Method for isolating target microorganisms

Abstract

This invention provides a method for isolating target microorganisms, which are rare biospheres, from environmental microbial samples. [Solution] A method for isolating target microorganisms, which are rare biospheres, from an environmental microbial sample, comprising the steps of: preparing donor DNA, which is nucleic acid around the sequence of an antibiotic susceptibility gene, to perform a single nucleotide substitution on the antibiotic susceptibility gene of the target microorganism; introducing the donor DNA into the environmental microbial sample and performing a single nucleotide substitution on the antibiotic binding site of the target microorganism; accumulating and culturing the environmental microbial sample in a liquid medium containing the antibiotic; and separating the microorganism after accumulation and culturing by the agar plate method or the ultradilution method.

Description

[Technical Field]

[0001] This invention relates to a method for isolating target microorganisms, which are rare biospheres, from environmental microbial samples. [Background technology]

[0002] Establishing methods for isolating and culturing microorganisms belonging to rare biospheres is a crucial challenge in the search for useful microbial resources. Rare biospheres are microbial communities composed of extremely diverse species that exist in the environment at very low concentrations. More than 99.9% of the species in the complex microbial systems formed in the environment belong to rare biospheres, but their population ratio is less than 0.1%. Due to the diversity of these microbial species, the probability of useful microbial resources existing in rare biospheres is extremely high. The ecological significance of rare biospheres is still in the nascent research stage (Non-Patent Literature 1), and it has been reported that the significance of rare biospheres is still not fully understood (Non-Patent Literature 2).

[0003] One existing culture technique that allows for the preferential cultivation of microorganisms with low abundance is the accumulation culture method based on the substrate assimilation ability of microorganisms (Non-Patent Literature 3). However, this method is only applicable when the physiological properties of the target microorganism are known.

[0004] The rare microbial species, known as the rare biospheres, only have phylogenetic data available because only genes are detected from extracted environmental DNA, while physiological data is lacking. Therefore, it is currently difficult to develop strategies for culturing rare microorganisms. Consequently, rare biosphere microorganisms, which constitute the majority of environmental microorganisms, cannot be "targeted" for cultivation based on their taxonomic and phylogenetic information, making access to this biosphere critically difficult. [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] Lynch&Neufeld, 2015; Pedr6s Ali6, 2012; Sogin et al., 2006 [Non-Patent Document 2] Akira Hiraishi, Cultureability of Environmental Microorganisms and Their Ecological Significance, Journal of the Japanese Society for Microbial Resources, Vol. 32, No. 1, June 2016. [Non-Patent Document 3] Beijerinck, Martinus W. (1901). “Anhaufungsversuche mit Ureumbakterien”. Centralblatt f. Bakteriologie, II 7: 33-61. [Overview of the Initiative] [Problems that the invention aims to solve]

[0006] This invention has been made in view of the above problems, and aims to provide a method for isolating target microorganisms, which are rare biospheres, from environmental microbial samples. [Means for solving the problem]

[0007] The present invention provides a method for isolating a target microorganism, which is a rare biosphere, from an environmental microorganism sample, and is characterized by comprising the steps of: preparing donor DNA, which is nucleic acid around the sequence of the antibiotic susceptibility gene of the target microorganism, and performing a single nucleotide substitution on the antibiotic susceptibility gene of the target microorganism; introducing the donor DNA into the environmental microorganism sample and performing a single nucleotide substitution on the antibiotic binding site of the target microorganism; accumulating and culturing the environmental microorganism sample in a liquid medium containing the antibiotic; and separating the microorganism after the accumulation and culturing by the agar plate method or the ultradilution method. [Effects of the Invention]

[0008] According to the present invention, based on the nucleotide sequence of the antibiotic susceptibility gene of a target microorganism, a single nucleotide substitution of the antibiotic susceptibility gene is performed to confer antibiotic resistance to the target microorganism, thereby enabling the accumulation and separation of unused microbial resources. According to the present invention, since rare bacterial species in the environment can be targeted for accumulation and separation, rare bacterial species that were difficult to establish an accumulation strategy can be accumulated and separated. Therefore, it can become a systematic basic technology for accessing the rare biosphere. The rare biosphere is an uncharted vast bioresource, and the establishment of a method for accessing this bioresource has extremely important significance that can transform the utilization paradigm of environmental microorganisms.

Brief Description of the Drawings

[0009] [Figure 1] It is a diagram for explaining the outline of a single nucleotide substitution step of introducing donor DNA and performing a single nucleotide substitution at the binding site of a target microorganism to an antibiotic. [Figure 2] It is a diagram for explaining the outline of a culture step of accumulating and culturing an environmental microbial sample in a liquid medium containing an antibiotic.

Embodiments for Carrying Out the Invention

[0010] Hereinafter, embodiments of the present invention will be specifically described with reference to the accompanying drawings. However, the embodiments are for facilitating the understanding of the principle of the present invention, and the scope of the present invention is not limited to the following embodiments. Other embodiments in which those skilled in the art appropriately substitute the configurations of the following embodiments are also included in the scope of the present invention.

[0011] <0000,103>The method for separating a target microorganism according to the present invention is a method for separating a target microorganism, which is a rare biosphere, from an environmental microbial sample, and has the following steps.

[0012] (i) A step of preparing donor DNA, which is a nucleic acid around the sequence of the antibiotic susceptibility gene, for performing a single nucleotide substitution of the antibiotic susceptibility gene of the target microorganism (donor DNA preparation step) (ii) A step in which donor DNA is introduced into an environmental microbial sample and a single nucleotide substitution is performed on the antibiotic binding site of the target microorganism (single nucleotide substitution step). (iii) A step of culturing environmental microbial samples in a liquid culture medium containing antibiotics (culturing step). (iv) Separation step after accumulation culture by agar plate method or ultradilution method (separation step)

[0013] First, an environmental microbiological sample containing multiple microorganisms, including the target microorganism to be isolated, is prepared. The environmental microbiological sample is not particularly limited, but is preferably an activated sludge sample. The activated sludge sample contains microorganisms such as bacteria, protozoa, metazoans, and fungi, and the bacteria include many species such as the genera Commamonas, Zoogloea, Bacillus, Pseudomonas, and Flavobacterium.

[0014] In the donor DNA preparation step, a single nucleotide substitution is performed on the antibiotic susceptibility gene of the target microorganism. Donor DNA (which can also be described as a single-stranded oligonucleotide) is prepared, which is the nucleic acid surrounding the sequence of the antibiotic susceptibility gene. Donor DNA is defined as the nucleic acid surrounding the sequence of the antibiotic susceptibility gene as, for example, an amino acid sequence in which 1 to 30 amino acids are substituted, deleted, inserted, and / or added to the sequence of the antibiotic susceptibility gene.

[0015] The target microorganisms to be isolated are rare biospheres in environmental microbial samples. The number of target microorganisms in the environmental microbial sample is not particularly limited, but for example, 1 × 10⁻⁶ 3 CFU / 100μL~1×10 10 The concentration is CFU / 100μL, preferably 1×10 4 CFU / 100μL~1×10 9 It is CFU / 100μL.

[0016] Furthermore, the relative abundance of the target microorganism in the environmental microbial sample is not particularly limited, but is, for example, 0.001% to 0.1%, and preferably 0.01% to 0.1%.

[0017] The antibiotic used in determining the antibiotic susceptibility of the target microorganism is not particularly limited, but examples include gentamicin, ciprofloxacin, erythromycin, rifampicin, tetracycline, hygromycin, kanamycin, or streptomycin, with streptomycin being preferred.

[0018] The antibiotic sensitivity gene, in the case of streptomycin, is, for example, the rpsL gene. The rpsL gene codes for S12, one of the proteins that make up ribosome particles that perform protein biosynthesis. Streptomycin binds to this protein, inhibiting the complex formation reaction of protein synthesis and causing growth inhibition.

[0019] A single nucleotide substitution in the antibiotic susceptibility gene of a target microorganism is not particularly limited, but for example, it is a single nucleotide substitution in which adenine at position 128 of the rpsL gene is replaced with cytosine (the A at position 128 from the start codon is replaced with C). It is also possible to perform a double nucleotide substitution in the antibiotic susceptibility gene of a target microorganism, in which case the G at position -22 from the start codon is replaced with A, and the A at position 128 is replaced with C.

[0020] The donor DNA, which is the nucleic acid surrounding the sequence of the antibiotic sensitivity gene, is not particularly limited, but is, for example, W542. The sequence of W542 is ATACTTTACGCAGCGCGGAGTTCGGTTTTGTAGGAGTGGTAGTATATACACGAGTACAT (see DOI: 10.1038 / nbt.2508) (Sequence ID 1).

[0021] Furthermore, donor DNA, which is the nucleic acid surrounding the sequence of the antibiotic susceptibility gene, is, for example, Pprpsl. The sequence of Pprpsl is ATACTTTACGCAGTGCCGAGTTAGGTTTTGTCGGCGTGGTGGTGTACACACGGGTGCAC (Sequence ID 2).

[0022] Table 1 below lists specific examples of antibiotics, antibiotic susceptibility genes, single nucleotide substitutions in antibiotic susceptibility genes, mechanisms of antibiotic resistance, and donor DNA, which is the nucleic acid surrounding the sequence of the antibiotic susceptibility gene, in relation to the antibiotic susceptibility of target microorganisms.

[0023] [Table 1]

[0024] In the single-nucleotide substitution process, donor DNA is introduced into an environmental microbial sample, and a single nucleotide substitution is performed at the antibiotic binding site of the target microorganism. Figure 1 is a diagram illustrating the outline of the single-nucleotide substitution process, in which donor DNA is introduced and a single nucleotide substitution is performed at the antibiotic binding site of the target microorganism.

[0025] A single base substitution is performed using the beta gene, one of the constituent genes of the λRed system, and donor DNA. The plasmid vector is used to express the Beta protein in cells and is not particularly limited, but for example, pBBR1, RK2, pSEVA, RSF1010, pSAM2, pIM13, or pCL1 can be used, with pBBR1 being preferred. pBBR1 has been introduced into the cells beforehand by electroporation, and Beta protein expression has been induced by arabinose.

[0026] The introduction of donor DNA into environmental microbial samples is performed by chemical transformation or physical transformation. Examples of physical transformation methods include the introduction of microparticles using a gene gun, direct microinjection, laser transfection, or electroporation. Of the physical transformation methods, electroporation is preferred. Electroporation is a method in which an electric pulse is applied to cells suspended in a DNA solution to create tiny holes in the cell membrane, allowing the DNA to be taken up into the cell. Examples of chemical transformation methods include cationic lipid-mediated introduction, calcium phosphate coprecipitation, DEAE-dextran introduction, or lipofection. Of the chemical transformation methods, lipofection is preferred. The lipofection method mainly uses liposomes made of cationic artificial lipids. Unlike the previously reported liposome method, which encapsulates DNA within liposomes, the lipofection method involves mixing the DNA with the liposomes to form a complex through electrostatic interactions, which is then taken up by phagocytosis or membrane fusion in the cell. As shown in Figure 1, for example, donor DNA containing a single nucleotide substitution in the streptomycin-sensitive gene rpsL of the target microorganism E. coli (Escherichia coli) is introduced by electroporation, thereby introducing a single nucleotide substitution at the streptomycin-binding site of the target microorganism E. coli.

[0027] In the culture process, environmental microbial samples are cultured in a liquid medium containing antibiotics. Figure 2 is a diagram illustrating the outline of the culture process in which environmental microbial samples are cultured in a liquid medium containing antibiotics. Microorganisms that do not continuously express antibiotic resistance cannot be cultured in antibiotic-containing medium. However, microorganisms that continuously express antibiotic resistance can be selectively cultured in antibiotic-containing medium. As shown in Figure 2, for example, E. coli with a mutation that replaces A to C at base 128 of the rpsL gene is conferred with streptomycin resistance, so selective culture in streptomycin-containing medium is possible. On the other hand, microorganisms that do not continuously express streptomycin resistance cannot be selectively cultured in streptomycin-containing medium.

[0028] In the separation step, after the batch culture, separation is performed by the agar plate method or the limiting dilution method. The agar plate method is a technique that uses an agar medium, for example, culturing at 35.0 ± 1.0 °C for 48 ± 3 hours and counting all the colonies grown on the medium. The limiting dilution method is performed when the fungus to be separated cannot grow on the agar medium, and it is a method of obtaining a culture solution derived from a single cell by diluting the medium in which the fungus is suspended many times and culturing it.

[0029] As described above, according to the present invention, by performing a single nucleotide substitution of the antibiotic susceptibility gene of the target microorganism and imparting antibiotic resistance to the target microorganism, it becomes possible to accumulate and separate the target microorganism.

Example

[0030] (1) Example 1 The number of E. coli (E. coli K-12) bacteria was 1.90×10[[ID=I7]] 9 ± 1.06×10 9 CFU / 100 μL (100%). The number of P. putida (Pseudomonas putida mt-2) bacteria was 2.39×10 8 ± 1.49×10 8 [[ID=Z4]]CFU / 100 μL (100%).

[0031] A bacterial solution of a two-species mixed system of E. coli (E. coli K-12) and P. putida (Pseudomonas putida mt-2) was prepared, and an attempt was made to isolate E. coli from this. The number of E. coli (E. coli K-12) bacteria was 1.90×10 8 ± 1.06×10 8 CFU / 100 μL, and the number of P. putida (Pseudomonas putida mt-2) bacteria was 2.15×10 8 ± 1.34×10 8 CFU / 100 μL. That is, it was a two-species mixed system with 1 / 10 the number of E. coli (E. coli K-12) bacteria and 9 / 10 the number of P. putida (Pseudomonas putida mt-2) bacteria.

[0032] (1-1) Plasmid construction The plasmid vector pBBR1-β was prepared using the following method. pBBR1-λred (SEQ ID NO: 18) was constructed by inserting three λred genes into the commercially available pBBR1-MCS2 (SEQ ID NO: 17). Specifically, first, using pCas (DOI: 10.1128 / AEM.04023-14, see SEQ ID NO: 19) as a template, PCR was performed under the conditions shown in Table 3 using the primer sets araC-red-F (SEQ ID NO: 9) and araC-red-R (SEQ ID NO: 10) shown in Table 2 to amplify the region containing the three λred genes, the araBAD promoter, and the araC gene. Next, using pBBR1-MCS2 as a template, PCR was performed under the conditions shown in Table 4 using the primer sets pBBR1-red-in-F (SEQ ID NO: 11) and pBBR1-red-in-R (SEQ ID NO: 12) shown in Table 2 to obtain a linearized vector. pBBR1-λred was obtained by inserting the amplified PCR product into the resulting linearization vector according to the protocol of the In-Fusion HD Cloning Kit (Clontech). All PCRs were performed using KOD One (TOYOBO) with the compositions shown in Table 5.

[0033] [Table 2]

[0034] [Table 3]

[0035] [Table 4]

[0036] [Table 5]

[0037] pBBR1-λBE (SEQ ID NO: 20) and pBBR1-β (SEQ ID NO: 21) were constructed using the KOD plus mutagenesis Kit (TOYOBO). Specifically, pBBR1-λBE was constructed by performing inverse PCR using pBBR1-λred as a template with the Beta-F (SEQ ID NO: 14) and pBAD-R (SEQ ID NO: 13) primer sets shown in Table 2, at the composition shown in Table 5 and the conditions shown in Table 6, and then self-ligating the resulting PCR product. Next, pBBR1-β was constructed by performing inverse PCR using pBBR1-λBE as a template with the ramudatl3-F (SEQ ID NO: 16) and Beta-R (SEQ ID NO: 15) primer sets shown in Table 2, at the composition shown in Table 5 and the conditions shown in Table 7, and then self-ligating the resulting PCR product.

[0038] [Table 6]

[0039] [Table 7]

[0040] (1-2) Introduction of pBBR1-β into E. coli K-12 and P. putida mt-2 The introduction of pBBR1-β into E. coli K-12 and P. putida mt-2 was performed using the following method. Each strain was cultured using LB medium with the composition shown in Table 8. Each strain was inoculated onto LB agar plates, a single colony was picked, and it was inoculated into 5 mL of LB liquid medium for 16 hours of pre-culture. 2 mL of the resulting culture solution was inoculated into 200 mL of LB liquid medium, and OD was performed. 600Main culture was carried out until the value reached 0.2 to 0.3. The culture medium was transferred to a 50 mL centrifuge tube and centrifuged at 5800 × g for 10 min to collect the cell pellet. 10 mL of 300 mM sucrose was added to the collected cell pellet and thoroughly mixed by vortexing to wash the cells. After washing, centrifuging was performed again at 5800 × g for 10 min to collect the cell pellet. A total of two cell washings were performed. 300 mM sucrose was added to the cell pellet after the two washes. 600 The mixture was increased to 40-50%, and thoroughly mixed by vortexing to obtain the cell suspension. An arbitrary amount of pBBR1-β was added to 100 μL of cell suspension, and the entire volume was transferred to an electroporation cuvette with an electrode distance of 2 mm (Bio-Rad Laboratories). Electroporation was then performed using a Gene Pulser Xcell™ electroporation system (Bio-Rad Laboratories) under conditions of 2.5 kV, 200 Ω, and 25 μF. Immediately after electroporation, the entire cell suspension was transferred to 10 mL of LB liquid medium and recovery culture was performed at 37°C for 1 hour. After recovery culture, the cells were spread onto LB agar plates containing 50 μg / ml kanamycin and screened. Plasmids were extracted from the obtained strains to confirm whether they retained pBBR1-β, and these were then used in subsequent experiments.

[0041] [Table 8]

[0042] (1-3) Isolation of each strain from a mixture of E. coli K-12 and P. putida mt-2. Each strain of E. coli K-12 and P. putida mt-2 was cultured using LB medium with the composition shown in Table 8. For isolation experiments, E. coli K-12::pBBR1-β and P. putida mt-2::pBBR1-β, which were introduced with pBBR1-β prepared in (1-1), were used. Each strain was inoculated into 5 mL of LB liquid medium containing 50 μg / ml kanamycin and 10 mM arabinose, and pre-cultured for 16 hours. Kanamycin is necessary to retain pBBR1-β within the cells. The resulting culture was then inoculated into 200 mL of LB medium containing 50 μg / ml kanamycin and 10 mM arabinose, and OD was performed on each strain. 600The cells were cultured until the concentration reached 0.2 to 0.3. Next, a cell suspension was obtained by washing with 300 mM sucrose using the same method as in (1-2). To 100 μL of a mixed cell solution prepared by mixing the obtained cell solutions of E. coli and P. putida in the ratios of Example 1 (1 / 10 E. coli and 9 / 10 P. putida), 500 pmol of donor DNA was added. To isolate E. coli, W542 was used; to isolate P. putida, Pprpsl was used. To isolate S. oneidensis, Sorpsl (CTACTTTACGTAGTGCAGAGTTAGGTTTTGTAGGGGTAGTTGTGTACACACGTGTACAA (SEQ ID NO: 22)) can be used; and to isolate C. necator, Cnrpsl (CAACCTTACGCAGTGCCGAGTTCGGCTTCGTCGGCGTCGTGGTGTACACGCGGGTGCAC (SEQ ID NO: 23)) was added. The entire volume was transferred to an electroporation cuvette with a 2 mm inter-electrode distance (Bio-Rad Laboratories), and then subjected to Genesis under conditions of 2.5 kV, 200 Ω, and 25 μF. Electroporation was performed using the Pulser Xcell™ electroporation system (Bio-Rad Laboratories) to induce a point mutation in the rpsL gene of E. coli (E. coli K-12), substituting adenine at position 128 with cytosine, thereby conferring streptomycin resistance to E. coli (E. coli K-12). Immediately after electroporation, the entire cell suspension was transferred to 10 mL of LB liquid medium containing 10 mM arabinose, and recovery culture was performed at 37°C for 4 hours. After recovery culture, the cells were spread onto LB agar plates containing 1 mg / ml streptomycin and screened. The 16s rRNA gene sequence of the obtained strains was confirmed to verify whether the target strain had been isolated. A total of three isolation experiments were performed, and the viable number of E. coli (E. coli K-12) cells in the suspension was measured from the average value. Abundance of E. coli in suspension = Viable number of E. coli cells / (Viable number of E. coli cells + Viable number of P. putida cells) The calculation was performed using a multiplier of 100. The prevalence of E. coli in the bacterial suspension was 62.1 ± 9.84%.The number of isolated strains was 73 ± 20 CFU. Therefore, isolation of E. coli (E. coli K-12) was possible.

[0043] (2) Example 2 Similar to Example 1, a bacterial suspension was prepared using a mixed system of two bacterial species, E. coli (E. coli K-12) and P. putida (Pseudomonas putida mt-2), and an attempt was made to isolate E. coli from it. The number of E. coli (E. coli K-12) cells was 1.90 × 10⁶. 7 ± 1.06 × 10 7 The number of P. putida (Pseudomonas putida mt-2) cells per 100 μL was 2.37 × 10⁶. 8 ± 1.48 × 10 8 The CFU / 100μL was observed. Specifically, it was a mixed system of two bacterial species: 1 / 100 of E. coli (E. coli K-12) and 99 / 100 of P. putida (Pseudomonas putida mt-2).

[0044] By introducing the single-stranded oligonucleotide W542 into cells using electroporation, a point mutation was induced in the rpsL gene of E. coli (Esherichia coli K-12), in which adenine at position 128 was replaced with cytosine, through the action of the beta gene inserted into pBBR1-β, thereby conferring streptomycin resistance to E. coli (Esherichia coli K-12).

[0045] Similar to Example 1, recovery culture was performed after electroporation. After recovery culture, the strains were spread onto LB agar plates containing 1 mg / ml streptomycin and screened. The 16s rRNA gene sequence of the obtained strains was confirmed to verify whether the target strain had been isolated. The isolation experiment was performed a total of three times, and the number of viable E. coli (E. coli K-12) cells in the suspension was measured from the average value. The prevalence of E. coli in the suspension was 13.6 ± 4.77%. The number of isolated strains was 14 ± 10 CFU. That is, isolation of E. coli (E. coli K-12) was possible.

[0046] (3) Example 3 Similar to Example 1, a bacterial suspension was prepared using a mixed system of two bacterial species, E. coli (E. coli K-12) and P. putida (Pseudomonas putida mt-2), and an attempt was made to isolate E. coli from it. The number of E. coli (E. coli K-12) cells was 1.90 × 10⁶. 6 ± 1.06 × 10 6 The number of P. putida (Pseudomonas putida mt-2) cells per 100 μL was 2.39 × 10⁶. 8 ± 1.49 × 10 8 The CFU / 100μL was the result. Specifically, it was a mixed system of two bacterial species: E. coli (E. coli K-12) at a concentration of 1 / 1000 and P. putida (Pseudomonas putida mt-2) at a concentration of 999 / 1000.

[0047] By introducing the single-stranded oligonucleotide W542 into cells using electroporation, a point mutation was induced in the rpsL gene of E. coli (Esherichia coli K-12), in which adenine at position 128 was replaced with cytosine, through the action of the beta gene inserted into pBBR1-β, thereby conferring streptomycin resistance to E. coli (Esherichia coli K-12).

[0048] Similar to Example 1, recovery culture was performed after electroporation. After recovery culture, the strains were spread onto LB agar plates containing 1 mg / ml streptomycin and screened. The 16s rRNA gene sequence of the obtained strains was confirmed to verify whether the target strain had been isolated. The isolation experiment was performed a total of three times, and the number of viable E. coli (E. coli K-12) cells in the suspension was measured from the average value. The abundance of E. coli in the suspension was 1.56 ± 0.62%. The number of isolated strains was 4 ± 4 CFU. That is, isolation of E. coli (E. coli K-12) was possible.

[0049] (4) Example 4 The number of E. coli (E. coli K-12) bacteria was 1.90 × 10⁻⁶ 9 ± 1.06 × 10 9 The concentration was set to CFU / 100μL (100%). The number of P. putida (Pseudomonas putida mt-2) bacteria was 2.39 × 10⁻⁶. 8 ± 1.49 × 10 8 The concentration was set to CFU / 100μL (100%).

[0050] A bacterial suspension was prepared from a mixed system of two bacterial species, E. coli (E. coli K-12) and P. putida (Pseudomonas putida mt-2), and an attempt was made to isolate P. putida from this suspension. The bacterial count of P. putida (Pseudomonas putida mt-2) was 2.39 × 10⁶. 7 ± 1.49 × 10 7 The number of E. coli (E. coli K-12) cells per 100 μL was 1.71 × 10⁶. 9 ± 0.95 × 10 9 The CFU / 100μL was observed. Specifically, it was a mixed system of two bacterial species: P. putida (Pseudomonas putida mt-2) at a ratio of 1 / 10 and E. coli (E. coli K-12) at a ratio of 9 / 10.

[0051] The plasmid vector pBBR1-β was prepared by inserting the beta gene into the commercially available pBBR1-MCS2, similar to (1-1) in Example 1 described above.

[0052] By introducing the single-stranded oligonucleotide W542 into cells using electroporation, a point mutation was induced in the rpsL gene of P. putida (Pseudomonas putida mt-2), in which adenine at position 128 was replaced with cytosine, via the action of the beta gene inserted into pBBR1-β, thereby conferring streptomycin resistance to P. putida (Pseudomonas putida mt-2). The sequence of Pprpsl was ATACTTTACGCAGTGCCGAGTTAGGTTTTGTCGGCGTGGTGGTGTACACACGGGTGCAC (Sequence ID 2).

[0053] After electroporation, the entire cell suspension was immediately transferred to 10 mL of LB liquid medium containing 10 mM arabinose, and recovery culture was performed at 37°C for 4 hours. After recovery culture, the cells were spread onto LB agar plates containing 1 mg / ml streptomycin and screened. The 16s rRNA gene sequence of the obtained strains was confirmed to verify whether the target strain had been isolated. The isolation experiment was performed a total of three times, and the number of viable P. putida (Psedomonas putida mt-2) cells in the suspension was measured from the average value. The abundance of P. putida in the suspension was calculated as: Abundance of P. putida = Number of viable P. putida cells / (Number of viable E. coli cells + Number of viable P. putida cells) × 100. The abundance of P. putida in the suspension was 0.780 ± 0.328%. The number of isolated strains was 205 ± 220 CFU. In other words, isolation of P. putida (Pseudomonas putida mt-2) was possible.

[0054] (5) Example 5 Similar to Example 4, a bacterial suspension was prepared using a mixed system of two bacterial species, E. coli (E. coli K-12) and P. putida (Pseudomonas putida mt-2), and an attempt was made to isolate P. putida from this suspension. The number of P. putida (Pseudomonas putida mt-2) cells was 2.39 × 10⁶. 6 ± 1.49 × 10 6 The number of E. coli (E. coli K-12) cells per 100 μL was 1.88 × 10⁶. 9 ± 1.05 × 10 9 The CFU / 100mL was the result. Specifically, it was a mixed system of two bacterial species: P. putida (Pseudomonas putida mt-2) at a concentration of 1 / 100 and E. coli (E. coli K-12) at a concentration of 99 / 100.

[0055] By introducing the single-stranded oligonucleotide W542 into cells using electroporation, a point mutation was induced in the rpsL gene of P. putida (Pseudomonas putida mt-2), in which adenine at position 128 was replaced with cytosine, through the action of the beta gene inserted into pBBR1-β, thereby conferring streptomycin resistance to P. putida (Pseudomonas putida mt-2).

[0056] Similar to Example 4, recovery culture was performed after electroporation. After recovery culture, the strains were spread onto LB agar plates containing 1 mg / ml streptomycin and screened. The 16s rRNA gene sequence of the obtained strains was confirmed to verify whether the target strain had been isolated. The isolation experiment was performed a total of three times, and the number of viable P. putida (Pseudomonas putida mt-2) cells in the suspension was measured from the average value. The abundance of P. putida in the suspension was 0.0715 ± 0.0303%. The number of isolated strains was 7.3 ± 4.6 CFU. That is, isolation of P. putida (Pseudomonas putida mt-2) was possible.

[0057] (6) Example 6 Similar to Example 4, a bacterial suspension was prepared using a mixed system of two bacterial species, E. coli (E. coli K-12) and P. putida (Pseudomonas putida mt-2), and an attempt was made to isolate P. putida from this suspension. The number of P. putida (Pseudomonas putida mt-2) cells was 2.39 × 10⁶. 5 ± 1.49 × 10 5 The number of E. coli (E. coli K-12) cells per 100 μL was 1.90 × 10⁶. 9 ± 1.06 × 10 9 The CFU / 100μL was observed. Specifically, it was a mixed system of two bacterial species: P. putida (Pseudomonas putida mt-2) at a concentration of 1 / 1000 and E. coli (E. coli K-12) at a concentration of 999 / 1000.

[0058] By introducing the single-stranded oligonucleotide W542 into cells using electroporation, a point mutation was induced in the rpsL gene of P. putida (Pseudomonas putida mt-2), in which adenine at position 128 was replaced with cytosine, through the action of the beta gene inserted into pBBR1-β, thereby conferring streptomycin resistance to P. putida (Pseudomonas putida mt-2).

[0059] Similar to Example 4, recovery culture was performed after electroporation. After recovery culture, the strains were spread onto LB agar plates containing 1 mg / ml streptomycin and screened. The 16s rRNA gene sequence of the obtained strains was confirmed to verify whether the target strain had been isolated. The isolation experiment was performed a total of three times, and the number of viable P. putida (Pseudomonas putida mt-2) cells in the suspension was measured from the average value. The abundance of P. putida in the suspension was 0.00644 ± 0.00340%. The number of isolated strains was 0.33 ± 0.58 CFU. That is, isolation of P. putida (Pseudomonas putida mt-2) was possible.

[0060] (7) Example 7 In the above-mentioned example, isolation was performed from a two-species mixed system. In this example, isolation is performed from a four-species mixed system. The culture medium for the four-species mixed system was prepared by inoculating the same 200 mL of LB medium with E. coli (Esherichia coli K-12), P. putida (Pseudomanas putida mt-2), S. oneidensis (Shewanella oneidensis MR-1), and C. necator (Cupriavidus necator ATCC 17697). Strains of E. coli (Esherichia coli K-12), P. putida (Pseudomanas putida mt-2), S. oneidensis (Shewanella oneidensis MR-1), and C. necator (Cupriavidus necator ATCC 17697) into which pBBR1-β was introduced were used.

[0061] The total number of viable cells in the mixed system of four bacterial species was confirmed by plate dilution, and it was 5.37 × 10⁶. 9 The CFU / 100μL was observed. Additionally, 33 colonies were randomly selected from the colonies formed on agar plates, and 16s rRNA was amplified by colony PCR. The proportion of each strain was then measured, and the results were as follows: E. coli (Esherichia coli K-12) 16 / 33 (48%), P. putida (Pseudomonas putida mt-2) 17 / 33 (52%), S. oneidensis (Shewanella oneidensis MR-1) 0 / 33 (0%), and C. necator (Cupriavidus necator ATCC 17697) 0 / 33 (0%). An attempt was made to isolate E. coli (Esherichia coli K-12) from this mixed system of four bacterial species.

[0062] The plasmid vector pBBR1-β was created by inserting the beta gene into the commercially available pBBR1-MCS2.

[0063] By introducing the single-stranded oligonucleotide W542 into cells using electroporation, a point mutation was induced in the rpsL gene of E. coli (Esherichia coli K-12), in which adenine at position 128 was replaced with cytosine, through the action of the beta gene inserted into pBBR1-β, thereby conferring streptomycin resistance to E. coli (Esherichia coli K-12).

[0064] After electroporation, the entire cell hydrate was immediately transferred to 10 mL of LB liquid medium containing 10 mM arabinose, and recovery culture was performed at 30°C for 4 hours. After recovery culture, the cells were spread onto LB agar plates containing 1 mg / ml streptomycin and screened. The 16s rRNA gene sequence of the obtained strains was confirmed to verify whether the target strain had been isolated. The number of isolated strains was 25 CFU. That is, isolation of E. coli (E. coli K-12) was possible.

[0065] (8) Example 8 Similar to Example 7, a bacterial suspension was prepared containing a mixture of four bacterial species: E. coli (E. coli K-12), P. putida (Pseudomonas putida mt-2), S. oneidensis (Shewanella oneidensis MR-1), and C. necator (Cupriavidus necator ATCC 17697). An attempt was made to isolate P. putida from this suspension. The total viable cell count in the four-species mixture was 5.37 × 10⁶. 9 At CFU / 100μL, the proportions of each strain were as follows: E. coli (Esherichia coli K-12) 16 / 33 (48%), P. putida (Pseudomonas putida mt-2) 17 / 33 (52%), S. oneidensis (Shewanella oneidensis MR-1) 0 / 33 (0%), and C. necator (Cupriavidus necator ATCC 17697) 0 / 33 (0%).

[0066] By introducing the single-stranded oligonucleotide W542 into cells using electroporation, a point mutation was induced in the rpsL gene of P. putida (Pseudomonas putida mt-2), in which adenine at position 128 was replaced with cytosine, through the action of the beta gene inserted into pBBR1-β, thereby conferring streptomycin resistance to P. putida (Pseudomonas putida mt-2).

[0067] Similar to Example 7, recovery culture was performed after electroporation. After recovery culture, the cells were spread onto LB agar plates containing 1 mg / ml streptomycin and screened. The 16s rRNA gene sequence of the obtained strains was checked to confirm whether the target strain had been isolated. The number of isolated strains was 75,800 CFU. That is, isolation of P. putida (Pseudomonas putida mt-2) was possible. [Industrial applicability]

[0068] It can be used for the isolation and cultivation of rare microorganisms.

Claims

1. A method for isolating target microorganisms, which are rare biospheres, from environmental microbial samples, A step of performing a single nucleotide substitution on the antibiotic susceptibility gene of the target microorganism, and preparing donor DNA which is nucleic acid surrounding the sequence of the antibiotic susceptibility gene, The process involves introducing the donor DNA into the environmental microbial sample and performing a single base substitution on the antibiotic binding site of the target microorganism, A step of culturing the environmental microbial sample in a liquid culture medium containing the aforementioned antibiotic, A method for isolating a target microorganism, characterized by comprising the step of separating it by the agar plate method or ultradilution method after the aforementioned accumulation culture.

2. The method for isolating a target microorganism according to claim 1, characterized in that the antibiotic is streptomycin.

3. The method for isolating a target microorganism according to claim 2, characterized in that the antibiotic susceptibility gene is the rpsL gene.

4. The method for isolating a target microorganism according to claim 3, characterized in that the single nucleotide substitution of the antibiotic susceptibility gene of the target microorganism is a single nucleotide substitution in which adenine at base 128 of the rpsL gene is replaced with cytosine.

5. The method for isolating a target microorganism according to claim 4, characterized in that the donor DNA is W542.

6. The method for isolating a target microorganism according to claim 4, characterized in that the donor DNA is Pprpsl.

7. The number of target microorganisms in the aforementioned environmental microbial sample is 1 × 10⁶. 3 CFU / 100μL to 1×10 10 The method for isolating a target microorganism according to claim 1, characterized in that the concentration is CFU / 100 μL.

8. The method for isolating a target microorganism according to claim 1, characterized in that the relative abundance of the target microorganism in the environmental microbial sample is 0.001% to 0.1%.

9. The method for isolating a target microorganism according to claim 1, characterized in that the introduction of the donor DNA into the environmental microbial sample is performed by a chemical transformation method or a physical transformation method.

10. The method for isolating a target microorganism according to claim 9, characterized in that the physical transformation method is an electroporation method.

Images