Chimeric transgenic immunoglobulin mice with modified heavy chain loci and methods for making and using same

Abstract

Chimeric transgenic immunoglobulin (Ig) mice are provided that contain a modified heavy chain locus in which the endogenous mouse D and J segments have been deleted and a human heavy chain Ig transgene inserted in their place, thereby expressing an antibody repertoire that utilizes human and mouse VH in the heavy chain linked to human D and JH segments, respectively, increasing antibody diversity. Methods for preparing and using the transgenic animals (e.g., to raise antibodies) are also provided.

Description

[Technical Field]

[0001] (CROSS-REFERENCE TO RELATED APPLICATIONS) This application claims the benefit under 35 U.S.C. §119(e) of U.S. Provisional Patent Application No. 63 / 439,801, filed January 18, 2023, which is incorporated herein in its entirety for all purposes.

[0002] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in XML file format, which is incorporated herein by reference in its entirety. The XML copy created on December 19, 2023 is named ZL8018-WO-PCT_SL.xml and is 153,150 bytes in size. [Background technology]

[0003] Immunotherapy has revolutionized the treatment of a wide variety of diseases, including cancer and autoimmune disorders. A key element in immunotherapy is the ability to generate therapeutic antibodies with desired binding characteristics for an antigen of interest. A variety of approaches for generating such antibodies have been established in the art and were developed following the discovery of the first B-cell hybridoma technology for generating monoclonal antibodies (mAbs) (for a review, see, e.g., Lu et al. (2018) J. Biomed. Sci. 27:1). Initially, mouse mAbs were made human-like by recombinantly swapping human constant regions with mouse constant regions, thereby generating chimeric antibodies. Alternatively, CDR sequences from mouse (or other non-human) mAbs were grafted onto a human antibody framework, thereby generating humanized antibodies with more human-derived sequences than chimeric antibodies. It has since been possible to generate fully human therapeutic antibodies using two different general approaches now established in the art: screening diverse human antibody libraries in vitro, e.g., libraries expressed on display packages such as bacteriophage, and generating antibodies in animals carrying transgenic Ig sequences (e.g., human Ig sequences).

[0004] The first human antibody transgenic mice generated in the art incorporated fully human transgenes (human variable and constant regions) into the mouse genome while simultaneously disabling the endogenous mouse Ig loci so that mouse antibodies were not produced in the animal (see, e.g., U.S. Patent Nos. 5,545,806, 5,569,825, 5,625,126, and 5,625,126, all to Lonberg and Kay). (See U.S. Patent Nos. 6,633,425, 5,789,650, 5,877,397, 5,661,016, 5,814,318, 5,874,299, and 5,770,429, as well as U.S. Patent Nos. 5,939,598, 6,075,181, 6,114,598, 6,150,584, and 6,162,963, all to Kucherlapati et al.).

[0005] Transgenic mice have also been described that carry only human variable region transgene sequences operably linked to endogenous mouse constant regions, thus generating chimeric antibodies in the animals (see, e.g., U.S. Pat. Nos. 6,596,541, 10,584,364, and U.S. Patent Application Publication No. 2016 / 0316731). The use of mouse constant regions, which retain more of the structure and signaling function of the original endogenous Ig locus compared to fully human transgenes, can generate antibodies that would not otherwise be formed using human constant regions, thereby providing a distinct antibody repertoire for testing responsiveness to antigens of interest. Chimeric antibodies produced in mice can then be engineered back to be fully human.

[0006] Further approaches to achieve different antibody repertoire diversity in Ig transgenic mice have been described in the art. For example, one approach uses a long heavy chain CDR3 sequence in the heavy chain transgene, which can generate additional HCDR3 diversity (see, for example, U.S. Patent Nos. 10,640,574, 10,562,980, 10,259,863, 10,259,863, 9,504,236, and U.S. Patent Application Publication No. 2020 / 0181241). Another approach uses a fixed light chain transgene sequence, which can identify heavy chain pairings different from those obtained using a full repertoire of light chains (see, for example, U.S. Patent No. 10,412,940 and U.S. Patent Application Publication No. 2020 / 0024368).

[0007] Although some progress has been made, there is a need for additional approaches and compositions for preparing animals expressing transgenic Ig sequences for therapeutic antibody production, particularly animals that produce hosts with increased antibody repertoire diversity. Summary of the Invention

[0008] The present disclosure relates to transgenic mice with chimeric immunoglobulin (Ig) heavy chain loci and methods for producing the same. The present disclosure provides methods for preparing a chimeric Ig heavy chain locus in mouse cells and transgenic mice produced thereby, in which the endogenous mouse heavy chain locus lacks the D and J segments downstream of the Adam6b gene and upstream of the IgM segment, and has a human heavy chain variable region transgene inserted in its place, comprising multiple human V, D, and J segments. In some embodiments, the disclosed methods produce transgenic mice that express antibody repertoires utilizing human and mouse VH segments in the resulting heavy chains via either hVH-DJ recombination or mVH-DJ recombination at the modified heavy chain locus. Thus, in some embodiments, the transgenic mice of the present disclosure, carrying the Supra allele and referred to herein as Supra diversity mice, provide tools for generating VH sequences with greater diversity than those generated by either the unmodified endogenous mouse HC locus or a humanized VDJ locus (i.e., a locus with an active human VH segment and an inactivated mouse VH segment) alone.

[0009] Thus, in one aspect, the disclosure provides a method of preparing a chimeric immunoglobulin heavy chain locus in a mouse cell, comprising: (a) deleting the mouse D and J segments downstream of Adam6b and upstream of IgM in the endogenous mouse immunoglobulin (Ig) heavy chain locus; (b) introducing a human heavy chain variable region transgene downstream of Adam6b and upstream of IgM into an endogenous mouse Ig heavy chain locus, wherein the transgene comprises a plurality of unrearranged human variable segments (VH), a plurality of human D segments (DH), and a plurality of human J segments (JH), thereby preparing a chimeric Ig heavy chain locus in the mouse cell; The present invention relates to methods in which mice comprising a chimeric Ig heavy chain locus express an antibody repertoire comprising a mouse VH segment and a human VH segment linked to a human DH segment and a JH segment, respectively.

[0010] In one embodiment, steps (a) and (b) are carried out simultaneously using CRISPR-Cas9-mediated knockout / knock-in technology. In another embodiment, the mouse D segment and the mouse J segment are deleted by CRISPR-Cas9-mediated gene editing (i.e., step (a) of the method), and a human heavy chain variable region transgene is introduced into the mouse Ig heavy chain locus by Cre-Lox-mediated recombination (i.e., step (b) of the method).

[0011] In one embodiment, the human heavy chain variable region transgene is carried on a bacterial artificial chromosome (BAC).

[0012] In various embodiments, mice comprising a chimeric Ig heavy chain locus express an antibody repertoire comprising at least 20, at least 30, or at least 40 different human VH segments. In one embodiment, the mouse comprising the chimeric Ig heavy chain locus expresses an antibody repertoire comprising human VH segments 3-74, 3-73, 3-72, 2-70, 1-69, 3-66, 3-64, 4-61, 4-59, 1-58, 3-53, 5-51, 3-49, 3-48, 1-46, 1-45, 3-43, 4-39, 4-34, 3-33, 4-31, 3-30, 4-28, 2-26, 1-24, 3-23, 3-21, 3-20, 1-18, 3-15, 3-13, 3-11, 3-9, 1-8, 3-7, 2-5, 7-4-1, 4-4, 1-3, 1-2, and 6-1.

[0013] In one embodiment, a mouse comprising a chimeric Ig heavy chain locus expresses an antibody repertoire comprising at least 100 different mouse VH segments.

[0014] In one embodiment, a mouse comprising a chimeric Ig heavy chain locus expresses an antibody repertoire comprising at least 15 different human D segments, hi one embodiment, a mouse comprising a chimeric Ig heavy chain locus expresses an antibody repertoire comprising at least 26 different human D segments.

[0015] In one embodiment, mice comprising a chimeric Ig heavy chain locus express an antibody repertoire comprising six different human JH segments.

[0016] In another aspect, the present disclosure relates to a transgenic mouse cell, e.g., prepared according to the methods of the present disclosure. In one embodiment, the present disclosure relates to a transgenic mouse cell comprising a chimeric immunoglobulin (Ig) heavy chain locus, wherein the chimeric Ig heavy chain locus is (a) lacking the mouse D and J segments downstream of the endogenous Adam6b sequence and upstream of the endogenous IgM constant sequence; and (b) a human heavy chain variable region transgene downstream of the endogenous Adam6b sequence and upstream of the endogenous IgM sequence, the transgene comprising a plurality of unrearranged human variable segments (VH), a plurality of human D segments (DH), and a plurality of human J segments (JH); Transgenic mouse cells containing a chimeric Ig heavy chain locus are provided, which express an antibody repertoire comprising a mouse VH segment and a human VH segment linked to a human DH segment and a JH segment, respectively.

[0017] In another aspect, the present disclosure relates to a transgenic mouse, e.g., prepared from a transgenic mouse cell of the present disclosure. In one embodiment, the present disclosure relates to a transgenic mouse comprising a chimeric immunoglobulin (Ig) heavy chain locus, wherein the chimeric Ig heavy chain locus is (a) lacking the mouse D and J segments downstream of the endogenous Adam6b sequence and upstream of the endogenous IgM constant sequence; and (b) a human heavy chain variable region transgene downstream of the endogenous Adam6b sequence and upstream of the endogenous IgM sequence, the transgene comprising a plurality of unrearranged human variable segments (VH), a plurality of human D segments (DH), and a plurality of human J segments (JH); Transgenic mice containing a chimeric Ig heavy chain locus are provided, which express an antibody repertoire comprising a mouse VH segment and a human VH segment linked to a human DH segment and a JH segment, respectively.

[0018] In one embodiment, the transgenic mouse further comprises a transgene construct encoding a human immunoglobulin light chain such that the mouse expresses antibodies comprising a human immunoglobulin light chain variable domain operably linked to either a mouse C-kappa constant region or a human C-kappa constant region.

[0019] In yet another embodiment, the chimeric immunoglobulin heavy chain loci of the present disclosure can serve as a starting point for creating a fully diverse human VH segment locus through deletion of endogenous mouse VH segments, as described herein.

[0020] In another aspect, the present disclosure relates to a method for generating an antibody against an antigen of interest, comprising administering the antigen of interest to a transgenic mouse of the present disclosure, such that an antibody that binds to the antigen of interest is generated. In one embodiment, the method further comprises isolating the antibody of interest from the mouse. In one embodiment, the method further comprises isolating nucleic acid encoding the antibody of interest from the mouse and replacing mouse constant region sequences in the nucleic acid with human constant region sequences. [Brief explanation of the drawings]

[0021] [Figure 1] FIG. 1 is a schematic representation of a one-step process for inserting a human heavy chain transgene construct into an endogenous mouse Ig locus. [Figure 2A]Figure 2A shows a schematic diagram illustrating how the Supra allele supports both fully human and chimeric VDJ recombination, and graphs depicting mouse VH versus human VH usage in naive splenocytes (Figure 2B), Covid spike protein-immunized splenocytes (Figure 2C), and single B cells from target X-immunized lymph nodes (Figure 2D) of transgenic mice carrying the Supra allele, as determined by next-generation sequencing (NGS). [Figure 2B] Figure 2A shows a schematic diagram illustrating how the Supra allele supports both fully human and chimeric VDJ recombination, and graphs depicting mouse VH versus human VH usage in naive splenocytes (Figure 2B), Covid spike protein-immunized splenocytes (Figure 2C), and single B cells from target X-immunized lymph nodes (Figure 2D) of transgenic mice carrying the Supra allele, as determined by next-generation sequencing (NGS). [Figure 2C] Figure 2A shows a schematic diagram illustrating how the Supra allele supports both fully human and chimeric VDJ recombination, and graphs depicting mouse VH versus human VH usage in naive splenocytes (Figure 2B), Covid spike protein-immunized splenocytes (Figure 2C), and single B cells from target X-immunized lymph nodes (Figure 2D) of transgenic mice carrying the Supra allele, as determined by next-generation sequencing (NGS). [Figure 2D] Figure 2A shows a schematic diagram illustrating how the Supra allele supports both fully human and chimeric VDJ recombination, and graphs depicting mouse VH versus human VH usage in naive splenocytes (Figure 2B), Covid spike protein-immunized splenocytes (Figure 2C), and single B cells from target X-immunized lymph nodes (Figure 2D) of transgenic mice carrying the Supra allele, as determined by next-generation sequencing (NGS). [Figure 3] FIG. 1 is a schematic diagram summarizing the use of hVH, D, and J segments in Supra allele transgenic mice. [Figure 4] FIG. 1 is a schematic diagram summarizing the use of mVH segments, hVH segments, D segments, and J segments in Supra allele transgenic mice. [Figure 5] FIG. 1 is a schematic diagram of a representative vector construct for a human Ig heavy chain transgene of the present disclosure. [Figure 6] FIG. 1 is a schematic diagram of a representative approach for converting Supra alleles into fully diverse human VH segment transgenes. DETAILED DESCRIPTION OF THE INVENTION

[0022] The chimeric Ig heavy chain loci described herein allow for the expression of antibody repertoires utilizing human and mouse VH segments in the resulting heavy chains via either hVH-DJ or mVH-DJ recombination in the engineered heavy chain locus, as illustrated schematically in Figure 2A. The resulting chimeric antibodies may be well suited for reagent and / or diagnostic use in their chimeric form. Furthermore, as described herein, chimeric antibodies can be converted to fully human antibodies using standard methods, allowing them to be used therapeutically. Furthermore, in another embodiment, the chimeric Ig heavy chain loci can serve as a starting point for generating Ig heavy chain loci containing only human VH, human D, and human JH variable segments via excision of the endogenous mouse VH segment.

[0023] Various aspects of the present disclosure are described in further detail below. Unless otherwise defined, all technical terms, notations, and other scientific terms used herein are intended to have the meaning commonly understood by those of ordinary skill in the art to which this disclosure pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and / or ready reference, and the inclusion of such definitions herein should not necessarily be construed as representing a deviation from that understood in the art. The techniques and procedures described or referenced herein are generally well understood and routinely employed by those of ordinary skill in the art using conventional methodologies, e.g., widely used molecular cloning methodologies described in Sambrook et al., Molecular Cloning: A Laboratory Manual, 4th ed. (2012) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Where appropriate, procedures involving the use of commercially available kits and reagents are generally performed according to manufacturer-defined protocols and / or parameters unless otherwise specified.

[0024] I. Supra Diversity Approach One embodiment of an approach for generating a modified endogenous Ig locus that produces heavy chains using either human V segments or mouse V segments is shown schematically in Figure 1. This approach involves simultaneous double modifications at the endogenous heavy chain locus: (i) removing (deleting, excising, knocking out) the endogenous mouse D and J segments (also referred to herein as mDH and mJH) downstream of the Adam6b gene and upstream of the mouse IgM constant region segment, and (ii) inserting (knocking in, swapping) a human Ig heavy chain variable region transgene comprising human V, human D, and human J segments (also referred to herein as hVH, hDH, and hJH) at the site of the mDH and mJH deletion. Alternatively, the two modifications can be performed in two separate steps, as described herein. As shown in Figure 2A, the resulting chimeric heavy chain locus is capable of both mVH-hDH-hJH and hVH-hDH-hJH recombination, thereby generating heavy chains incorporating either mouse or human VH segments.

[0025] Thus, in one aspect, the disclosure provides a method of preparing a chimeric immunoglobulin heavy chain locus in a mouse cell, comprising: (a) deleting mouse D and J segments downstream (i.e., 3') of Adam6b and upstream (i.e., 5') of IgM in the endogenous mouse immunoglobulin (Ig) heavy chain locus; (b) introducing a human heavy chain variable region transgene downstream (i.e., 3') of Adam6b and upstream (i.e., 5') of IgM into an endogenous mouse Ig heavy chain locus, wherein the transgene comprises a plurality of unrearranged human variable segments (VH), a plurality of human D segments (DH), and a plurality of human J segments (JH), thereby preparing a chimeric Ig heavy chain locus in the mouse cell; The present invention relates to a method in which a mouse comprising a chimeric Ig heavy chain locus expresses an antibody repertoire comprising a mouse VH segment and antibodies comprising a human VH segment linked to a human D and JH segment, respectively.

[0026] In one embodiment, steps (a) and (b) are performed simultaneously, for example, using CRISPR-Cas9-mediated knockout / knock-in technology. In another embodiment, the mouse D segment and mouse J segment are deleted by CRISPR-Cas9-mediated gene editing (i.e., step (a)), and a human heavy chain variable region transgene is introduced into the mouse Ig heavy chain locus by Cre-Lox-mediated recombination (i.e., step (b)). These recombination techniques are well established in the art and can be applied to Ig loci using standard methods. The use of recombinant approaches to generate Supra alleles of the present disclosure is described in further detail in Section III below and Example 1.

[0027] The Supra diversity mice of the present disclosure generate antibody repertoires comprising heavy chains using either mouse or human VH, as shown schematically in Figure 4 and described in detail in Example 2. Analysis of antibody mRNA expressed in the mice indicated that the antibody repertoire utilized substantially all of the human VH, human DH, and human JH segments contained in the transgene. The structure and construction of human Ig heavy chain variable region transgenes are described in further detail in Section II below. Furthermore, mRNA analysis indicated that the antibody repertoire utilized more than 100 endogenous mouse VH segments. Thus, in one embodiment, the transgenic mice of the present disclosure comprise a chimeric Ig heavy chain locus that expresses an antibody repertoire comprising at least 100 different mouse VH segments.

[0028] The modified endogenous heavy chain locus retains the germline location, configuration, and arrangement of the ADAM6 gene complex, including Adam6a and Adam6b. These genes have been shown to be required for male fertility in mice, and therefore, retaining the native structure of the ADAM6 gene within the Ig locus is a beneficial feature of the Supra allele that may result in better fertility than transgenic approaches known in the art that delete ADAM6 genes from the Ig locus and then reinsert them elsewhere in the mouse genome (e.g., as described in PCT Publication WO 2013 / 079953).

[0029] The ADAM6 gene complex contains two mouse DH segments, 1-3 and 3-1 (shown in Figure 1), embedded within it, separate from the remaining portion of the deleted endogenous mouse DH segment. These 1-3 and 3-1 mDH segments remain functional and active. Therefore, the Supra allele can also generate chimeric heavy chains containing mVH-mDH-hJH as an additional means of generating diversity. However, it should be noted that definitively confirming the use of mDH segments from within the ADAM6 complex may be challenging due to the short length of these mDH segments and their high homology to the human DH homolog present in the Supra allele.

[0030] In another embodiment, the Supra allele serves as a starting point for generating an Ig heavy chain locus utilizing only human VH, D, and JH variable segments through excision (deletion, knockout) of the endogenous mouse VH segment, while still retaining the germline location, configuration, and sequence of the ADAM6 gene complex, including Adam6a and Adam6b. As shown schematically in Figure 6, the endogenous mouse VH segment of the Supra allele is deleted by standard recombination (e.g., using CRISPR / Cas9-mediated recombination or other suitable recombination techniques available in the art), thereby resulting in an Ig heavy chain locus that lacks the endogenous mouse VH segment and simultaneously contains the full diversity of human VH segments, such that transgenic mice bearing the Ig heavy chain locus express an antibody repertoire that contains the full diversity of human VH segments and is devoid of mouse VH segments. Thus, in one embodiment, the mouse VH segment is deleted from the Supra allele of the present disclosure by standard recombination methods to generate an Ig heavy chain locus that contains only human VH segments.

[0031] In another aspect, the disclosure provides a method for preparing an immunoglobulin (Ig) heavy chain locus in a mouse cell, wherein the Supra allele is an intermediate, the method comprising: (a) deleting mouse D and J segments downstream (i.e., 3') of Adam6b and upstream (i.e., 5') of IgM in the endogenous mouse immunoglobulin (Ig) heavy chain locus; (b) introducing a human heavy chain variable region transgene downstream (i.e., 3') of Adam6b and upstream (i.e., 5') of IgM into an endogenous mouse Ig heavy chain locus, wherein the transgene comprises a plurality of unrearranged human variable segments (VH), a plurality of human D segments (DH), and a plurality of human J segments (JH), thereby preparing a chimeric Ig heavy chain locus in the mouse cell; (c) deleting a mouse V segment upstream (i.e., 5') of Adam6a; We provide a method in which mice containing an Ig heavy chain locus express an antibody repertoire that contains human VH segments linked to human D and J segments, respectively, and lacks mouse VH segments. As shown in Figure 6, this approach allows for the introduction of the full diversity of human VH segments while still retaining the germline location, configuration, and sequence of the ADAM6 gene complex, including Adam6a and Adam6b.

[0032] II. Preparation of Heavy Chain Transgene Constructs The transgene constructs of the present disclosure can be prepared using standard recombinant DNA techniques. Cloning vectors containing polylinkers are useful as starting vectors for insertion of a DNA fragment of interest. Suitable cloning vectors are well established in the art. Additionally, plasmids or other vectors (e.g., YACs and BACs) carrying unrearranged human heavy chain immunoglobulin sequences have been described in the art (e.g., U.S. Patent Nos. 5,545,806, 5,569,825, 5,625,126, 5,633,425, 5,789,650, 5,877,397, 5,677,498, all to Lonberg and Kay). (See U.S. Patent Nos. 6,114,598, 6,150,584, and 6,162,963, all to Kucherlapati et al.) can be used as a source of heavy chain V region, D region, and J region sequences. Furthermore, databases disclosing human heavy chain V, D, and J region sequences have been established in the art. In one embodiment, the desired sequences can be synthesized by standard methods or obtained by standard recombinant DNA techniques. The appropriate DNA fragments are then operably joined into a cloning vector via ligation, and the vector is then characterized (e.g., by restriction fragment analysis or sequencing) to confirm proper placement of the fragments.

[0033] In one embodiment, a chimeric Ig heavy chain locus of the present disclosure comprises more than 20 different human VH segments (e.g., a transgenic mouse harboring a chimeric Ig locus expresses an antibody repertoire comprising at least 20 different human VH segments). In another embodiment, a chimeric Ig heavy chain locus of the present disclosure comprises more than 30 different human VH segments (e.g., a transgenic mouse harboring a chimeric Ig locus expresses an antibody repertoire comprising at least 30 different human VH segments). In another embodiment, a chimeric Ig heavy chain locus of the present disclosure comprises more than 40 different human VH segments (e.g., a transgenic mouse harboring a chimeric Ig locus expresses an antibody repertoire comprising at least 40 different human VH segments).

[0034] In one embodiment, a chimeric Ig heavy chain locus of the disclosure comprises human VH segments 3-74, 3-73, 3-72, 2-70, 1-69, 3-66, 3-64, 4-61, 4-59, 1-58, 3-53, 5-51, 3-49, 3-48, 1-46, 1-45, 3-43, 4-39, 4-34, 3-33, 4-31, 3-30, 4-28, 2-26, 1-24, 3-23, 3-21, 3-20, 1-18, 3-15, 3-13, 3-11, 3-9, 1-8, 3-7, 2-5, 7-4-1, 4-4, 1-3, 1-2, and 6-1. For example, the transgene may comprise human VH segments 3-74, 3-75, 3-76, 3-77, 3-78, 3-79, 3-71, 3-72, 3-73, 3-74, 3-75, 3-76, 3-77, 3-78, 3-79, 3-79, 3-76, 3-79, 3-71, 3-72, 3-73, 3-74, 3-75, 3-76, 3-77, 3-78, 3-79 ... * 01, 3-73 * 01, 3-72 * 01, 2-70 * 03, 1-69 * 01, 3-66 * 01, 3-64 * 01, 4-61 * 01, 4-59 * 01, 1-58 * 01, 3-53 * 01, 5-51 * 01, 3-49 * 01, 3-48 * 01, 1-46 * 01, 1-45 * 01, 3-43* 01, 4-39 * 01, 4-34 * 01, 3-33 * 01, 4-31 * 02, 3-30 * 01, 4-28 * 01, 2-26 * 01, 1-24 * 01, 3-23 * 01, 3-21 * 01, 3-20 * 01, 1-18 * 01, 3-15 * 01, 3-13 * 04, 3-11 * 01, 3-9 * 02, 1-8 * 01, 3-7 * 02, 2-5 * 02, 7-4-1 * 02, 4-4 * 05, 1-3 * 02, 1-2 * 01 and 6-1 * May include 01.

[0035] In one embodiment, a mouse comprising a chimeric Ig heavy chain locus expresses an antibody repertoire comprising human VH segments 3-74, 3-73, 3-72, 2-70, 1-69, 3-66, 3-64, 4-61, 4-59, 1-58, 3-53, 5-51, 3-49, 3-48, 1-46, 1-45, 3-43, 4-39, 4-34, 3-33, 4-31, 3-30, 4-28, 2-26, 1-24, 3-23, 3-21, 3-20, 1-18, 3-15, 3-13, 3-11, 3-9, 1-8, 3-7, 2-5, 7-4-1, 4-4, 1-3, 1-2, and 6-1. For example, a mouse of the disclosure expresses an antibody repertoire comprising human VH segments 3-74, 3-73, 3-72, 2-70, 1-69, 3-66, 3-64, 4-61, 4-59, 1-58, 3-53, 5-51, 3-49, 3-48, 1-46, 1-45, 3-43, 4-39, 4-34, 3-33, 4-31, 3-30, 4-28, 2-26, 1-24, 3-23, 3-21, 3-20, 1-18, 3-15, 3-13, 3-11, 3-9, 1-8, 3-7, 2-5, 7-4-1, 4 * 01, 3-73 * 01, 3-72 * 01, 2-70 * 03, 1-69 * 01, 3-66 * 01, 3-64 * 01, 4-61 * 01, 4-59 * 01, 1-58 *01, 3-53 * 01, 5-51 * 01, 3-49 * 01, 3-48 * 01, 1-46 * 01, 1-45 * 01, 3-43 * 01, 4-39 * 01, 4-34 * 01, 3-33 * 01, 4-31 * 02, 3-30 * 01, 4-28 * 01, 2-26 * 01, 1-24 * 01, 3-23 * 01, 3-21 * 01, 3-20 * 01, 1-18 * 01, 3-15 * 01, 3-13 * 04, 3-11 * 01, 3-9 * 02, 1-8 * 01, 3-7 * 02, 2-5 * 02, 7-4-1 * 02, 4-4 * 05, 1-3 * 02, 1-2 * 01 and 6-1 * The antibody may express a repertoire of antibodies, including .O1.

[0036] In one embodiment, the human Ig heavy chain transgene comprises at least 15 different human D segments, more preferably at least 26 different human D segments, or all 27 human D segments identified to date. In one embodiment, a mouse comprising a chimeric Ig heavy chain locus expresses an antibody repertoire comprising at least 15, more preferably at least 26 different human D segments.

[0037] In one embodiment, the human Ig heavy chain transgene comprises six different human J segments, i.e., human J1-J6 segments. In one embodiment, a mouse comprising a chimeric Ig heavy chain locus expresses an antibody repertoire comprising six different JH segments (i.e., human J1-J6).

[0038] In one embodiment, the transgene construct is carried on a bacterial artificial chromosome (BAC). BAC technology for carrying Ig transgenes is well established in the art.

[0039] A non-limiting example of a human Ig heavy chain variable region transgene vector of the present disclosure is shown schematically in Figure 5. In one embodiment, the human Ig heavy chain variable region transgene construct comprises the nucleotide sequence set forth in SEQ ID NO:1.

[0040] The nucleotide sequence of the transgene construct can be further optimized for the intended purpose, for example, the construct can be modified for codon optimization (e.g., to increase expression of the encoded region).

[0041] The transgene construct may further comprise sequences that allow for targeted insertion of the transgene into a particular locus, for example, the endogenous mouse heavy chain locus. Knock-in techniques for replacing endogenous loci with targeted transgenes are well established in the art and are further described in Section III below. In one preferred embodiment, the transgene construct comprises a recombination sequence (Guide Recombination Sequence or GRS) that allows for the knock-in of the transgene into the endogenous mouse heavy chain locus.

[0042] To prepare a transgene construct for transfection, microinjection, or other recombinant genetic techniques, the construct can be isolated from the vector carrying it by cleavage with appropriate restriction enzymes to liberate the transgene construct fragment. This fragment can be isolated using standard techniques, such as pulsed-field gel electrophoresis on an agarose gel, followed by isolation of the fragment from the agarose gel by, for example, beta-agarase digestion or electroelution. For example, an agarose gel slice containing the transgene construct fragment can be excised from the gel and the agarose digested with beta-agarase (e.g., Takara) using standard methodologies. Alternatively, preparation of the transgene for knock-in purposes can be performed by standard BAC or plasmid purification techniques, followed by isolation of the closed circular form for direct transfection or introduction into recipient mouse cells or embryos.

[0043] III. Preparation of transgenic mice Another aspect of the present disclosure relates to transgenic mice comprising chimeric endogenous immunoglobulin heavy chain loci, prepared according to the methods of the present disclosure such that the animals express an immune repertoire comprising antibodies that utilize human VH segments (e.g., hVH-hDH-hJH-mC antibodies) and antibodies that use mouse VH segments (e.g., mVH-hDH-hJH-mC antibodies). The transgenic mice of the present disclosure are prepared using standard methods known in the art for deleting foreign genomic sequences, introducing foreign nucleic acid into the genome of mouse cells, and then preparing transgenic mice from the transgenic mouse cells.

[0044] Thus, in one aspect, the disclosure provides a transgenic mouse cell comprising a chimeric immunoglobulin (Ig) heavy chain locus, wherein the chimeric Ig heavy chain locus comprises: (a) lacking the mouse D and J segments downstream of the endogenous Adam6b sequence and upstream of the endogenous IgM constant sequence; and (b) a human heavy chain variable region transgene downstream of the endogenous Adam6b sequence and upstream of the endogenous IgM sequence, the transgene comprising a plurality of unrearranged human variable segments (VH), a plurality of human D segments (DH), and a plurality of human J segments (JH); Transgenic mouse cells containing a chimeric Ig heavy chain locus are provided, which express an antibody repertoire comprising a mouse VH segment and a human VH segment linked to a human DH segment and a JH segment, respectively.

[0045] In another aspect, the present disclosure provides a transgenic mouse comprising a chimeric immunoglobulin (Ig) heavy chain locus, wherein the chimeric Ig heavy chain locus comprises: (a) lacking the mouse D and J segments downstream of the endogenous Adam6b sequence and upstream of the endogenous IgM constant sequence; and (b) a human heavy chain variable region transgene downstream of the endogenous Adam6b sequence and upstream of the endogenous IgM sequence, the transgene comprising a plurality of unrearranged human variable segments (VH), a plurality of human D segments (DH), and a plurality of human J segments (JH); Transgenic mice containing a chimeric Ig heavy chain locus are provided, which express an antibody repertoire comprising a mouse VH segment and a human VH segment linked to a human DH segment and a JH segment, respectively.

[0046] In one preferred approach, steps (a) and (b) of the disclosed method are performed simultaneously to remove the endogenous mouse D and DJ segments and replace them with a human Ig heavy chain transgene, preferably using CRISPR / Cas9-mediated recombination for a combined knockout / knockin approach. For example, the transgene construct can include flanking guide recombination sequences (GRSs) to facilitate CRISPR / Cas9-mediated recombination. These are 500-1500 bp sequences flanking the transgene insert and have specific homology to endogenous mouse sequences adjacent to specific CRISPR / Cas9 cleavage sites in the mouse genome. Adding identical CRISPR / CAS cleavage sites to the ends of the GRS-flanking sequences allows CRISPR / CAS-mediated digestion to simultaneously cleave the endogenous mouse genome and the transgene donor (e.g., a circular BAC vector). In this way, the cut ends of the mouse CRISPR / CAS site become available for homologous recombination-mediated repair via a similarly cut and linearized transgene donor insert, resulting in site-specific knock-in.

[0047] Alternatively, the two modifications can be performed in two separate steps, i.e., a knockout step and a knockin step. For example, the endogenous mouse heavy chain D and J segments can be removed from the endogenous mouse Ig locus by standard knockout technology, preferably using CRISPR-Cas9-mediated recombination. Then, a human Ig heavy chain variable region transgene can be inserted into the endogenous mouse Ig heavy chain locus by standard knockin technology. For example, in one knockin approach, typically, loxP-flanked sites are included in the construct so that these sites facilitate recombination between the host's loxP-flanked sites and the transgene donor's loxP-flanked sites upon expression of Cre recombinase. Recombination is performed in mouse embryonic stem cells, and then the embryonic stem cells with the desired modification are implanted into viable blastocysts, which then grow into mature chimeric mice, some cells of which carry the genetic information of the original blastocyst cells and other cells carry the modification introduced into the embryonic stem cells. The subsequent offspring of the chimeric mice will then carry the gene knockin. Knock-in technology is summarized in, for example, Manis (2007) New Engl. J. Med. 357:2426-2429.

[0048] Southern blot analysis, PCR, or other such techniques for analyzing genomic DNA are used to detect the presence of unique nucleic acid fragments present in the transgenic animals but not in the non-transgenic animals. By selectively breeding the transgenic offspring, homozygosity for the transgene can be achieved.

[0049] A transgenic mouse of the present disclosure carrying a chimeric Ig heavy chain locus can be crossed with a mouse carrying an immunoglobulin light chain transgene (e.g., a human Ig light chain transgene), thereby producing a mouse that expresses antibodies comprising a light chain (e.g., a human light chain) from the transgene paired with a heavy chain from the chimeric heavy chain locus. Immunoglobulin light chain transgenic mice are well established in the art.

[0050] IV. Use of Transgenic Mice The transgenic mice of the present disclosure are useful for generating antibodies against a wide variety of antigens of interest. In mice that have only a chimeric Ig heavy chain locus and an endogenous mouse light chain locus, the mice produce chimeric heavy chain / mouse light chain antibodies, which can be reverse engineered, if desired, to pair the chimeric heavy chain with a light chain from another species and / or replace the mouse constant region(s) with a human constant region. Alternatively, in mice that possess both a chimeric Ig heavy chain locus and a human light chain Ig transgene, chimeric heavy chain / human light chain antibodies can be prepared in the host mouse. Chimeric antibodies that are not further humanized or fully human may still be useful as in vitro reagents and for use in diagnostic assays. Antibodies intended for therapeutic use in humans are typically reverse engineered to be fully human.

[0051] Additional or alternative recombination manipulations can be performed on antibodies of interest isolated from the transgenic mice of the present disclosure having chimeric Ig heavy chain loci. For example, for antibodies utilizing mVH-hDH-hJH or mVH-mDH-hJH variable regions, the unique CDR3 generated by the recombination event can be isolated and grafted onto another antibody scaffold according to methods well established in the art.

[0052] Thus, in another aspect, the present disclosure relates to a method for generating an antibody against an antigen of interest, the method comprising administering the antigen of interest to a transgenic mouse of the present disclosure. In one embodiment, the antigen is administered to the mouse such that an antibody that binds to the antigen of interest is produced in the mouse. In one embodiment, the transgenic mouse contains both a chimeric Ig heavy chain locus described herein and a human Ig light chain transgene, and the antigen is administered to the mouse such that hVH-containing chimeric antibodies and mVH-containing chimeric antibodies are produced in the mouse. In one embodiment, the method may further comprise isolating the antibody of interest from the host mouse. In one embodiment, the method may further comprise isolating nucleic acid encoding the antibody of interest from the mouse and replacing mouse constant region sequences in the nucleic acid with human constant region sequences. Additional or alternative recombination manipulations of the resulting antibody (e.g., to back-engineer mouse sequences into human sequences) are contemplated.

[0053] The transgenic animals can be immunized with the antigen(s) of interest using standard methodologies known in the art, and antibodies produced in the animals can be isolated and characterized using standard, established methods. Polyclonal antibodies can be isolated directly from the host animals, and monoclonal antibodies can be prepared using standard methods, such as hybridoma technology. Procedures for producing monoclonal antibodies using hybridomas are well established in the art (see, e.g., U.S. Pat. No. 4,977,081, PCT Publication No. WO 97 / 16537, and European Patent No. 491057(B1), the disclosures of which are incorporated herein by reference). Alternatively, in vitro production of monoclonal antibodies from cloned cDNA molecules is also established in the art (see, e.g., Andris-Widhopf et al. (2000) J. Immunol. Methods 242:159 and Burton (1995) Immunotechnology 1:87, the disclosures of which are incorporated herein by reference). B cell clones from immunized transgenic mice can be isolated, and cDNAs encoding antibodies can be isolated and cloned into expression vectors by standard molecular biology techniques. Further recombinant manipulation of cloned Ig cDNAs is also possible and well established in the art.

[0054] V. Definition As used herein, the term "chimeric" as in "chimeric Ig locus" is intended to refer to nucleic acid sequences derived from two different species, such as human and mouse. Thus, an endogenous mouse Ig locus is chimeric when it contains nucleic acid sequences derived from another species, such as human.

[0055] As used herein, the term "operably linked" is intended to describe the placement of a nucleic acid sequence in a functional relationship with another nucleic acid sequence. For example, a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence. With respect to the linking of two protein-coding regions, operably linked means that the linked nucleic acid sequences are contiguous and in reading frame. With respect to splice donor / splice acceptor and RSS sequences, operably linked means that the sequences are capable of achieving their functional purpose.

[0056] As used herein, the term "Supra-diverse mice" is intended to refer to chimeric mice of the present disclosure that have an endogenous heavy chain locus that has been modified by the insertion of a human Ig heavy chain transgene so as to express an antibody repertoire with greater V-region diversity (e.g., diversity in VH usage) than mice with an unmodified endogenous mouse HC locus and mice with a humanized VDJ locus in which mouse V segments have been inactivated. The modified Ig heavy chain alleles prepared according to the methods of the present disclosure are also referred to herein as "Supra alleles," resulting in the generation of Supra-diverse mice.

[0057] As used herein, the term "transgene" refers to a gene that is introduced as an exogenous source into a site within the host genome (eg, the mouse heavy chain Ig locus).

[0058] As used herein, the term "transgene construct" refers to a nucleic acid preparation suitable for introduction into the genome of a host animal.

[0059] As used herein, the term "transgenic mouse" refers to a mouse comprising cells that carry a transgene, as defined herein. The transgene can be present in all or some of the cells of the mouse.

[0060] As used herein, the term "unrearranged" with respect to an immunoglobulin V segment refers to an immunoglobulin V segment that is in a germline configuration and has not recombined so that the V segment is immediately adjacent to a D or J segment.

[0061] The present invention is further illustrated by the following examples, which should not be construed as further limiting. The contents of the figures and all references, patents and published patent applications cited throughout this application are hereby expressly incorporated by reference. [Example]

[0062] Example 1: Preparation of Supra diversity transgenic mice This example describes the preparation of a Supradiversity transgenic mouse with a chimeric endogenous heavy chain Ig locus, in which mouse D and J segments are deleted from the endogenous locus and human V, D, and J segments are introduced in their place, while maintaining the presence and function of the mouse V segments, so that both hVH-DJ and mVH-DJ recombination can occur. Considering that both mVH and hVH are used to form the antibody repertoire of a Supradiversity mouse, this provides a tool for generating a greater diversity of VH sequences than either a mouse with only an intact endogenous mouse heavy chain locus or a mouse with only a fully humanized heavy chain locus (e.g., an inactivated mouse sequence containing inserted human sequences and mVH).

[0063] Endogenous mouse D and J segment deletions As shown schematically in Figure 1, Supra-diversity mice were prepared using a process involving the deletion of endogenous mouse D and J segments from the endogenous mouse Ig heavy chain locus on mouse chromosome 12. Mouse D and J segments were deleted downstream of the Adam6b gene and upstream of the mouse IgM region, while retaining the ADAM6 gene region (including Adam6a and Adam6b) required for mouse fertility. This strategy resulted in the deletion of all mouse D segments downstream of the ADAM6 gene region while maintaining the mouse 1-3 and 3-1 D segments embedded within the ADAM6 gene region. The deleted region of the mouse IGH locus on chromosome 12 created by this process corresponds to base pairs 113, 391, 744 to 113, 446, 387 (according to NCBI reference sequence: NC_000078.7; GRCm39; see https: / / www.ncbi.nlm.nih.gov / nucleotide / NC_000078.7).

[0064] Deletion of a portion of the endogenous mouse heavy chain locus in the region shown in Figure 1 was achieved in mouse embryonic stem (ES) cells using standard CRISPR-Cas9-mediated recombination with guide RNA (gRNA), a method well established in the art for deleting genomic sequences. ES cells with the correct recombination at the heavy chain locus were identified by standard methods. Recombinant cells contained a puromycin resistance gene to allow for puromycin selection. Genomic DNA analysis can also be used to confirm that the recombination was correct.

[0065] Introduction of human Ig heavy chain variable region transgene As shown schematically in Figure 1, the process for preparing Supra-diversity mice involves introducing a human Ig heavy chain variable region transgene into the endogenous mouse Ig heavy chain locus at the site where the mouse D and J segments have been deleted. A bacterial artificial chromosome (BAC) was used as a vector to design the human Ig heavy chain transgene, containing multiple human heavy chain V, D, and J segments. The following 41 human VH segments were included in the transgene in their unrearranged germline configuration: 3-74, 3-73, 3-72, 2-70, 1-69, 3-66, 3-64, 4-61, 4-59, 1-58, 3-53, 5-51, 3-49, 3-48, 1-46, 1-45, 3-43, 4-39, 4-34, 3-33, 4-31, 3-30, 4-28, 2-26, 1-24, 3-23, 3-21, 3-20, 1-18, 3-15, 3-13, 3-11, 3-9, 1-8, 3-7, 2-5, 7-4-1, 4-4, 1-3, 1-2, and 6-1. The transgene also contained 27 human D segments in their germline configuration and all six human J segments in their germline configuration. The 27 D segments used represent the entire human D repertoire present in the heavy chain locus from human chromosome 14, including the most distal D segment.

[0066] Figure 5 shows a schematic of the BAC vector transgene construct. A human Ig heavy chain BAC was generated by a combination of gene synthesis and recombineering. A human VH array consisting of 41 segments was a fully synthetic construct inserted into the BAC vector backbone. This VH donor was then used in a recombineering scheme to recombine the VH array with human germline sequences for the D and J elements using the human BAC clone CTD-2572O2 as a substrate. Mouse-specific GRS homology domains were added to both ends of the recombinant BAC, along with mouse-specific CRISPR-Cas9 guide recognition sites to facilitate the GRS recombination process. The specific guides used for the GRS recombination process and incorporated into the BAC construct are as follows (protospacer adjacent motif (PAM) sequences are in parentheses): moIgH JEmu-1:TTATACAGTATCCGATGCAT(AGG) (SEQ ID NO: 2) * moIgH D1-1: ATCATGATATCCCACAAGTA(TGG) (SEQ ID NO: 3)

[0067] As shown schematically in Figure 1, a human Ig heavy chain variable region transgene construct was introduced into the endogenous mouse Ig heavy chain locus of ES cells lacking the endogenous D and J segments. Standard knock-in technology using the GRS method of CRISPR-Cas9-mediated recombination was used to introduce the transgene into the appropriate site within the endogenous mouse heavy chain locus. ES cells with the correct recombination at the heavy chain locus were identified using standard methods. Introduction of the human Ig transgene allowed for puromycin selection. After selection, the puromycin cassette can be removed, for example, by Flp recombination or other means established in the art, so as not to interfere with donor DNA gene expression. Genomic DNA analysis can also be used to confirm proper knock-in of the transgene.

[0068] After generating the Supra allele at the endogenous mouse Ig heavy chain locus in mouse ES cells as described above, transgenic Supra-diverse mice were generated from the ES cells by standard methods well established in the art.

[0069] Example 2: Characterization of Supra diversity transgenic mice In this example, Supra-diversity mice, prepared as described in Example 1, were characterized for their VH segment usage in both naive and immunized animals. The schematic diagram in Figure 2A illustrates how the Supra allele can generate recombined VDJ units derived from different parts of the knock-in construct. This is based on the unique property of Ig loci to undergo stochastic recombination between altered VH-, DH-, and JH-coding sequences during B cell development, forming functional VDJ products that function to encode the variable portion of the Ig heavy chain.

[0070] In the first set of experiments, we used RT-PCR and sequence analysis of RNA from Supra mice to assign the proportion of fully human VDJ recombination products versus mVH / hDH / hJH products using the Enpicom IGX platform for Ig sequence analysis. Naive, unimmunized mice and mice immunized with different immunogens were tested. Results showed that naive, unimmunized mice exhibited 45% human VH usage versus 55% mouse VH usage (Figure 2B). Mice immunized with the COVID-19 spike protein exhibited 44% human VH usage versus 56% mouse VH usage (Figure 2C). Mice immunized with an undisclosed immunogen ("Target X") exhibited 63% human VH usage versus 37% mouse VH usage (Figure 2D). The data demonstrate that both types of recombination products were readily recovered, although the proportions varied depending on the source of RNA used for RT-PCR and sequencing. Single B cells isolated from immunized lymph nodes (the "target X" experiment) appeared to contain a greater proportion of fully human recombinant product than bulk-treated whole spleens.

[0071] IGX bioinformatics analysis was used to further characterize the specific V regions used in the Supra diversity mice. The relative frequency of usage of different human V, D, and J segments is shown in Figure 3, which shows results for naive, unimmunized mice and mice immunized with either the COVID-19 spike protein or the targeted X immunogen. Results show that across the collective data for all three sets of mice, all input human VH segments were utilized to some extent, as were nearly all human D segments and all J segments, confirming the functionality of the human donor transgene.

[0072] A more quantitative summary of human VH, D, and J usage determined by the IGX platform is shown in Tables 1-3 below, respectively. Counts correspond to the number of VH, D, or JH segments individually identified within an NGS sequencing run. Naive and spike-immunized samples were bulk NGS runs from total spleen RNA. Target X-immunized samples were run in single-cell mode using the 10X methodology (https: / / www.10xgenomics.com / ).

[0073] [Table 1]

[0074] [Table 2]

[0075] [Table 3]

[0076] The amino acid and nucleotide sequences of the top 20 clonotypes identified in naive, non-immunized spleen samples were further analyzed using the NCBI "Ig BLAST" program. Human transcripts accounted for 59.7% of the total, while mouse transcripts accounted for 40.3%. This confirmed that the IGX program can identify both fully human (hVH / hDH / hJH) and mouse-human hybrid (mVH / hDH / hJH) transcripts.

[0077] To assess whether mouse VH segment usage in Supra diversity mice reflects that of "normal" mice, we compared the most frequent VH segments between (i) Supra diversity mice, (ii) wild-type C57 / B16 mouse spleen RNA sequenced in-house, and (iii) a published reference for normal mouse Ig repertoire derived from C57B1 / 6 wild-type spleen (Rettig et al. (2018) PLoS One 13(1):e0190982). The ranking of the 14 VH segments from most to least frequently used in the three groups is shown in Table 4 below.

[0078] [Table 4]

[0079] Several (6 / 14) of the top "hits" in the publicly available naive mouse repertoire ("PLoS") were also found in the Supra-diverse mice (VH segments 1-80, 1-53, 1-55, 1-18, 9-3, and 1-64). Additionally, there were VH segments shared between the Supra-diverse mice and the in-house sequenced C57 WT sample, "WT Zai naive moVH" (VH segments 1-61, 1-74, and 1-64). There were also shared hits between the publicly available repertoire ("PLoS") and the in-house sequenced sample ("WT") (VH segments 1-26, 1-9, 1-50, 1-78, and 1-64). Overall, the results show a generally consistent usage profile with normal variability, which is typical for analyses of naive repertoires.

[0080] The extent of mouse VH usage was also examined in Supra diversity mice by NGS and bioinformatics analysis. A summary of mouse VH usage obtained from NGS sequencing on the MiSeq platform using the IGX MiXCR application is shown in Table 5 below.

[0081] [Table 5]

[0082] The results indicated that the number of mouse VH segments expressed in the Supra-diverse mice was approximately 115. The number of expressed mouse VH segments identified from in-house C57Bl / 6 wild-type naive spleen sequencing was 114. Furthermore, approximately 132 mouse VH segments have been reported in the published repertoire (Rettig et al. (2018) PLoS One 13(1):e0190982). Based on this, the VH usage frequency in the Supra-diverse mice appears to be normal.

[0083] VH usage in the Supra diversity mice is summarized schematically in Figure 4, which shows the use of 115 mouse VH segments combined with 26 human VD segments and 6 human VJ segments, and 41 human VH segments combined with 26 human VD segments and 6 human VJ segments. These results demonstrate the widespread use of all available VH, D, and JH segments in the Supra diversity mice, regardless of whether the initial VH domain is human or mouse.

[0084] To examine the CDR3 diversity in Supra-diverse mice, we compared the top 48 clonotypes using mouse VH 1-64 between Supra-diverse mice and WT-C57B1 / 6 mice. Comparison of the CDR3 domains revealed several common sequence motifs between the CDR3 domains from Supra and WT mice, but also revealed significant diversity or differences between the CDR3s of these two strains. These results provide evidence that Supra-diverse mice generate unique VH and CDR3 combinations that are atypical or not found in either human or wild-type mouse sources.

[0085] In conclusion, analysis of variable region usage in Supra-diverse mice demonstrated that variable region sequences from either human or mouse origin were efficiently utilized and recombined to form functional VDJ domains, with virtually all available component VH, DH, and JH segments being utilized in functional rearrangements. Furthermore, knock-in of a human donor BAC transgene still allowed for the recovery of the same mouse VH segments found in wild-type mice. Sequence analysis demonstrated both chimeric mVH / hDH / hJH rearrangements and fully human hVH / hDH / hJH rearrangements, with hVH and mVH usage frequencies roughly equivalent in some cases and a preference for fully human rearrangements in others. Overall, the results support the use of Supra-diverse mice as a novel source of antibodies with unique repertoires not found in normal wild-type or human samples.

[0086] [Table 6-1] [Table 6-2] [Table 6-3] [Table 6-4] [Table 6-5] [Table 6-6] [Table 6-7] [Table 6-8] [Table 6-9] [Table 6-10] Table 6-11 Table 6-12 Table 6-13 Table 6-14 Table 6-15 Table 6-16 Table 6-17 Table 6-18 Table 6-19 Table 6-20 Table 6-21 Table 6-22 Table 6-23 Table 6-24 Table 6-25 Table 6-26 Table 6-27 Table 6-28 Table 6-29 Table 6-30 Table 6-31 Table 6-32 Table 6-33 Table 6-34 Table 6-35 Table 6-36 Table 6-37 Table 6-38 Table 6-39 Table 6-40 Table 6-41 Table 6-42 Table 6-43 Table 6-44

[0087]

Claims

1. 1. A method for preparing a chimeric immunoglobulin heavy chain locus in a mouse cell, comprising: (a) deleting mouse D and J segments downstream of Adam6b and upstream of IgM in the endogenous mouse immunoglobulin (Ig) heavy chain locus; (b) introducing a human heavy chain variable region transgene downstream of Adam6b and upstream of IgM into the endogenous mouse Ig heavy chain locus, wherein the transgene comprises a plurality of unrearranged human variable segments (VH), a plurality of human D segments (DH), and a plurality of human J segments (JH), thereby preparing a chimeric Ig heavy chain locus in the mouse cell; The method wherein a mouse comprising said chimeric Ig heavy chain locus expresses an antibody repertoire comprising a mouse VH segment and a human VH segment linked to a human DH and JH segment, respectively.

2. The method of claim 1, wherein step (a) and step (b) are carried out simultaneously using CRISPR-Cas9-mediated knockout / knock-in technology.

3. 2. The method of claim 1, wherein the mouse D segment and the mouse J segment are deleted by CRISPR-Cas9-mediated gene editing, and the human heavy chain variable region transgene is introduced into the mouse Ig heavy chain locus by Cre-Lox-mediated recombination.

4. The method of claim 1 , wherein the human heavy chain variable region transgene is carried on a bacterial artificial chromosome (BAC).

5. The method of claim 1, wherein the mouse comprising the chimeric Ig heavy chain locus expresses an antibody repertoire comprising at least 20 different human VH segments.

6. The method of claim 1, wherein the mouse comprising the chimeric Ig heavy chain locus expresses an antibody repertoire comprising at least 30 different human VH segments.

7. The method of claim 1, wherein the mouse comprising the chimeric Ig heavy chain locus expresses an antibody repertoire comprising at least 40 different human VH segments.

8. 2. The method of claim 1, wherein the mouse comprising the chimeric Ig heavy chain locus expresses an antibody repertoire comprising human VH segments 3-74, 3-73, 3-72, 2-70, 1-69, 3-66, 3-64, 4-61, 4-59, 1-58, 3-53, 5-51, 3-49, 3-48, 1-46, 1-45, 3-43, 4-39, 4-34, 3-33, 4-31, 3-30, 4-28, 2-26, 1-24, 3-23, 3-21, 3-20, 1-18, 3-15, 3-13, 3-11, 3-9, 1-8, 3-7, 2-5, 7-4-1, 4-4, 1-3, 1-2, and 6-1.

9. The method of claim 1, wherein the mouse comprising the chimeric Ig heavy chain locus expresses an antibody repertoire comprising at least 100 different mouse VH segments.

10. The method of claim 1, wherein the mouse comprising the chimeric Ig heavy chain locus expresses an antibody repertoire comprising at least 15 different human D H segments.

11. The method of claim 1, wherein the mouse comprising the chimeric Ig heavy chain locus expresses an antibody repertoire comprising at least 26 different human D H segments.

12. The method of claim 1, wherein the mouse comprising the chimeric Ig heavy chain locus expresses an antibody repertoire comprising at least six different human JH segments.

13. 1. A transgenic mouse cell comprising a chimeric immunoglobulin (Ig) heavy chain locus, the chimeric Ig heavy chain locus comprising: (a) lacking the mouse D and J segments downstream of the endogenous Adam6b sequence and upstream of the endogenous IgM constant sequence; and (b) a human heavy chain variable region transgene downstream of the endogenous Adam6b sequence and upstream of the endogenous IgM sequence, the transgene comprising a plurality of unrearranged human variable segments (VH), a plurality of human D segments (DH), and a plurality of human J segments (JH); A transgenic mouse cell, wherein the transgenic mouse cell comprising the chimeric Ig heavy chain locus expresses an antibody repertoire comprising a mouse VH segment and a human VH segment linked to a human DH segment and a JH segment, respectively.

14. 1. A transgenic mouse comprising a chimeric immunoglobulin (Ig) heavy chain locus, wherein the chimeric Ig heavy chain locus comprises: (a) lacking the mouse D and J segments downstream of the endogenous Adam6b sequence and upstream of the endogenous IgM constant sequence; and (b) a human heavy chain variable region transgene downstream of the endogenous Adam6b sequence and upstream of the endogenous IgM sequence, the transgene comprising a plurality of unrearranged human variable segments (VH), a plurality of human D segments (DH), and a plurality of human J segments (JH); A transgenic mouse, wherein the transgenic mouse comprising the chimeric Ig heavy chain locus expresses an antibody repertoire comprising a mouse VH segment and a human VH segment linked to a human DH segment and a JH segment, respectively.

15. 15. The transgenic mouse of claim 14, further comprising a transgene construct encoding a human immunoglobulin light chain such that the mouse expresses an antibody comprising the human immunoglobulin light chain.

16. A method for producing an antibody against an antigen of interest, comprising administering the antigen of interest to a transgenic mouse according to any one of claims 13 to 15, so as to produce an antibody that binds to the antigen of interest.

17. 17. The method of claim 16, further comprising isolating the antibody of interest from the mouse.

18. 17. The method of claim 16, further comprising isolating nucleic acid encoding the antibody of interest from the mouse and replacing mouse constant region sequences in the nucleic acid with human constant region sequences.

Images