification reduces susceptibility to type 1 PRRSV virus, type 2 PRRSV, or both type 1 and type 2 PRRSV viruses.
92. The method according to claim 91, wherein the modifications reduce susceptibility to PRRSV isolates selected from the group consisting of NVSL97-7895, KS06-72109, P129, VR2332, CO90, AZ25, MLV-ResPRRS, KS62-06274, KS483 (SD23983), CO84, SD13-15, Lelystad, 03-1059, 03-1060, SD01-08, 4353PZ, and combinations thereof.
93. The method according to any one of claims 88 to 92, wherein the animal is an embryo, a juvenile, or an adult.
94. The method according to any one of claims 88 to 93, wherein the animal includes domesticated animals.
95. The method according to claim 94, wherein the aforementioned animals include domesticated animals.
96. The method according to claim 95, wherein the livestock animal is selected from the group consisting of pigs, cattle, sheep, goats, horses, buffalo, camels, or birds.
97. The method according to claim 96, wherein the bovine animal includes beef cattle or dairy cattle.
98. The method according to claim 96, wherein the avian animal includes a chicken, a turkey, a duck, a goose, a guinea fowl, or a chick.
99. The method according to claim 96, wherein the equine animal includes a horse or a donkey.
100. The method according to claim 96, wherein the livestock animal is a cattle or a pig.
101. The method according to claim 100, wherein the livestock animal is a pig.
102. The method according to any one of claims 88 to 101, wherein the step of genetically modifying the oocyte, sperm cell, or fertilized egg includes genetic editing of the oocyte, sperm cell, or fertilized egg.
103. The method according to claim 102, wherein the gene editing comprises the use of a homing endonuclease.
104. The method according to claim 103, wherein the homing endonuclease comprises a designed homing endonuclease.
105. The method according to claim 103 or 104, wherein the homing endonuclease comprises a clustered and regularly arranged short palindromic sequence repeat (CRISPR) / Cas9 system, a transcription activator-like effector nuclease (TALEN), a zinc finger nuclease (ZFN), a recombinase fusion protein, a meganuclease, or a combination thereof.
106. The method according to any one of claims 102 to 105, wherein the genetic editing includes the use of a CRISPR / Cas9 system.
107. The method according to any one of claims 88 to 106, wherein the oocyte, spermatocyte, or fertilized egg is heterozygous with respect to the modified chromosome sequence.
108. The method according to any one of claims 88 to 106, wherein the oocyte, spermatocyte, or fertilized egg is homozygous with respect to the modified chromosome sequence.
109. The method according to any one of claims 88 to 108, wherein the modified chromosome sequence includes an insertion in the gene encoding the CD163 protein, a deletion in the gene encoding the CD163 protein, or a combination thereof.
110. The method according to claim 109, wherein the modified chromosome sequence includes a deletion in the gene encoding the CD163 protein.
111. The method according to claim 109 or 110, wherein the deletion includes an in-frame deletion.
112. The method according to any one of claims 109 to 111, wherein the modified chromosome sequence includes an insertion in the gene encoding the CD163 protein.
113. The method according to any one of claims 88 to 112, wherein the modified chromosome sequence causes a reduction in CD163 protein production or activity compared to the CD163 protein production or activity in animals lacking the modified chromosome sequence.
114. The method according to any one of claims 88 to 113, wherein the modified chromosome sequence results in the production of a substantially non-functional CD163 protein by the animal.
115. The method according to any one of claims 101 to 114, wherein the modified chromosome sequence includes modifications in exon 7 of the gene encoding the CD163 protein, exon 8 of the gene encoding the CD163 protein, an intron adjacent to exon 7 or exon 8 of the gene encoding the CD163 protein, or a combination thereof.
116. The method according to claim 115, wherein the modified chromosome sequence includes a modification in exon 7 of the gene encoding the CD163 protein.
117. The method according to claim 116, wherein the modification in exon 7 of the gene encoding the CD163 protein includes a deletion.
118. The method according to claim 117, wherein the deletion includes an in-frame deletion in exon 7.
119. The method according to any one of claims 116 to 118, wherein the modification in exon 7 of the gene encoding the CD163 protein includes an insertion.
120. The aforementioned modified chromosome sequence is (a) SEQ ID NO: 118; or (b) Modifications selected from the group consisting of the following: Compared to the reference sequence SEQ ID NO: 47, there is a deletion of 11 base pairs from nucleotide 3,137 to nucleotide 3,147; Compared to the reference sequence SEQ ID NO: 47, there is a two-base pair insertion between nucleotides 3,149 and 3,150, and a 377-base pair deletion from nucleotide 2,573 to nucleotide 2,949 on the same allele compared to the reference sequence SEQ ID NO: 47; Compared to the reference sequence SEQ ID NO: 47, there is a 124-base pair deletion from nucleotide 3,024 to nucleotide 3,147; Compared to the reference sequence SEQ ID NO: 47, there is a 123-base pair deletion from nucleotide 3,024 to nucleotide 3,146; Compared to the reference sequence SEQ ID NO: 47, a single base pair insertion occurred between nucleotides 3,147 and 3,148; Compared to the reference sequence SEQ ID NO: 47, there is a deletion of 130 base pairs from nucleotide 3,030 to nucleotide 3,159; Compared to the reference sequence SEQ ID NO: 47, there is a 132-base pair deletion from nucleotide 3,030 to nucleotide 3,161; Compared to the reference sequence SEQ ID NO: 47, there is a deletion of 1506 base pairs from nucleotide 1,525 to nucleotide 3,030; Compared to the reference sequence SEQ ID NO: 47, a 7-base pair insertion occurred between nucleotides 3,148 and 3,149; Compared to the reference sequence SEQ ID NO: 47, there is a deletion of 1280 base pairs from nucleotide 2,818 to nucleotide 4,097; Compared to the reference sequence SEQ ID NO: 47, there is a deletion of 1373 base pairs from nucleotide 2,724 to nucleotide 4,096; Compared to the reference sequence SEQ ID NO: 47, there is a deletion of 1467 base pairs from nucleotide 2,431 to nucleotide 3,897; Compared to the reference sequence SEQ ID NO: 47, the deletion comprises 1930 base pairs from nucleotide 488 to nucleotide 2,417, the deleted sequence being replaced by a 12-base-pair insertion beginning at nucleotide 488, and a further 129 base-pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172, compared to the reference sequence SEQ ID NO: 47; Compared to the reference sequence SEQ ID NO: 47, there is a 28-base pair deletion from nucleotide 3,145 to nucleotide 3,172; Compared to the reference sequence SEQ ID NO: 47, there is a deletion of 1387 base pairs from nucleotide 3,145 to nucleotide 4,531; Compared to the reference sequence SEQ ID NO: 47, there is a deletion of 1382 base pairs from nucleotide 3,113 to nucleotide 4,494, wherein the deleted sequence is replaced by an 11-base pair insertion beginning at nucleotide 3,113; Compared to the reference sequence SEQ ID NO: 47, there is a deletion of 1720 base pairs from nucleotide 2,440 to nucleotide 4,160; Compared to the reference sequence SEQ ID NO: 47, there is a 452-base pair deletion from nucleotide 3,015 to nucleotide 3,466; and their combinations The method according to any one of claims 115 to 119, including the method described in any one of claims 115 to 119.
121. The method according to claim 120, wherein, compared to the reference sequence SEQ ID NO: 47, the two-base pair insertion between nucleotides 3,149 and 3,150 includes the insertion of dinucleotide AG.
122. The method according to claim 120, wherein, compared to the reference sequence SEQ ID NO: 47, the one-base pair insertion between nucleotides 3,147 and 3,148 includes the insertion of a single adenine residue.
123. The method according to claim 120, wherein, compared to the reference sequence SEQ ID NO: 47, the seven-base pair insertion between nucleotides 3,148 and 3,149 includes the sequence TACTACT (SEQ ID NO: 115).
124. The method according to claim 120, wherein the modified chromosome sequence includes the 1,930 base pair deletions from nucleotide 488 to nucleotide 2,417 compared to the reference sequence SEQ ID NO: 47, the deleted sequences are replaced by a 12 base pair insertion beginning at nucleotide 488, and there is a further 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 compared to the reference sequence SEQ ID NO: 47, the 12 base pair insertions include the sequence TGTGGAGAATTC (SEQ ID NO: 116).
125. The method according to claim 120, wherein the modified chromosome sequence includes the 1,382 base pair deletions from nucleotide 3,113 to nucleotide 4,494 compared to the reference sequence SEQ ID NO: 47, the deleted sequence is replaced by an 11-base pair insertion beginning at nucleotide 3,113, the 11-base pair insertion includes the sequence AGCCAGCGTGC (SEQ ID NO: 117).
126. The aforementioned deletion is, Compared to the reference sequence SEQ ID NO: 47, the aforementioned 1,506 base pair deletions are present from nucleotide 1,525 to nucleotide 3,030; Compared to the reference sequence SEQ ID NO: 47, the deletion comprises the aforementioned 1930 base pairs from nucleotide 488 to nucleotide 2,417, wherein the deleted sequence is replaced by a 12 base pair insertion beginning at nucleotide 488, and also includes a further 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172, compared to the reference sequence SEQ ID NO: 47; Compared to the reference sequence SEQ ID NO: 47, the aforementioned 1373 base pair deletions are present from nucleotide 2,724 to nucleotide 4,096; Compared to the reference sequence SEQ ID NO: 47, the aforementioned 123 base pair deletions from nucleotide 3,024 to nucleotide 3,146; Compared to the reference sequence SEQ ID NO: 47, the aforementioned 1467 base pair deletions are found from nucleotide 2,431 to nucleotide 3,897; Compared to the reference sequence SEQ ID NO: 47, the aforementioned 1387 base pair deletions are found from nucleotide 3,145 to nucleotide 4,531; Compared to the reference sequence SEQ ID NO: 47, the deletion comprises 1382 base pairs from nucleotide 3,113 to nucleotide 4,494, wherein the deleted sequence is replaced by an 11-base pair insertion beginning at nucleotide 3,113; Compared to the reference sequence SEQ ID NO: 47, the aforementioned 1720 base pair deletions are present from nucleotide 2,440 to nucleotide 4,160; and their combinations The method according to claim 120, comprising an in-frame deletion in exon 7, selected from the group consisting of the following.
127. The aforementioned insertion or deletion is Compared to the reference sequence SEQ ID NO: 47, the aforementioned two-base pair insertion between nucleotides 3,149 and 3,150, and the aforementioned 377-base pair deletion between nucleotides 2,573 and 2,949 in the same allele, compared to the reference sequence SEQ ID NO: 47; Compared to the reference sequence SEQ ID NO: 47, the aforementioned 28 base pair deletions are present from nucleotide 3,145 to nucleotide 3,172; Compared to the reference sequence SEQ ID NO: 47, the aforementioned 452 base pair deletions are present from nucleotide 3,015 to nucleotide 3,466; and their combinations A method according to claim 120 or 121, selected from the group consisting of the following.
128. The method according to claim 127, wherein the modified chromosome sequence includes the two base pair insertion between nucleotides 3,149 and 3,150, and the 377 base pair deletions from nucleotide 2,573 to nucleotide 2,949 in the same allele, compared to the reference sequence SEQ ID NO:
47.
129. The method according to claim 127, wherein the modified chromosome sequence includes the 28 base pair deletions from nucleotide 3,145 to nucleotide 3,172 compared to the reference sequence SEQ ID NO:
47.
130. The method according to claim 127, wherein the modified chromosome sequence includes the 452 base pair deletions from nucleotide 3,015 to nucleotide 3,466 compared to the reference sequence SEQ ID NO:
47.
131. The aforementioned modified chromosome sequence is In one allele of the gene encoding the CD163 protein, the seven-base pair insertion between nucleotide 3,148 and nucleotide 3,149 compared to the reference sequence SEQ ID NO: 47; and In other alleles of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO: 47, the 11 base pair deletions from nucleotide 3,137 to nucleotide 3,147 The method according to claim 120 or 123, including the method described in claim 120 or 123.
132. The aforementioned modified chromosome sequence is In one allele of the gene encoding the CD163 protein, the seven-base pair insertion between nucleotide 3,148 and nucleotide 3,149 compared to the reference sequence SEQ ID NO: 47; and In another allele of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO: 47, there is a 1382 base pair deletion from nucleotide 3,113 to nucleotide 4,494, wherein the deleted sequence is replaced by an 11-base pair insertion beginning at nucleotide 3,113. The method according to any one of claims 120, 123, 125, and 126, including
133. The aforementioned modified chromosome sequence is In one allele of the gene encoding the CD163 protein, SEQ ID NO: 118; and In other alleles of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO: 47, the 11 base pair deletions from nucleotide 3,137 to nucleotide 3,147 The method according to claim 120, including the method described in claim 120.
134. The aforementioned modified chromosome sequence is In one allele of the gene encoding the CD163 protein, SEQ ID NO: 118; and In other alleles of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO: 47, the aforementioned two-base pair insertion between nucleotides 3,149 and 3,150, and compared to the reference sequence SEQ ID NO: 47, the aforementioned 377-base pair deletion from nucleotide 2,573 to nucleotide 2,949. The method according to any one of claims 120, 121, 127, and 128, including
135. The aforementioned modified chromosome sequence is In one allele of the gene encoding the CD163 protein, the 1280 base pair deletions from nucleotide 2,818 to nucleotide 4,097 compared to the reference sequence SEQ ID NO: 47; and In other alleles of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO: 47, the 11 base pair deletions from nucleotide 3,137 to nucleotide 3,147 The method according to claim 120, including the method described in claim 120.
136. The aforementioned modified chromosome sequence is In one allele of the gene encoding the CD163 protein, the 1280 base pair deletions from nucleotide 2,818 to nucleotide 4,097 compared to the reference sequence SEQ ID NO: 47; and In other alleles of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO: 47, the aforementioned two-base pair insertion between nucleotides 3,149 and 3,150, and compared to the reference sequence SEQ ID NO: 47, the aforementioned 377-base pair deletion from nucleotide 2,573 to nucleotide 2,949. The method according to any one of claims 120, 121, 127, and 128, including
137. The aforementioned modified chromosome sequence is In one allele of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO: 47, there is a 1930 base pair deletion from nucleotide 488 to nucleotide 2,417, wherein the deleted sequence is replaced by a 12 base pair insertion beginning at nucleotide 488, and there is a further 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 compared to the reference sequence SEQ ID NO: 47; and In other alleles of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO: 47, the aforementioned two-base pair insertion between nucleotides 3,149 and 3,150, and compared to the reference sequence SEQ ID NO: 47, the aforementioned 377-base pair deletion from nucleotide 2,573 to nucleotide 2,949. The method according to any one of claims 120, 121, 124, and 126-128, including the method described above.
138. The aforementioned modified chromosome sequence is In one allele of the gene encoding the CD163 protein, SEQ ID NO: 118; and In another allele of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO: 47, there is a 1930 base pair deletion from nucleotide 488 to nucleotide 2,417, wherein the deleted sequence is replaced by a 12 base pair insertion beginning at nucleotide 488, and there is a further 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 compared to the reference sequence SEQ ID NO:
47. The method according to any one of claims 120, 124, and 126, including the following:
139. The aforementioned modified chromosome sequence is In one allele of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO: 47, there is a 1930 base pair deletion from nucleotide 488 to nucleotide 2,417, wherein the deleted sequence is replaced by a 12 base pair insertion beginning at nucleotide 488, and there is a further 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 compared to the reference sequence SEQ ID NO: 47; and In other alleles of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO: 47, the 11 base pair deletions from nucleotide 3,137 to nucleotide 3,147 The method according to any one of claims 120, 124, and 126, including the following:
140. The aforementioned modified chromosome sequence is In one allele of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO: 47, the 1467 base pair deletions from nucleotide 2,431 to nucleotide 3,897; and In other alleles of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO: 47, the aforementioned two-base pair insertion between nucleotides 3,149 and 3,150, and compared to the reference sequence SEQ ID NO: 47, the aforementioned 377-base pair deletion from nucleotide 2,573 to nucleotide 2,949. The method according to any one of claims 120, 121, and 126 to 128, including
141. The aforementioned modified chromosome sequence is In one allele of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO: 47, the 1467 base pair deletions from nucleotide 2,431 to nucleotide 3,897; and In other alleles of the gene encoding the CD163 protein, compared to the reference sequence SEQ ID NO: 47, the 11 base pair deletions from nucleotide 3,137 to nucleotide 3,147 The method according to claim 120 or 126, including the method described in claim 120 or 126.
142. The method according to any one of claims 120 to 141, wherein the modified chromosome sequence includes a chromosome sequence having at least 80% sequence identity with SEQ ID NO: 47 in the region of the chromosome sequence outside the insertion or deletion.
143. The method according to claim 142, wherein the modified chromosome sequence includes a chromosome sequence having at least 85% sequence identity with SEQ ID NO: 47 in the region of the chromosome sequence outside the insertion or deletion.
144. The method according to claim 142, wherein the modified chromosome sequence includes a chromosome sequence having at least 90% sequence identity with SEQ ID NO: 47 in the region of the chromosome sequence outside the insertion or deletion.
145. The method according to claim 142, wherein the modified chromosome sequence includes a chromosome sequence having at least 95% sequence identity with SEQ ID NO: 47 in the region of the chromosome sequence outside the insertion or deletion.
146. The method according to claim 142, wherein the modified chromosome sequence includes a chromosome sequence having at least 98% sequence identity with SEQ ID NO: 47 in the region of the chromosome sequence outside the insertion or deletion.
147. The method according to claim 142, wherein the modified chromosome sequence includes a chromosome sequence having at least 99% sequence identity with SEQ ID NO: 47 in the region of the chromosome sequence outside the insertion or deletion.
148. The method according to claim 142, wherein the modified chromosome sequence includes a chromosome sequence having at least 99.9% sequence identity with SEQ ID NO: 47 in the region of the chromosome sequence outside the insertion or deletion.
149. The method according to claim 142, wherein the modified chromosome sequence includes a chromosome sequence having 100% sequence identity with SEQ ID NO: 47 in the region of the chromosome sequence outside the insertion or deletion.
150. The method according to any one of claims 120 to 149, wherein the modified chromosome sequence includes a chromosome sequence having SEQ ID NO: 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 118, or 119.
151. The method according to claim 150, wherein the modified chromosome sequence includes a chromosome sequence having SEQ ID NO: 98, 101, 105, 109, 110, 112, 113, or 114.
152. The method according to claim 150, wherein the modified chromosome sequence includes a chromosome sequence having SEQ ID NO: 103, 111, or 119.
153. The aforementioned modified chromosome sequence is The 11-base pair deletion in one allele of the gene encoding the CD163 protein; and The 2-base pair insertion and 377-base pair deletion in other alleles of the gene encoding the CD163 protein The method according to any one of claims 120, 121, 127, 128, 142-150, and 152, including
154. The aforementioned modified chromosome sequence is The 124 base pair deletion in one allele of the gene encoding the CD163 protein; and The 123 base pair deletion in another allele of the gene encoding the CD163 protein The method according to any one of claims 120, 126, and 142 to 151, including the following:
155. The method according to any one of claims 120, 122, and 142-150, wherein the modified chromosome sequence includes the single base pair insertion.
156. The aforementioned modified chromosome sequence is The 130 base pair deletion in one allele of the gene encoding the CD163 protein; and The 132 base pair deletion in another allele of the gene encoding the CD163 protein The method according to any one of claims 120 and 142 to 150, including the method described in claim 120 and 142 to 150.
157. The method according to any one of claims 120, 126, and 142-151, wherein the modified chromosome sequence includes the 1506 base pair deletion.
158. The method according to any one of claims 120, 123, and 142-150, wherein the modified chromosome sequence includes the seven-base pair insertion.
159. The aforementioned modified chromosome sequence is The 1280 base pair deletion in one allele of the gene encoding the CD163 protein; and The 1373 base pair deletion in another allele of the gene encoding the CD163 protein The method according to any one of claims 120, 126, and 142 to 151, including the following:
160. The method according to any one of claims 120, 126, and 142-151, wherein the modified chromosome sequence includes the 1467 base pair deletion.
161. The method according to any one of claims 120, 124, 126, and 142-151, wherein the modified chromosome sequence comprises the 1,930 base pair intron 6 deletion from nucleotide 488 to nucleotide 2,417, and a 12 base pair insertion at nucleotide 4,488 in exon 7 and an additional 129 base pair deletion.
162. The aforementioned modified chromosome sequence is The 28-base pair deletion in one allele of the gene encoding the CD163 protein; and The 1387 base pair deletion in another allele of the gene encoding the CD163 protein The method according to any one of claims 120, 126, 127, 129, and 142 to 151, including the method described above.
163. The method according to any one of claims 120, 125, 126, and 142-151, wherein the modified chromosome sequence comprises the 1382 base pair deletion and the 11 base pair insertion in one allele of the gene encoding the CD163 protein, and the 1720 base pair deletion in the other allele of the gene encoding the CD163 protein.
164. The method according to any one of claims 88 to 163, wherein the selected animal is used as a founder animal.
165. The method according to any one of claims 88 to 164, wherein the fertilization includes artificial insemination.
166. A population of animals produced by the method described in any one of claims 88 to 165.
167. The population of animals according to claim 166, wherein the population of animals is resistant to infection by pathogens.
168. The group according to claim 167, wherein the pathogen includes a virus.
169. The group of viruses according to claim 168, including PRRSV.
170. The group according to claim 169, wherein the virus comprises type 1 PRRSV virus, type 2 PRRSV, or both type 1 and type 2 PRRSV viruses.
171. The group according to claim 170, wherein the virus comprises PRRSV isolates selected from the group consisting of NVSL97-7895, KS06-72109, P129, VR2332, CO90, AZ25, MLV-ResPRRS, KS62-06274, KS483 (SD23983), CO84, SD13-15, Lelystad, 03-1059, 03-1060, SD01-08, 4353PZ, and combinations thereof.
172. A method for increasing the resistance of livestock animals to pathogen infection, comprising genetically editing at least one chromosome sequence derived from the gene encoding the CD163 protein, thereby reducing CD163 protein production or activity compared to CD63 protein production or activity in livestock animals that do not contain the edited chromosome sequence in the gene encoding the CD163 protein.
173. The method according to claim 172, wherein the livestock animal produces a substantially non-functional CD163 protein.
174. The method according to claim 172, comprising genetically editing at least one chromosome sequence encoding the CD163 protein to introduce an in-frame deletion.
175. (a) Nucleotide sequence containing SEQ ID NO: 47; (b) A nucleotide sequence having at least 80% sequence identity with respect to the sequence of SEQ ID NO: 47, wherein the nucleotide sequence includes at least one substitution, insertion, or deletion with respect to SEQ ID NO: 47; and (c) c DNA sequence of (a) or (b) A nucleic acid molecule containing a nucleotide sequence selected from the group consisting of the following.
176. The nucleic acid molecule according to claim 175, wherein the nucleic acid molecule is an isolated nucleic acid molecule.
177. The nucleic acid according to claim 175 or 176, wherein the nucleic acid comprises a nucleotide sequence including SEQ ID NO:
47.
178. The nucleic acid according to claim 175 or 176, wherein the nucleic acid comprises a nucleotide sequence having at least 80% sequence identity with respect to the sequence of SEQ ID NO: 47, and the nucleotide sequence comprises at least one substitution, insertion, or deletion with respect to SEQ ID NO:
47.
179. The nucleic acid according to claim 178, comprising a nucleotide sequence having at least 85% sequence identity with respect to the sequence of SEQ ID NO: 47, wherein the nucleotide sequence comprises at least one substitution, insertion, or deletion with respect to SEQ ID NO:
47.
180. The nucleic acid according to claim 178, comprising a nucleotide sequence having at least 87.5% sequence identity with respect to the sequence of SEQ ID NO: 47, wherein the nucleotide sequence comprises at least one substitution, insertion, or deletion with respect to SEQ ID NO:
47.
181. The nucleic acid according to claim 178, comprising a nucleotide sequence having at least 90% sequence identity with respect to the sequence of SEQ ID NO: 47, wherein the nucleotide sequence comprises at least one substitution, insertion, or deletion with respect to SEQ ID NO:
47.
182. The nucleic acid according to claim 178, comprising a nucleotide sequence having at least 95% sequence identity with respect to the sequence of SEQ ID NO: 47, wherein the nucleotide sequence comprises at least one substitution, insertion, or deletion with respect to SEQ ID NO:
47.
183. The nucleic acid according to claim 178, comprising a nucleotide sequence having at least 98% sequence identity with respect to the sequence of SEQ ID NO: 47, wherein the nucleotide sequence comprises at least one substitution, insertion, or deletion with respect to SEQ ID NO:
47.
184. The nucleic acid according to claim 178, comprising a nucleotide sequence having at least 99% sequence identity with respect to the sequence of SEQ ID NO: 47, wherein the nucleotide sequence comprises at least one substitution, insertion, or deletion with respect to SEQ ID NO:
47.
185. The nucleic acid according to claim 178, comprising a nucleotide sequence having at least 99.9% sequence identity with respect to the sequence of SEQ ID NO: 47, wherein the nucleotide sequence comprises at least one substitution, insertion, or deletion with respect to SEQ ID NO:
47.
186. The nucleic acid according to any one of claims 175, 176, and 178-185, wherein the substitution, insertion, or deletion reduces or eliminates CD163 protein production or activity compared to nucleic acid without the substitution, insertion, or deletion.
187. The nucleic acid according to claim 175, 176, 178, or 186, wherein the nucleic acid includes SEQ ID NO: 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 118, or 119.
188. The nucleic acid according to claim 187, wherein the nucleic acid includes SEQ ID NO: 98, 101, 105, 109, 110, 112, 113, or 114.
189. The nucleic acid according to claim 187, wherein the nucleic acid includes SEQ ID NO: 103, 111, and 119.
190. The isolated nucleic acid according to claim 175 or 176, wherein the nucleic acid comprises cDNA.
191. SEQ ID NO: nucleic acids including 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 118, 119.
192. The nucleic acid according to claim 191, wherein the nucleic acid is an isolated nucleic acid.
193. The isolated nucleic acid according to claim 191 or 192, comprising SEQ ID NO: 98, 101, 105, 109, 110, 112, 113, or 114.
194. The isolated nucleic acid according to claim 191 or 192, wherein the nucleic acid includes SEQ ID NO: 103, 111, or 119.