OMNI-335 CRISPR nuclease

Abstract

The present invention provides non-naturally occurring compositions containing a CRISPR nuclease comprising a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:1, or a nucleic acid molecule comprising a sequence encoding the CRISPR nuclease.

Description

[Technical Field]

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 284,858 (filed December 28, 2022), the contents of which are incorporated herein by reference.

[0002] Throughout this application, various publications are referenced, including those within parentheses. The entire disclosures of all publications mentioned in this application are incorporated by reference into this application in their entireties to inform the reader of the technology that may be used in or to which the present invention pertains.

[0003] Sequence Listing Reference This application was created on December 22, 2022 on an IBM PC machine using an operating system compatible with MS-Windows®, and incorporates by reference the nucleotide sequence in the XML file with file name "221228_102322-040365_Sequence_Listing_AWG.xml", 34 KB in size, filed as part of this application on December 28, 2023.

[0004] Technical Field The present invention relates, inter alia, to compositions and methods for genome editing. [Background technology]

[0005] The clustered regularly interspaced short palindromic repeats (CRISPR) system in bacterial and archaeal adaptive immunity exhibits extreme diversity in protein composition and genomic locus structure. CRISPR systems have become important tools for research and genome engineering. Nevertheless, many details of CRISPR systems remain unknown, and the application of CRISPR nucleases may be limited by sequence specificity, expression, or delivery. Different CRISPR nucleases have diverse characteristics, including size, PAM site, on-target activity, specificity, cleavage patterns (e.g., blunt ends, sticky ends), and prominent patterns of indel formation after cleavage. Combinations of diverse properties may be useful for various applications. For example, some CRISPR nucleases can target specific genomic loci, while others cannot due to PAM site restrictions. Furthermore, some currently used CRISPR nucleases exhibit pre-existing immunity, potentially limiting their in vivo applicability. See Charlesworth et al., Nature Medicine (2019) and Wagner et al., Nature Medicine (2019). Therefore, the discovery, application, and improvement of novel CRISPR nucleases is important. Summary of the Invention

[0006] Disclosed herein are compositions and methods that can be used for genome engineering, epigenome engineering, genome targeting, cellular genome editing, and / or in vitro diagnostics.

[0007] The disclosed compositions may be used to modify genomic DNA sequences. As used herein, genomic DNA refers to linear and / or chromosomal DNA and / or plasmid or other extrachromosomal DNA sequences present in a cell of interest. In some embodiments, the cell of interest is a eukaryotic cell. In some embodiments, the cell of interest is a prokaryotic cell. In some embodiments, the method generates a double-strand break (DSB) at a predetermined target site in the genomic DNA sequence, resulting in a mutation, addition, and / or deletion of the DNA sequence at the target site in the genome.

[0008] Thus, in some embodiments, the composition contains a clustered regularly interspaced short palindromic repeat (CRISPR) nuclease. In some embodiments, the CRISPR nuclease is a CRISPR-associated protein.

[0009] OMNI-335 CRISPR nuclease Embodiments of the invention provide a CRISPR nuclease designated "OMNI-335" nuclease, shown in Table 1.

[0010] The present invention provides a method for modifying a nucleotide sequence at a target site in the genome of a mammalian cell, comprising: (i) a composition containing a nucleic acid molecule comprising a sequence encoding a CRISPR nuclease having at least 95% identity to the amino acid sequence set forth in SEQ ID NO: 1, or a CRISPR nuclease having a sequence at least 95% identical to the nucleic acid sequence set forth in SEQ ID NOs: 2-3; and (ii) a DNA-targeting RNA molecule, or a DNA polynucleotide encoding the DNA-targeting RNA molecule, comprising a nucleotide sequence complementary to the sequence of the target DNA, into the cell.

[0011] This invention is a) one or more RNA molecules comprising a guide sequence portion linked to direct repeat sequences capable of hybridizing to a target sequence, or one or more nucleotide sequences encoding said one or more RNA molecules; and b) a CRISPR nuclease comprising an amino acid sequence having at least 95% identity to the amino acid sequence set forth in SEQ ID NO: 1, or a nucleic acid molecule comprising a sequence encoding said CRISPR nuclease; Also provided are non-naturally occurring compositions containing a CRISPR-associated system comprising: wherein the one or more RNA molecules hybridize to the target sequence, the target sequence being flanked by complementary sequences of a protospacer adjacent motif (PAM), and the one or more RNA molecules form a complex with an RNA-guided nuclease.

[0012] This invention is a) a CRISPR nuclease comprising a sequence having at least 95% identity to the amino acid sequence set forth in SEQ ID NO: 1, or a nucleic acid molecule comprising a sequence encoding said CRISPR nuclease; and b) i) a nucleotide sequence of a nuclease-binding RNA capable of interacting with / binding to the CRISPR nuclease; and ii) a nucleotide sequence of the DNA-targeting RNA that comprises a sequence complementary to a sequence in the target DNA sequence; one or more RNA molecules, or one or more DNA polynucleotides encoding said one or more RNA molecules, comprising at least one of: Also provided are non-naturally occurring compositions containing a CRISPR-associated system comprising: Here, the CRISPR nuclease can complex with the one or more RNA molecules to form a complex that can hybridize to the target DNA sequence.

[0013] This specification discloses compositions and methods that can be used for genome engineering, epigenome engineering, genome targeting, cellular genome editing, and / or in vitro diagnostics using non-naturally occurring RNA molecules that include a scaffold portion that can specifically bind and activate OMNI-335 CRISPR nuclease to target a DNA target site based on a guide sequence portion of the RNA molecule, also referred to as an RNA spacer portion, and OMNI-335 CRISPR nuclease.

[0014] The disclosed compositions may be used to modify genomic DNA sequences. As used herein, genomic DNA refers to linear and / or chromosomal DNA and / or plasmid or other extrachromosomal DNA sequences present in a cell of interest. In some embodiments, the cell of interest is a eukaryotic cell. In some embodiments, the cell of interest is a prokaryotic cell. In some embodiments, the method generates a double-strand break (DSB) at a predetermined target site in the genomic DNA sequence, resulting in a mutation, addition, and / or deletion of the DNA sequence at the target site in the genome. DETAILED DESCRIPTION OF THE INVENTION

[0015] Detailed Description In some aspects of the invention, the disclosed compositions contain a clustered regularly interspaced short palindromic repeat (CRISPR) nuclease and / or a nucleic acid molecule comprising a sequence encoding the same.

[0016] Table 1 shows novel CRISPR nucleases and the location of one or more substitutions within the nuclease that convert the nuclease into a nickase or a dead nuclease.

[0017] Table 2 lists crRNA, tracrRNA, and single guide RNA (sgRNA) sequences, as well as portions of crRNA, tracrRNA, and sgRNA sequences compatible with each CRISPR nuclease. Thus, a crRNA molecule capable of binding to and targeting OMNI-335 nuclease as part of a crRNA:tracrRNA complex may comprise a crRNA sequence listed in Table 2. The crRNA molecule may further comprise a guide sequence portion or a spacer sequence. Similarly, a tracrRNA molecule capable of binding to and targeting OMNI-335 nuclease as part of a crRNA:tracrRNA complex may comprise a tracrRNA sequence listed in Table 2. Additionally, a single guide RNA molecule capable of binding to and targeting OMNI-335 nuclease may comprise a sequence listed in Table 2. The sgRNA molecule may further comprise a guide sequence portion or a spacer sequence.

[0018] For example, a crRNA molecule for OMNI-335 nuclease (SEQ ID NO: 1) may comprise the sequence set forth in any one of SEQ ID NOs: 5-8; a tracrRNA molecule for OMNI-335 nuclease may comprise the sequence set forth in any one of SEQ ID NOs: 9-19, 21, and 22; and a sgRNA molecule for OMNI-335 nuclease may comprise the sequence set forth in any one of SEQ ID NOs: 4-22. Other crRNA, tracrRNA, or sgRNA molecules for OMNI-335 nuclease can be derived in the same manner from the sequences set forth in Table 2.

[0019] The invention provides a non-naturally occurring composition containing a CRISPR nuclease comprising a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 1, or a nucleic acid molecule comprising a sequence encoding said CRISPR nuclease. The nucleic acid molecule may be, for example, a DNA molecule or an RNA molecule.

[0020] In some embodiments, the CRISPR nuclease has full catalytic activity, is a nickase, or is catalytically inactive, and is fused to a DNA-interacting protein or a modifying protein. For example, the CRISPR nuclease may be fused to a deaminase protein for use in base editing methods. In another example, the CRISPR nuclease may be fused to a reverse transcriptase for use in prime editing methods.

[0021] In some embodiments, the composition further comprises one or more RNA molecules or a DNA polynucleotide encoding any one of said one or more RNA molecules, wherein said one or more RNA molecules and the CRISPR nuclease are not found together in nature, and wherein said one or more RNA molecules are configured to form a complex with the CRISPR nuclease and / or said one or more RNA molecules are configured to target the complex to a target site.

[0022] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 1, and at least one RNA molecule comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 4-22.

[0023] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:1, and the at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs:5-8.

[0024] In some embodiments, the composition further comprises a trans-activating CRISPR RNA (tracrRNA) molecule comprising a sequence set forth in the group consisting of SEQ ID NOs: 9-19, 21, and 22.

[0025] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 1, and the at least one RNA molecule is a single guide RNA (sgRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 4-22.

[0026] In some embodiments, the CRISPR nuclease is a nickase having an inactivated RuvC domain created by amino acid substitutions in the CRISPR nuclease at the positions shown in column 5 of Table 1.

[0027] In some embodiments, the CRISPR nuclease is a nickase having an inactive HNH domain created by amino acid substitutions in the CRISPR nuclease at the positions shown in column 6 of Table 1.

[0028] In some embodiments, the CRISPR nuclease is a dead nuclease having an inactivated RuvC domain and an inactivated HNH domain created by substitution of the CRISPR nuclease at the positions shown in column 7 of Table 1.

[0029] For example, substituting the aspartic acid residue (D) at position 10 of the OMNI-335 amino acid sequence (SEQ ID NO: 1) with another amino acid (e.g., alanine (A)) can inactivate the RuvC domain and generate a nickase form of the OMNI-335 nuclease. Substitutions with other amino acids are permitted at each of the amino acid positions shown in columns 5-7 of Table 1.

[0030] In some aspects, the CRISPR nuclease is a nickase created with an amino acid substitution at position D10, E733, H949, or D952.

[0031] In some aspects, the CRISPR nuclease is a nickase created with an amino acid substitution at position D817, H818, or N841.

[0032] In some embodiments, the CRISPR nuclease is an inactive nuclease created with an amino acid substitution at any one of positions D10, E733, H949, or D952, and an amino acid substitution at any one of positions D817, H818, or N841.

[0033] In some embodiments, the CRISPR nuclease utilizes a protospacer adjacent motif (PAM) sequence shown in column 2 or column 3 of Table 3.

[0034] The invention also provides a method for modifying the nucleotide sequence of a DNA target site in the genome of a cell-free system or a cell, comprising introducing the composition into a cell. In some embodiments, the composition contains a CRISPR nuclease and a crRNA:tracrRNA complex or an sgRNA molecule.

[0035] In some embodiments, the CRISPR nuclease cleaves the DNA strand adjacent to the protospacer adjacent motif (PAM) sequence shown in column 2 or column 3 of Table 3, and cleaves the DNA strand adjacent to the sequence complementary to the PAM sequence. For example, an OMNI-335 nuclease with an appropriate targeting sgRNA or crRNA:tracrRNA complex can cleave DNA at the strand adjacent to the sequence NVTAYTNN or NRTAYTNN, and at the DNA strand adjacent to the sequence complementary to the sequence NVTAYTNN or NRTAYTNN. In some embodiments, the DNA strand is within the nucleus of a cell.

[0036] In some embodiments, the CRISPR nuclease is a nickase having an inactivated RuvC domain created by amino acid substitutions in the CRISPR nuclease at the positions shown in column 5 of Table 1, and cleaves the DNA strand adjacent to the sequence complementary to the PAM sequence.

[0037] In some embodiments, the CRISPR nuclease is a nickase with an inactive HNH domain created by an amino acid substitution in the CRISPR nuclease at the position shown in column 6 of Table 1, and cleaves the DNA strand adjacent to the PAM sequence.

[0038] In some embodiments, the CRISPR nuclease is an inactivated nuclease having an inactivated RuvC domain and an inactivated HNH domain created by substitution of the CRISPR nuclease at the positions shown in column 7 of Table 1, and cleaves the DNA strand adjacent to the PAM sequence.

[0039] The invention also provides a method for modifying the nucleotide sequence of a DNA target site in the genome of a cell-free system or a cell, comprising introducing a composition of the invention into the cell.

[0040] In some aspects, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:1, wherein the CRISPR nuclease cleaves the DNA strand adjacent to an NVTAYTNN or NRTAYTNN protospacer adjacent motif (PAM) sequence and / or cleaves the DNA strand adjacent to a sequence complementary to the PAM sequence.

[0041] In some embodiments, the CRISPR nuclease is a nickase created with an amino acid substitution at position D10, E733, H949, or D952, and cleaves the DNA strand adjacent to the PAM sequence.

[0042] In some embodiments, the CRISPR nuclease is a nickase created with an amino acid substitution at position D817, H818, or N841, and cleaves the DNA strand adjacent to the sequence complementary to the PAM sequence.

[0043] In some aspects, the cell is a eukaryotic cell or a prokaryotic cell.

[0044] In some aspects, the cells are mammalian cells.

[0045] In some embodiments, the cells are human cells.

[0046] This invention is (i) a CRISPR nuclease comprising a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 1; (ii) a crRNA molecule having a guide sequence portion; and (iii) tracrRNA molecule containing a nuclease-binding RNA sequence Also provided is a method for modifying a nucleotide sequence at a target site in the genome of a cell, comprising introducing into the cell

[0047] In some embodiments, the crRNA molecule further comprises a portion having a sequence selected from the group consisting of SEQ ID NOs: 5-8.

[0048] In some embodiments, the tracrRNA molecule comprises a portion having a sequence selected from the group consisting of SEQ ID NOs: 9-19, 21, and 22.

[0049] In some embodiments, the crRNA molecule and the tracrRNA molecule are fused together in the form of a single guide RNA molecule.

[0050] In some embodiments, the sgRNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 4-22.

[0051] In some embodiments, the CRISPR nuclease comprises an amino acid sequence having at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, or 82% amino acid sequence identity to the CRISPR nuclease set forth in SEQ ID NO: 1. In certain embodiments, the sequence encoding the CRISPR nuclease has at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, or 82% identity to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 2-3.

[0052] The invention also provides a non-naturally occurring composition comprising a CRISPR nuclease, wherein the CRISPR nuclease comprises an amino acid sequence corresponding to the amino acid sequence of at least one of Domain A, Domain B, Domain C, Domain D, Domain E, Domain F, Domain G, Domain H, Domain I, or Domain J of SEQ ID NO:1; a) Domain A comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 1 to 43 of SEQ ID NO: 1; b) Domain B comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 44 to 81 of SEQ ID NO: 1; c) Domain C comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 82 to 157 of SEQ ID NO: 1; d) Domain D comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 158 to 304 of SEQ ID NO: 1; e) Domain E comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 305 to 494 of SEQ ID NO: 1; f) Domain F comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 495 to 682 of SEQ ID NO: 1; g) Domain G comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 683 to 735 of SEQ ID NO: 1; h) Domain H comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 736 to 885 of SEQ ID NO: 1; i) Domain I comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 886 to 1020 of SEQ ID NO: 1; j) Domain J comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 1021 to 1297 of SEQ ID NO: 1.

[0053] In some aspects of the invention, the disclosed compositions contain a DNA construct or vector system comprising a nucleotide sequence encoding a CRISPR nuclease or a CRISPR nuclease variant. In some embodiments, the nucleotide sequence encoding the CRISPR nuclease or a CRISPR nuclease variant is operably linked to a promoter operable in a cell of interest. In some embodiments, the cell of interest is a eukaryotic cell. In some embodiments, the cell of interest is a mammalian cell. In some embodiments, the nucleic acid sequence encoding the modified CRISPR nuclease is codon-optimized for use in cells of a particular organism. In some embodiments, the nucleic acid sequence encoding the nuclease is codon-optimized for E. coli. In some embodiments, the nucleic acid sequence encoding the nuclease is codon-optimized for eukaryotic cells. In some embodiments, the nucleic acid sequence encoding the nuclease is codon-optimized for mammalian cells.

[0054] In some embodiments, the composition contains a recombinant nucleic acid comprising a heterologous promoter operably linked to a polynucleotide encoding a CRISPR enzyme having at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90% identity to the sequence set forth in SEQ ID NO: 1. Each possibility is a separate embodiment.

[0055] In some embodiments of the composition, the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95%, or 97% identity to the amino acid sequence set forth in SEQ ID NO:1, or the sequence encoding the CRISPR nuclease has at least 75%, 80%, 85, 90%, 95%, or 97% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs:2 and 3.

[0056] In some embodiments, modified or non-naturally occurring compositions are provided containing a CRISPR nuclease comprising a sequence having at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, or 80% identity to the amino acid sequence set forth in SEQ ID NO: 1, or a nucleic acid molecule comprising a sequence encoding the CRISPR nuclease. Each possibility is a separate embodiment. In some embodiments, the CRISPR nuclease is modified or non-naturally occurring. The CRISPR nuclease may be recombinant. Such CRISPR nucleases are created by collecting genetic material from multiple sources and using laboratory methods (e.g., molecular cloning) to create sequences not otherwise found in organisms.

[0057] In certain embodiments, the CRISPR nuclease further comprises an RNA binding site capable of interacting with a DNA-targeting RNA molecule (gRNA molecule), and an active site that exhibits site-specific enzymatic activity.

[0058] In certain embodiments, the composition further comprises a DNA-targeting RNA molecule or a DNA polynucleotide encoding a DNA-targeting RNA molecule, wherein the DNA-targeting RNA molecule comprises a guide sequence portion, i.e., a nucleotide sequence complementary to a sequence in the target region, and wherein the DNA-targeting RNA molecule and the CRISPR nuclease do not occur together in nature.

[0059] In certain embodiments, the DNA-targeting RNA molecule further comprises a nucleotide sequence that is capable of forming a complex with a CRISPR nuclease.

[0060] This invention is a) one or more RNA molecules comprising a guide sequence portion linked to direct repeat sequences capable of hybridizing to a target sequence, or one or more nucleotide sequences encoding said one or more RNA molecules; and b) a CRISPR nuclease comprising an amino acid sequence having at least 95% identity to the amino acid sequence set forth in SEQ ID NO: 1, or a nucleic acid molecule comprising a sequence encoding said CRISPR nuclease; Also provided are non-naturally occurring compositions containing a CRISPR-associated system comprising: wherein said one or more RNA molecules hybridize to said target sequence; wherein the target sequence is flanked by protospacer adjacent motifs (PAMs), and the one or more RNA molecules form a complex with an RNA-guided nuclease.

[0061] In some embodiments, the composition further comprises an RNA molecule (e.g., a tracrRNA molecule) comprising a nucleotide sequence capable of complexing with a CRISPR nuclease, or a DNA polynucleotide comprising a sequence encoding an RNA molecule capable of complexing with a CRISPR nuclease.

[0062] In some embodiments, the composition further comprises a donor template for homology-directed repair (HDR).

[0063] In some embodiments, the composition is capable of editing a target region of the genome of a cell.

[0064] According to some aspects, (a) an RNA binding site; and Active sites that exhibit site-specific enzymatic activity A CRISPR nuclease or a polynucleotide encoding said CRISPR nuclease, wherein said CRISPR nuclease has at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, 80% identity to the sequence set forth in SEQ ID NO:1; and (b) i) a DNA-targeting RNA sequence comprising a nucleotide sequence complementary to a sequence in a target DNA sequence; and ii) protein-binding RNA sequences that can interact with the RNA-binding site of the CRISPR nuclease; one or more RNA molecules or DNA polynucleotides encoding said one or more RNA molecules, comprising: A naturally occurring composition is provided, comprising: Here, the DNA-targeting RNA sequence and the CRISPR nuclease do not occur together in nature, and each possibility is a separate embodiment.

[0065] In some embodiments, a single RNA molecule is provided, comprising a DNA targeting RNA sequence and a protein-binding RNA sequence, wherein the RNA molecule can form a complex with CRISPR nuclease and function as a DNA targeting module.In some embodiments, the length of the RNA molecule is at most 1000 bases, 900 bases, 800 bases, 700 bases, 600 bases, 500 bases, 400 bases, 300 bases, 200 bases, 100 bases, 50 bases.Each possibility is a separate embodiment.In some embodiments, the first RNA molecule comprising the DNA targeting RNA sequence and the second RNA molecule comprising the protein-binding RNA sequence interact by base pairing or are fused with each other to form a complex with CRISPR nuclease and form one or more RNA molecules that function as a DNA targeting module.

[0066] This invention is a) a CRISPR nuclease comprising a sequence having at least 95% identity to the amino acid sequence set forth in SEQ ID NO: 1, or a nucleic acid molecule comprising a sequence encoding said CRISPR nuclease; and b) i) a nucleotide sequence of a nuclease-binding RNA capable of interacting with / binding to the CRISPR nuclease; and ii) a nucleotide sequence of the DNA-targeting RNA that comprises a sequence complementary to a sequence in the target DNA sequence; one or more RNA molecules, or one or more DNA polynucleotides encoding said one or more RNA molecules, comprising at least one of: Also provided are non-naturally occurring compositions containing a CRISPR-associated system comprising: Here, the CRISPR nuclease can complex with the one or more RNA molecules to form a complex that can hybridize to the target DNA sequence.

[0067] In some embodiments, the CRISPR nuclease and one or more RNA molecules form a CRISPR complex that is capable of binding to and cleaving a target DNA sequence.

[0068] In some embodiments, the CRISPR nuclease and at least one of the one or more RNA molecules do not occur together in nature.

[0069] In one aspect, a) CRISPR nucleases contain an RNA-binding site and an active site that exhibits site-specific enzymatic activity; b) the nucleotide sequence of the DNA-targeting RNA comprises a nucleotide sequence complementary to a sequence in the target DNA sequence; and c) The nucleotide sequence of the nuclease-binding RNA comprises a sequence that interacts with the RNA-binding site of the CRISPR nuclease.

[0070] In one embodiment, the nucleotide sequence of the nuclease-binding RNA and the nucleotide sequence of the DNA-targeting RNA are on a single guide RNA molecule (sgRNA), wherein the sgRNA molecule is capable of forming a complex with a CRISPR nuclease and functioning as a DNA-targeting module.

[0071] In one aspect, the nucleotide sequence of the nuclease-binding RNA is on a first RNA molecule and the nucleotide sequence of the DNA-targeting RNA is on a second RNA molecule, and the first and second RNA molecules interact by base pairing or are fused to each other to form an RNA complex, or sgRNA, that complexes with the CRISPR nuclease and functions as the DNA-targeting module.

[0072] In certain embodiments, the sgRNA is up to 1000 bases, 900 bases, 800 bases, 700 bases, 600 bases, 500 bases, 400 bases, 300 bases, 200 bases, 100 bases, or 50 bases in length.

[0073] In some embodiments, the composition further comprises a donor template for homology-directed repair (HDR).

[0074] In some embodiments, the CRISPR nuclease is not naturally occurring.

[0075] In some embodiments, the CRISPR nuclease is modified to include unnatural or synthetic amino acids.

[0076] In some embodiments, the CRISPR nuclease is modified to include one or more of a nuclear localization sequence (NLS), a cell-penetrating peptide sequence, and / or an affinity tag.

[0077] In certain embodiments, the CRISPR nuclease comprises one or more nuclear localization sequences of sufficient strength to drive accumulation of a detectable amount of a CRISPR complex comprising the CRISPR nuclease in the nucleus of a eukaryotic cell.

[0078] The present invention also provides a method for modifying the nucleotide sequence of a target site in the genome of a cell-free system or a cell, comprising introducing a composition of the present invention into the cell.

[0079] In some embodiments, the cell is a eukaryotic cell.

[0080] In another embodiment, the cell is a prokaryotic cell.

[0081] In some embodiments, the one or more RNA molecules further comprise an RNA sequence comprising a nucleotide molecule capable of complexing with an RNA nuclease (tracrRNA) or a DNA polynucleotide encoding an RNA molecule comprising a nucleotide sequence capable of complexing with a CRISPR nuclease.

[0082] In some embodiments, the CRISPR nuclease comprises one, two, three, four, five, six, seven, eight, nine, ten, or more NLSs at or near the amino terminus, one, two, three, four, five, six, seven, eight, nine, ten, or more NLSs at or near the carboxyl terminus, or a combination of one, two, three, four, five, six, seven, eight, nine, ten, or more NLSs at or near the amino terminus and one, two, three, four, five, six, seven, eight, nine, ten, or more NLSs at or near the carboxyl terminus. In some embodiments, one to four NLSs are fused to the CRISPR nuclease. In some embodiments, the NLS is internal to the open reading frame (ORF) of the CRISPR nuclease.

[0083] The method of fusing NLS at or near the amino terminus, at or near the carboxyl terminus, or within ORF of expressed protein is widely known in the art.For example, to fuse NLS to the amino terminus of CRISPR nuclease, the nucleic acid sequence of NLS is placed immediately after the start codon of CRISPR nuclease in the nucleic acid encoding NLS-fused CRISPR nuclease.Furthermore, to fuse NLS to the carboxyl terminus of CRISPR nuclease, the nucleic acid sequence of NLS is placed after the codon that codes the last amino acid of CRISPR nuclease and before the stop codon.

[0084] The present invention contemplates the combination of NLS, cell-penetrating peptide sequences and / or affinity tags positioned along the ORF of the CRISPR nuclease.

[0085] The amino acid and nucleic acid sequences of the CRISPR nucleases of the present invention may include NLSs and / or TAGs inserted to interrupt the consecutive amino acid or nucleic acid sequences of the CRISPR nuclease.

[0086] In certain embodiments, one or more NLSs are tandemly repeated.

[0087] In certain aspects, one or more NLSs are considered to be proximal to the N-terminus or C-terminus if the nearest amino acid of the NLS is within about 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 40, 50 or more amino acids along the polypeptide chain from the N-terminus or C-terminus.

[0088] As discussed, CRISPR nucleases may be modified to include one or more of a nuclear localization sequence (NLS), a cell-penetrating peptide sequence, or an affinity tag.

[0089] In certain embodiments, the composition further contains a recombinant nucleic acid molecule comprising a heterologous promoter operably linked to a nucleic acid molecule comprising a sequence encoding a CRISPR nuclease.

[0090] In certain embodiments, the CRISPR nuclease or the nucleic acid molecule comprising a sequence encoding the CRISPR nuclease is non-naturally occurring or modified.

[0091] The invention also provides non-naturally occurring or modified compositions containing vector systems comprising nucleic acid molecules comprising sequences encoding the CRISPR nucleases of the invention.

[0092] The invention also provides the use of the compositions of the invention in treating a subject suffering from a disease associated with a genomic mutation, comprising modifying a nucleotide sequence at a target site in the subject's genome.

[0093] The present invention provides a method for modifying a nucleotide sequence at a target site in the genome of a mammalian cell, comprising: (i) a composition containing a nucleic acid molecule comprising a sequence encoding a CRISPR nuclease having at least 95% identity to the amino acid sequence set forth in SEQ ID NO: 1, or a CRISPR nuclease having a sequence at least 95% identical to the nucleic acid sequence set forth in SEQ ID NOs: 2-3; and (ii) a DNA-targeting RNA molecule, or a DNA polynucleotide encoding the DNA-targeting RNA molecule, comprising a nucleotide sequence complementary to the sequence of the target DNA, into the cell.

[0094] In some embodiments, the method is performed ex vivo. In some embodiments, the method is performed in vivo. In some embodiments, some steps of the method are performed ex vivo and some steps are performed in vivo. In some embodiments, the mammalian cells are human cells.

[0095] In some embodiments, the method further comprises (iii) introducing into the cell an RNA molecule comprising the tracrRNA sequence or a DNA polynucleotide encoding an RNA molecule comprising the tracrRNA sequence.

[0096] In some embodiments, the DNA-targeting RNA molecule comprises a crRNA repeat sequence.

[0097] In some embodiments, an RNA molecule comprising a tracrRNA sequence can bind to a DNA-targeting RNA molecule.

[0098] In some embodiments, the DNA-targeting RNA molecule and the RNA molecule comprising the tracrRNA sequence interact to form an RNA complex, which can form an active complex with a CRISPR nuclease.

[0099] In one embodiment, the DNA-targeting RNA molecule and the RNA molecule comprising the nuclease-binding RNA sequence are fused together in the form of a single guide RNA molecule suitable for forming an active complex with a CRISPR nuclease.

[0100] In some embodiments, the guide sequence portion comprises a sequence complementary to a protospacer sequence.

[0101] In some embodiments, the CRISPR nuclease complexes with the DNA-targeting RNA molecule and makes a double-stranded break in the region 3' or 5' of the protospacer adjacent motif (PAM).

[0102] In certain aspects of the methods described herein, the methods are for treating a subject suffering from a disease associated with a genomic mutation, comprising modifying a nucleotide sequence at a target site in the subject's genome.

[0103] In one aspect, the method involves first selecting a subject suffering from a disease associated with a genomic mutation and obtaining cells from the subject.

[0104] The invention also provides modified cells obtained by the methods described herein. In some embodiments, these modified cells are capable of giving rise to progeny cells. In some embodiments, these modified cells are capable of giving rise to progeny cells after transplantation.

[0105] The invention also provides compositions containing these modified cells and a pharmaceutically acceptable carrier, as well as in vitro or ex vivo methods for preparing the same, which involve combining the cells with a pharmaceutically acceptable carrier.

[0106] The invention also provides a composition containing a CRISPR nuclease comprising a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:1 and a non-naturally occurring RNA molecule, wherein the RNA molecule comprises a crRNA repeat portion and a guide sequence portion, wherein the RNA molecule forms a complex with and targets the OMNI-335 nuclease to a DNA target site in the presence of a tracrRNA sequence, the tracrRNA sequence being encoded by the tracrRNA portion of the RNA molecule or the tracrRNA portion of a second RNA molecule.

[0107] In some embodiments, the RNA molecule comprises a tracrRNA portion and further comprises a crRNA repeat portion and a guide sequence portion.

[0108] In some embodiments, the tracrRNA portion is covalently linked to the crRNA repeat sequence by a polynucleotide linker portion.

[0109] In some embodiments, the length of the polynucleotide linker portion is between 4 and 10 nucleotides.

[0110] In some embodiments, the polynucleotide linker has the sequence GAAA.

[0111] In some embodiments, the composition further comprises an OMNI-335 CRISPR nuclease, wherein the OMNI-335 CRISPR nuclease has at least 95% identity to the amino acid sequence set forth in SEQ ID NO:1.

[0112] In some embodiments, the RNA molecules are formed by in vitro transcription (IVT) or solid phase artificial oligonucleotide synthesis.

[0113] In some embodiments, the RNA molecule comprises modified nucleotides.

[0114] The invention also provides a polynucleotide molecule encoding an RNA molecule of any of the above aspects.

[0115] The invention also provides a method for modifying the nucleotide sequence of a DNA target site in the genome of a cell-free system or cell, comprising introducing into the system or cell any of the RNA molecules described herein and a CRISPR nuclease having at least 95% sequence identity to the amino acid sequence set forth in SEQ ID NO:1.

[0116] In some aspects, the cell is a eukaryotic cell or a prokaryotic cell.

[0117] In some aspects, the eukaryotic cell is a human cell or a plant cell.

[0118] The invention also provides a kit for modifying the nucleotide sequence of a DNA target site in the genome of a cell-free system or a cell, comprising introducing into the system or cell a composition of any of the above aspects, a CRISPR nuclease having at least 95% sequence identity to the amino acid sequence set forth in SEQ ID NO:1, and instructions for delivering the RNA molecule and the CRISPR nuclease to the cell.

[0119] In some embodiments of the invention, the non-naturally occurring RNA molecule comprises a "spacer" or "guide sequence" portion. A "spacer portion" or "guide sequence portion" of an RNA molecule refers to a nucleotide sequence that can hybridize to a specific target DNA sequence; for example, the guide sequence portion has a nucleotide sequence that is completely complementary to the targeted DNA sequence along its length. In some embodiments, the length of the guide sequence portion is 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides, or about 17-30, 17-29, 17-28, 17-27, 17-26, 17-25, 17-24, 18-22, 19-22, 18-20, 17-20, or 21-22 nucleotides. Preferably, the entire guide sequence portion is completely complementary to the targeted DNA sequence. The guide sequence portion is a portion of an RNA molecule with a "scaffold portion" that can form a complex with and activate a CRISPR nuclease, and the guide sequence portion of the RNA molecule functions as the DNA targeting portion of the CRISPR complex. When an RNA molecule with a scaffold portion and a guide sequence portion is present simultaneously with a CRISPR molecule, the RNA molecule can direct the CRISPR nuclease to a specific target DNA sequence. Each possibility is a separate embodiment. The spacer portion of the RNA molecule can be specifically designed to target a desired sequence.

[0120] In some embodiments, the nucleotide sequence of the nuclease-binding RNA and the nucleotide sequence of the DNA-targeting RNA (e.g., the spacer or guide sequence portion) are located on a single guide RNA molecule (sgRNA), which can form a complex with an OMNI-335 CRISPR nuclease and function as a DNA-targeting module.

[0121] In one aspect, the nucleotide sequence of the nuclease-binding RNA is on a first RNA molecule and the nucleotide sequence of the DNA-targeting RNA is on a second RNA molecule, and the first and second RNA molecules interact by base pairing to form a complex with the CRISPR nuclease and function as the targeting module.

[0122] In some aspects of the invention, the disclosed methods include methods for modifying the nucleotide sequence of a target site in the genome of a cell-free system or a cell, comprising introducing into the cell a composition of the embodiments described herein.

[0123] The invention also provides the use of a composition or method of the invention to modify a nucleotide sequence at a DNA target site in a cell.

[0124] The invention provides a method for modifying a nucleotide sequence at a target site in the genome of a eukaryotic cell.

[0125] The invention provides methods for modifying a nucleotide sequence at a target site in the genome of a mammalian cell. In some embodiments, the mammalian cell is a human cell.

[0126] The invention provides a method for modifying a nucleotide sequence at a target site within the genome of a plant cell.

[0127] In some embodiments, the method is performed ex vivo. In some embodiments, the method is performed in vivo. In some embodiments, some steps of the method are performed ex vivo and some steps are performed in vivo. In some embodiments, the mammalian cells are human cells.

[0128] The invention also provides modified cells obtained by the methods described herein. In some embodiments, these modified cells are capable of giving rise to progeny cells. In some embodiments, these modified cells are capable of giving rise to progeny cells after transplantation.

[0129] The invention also provides compositions containing these modified cells and a pharmaceutically acceptable carrier, as well as in vitro or ex vivo methods for preparing the same, which involve combining the cells with a pharmaceutically acceptable carrier.

[0130] The invention also provides a kit for modifying the nucleotide sequence of a DNA target site in the genome of a cell-free system or cell, comprising introducing into the system or cell a CRISPR nuclease having at least 95% sequence identity to the amino acid sequence set forth in SEQ ID NO:1, one or more RNA molecules configured to form a complex with the CRISPR nuclease and / or configured to target the complex to the target site, and instructions for delivering the RNA molecules and the CRISPR nuclease to the cell. For example, the kit may be used as a diagnostic kit to detect the presence of a target site (e.g., a DNA sequence) in a nucleotide molecule in a cell or in a test tube.

[0131] DNA-targeting RNA molecules The "guide sequence portion" of an RNA molecule refers to a nucleotide sequence that can hybridize to a specific target DNA sequence. For example, the guide sequence portion has a nucleotide sequence that is partially or completely complementary to the target DNA sequence along the guide sequence portion. In some embodiments, the nucleotide length of the guide sequence portion is 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides, or about 17-50, 17-49, 17-48, 17-47, 17-46, 17-45, 17-44, 17-43, 17-42, 17-41, 17-44, 17-45, 17-46, 17-47, 17-48, 17-49, 17-49, 17-50, 17-51, 17-52, 17-53, 17-54, 17-55, 17-56, 17-57, 17-58, 17-59, 17-60, 17-61, 17-62, 17-63, 17-64, 17-65, 17-66, 17-67, 17-68, 17-69, 17-70, 17-71, 17-72, 17-73, 17-74, 17- 0, 17-39, 17-38, 17-37, 17-36, 17-35, 17-34, 17-33, 17-31, 17-30, 17-29, 17-28, 17-27, 17-26, 17-25, 17-24, 17-22, 17-21, 18-25, 18-24, 18-23, 18-22, 18-21, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-22, 18-20, 20-21, 21-22, or 17-20. The entire length of the guide sequence portion is completely complementary to the target DNA sequence. The guide sequence portion may be a portion of an RNA molecule that can form a complex with a CRISPR nuclease, with the guide sequence portion serving as the DNA targeting portion of the CRISPR complex. When a DNA molecule having a guide sequence portion is present simultaneously with a CRISPR molecule, the RNA molecule can direct the CRISPR nuclease to a specific target DNA sequence. Each possibility is a separate embodiment. The RNA molecule can be specifically designed to target a desired sequence. Thus, a molecule containing a "guide sequence portion" is a type of targeting molecule. Throughout this application, the terms "guide molecule," "RNA guide molecule," "guide RNA molecule," and "gRNA molecule" are synonymous with a molecule containing a guide sequence portion, and the term "spacer" is synonymous with "guide sequence portion."

[0132] In aspects of the invention, CRISPR nucleases have greatest cleavage activity when used with RNA molecules that include a guide sequence portion that is 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides long.

[0133] Single guide RNA (sgRNA) molecules can be used to direct CRISPR nucleases to desired target sites. Single guide RNAs include a guide sequence portion and a scaffold portion. The scaffold portion interacts with CRISPR nucleases, and together with the guide sequence portion, activates and directs CRISPR nucleases to desired target sites. The scaffold portion can be further modified, for example, to reduce its size.

[0134] In some aspects of the invention, the disclosed methods include methods for modifying the nucleotide sequence of a target site in the genome of a cell-free system or a cell, comprising introducing into the cell a composition of the embodiments described herein.

[0135] In some aspects, the cell is a eukaryotic cell, preferably a mammalian cell or a plant cell.

[0136] In some aspects of the invention, the disclosed methods also provide for the use of the compositions described herein in treating a subject suffering from a disease associated with a genomic mutation, comprising modifying a nucleotide sequence at a target site in the subject's genome.

[0137] In some aspects of the invention, the disclosed methods include methods of treating a subject with a mutational disorder, comprising targeting a composition described herein to an allele associated with the mutational disorder.

[0138] In some aspects, the mutational disorder is associated with a disease or disorder selected from neoplasia, age-related macular degeneration, schizophrenia, neurological disorders, neurodegenerative diseases, movement disorders, fragile X syndrome, secretase-related disorders, prion-related disorders, ALS, addiction, autism, Alzheimer's disease, neutropenia, inflammation-related disorders, Parkinson's disease, blood and coagulation diseases and disorders, beta thalassemia, sickle cell anemia, cellular dysregulation, tumor-related diseases and disorders, inflammation and immune-related diseases and disorders, metabolic, liver, kidney and protein diseases and disorders, muscular and skeletal diseases and disorders, skin diseases and disorders, neurological diseases and disorders, and ophthalmic diseases and disorders.

[0139] OMNI CRISPR nuclease domain The characteristic targeted nuclease activity of CRISPR nucleases is conferred by the various functions of their specific domains, which in this application are defined as Domain A, Domain B, Domain C, Domain D, Domain E, Domain F, Domain G, Domain H, Domain I, and Domain J.

[0140] This specification describes the activity of each domain of the OMNI-335 CRISPR nuclease, and the activity of each domain provides an aspect of the nuclease's advantageous characteristics.

[0141] Specifically, Domain A, Domain G, and Domain I form the structural unit of the OMNI CRISPR nuclease, which contains the nuclease active site responsible for DNA strand cleavage. The structural unit formed by Domain A, Domain G, and Domain I cleaves the DNA strand displaced by the guide RNA molecule that binds to the double-stranded DNA target site.

[0142] Domain B is responsible for initiating DNA cleavage activity after binding of the OMNI CRISPR nuclease to its target DNA site.

[0143] Domains C, D, E and F are involved in binding to the guide RNA molecule and providing specificity for target site recognition.

[0144] Domain H contains the nuclease active site responsible for DNA strand cleavage, which cleaves the DNA strand where the guide RNA molecule binds to the DNA target site.

[0145] Domain J is responsible for providing PAM site specificity to the OMNI CRISPR nuclease, including PAM site matching and recognition aspects. Domain J also exerts topoisomerase activity.

[0146] Further description of other CRISPR nuclease domains and their general functions can be found in, inter alia, Mir et al., ACS Chem. Biol. (2019), Palermo et al., Quarterly Reviews of Biophysics (2018), Jiang and Doudna, Annual Review of Biophysics (2017), Nishimasu et al., Cell (2014), and Nishimasu et al., Cell (2015), which are incorporated herein by reference.

[0147] In one aspect of the invention, amino acid sequences having similarity to domains of OMNI CRISPR nucleases may be used to design and produce non-naturally occurring peptides, e.g., CRISPR nucleases, such that the peptides exhibit advantageous characteristics of the activity of the domains of OMNI CRISPR nucleases.

[0148] In certain embodiments, such a peptide, e.g., a CRISPR nuclease, comprises an amino acid sequence having at least 100%, 99.5%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, or 70% identity to the amino acid sequence of at least one of Domain A, Domain B, Domain C, Domain D, Domain E, Domain F, Domain G, Domain H, Domain I, or Domain J of OMNI-335 CRISPR nuclease. In some embodiments, the peptide comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or at least eleven amino acid sequences selected from amino acid sequences having at least 100%, 99.5%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, or 70% identity to the amino acid sequences of Domain A, Domain B, Domain C, Domain D, Domain E, Domain F, Domain G, Domain H, Domain I, and Domain J of OMNI-335 CRISPR nuclease. In certain embodiments, the peptides exhibit extensive amino acid variability relative to the full-length OMNI-335 CRISPR nuclease amino acid sequence outside of an amino acid sequence having at least 100%, 99.5%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, or 70% identity to the amino acid sequence of at least one of Domain A, Domain B, Domain C, Domain D, Domain E, Domain F, Domain G, Domain H, Domain I, or Domain J of OMNI-335 CRISPR nuclease.In one embodiment, the peptide comprises an amino acid sequence between two domain sequences. In one embodiment, the length of the amino acid sequence between the domains is 1 to 10, 10 to 20, 20 to 40, 40 to 50, 50 to 60, 80 to 100, 100 to 150, 150 to 200, 200 to 250, up to 100, up to 200, or up to 300. Each possibility is a separate embodiment. In one embodiment, the sequence between the domains is a linker sequence. In one embodiment, the CRISPR nuclease comprises multiple domains from an OMNI CRISPR nuclease, and the domains are preferably organized alphabetically from the N-terminus to the C-terminus of the CRISPR nuclease. For example, a CRISPR nuclease may contain domain A, domain E, and domain I of OMNI-335, and the order of these domains in the CRISPR nuclease sequence is domain A, domain E, and finally domain I, with amino acid sequences potentially present at either or both ends of each domain.

[0149] In one aspect of the invention, the amino acid sequence encoding any one of the domains of the OMNI CRISPR nuclease described herein may be substituted with one or more amino acids compared to the original OMNI CRISPR nuclease domain sequence. The amino acid substitution may be a conservative substitution, i.e., a substitution with an amino acid having similar chemical properties to the original amino acid. For example, a positively charged amino acid may be substituted with another positively charged amino acid, such as an arginine residue being substituted with a lysine residue, or a polar amino acid being substituted with a different polar amino acid. Conservative substitutions are more tolerated, and an amino acid sequence encoding any one of the domains of the OMNI CRISPR nuclease may contain up to 10% of such substitutions. The amino acid substitution may also be a radical substitution, i.e., a substitution with an amino acid having different chemical properties from the original amino acid. For example, a positively charged amino acid may be substituted with a negatively charged amino acid, such as an arginine residue being substituted with a glutamic acid residue, or a polar amino acid being substituted with a non-polar amino acid. The amino acid substitutions may be semi-conservative, or may be made with any other amino acid. The substitutions may alter the activity of the original OMNI CRISPR nuclease domain function, for example, reducing catalytic nuclease activity.

[0150] In some aspects of the invention, the disclosed compositions include non-naturally occurring compositions comprising a CRISPR nuclease, wherein the CRISPR nuclease comprises an amino acid sequence corresponding to the amino acid sequence of at least one of Domain A, Domain B, Domain C, Domain D, Domain E, Domain F, Domain G, Domain H, Domain I, or Domain J of OMNI-335 CRISPR nuclease. The amino acid ranges for each domain within the OMNI CRISPR nuclease amino acid sequence are set forth in Supplementary Table 1. In some embodiments of the invention, the CRISPR nuclease comprises at least one, at least two, at least three, at least four, or at least five amino acid sequences, each corresponding to any one of the amino acid sequences Domain A, Domain B, Domain C, Domain D, Domain E, Domain F, Domain G, Domain H, Domain I, or Domain J of OMNI-335 CRISPR nuclease. Thus, a CRISPR nuclease may comprise a combination of amino acid sequences corresponding to Domain A, Domain B, Domain C, Domain D, Domain E, Domain F, Domain G, Domain H, Domain I, or Domain J of an OMNI CRISPR nuclease. In some embodiments, the amino acid sequence is at least 100-250, 250-500, 500-1000, 1000-1500, 1000-1700, or 1000-2000 amino acids in length.

[0151] Diseases and Treatments Certain embodiments of the invention target nucleases to specific genetic loci associated with a disease or disorder as a form of gene editing, treatment, or therapy. For example, the novel nucleases disclosed herein may be specifically targeted to pathogenic mutant alleles of a gene using specially designed guide RNA molecules to induce gene editing or knockout. It is preferable to design guide RNA molecules by first considering the PAM requirements of the nuclease, which will also depend on the system in which gene editing will be performed, as described herein. For example, guide RNA molecules designed to target an OMNI-335 nuclease to a target site are designed to include a spacer region complementary to the DNA strand of the DNA double-stranded region adjacent to the OMNI-335 PAM sequence (e.g., "NVTAYTNN" or "NRTAYTNN"). The guide RNA molecule is preferably further designed to include a spacer region (i.e., the region of the guide RNA molecule complementary to the target allele) of sufficient, and preferably optimal, length to increase the specific activity of the nuclease and reduce off-target effects.

[0152] As a non-limiting example, a guide RNA molecule may be designed to target a nuclease to a specific region of a mutant allele, such as near the start codon, so that upon DNA damage by the nuclease, the non-homologous end joining (NHEJ) pathway is induced, resulting in the silencing of the mutant allele by introducing a frameshift mutation. This approach to designing a guide RNA molecule is particularly useful for altering the effect of a dominant-negative mutation, thereby treating a subject. As another non-limiting example, a guide RNA molecule may be designed to target a specific pathogenic mutation of a mutated allele, so that upon DNA damage by the nuclease, the homology-directed repair (HDR) pathway is induced, resulting in template-mediated correction of the mutant allele. This approach to designing a guide RNA molecule is particularly useful for altering the haploinsufficient effect of a mutant allele, thereby treating a subject.

[0153] Non-limiting examples of genes that may be targeted for modification to treat a disease or disorder are provided below. Disease-related genes and mutations that cause mutational disorders have been described in the literature. Such mutations allow for the design of DNA-targeting RNA molecules that direct CRISPR compositions to alleles of disease-related genes, where the CRISPR compositions cause DNA damage and induce DNA repair pathways to modify the alleles, thereby treating the mutational disorder.

[0154] Mutations in the ELANE gene are associated with neutropenia, and therefore, without limitation, aspects of the invention that target ELANE may be used in methods of treating subjects suffering from neutropenia.

[0155] CXCR4 is a co-receptor in human immunodeficiency virus type 1 (HIV-1) infection. Accordingly, without limitation, embodiments of the invention that target CXCR4 may be used in methods of treating a subject with HIV-1 or conferring resistance to HIV-1 infection in a subject.

[0156] Disruption of programmed cell death protein 1 (PD-1) promotes CAR-T cell killing of tumor cells, making PD-1 a potential target for cancer therapy. Accordingly, without limitation, embodiments of the invention that target PD-1 may be used in methods of treating subjects with cancer. In one embodiment, the treatment is CAR-T cell therapy with T cells engineered according to the invention to be PD-1 deficient.

[0157] Furthermore, BCL11A is a gene involved in the suppression of hemoglobin production. Inhibiting BCL11A increases globin production and may treat diseases such as thalassemia and sickle cell anemia. See, for example, International Publication No. 2017 / 077394, U.S. Patent Application Publication No. 2011 / 0182867; Humbert et al. Sci. Transl. Med. (2019), and Canver et al. Nature (2015). Thus, without limitation, embodiments of the invention targeting the BCL11A enhancer may be used in methods for treating subjects with β-thalassemia or sickle cell anemia.

[0158] Aspects of this invention that target disease-associated genes may be used to study, modify, or treat the diseases or disorders listed below in Table A or Table B. Indeed, any disease associated with a genetic locus may be studied, modified, or treated using the nucleases disclosed herein to target the appropriate disease-associated gene (e.g., those listed in U.S. Patent Application Publication No. 2018 / 0282762 and EP 3079726 B1).

[0159] [Table A]

[0160] [Table B-1]

[0161] [Table B-2]

[0162] [Table B-3]

[0163] Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described in the specification can be used in the practice or testing of embodiments of the invention, representative methods and / or materials are described below. In case of conflict, the specification, including definitions, will control. Additionally, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.

[0164] Unless otherwise stated in the discussion section, adjectives such as "substantially" and "about" modifying a condition or relationship of a feature of an embodiment of the invention are understood to mean that the condition or relationship is defined within an acceptable range for operation of the embodiment for its intended use. Unless otherwise indicated, the term "or" in the specification and claims is considered an inclusive "or" rather than an exclusive "or," indicating at least one, and any combination, of the associated items.

[0165] The term "a" or "an" as used herein should be understood to refer to "one or more" of the listed components. It will be clear to one of ordinary skill in the art that the use of the singular includes the plural unless otherwise specified. Thus, the terms "a" and "at least one" have the same meaning in this application.

[0166] To better understand the present teachings and in no way limit the scope of the teachings, unless otherwise specified, all numbers indicating quantities, percentages, or ratios, and other numerical values ​​used in the specification and claims should be understood to be modified in all instances by the term "about." Thus, unless indicated to the contrary, the numerical values ​​set forth in the specification and claims are approximations that may vary depending on the desired properties sought to be obtained. At the very least, each numerical value should be construed in light of the number of significant digits and by applying ordinary rounding techniques.

[0167] Where numerical ranges are stated herein, it is understood that the invention contemplates every integer between the upper and lower limits, inclusive, unless otherwise stated.

[0168] In this specification and claims, the verbs "contain," "include," and "have," and each of their conjugations, are used to indicate that the object of the verb is not necessarily an exhaustive list of components, elements, or parts of the subject of the verb. Other terms used in this specification are intended to have the meaning commonly known in the art.

[0169] The terms "polynucleotide," "nucleotide," "nucleotide sequence," "nucleic acid," and "oligonucleotide" are synonymous. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or their analogs. Polynucleotides may have any three-dimensional structure and may perform any function, known or unknown. Non-limiting examples of polynucleotides include coding and non-coding regions of a gene or gene fragment, loci determined by linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, small interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA sequences, isolated RNA sequences, nucleic acid probes, and primers. A polynucleotide may contain one or more modified nucleotides, such as methylated nucleotides or their analogs. Modifications to the nucleotide structure may occur before or after assembly of the polymer. The nucleotide sequence may be interrupted by non-nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component.

[0170] The term "nucleotide analog" or "modified nucleotide" refers to a nucleotide that contains one or more of various chemical modifications (e.g., substitutions) in the nitrogenous base of the nucleoside (e.g., cytosine (C), thymine (T) or uracil (U), adenine (A) or guanine (G)), in the sugar moiety of the nucleoside (e.g., ribose, deoxyribose, modified ribose, modified deoxyribose, six-membered sugar analog, or open-ring sugar analog), or in the phosphate moiety. Each of the RNA sequences described herein may contain one or more nucleotide analogs.

[0171] In this specification, the following nucleotide identifiers are used to represent nucleotide bases:

[0172] [Table C]

[0173] As used herein, the term "targeting sequence" or "targeting molecule" refers to a nucleotide sequence capable of hybridizing with a specific target sequence or a molecule comprising such a nucleotide sequence; for example, a targeting sequence has a nucleotide sequence that is at least partially complementary to the sequence to be targeted. The targeting sequence or targeting molecule may be a portion of a targeting RNA molecule capable of forming a complex with a CRISPR nuclease, where the targeting sequence serves as the targeting portion of the CRISPR complex. When a molecule having a targeting sequence is present simultaneously with a CRISPR molecule, the RNA molecule can direct the CRISPR nuclease to a specific target sequence. Each possibility is a separate embodiment. The targeting RNA molecule can be specifically designed to target a desired sequence.

[0174] In this specification, the term "targeting" or "directing to the target" refers to the preferential hybridization of a targeting molecule or targeting sequence with a nucleic acid having a target nucleotide sequence. The term "targeting" or "directing to the target" encompasses variable hybridization efficiency, and thus, although the nucleic acid having the target nucleotide sequence is preferentially targeted, it is understood that in addition to on-target hybridization, unintended off-target hybridization may also occur. When an RNA molecule targets a sequence, it is understood that the complex of the RNA molecule and the CRISPR nuclease molecule targets that sequence for nuclease activity.

[0175] When targeting a DNA sequence present in multiple cells, it is understood that targeting encompasses the hybridization of the guide sequence portion of the RNA molecule with the sequence in one or more cells, and also encompasses the hybridization of the RNA molecule with the target sequence in not all cells in multiple cells.Therefore, when targeting a sequence in multiple cells, it is understood that the complex of the RNA molecule and CRISPR nuclease hybridizes with the target sequence in one or more cells, and it is also understood that it may hybridize with the target sequence in not all cells.Therefore, it is understood that the complex of the RNA molecule and CRISPR nuclease may hybridize with the target sequence in one or more cells and cause double-strand breaks, and may hybridize with the target sequence in not all cells and cause double-strand breaks.In this specification, the term "modified cell" refers to a cell in which double-strand breaks are made by the complex of the RNA molecule and CRISPR nuclease as a result of hybridization with the target sequence, i.e., on-target hybridization.

[0176] As used herein, the term "wild-type" is a term of art understood by those skilled in the art and refers to the typical form of a naturally occurring organism, strain, gene, or trait, as distinguished from a variant or mutant. Thus, as used herein, when an amino acid or nucleotide sequence refers to a wild-type sequence, a variant refers to a variant of that sequence, including, for example, a substitution, deletion, or addition. In embodiments of the invention, the modified CRISPR nuclease is a variant of a CRISPR nuclease that includes at least one amino acid modification (e.g., a substitution, deletion, and / or addition) relative to any of the CRISPR nucleases listed in Table 1.

[0177] The terms "non-natural," "non-naturally occurring," or "modified" are used interchangeably and refer to human modification. When used with reference to a nucleic acid molecule or polypeptide, this term may mean that the nucleic acid molecule or polypeptide is at least substantially free from at least one component with which it is naturally associated and found in nature.

[0178] As used herein, the term "amino acid" includes natural and / or unnatural or synthetic amino acids, including glycine, their D or L, optical isomers, and amino acid analogs and peptidomimetics.

[0179] As used herein, "genomic DNA" refers to linear and / or chromosomal DNA and / or plasmid or other extrachromosomal DNA sequences present in a cell or cells of interest. In some embodiments, the cells of interest are eukaryotic cells. In some embodiments, the cells of interest are prokaryotic cells. In some embodiments, the method generates a double-strand break (DSB) at a predetermined target site in the genomic DNA sequence, resulting in a mutation, addition, and / or deletion of the DNA sequence at the target site in the genome.

[0180] "Eukaryotic" cells include, but are not limited to, fungal cells (such as yeast), plant cells, animal cells, mammalian cells, and human cells.

[0181] As used herein, the term "nuclease" refers to an enzyme capable of cleaving phosphodiester bonds between nucleotide subunits of nucleic acids. Nucleases may be isolated or derived from natural sources. The natural source may be any organism. Alternatively, nucleases may be modified or synthetic proteins with phosphodiester bond cleavage activity.

[0182] As used herein, the term "PAM" refers to a nucleotide sequence in a target DNA that is located adjacent to the target DNA sequence and that is recognized by a CRISPR nuclease. The PAM sequence may vary depending on the nuclease.

[0183] As used herein, the term "mutational disorder" or "mutational disease" refers to a disorder or disease associated with a dysfunction of a gene caused by a mutation. A dysfunctional gene that manifests as a mutational disorder contains a mutation in at least one of its alleles and is referred to as a "disease-associated gene." The mutation may be present in any part of the disease-associated gene, for example, a regulatory portion, a coding portion, or a non-coding portion. The mutation may be a substitution, addition, or deletion mutation. Mutations in disease-associated genes may manifest as disorders or diseases depending on any mutation mechanism, such as recessive, dominant-negative, gain-of-function, loss-of-function, or mutations leading to haploinsufficiency of the gene product.

[0184] Those skilled in the art will appreciate that embodiments of this invention disclose RNA molecules that can form a complex with a nuclease (e.g., a CRISPR nuclease), such as by binding to a target genomic DNA sequence of interest adjacent to a protospacer adjacent motif (PAM). The nuclease then cleaves the target DNA, creating a double-stranded break within the protospacer.

[0185] In some embodiments of the invention, the CRISPR nuclease and the targeting molecule form a CRISPR complex that binds to and cleaves a target DNA sequence. The CRISPR nuclease may form a CRISPR complex that includes the CRISPR nuclease and an RNA molecule without a separate tracrRNA molecule. Alternatively, the CRISPR nuclease may form a CRISPR complex with the CRISPR nuclease, an RNA molecule, and a tracrRNA molecule.

[0186] The term "protein binding sequence" or "nuclease binding sequence" refers to a sequence that can bind to a CRISPR nuclease to form a CRISPR complex. Those skilled in the art will understand that a tracrRNA that can bind to a CRISPR nuclease to form a CRISPR complex contains a protein or nuclease binding sequence.

[0187] The "RNA-binding portion" of a CRISPR nuclease refers to the portion of the CRISPR nuclease that can bind to an RNA molecule to form a CRISPR complex, such as the nuclease-binding sequence of a tracrRNA molecule. The "active portion" of a CRISPR nuclease refers to the portion of the CRISPR nuclease that makes a double-stranded break in a DNA molecule, for example, when complexed with a DNA-targeting RNA molecule.

[0188] The RNA molecule may comprise a sequence sufficiently complementary to the tracrRNA molecule so as to hybridize to the tracrRNA through base pairing and promote the formation of a CRISPR complex (see U.S. Patent No. 8,906,616). In some embodiments of the invention, the RNA molecule may further comprise a portion having a tracr mate sequence.

[0189] In some embodiments of the invention, the targeting molecule may further comprise the sequence of a tracrRNA molecule. Such embodiments may be designed as a synthetic fusion of a guide portion of an RNA molecule (gRNA or crRNA) and a transactivating crRNA (tracrRNA), forming a single guide RNA (sgRNA) (see Jinek et al., Science (2012)). Some embodiments of the invention may also form CRISPR complexes that utilize another tracrRNA molecule and another RNA molecule that includes a guide sequence portion. In such embodiments, the tracrRNA molecule may hybridize to the RNA molecule through base pairing, which may be advantageous in certain applications of the invention described herein.

[0190] In some embodiments of the invention, the RNA molecule may contain "nexus" and / or "hairpin" regions that may further specify the structure of the RNA molecule (see Briner et al., Molecular Cell (2014)).

[0191] As used herein, the term "direct repeat" refers to two or more repeats of a particular amino acid sequence of a nucleotide sequence.

[0192] As used herein, an RNA sequence or molecule that can "interact with" or "bind to" a CRISPR nuclease refers to the ability of the RNA sequence or molecule to form a CRISPR complex with a CRISPR nuclease.

[0193] As used herein, the term "operably linked" refers to a relationship (i.e., fusion, hybridization) between two sequences or molecules that allows them to function in their intended manner. In embodiments of the invention, when an RNA molecule is operably linked to a promoter, the RNA molecule and the promoter can function in their intended manner.

[0194] As used herein, the term "heterologous promoter" refers to a promoter that is not naturally associated with the molecule being expressed or the pathway being promoted.

[0195] As used herein, a sequence or molecule has X% "sequence identity" with another sequence or molecule if X% of the bases or amino acids between the sequences of the molecules are the same and in the same relative positions. For example, a first nucleotide sequence that has at least 95% sequence identity with a second nucleotide sequence has at least 95% of the bases in the same relative positions as the other sequence.

[0196] nuclear localization sequence The terms "nuclear localization sequence" and "NLS" are used interchangeably to refer to an amino acid sequence / peptide that directs the transport of a bound protein from the cytoplasm across the nuclear membrane barrier. The term "NLS" is intended to encompass not only specific peptides that can direct the translocation of cytoplasmic polypeptides across the nuclear membrane barrier, but also their derivative nuclear localization sequences. An NLS can direct the nuclear translocation of a polypeptide by attaching it to the N-terminus, C-terminus, or both of the polypeptide. Furthermore, polypeptides with NLSs linked to the N- or C-terminus of an amino acid side chain randomly positioned in their amino acid sequence translocate. NLSs typically consist of one or more short sequences of positively charged lysines or arginines exposed on the protein surface, although other types of NLSs are known. Non-limiting examples of NLSs include NLS sequences derived from SV40 virus large T antigen, nucleoplasmin, c-myc, hRNPA1 M9 NLS, the IBB domain from importin alpha, fibroid T protein, human p53, mouse c-abl IV, influenza virus NS1, hepatitis virus delta antigen, mouse Mx1 protein, human poly(ADP-ribose) polymerase, and steroid hormone receptor (human) glucocorticoid.

[0197] delivery The CRISPR nucleases or CRISPR compositions described herein may be delivered as proteins, DNA molecules, RNA molecules, ribonucleoproteins (RNPs), nucleic acid vectors, or combinations thereof. In some embodiments, the RNA molecules comprise chemical modifications. Non-limiting examples of suitable chemical modifications include 2'-O-methyl (M), 2'-O-methyl-3'-phosphorothioate (MS) or 2'-O-methyl-3'-thioPACE (MSP), pseudouridine, and 1-methylpseudouridine. Each possibility represents a separate embodiment of this invention.

[0198] Nucleotide molecules such as CRISPR nucleases and / or polynucleotides encoding them, as described herein, and optionally additional proteins (e.g., ZFPs, TALENs, transcription factors, restriction enzymes) and / or guide RNAs, may be delivered to target cells by suitable means. Target cells may be any cell (e.g., eukaryotic, prokaryotic) in any environment (e.g., isolated or not, in culture, in vitro, ex vivo, in vivo, in planta).

[0199] In some embodiments, the composition to be delivered comprises a nuclease mRNA and a guide RNA. In some embodiments, the composition to be delivered comprises a nuclease mRNA, a guide RNA, and a donor template. In some embodiments, the composition to be delivered comprises a CRISPR nuclease and a guide RNA. In some embodiments, the composition to be delivered comprises a CRISPR nuclease, a guide RNA, and a donor template for gene editing, e.g., by homology-directed repair. In some embodiments, the composition to be delivered comprises a nuclease mRNA, a DNA-targeting RNA, and a tracrRNA. In some embodiments, the composition to be delivered comprises a nuclease mRNA, a DNA-targeting RNA, a tracrRNA, and a donor template. In some embodiments, the composition to be delivered comprises a CRISPR nuclease, a DNA-targeting RNA, and a tracrRNA. In some embodiments, the composition to be delivered comprises a CRISPR nuclease, a DNA-targeting RNA, a tracrRNA, and a donor template for gene editing, e.g., by homology-directed repair.

[0200] RNA compositions can be delivered using an appropriate viral vector system. Conventional viral and non-viral-based gene transfer methods can be used to introduce nucleic acids and / or CRISPR nucleases into cells (e.g., mammalian cells, plant cells, etc.) and target tissues. Such methods can also be used to provide encoded nucleic acids and / or CRISPR nuclease proteins to cells in vitro. In some embodiments, nucleic acids and / or CRISPR nucleases are administered for in vivo or ex vivo gene therapy. Non-viral vector delivery systems include naked nucleic acids and nucleic acids complexed with delivery vehicles such as liposomes or poloxamers. For reviews of gene therapy procedures, see Anderson, Science (1992); Nabel and Felgner, TIBTECH (1993); Mitani and Caskey, TIBTECH (1993); Dillon, TIBTECH (1993); Miller, Nature (1992); Van Brunt, Biotechnology (1988); Vigne et al., Restorative Neurology and Neuroscience 8:35-36 (1995); Kremer and Perricaudet, British Medical Bulletin (1995); Haddada et al., Current Topics in Microbiology and Immunology (1995) and Yu et al., Gene Therapy 1:13-26 (1994).

[0201] Non-viral methods for delivery of nucleic acids and / or proteins include electroporation, lipofection, microinjection, biolistics, particle gun acceleration, virosomes, liposomes, immunoliposomes, lipid nanoparticles (LNPs), polycation or lipid:nucleic acid conjugates, artificial virions, and drug-enhanced nucleic acid uptake, or delivery to plant cells by bacteria or viruses (e.g., Agrobacterium, Rhizobium sp. NGR234, Sinorhizoboium meliloti, Mesorhizobium loti, Tobacco mosaic virus, Potato virus X, Cauliflower mosaic virus, Cassava vein mosaic virus). See, e.g., Chung et al. Trends Plant Sci. (2006). Sonoporation, for example using the Sonitron 2000 system (Rich-Mar), can also be used to deliver nucleic acids. Cationic lipid-mediated delivery of proteins and / or nucleic acids is also contemplated as an in vivo, ex vivo, or in vitro delivery method. See Zuris et al., Nat. Biotechnol. (2015); Coelho et al., N. Engl. J. Med. (2013); Judge et al., Mol. Ther. (2006); and Basha et al., Mol. Ther. (2011).

[0202] Non-viral vectors, such as transposon-based systems (e.g., recombinant Sleeping Beauty transposon systems or recombinant PiggyBac transposon systems), may also be used to deliver and transpose the polynucleotide sequences of or encoding the molecules of the composition into target cells.

[0203] Other representative nucleic acid delivery systems include those offered by Amaxa® Biosystems (Cologne, Germany), Maxcyte, Inc. (Rockville, Md.), BTX Molecular Delivery Systems (Holliston, Mass.), and Copernicus Therapeutics Inc. (see, e.g., U.S. Pat. No. 6,008,336). Lipofectin is described, for example, in U.S. Pat. Nos. 5,049,386, 4,946,787, and 4,897,355, and lipofection reagents are commercially available (e.g., Transfectam®, Lipofectin®, and Lipofectamine® RNAiMAX). Cationic and neutral lipids suitable for efficient receptor-recognition lipofection of polynucleotides include those disclosed in WO 91 / 17424 and WO 91 / 16024. Delivery to cells (ex vivo) or target tissues (in vivo) is possible.

[0204] The preparation of lipid:nucleic acid complexes, including targeted liposomes such as immunolipid complexes, is widely known to those skilled in the art (see, e.g., Crystal, Science (1995); Blaese et al., Cancer Gene Ther. (1995); Behr et al., Bioconjugate Chem. (1994); Remy et al., Bioconjugate Chem. (1994); Gao and Huang, Gene Therapy (1995); Ahmad and Allen, Cancer Res., (1992); U.S. Patent Nos. 4,186,183; 4,217,344; 4,235,871; 4,261,975; 4,485,054; 4,501,728; 4,774,085; 4,837,028 and 4,946,787).

[0205] Another delivery method involves packaging the nucleic acid to be delivered in an EnGeneIC delivery vehicle (EDV). EDVs are specifically delivered to target tissues using bispecific antibodies, one arm of which has specificity for the target tissue and the other arm for the EDV. The antibody carries the EDV to the surface of the target cell, where it is then transported into the cell by endocytosis. Once inside the cell, its contents are released (see MacDiamid et al., Nature Biotechnology (2009)).

[0206] Delivery vehicles include, but are not limited to, bacteria, preferably non-pathogenic vehicles, nanoparticles, exosomes, microvesicles, biolistic delivery, e.g., by attachment of the composition to gold particles that are fired into cells using a "gene gun", viral vehicles, virus-like particles (VLPs), large VLPs (LVLPs), lentivirus-like particles, transposons, viral vectors, naked vectors, DNA or RNA, including, but not limited to, lentiviruses, AAVs and retroviruses, among other delivery vehicles known in the art.

[0207] Delivery of the CRISPR nuclease and / or polynucleotide encoding the CRISPR nuclease, and optionally additional nucleotide molecules and / or additional proteins or peptides, may be achieved using a single delivery vehicle or method, or a combination of different delivery vehicles or methods. For example, the CRISPR nuclease may be delivered to cells using LNPs, and the crRNA and tracrRNA molecules may be delivered to cells using AAV. Alternatively, the CRISPR nuclease may be delivered to cells using AAV particles, and the crRNA and tracrRNA molecules may be delivered to cells using separate AAV particles, which may be advantageous due to size limitations.

[0208] The use of RNA or DNA virus-based systems for nucleic acid delivery utilizes highly evolved methods to target viruses to specific cells in the body and transport the viral payload to the nucleus. Viral vectors can be administered directly to patients (in vivo) or can be used to treat cells in vitro, and the modified cells are then administered to patients (ex vivo). RNA or DNA virus-based systems for nucleic acid delivery include, but are not limited to, recombinant retroviruses, lentiviruses, adenoviruses, adeno-associated viruses, vaccinia viruses, and herpes simplex virus vectors for gene transfer. However, RNA viruses are preferred for delivery of the RNA compositions described herein. High transduction efficiencies have also been observed in various cells and target tissues. The nucleic acids of the present invention may also be delivered by non-integrating lentiviruses. Optionally, lentivirus-mediated RNA delivery is utilized. In some cases, the lentivirus contains a nuclease mRNA and a guide RNA. In some cases, the lentivirus contains a nuclease mRNA, a guide RNA, and a donor template. In some cases, the lentivirus contains a nuclease protein and a guide RNA. In some cases, the lentivirus comprises a nuclease protein, a guide RNA, and / or a donor template for gene editing, e.g., by homology-directed repair. In some cases, the lentivirus comprises a nuclease mRNA, a DNA targeting RNA, and a tracrRNA. In some cases, the lentivirus comprises a nuclease mRNA, a DNA targeting RNA, a tracrRNA, and a donor template. In some cases, the lentivirus comprises a nuclease protein, a DNA targeting RNA, and a tracrRNA. In some cases, the lentivirus comprises a nuclease protein, a DNA targeting RNA, a tracrRNA, and a donor template for gene editing, e.g., by homology-directed repair.

[0209] As previously described, the compositions described herein can be delivered to target cells using non-integrating lentiviral particle methods (e.g., the LentiFlash® system). Such methods may also be used to deliver mRNA or other RNA to target cells, such that delivery of the RNA to the target cell results in assembly of the compositions described herein inside the target cell. See also WO 2013 / 014537, WO 2014 / 016690, WO 2016 / 185125, WO 2017 / 194902, and WO 2017 / 194903.

[0210] Retroviral tropism can be altered by incorporating foreign envelope proteins, expanding the potential target cell range. Lentiviral vectors are retroviral vectors that can transduce or infect non-dividing cells and typically produce high viral titers. The choice of retroviral gene transfer system depends on the target tissue. Retroviral vectors consist of cis-acting long terminal repeats that can package foreign sequences up to 6-10 kb. A minimal set of cis-acting LTRs is sufficient for vector replication and packaging, which is then used to integrate therapeutic genes into target cells and provide permanent transgene expression. Widely used retroviral vectors include those based on murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), simian immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof (see, e.g., Buchscher Panganiban, J. Virol. (1992); Johann et al., J. Virol. (1992); Sommerfelt et al., Virol. (1990); Wilson et al., J. Virol. (1989); Miller et al., J. Virol. (1991); WO 94 / 26877).

[0211] At least six viral vector approaches are currently available for gene transfer in clinical trials, using methods involving complementation of defective vectors by genes inserted into helper cell lines to generate transducing agents.

[0212] pLASN and MFG-S are examples of retroviral vectors used in clinical trials (Dunbar et al., Blood (1995); Kohn et al., Nat. Med. (1995); Malech et al., PNAS (1997)). PA317 / pLASN was the first therapeutic vector used in gene therapy (Blaese et al., Science (1995)). Transduction efficiencies of over 50% have been observed with MFG-S-packaged vectors (Ellem et al., Immunol Immunother. (1997); Dranoff et al., Hum. Gene Ther. (1997)).

[0213] Packaging cells are used to form viral particles capable of infecting host cells. Such cells include 293 cells, which package adenovirus (AAV), and psi.2 or PA317 cells, which package retrovirus. Viral vectors used in gene therapy are typically obtained by producer cell lines that package nucleic acid vectors into viral particles. The vector typically contains minimal viral sequences necessary for packaging and subsequent integration into the host (if applicable), with other viral sequences replaced by expression cassettes encoding the proteins to be expressed. Missing viral functions are supplied in trans by the packaging cell line. For example, AAV vectors used in gene therapy typically contain only the inverted terminal repeat (ITR) sequences of the AAV genome, which are necessary for packaging and integration into the host genome. The viral DNA is packaged into cell lines containing helper plasmids encoding other AAV genes, namely rep and cap, but lacking the ITR sequences. The cell lines are also infected with adenovirus as a helper. The helper virus facilitates AAV vector replication and expression of AAV genes from the helper plasmid. The helper plasmid lacks ITR sequences and is therefore not packaged in large quantities. Contamination with adenovirus can be reduced, for example, by heat treatment, to which adenovirus is more sensitive than AAV. Furthermore, AAV can be produced on a clinical scale using the baculovirus system (see U.S. Patent No. 7,479,554).

[0214] In many gene therapies, highly specific delivery of gene therapy vectors to specific tissues is desirable. Therefore, viral vectors can be engineered to have specificity for target cells by expressing a ligand as a fusion protein with the viral coat protein on the outer surface of the virus. The ligand is selected to have affinity for a receptor known to be present on the target cells. For example, Han et al., Proc. Natl. Acad. Sci. USA (1995) reported that Moloney murine leukemia virus can be engineered to express human heregulin fused to gp70 and that the recombinant virus infects specific human breast cancer cells expressing the human epidermal growth factor receptor. This principle can be extended to other virus-target cell combinations, where the target cells express a receptor and the virus expresses a fusion protein containing a ligand for the cell surface receptor. For example, filamentous phage can be engineered to display antibody fragments (e.g., FAB, Fv) that have substantially specific binding affinity for a selected cellular receptor. While this discussion primarily applies to viral vectors, the same principles can be applied to nonviral vectors. Such vectors can be modified to contain uptake sequences that facilitate uptake by specific target cells.

[0215] Gene therapy vectors can be delivered in vivo by administration to an individual patient, typically by systemic administration (e.g., intravenous, intraperitoneal, intramuscular, subcutaneous, or intracranial injection) or local application, as described below. Alternatively, vectors can be delivered ex vivo to cells, such as transplanted cells from an individual patient (e.g., lymphocytes, bone marrow aspirate, biopsy tissue) or hematopoietic stem cells from a universal donor, which are then re-implanted into the patient, typically after selection of cells that have incorporated the vector. In some embodiments, in vivo and ex vivo delivery of mRNA, as well as delivery of RNPs, may be utilized.

[0216] Ex vivo cell transfection for diagnostics, research, or gene therapy (e.g., by re-infusion of the transfected cells into the host organism) is widely known to those of skill in the art. In a preferred embodiment, cells are isolated from a subject organism, transfected with an RNA composition, and re-infused into the subject organism (e.g., a patient). A variety of cells suitable for ex vivo transfection are well known to those of skill in the art (see, e.g., Freshney, "Culture of Animal Cells, A Manual of Basic Technique and Specialized Applications" (6th edition, 2010) and the references cited therein for a discussion of methods for isolating and culturing cells from patients).

[0217] Suitable cells include, but are not limited to, eukaryotic and prokaryotic cells and / or cell lines. Non-limiting examples of such cells or cell lines generated from such cells include COS, CHO (e.g., CHO-S, CHO-K1, CHO-DG44, CHO-DUXB11, CHO-DUKX, CHOK1SV), VERO, MDCK, WI38, V79, B14AF28-G3, BHK, HaK, NSO, SP2 / 0-Ag14, HeLa, HEK293 (e.g., HEK293-F, HEK293-H, HEK293-T) and perC6 cells, plant cells (differentiated or undifferentiated), and insect cells such as Spodoptera fugitive flora (Sf), or fungal cells such as Saccharomyces, Pichia, and chizosaccharomyces. In some embodiments, the cell line is a CHO-K1, MDCK, or HEK293 cell line. Additionally, primary cells may be isolated, treated with a nuclease (e.g., ZFN or TALEN) or nuclease system (e.g., CRISPR), and then used ex vivo for reintroduction into a subject. Suitable primary cells include peripheral blood mononuclear cells (PBMCs) and blood cell subsets, such as, but not limited to, CD4+ T cells or CD8+ T cells. Suitable cells also include stem cells, such as, for example, embryonic stem cells, induced pluripotent stem cells, hematopoietic stem cells (CD34+), neural stem cells, and mesenchymal stem cells.

[0218] In one embodiment, stem cells are used in ex vivo procedures for cell transfection and gene therapy. The advantage of using stem cells is that they can be differentiated into other cells in vitro or introduced into a mammal (such as a cell donor) where they engraft in the bone marrow. Methods are known for differentiating CD34+ cells into clinically important immune cells in vitro using cytokines such as GM-CSF, IFNγ, and TNFα (see, for example, Inaba et al., J. Exp. Med. (1992)).

[0219] Stem cells are isolated for transduction and differentiation using known methods. For example, stem cells are isolated from bone marrow cells by panning the bone marrow cells with antibodies that bind to unwanted cells such as CD4+ and CD8+ (T cells), CD45+ (pan-B cells), GR-1 (granulocytes), and Iad (differentiated antigen-presenting cells) (see, for non-limiting examples, Inaba et al., J. Exp. Med. (1992)). In some embodiments, modified stem cells can also be used.

[0220] In particular, any one of the CRISPR nucleases described herein may be suitable for genome editing of post-mitotic cells or cells that are not actively dividing (e.g., arrested cells). Examples of post-mitotic cells that may be edited with the CRISPR nucleases of the invention include, but are not limited to, muscle cells, cardiomyocytes, hepatocytes, bone cells, and neurons.

[0221] Vectors (e.g., retroviruses, liposomes, etc.) containing therapeutic RNA compositions can also be administered directly to an organism for transduction of cells in vivo. Alternatively, naked RNA or mRNA can be administered. Administration can be by routes commonly used to introduce molecules with ultimate contact with blood or tissue cells, including, but not limited to, injection, infusion, topical application, and electroporation. Suitable methods for administering such nucleic acids are available and known to those of skill in the art, and while multiple routes of administration for a particular composition can be used, certain routes often result in more rapid and effective responses than others.

[0222] Suitable vectors for introducing transgenes into immune cells (e.g., T cells) include non-integrating lentiviral vectors, see, e.g., U.S. Patent Application Publication No. 2009 / 0117617.

[0223] Pharmaceutically acceptable carriers are determined in part by the composition being administered, as well as by the method used to administer the composition. Thus, there is a wide variety of suitable formulations of pharmaceutical compositions available, for example, as described in Remington's Pharmaceutical Sciences, 17th ed., 1989.

[0224] DNA repair by homologous recombination The term "homologous recombination repair" or "HDR" refers to a mechanism that repairs DNA damage in cells, e.g., during repair of double- and single-strand breaks in DNA. HDR requires nucleotide sequence homology and uses a "nucleic acid template" (the terms nucleic acid template and donor template are used interchangeably herein) to repair the sequence (e.g., DNA target sequence) where the double- or single-strand break occurred. This results in, for example, the transfer of genetic information from the nucleic acid template to the DNA target sequence. If the nucleic acid template sequence differs from the DNA target sequence and some or all of the nucleic acid template polynucleotide or oligonucleotide is incorporated into the DNA target sequence, HDR can result in an alteration (e.g., addition, deletion, mutation) of the DNA target sequence. In some embodiments, all or part of the nucleic acid template polynucleotide, or a copy of the nucleic acid template, is incorporated at the site of the DNA target sequence.

[0225] The terms "nucleic acid template" and "donor" refer to a nucleotide sequence to be inserted or copied into a genome. A nucleic acid template comprises, for example, one or more nucleotide sequences that may be added to a target nucleic acid, template a change in the target nucleic acid, or be used to modify a target sequence. The nucleic acid template sequence may be any length, for example, from 2 to 10,000 nucleotides (or any integer therebetween), preferably from about 100 to 1,000 nucleotides (or any integer therebetween), and more preferably from about 200 to 500 nucleotides. A nucleic acid template may be a single-stranded nucleic acid or a double-stranded nucleic acid. In some embodiments, a nucleic acid template comprises, for example, one or more nucleotide sequences corresponding to the wild-type sequence of a target nucleic acid, for example, at a target location. In some embodiments, a nucleic acid template comprises, for example, one or more ribonucleotide sequences corresponding to the wild-type sequence of a target nucleic acid, for example, at a target location. In some embodiments, a nucleic acid template comprises modified ribonucleotides.

[0226] Insertion of an exogenous sequence (also referred to as a "donor sequence," "donor template," or "donor") can also be performed, for example, to correct a mutant gene or increase expression of a wild-type gene. It is readily apparent that the donor sequence is usually not identical to the genomic sequence into which it is placed. The donor sequence can comprise a non-homologous sequence flanked by two homologous regions to enable efficient HDR at the target location. Furthermore, the donor sequence can comprise a vector molecule comprising a sequence that is not homologous to the target region in cellular chromatin. The donor molecule can comprise discontinuous regions homologous to cellular chromatin. For example, to target insertion of a sequence not normally present in the target region, the sequence can be present in the donor nucleic acid molecule and can be flanked by regions homologous to the sequence of the target region.

[0227] The donor polynucleotide may be single-stranded and / or double-stranded DNA or RNA and may be introduced into cells in a linear or circular form. See, for example, U.S. Patent Application Publication Nos. 2010 / 0047805; 2011 / 0281361; 2011 / 0207221; and 2019 / 0330620. When introduced in a linear form, the ends of the donor sequence can be protected (e.g., from exonuclease degradation) by methods known to those skilled in the art. For example, one or more dideoxynucleotide residues can be added to the 3' end of the linear molecule, and / or self-complementary oligonucleotides can be ligated to one or both ends. See, for example, Chang and Wilson, Proc. Natl. Acad. Sci. USA (1987); Nehls et al., Science (1996). Other methods of protecting exogenous polynucleotides from degradation include, but are not limited to, the addition of terminal amino groups and the use of modified internucleotide linkages (e.g., phosphorothioates, phosphoramidates, and O-methylribose or deoxyribose residues).

[0228] Thus, embodiments of the invention that use a donor template for repair may use single-stranded and / or double-stranded donor templates, DNA or RNA, that can be introduced into cells in linear or circular form. In some embodiments of the invention, the gene editing composition contains (1) an RNA molecule comprising a guide sequence that makes a double-stranded break in the gene prior to repair, and (2) a donor RNA template for repair, where the RNA molecule comprising the guide sequence is a first RNA molecule and the donor RNA template is a second RNA molecule. In some embodiments, the guide RNA molecule and the template RNA molecule are linked as part of a single molecule.

[0229] The donor sequence may be an oligonucleotide and may be used for gene correction or targeted modification of an endogenous sequence. The oligonucleotide may be introduced into a cell via a vector, electroporated into a cell, or by other methods known in the art. The oligonucleotide may be used to "correct" a mutant sequence in an endogenous gene (e.g., the sickle mutation of beta-globin) or may be used to insert a sequence for a desired purpose into an endogenous gene locus.

[0230] Polynucleotides can be introduced into cells as part of a vector molecule that contains additional sequences, such as, for example, an origin of replication, a promoter, and genes encoding antibiotic resistance. Additionally, donor polynucleotides can be introduced as naked nucleic acid, as nucleic acid complexed with agents such as liposomes, poloxamers, or delivered by recombinant viruses (e.g., adenovirus, AAV, herpesvirus, retrovirus, lentivirus, and integrase-deficient lentivirus (IDLV)).

[0231] The donor is generally inserted such that its expression is driven by the endogenous promoter of the integration site, i.e., the promoter that drives expression of the endogenous gene into which the donor is inserted. However, it will be apparent that the donor may also comprise a promoter and / or enhancer, e.g., a constitutive promoter or an inducible or tissue-specific promoter.

[0232] The donor molecule may be inserted into an endogenous gene such that all, a portion, or none of the endogenous gene is expressed. For example, a transgene described herein may be inserted into an endogenous locus such that a portion of the endogenous sequence (e.g., the N-terminus and / or C-terminus of the transgene) is expressed, e.g., as a fusion with the transgene, or none of the endogenous sequence is expressed. In other embodiments, a transgene (e.g., with or without additional coding sequence, e.g., an endogenous gene) is integrated into an endogenous locus, such as a safe harbor locus (e.g., the CCR5 gene, the CXCR4 gene, the PPP1R12c (also known as AAVS1) gene, the albumin gene, or the Rosa gene). See, e.g., U.S. Patent Nos. 7,951,925 and 8,110,379; U.S. Patent Application Publication Nos. 2008 / 0159996; 20100 / 0218264; 2010 / 0291048; 2012 / 0017290; 2011 / 0265198; 2013 / 0137104; 2013 / 0122591; 2013 / 0177983 and 2013 / 0177960, and U.S. Provisional Application No. 61 / 823,689).

[0233] When an endogenous sequence (either endogenous or a portion of a transgene) is expressed in conjunction with a transgene, the endogenous sequence may be a full-length sequence (wild-type or mutant) or a partial sequence. Preferably, the endogenous sequence is functional. Non-limiting examples of functions of these full-length or partial sequences include increasing the half-life of a polypeptide expressed by the transgene (e.g., a therapeutic gene) and / or acting as a carrier.

[0234] Additionally, although not essential for expression, the exogenous sequence may also include transcriptional or translational regulatory sequences, such as promoters, enhancers, insulators, internal ribosome entry sites, sequences encoding 2A peptides, and / or polyadenylation signals.

[0235] In some embodiments, the donor molecule comprises a sequence selected from the group consisting of a gene encoding a protein (e.g., a coding sequence encoding a protein that is missing in the cell or individual, or an alternative version of a gene encoding a protein), a regulatory sequence, and / or a sequence encoding a structural nucleic acid such as a microRNA or siRNA.

[0236] It is intended that the embodiments described above are applicable to one another, for example, it will be understood that an RNA molecule or composition of the invention may be utilized in a method of the invention.

[0237] All headings in this specification are for organizational purposes only and are not intended to limit the disclosure in any way. The content of each section is equally applicable to all sections.

[0238] Additional objects, advantages, and novel features of the present invention will become apparent to those skilled in the art upon examination of the following examples, which are not intended to be limiting. Additionally, each of the various embodiments and aspects of the invention as described hereinabove and as claimed below finds experimental support in the following examples.

[0239] It will be understood that features of the invention that are, for clarity, described in separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention that are, for brevity, described in a single embodiment, may also be provided separately, in any suitable subcombination, or in other embodiments of the invention, as appropriate. Certain features described in various embodiments should not be considered essential features of those embodiments, unless the embodiment cannot function without those elements.

[0240] Generally, the nomenclature used herein and the laboratory procedures utilized in this invention include molecular, biochemical, microbiological, and recombinant DNA techniques. Such techniques are fully described in the literature. See, e.g., Sambrook et al., "Molecular Cloning: A Laboratory Manual" (1989); Ausubel, R.M. (Ed.), "Current Protocols in Molecular Biology" Volumes I-III (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley & Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (Eds.), "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New York. (1998); methods disclosed in U.S. Patent Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; Cellis, JE (Ed.), "Cell Biology: A Laboratory Handbook", Volumes I-III (1994); Freshney, "Culture of Animal Cells - A Manual of Basic Technique" Third Edition, Wiley-Liss, NY (1994); Coligan JE (Ed.), "Current Protocols in Immunology" Volumes I-III (1994); Stites et al. (Eds.), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (Eds.), "Strategies for Protein Purification and Characterization - A Laboratory Course Manual" CSHL Press (1996); Clokie and Kropinski (Eds.), "Bacteriophage Methods and Protocols", Volume 1: Isolation, Characterization, and Interactions (2009), all of which are incorporated by reference. Other general references are provided throughout this specification.

[0241] In order to facilitate a more complete understanding of the present invention, the following examples are provided. The following examples illustrate representative modes of making and practicing the invention. However, the scope of this invention is not limited to the specific embodiments disclosed in these examples, which are for illustrative purposes only. [Example]

[0242] Experiment details In order to facilitate a more complete understanding of the invention, the following examples are set forth. The following examples illustrate exemplary modes of making and practicing the invention. However, the scope of the invention is not limited to the specific embodiments disclosed in these examples, which are for illustrative purposes only.

[0243] Example OMNI-335 CRISPR nuclease CRISPR repeat (crRNA), trans-activating RNA (tracrRNA), nuclease polypeptide (OMNI), and protospacer adjacent motif (PAM) sequences were predicted from a metagenomic database of sequences from environmental samples.

[0244] Construction of OMNI-335 nuclease polypeptide To construct the novel OMNI-335 nuclease polypeptide, the OMNI-335 nuclease open reading frame was codon-optimized for expression in human cell lines, and the ORF was cloned into the bacterial expression plasmid pET9a (Table 4).

[0245] sgRNA prediction and construction The single guide RNA (sgRNA) of OMNI-335 was predicted by detecting CRISPR repeats and transactivating crRNAs in the respective bacterial genomes. In silico, the sequences of the native and immature crRNA and tracrRNA were connected with the tetraloop "gaaa," and the secondary structure elements of the duplex were predicted using an RNA secondary structure prediction tool.

[0246] The predicted secondary structures of all duplex RNA elements (crRNA-tracrRNA chimeras) were used to identify potential tracrRNA sequences for sgRNA design. To overcome potential transcriptional and structural constraints and evaluate the flexibility of the sgRNA scaffold in the human cellular environment, in some cases the nucleotide sequences of the designed sgRNAs were slightly modified (Table 2, designated "v2"). Finally, up to two versions of the scaffold designed for OMNI-335 were synthesized, attached downstream to a 22-nucleotide universal and unique spacer sequence (T2, SEQ ID NO: 30), and cloned into a bacterial expression plasmid (pShuttleGuide, Table 4) under the control of an inducible T7 promoter combined with a U6 promoter for mammalian expression. T2 - GGAAGAGCAGAGCCUUGGUCUC (SEQ ID NO: 30)

[0247] In vitro depletion assay with TXTL In vitro PAM sequence depletion was tracked using the method described in Maxwell et al., Methods. 2018. Briefly, linear DNA expressing OMNI nuclease and a T7 promoter-driven sgRNA were added to an in vitro cell-free transcription / translation system (TXTL mix, Arbor Bioscience) along with a linear construct expressing T7 polymerase. RNA expression and protein translation in the TXTL mix resulted in the formation of ribonucleoprotein (RNP) complexes. Because linear DNA was used, a Chi6 DNA sequence was added to the TXTL reaction mix to inhibit the exonuclease activity of RecBCD and protect the linear DNA from degradation. The sgRNA spacer was designed to target a library of plasmids (pbPOS T2 library, Table 4) containing targeting protospacers flanking an 8N randomized set of potential PAM sequences. To add the necessary adapters and indexes to both the cleaved library and a control library expressing a non-targeting gRNA, depletion of PAM sequences in the libraries was measured using PCR followed by high-throughput sequencing. After deep sequencing, in vitro activity was confirmed by the percentage of depleted sequences with the same PAM sequence compared to their appearance in the control, indicating functional DNA cleavage by OMNI nuclease (Table 3).

[0248] [Table 1]

[0249] [Table 1-2]

[0250] [Table 2]

[0251] [Table 3]

[0252]

Table 4

[0253]

Table 4-2

[0254] References 1. Ahmad and Allen (1992) “Antibody-mediated Specific Binging and Cytotoxicity of Lipsome-entrapped Doxorubicin to Lung Cancer Cells in Vitro”, Cancer Research 52:4817-20. 2. Anderson (1992) “Human gene therapy”, Science 256:808-13. 3. Basha et al. (2011) “Influence of Cationic Lipid Composition on Gene Silencing Properties of Lipid Nanoparticle Formulations of siRNA in Antigen-Presenting Cells”, Mol. Ther. 19(12):2186-200. 4. Behr (1994) “Gene transfer with synthetic cationic amphiphiles: Prospects for gene therapy”, Bioconjuage Chem 5:382-89. 5. Blaese et al. (1995) “Vectors in cancer therapy: how will they deliver”, Cancer Gene Ther. 2:291-97. 6. Blaese et al. (1995) “T lympocyte-directed gene therapy for ADA-SCID: initial trial results after 4 years”, Science 270(5235):475-80. 7. Briner et al. (2014) “Guide RNA functional modules direct Cas9 activity and orthognality”, Molecular Cell 56:333-39. 8. Buchschacher and Panganiban (1992) “Human immunodeficiency virus vectors for inducible expression of foreign genes”, J. Virol. 66:2731-39. 9. Burstein et al. (2017) “New CRISPR-Cas systems from uncultivated microbes”, Nature 542:237-41. 10. Canver et al., (2015) "BCL11A enhancer dissection by Cas9-mediated in situ saturating mutagenesis", Nature Vol. 527, Pgs. 192-214. 11. Chang and Wilson (1987) “Modification of DNA ends can decrease end-joining relative to homologous recombination in mammalian cells”, Proc. Natl. Acad. Sci. USA 84:4959-4963. 12. Charlesworth et al. (2019) “Identification of preexisting adaptive immunity to Cas9 proteins in humans”, Nature Medicine, 25(2), 249. 13. Chung et al. (2006) “Agrobacterium is not alone: gene transfer to plants by viruses and other bacteria”, Trends Plant Sci. 11(1):1-4. 14. Coelho et al. (2013) “Safety and efficacy of RNAi therapy for transthyretin amyloidosis” N. Engl. J. Med. 369, 819-829. 15. Crystal (1995) “Transfer of genes to humans: early lessons and obstacles to success”, Science 270(5235):404-10. 16. Dillon (1993) “Regulation gene expression in gene therapy” Trends in Biotechnology 11(5):167-173. 17. Dranoff et al. (1997) “A phase I study of vaccination with autologous, irradiated melanoma cells engineered to secrete human granulocyte macrophage colony stimulating factor”, Hum. Gene Ther. 8(1):111-23. 18. Dunbar et al. (1995) “Retrovirally marked CD34-enriched peripheral blood and bone marrow cells contribute to long-term engraftment after autologous transplantation”, Blood 85:3048-57. 19. Ellem et al. (1997) “A case report: immune responses and clinical course of the first human use of ganulocyte / macrophage-colony-stimulating-factor-tranduced autologous melanoma cells for immunotherapy”, Cancer Immunol Immunother 44:10-20. 20. Gao and Huang (1995) “Cationic liposome-mediated gene transfer” Gene Ther. 2(10):710-22. 21. Haddada et al. (1995) “Gene Therapy Using Adenovirus Vectors”, in: The Molecular Repertoire of Adenoviruses III: Biology and Pathogenesis, ed. Doerfler and Boehm, pp. 297-306. 22. Han et al. (1995) “Ligand-directed retro-viral targeting of human breast cancer cells”, Proc. Natl. Acad. Sci. USA 92(21):9747-51. 23. Humbert et al., (2019) "Therapeutically relevant engraftment of a CRISPR-Cas9-edited HSC-enriched population with HbF reactivation in nonhuman primates", Sci. Trans. Med., Vol. 11, Pgs. 1-13. 24. Inaba et al. (1992) “Generation of large numbers of dendritic cells from mouse bone marrow cultures supplemented with granulocyte / macrophage colony-stimulating factor”, J Exp Med. 176(6):1693-702. 25. Jiang and Doudna (2017) “CRISPR-Cas9 Structures and Mechanisms”, Annual Review of Biophysics 46:505-29. 26. Jinek et al. (2012) “A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity”, Science 337(6096):816-21. 27. Johan et al. (1992) “GLVR1, a receptor for gibbon ape leukemia virus, is homologous to a phosphate permease of Neurospora crassa and is expressed at high levels in the brain and thymus”, J Virol 66(3):1635-40. 28. Judge et al. (2006) “Design of noninflammatory synthetic siRNA mediating potent gene silencing in vivo”, Mol Ther. 13(3):494-505. 29. Kohn et al. (1995) “Engraftment of gene-modified umbilical cord blood cells in neonates with adnosine deaminase deficiency”, Nature Medicine 1:1017-23. 30. Kremer and Perricaudet (1995) “Adenovirus and adeno-associated virus mediated gene transfer”, Br. Med. Bull. 51(1):31-44. 31. Macdiarmid et al. (2009) “Sequential treatment of drug-resistant tumors with targeted minicells containing siRNA or a cytotoxic drug”, Nat Biotehcnol. 27(7):643-51. 32. Malech et al. (1997) “Prolonged production of NADPH oxidase-corrected granulocyes after gene therapy of chronic granulomatous disease”, PNAS 94(22):12133-38. 33. Maxwell et al. (2018) “A detailed cell-free transcription-translation-based assay to decipher CRISPR protospacer adjacent motifs”, Methods 14348-57. 34. Miller et al. (1991) “Construction and properties of retrovirus packaging cells based on gibbon ape leukemia virus”, J Virol. 65(5):2220-24. 35. Miller (1992) “Human gene therapy comes of age”, Nature 357:455-60. 36. Mir et al. (2019) “Type II-C CRISPR-Cas9 Biology, Mechanism and Application”, ACS Chem. Biol. 13(2):357-365. 37. Mitani and Caskey (1993) “Delivering therapeutic genes - matching approach and application”, Trends in Biotechnology 11(5):162-66. 38. Nabel and Felgner (1993) “Direct gene transfer for immunotherapy and immunization”, Trends in Biotechnology 11(5):211-15. 39. Nehls et al. (1996) “Two genetically separable steps in the differentiation of thymic epithelium” Science 272:886-889. 40. Nishimasu et al. “Crystal structure of Cas9 in complex with guide RNA and target DNA” (2014) Cell 156(5):935-49. 41. Nishimasu et al. (2015) “Crystal Structure of Staphylococcus aureus Cas9” Cell 162(5):1113-26. 42. Palermo et al. (2018) “Key role of the REC lobe during CRISPR-Cas9 activation by ‘sensing’, ‘regulating’, and ‘locking’ the catalytic HNH domain” Quarterly Reviews of Biophysics 51, e9, 1-11. 43. Remy et al. (1994) “Gene Transfer with a Series of Lipphilic DNA-Binding Molecules”, Bioconjugate Chem. 5(6):647-54. 44. Sentmanat et al. (2018) “A Survey of Validation Strategies for CRISPR-Cas9 Editing”, Scientific Reports 8:888, doi:10.1038 / s41598-018-19441-8. 45. Sommerfelt et al. (1990) “Localization of the receptor gene for type D simian retroviruses on human chromosome 19”, J. Virol. 64(12):6214-20. 46. Van Brunt (1988) “Molecular framing: transgenic animals as bioactors” Biotechnology 6:1149-54. 47. Vigne et al. (1995) “Third-generation adenovectors for gene therapy”, Restorative Neurology and Neuroscience 8(1,2): 35-36. 48. Wagner et al. (2019) “High prevalence of Streptococcus pyogenes Cas9-reactive T cells within the adult human population” Nature Medicine, 25(2), 242. 49. Wilson et al. (1989) “Formation of infectious hybrid virion with gibbon ape leukemia virus and human T-cell leukemia virus retroviral envelope glycoproteins and the gag and pol proteins of Moloney murine leukemia virus”, J. Virol. 63:2374-78. 50. Yu et al. (1994) “Progress towards gene therapy for HIV infection”, Gene Ther. 1(1):13-26. 51. Zetsche et al. (2015) “Cpf1 is a single RNA-guided endonuclease of a class 2 CRIPSR-Cas system” Cell 163(3):759-71. 52. Zuris et al. (2015) “Cationic lipid-mediated delivery of proteins enables efficient protein based genome editing in vitro and in vivo” Nat Biotechnol. 33(1):73-80.

Claims

1. A non-naturally occurring composition comprising a CRISPR nuclease comprising a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 1, or a nucleic acid molecule comprising a sequence encoding said CRISPR nuclease.

2. 10. The composition of claim 1, further comprising one or more RNA molecules or a DNA polynucleotide encoding any one of said one or more RNA molecules, wherein said one or more RNA molecules and said CRISPR nuclease are not found together in nature, and said one or more RNA molecules are configured to form a complex with said CRISPR nuclease and / or said one or more RNA molecules are configured to target said complex to a target site.

3. 3. The composition of claim 2, wherein the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:1, and at least one RNA molecule comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs:4-22.

4. 4. The composition of claim 3, wherein the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:1, and the at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs:5-8.

5. 5. The composition of claim 4, further comprising a trans-activating CRISPR RNA (tracrRNA) molecule comprising a sequence set forth in the group consisting of SEQ ID NOs: 9-19, 21 and 22.

6. 3. The composition of claim 2, wherein the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:1, and the at least one RNA molecule is a single guide RNA (sgRNA) molecule comprising a guide sequence portion and a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs:4-22.

7. The composition of any one of claims 1 to 6, wherein the CRISPR nuclease is a nickase created by amino acid substitution at positions D10, E733, H949, or D952.

8. The composition of any one of claims 1 to 6, wherein the CRISPR nuclease is a nickase created with an amino acid substitution at position D817, H818, or N841.

9. 7. The composition of any one of claims 1 to 6, wherein the CRISPR nuclease is an inactivated nuclease created by an amino acid substitution at any one of positions D10, E733, H949 or D952, and an amino acid substitution at any one of positions D817, H818 or N841.

10. 1. A non-naturally occurring composition comprising a CRISPR nuclease, wherein the CRISPR nuclease comprises an amino acid sequence corresponding to the amino acid sequence of at least one of Domain A, Domain B, Domain C, Domain D, Domain E, Domain F, Domain G, Domain H, Domain I, or Domain J of SEQ ID NO:1; a) Domain A comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 1-43 of SEQ ID NO: 1; b) Domain B comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 44-81 of SEQ ID NO: 1; c) Domain C comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 82-157 of SEQ ID NO: 1; d) Domain D comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 158-304 of SEQ ID NO: 1; e) Domain E comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 305-494 of SEQ ID NO: 1; f) Domain F comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 495-682 of SEQ ID NO: 1; g) Domain G comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 683-735 of SEQ ID NO: 1; h) Domain H comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 736-885 of SEQ ID NO: 1; i) Domain I comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 886-1020 of SEQ ID NO:1; j) A composition wherein Domain J comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 1021 to 1297 of SEQ ID NO:

1.

11. 12. A method for modifying the nucleotide sequence of a DNA target site in the genome of a cell-free system or a cell, the method comprising introducing into said cell a composition according to any one of claims 1 to 11.

12. 12. The method of claim 11, wherein the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 1, and wherein the CRISPR nuclease cleaves the DNA strand adjacent to an NVTAYTNN or NRTAYTNN protospacer adjacent motif (PAM) sequence and / or cleaves the DNA strand adjacent to a sequence complementary to the PAM sequence.

13. 12. The method of claim 11, wherein the CRISPR nuclease is a nickase created by an amino acid substitution at position D10, E733, H949, or D952, and cleaves the DNA strand adjacent to the PAM sequence.

14. 12. The method of claim 11, wherein the CRISPR nuclease is a nickase created by an amino acid substitution at position D817, H818, or N841, and cleaves the DNA strand adjacent to a sequence complementary to the PAM sequence.

15. The method of any one of claims 11 to 14, wherein the cell is a eukaryotic or prokaryotic cell.

16. 16. The method of claim 15, wherein the cell is a mammalian cell.

17. 17. The method of claim 16, wherein the cells are human cells.

18. 1. A method for modifying a nucleotide sequence at a target site in the genome of a cell, comprising administering to said cell: (i) the composition of claim 1; (ii) a crRNA molecule having a guide sequence portion; and (iii) a tracrRNA molecule having a nuclease-binding RNA sequence; 20. A method comprising:

19. 19. The method of claim 18, wherein the crRNA molecule further comprises a portion having a sequence selected from the group consisting of SEQ ID NOs: 5-8.

20. 20. The method of claim 18 or 19, wherein the tracrRNA molecule comprises a portion having a sequence selected from the group consisting of SEQ ID NOs: 9-19, 21 and 22.

21. 21. The method of any one of claims 18 to 20, wherein the crRNA molecule and the tracrRNA molecule are fused in the form of a single guide RNA molecule.

22. 22. The method of any one of claims 18 to 21, wherein the sgRNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 4 to 22.

23. 23. The method of any one of claims 18 to 22, wherein the guide sequence portion is complementary to a DNA target site adjacent to a PAM site of NVTAYTNN or NRTAYTNN.

24. 12. A kit for modifying the nucleotide sequence of a DNA target site in the genome of a cell-free system or cell, the kit comprising instructions for introducing into the system or cell a composition of any one of claims 1 to 11, and for delivering an RNA molecule and a CRISPR nuclease to the cell.

25. A composition, method, product, process, system, kit, or use characterized by one or more elements disclosed in the present application.

Images