Composition for the prevention or treatment of Ewing's sarcoma, containing an ARID1A phase separation inhibitor as an active ingredient.

Abstract

The present invention provides a composition for the prevention or treatment of Ewing's sarcoma. [Solution] An ARID1A phase separation inhibitor is used as the active ingredient. Specifically, the prion-like domain induces liquid-liquid phase separation of intranuclear ARID1A, and both the PrLD and Pfam homology domains are necessary for ARID1A to integrate the BAF complex subunit into a condensate. The loss of ARID1A LLPS significantly reduces the proliferation and invasiveness of Ewing sarcoma, and by confirming that ARID1A interacts with EWS / FLI1 through phase separation, it has the advantage of being applicable to the treatment of Ewing sarcoma by regulating ARID1A.

Description

Technical Field

[0001] The present invention relates to a composition for preventing or treating Ewing sarcoma containing an ARID1A phase separation inhibitor as an active ingredient.

Background Art

[0002] ARID1A is a chromatin remodeling factor known as a component of the Brahma-related gene 1 (BRG1) / Brahma homolog (BRM)-associated factor (BAF) complex. In colorectal cancer, ARID1A has been shown to act on enhancers occupied by activator protein 1 (AP1) and upregulate related genes involved in the MAPK / extracellular signal-regulated kinase (ERK) signaling pathway. Also, ARID1A has been shown to occupy the luminal transcription factor site bound by estrogen receptor α (ERα) and forkhead box A1 (FOXA1) in breast cancer. ARID1A loss leads to a change from luminal to basal and resistance to endocrine therapy. ARID1A has been shown to be frequently mutated in cancer, and recurrent mutations in ARID1A have been confirmed in various cancers including ovarian cancer, breast cancer, and pancreatic cancer. In the case of hepatocellular carcinoma, high expression of ARID1A increases cytochrome P450-mediated oxidative stress and promotes tumorigenicity. Such studies suggest that ARID1A may play an important role in regulating tumor formation.

[0003] Liquid-liquid phase separation (LLPS) facilitates essential cellular processes, including transcription. Molecules experiencing LLPS generally exhibit condensation, forming distinct water droplets within the cell. Typically, intrinsically disordered regions (IDRs) drive LLPS through multivalent interactions between various amino acid residues. Prion-like domains (PrLDs) are also intrinsically disordered and exhibit LLPS behavior. Recent studies have revealed that PrLDs lack a stable molecular structure, and aromatic residues within such domains act as "stickers" mediating direct molecular interactions, while polar residues, limited between each aromatic residue, act as "spacers" that uniformly distribute the stickers throughout the PrLD and regulate LLPS. PrLDs are crucial for driving diverse biological functions; for example, early development 3 (ELF3) acts as a thermal sensor in Arabidopsis thaliana via PrLD-mediated LLPS in the heat-induced development of development. The PrLD of early B-cell factor 1 (EBF1) is an essential element in determining B-cell lineage.

[0004] Ewing's sarcoma is a rare malignant tumor that occurs in the bone and soft tissues of children, adolescents, and young adults. While Ewing's sarcoma can be treated with chemotherapy, 75-80% of patients with metastatic Ewing's sarcoma that progresses die within five years. Chromosomal translocations occurring in Ewing's sarcoma lead to the binding of the Ewing's sarcoma gene (EWS) and the friend leukemia insertion (FLI) gene, an ETS gene, to form the EWS-FLI1 (Ewing's sarcoma protein-friend leukemia integration 1 transcription factor) protein. This EWS-FLI1 protein is known to influence the pathological mechanisms associated with the development and metastasis of Ewing's sarcoma.

[0005] Therefore, we have confirmed that the present invention can be applied to the treatment of Ewing's sarcoma by utilizing a mechanism of liquid-liquid phase separation mediated by the prion-like domain of ARID1A. [Prior art documents] [Patent Documents]

[0006] [Patent Document 1] Korean Patent Publication No. 10-2022-0003560 (January 10, 2022) [Overview of the Initiative] [Problems that the invention aims to solve]

[0007] The object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of Ewing's sarcoma, comprising an ARID1A (AT-rich interactive domain-containing protein) phase separation inhibitor as an active ingredient.

[0008] Another object of the present invention is to provide a health functional food composition for the prevention or improvement of Ewing's sarcoma, comprising an ARID1A (AT-rich interactive domain-containing protein) phase separation inhibitor as an active ingredient.

[0009] A further object of the present invention is to provide a method for screening candidate substances for the treatment of Ewing's sarcoma, comprising the steps of: (a) treating a sample isolated from an individual with an ARID1A (AT-rich interactive domain-containing protein) phase separation inhibitor; (b) comparing the expression level and phase separation level of ARID1A in the treated sample; and (c) selecting substances in which the ARID1A expression level and phase separation level of the sample are reduced compared to the expression levels of a normal control group.

[0010] Other objectives and merits of the present invention will become clearer from the detailed description of the invention, claims, and drawings below. [Means for solving the problem]

[0011] The present invention provides a pharmaceutical composition for the prevention or treatment of Ewing's sarcoma, comprising an ARID1A (AT-rich interactive domain-containing protein) phase separation inhibitor as an active ingredient.

[0012] Furthermore, the present invention provides a health functional food composition for the prevention or improvement of Ewing's sarcoma, comprising an ARID1A (AT-rich interactive domain-containing protein) phase separation inhibitor as an active ingredient.

[0013] The present invention also provides a method for screening candidate substances for the treatment of Ewing's sarcoma, comprising the following steps: (a) treating a sample isolated from an individual with an ARID1A (AT-rich interactive domain-containing protein) phase separation inhibitor; (b) comparing the expression level and phase separation level of ARID1A in the treated sample; and (c) selecting substances in which the ARID1A expression level and phase separation level of the sample are reduced compared to the expression levels of a normal control group. [Effects of the Invention]

[0014] The present invention relates to the therapeutic application of Ewing sarcoma by inhibiting prion-like domain-mediated fluid-liquid phase separation of ARID1A, and has the advantage of being applicable to the treatment of Ewing sarcoma by regulating ARID1A, as it confirms that the prion-like domain induces fluid-liquid phase separation of intranuclear ARID1A, that both PrLD and Pfam homology domains are necessary for ARID1A to integrate BAF complex subunits into condensates, that loss of ARID1A LLPS greatly reduces the proliferation and invasiveness of Ewing sarcoma, and that ARID1A interacts with EWS / FLI1 through phase separation. [Brief explanation of the drawing]

[0015] [Figure 1]Figure 1 shows that ARID1A undergoes liquid-liquid phase separation via PrLDs. (a) Domain structure and intrinsic tendency of ARID1A. The upper panel shows the domain of ARID1A, PLAAC analysis, PONDR analysis, FOLD analysis, and catGRANULE analysis. (b) Representative image of a FRAP experiment performed on 293T cells transformed with GFP-ARID1A. White boxes highlight targeted bleached organelles. The lower panel shows quantification of FRAP data for GFP-ARID1A puncta. Bleaching occurs at t=0 sec. Initial fluorescence was used as a baseline for calculating relative fluorescence intensity. Data are expressed as mean ± SEM (n=9). n = individual ARID1A nuclear condensate. Scale bar: 5 μm. (c) Real-time imaging of 293T cells expressing GFP-ARID1A. Arrows indicate representative ARID1A puncta that fused over time. Scale bar: 2 μm. Representative images, supported by relevant statistics, were selected from three independent preparations with similar results. (d) GFP-ARID1A forms nuclear puncta in 293T cells. Cells transformed with GFP-ARID1A were imaged by confocal microscopy with or without treatment of 6% Hex for 5 minutes. Nuclei were stained with DAPI. Quantification on the right shows the percentage of cells with nuclear puncta. Data are expressed mean ± SEM. **p<0.01, ***p<0.001, NS not significant. Statistics were performed by two-sided t-tests. Twelve transformed cells were analyzed in each group (model and hexanediol treatment); n=12 biologically independent samples. Scale bar: 5 μm. (e) Representative confocal images of 293T cells expressing GFP-ARID1A at different fluorescence intensities. Scale bar: 5 μm. Representative images, supported by relevant statistics, were selected from three independent preparations with similar results. (f) Representative confocal images of 293T cells transformed with different morphologies of recombinant GFP-ARID1A structures, including GFP, GFP-ARID1A, GFP-PrLD1, GFP-ARID, GFP-PrLD2, GFP-Pfam, GFP-ARID1A PrLD(Y / S), and GFP-ΔDD mutations. Scale bar: 5 μm.Representative images, supported by relevant statistics, were selected from three independent preparations with similar results. (g) Quantitative phase separation diagram showing intracellular nuclear concentrations of the ARID1A domain and mutations. Each point represents the ARID1A concentration in a specific cell. Red indicates positive phase separation, and blue indicates negative phase separation. (au = arbitrary units). Source data was provided in the source data file. [Figure 2] Figure 2 shows that ARID1A requires all PrLDs and Pfam homology domains to integrate the BAF subunit into the condensate. (a) Immunoprecipitation experiments performed to detect interactions between endogenous BAF complex subunits expressed in 293T cells and ARID1A wild-type (WT), ΔDD, or ΔPfam mutants. Representative images, supported by relevant statistics, were selected from three independent preparations with similar results. (b) Representative confocal image showing the intracellular locations of different GFP-BAF complex subunits. Scale bar: 5 μm. Representative images, supported by relevant statistics, were selected from three independent preparations with similar results. (c) Representative confocal image showing the colocospheric pattern of recombinant ARID1A protein (green) and SMARCB1 (red). Scale bar: 5 μm. Representative images, supported by relevant statistics, were selected from three independent preparations with similar results. (d) Representative confocal image showing the colocospheric pattern of recombinant ARID1A protein (green) and SMARCB1 (red). Scale bar: 5 μm. Representative images, supported by relevant statistics, were selected from three independent preparations with similar results. (e) Representative confocal image of 293T cells transformed with recombinant ARID1A and immunostained with anti-SMARCD and anti-SMARCC1 antibodies. Scale bar: 5 μm. Representative images, supported by relevant statistics, were selected from three independent preparations with similar results. Source data were provided in the source data file. [Figure 3]Figure 3 shows that loss of ARID1A LLPS significantly reduces the proliferation and invasiveness of Ewing sarcoma. (a) ARID1A protein expression levels in various cancer types obtained from the Cancer Cell Line Encyclopedia. (b) Representative immunoblot images measuring ARID1A protein levels in various cancer cell lines. Quantification shows the density ratio of ARID1A / β-actin protein. Representative images supported by relevant statistics were selected from three independent preparations with similar results. (c) Immunohistochemical results showing ARID1A staining in normal bone tissue and tissue from two Ewing sarcoma patients. Scale bar: 10 μm. Representative images supported by relevant statistics were selected from three independent preparations with similar results. (d) Immunocytochemical images showing endogenous ARID1A location in WT, ARID1A- / -, ARID1A- / -+WT, and ARID1A- / -+ΔDD cells. Scale bar: 5 μm. Representative images supported by relevant statistics were selected from three independent preparations with similar results. (e) Left: Wound healing analysis performed on WT, ARID1A- / -, ARID1A- / -+WT, and ARID1A- / -+ΔDD A673 cell lines. Right: Quantification of wound healing analysis. Bars indicate SEM; **p<0.01, ***p<0.001, NS not significant. n=10 technically replicated wound closures. Statistical analysis was performed using a two-sided Wilcoxon signed-rank test on 48-hour samples of ARID1A- / -+WT and ARID1A- / -+ΔDD A673 cell lines. Scale bar, 500 μm. (f) Left: Spheroid formation analysis performed on four cell lines over 4 days. Right: Quantification of spheroid formation analysis. Bars indicate mean ± SEM; **p<0.01, ***p<0.001, NS not significant. n=10 technically replicated spheroids. Statistical analysis was performed using a two-sided Wilcoxon signed-rank test on 4-day samples of ARID1A- / -+WT and ARID1A- / -+ΔDD A673 cell lines. Scale bar, 500 μm. (g) Left: Spheroid invasion analysis performed on four cell lines over 2 days. Right: Quantification of spheroid invasion analysis. Bars indicate mean ± SEM; **p<0.01, ***p<0.001, NS not significant. n=10 technically replicated spheroids.Statistical analysis was performed using a two-sided Wilcoxon signed-rank test on 4-day samples of ARID1A- / -+WT and ARID1A- / -+ΔDD A673 cell lines. Scale bar, 500 μm. (h) Left: In vivo xenograft analysis performed on four cell lines. Nude mice and excised tumors are visible. Upper right panel: Volume quantification of excised tumors. Lower right panel: Weight quantification of excised tumors. Bars indicate mean ± SEM; **p<0.01, ***p<0.001, NS not significant. n=10 tumor extracts. Statistical analysis was performed using a two-sided Wilcoxon signed-rank test. ARID1A- / -, ARID1A- / -+WT, and ARID1A- / -+ΔDD A673 cell lines were individually compared to WT. (i) Representative immunohistochemical images of excised tumors formed from four cell lines. Immunostaining was performed using anti-ARID1A antibody. Scale bar: 10 μm. Representative images, supported by relevant statistics, were selected from three independent preparations with similar results. Source data were provided in the source data file. [Figure 4]Figure 4 shows that ARID1A directly interacts with EWS / FLI1 through phase separation. (a) Binding sites of FLAG-EWS / FLI1 and GFP-ARID1A recombinant protein were mapped by immunoprecipitation. Proteins tested included PrLD1, ARID, PrLD2, Pfam, PrLD(Y / S) mutation, and full-length ARID1A. Representative images, supported by relevant statistics, were selected from three independent preparations with similar results. (b) Confocal image of in vitro co-droplet analysis showing the copositional pattern of purified GFP-ARID1A and mCherry-EWS / FLI1. Scale bar: 5 μm. Representative images, supported by relevant statistics, were selected from three independent preparations with similar results. (c) Representative confocal image of ARID1A- / -+WT and ARID1A- / -+ΔDD A673 cell lines immunostained with anti-FLI1 and anti-ARID1A antibodies. Scale bar: 5 μm. (d) Quantification of the number of FLI1 punctas per cell line for each cell line in (c). n=32 technically replicated cells; bars indicate mean ± sem; **p<0.01, ***p<0.001, NS not significant. Statistical analysis was performed using a two-sided t-test. ARID1A- / -, ARID1A- / -+WT, and ARID1A- / -+ΔDD A673 cell lines were individually compared to WT. (e) ChIP experiments performed in EWS / FLI1 binding enhancers using antibodies (IgG, FLI1, H3K27ac, SMARCC1) in ARID1A- / -+WT and ARID1A- / -+ΔDD A673 cell lines. Bars indicate mean ± sem; n=3 technically replicated cells; **p<0.01, ***p<0.001, NS not significant. Statistical analysis was performed using a two-tailed t-test comparing ARID1A- / -+WT and ARID1A- / -+ΔDD A673 cell lines. Source data were provided in the source data file. [Figure 5]Figure 5 shows the schematics of ARID1A phase separation. ARID1A undergoes phase separation with an EWS / FLI1 binding enhancer to form condensates, which compartmentalize BAF complex subunits to drive chromatin remodeling and transcriptional activation of tumor genes. Loss of ARID1A phase separation leads to chromatin closure and decreased tumor gene target transcription, which greatly reduces the tumorigenic potential of Ewing's sarcoma. The schematic diagram was generated using Biorender.com.

Modes for Carrying Out the Invention

[0016] The present invention provides a pharmaceutical composition for preventing or treating Ewing's sarcoma containing, as an active ingredient, an inhibitor of phase separation of ARID1A (AT-rich interactive domain-containing protein).

[0017] In the present invention, the phase separation may be liquid-liquid phase separation (LLPS). According to one embodiment of the present invention, it was confirmed that loss of liquid-liquid phase separation of ARID1A greatly reduces the growth and invasion characteristics of Ewing's sarcoma.

[0018] In the present invention, the phase separation may be mediated by the Prion-like domain of ARID1A. In the present invention, ARID1A may interact with EWS / FLI1 through the liquid-liquid phase separation.

[0019] In the present invention, the liquid-liquid phase separation may proceed through PrLDs. In the present invention, the ARID1A may contain PrLDs and Pfam homology domains. According to one embodiment of the present invention, it was confirmed that both PrLDs and Pfam homology domains are necessary for ARID1A to integrate BAF subunits into condensates.

[0020] When the composition according to the present invention is in the form of a pharmaceutical composition, it may contain a pharmaceutically effective amount of an ARID1A phase separation inhibitor alone or may contain one or more pharmaceutically acceptable carriers. At this time, the pharmaceutically acceptable carriers are those commonly used in the formulation, including, but not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. In addition to the above components, lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives and the like may further be included.

[0021] The pharmaceutical composition of the present invention can be administered orally or parenterally (e.g., intravenously, subcutaneously, intraperitoneally or topically applied) by the intended method, and the dosage varies depending on the patient's condition and weight, the degree of the disease, the drug form, the administration route and time, but can be appropriately selected by those skilled in the art.

[0022] The pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and the effective dosage level can be determined by factors including the type and severity of the patient's disease, the activity of the drug, drug sensitivity, administration time, administration route and excretion rate, treatment period, drugs used simultaneously, and other factors well known in the medical field. The pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and can be administered sequentially or simultaneously with conventional therapeutic agents, and can be administered once or multiple times. It is important to administer an amount that can obtain the maximum effect with the minimum amount without side effects considering all the above factors, and this can be easily determined by those skilled in the art.

[0023] Specifically, the effective amount of the pharmaceutical composition of the present invention can vary depending on the patient's age, sex, condition, weight, the degree of absorption, inactivation rate, and excretion rate of the active ingredient in the body, the type of disease, and the drugs used in combination. Generally, 1 to 500 mg per kg of body weight may be administered daily or every other day, or divided into 1 to 3 doses per day. However, the dosage can be increased or decreased depending on the route of administration, sex, weight, age, etc., so the aforementioned dosage does not limit the scope of the present invention in any way.

[0024] Furthermore, the present invention provides a health functional food composition for the prevention or improvement of Ewing's sarcoma, comprising an ARID1A (AT-rich interactive domain-containing protein) phase separation inhibitor as an active ingredient.

[0025] In the present invention, the phase separation may be liquid-liquid phase separation. In the present invention, the phase separation may be mediated by the prion-like domain of ARID1A.

[0026] In the present invention, ARID1A may interact with EWS / FLI1 through the liquid-liquid phase separation. In the present invention, the liquid-liquid phase separation may be carried out through PrLDs.

[0027] In the present invention, ARID1A may include PrLDs and Pfam homology domains. When the composition according to the present invention is in the form of a functional food composition, it can be manufactured as a food for specified health uses, a food with high medical and therapeutic effects processed to efficiently exhibit biological regulatory functions in addition to nutritional supply, and the food may be mixed with functional foods, health foods, and health supplements, and can be manufactured in various forms such as tablets, capsules, powders, granules, liquids, and pills to obtain useful effects.

[0028] The health functional food of the present invention may contain additional ingredients commonly used in food compositions that can improve odor, taste, appearance, etc. For example, it may contain vitamins A, C, D, E, B1, B2, B6, B12, niacin, biotin, folate, pantothenic acid, etc. It may also contain minerals such as zinc (Zn), iron (Fe), calcium (Ca), chromium (Cr), magnesium (Mg), manganese (Mn), and copper (Cu). It may also contain amino acids such as lysine, tryptophan, cysteine, and valine. In addition, food additives such as preservatives (potassium sorbate, sodium benzoate, salicylic acid, sodium dihydroacetate, etc.), disinfectants (bleaching powder and high-grade bleaching powder, sodium hypochlorite, etc.), antioxidants (butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), etc.), colorants (tar dyes, etc.), color fixatives (sodium nitrite, sodium acetate, etc.), bleaching agents (sodium sulfite), seasonings (MSG, monosodium glutamate, etc.), sweeteners (dulcin, Cyclemate, saccharin, sodium, etc.), flavorings (vanillin, lactones, etc.), leavening agents (alum, potassium bitartrate, etc.), fortifiers, emulsifiers, thickeners, coating agents, gum bases, bubble inhibitors, solvents, and improvers may be added. The aforementioned additives can be selected according to the type of food and used in appropriate amounts.

[0029] When using the health functional food of the present invention as a food additive, it can be added as is or used together with other foods or food components, and can be used appropriately by conventional methods. In the health functional food of the present invention, the content of the ARID1A phase separation inhibitor is not particularly limited and can be varied depending on the condition of the recipient, the type of disease, the progression, etc. If necessary, it may also be included in the total content of the food.

[0030] The present invention also provides a method for screening candidate substances for the treatment of Ewing's sarcoma, comprising the following steps: (a) treating a sample isolated from an individual with an ARID1A (AT-rich interactive domain-containing protein) phase separation inhibitor; (b) comparing the expression level and phase separation level of ARID1A in the treated sample; and (c) selecting substances in which the ARID1A expression level and phase separation level of the sample are reduced compared to the expression levels of a normal control group.

[0031] In this invention, "individual" means all animals, including humans, rats, mice, and livestock. Preferably, it may be a mammal, including humans. The characteristic corresponding to ARID1A, as described above, included in the screening method for candidate therapeutic substances for Ewing's sarcoma, can be replaced by the previously mentioned section, and therefore its description is omitted.

[0032] The present invention will be described in detail below with reference to examples to aid in understanding the present invention. However, the following examples are merely illustrative of the content of the present invention, and the scope of the present invention is not limited to these examples. The examples of the present invention are provided to give a more complete explanation of the present invention to a person of average knowledge in the art.

[0033] Example 1. Materials and Methods 1.1. Reagents The following commercially available antibodies were used: anti-ARID1A (ab182560), anti-SMARCC1 (ab172638), anti-FLI1 (ab133485), anti-SMARCE (ab70540), anti-H3K27ac (ab4729) (Abcam); anti-Flag (F3165), anti-β-actin (A1978), anti-ARID1A (AMAb91192) (Sigma-Aldrich); anti-GFP (sc-9996), anti-SMARCB (sc166-165), anti-SMARCD (sc-135843) (Santa Cruz Biotechnology); anti-SMARCA2 (26613-1-AP) (Proteintech). Next, commercially available fluorescently labeled secondary antibodies were used: Alexa Fluor 488 donkey anti-rabbit IgG (A21206) and Alexa Fluor 594 donkey anti-mouse IgG (A21203) (Invitrogen). Cell cultures and transformed A673, SK-N-MC cell lines were purchased from the Korean Cell Line Bank. HEK293T cells were obtained from ATCC. TC-106 was provided by Thomas GPGrunewald. Cells were tested for mycoplasma contamination and regularly treated with BM-cyclin. A673 cells were cultured in RPMI1640 medium containing 10% fetal bovine serum (FBS) and antibiotics in a humidified incubator at 5% CO2 and 37°C. HEK293T cell lines were cultured in Dulbecco's modified Eagle's medium containing 10% FBS and antibiotics. Transformation was performed using PEI (Sigma-Aldrich). The cell lines were STR certified by STR profiling.

[0034] 1.2 Genetically Modified Cell Line Generation Ewing sarcoma cell line A673 was genetically modified using the CRISPR-CAS9 system. A guide RNA (sequence: GGGGCCTGGAGCCCTACGCG) targeting the first exon of ARID1A was cloned into the px330 vector. Transformed cells were cultured in 99-well plates with one cell per well. Single-cell colonies grew and were genotyped. Cells with complete loss of ARID1A protein expression, as confirmed by Western blotting, were selected as ARID1A KO A673. For ARID1A structure-restored A673 KO cells, the pLenti-puro-ARID1A (plasmid #39478, Addgene) plasmid was introduced into ARID1A KO A673 cells using lentiviral particles. Transduced cells were selected using puromycin. Selected cells were plated in 99-well plates with one cell per well. Single-cell colonies were genotyped multiple times until ARID1A levels were similar to those of wild-type colleagues. For the generation of ARID1A PrLD(Y / S) and ARID1AΔDD structurally restored A673 ARID1A KO cells, pLenti-puro-ARID1A PrLD(Y / S) and pLenti-puro-ARID1AΔDD were introduced into KO cells, respectively, via lentiviral particles. The introduced cells were selected using puromycin and added to 99-well plates with one cell per well. Single-cell colonies were genotyped multiple times until sufficient ARID1A PrLD(Y / S) or ARID1AΔDD expression was observed.

[0035] 1.3. Immunofluorescence staining and real-time cell imaging Cells were cultured in a confocal dish and fixed with 1% formaldehyde in PBS for 15 minutes. Fixed cells were permeabilized with PBS-T (0.5% Triton X-100 in PBS) at room temperature for 10 minutes. Blockade was performed with 3% bovine serum in PBS-T for 1 hour. For staining, cells were treated with a primary antibody at room temperature for 2 hours, then with a fluorescently labeled secondary antibody and DAPI for 1 hour. VECTASHIELD Antifade Mounting Medium was used, and cells were visualized under a confocal microscope (Zeiss, LSM700). For real-time cell imaging, 293T cells were transformed with a GFP-ARID1A structure one day prior and imaged. For hexanediol treatment, 293T cells were cultured in a confocal dish, and the nuclei were stained with Hoechst 33342. 6% 1,6-hexanediol was added directly to the cells under the microscope, and images were continuously acquired. FRAP was performed using a Zeiss LSM700 microscope equipped with a 594 nm laser. Bleaching was performed at 1 μm with 100% laser power. Images were acquired every second. For quantification, various sets of FRAP experiments were performed on independent GFP-ARID1A condensates. The same image acquisition interval was applied to each set of experiments. Fluorescence intensity was acquired through the Zen program (Zeiss). Relative fluorescence intensity was calculated using the initial fluorescence intensity as a reference point. The mean and standard deviation were calculated subsequently.

[0036] 1.4. Protein Expression and Purification Prokaryotic plasmids containing recombinant proteins with His-GFP tags (PrLD1, ARID, PrLD2, Pfam) or His-mCh-EWS / FLI1 were transformed into M15(pREP) cells. After induction with isopropyl-β-D-galactoside, the bacterial pellets were lysed in buffer (50 mM Tris-HCl [pH 7.5], 200 mM NaCl, 1 mM dithiothreitol (DTT), and 1% Triton X-100). The lysates were sonicated and then centrifuged. The supernatant was incubated with Talon beads overnight. The bead-protein complexes were washed three times with the lysate and then eluted using elution buffer (50 mM Tris-HCl [pH 7.5], 200 mM imidazole, and 1 mM DTT). Eluted proteins were evaluated by Coomassie staining, and single protein bands were confirmed. HEK293T cells were used for transformation to purify GFP-ARID1A, GFP-ARID1A PrLD(Y / S), and GFP-ARID1AΔDD. GFP-tagged proteins in the cell lysates were enriched using GFP-Trap magnetic beads (Chromotek). Protein-bead conjugates were rigorously washed five times with a high-salt wash buffer and then eluted using an acidic elution buffer in the manufacturer's suggested configuration. Eluted proteins were immediately neutralized with a neutralization buffer. The size and purity of the eluted proteins were analyzed by SDS-PAGE and Coomassie blue staining.

[0037] 1.5. Droplet formation experiment In vitro droplet formation experiments were performed using conventional methods. Briefly, recombinant proteins were concentrated and desalted using an Amicon Ultra centrifugal filter (30K MWCO, Millipore). Eluted proteins were diluted at various concentrations in a phase separation buffer containing 50 mM Tris-HCl [pH 7.5], 10% glycerol, 10% PEG8000, and 1 mM DTT. Protein solutions were loaded into confocal dishes and imaged using a Zeiss LSM700 microscope. Droplet size was quantified by measuring the circumference of the droplet using the Zen Image Viewer. To characterize the saturation concentration of ARID1A mutants, HEK 293 cells transformed with the corresponding GFP-tagged ARID1A mutants were used 24 hours prior to imaging to measure the saturation concentrations of various ARID1A mutants. The nuclear boundaries of the cells were manually sensed. For individual cells, mean nuclear fluorescence intensity was measured using the NIH Image J program (http: / / rsb.info.nih.gov / ij), confirming the presence of ARID1A mutant condensates. ARID1A protein expression levels were obtained from raw data of previously published proteomic analyses. In short, 375 cell lines were grouped by cancer type, and ARID1A expression levels were determined for each type. The resulting individual, mean, and standard deviations of ARID1A protein expression values ​​are presented in the box diagram.

[0038] 1.6. Wound Healing Analysis Wound healing scratch migration analysis was performed on WT, ARID1A- / -, ARID1A- / -+WT, and ARID1A- / -+ΔDD A673 cell lines. Cells were cultured in 12-well culture plates and cultured until convergence. Cells were scratched with a 200 μl micropipette tip and cultured at 37°C for 48 hours. Micrographs of closed intervals were taken at 0, 24, and 48 hours using the JuLI Stage real-time cell imaging system (NanoEntek; http: / / www.NanoEntek.com). Cell migration distance was quantified by the distance between intervals using the wound healing analysis package provided in the JuLI Stage software. Prices were expressed as mean ± sem.

[0039] 1.7. Spheroid formation and spheroid invasion experiments Spheroid formation experiments were performed using WT, ARID1A- / -, ARID1A- / -+WT, and ARID1A- / -+ΔDD A673 cell lines. 2000 cells were counted from each cell line and pipetteed into Ultra-Low Attachment 96-well plates (Corning Costar). The plates were then centrifuged at low speed for 10 minutes, and the isolated cells were visualized under a microscope. For spheroid formation experiments, cells were cultured at 37°C for 24 hours before imaging. Microscopic images of spheroid growth were taken daily for up to 4 days using the JuLI Stage real-time cell imaging system (NanoEntek; http: / / www.NanoEntek.com). Spheroid volume was quantified through an automated spheroid analysis package provided by the JuLI Stage software. For spheroid invasion experiments, Matrigel (BD Biosciences, Bedford, MA) was added directly to the culture medium containing the spheroids the following day. Matrigel was solidified in the incubator. Microscopic images of globule growth were taken at 0, 24, and 48 hours using the JuLI Stage real-time cell imaging system (NanoEntek). The volume of the globules was quantified through an automated globule analysis package provided by the JuLI Stage software.

[0040] 1.8. Immunohistochemistry To detect ARID1A expression in human tissue samples, formalin-fixed human normal bone tissue (US Biomax, BO244g) and Ewing's sarcoma tissue (US Biomax, T263, T264a) were heated in 10 mM sodium citrate [pH 6.0] for 10 minutes for deparaffinization, hydration, and antigen recovery, and then treated with ARID1A antibody (Abcam, ab182560, 1:200). The tissues were then treated with fluorescently labeled secondary antibody and DAPI for 1 hour. VECTASHIELD Antifade Mounting Medium was used, and the tissues were visualized under a confocal microscope (Zeiss, LSM700). Patient age, sex, and diagnostic information can be found on the company website: US Biomax Ewing's sarcoma tissue; US Biomax normal bone tissue.

[0041] 1.9. Xenotransplantation For in vivo tumor formation, 10 7 Matrigel (BD Biosciences, Bedford, MA) in a volume equivalent to the cells was subcutaneously injected into the left and right flanks of 6-week-old thoracic-avoiding nu / nu female mice (Charles River). Tumors were measured weekly, and the experiment was completed at 5 weeks. Ten tumors were excised from 5 mice for each cell line and weighed. Statistical differences in tumor weight were determined by the Wilcoxon signed-rank test using Graphpad Prism. This experiment was conducted with the approval of the Institute of Animal Science and Coordination (IACUC) at Seoul National University. Tumor sections were stained and imaged as described above. Image quantification was performed using the NIH Image J program (http: / / rsb.info.nih.gov / ij).

[0042] 1.10. ChIP Experiment Cells were cross-bound with 1% formaldehyde at room temperature for 10 minutes. The reaction was then stopped with 1.25 M glycine, and the cells were washed twice with PBS. The cells were then scraped and lysed in a solution supplemented with a total protease inhibitor containing 50 mM Tris-HCl (pH 8.1), 10 mM EDTA, and 1% SDS. The cells were sonicated under sonication conditions of 70 amplitude, 30 minutes processing time, 30 seconds ON and 30 seconds OFF. After sonication, the lysates were centrifuged, and the supernatant was collected. Chromate extracts containing DNA fragments averaging 250 bp were diluted 10-fold in a dilution solution supplemented with a total protease inhibitor containing 1% Triton X-100, 2 mM EDTA, 150 mM NaCl, and 20 mM Tris-HCl (pH 8.1), and used for immunoprecipitation overnight at 4°C. The conjugates were further incubated at 4°C for 2 hours with 40 μl of protein A / G Sepharose blocked with BSA. The beads were washed three times with TSE I buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl (pH 8.1), 150 mM NaCl), TSE II buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl (pH 8.1), 500 mM NaCl), buffer III (0.25 M LiCl, 1% NP-40, 1% deoxycholic acid, 10 mM Tris-HCl (pH 8.1), 1 mM EDTA), and TE buffer (10 mM Tris-HCl (pH 8.0), 1 mM EDTA), and eluted using elution buffer (1% SDS, 0.1 M NaHCO3). Reverse cross-jointing was performed by incubating eluted DNA overnight at 65°C. The DNA was then treated with RNase and Proteinase K. Finally, the DNA was purified using a MinElute PCR Purification Kit (QIAGEN). The purified DNA was used for qPCR analysis with primers targeting each enhancement region of the target gene.

[0043] Example 2. Experimental Results 2.1. Induction of liquid-liquid phase separation of prion-like domains in nuclear ARID1A ARID1A contains several annotated domains, including an ARID DNA-binding domain, a nuclear position signaling domain (NLS), and a Pfam homology domain. Using PONDR and PLAAC, bioinformatics algorithms used to identify intrinsically disordered regions (IDRs) and prion-like domains (PrLDs), respectively, we discovered that ARID1A is primarily composed of PrLDs (Figure 1a). ARID1A has two PrLDs (PrLD1 and PrLD2) separated by the ARID domain. Furthermore, FOLDIndex, a program that scores protein folding, showed that both PrLD1 and PrLD2 are significantly more flexible than the surrounding region and contain smaller, denatured regions (annotated with disordered domains (DD) 1 and 2) (Figure 1a). Finally, catGRANULE analysis revealed that both PrLD1 and PrLD2 exhibit high phase separation orientation (Figure 1a). To investigate whether ARID1A exhibits intracellular phase separation, GFP-ARID1A was expressed in 293T cells, and its intracellular distribution was monitored. GFP-ARID1A showed clear nuclear condensates (Figure 1b). FRAP experiments on the nuclear ARID1A condensates showed rapid molecular rearrangement, confirming that the ARID1A condensates were indeed liquid-like (Figure 1b). The ARID1A condensates increased in size through fusion events, exhibiting a highly spherical morphology, suggesting they possess liquid-like physical properties (Figure 1c). Furthermore, treatment with 1,6-hexanediol, a compound that interferes with phase separation interactions, significantly dissolved the intracellular ARID1A condensates (Figure 1d). GFP-ARID1A generated concentration-dependently separated nuclear condensates (Figure 1e). Overall, the above results indicate that ARID1A experiences liquid-liquid phase separation intracellularly. Next, we attempted to comprehensively identify the region responsible for inducing LLPS (liquid-liquid phase separation) of ARID1A. Through PONDR and PLAAC amino acid sequence-based analysis, we observed that ARID1A possesses two ordered domains containing the ARID domain and the Pfam homology domain, and two disordered domains containing PrLD1 and PrLD2. Proteins that separate through phase separation processes generally possess specific domains that induce condensation.To analyze the portion of ARID1A that plays a crucial role in inducing LLPS, various truncation variants of ARID1A were generated and their intracellular locations were observed (Figure 1f). Full-length GFP-fused ARID1A formed a distinct nuclear condensate, while control GFP expression showed a widely spread staining pattern throughout the entire cell. PrLD1, lacking the NLS, formed a large segment clearly visible under bright light and remained in the cytoplasm. PrLD2, on the other hand, possessing the NLS, adopted a distinct condensate morphology within the nucleus. ARID DNA-binding domains and Pfam homology domains without PrLD did not experience LLPS (Figure 1f). To confirm that PrLD1 and PrLD2 are critical regions for inducing ARID1A LLPS, ARID1A deletion mutations (ΔDD) lacking the disordered domain of ARID1A were generated. These ΔDD mutations did not experience LLPS, demonstrating the essential role of the disordered domains of PrLD1 and PrLD2 in ARID1A condensation. The intermolecular interactions that induce phase separation of the prion-like domain were explained using a sticker-spacer framework. Stickers exhibit relevance interactions to induce phase separation. In the case of PrLD, aromatic residues such as tyrosine were found to act as stickers. Spacers, on the other hand, are ligators that link the stickers and play a regulatory role in phase separation. To investigate whether tyrosine residues are important for ARID1A phase separation, we generated an ARID1A variant in which 52 tyrosine residues in PrLD were replaced with serine. Live cell imaging using the ARID1A PrLD(Y / S) mutation revealed that the disruption of tyrosine interactions completely eliminated PrLD-mediated LLPS, confirming that aromatic residues within PrLD are the main inducers of LLPS. Finally, we studied concentration-dependent nuclear ARID1A condensate formation by tracking the nucleoplasmic concentration at which the ARID1A protein begins to form condensates. As a result, we discovered a clear critical value at which ARID1A begins to form condensates. The size and number of nuclear condensates gradually increased as the molecular concentration exceeded critical levels, including the condensate-forming proteins ARID1A WT, NLS-PrLD1, and PrLD2 (Figure 1g).On the other hand, ARID domain, Pfam homology domain, and LLPS deletion mutations were unable to form nuclear condensates, demonstrating that PrLD in ARID1A plays a crucial role in condensate formation (Figure 1g).

[0044] 2.2. All PrLD and Pfam homology domains are required to integrate the ARID1A BAF complex subunit into the condensate. ARID1A plays a structural role as a core and support structure in the BAF complex, and the C-terminal Pfam homology domain of ARID1A mediates direct molecular contact with other BAF subunits to maintain the stable basic module of the BAF complex. Therefore, we investigated whether ARID1A condensates can compartmentalize their chromatin remodeling cofactors through phase separation. First, we confirmed whether the loss of ARID1A LLPS could affect its interaction with BAF subunits. Immunoblotting experiments revealed that WT and ΔDD mutations maintained interactions with all BAF complex subunits, including SMARCA2, SMARCB, SMARCD, SMARCC1, and SMARCE, while ΔPfam mutations did not interact with BAF complex subunits (Figure 2a). This data indicates that the phase separation ability of ARID1A does not affect its interaction with the BAF complex. When overexpressed in 293T cells, other BAF subunits distinct from ARID1A were diffusely distributed (Figure 2b). To investigate ARID1A's ability to compartmentalize BAF subunits, various recombinant ARID1A proteins were co-expressed with SMARCB1 (Figure 2c) or SMARCD1 (Figure 2d). Since PrLD1 lacks NLS, NLS was artificially added to obtain nuclear condensates. NLS-PrLD1 formed nuclear condensates, but SMARCB1 and SMARCD1 remained diffused, indicating insufficient compartmentalization. In contrast, the BAF subunits successfully integrated by the ARID1A WT condensate did not form droplets with the Y / S mutation in PrLD and ΔDD, and SMARCB1 and SMARCD1 were not properly phase-separated. Finally, similar to NLS-PrLD1, ΔPfam formed distinct condensates in the nucleus but did not compartmentalize SMARCB1 and SMARCD1 (Figure 2c, Figure 2d). This data indicates that the Pfam domain of ARID1A is essential not only for its interaction with BAF complex subunits but also for compartmentalizing BAF complex subunits into the ARID1A condensate.The results suggest a modular domain structure for ARID1A phase separation: PrLD induces condensate formation, and the Pfam domain modulates its components. To confirm whether ARID1A condensates compartmentalize BAF subunits in an endogenous state, immunostaining was performed using anti-SMARCD1 and anti-SMARCC1 antibodies. Co-immunostaining of GFP-ARID1A condensates and endogenous BAF showed noticeable condensation of BAF subunits (Figure 2e). When a phase separation deletion mutant ARID1A was expressed, the molecules exhibited a diffused state. Furthermore, condensates formed by ARID1A lacking the Pfam domain were unable to recruit BAF components, and these remained diffused in the nucleus (Figure 2g). Thus, the data indicate that ARID1A forms nuclear condensates via PrLD-induced phase separation and recruits BAF subunits with the help of the Pfam homology domain.

[0045] 2.3. Significantly reduces Ewing sarcoma growth and invasiveness in those with ARID1A LLPS loss. Next, we investigated the biological context in which endogenous ARID1A LLPS is observed. Quantitative proteomics for analyzing 375 cancer cell lines generated a cancer cell line encyclopedia. Utilizing this resource, we explored ARID1A protein levels in diverse cancer types and found that ARID1A protein levels were significantly higher in Ewing sarcoma compared to many other cancer types (Figure 3a). This abnormally high expression of ARID1A in Ewing sarcoma was validated by immunoblotting analysis in various cancer cell lines, including Ewing sarcoma cell lines (A673 and SK-N-MC) (Figure 3b). We explored whether nuclear condensates mediated by concentration-dependent ARID1A LLPS, observed in vitro and intracellularly, could be sensed in the tissues of Ewing sarcoma patients. Immunohistochemistry was performed on tumor samples obtained from two independent patients with Ewing sarcoma to image the location of ARID1A. Surprisingly, ARID1A showed increased expression in the tissues of Ewing sarcoma patients, forming prominent nuclear foci, while normal bone tissue showed a significantly lower punctate pattern throughout the nucleus (Figure 3c). These results suggest that significant upregulation of ARID1A in Ewing sarcoma leads to the formation of nuclear foci. Proteins that undergo phase separation within cancer cells show higher expression compared to normal cells and possess tumorigenic potential. Therefore, we decided to test the tumorigenic potential of ARID1A in Ewing sarcoma cell lines using cell proliferation, invasion, and migration tests. ARID1A-deficient cell lines were rescued in WT or LLPS-deleted mutant ΔDD cells. Immunocytochemical data showed that endogenous ARID1A formed condensates in WT and ARID1A- / -+WT cells (LLPS-positive), while it remained diffuse in ARID1A- / -+ΔDD cells (LLPS-negative) (Figure 3d). Wound healing analysis was performed using LLPS-positive and LLPS-negative cell lines to evaluate the ability of each generated cancer cell line to repair scratches generated on the surface of the culture dish and to assess its mobility. ARID1A deficiency reduced cell mobility and migration speed, and reconstitution to WT restored the reduced migration speed, but ΔDD mutation did not (Figure 3e).To further demonstrate that ARID1A LLPS promotes cancer progression and ARID1A condensate loss antagonizes it, globule formation analysis and globule invasion analysis were performed to measure the ability of cells to form tumor-like solid structures. Four days after globule formation, the volume of globules formed by LLPS-positive cells was larger than that formed by LLPS-negative cells (Figure 3f). Globulule invasion analysis showed similar results (Figure 3g). Finally, to evaluate whether this phenomenon is reproducible in vivo, cells were subcutaneously injected into nude mice and xenografted in vivo. Tumors generated by ARID1A LLPS-positive cells showed a significantly larger volume than those generated by LLPS-negative cells (Figure 3h). Immunohistochemistry also confirmed that ARID1A condensates were clearly present in ARID1A LLPS-positive tumors, but diffused or were not detected in LLPS-negative tumors (Figure 3i). Overall, the results suggest that ARID1A exhibits strong tumorigenic potential in Ewing sarcoma through PrLDs-mediated LLPS.

[0046] 2.4. Interaction of ARID1A with EWS / FLI1 through phase separation We investigated the direct linkage between EWS / FLI1 and ARID1A by having ARID1A LLPS induce significant changes in the chromatin structure and transcriptional profile of the EWS / FLI1 target gene. Immunoblotting confirmed the direct interaction between the PrLD1 and PrLD2 regions responsible for phase separation in ARID1A and EWS / FLI1 liver (Figure 4a). Furthermore, ARID1A WT capable of LLPS could bind to EWS / FLI1, while PrLD Y / S mutations did not, suggesting that the interaction between ARID1A and EWS / FLI1 is LLPS-dependent (Figure 4a). In addition, in vitro droplet experiments showed that EWS / FLI1 forms a cocondensate with ARID1A WT (Figure 4b). To further investigate the effect of ARID1A LLPS on the organelle location of EWS / FLI1, immunostaining of endogenous EWS / FLI1 was performed in ARID1A LLPS-positive and negative cells. In ARID1A LLPS-positive cells, the formation of nuclear condensates of ARID1A and EWS / FLI1 was observed, indicating that they are located in the same location. However, in ARID1A LLPS-negative cells, the number of EWS / FLI1 condensates was significantly reduced (Figure 4c, Figure 4d). In addition, ChIP experiments were performed in the A673 cell line using anti-EWS / FLI1, anti-H3K27ac, and anti-SMARCC1 antibodies. The target was cRE, an EWS / FLI1-induced gene whose chromatin accessibility has been reported to be regulated by ARID1A LLPS. In all the cREs tested, loss of ARID1A LLPS significantly reduced the chromatin occupancy of EWS / FLI1 and SMARCC1, and also reduced the enhancer histone marker H3K27ac (Figure 4e). Overall, these data suggest that ARID1A nuclear condensates reach EWS / FLI1 target genes through co-phase separation with EWS / FLI1, and subsequently compartmentalize the BAF complex to form an active chromatin remodeling hub, thereby promoting Ewing sarcoma (Figure 5).

[0047] Having described in detail certain aspects of the present invention, it will be clear to those with ordinary skill in the art that such specific techniques are merely preferred embodiments and do not limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A pharmaceutical composition for the prevention or treatment of Ewing's sarcoma, comprising ARID1A (AT-rich interactive domain-containing protein) as an active ingredient, which is a phase separation inhibitor.

2. The pharmaceutical composition for the prevention or treatment of Ewing's sarcoma according to claim 1, characterized in that the phase separation is liquid-liquid phase separation.

3. The pharmaceutical composition for the prevention or treatment of Ewing sarcoma according to claim 1, characterized in that the phase separation is mediated by the prion-like domain of ARID1A.

4. The pharmaceutical composition for the prevention or treatment of Ewing's sarcoma according to claim 2, characterized in that ARID1A interacts with EWS / FLI1 through the aforementioned liquid-liquid phase separation.

5. The pharmaceutical composition for the prevention or treatment of Ewing's sarcoma according to claim 2, characterized in that the liquid-liquid phase separation is carried out through PrLDs.

6. The pharmaceutical composition for the prevention or treatment of Ewing's sarcoma according to claim 1, characterized in that the ARID1A comprises PrLDs and Pfam homology domains.

7. A health functional food composition for the prevention or improvement of Ewing's sarcoma, comprising ARID1A (AT-rich interactive domain-containing protein) as an active ingredient, which is a phase separation inhibitor.

8. The health functional food composition for preventing or improving Ewing's sarcoma according to claim 7, characterized in that the phase separation is liquid-liquid phase separation.

9. The phase separation is mediated by the prion-like domain of ARID1A, as described in claim 7, for use as a health functional food composition for the prevention or improvement of Ewing sarcoma.

10. The functional food composition for preventing or improving Ewing's sarcoma according to claim 8, characterized in that ARID1A interacts with EWS / FLI1 through the liquid-liquid phase separation.

11. The functional food composition for preventing or improving Ewing's sarcoma according to claim 8, characterized in that the liquid-liquid phase separation is carried out through PrLDs.

12. The ARID1A comprises PrLDs and Pfam homology domains, as described in claim 7, and is a functional food composition for the prevention or improvement of Ewing's sarcoma.

13. Screening methods for potential therapeutic substances for Ewing's sarcoma, including the following stages: (a) The step of treating the sample isolated from the organism with a phase separation inhibitor, ARID1A (AT-rich interactive domain-containing protein); (b) A step of comparing the expression level and phase separation level of ARID1A in the processed sample; and (c) A step of selecting substances in which the ARID1A expression level and phase separation level of the sample decrease compared to the expression levels of the normal control group.

14. The method for screening candidate substances for the treatment of Ewing's sarcoma according to claim 13, characterized in that the phase separation is liquid-liquid phase separation.

15. The method for screening candidate substances for the treatment of Ewing's sarcoma according to claim 13, characterized in that the phase separation is mediated by the prion-like domain of ARID1A.

Images