Compositions and methods for inhibiting the expression of 17 beta-hydroxysteroid dehydrogenase type 13 (HSD17B13)

Abstract

Compositions and methods useful for reducing expression of the 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) gene and treating HSD17B13-associated diseases and conditions are provided. HSD17B13 dsRNA agents, HSD17B13 antisense polynucleotide agents, compositions comprising HSD17B13 dsRNA agents, and compositions comprising HSD17B13 antisense polynucleotide agents are provided, which can be used to reduce HSD17B13 expression in cells and subjects.

Description

[Technical Field]

[0001] The present invention relates, in part, to compositions and methods that can be used to inhibit 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) gene expression. [Background technology]

[0002] 17-Hydroxysteroid dehydrogenase type 13 (HSD17B13) is a member of the 17β-hydroxysteroid dehydrogenase (HSD17B or 17β-HSD) family of enzymes, whose members have diverse functions, including the reduction or oxidation of sex hormones, fatty acids, and bile acids in vivo (Moeller and Adamski (2009) Mol Cell Endocrinol 301:7). The HSD17B family consists of 14 enzymes involved in the reduction or oxidation of sex hormones, fatty acids, and bile acids. Tissue distribution, subcellular localization, and catalytic preferences vary among the various family members. The HSD17B family exhibits diverse substrate specificities, including steroids, lipids, and retinoids.

[0003] The highest expression level of HSD17B13 is found in hepatocytes of the liver, with lower levels detectable in the ovaries, bone marrow, kidneys, brain, lungs, skeletal muscle, bladder, and testes. Hepatocytes, which form the liver parenchyma, are responsible for mobilizing lipids for energy and storing excess lipids in the form of lipid droplets (LDs), making the liver a major organ responsible for lipid homeostasis. Although the function of HSD17B13 is not fully understood, several 17β-HSD family members, including 17β-HSD-4, -7, -10, and -12, have been shown to be involved in carbohydrate and fatty acid metabolism. This suggests that HSD17B13 may also play a role in lipid metabolism. Upregulation of hepatic HSD17B13 has been reported in patients with fatty liver disease, supporting the role of this enzyme in the development of nonalcoholic fatty liver disease (NAFLD).

[0004] Therefore, novel therapeutic agents targeting HSD17B13 may reduce HSD17B13 levels and represent a new approach to treating liver diseases such as non-alcoholic fatty liver disease. Summary of the Invention

[0005] In general, the disclosure features novel HSD17B13 gene-specific RNAi agents, compositions comprising the HSD17B13 RNAi agents, and methods of inhibiting HSD17B13 gene expression in vitro and / or in vivo using the HSD17B13 RNAi agents and compositions comprising the HSD17B13 RNAi agents described herein. The HSD17B13 RNAi agents described herein can selectively and efficiently reduce, inhibit, or suppress expression of the HSD17B13 gene in a subject, e.g., a human or animal subject.

[0006] According to one aspect of the present invention, there is provided a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13), the dsRNA agent comprising a sense strand and an antisense strand, wherein the sense strand comprises at least 15 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO:1 by no more than 3 nucleotides, and the antisense strand comprises at least 15 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO:2 by no more than 3 nucleotides. In some embodiments, a dsRNA agent comprises a sense strand and an antisense strand that form a double-stranded region at least 17 nucleotides in length, wherein the sense strand comprises at least 15 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from any one of nucleotides 45-85, 49-85, 576-606, 651-681, 659-689, 666-696, 760-790, 769-799, 772-802, 817-847, 841-871, 876-906, 959-989, 1000-1030, or 1508-1538 of the nucleotide sequence of SEQ ID NO:1, and the antisense strand comprises at least 15 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from the nucleotide sequence of SEQ ID NO:2. In some embodiments, a dsRNA agent comprises a sense strand and an antisense strand that form a double-stranded region at least 17 nucleotides in length, wherein the sense strand comprises at least 15 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from any one of nucleotides 54-72, 56-74, 59-77, 60-78, 581-599, 656-674, 664-682, 671-689, 765-783, 774-792, 777-795, 822-840, 846-864, 881-899, 964-982, 1005-1023, or 1513-1531 of the nucleotide sequence of SEQ ID NO:1, and the antisense strand comprises at least 15 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from the nucleotide sequence of SEQ ID NO:2.In some embodiments, a dsRNA agent includes a sense strand and an antisense strand that form a double-stranded region at least 15, 16, 17 nucleotides in length, wherein the sense strand includes at least 15, 16, 17, 18, 19, or 20 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from any one of nucleotides 45-65, 46-66, 47-67, 48-68, 49-69, 50-70, 51-71, 52-72, 53-73, 54-74, 55-75, 56-76, 57-77, 58-78, 59-79, 60-80, 61-81, 62-82, 63-83, 64-84, or 65-85 of the nucleotide sequence of SEQ ID NO:1, and the antisense strand includes at least 15 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from the corresponding nucleotide sequence of SEQ ID NO:2. In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein nucleotide positions 2-18 of the antisense strand comprise a region of complementarity to an HSD17B13 RNA transcript, wherein the region of complementarity comprises at least 15 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from one of the antisense sequences listed in one of Tables 1-3, and optionally a target ligand. In some embodiments, the region of complementarity to the HSD17B13 RNA transcript comprises at least 15, 16, 17, 18, 19, or 20 contiguous nucleotides that differ by no more than 3 nucleotides from one of the antisense sequences listed in one of Tables 1-3. In certain embodiments, the antisense strand of the dsRNA is at least substantially complementary to any one of the target regions of SEQ ID NO: 1, provided in any one of Tables 1-3. In some embodiments, the antisense strand of the dsRNA is fully complementary to any one of the target regions of SEQ ID NO: 1, provided in any one of Tables 1-3. In some embodiments, the dsRNA agent comprises a sense strand sequence set forth in any one of Tables 1-3, wherein the sense strand sequence is at least substantially complementary to the antisense strand sequence in the dsRNA agent.In certain embodiments, the dsRNA agent comprises a sense strand sequence set forth in any one of Tables 1-3, wherein the sense strand sequence is perfectly complementary to the antisense strand sequence in the dsRNA agent. In some embodiments, the dsRNA agent comprises an antisense strand sequence set forth in any one of Tables 1-3. In some embodiments, the dsRNA agent comprises a sequence set forth as a duplex sequence in any of Tables 1-3.

[0007] In some embodiments, the antisense strand of the dsRNA comprises the nucleotide sequence SI:5'-z1AGAAGCAGAAGGAUUUz2-3', where z1 and z2 each independently represent a nucleotide sequence 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length, and the nucleotide sequence SI is substantially or completely complementary to a portion of an HSD17B13 mRNA transcript. In certain embodiments, z1 is selected from C, G, A, or U. In certain embodiments, z1 is U. In certain embodiments, z2 is absent. In certain embodiments, z2 is a nucleotide sequence selected from C, CU, CA, CC, CG, CUU, CUA, CUC, CUG, CUAC, CUAU, CUAA, CUAG, CUAGG, CUAGUU, CUAGGA, CUAGGAU, CUAGGAUG, CUAGGAUGA, or CUAGGAUGAUGUUCAUGGCUUUG. In some embodiments, the antisense strand of the dsRNA consists of the nucleotide sequence SI:5'-z1AGAAGCAGAAGGAUUUz2-3', where z1 and z2 are each independently as defined above. In certain embodiments, the antisense strand of the dsRNA consists of the nucleotide sequence SI':5'-z1AGAAGCAGAAGGAUUUCz2'-3', where z1 is selected from C, G, A, or U, and z2 is a nucleotide sequence selected from U, A, C, G, UU, UA, UC, UG, UAC, UAU, UAA, UAG, UAGG, UAGUU, UAGGA, UAGGAU, UAGGAUG, AUUUCUAG, UAGGAUGA, or UAGGAUGAUGUUCAUGGCUUUG.

[0008] In some embodiments, the sense strand of the dsRNA comprises the nucleotide sequence SII:5'-z3AAAUCCUUCUGCUUCUz4-3', where z3 and z4 each independently represent a nucleotide sequence 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In certain embodiments, z4 is selected from C, G, A, or U. In certain embodiments, z4 is A. In certain embodiments, z3 is absent. In certain embodiments, z3 is a nucleotide sequence selected from G, AG, UG, GG, CG, AAG, UAG, GAG, CAG, CUAG, GUAG, AUAG, UUAG, CCUAG, UCCUAG, AUCCUAG, CAUCCUAG, UCAUCCUAG, or CAAAGCCAUGAACAUCAUCCUAG. In some embodiments, the sense strand of the dsRNA consists of the nucleotide sequence SII:5'-z3AAAUCCUUCUGCUUCUz4-3', where z3 and z4 are each independently as defined above. In some embodiments, the sense strand of the dsRNA consists of the nucleotide sequence SII':5'-z 3’ GAAAUCCUUCUGCUUCUz4-3', z4 being selected from C, G, A, or U; 3’ is a nucleotide sequence selected from A, U, G, C, AA, UA, GA, CA, CUA, GUA, AUA, UUA, CCUA, UCCUA, AUCCUA, CAUCCUA, UCAUCCUA, or CAAAGCCAUGAACAUCAUCCUA. It is understood that a sense strand is substantially or completely complementary to the corresponding antisense strand.

[0009] In some embodiments, z1 is a nucleotide sequence that is substantially or completely complementary to z4. In some embodiments, z2 is a nucleotide sequence that is substantially or completely complementary to z3. In some embodiments, z 2’ is z 3’ is a nucleotide sequence that is substantially or completely complementary to

[0010] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the antisense strand of the dsRNA comprises the nucleotide sequence SI or SI' described above, and the sense strand is substantially or perfectly complementary to the antisense strand sequence, forming a duplex region of at least 15, 16, 17, 18, or 19 nucleotides containing 0, 1, 2, or 3 mismatches.

[0011] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the antisense strand of the dsRNA consists of the nucleotide sequence SI or SI' described above, and the sense strand is substantially or completely complementary to the antisense strand sequence, forming a duplex region of at least 15, 16, 17, 18, or 19 nucleotides containing 0, 1, 2, or 3 mismatches.

[0012] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand of the dsRNA comprises the nucleotide sequence SII and the antisense strand of the dsRNA comprises the nucleotide sequence SI, and nucleotide sequences SII and SI are as described above. In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand of the dsRNA consists of the nucleotide sequence SII and the antisense strand of the dsRNA consists of the nucleotide sequence SI, and nucleotide sequences SII and SI are as described above.

[0013] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand of the dsRNA comprises the nucleotide sequence SII' and the antisense strand of the dsRNA comprises the nucleotide sequence SI', and the nucleotide sequences SII' and SI' are as described above. In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand of the dsRNA consists of the nucleotide sequence SII' and the antisense strand of the dsRNA consists of the nucleotide sequence SI', and the nucleotide sequences SII' and SI' are as described above.

[0014] In some embodiments, the antisense strand of the dsRNA comprises the nucleotide sequence SIII:5'-zGUGAUCAGAAGCAGAAz6-3', where z5 and z6 each independently represent a nucleotide sequence 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length, and the nucleotide sequence SIII is substantially or completely complementary to a portion of an HSD17B13 mRNA transcript. In certain embodiments, z5 is selected from C, G, A, or U. In certain embodiments, z5 is U. In certain embodiments, z5 is absent. In certain embodiments, z5 is a nucleotide sequence selected from G, GU, GA, GC, GG, GGU, GGA, GGC, GGG, GGAC, GGAU, GGAA, GGAUU, GGAUGA, GGAUUU, GGAUUUC, GGAUUUCU, GGAUUUCUA, or GGAUUUCUAGGAUGAUGUUCAUG. In some embodiments, the antisense strand of the dsRNA consists of the nucleotide sequence SIII:5'-z5GUGAUCAGAAGCAGAAz6-3', where z5 and z6 are each independently as defined above. In certain embodiments, the antisense strand of the dsRNA consists of the nucleotide sequence SIII':5'-z5GUGAUCAGAAGCAGAAGz 6’ z5 is selected from C, G, A, or U; z 6’ is a nucleotide sequence selected from U, A, C, G, GU, GA, GC, GG, GAC, GAU, GAA, GAUU, GAUGA, GAUUU, GAUUUC, GAUUUCU, GAUUUCUA, or GAUUUCUAGGAUGAUGUUCAUG.

[0015] In some embodiments, the sense strand of the dsRNA comprises the nucleotide sequence SIV:5'-z7UUCUGCUUCUGAUCACz8-3', where z7 and z8 each independently represent a nucleotide sequence that is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In certain embodiments, z8 is selected from C, G, A, or U. In certain embodiments, z8 is A. In certain embodiments, z7 is absent. In certain embodiments, z7 is a nucleotide sequence selected from C, AC, UC, GC, CC, ACC, UCC, GCC, CCC, GUCC, AUCC, UUCC, AAUCC, AAAUCC, GAAAUCC, AGAAAUCC, UAGAAAUCC, or CAUGAACAUCAUCCUAGAAAUCC. In some embodiments, the sense strand of the dsRNA consists of the nucleotide sequence SIV:5'-z7UUCUGCUUCUGAUCACz8-3', where z7 and z8 are each independently as defined above. In some embodiments, the sense strand of the dsRNA consists of the nucleotide sequence SIV':5'-z 7’ CUUCUGCUUCUGAUCACz8-3', where z8 is selected from C, G, A, or U; 7’ is a nucleotide sequence selected from A, U, G, C, AC, UC, GC, CC, GUC, AUC, UUC, AAUC, AAAUC, GAAAUC, AGAAAUC, UAGAAAUC, or CAUGAACAUCAUCCUAGAAAUC. It is understood that a sense strand is substantially or completely complementary to the corresponding antisense strand.

[0016] In some embodiments, z5 is a nucleotide sequence that is substantially or completely complementary to z8. In some embodiments, z6 is a nucleotide sequence that is substantially or completely complementary to z7. In some embodiments, z 6’ is z 7’ is a nucleotide sequence that is substantially or completely complementary to

[0017] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the antisense strand of the dsRNA comprises the nucleotide sequence SIII or SIII' described above, and the sense strand is substantially or perfectly complementary to the antisense strand sequence, forming a duplex region of at least 15, 16, 17, 18, or 19 nucleotides containing 0, 1, 2, or 3 mismatches.

[0018] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the antisense strand of the dsRNA consists of the nucleotide sequence SIII or SIII' described above, and the sense strand is substantially or perfectly complementary to the antisense strand sequence, forming a duplex region of at least 15, 16, 17, 18, or 19 nucleotides containing 0, 1, 2, or 3 mismatches.

[0019] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand of the dsRNA comprises the nucleotide sequence SIV and the antisense strand of the dsRNA comprises the nucleotide sequence SIII, and the nucleotide sequences SIII and SIV are as described above. In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand of the dsRNA consists of the nucleotide sequence SIV and the antisense strand of the dsRNA consists of the nucleotide sequence SIII, and the nucleotide sequences SIII and SIV are as described above.

[0020] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand of the dsRNA comprises the nucleotide sequence SIV' and the antisense strand of the dsRNA comprises the nucleotide sequence SIII', and the nucleotide sequences SIII' and SIV' are as described above. In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand of the dsRNA consists of the nucleotide sequence SIV' and the antisense strand of the dsRNA consists of the nucleotide sequence SIII', and the nucleotide sequences SIII' and SIV' are as described above.

[0021] In some embodiments, the dsRNA agent comprises at least one modified nucleotide.In certain embodiments, all or substantially all of the nucleotides of the antisense strand are modified nucleotides.In certain embodiments, all or substantially all of the nucleotides of the sense strand and the antisense strand are modified nucleotides. In some embodiments, at least one of the modified nucleotides comprises a 2'-O-methyl nucleotide, a 2'-fluoro nucleotide, a 2'-deoxy nucleotide, a 2'3'-seconucleotide mimic, a locked nucleotide, an unlocked nucleic acid nucleotide (UNA), a glycol nucleic acid nucleotide (GNA), a 2'-F-arabinonucleotide, a 2'-methoxyethyl nucleotide, an abasic nucleotide, ribitol, an inverted nucleotide, an inverted abasic nucleotide, an inverted 2'-Ome nucleotide, an inverted 2'-deoxy nucleotide, an isomannide nucleotide, a 2'-amino-modified nucleotide, a 2'-alkyl-modified nucleotide, a mophorinonucleotide, and a 3'-OMe nucleotide, a nucleotide containing a 5'-phosphorothioate group, a 5'-phosphonate-modified nucleotide or terminal nucleotide linked to a cholesteryl derivative or a dodecanoic acid bisdecylamide group, a 2'-amino-modified nucleotide, a phosphoramidite, or a non-natural base-containing nucleotide. In some embodiments, the dsRNA agent comprises an E-vinyl phosphonate nucleotide at the 5' end of the guide strand. In certain embodiments, the dsRNA agent comprises at least one phosphorothioate internucleoside linkage. In certain embodiments, the sense strand comprises at least one phosphorothioate internucleoside linkage. In some embodiments, the antisense strand comprises at least one phosphorothioate internucleoside linkage. In some embodiments, the sense strand comprises 1, 2, 3, 4, 5, or 6 phosphorothioate internucleoside linkages. In some embodiments, the antisense strand comprises 1, 2, 3, 4, 5, or 6 phosphorothioate internucleoside linkages.In some embodiments, the antisense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methyl nucleotides and 2'-fluoro nucleotides, and fewer than six modified nucleotides are 2'-fluoro nucleotides. In certain embodiments, the antisense strand comprises three or five 2'-fluoro nucleotides, and preferably, the antisense strand comprises five 2'-fluoro nucleotides. In certain embodiments, the antisense strand comprises five 2'-fluoro nucleotides and 5'-phosphonate-modified nucleotides, and preferably, the 5'-phosphonate-modified nucleotides are nucleotides containing vinyl phosphonate. In some embodiments, the sense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methyl nucleotides and 2'-fluoro nucleotides, and fewer than four modified nucleotides are 2'-fluoro nucleotides. In certain embodiments, the sense strand comprises three 2'-fluoro nucleotides. In some embodiments, the antisense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methyl nucleotides and 2'-fluoro nucleotides, wherein at least 16 modified nucleotides are 2'-O-methyl nucleotides, and the nucleotides at positions 2, 7, 12, 14, and / or 16, counting from the 5'-end of the antisense strand to the first matching position, are 2'-fluoro nucleotides. In certain embodiments, the nucleotides at positions 2, 7, 12, 14, and 16, counting from the 5'-end of the antisense strand to the first matching position, are 2'-fluoro nucleotides, and the 5'-terminal nucleotide of the antisense strand is a nucleotide containing a vinyl phosphonate, preferably, the nucleotide containing a vinyl phosphonate is VPu* as defined herein. In some embodiments, the sense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methyl nucleotides and 2'-fluoro nucleotides, preferably at least 18 modified nucleotides are 2'-O-methyl nucleotides, and the nucleotides at positions 9, 11, and / or 13, counting from the first matching position from the 3' end of the sense strand, are 2'-fluoro nucleotides.

[0022] In some embodiments, the sense strand is complementary or substantially complementary to the antisense strand, and the region of complementarity is between 16 and 23 nucleotides in length. In some embodiments, the region of complementarity is 19 to 21 nucleotides in length. In certain embodiments, the region of complementarity is 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, each strand is 40 nucleotides or less in length. In some embodiments, each strand is 30 nucleotides or less in length. In some embodiments, each strand is 25 nucleotides or less in length. In some embodiments, each strand is 23 nucleotides or less in length. In some embodiments, each strand is 21 nucleotides or less in length.

[0023] In some embodiments, the dsRNA agent comprises at least one modified nucleotide and further comprises one or more targeting groups or linking groups. In some embodiments, one or more targeting groups or linking groups are conjugated to the sense strand. In some embodiments, the targeting group or linking group comprises N-acetylgalactosamine (GalNAc).

[0024] In some embodiments, the targeting group has a structure as follows:

[0025] [ka]

[0026] Each n" is independently selected from 1 or 2.

[0027] In some embodiments, the targeting group has the following structure:

[0028] [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4]

[0029] In certain embodiments, a dsRNA agent comprises a targeting group conjugated to the 5'-end of the sense strand. In some embodiments, a dsRNA agent comprises a targeting group conjugated to the 3'-end of the sense strand. In some embodiments, the antisense strand comprises one inverted abasic residue at the 3'-end. In certain embodiments, the sense strand comprises one or two inverted abasic residues and / or one or two iman residues at the 3'-end and / or 5'-end. In some embodiments, the dsRNA agent has two blunt ends. In some embodiments, at least one strand comprises a 3' overhang of at least one nucleotide. In some embodiments, at least one strand comprises a 3' overhang of at least two nucleotides.

[0030] In some embodiments, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) is provided, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand and the antisense strand comprises a region complementary to a portion of an mRNA encoding HSD17B13, each strand being about 14 to about 30 nucleotides in length, and wherein the sense strand sequence can be represented by Formula (I):

[0031] [ka] During the ceremony, Each N' F represents a 2'-fluoro modified nucleotide, and each N'N1 , N' N2 , N' N3 , N' N4 , N' N5 , and N' N6 independently represent a modified or unmodified nucleotide, and N' N1 , N' N2 , N' N3 , and N' N4 , N' N5 , N' N6 each independently represents a motif containing at least two different modified nucleotides, and each N' L independently represent a modified or unmodified nucleotide, but do not represent a 2'-fluoro modified nucleotide; m' and n' are each independently an integer of 0 to 7.

[0032] In some embodiments, n' is 1 and m' is 1, or n' is 1 and m' is 2, or n' is 1 and m' is 3, or n' is 1 and m' is 4, or n' is 1 and m' is 5, or n' is 3 and m' is 1, or n' is 3 and m' is 2, or n' is 3 and m' is 3, or n' is 5 and m' is 1.

[0033] In certain embodiments, a dsRNA agent comprises a targeting group conjugated to the 5'-end of the sense strand, preferably a targeting group selected from GLO-1 to GLO-16 and GLS-1 to GLS-16 as described above, more preferably GLS-15 as described above. In certain embodiments, a dsRNA agent comprises a targeting group conjugated to the 3'-end of the sense strand. In certain embodiments, the antisense strand comprises one inverted abasic residue at the 3'-end. In certain embodiments, the sense strand comprises one or two inverted abasic residues and / or one or two iman residues at the 3'-end and / or 5'-end. In certain embodiments, the 3'-end and 5'-end of the sense strand each independently comprise an iman residue. In certain embodiments, the sense strand comprises two iman residues at the 3'-end and 5'-end, and a residue at either the 3'-end or the 5'-end is further conjugated to a targeting group, preferably GLS-15 as described above.

[0034] In some embodiments, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) is provided, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand and the antisense strand comprises a region complementary to a portion of an mRNA encoding HSD17B13, each strand being about 14 to about 30 nucleotides in length, and wherein the antisense strand sequence can be represented by Formula (II):

[0035] [ka] During the ceremony, each N F represents a 2'-fluoro modified nucleotide, and each N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 , and N M8 independently represent modified or unmodified nucleotides, preferably NM2 , N M3 , and N M6 each independently represents a 2'-fluoro modified nucleotide, and each N L independently represent a modified or unmodified nucleotide, but do not represent a 2'-fluoro modified nucleotide; and n is an integer from 0 to 7.

[0036] In some embodiments, n is 1, or n is 2, or n is 3.

[0037] In some embodiments, N M6 , N M3 , and N M2 each independently represents a 2'-fluoro modified nucleotide.

[0038] In some embodiments, N M6 , N M3 , and N M2 are all 2'-fluoro modified nucleotides.

[0039] In some embodiments, the modified nucleotide is a modified nucleotide as defined above.

[0040] In some embodiments, the modified nucleotide is a 2'-OMe modified nucleotide or a 2'-F modified nucleotide.

[0041] In some embodiments, the antisense strand sequence can be represented by formula (II').

[0042] [ka] During the ceremony, each N F represents a 2'-fluoro modified nucleotide, and each N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 , and NM8 independently represent modified or unmodified nucleotides, preferably N M2 , N M3 , and N M6 each independently represents a 2'-fluoro modified nucleotide, and each N L independently represent a modified or unmodified nucleotide, but does not represent a 2'-fluoro modified nucleotide; N Z represents a nucleotide containing a phosphomimetic, preferably N Z represents a nucleotide containing a vinylphosphonate, and n is an integer of 0 to 7.

[0043] In some embodiments, n is 1, or n is 2, or n is 3.

[0044] In some embodiments, N M6 , N M3 , and N M2 each independently represents a 2'-fluoro modified nucleotide.

[0045] In some embodiments, N M6 , N M3 , and N M2 are all 2'-fluoro modified nucleotides.

[0046] In some embodiments, the modified nucleotide is a modified nucleotide as defined above.

[0047] In some embodiments, the modified nucleotide is a 2'-OMe modified nucleotide or a 2'-F modified nucleotide.

[0048] In some embodiments, N Z is a vinylphosphonate modified nucleotide.

[0049] In some embodiments, N Z is the structure [ka] VPu* has the following structure.

[0050] In some embodiments, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) is provided, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a dsRNA duplex, wherein the sense strand is complementary to the antisense strand, and the antisense strand comprises a region of complementarity to an mRNA encoding HSD17B13, wherein the region of complementarity comprises at least 15 contiguous nucleotides, and wherein the dsRNA duplex can be represented by formula (III):

[0051] [ka] During the ceremony, each strand is about 17 to about 30 nucleotides in length; each N F and N' F independently represent a 2'-fluoro modified nucleotide, N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 , N M8 , N' N1 , N' N2 , N' N3 , N' N4 , N' N5 , and N' N6 each independently represents a modified or unmodified nucleotide, and each N L and N' L independently represent a modified or unmodified nucleotide, but do not represent a 2'-fluoro modified nucleotide; m', n', and n are each independently an integer of 0 to 7.

[0052] In some embodiments, the modified nucleotide is a modified nucleotide as defined above.

[0053] In some embodiments, the modified nucleotide is a 2'-OMe modified nucleotide or a 2'-F modified nucleotide.

[0054] In some embodiments, n' is 1 and m' is 1, or n' is 1 and m' is 2, or n' is 1 and m' is 3, or n' is 1 and m' is 4, or n' is 1 and m' is 5, or n' is 3 and m' is 1, or n' is 3 and m' is 2, or n' is 3 and m' is 3, or n' is 5 and m' is 1.

[0055] In some embodiments, n is 1, or n is 2, or n is 3.

[0056] In some embodiments, N' N1 N' N2 N' N3 and N' N4 N' N5 N' N6 each independently represent a motif containing at least two different modified nucleotides.

[0057] In some embodiments, N M6 , N M3 , and N M2 each independently represent a 2'-fluoro modified nucleotide. M6 , N M3 , and N M2 are all 2'-fluoro modified nucleotides.

[0058] In some embodiments, the sense strand and the antisense strand form a dsRNA duplex, wherein the sense strand is complementary to the antisense strand, and the antisense strand comprises a region of complementarity to an mRNA encoding HSD17B13, wherein the region of complementarity comprises at least 15 contiguous nucleotides, and the dsRNA duplex can be represented by formula (III'):

[0059] [ka] During the ceremony, each strand is about 17 to about 30 nucleotides in length; each N F and N' F independently represent a 2'-fluoro modified nucleotide, N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 , N M8 , N' N1 , N' N2 , N' N3 , N' N4 , N' N5 , and N' N6 each independently represents a modified or unmodified nucleotide, and each N L and N' L independently represent a modified or unmodified nucleotide, but does not represent a 2'-fluoro modified nucleotide; N Z represents a nucleotide containing a phosphomimetic, preferably N Z represents a nucleotide containing a vinylphosphonate, and m', n', and n are each independently an integer of 0 to 7.

[0060] In some embodiments, the modified nucleotide is a modified nucleotide as defined above.

[0061] In some embodiments, the modified nucleotide is a 2'-OMe modified nucleotide or a 2'-F modified nucleotide.

[0062] In some embodiments, n' is 1 and m' is 1, or n' is 1 and m' is 2, or n' is 1 and m' is 3, or n' is 1 and m' is 4, or n' is 1 and m' is 5, or n' is 3 and m' is 1, or n' is 3 and m' is 2, or n' is 3 and m' is 3, or n' is 5 and m' is 1.

[0063] In some embodiments, n is 1, or n is 2, or n is 3.

[0064] In some embodiments, N' N1 N' N2 N' N3 and N' N4 N' N5 N' N6 each independently represent a motif containing at least two different modified nucleotides.

[0065] In some embodiments, N M6 , N M3 , and N M2 each independently represent a 2'-fluoro modified nucleotide. M6 , N M3 , and N M2 are all 2'-fluoro modified nucleotides.

[0066] In some embodiments, N Z is a vinylphosphonate modified nucleotide.

[0067] In some embodiments, N Z is the structure [ka] VPu* has the following structure.

[0068] In some embodiments, the dsRNA agent comprises a targeting group conjugated to the 5'-end of the sense strand; preferably, the targeting group is any one selected from the aforementioned GLO-1 to GLO-16 and GLS-1 to GLS-16; more preferably, the targeting group is the aforementioned GLS-15. In certain embodiments, the dsRNA agent comprises a targeting group conjugated to the 3'-end of the sense strand. In certain embodiments, the antisense strand comprises one inverted abasic residue at the 3'-end. In certain embodiments, the sense strand comprises one or two inverted abasic residues and / or one or two iman residues at the 3'-end and / or 5'-end. In certain embodiments, the sense strand comprises two iman residues at the 3'-end and 5'-end. In certain embodiments, each end of the sense strand comprises one inverted abasic residue. In certain embodiments, each end of the sense strand comprises one iman residue. In certain embodiments, the sense strand comprises two Iman residues at the 3' and 5' ends, and either the 3' or 5' end residue is further conjugated to a targeting group, which is preferably GLS-15. In certain embodiments, the dsRNA agent has two blunt ends. In certain embodiments, at least one strand comprises a 3' overhang of at least one nucleotide. In certain embodiments, at least one strand comprises a 3' overhang of at least two nucleotides.

[0069] In some embodiments, at least one bond in the sense strand and / or antisense strand is a phosphodiester (PO) bond. In some embodiments, at least one bond in the sense strand and / or antisense strand is a modified bond. In some embodiments, at least one bond in the sense strand and / or antisense strand is a phosphorothioate (PS) bond. In some embodiments, at least one phosphorothioate (PS) bond is introduced at the 5'-end, 3'-end, or both ends of the sense strand and / or antisense strand. In some embodiments, 1, 2, 3, 4, 5, or 6 phosphorothioate (PS) bonds are introduced at the 5'-end, 3'-end, or both ends of the sense strand and / or antisense strand. In some embodiments, at least two terminal-modified or unmodified nucleotides at one or both ends of the antisense strand are linked via phosphorothioate bonds. In some embodiments, three terminal-modified or unmodified nucleotides at one or both ends of the antisense strand are linked via phosphorothioate bonds. In some embodiments, at least two terminal modified or unmodified nucleotides at one or both ends of the sense strand are linked via phosphorothioate bonds. In some embodiments, three terminal modified or unmodified nucleotides at one or both ends of the sense strand are linked via phosphorothioate bonds. In some embodiments, three terminal modified or unmodified nucleotides at the 5' end of the sense strand are linked via phosphorothioate bonds, and two terminal modified or unmodified nucleotides at the 3' end of the sense strand are linked via phosphorothioate bonds. In some embodiments, the sense strand contains phosphorothioate bonds between the target group and the inverted abasic or iman residue, and between the inverted abasic or iman residue and the terminal modified or unmodified nucleotide at the 5' end of the sense strand.

[0070] In some embodiments, any one of the sense strands in Table 1 may be further modified in the pattern shown in formula (I) or (III) above. In some embodiments, any one of the antisense strands in Table 1 may be further modified in the pattern shown in formula (II), (II'), (III), or (III') above. In some embodiments, any one of the duplexes in Table 1 may be further modified in the pattern shown in formula (III) or (III') above. In some embodiments, the modified sense strand has a modification pattern set forth in any one of Tables 2-3. In some embodiments, the modified antisense strand has a modification pattern set forth in any one of Tables 2-3. In some embodiments, the modified sense strand is a modified sense strand sequence set forth in one of Tables 2-3. In some embodiments, the modified antisense strand is a modified antisense strand sequence set forth in one of Tables 2-3. In some embodiments, the dsRNA is selected from the group consisting of AD00462, AD00463, AD00464, AD00465, AD00466, AD00467, AD00468, AD00469, AD00470, AD00471, AD00472, AD00473, AD00675, AD00676, AD00677, AD00678, AD00679, AD00680, AD00681, AD00682, AD00683, AD00684, AD00685, AD00686, AD00687, AD00688, AD00689, AD00690, AD00691, AD00692, AD00693, AD00694, AD00695, AD00696, AD00697, AD00698, AD00699, AD00700, AD00701, AD00702, AD00703, AD00704, AD00705, AD00706, AD00707, AD00708, AD00709, AD00710, AD00711, AD00712, AD00713, AD00714, AD00715, AD00716, AD00717, AD00718, AD00719, AD00720, AD00721, AD00722, AD00723, AD00724, AD00725, AD00726, AD00727, AD00728, AD00729, AD00730, AD00731, AD00732, AD0073 0685, AD00686, AD00687, AD00688, AD00689, AD00690, AD00691, AD00692, AD00693, AD00694, AD00695, AD00696, AD00697, AD00675-1, AD00677-1, AD00678-1, AD00682-1, AD00689-1, AD00675-2, AD00677-2, and AD00678-2.

[0071] According to one aspect of the present invention, a composition is provided that comprises any of the above-mentioned dsRNA agent aspects of the present invention.In certain embodiments, the composition also comprises a pharmaceutically acceptable carrier.In some embodiments, the composition also comprises one or more additional therapeutic agents.In certain embodiments, the composition is packaged in a kit, a container, a pack, a dispenser, a pre-filled syringe, or a vial.In some embodiments, the composition is formulated for subcutaneous administration or for intravenous (IV) administration.

[0072] According to another aspect of the present invention, there is provided a cell comprising any of the embodiments of the aforementioned dsRNA agent aspects of the present invention. In some embodiments, the cell is a mammalian cell, optionally a human cell.

[0073] According to another aspect of the present invention, there is provided a method for inhibiting expression of the HSD17B13 gene in a cell, the method comprising: (i) preparing cells comprising an effective amount of any of the aforementioned dsRNA agent embodiments of the present invention or any of the aforementioned composition embodiments of the present invention. In certain embodiments, the method also comprises (ii) maintaining the prepared cells for a period of time sufficient to allow degradation of mRNA transcripts of the HSD17B13 gene, thereby inhibiting expression of the HSD17B13 gene in the cells. In some embodiments, the cells are present in a subject and the dsRNA agent is administered to the subject subcutaneously. In some embodiments, the cells are present in a subject and the dsRNA agent is administered to the subject by IV administration. In certain embodiments, the method also includes assessing the inhibition of the HSD17B13 gene after administering the dsRNA agent to the subject, wherein the means for assessing includes (i) determining one or more physiological characteristics of the HSD17B13-related disease or condition in the subject, and (ii) comparing the determined physiological characteristics with a baseline physiological characteristic before treatment of the HSD17B13-related disease or condition and / or a control physiological characteristic of the HSD17B13-related disease or condition, wherein the comparison indicates one or more of the presence or absence of inhibition of expression of the HSD17B13 gene in the subject. In some embodiments, the physiological characteristic is one or more of HSD17B13 mRNA level and HSD17B13 protein level. Decreased expression of HSD17B13 can also be assessed indirectly by measuring a decrease in the biological activity of HSD17B13, for example, a decrease in the enzymatic activity of HSD17B13, and / or a decrease in one or more of lipids, triglycerides, cholesterol (including LDL-C, HDL-C, VLDL-C, IDL-C, and total cholesterol), or free fatty acids in plasma or tissue samples, and / or a decrease in fat accumulation and / or an expansion of lipid droplets in the liver.

[0074] According to another aspect of the present invention, there is provided a method for inhibiting expression of the HSD17B13 gene in a subject, the method comprising administering to the subject an effective amount of an embodiment of the dsRNA agent aspect of the present invention described above or an embodiment of the composition of the present invention described above. In some embodiments, the dsRNA agent is administered to the subject subcutaneously. In certain embodiments, the dsRNA agent is administered to the subject via IV administration. In some embodiments, the method also includes assessing inhibition of the HSD17B13 gene after administration of the dsRNA agent, wherein the assessing means comprises (i) determining one or more physiological characteristics of the HSD17B13-related disease or condition in the subject, and (ii) comparing the determined physiological characteristics with a baseline physiological characteristic before treatment of the HSD17B13-related disease or condition and / or a control physiological characteristic of the HSD17B13-related disease or condition, wherein the comparison indicates one or more of the presence or absence of inhibition of expression of the HSD17B13 gene in the subject. In some embodiments, expression of the HSD17B13 gene can be assessed based on the level or change in level of any variable associated with expression of the HSD17B13 gene, such as HSD17B13 mRNA level, HSD17B13 protein level, etc. Decreased expression of HSD17B13 can also be assessed indirectly by measuring a decrease in the biological activity of HSD17B13, for example, a decrease in the enzymatic activity of HSD17B13, and / or a decrease in one or more of lipids, triglycerides, cholesterol (including LDL-C, HDL-C, VLDL-C, IDL-C, and total cholesterol), or free fatty acids in plasma or tissue samples, and / or a decrease in fat accumulation and / or an expansion of lipid droplets in the liver.

[0075] According to another aspect of the present invention, there is provided a method for treating a disease or condition associated with the presence of HSD17B13 protein, the method comprising administering to a subject an effective amount of any of the aforementioned dsRNA agent embodiments of the present invention or any of the aforementioned composition embodiments of the present invention to inhibit expression of the HSD17B13 gene. In some embodiments, the HSD17B13-related disease, disorder, or condition is selected from the group consisting of hepatitis, liver fibrosis, non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), cirrhosis, alcoholic steatohepatitis (ASH), alcoholic fatty liver disease (ALD), HCV-related cirrhosis, drug-induced liver injury, hepatocellular necrosis, and HSD17B13-related obesity. In some embodiments, the method also comprises administering an additional therapeutic regimen to the subject. In some embodiments, the additional therapeutic regimen includes treatment of an HSD17B13-related disease or condition. In certain embodiments, the additional treatment regimen comprises administering to the subject one or more HSD17B13 antisense polynucleotides of the invention, administering to the subject a non-HSD17B13 dsRNA therapeutic agent, and behavioral modification in the subject. In some embodiments, the non-HSD17B13 dsRNA therapeutic agent is one or more of pyridoxine, an ACE inhibitor (angiotensin-converting enzyme inhibitor), e.g., benazepril (Lotensin), an angiotensin II receptor blocker (ARB) (e.g., losartan potassium, such as Cozaar® from Merck & Co.), e.g., candesartan (Atacand), an HMG-CoA reductase inhibitor (e.g., a statin), a calcium binder, e.g., sodium cellulose phosphate (Calcibind), a diuretic, e.g., a thiazide diuretic, such as hydrochlorothiazide (Microzide), an insulin sensitizer, such as the PPARγ agonist pioglitazone, a glp-1r agonist, such as liraglutatide, vitamin E, an SGLT2 inhibitor, a DPPIV inhibitor, and a kidney / liver transplant, or a combination of any of the foregoing. In some embodiments, the dsRNA agent is administered subcutaneously to the subject. In certain embodiments, the dsRNA agent is administered to the subject by IV administration.In some embodiments, the method also includes determining the effectiveness of the administered double-stranded ribonucleic acid (dsRNA) agent in the subject. In some embodiments, the means for determining the effectiveness of treatment in the subject includes (i) determining one or more physiological characteristics of the HSD17B13-associated disease or condition in the subject, and (ii) comparing the determined physiological characteristics with a baseline pre-treatment physiological characteristic of the HSD17B13-associated disease or condition, wherein the comparison indicates one or more of the presence or absence of administration of the double-stranded ribonucleic acid (dsRNA) agent to the subject and a level of effectiveness. In some embodiments, expression of the HSD17B13 gene can be assessed based on the level or change in level of any variable associated with HSD17B13 gene expression, such as HSD17B13 mRNA level, HSD17B13 protein level, and / or HSD17B13 enzymatic activity in a subject, or lipid levels, triglyceride levels, cholesterol levels (including LDL-C, HDL-C, VLDL-C, IDL-C, and total cholesterol), free fatty acid levels, or fat levels and / or lipid droplet levels in the liver in plasma or tissue samples.

[0076] According to another aspect of the present invention, there is provided a method for reducing a subject's HSD17B13 protein level compared to the subject's baseline pre-treatment level of HSD17B13 protein, the method comprising administering to the subject an effective amount of any of the above-mentioned dsRNA agent embodiments of the present invention or any of the above-mentioned composition embodiments of the present invention to reduce the level of HSD17B13 gene expression. In some embodiments, the dsRNA agent is administered to the subject subcutaneously or administered to the subject via IV.

[0077] According to another aspect of the present invention, there is provided a method for altering the physiological characteristics of an HSD17B13-related disease or condition in a subject compared to the subject's baseline pre-treatment physiological characteristics of the HSD17B13-related disease or condition, the method comprising administering to the subject an effective amount of any of the aforementioned dsRNA agent embodiments of the present invention or any of the aforementioned composition embodiments of the present invention to alter the physiological characteristics of the HSD17B13-related disease or condition in the subject. In some embodiments, the dsRNA agent is administered to the subject subcutaneously or intravenously. In certain embodiments, the physiological characteristics are one or more of the following in the subject: HSD17B13 mRNA level, HSD17B13 protein level, and / or HSD17B13 enzymatic activity, or lipid levels, triglyceride levels, cholesterol levels (including LDL-C, HDL-C, VLDL-C, IDL-C, and total cholesterol), free fatty acid levels, or liver fat levels and / or lipid droplet levels in plasma or tissue samples.

[0078] According to another aspect of the present invention, the above-mentioned dsRNA agent is provided for use in a method for treating the disease or condition associated with the presence of HSD17B13 protein.In some embodiments, the disease or condition is one or more of hepatitis, liver fibrosis, simple fatty liver (steatosis), non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), cirrhosis, alcoholic steatohepatitis (ASH), alcoholic fatty liver disease (ALD), HCV-related cirrhosis, drug-induced liver injury, hepatocellular necrosis, and HSD17B13-related obesity.

[0079] According to another aspect of the present invention, there is provided an antisense polynucleotide agent for inhibiting expression of HSD17B13 protein, the agent comprising 10 to 30 consecutive nucleotides, at least one of which is a modified nucleotide, and the nucleotide sequence of the agent is about 80% complementary over its entire length to the equivalent region of the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the equivalent region is any one of the target regions of SEQ ID NO: 1, and the complementary sequence is one of those provided in any one of Tables 1-3. In certain embodiments, the antisense polynucleotide agent comprises one of the antisense sequences provided in any one of Tables 1-3.

[0080] According to another aspect of the present invention, there is provided a composition comprising any of the above-described embodiments of an antisense polynucleotide agent. In some embodiments, the composition also comprises a pharmaceutically acceptable carrier. In some embodiments, the composition also comprises one or more additional therapeutic agents for treating HSD17B13-related diseases or conditions. In certain embodiments, the composition is packaged in a kit, container, pack, dispenser, pre-filled syringe, or vial. In certain embodiments, the composition is formulated for subcutaneous or IV administration.

[0081] According to another aspect of the present invention, there is provided a cell comprising any of the foregoing antisense polynucleotide agent embodiments, hi some embodiments, the cell is a mammalian cell, optionally a human cell.

[0082] According to another aspect of the present invention, there is provided a method for inhibiting expression of the HSD17B13 gene in a cell, the method comprising: (i) preparing a cell comprising an effective amount of any of the embodiments of the antisense polynucleotide agent described above. In some embodiments, the method also comprises: (ii) maintaining the cell prepared in (i) for a time sufficient to allow degradation of mRNA transcripts of the HSD17B13 gene, thereby inhibiting expression of the HSD17B13 gene in the cell.

[0083] According to another aspect of the present invention, there is provided a method of inhibiting expression of the HSD17B13 gene in a subject, the method comprising administering to the subject an effective amount of any of the embodiments of the antisense polynucleotide agent described above.

[0084] According to another aspect of the present invention, there is provided a method of treating a disease or condition associated with the presence of HSD17B13 protein, the method comprising administering to a subject an effective amount of any of the aforementioned antisense polynucleotide agent embodiments of the present invention or any of the aforementioned composition embodiments of the present invention to inhibit expression of the HSD17B13 gene. In certain embodiments, the disease or condition is one or more of hepatitis, liver fibrosis, non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), cirrhosis, alcoholic steatohepatitis (ASH), alcoholic fatty liver disease (ALD), HCV-associated cirrhosis, drug-induced liver injury, hepatocellular necrosis, and HSD17B13-associated obesity.

[0085] According to another aspect of the present invention, there is provided a method of reducing the level of HSD17B13 protein in a subject compared to the subject's baseline pre-treatment level of HSD17B13 protein, the method comprising administering to the subject an effective amount of any of the aforementioned antisense polynucleotide agent embodiments of the present invention, or any of the aforementioned composition embodiments of the present invention, to reduce the level of HSD17B13 gene expression. In certain embodiments, the antisense polynucleotide agent is administered to the subject by subcutaneous or IV administration.

[0086] According to another aspect of the present invention, there is provided an antisense polynucleotide agent for inhibiting expression of the HSD17B13 gene, the agent comprising 10 to 30 consecutive nucleotides, at least one of the consecutive nucleotides being a modified nucleotide, and the nucleotide sequence of the agent being about 80% or about 85% complementary over its entire length to the equivalent region of the nucleotide sequence of SEQ ID NO: 1.

[0087] According to another aspect of the present invention, there is provided a method for altering physiological characteristics of an HSD17B13-associated disease or condition in a subject compared to the subject's baseline pre-treatment physiological characteristics of the HSD17B13-associated disease or condition, the method comprising administering to the subject an effective amount of any of the aforementioned antisense polynucleotide agent embodiments of the present invention or any of the aforementioned composition embodiments of the present invention to alter the physiological characteristics of the HSD17B13 disease or condition in the subject. In some embodiments, the antisense polynucleotide agent is administered to the subject by subcutaneous or intravenous administration. In some embodiments, the physiological characteristics are one or more of the following in the subject: HSD17B13 mRNA level, HSD17B13 protein level and / or HSD17B13 enzymatic activity, or lipid levels, triglyceride levels, cholesterol levels (including LDL-C, HDL-C, VLDL-C, IDL-C, and total cholesterol), free fatty acid levels, or liver fat levels and / or lipid droplet levels in a plasma or tissue sample. [Sequence Listing Description]

[0088] SEQ ID NO: 1 and SEQ ID NO: 2 (reverse complement) are Homo sapiens 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) mRNA [NCBI Reference Sequence: NM_178135.5].

[0089] SEQ ID NO: 3 and SEQ ID NO: 4 (reverse complement) are Homo sapiens 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) mRNA [NCBI Reference Sequence: NM_001136230.3].

[0090] SEQ ID NO:5 and SEQ ID NO:6 (reverse complement) are Homo sapiens 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) mRNA [Source: HGNC Symbol; Acc: HGNC:18685; Transcript: ENST00000302219.10].

[0091] SEQ ID NO:7 and SEQ ID NO:8 (reverse complement) are the predicted Macaca fascicularis 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) mRNA [NCBI Reference Sequence: XM_005555367.2].

[0092] SEQ ID NO:9 and SEQ ID NO:10 (reverse complement) are the predicted Macaca fascicularis 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) mRNA [Source: HGNC symbol; Acc: HGNC:18685; Transcript: ENSMFAT00000009821.2].

[0093] SEQ ID NO:11 and SEQ ID NO:12 (reverse complement) are the predicted Macaca fascicularis 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) mRNA [Source: HGNC symbol; Acc: HGNC:18685; Transcript: ENSMFAT00000009826.2].

[0094] SEQ ID NO: 13 and SEQ ID NO: 14 (reverse complement) are the predicted Macaca mulatta 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) mRNA [NCBI Reference Sequence: XM_015138766.2].

[0095] SEQ ID NO:15 and SEQ ID NO:16 (reverse complement) are the predicted Macaca mulatta 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) mRNA [Source: HGNC symbol; Acc: VGNC:73417; Transcript: ENSMMUT00000062701.2].

[0096] SEQ ID NO: 17 and SEQ ID NO: 18 (reverse complement) are Mus musculus 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) mRNA [NCBI Reference Sequence: NM_001163486.1].

[0097] SEQ ID NO: 19 and SEQ ID NO: 20 (reverse complement) are Mus musculus 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) mRNA [NCBI Reference Sequence: NM_198030.2].

[0098] SEQ ID NO: 21 and SEQ ID NO: 22 (reverse complement) are Mus musculus 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) mRNA [Source: MGI Symbol, Acc: MGI:2140804, Transcript: ENSMUST00000048118.15].

[0099] SEQ ID NO: 23 and SEQ ID NO: 24 (reverse complement) are Mus musculus 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) mRNA [Source: MGI Symbol, Acc: MGI:2140804, Transcript: ENSMUST00000120320.8].

[0100] SEQ ID NO: 25 and SEQ ID NO: 26 (reverse complement) are Mus musculus 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) mRNA [Source: MGI Symbol, Acc: MGI:2140804, Transcript: ENSMUST00000112803.3].

[0101] SEQ ID NO: 27 and SEQ ID NO: 28 (reverse complement) are the Rattus norvegicus 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) mRNA [NCBI Reference Sequence: NM_001009684.1].

[0102] SEQ ID NO: 29 and SEQ ID NO: 30 (reverse complement) are the Rattus norvegicus 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) mRNA [NCBI Reference Sequence: XR_005492928.1].

[0103] SEQ ID NO:31 and SEQ ID NO:32 (reverse complement) are Rattus norvegicus 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) mRNA [Source: RGD symbol, Acc: 1359553, Transcript: ENSRNOT00000038188.2].

[0104] SEQ ID NOs: 33 to 288 and 837 to 917 are shown in Table 1 and are sense strand sequences.

[0105] SEQ ID NOs: 289 to 544 and 918 to 998 are shown in Table 1 and are antisense strand sequences.

[0106] SEQ ID NOs: 545-750, 999-1178 are shown in Table 2 with chemical modifications indicated by uppercase: 2'-fluoro, lowercase: 2'-OMe, and thiophosphate: *, and those skilled in the art will understand that "*" is a symbol indicating a bond relationship, the presence of "*" means that the monomers are bonded to each other via a phosphorothioate diester bond, the absence of "*" between two monomers indicates that the monomers are bonded to each other via a phosphodiester bond, and invab = inverted abasic.

[0107] SEQ ID NOs: 751-836, 1179-1188 are shown in Table 3. Delivery molecules are indicated as "GLX-_" at the 3' or 5' end of each sense strand. Chemical modifications are indicated as uppercase: 2'-fluoro, lowercase: 2'-OMe, and phosphorothioate: *, where one skilled in the art will understand that "*" is a symbol indicating the bond relationship, and the presence of "*" means that the monomers are linked to each other via a phosphorothioate diester bond, while the absence of "*" between two monomers indicates that the monomers are linked to each other via a phosphodiester bond, and invab = inverted abasic. Iman: at the end of each strand [ka] or when further conjugated to a delivery molecule [ka] DETAILED DESCRIPTION OF THE INVENTION

[0108] The present invention includes, in part, RNAi agents, such as, but not limited to, double-stranded (ds) RNAi agents, capable of inhibiting 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) gene expression. The present invention also includes, in part, compositions comprising HSD17B13 RNAi agents and methods of using such compositions. The HSD17B13 RNAi agents disclosed herein can be attached to a delivery compound for delivery to cells, including hepatocytes. Pharmaceutical compositions of the present invention can include at least one ds HSD17B13 agent and a delivery compound. In some embodiments of the compositions and methods of the present invention, the delivery compound is a GalNAc-containing delivery compound. The HSD17B13 RNAi agents delivered to cells can inhibit expression of the HSD17B13 gene, thereby reducing the activity of the protein product of the HSD17B13 gene in the cells. The dsRNAi agents of the present invention can be used to treat HSD17B13-related diseases and conditions.

[0109] In some embodiments of the present invention, reducing HSD17B13 expression in a cell or a subject treats a disease or condition associated with HSD17B13 expression in a cell or a subject, respectively. Non-limiting examples of diseases and conditions that can be treated by reducing HSD17B13 activity include hepatitis, liver fibrosis, non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), cirrhosis, alcoholic steatohepatitis (ASH), alcoholic fatty liver disease (ALD), HCV-associated cirrhosis, drug-induced liver injury, hepatocellular necrosis, HSD17B13-associated obesity, or other diseases in which reducing HSD17B13 protein level and activity would be medically beneficial.

[0110] As used herein, "G," "C," "A," and "U" typically represent nucleotides containing guanine, cytosine, adenine, and uracil as bases, respectively. However, it will be understood that the term "ribonucleotide" or "nucleotide" can also refer to modified nucleotides or alternative replacement moieties, as described in more detail below. Those skilled in the art will understand that guanine, cytosine, adenine, and uracil can be substituted with other moieties without substantially altering the base pairing properties of an oligonucleotide containing a nucleotide with such a replacement moiety. For example, and without limitation, a nucleotide containing inosine as a base can base pair with a nucleotide containing adenine, cytosine, or uracil. Thus, in the nucleotide sequences of the present invention, nucleotides containing uracil, guanine, or adenine can be substituted with, for example, a nucleotide containing inosine. Sequences containing such replacement moieties are embodiments of the present invention.

[0111] As used herein, the term "17β-hydroxysteroid dehydrogenase type 13" is used interchangeably with the term "HSD17B13" and refers, unless otherwise specified, to a naturally occurring gene encoding a 17-hydroxysteroid dehydrogenase type 13 protein obtained from any vertebrate or mammalian source, including, but not limited to, human, bovine, chicken, rodent, mouse, rat, porcine, ovine, primate, monkey, or guinea pig. The term also refers to fragments and variants of native HSD17B13 that maintain at least one in vivo or in vitro activity of native HSD17B13. The amino acid sequence and complete coding sequence of the reference sequence of the human HSD17B13 gene can be found, for example, in GenBank Ref Seq Accession No. NM_178135.5 (SEQ ID NO: 1 and SEQ ID NO: 2), GenBank Ref Seq Accession No. NM_001136230.3 (SEQ ID NO: 3 and SEQ ID NO: 4), and HGNC Transcript: ENST00000302219.10 (SEQ ID NO: 5 and SEQ ID NO: 6).Mammalian orthologs of the human HSD17B13 gene are listed, for example, in GenBank Ref Seq Accession No. XM_005555367.2, cynomolgus monkey (SEQ ID NO: 7 and SEQ ID NO: 8), HGNC Transcript: ENSMFAT00000009821.2, cynomolgus monkey (SEQ ID NO: 9 and SEQ ID NO: 10), HGNC Transcript: ENSMFAT00000009826.2, cynomolgus monkey (SEQ ID NO: 11 and SEQ ID NO: 12), GenBank Ref Seq Accession No. XM_015138766.2, rhesus monkey (SEQ ID NO: 13 and SEQ ID NO: 14), VGNC transcript: ENSMMUT00000062701.2, rhesus monkey (SEQ ID NO: 15 and SEQ ID NO: 16); GenBank Ref Seq Accession No. NM_001163486.1, mouse (SEQ ID NO: 17 and SEQ ID NO: 18); GenBank Ref Seq Accession No. NM_198030.2, mouse (SEQ ID NO: 19 and SEQ ID NO: 20); MGI transcript: ENSMUST00000048118.15, mouse (SEQ ID NO: 21 and SEQ ID NO: 22); MGI transcript: ENSMUST00000120320.8, mouse (SEQ ID NO: 23 and SEQ ID NO: 24); MGI transcript: ENSMUST00000112803.3, mouse (SEQ ID NO: 25 and SEQ ID NO: 26); GenBank Ref Seq Accession No. NM_001009684.1, rat (SEQ ID NO: 27 and SEQ ID NO: 28); GenBank Ref Seq Accession No. XR_005492928.1, rat (SEQ ID NO: 29 and SEQ ID NO: 30); RGD transcript: ENSRNOT00000038188.2, rat (SEQ ID NO: 31 and SEQ ID NO: 32). Additional examples of HSD17B13 mRNA sequences are readily available using public databases such as, for example, GenBank, UniProt, Ensembl, and OMIM.

[0112] The following describes methods for making and using compositions containing HSD17B13 single-stranded (ssRNA) and dsRNA agents for inhibiting HSD17B13 gene expression, as well as compositions and methods for treating diseases and conditions caused by or regulated by HSD17B13 gene expression. The term "RNAi" is known in the art and is sometimes referred to as "siRNA."

[0113] As used herein, the term "RNAi" refers to an agent that contains RNA and mediates targeted cleavage of RNA transcripts via the RNA-induced silencing complex (RISC) pathway. As known in the art, an RNAi target region, also defined as a "target region" or "target portion," refers to a contiguous portion of the nucleotide sequence of a messenger RNA (mRNA) molecule formed during transcription of a gene, including the messenger RNA (mRNA) that is the product of RNA processing of the primary transcript. The target portion of the sequence will be at least long enough to serve as a substrate for RNAi-induced cleavage at or near that portion. The target sequence may be 8-30 nucleotides in length (inclusive), 10-30 nucleotides in length (inclusive), 12-25 nucleotides in length (inclusive), 15-23 nucleotides in length (inclusive), 16-23 nucleotides in length (inclusive), or 18-23 nucleotides in length (inclusive), including the shorter length within each of the listed ranges. In some embodiments of the invention, the target sequence is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length. In particular embodiments, the target sequence is 9 to 26 nucleotides in length (inclusive), including all subranges and integers therebetween. For example, and not intended to be limiting, in certain embodiments of the invention, the target sequence is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length, and the sequence is fully or at least substantially complementary to at least a portion of an RNA transcript of the HSD17B13 gene. Some aspects of the invention include pharmaceutical compositions comprising one or more HSD17B13 dsRNA agents and a pharmaceutically acceptable carrier. In certain embodiments of the present invention, the HSD17B13 RNAi described herein inhibits expression of HSD17B13 protein.

[0114] As used herein, the term "dsRNA agent" refers to a composition comprising an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule capable of sequence-specifically degrading or inhibiting translation of a messenger RNA (mRNA) transcript of a target mRNA. Without wishing to be limited to a particular theory, the dsRNA agents of the present invention may operate via an RNA interference mechanism (i.e., inducing RNA interference via interaction with the RNA interference pathway machinery (RNA-induced silencing complex or RISC) in mammalian cells) or by any alternative mechanism or pathway. Methods for silencing genes in plant, invertebrate, and vertebrate cells are well known in the art (see, for example, (Sharp et al., Genes Dev. 2001, 15:485; Bernstein et al., (2001) Nature 409:363; Nykanen et al., (2001) Cell 107:309; and Elbashir et al., (2001) Genes Dev. 15:188), the disclosures of each of which are incorporated herein by reference in their entirety). Gene silencing procedures known in the art can be used in combination with the disclosure provided herein to inhibit the expression of HSD17B13.

[0115] The dsRNA agents disclosed herein are composed of a sense strand and an antisense strand, and include, but are not limited to, short interfering RNA (siRNA), RNAi agents, microRNA (miRNA), short hairpin RNA (shRNA), and Dicer substrates. The antisense strand of the dsRNA agents described herein is at least partially complementary to the target mRNA. It is understood in the art that dsRNA duplex structures of different lengths can be used to inhibit the expression of target genes. For example, dsRNAs with duplex structures of 19, 20, 21, 22, and 23 base pairs are known to be effective in inducing RNA interference (Elbashir et al., EMBO 2001, 20:6877-6888). It is also known in the art that shorter or longer RNA duplex structures can also be effective in inducing RNA interference. As used herein, the terms "double-stranded region," "duplex region," and "complementary region" can be used interchangeably and refer to the region in which the sense strand is complementary or substantially complementary to the antisense strand, as known in the art. In certain embodiments of the present invention, the HSD17B13 dsRNA can include at least one strand that is a minimum of 21 nt in length, or can have a shorter duplex based on one of the sequences listed in any one of Tables 1-3, although dsRNAs with 1, 2, 3, or 4 fewer nucleotides at one or both ends, respectively, compared to the dsRNAs listed in Tables 1-3 can also be effective. In some embodiments of the invention, an HSD17B13 dsRNA agent may have a subsequence of at least 15, 16, 17, 18, 19, 20, or more contiguous nucleotides from one or more of the sequences in Tables 1-3, and have an ability to inhibit expression of the HSD17B13 gene that differs by no more than 5%, 10%, 15%, 20%, 25%, or 30% from the level of inhibition resulting from a dsRNA containing the entire sequence.The sense sequences, antisense sequences, and duplexes disclosed in Tables 1-3 are sometimes referred to herein as "parent" sequences. The sequences disclosed in Tables 1-3 may be modified, shortened, extended, substituted, etc., as described herein, with the resulting sequences retaining all or at least some of the effectiveness of the parent sequences in the methods and compositions of the present invention. The sense and antisense strands included in the dsRNA of the present invention are independently selected. As used herein, the term "independently selected" means that each of two or more similar elements can be selected independently of the selection of the other elements. For example, and not by way of limitation, two strands of "elements" may be selected to be included in a duplex when preparing a dsRNA of the present invention. One of the selected elements, the sense sequence, may be SEQ ID NO:546 (shown in Table 2), and the other selected element, the antisense sequence, may be SEQ ID NO:649, or SEQ ID NO:649, which is modified, shortened, extended, and / or contains one, two, or three substitutions compared to the parent sequence SEQ ID NO:649. It will be understood that a duplex of the invention need not contain both the sense and antisense sequences shown as pairs in the duplexes of Tables 1 to 3. Each sense and antisense strand sequence in the tables is immediately followed by its SEQ ID NO:

[0116] Certain embodiments of the compositions and methods of the present invention comprise single-stranded RNA in a composition and / or administered to a subject. For example, an antisense strand such as those listed in any one of Tables 1-3 can be or be present in a composition administered to a subject to reduce the activity of an HSD17B13 polypeptide and / or expression of the HSD17B13 gene in the subject. Tables 1-3 show the core stretch base sequences of the antisense and sense strands of certain HSD17B13 dsRNA agents. Single-stranded antisense molecules that can be included in certain compositions of the present invention and / or administered in certain ways are referred to herein as "single-stranded antisense agents" or "antisense polynucleotide agents." Single-stranded sense molecules that can be included in certain compositions of the present invention and / or administered in certain ways are referred to herein as "single-stranded sense agents" or "sense polynucleotide agents." The term "base sequence" is used herein to refer to a polynucleotide sequence without chemical modifications or delivery compounds. For example, the sense strand GAUUGGUUCUGUGGGAUAUUA (SEQ ID NO: 40) shown in Table 1 has the base sequence of SEQ ID NO: 552 in Table 2 and SEQ ID NO: 752 in Table 3, and SEQ ID NO: 552 and SEQ ID NO: 752 are shown together with their chemical modifications and delivery compounds. The sequences disclosed herein may be assigned identifiers. For example, a single-stranded sense sequence may be identified as "sense strand SS#," a single-stranded antisense sequence may be identified as "antisense strand AS#," and a duplex comprising a sense strand and an antisense strand may be identified as "duplex AD# / AV#."

[0117] Table 1 includes sense and antisense strands, and the identification numbers of duplexes formed from the sense and antisense strands are shown in the same row of Table 1. The sense strands of SEQ ID NOs: 183-288 contain random nucleobases (n) at positions 1, 2, 3, and 21 from the 5' end. The antisense strands of SEQ ID NOs: 439-544 contain random nucleobases (n) at positions 1, 19, 20, and 21 from the 5' end. In certain embodiments of the present invention, the antisense sequence contains a nucleobase u or a at the first position of the antisense sequence. In certain embodiments of the present invention, the antisense sequence contains a nucleobase u at the first position of the antisense sequence. In the sequences shown in Table 1, "n" can represent a nucleotide containing any one of nucleobases a, u, c, g, and t, and can be selected independently for the sense and antisense strands. Each "n" in the sense and antisense strands can be the same or different. When used in the context of "n" in sense and antisense strands, it will be understood that the nucleobase "n" selected and included at a position in the sense strand is not the same nucleobase as "n" in the antisense strand with which the sense strand is paired, but rather is generally complementary to the nucleobase "n" at the matching position in the opposite strand. As used herein, the term "matching position" in the sense and antisense strands refers to the position of each strand that "pairs" when the two strands are duplex. For example, in a 21-nucleobase sense strand and a 21-nucleobase antisense strand, the nucleobase at position 1 of the sense strand and the nucleobase at position 21 of the antisense strand are "matching positions". In yet another non-limiting example, in a 23-nucleobase sense strand and a 23-nucleobase antisense strand, the nucleobase 2 of the sense strand and the nucleobase 22 of the antisense strand are matching positions. In another non-limiting example, in an 18 nucleobase sense strand and an 18 nucleobase antisense strand, nucleobase at position 1 of the sense strand and nucleobase 18 of the antisense strand are at matching positions, and nucleobase 4 of the sense strand and nucleobase 15 of the antisense strand are at matching positions. A skilled artisan will understand how to identify matching positions within sense and antisense strands that are or become duplex and paired.

[0118] Although (n) can be a, u, c, g, or t, "n" at position 1 of the sense strand is typically complementary to (n) at position 21 of the antisense strand. In two non-limiting examples, (1) if position 1 of the sense strand is "g," then position 21 of the antisense strand is "c," and (2) if position 1 of the sense strand is "a," then position 21 of the antisense strand is "u" or "t." This type of complementary matching pairing applies to (n) at position 2 of the sense strand with (n) at position 20 of the antisense strand, and (n) at position 21 of the sense strand with (n) at position 1 of the antisense strand. At these positions, n can be any nucleotide; however, it will be understood that while nucleotides in the sense and antisense strands are generally complementary (matched), mismatches can occur in certain embodiments. For example, and not by way of limitation, in some embodiments, "n" can be "random," meaning that it may be complementary, but need not be. In certain embodiments, "n" is complementary. As a non-limiting example, "n" at position 1 in the antisense strand is "u" and "n" at position 21 in the sense strand is "a." A skilled artisan will understand how to identify matching positions within the sense and antisense strands that are or become duplexes and pairs.

[0119] The last column of Table 1 indicates the duplex AD# for duplexes containing sense and antisense sequences in the same table row. For example, Table 1 discloses a duplex assigned duplex AD#AD00519.um, containing sense strand SEQ ID NO: 33 and antisense strand SEQ ID NO: 289. Thus, each row of Table 1 identifies a duplex of the invention, each duplex containing the sense and antisense sequences shown in the same row, with the identifier assigned to each duplex shown in the last column of the row.

[0120] In some embodiments of the methods of the invention, an RNAi agent comprising a polynucleotide sequence set forth in Table 1 is administered to a subject. In some embodiments of the invention, the RNAi agent administered to a subject comprises a duplex comprising at least one of the base sequences set forth in Table 1, comprising 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 sequence modifications. In some embodiments of the methods of the invention, the RNAi agent comprising a polynucleotide sequence set forth in Table 1 is attached to a delivery molecule, non-limiting examples of which include delivery compounds comprising a GalNAc compound or a GLS-15 compound.

[0121] [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] [Table 2-8] [Table 2-9] Table 2-10 Table 2-11

[0122] Table 2 shows the sequences of certain chemically modified HSD17B13 RNAi agent antisense and sense strands of the invention. In some embodiments of the methods of the invention, an RNAi agent having a polynucleotide sequence shown in Table 2 is administered to a cell and / or subject. In some embodiments of the methods of the invention, an RNAi agent having a polynucleotide sequence shown in Table 2 is administered to a subject. In some embodiments of the methods of the invention, the RNAi agent administered to a subject comprises a duplex identified in the first column of a row in Table 2 and includes the sequence modifications shown in the sense and antisense strand sequences, respectively, in the third and sixth columns of the same row in Table 2. In some embodiments of the methods of the invention, the sequences shown in Table 2 can be attached (also referred to herein as "conjugates") to compounds capable of delivering the RNAi agent to cells and / or tissues of a subject. Non-limiting examples of delivery compounds that can be used in certain embodiments of the invention include GalNAc-containing compounds or GLS-15-containing compounds. Column 1 of Table 2 shows the duplex AV# of the base sequence shown in Table 1. Table 2 discloses the duplex AV#s and indicates the chemical modifications contained in the sense and antisense sequences of the duplex. For example, Table 1 lists the single-stranded sequences of SEQ ID NO:33 (sense) and SEQ ID NO:289 (antisense), which together form a double-stranded duplex identified as duplex AD#AD00519.um, and Table 2 lists the duplex AV# AV00519, which indicates that the duplexes of SEQ ID NO:545 and SEQ ID NO:648 contain the sequences of SEQ ID NO:33 and SEQ ID NO:289, respectively, but with the chemical modifications shown in columns 3 and 6 for the sense and antisense sequences, respectively. The "Sense Strand SS#" in column 2 of Table 2 is the identifier assigned to the sense sequence (including modifications) shown in column 3 of the same row. The "Antisense Strand AS#" in column 5 of Table 2 is the identifier assigned to the antisense sequence (including modifications) shown in column 6.

[0123] [Table 3-1] Table 3-2 Table 3-3 Table 3-4 Table 3-5 Table 3-6 Table 3-7

[0124] Table 3 shows the antisense and sense strand sequences of certain chemically modified HSD17B13 RNAi agents of the invention. In some embodiments of the methods of the invention, an RNAi agent shown in Table 3 is administered to a cell and / or a subject. In some embodiments of the methods of the invention, an RNAi agent having a polynucleotide sequence shown in Table 3 is administered to a subject. In some embodiments of the invention, the RNAi agent administered to a subject comprises a duplex identified in the first column of a row in Table 3, and includes the sequence modifications and / or delivery compounds shown in the sense and antisense strand sequences, respectively, in columns 3 and 6 of the same row in Table 3. These sequences were used in certain in vivo testing studies described elsewhere herein. In some embodiments of the methods of the invention, the sequences shown in Table 3 may be attached to a compound for delivery (also referred to herein as a "conjugate"), a non-limiting example of which is a GalNAc-containing compound, and the delivery compound is identified as "GLX-n" on the sense strand in column 3 of Table 3. As used herein, "GLX-n" is used to represent either a "GLS-n" or a "GLO-n" delivery compound (where "X" can be either an "S" or an "O"), and GLX-0 can be either a "GLS-n" or a "GLO-n" delivery compound that can be attached to the 3' end of an oligonucleotide during synthesis. As used herein and as shown in Table 3, "GLX-n" is used to indicate that the attached GalNAc-containing compound is any of the compounds GLS-1, GLS-2, GLS-3, GLS-4, GLS-5, GLS-6, GLS-7, GLS-8, GLS-9, GLS-10, GLS-11, GLS-12, GLS-13, GLS-14, GLS-15, GLS-16, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, the structures of each of which are provided elsewhere herein.Those skilled in the art can prepare and use dsRNA compounds of the invention in which the attached delivery compound is one of GLS-1, GLS-2, GLS-3, GLS-4, GLS-5, GLS-6, GLS-7, GLS-8, GLS-9, GLS-10, GLS-11, GLS-12, GLS-13, GLS-14, GLS-15, GLS-16, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16. Column 1 of Table 3 lists the duplex AD# assigned to the sense and antisense sequence duplexes in that row of the table. For example, duplex AD# AD00462 is a duplex of sense strand SEQ ID NO: 752 and antisense strand SEQ ID NO: 795. Each row in Table 3 lists a sense strand and an antisense strand and discloses the indicated sense and antisense strand duplex. The "Sense Strand SS#" in column 2 of Table 3 is the identifier assigned to the sense sequence (including modifications) shown in column 3 of the same row. The "Antisense Strand AS#" in column 5 of Table 3 is the identifier assigned to the antisense sequence (including modifications) shown in column 6. Identifiers for particular attached GalNAc-containing "GLO-n" or "GLS-n" compounds are designated as GLS-5, GLS-15, or GLX-0; it will be understood that instead of the compound designated as GLO-0, other "GLO-n" or "GLS-n" compounds may be used, and the resulting compounds are included in embodiments of the methods and / or compositions of the present invention. GLO-0 refers to the GalNAc3 compound of Jayaprakash et al. (2014) J. Am. Chem. Soc., 136, 16958-16961, or compound L96 of WO2015006740.

[0125] [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4]

[0126] In certain embodiments of the invention, a dsRNA (also referred to herein as a "duplex") is disclosed in one of Tables 1-3. Each row in Tables 1-3 discloses a duplex comprising the sense strand sequence and the antisense strand sequence of that table row. In addition to the duplexes disclosed in Tables 1-3, it will be understood that in some embodiments, a duplex of the invention can include sense and antisense sequences set forth in Tables 1-3 that differ by 0, 1, 2, or 3 nucleotides from the sequences set forth in Tables 1-3. Thus, by way of non-limiting example, in some embodiments, the antisense strand in a duplex of the invention is SEQ ID NO: 808, 809, 810, 811, 815, 816, or 817, which has 0, 1, 2, or 3 different nucleotides from the nucleotides of SEQ ID NO: 808, 809, 810, 811, 815, 816, or 817, respectively.

[0127] It will be understood that the sequences of the sense and antisense strands in a duplex of the present invention can be selected independently. Thus, a dsRNA of the present invention can comprise the sense and antisense strands of a duplex disclosed in a row in Tables 1-3. Alternatively, in a dsRNA of the present invention, one or both of the selected sense and antisense strands in the dsRNA comprise a sequence shown in Tables 1-3, but one or both of the sense and antisense sequences contain one, two, three, or more nucleobase substitutions from the parent sequence. In some embodiments, the selected sequence may be longer or shorter than its parent sequence. Thus, a dsRNA agent included in the present invention can, but need not, comprise the exact sequence of the sense and antisense pair disclosed as a duplex in Tables 1-3.

[0128] In some embodiments, a dsRNA agent comprises a sense strand and an antisense strand, wherein nucleotide positions 2-18 of the antisense strand comprise a region of complementarity to an HSD17B13 RNA transcript, wherein the region of complementarity comprises at least 15 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from one of the antisense sequences listed in one of Tables 1-3, and optionally comprises a target ligand. Optionally, the region of complementarity to an HSD17B13 RNA transcript comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ by no more than 3 nucleotides from one of the antisense sequences listed in one of Tables 1-3. In some embodiments of a dsRNA agent of the invention, the antisense strand of the dsRNA is at least substantially complementary to any one of the target regions of SEQ ID NO: 1, provided in any one of Tables 1-3. In some embodiments, the antisense strand of a dsRNA agent of the invention is fully complementary to any one of the target regions of SEQ ID NO: 1, provided in any one of Tables 1-3. In some embodiments, a dsRNA agent comprises a sense strand sequence set forth in any one of Tables 1-3, wherein the sense strand sequence is at least substantially complementary to the antisense strand sequence in the dsRNA agent. In other embodiments, a dsRNA agent of the invention comprises a sense strand sequence set forth in any one of Tables 1-3, wherein the sense strand sequence is fully complementary to the antisense strand sequence in the dsRNA agent. In some cases, a dsRNA agent of the invention comprises an antisense strand sequence set forth in any one of Tables 1-3. Some embodiments of a dsRNA agent of the invention comprise a sense sequence and an antisense sequence that are disclosed as a duplex in any of Tables 1-3. It will be understood that, as described herein, the sense and antisense strands in a duplex of the invention can be independently selected.

[0129] mismatch Those skilled in the art know that mismatches are tolerated for the efficacy of dsRNA, particularly mismatches within the terminal regions of the dsRNA. Certain mismatches are more tolerated for efficacy, for example, mismatches of wobble base pairs G:U and A:C (Du et al., A systematic analysis of the silencing effects of an active siRNA at all single-nucleotide mismatched target sites. Nucleic Acids Res. 2005 Mar 21; 33(5): 1671-7. Doi: 10.1093 / nar / gki312. Nucleic Acids Res. 2005; 33(11): 3698). In some embodiments of the methods and compounds of the present invention, the HSD17B13 dsRNA agent may contain one or more mismatches with respect to the HSD17B13 target sequence. In some embodiments, the HSD17B13 dsRNA agent of the present invention does not contain any mismatches. In certain embodiments, an HSD17B13 dsRNA agent of the present invention contains no more than one mismatch. In some embodiments, an HSD17B13 dsRNA agent of the present invention contains no more than two mismatches. In certain embodiments, an HSD17B13 dsRNA agent of the present invention contains no more than three mismatches. In some embodiments of the present invention, the antisense strand of an HSD17B13 dsRNA agent contains a mismatch to an HSD17B13 target sequence that is not located in the center of the region of complementarity. In some embodiments, the antisense strand of an HSD17B13 dsRNA agent contains one, two, three, four, or more mismatches located within the last 5, 4, 3, 2, or 1 nucleotide from either or both of the 5' end or 3' end of the region of complementarity. Methods described herein and / or known in the art can be used to determine whether an HSD17B13 dsRNA agent containing mismatches to an HSD17B13 target sequence is effective in inhibiting expression of the HSD17B13 gene.

[0130] Complementarity As used herein, unless otherwise specified, the term "complementary," when describing a first nucleotide sequence (e.g., the sense strand of an HSD17B13 dsRNA agent or a target HSD17B13 mRNA) in relation to a second nucleotide sequence (e.g., the antisense strand of an HSD17B13 dsRNA agent or a single-stranded antisense polynucleotide), refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize (forming base-pair hydrogen bonds under physiological conditions in a mammal (or similar in vitro conditions)) and, under specified conditions, form a duplex or double-helix structure with an oligonucleotide or polynucleotide comprising the second nucleotide sequence. Other conditions, such as physiologically relevant conditions that may be encountered inside an organism, are also applicable. A skilled artisan can determine the most appropriate set of conditions for testing the complementarity of two sequences depending on the ultimate use of the hybridized nucleotides. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs, and include natural or modified nucleotides or nucleotide mimetics, so long as at least the above hybridization requirements are met. Sequence identity or complementarity is independent of modifications.

[0131] For example, the complementary sequence in the HSD17B13 dsRNA described herein includes base pairing across the entire length of one or both nucleotide sequences of an oligonucleotide or polynucleotide comprising a first nucleotide sequence and an oligonucleotide or polynucleotide comprising a second nucleotide sequence. Such sequences can be referred to herein as "fully complementary" to each other. In embodiments, if two oligonucleotides are designed to form one or more single-stranded overhangs upon hybridization, it will be understood that such overhangs are not considered mismatches in determining complementarity herein. For example, an HSD17B13 dsRNA agent comprising one 19-nucleotide long oligonucleotide and another 20-nucleotide long oligonucleotide, although the longer oligonucleotide contains a 19-nucleotide sequence that is fully complementary to the shorter oligonucleotide, can still be referred to as "fully complementary" for purposes of the present description. Thus, as used herein, "fully complementary" means that all (100%) of the bases in a contiguous sequence of a first polynucleotide hybridize with the same number of bases in a contiguous sequence of a second polynucleotide. The contiguous sequence can include all or part of the first or second nucleotide sequence.

[0132] As used herein, the term "substantially complementary" means that in a hybridized pair of nucleobase sequences, at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, but not all, of the bases in a contiguous sequence of a first polynucleotide hybridize to the same number of bases in a contiguous sequence of a second polynucleotide. The term "substantially complementary" can be used in reference to a first sequence relative to a second sequence if the two sequences contain one or more, e.g., at least 1, 2, 3, 4, or 5 mismatched base pairs upon hybridization, forming a duplex of up to 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 base pairs (bp), while retaining the ability to hybridize under conditions most relevant to the end use, e.g., inhibition of HSD17B13 gene expression via the RISC pathway.

[0133] As used herein, the term "partially complementary" can be used to refer to a pair of hybridized nucleobase sequences in which at least 75%, but not all, of the bases in a contiguous sequence of a first polynucleotide hybridize to the same number of bases in a contiguous sequence of a second polynucleotide. In some embodiments, "partially complementary" means that at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the bases in the contiguous sequence of a first polynucleotide hybridize to the same number of bases in the contiguous sequence of a second polynucleotide.

[0134] As used herein, the terms "complementary," "fully complementary," "substantially complementary," and "partially complementary" are used in reference to base matches between the sense and antisense strands of an HSD17B13 dsRNA agent, between the antisense strand of an HSD17B13 dsRNA agent and the sequence of a target HSD17B13 mRNA, or between a single-stranded antisense oligonucleotide and the sequence of a target HSD17B13 mRNA. It will be understood that the term "antisense strand of an HSD17B13 dsRNA agent" can refer to the same sequence of an "HSD17B13 antisense polynucleotide agent."

[0135] As used herein, the term "substantially identical" or "substantial identity" in reference to a nucleic acid sequence refers to a nucleic acid sequence that contains a sequence having at least about 85% sequence identity, preferably at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity, relative to a reference sequence. The percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window. The percentage is calculated by determining the number of positions where identical nucleic acid bases occur in both sequences to calculate the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to calculate the percentage of sequence identity. The inventions disclosed herein encompass nucleotide sequences that are substantially identical to those disclosed herein, for example, in Tables 1-3. In some embodiments, the sequences disclosed herein are completely identical to, or at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to, those disclosed herein, e.g., in Tables 1-3.

[0136] As used herein, the term "strand comprising a sequence" refers to an oligonucleotide comprising a strand of nucleotides described by a sequence referenced using standard nucleotide nomenclature. The term "double-stranded RNA" or "dsRNA" as used herein refers to an RNAi molecule or molecular complex having a hybridized duplex region comprising two antiparallel and substantially or completely complementary nucleic acid strands, said to have "sense" and "antisense" orientations relative to the target HSD17B13 RNA. The duplex region can be any length that allows for specific degradation of the desired target HSD17B13 RNA via the RISC pathway, but is typically 9-30 base pairs in length, e.g., 15-30 base pairs in length. Considering a duplex between 9 and 30 base pairs, the duplex can be any length within this range, e.g., 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30, and 15-30 base pairs, 15-26 base pairs, 15-23 base pairs, 15-22 base pairs, 15-21 base pairs, 15-20 base pairs, 15-19 base pairs, 15-18 base pairs, 15-17 base pairs, 18-30 base pairs, 18-26 base pairs, 18-23 base pairs, 18-22 base pairs, 18-23 base pairs, 18-22 base pairs, 18-24 base pairs, 18-26 base pairs, 18-24 base pairs, 18-28 base pairs, 18-30 base pairs, 18-32 base pairs, 18-34 base pairs, 18-36 base pairs, 18-38 base pairs, 18-39 base pairs, 18-40 base pairs, 18-41 base pairs, 18-42 base pairs, 18-43 base pairs, 18-44 base pairs, 18-45 base pairs, 18-46 base pairs, 18-47 base pairs, 18-48 base pairs, 18-49 base pairs, 18-50 base pairs, 18-51 base pairs, 18-52 base pairs, 18-53 base pairs, 18-54 base pairs, 18-55 base pairs, 18-56 base pairs, 18-57 base pairs, 18- The length of the HSD17B13 dsRNA agent can be any subrange therebetween, including, but not limited to, 8-21 base pairs, 18-20 base pairs, 19-30 base pairs, 19-26 base pairs, 19-23 base pairs, 19-22 base pairs, 19-21 base pairs, 19-20 base pairs, 20-30 base pairs, 20-26 base pairs, 20-25 base pairs, 20-24 base pairs, 20-23 base pairs, 20-22 base pairs, 20-21 base pairs, 21-30 base pairs, 21-26 base pairs, 21-25 base pairs, 21-24 base pairs, 21-23 base pairs, or 21-22 base pairs. HSD17B13 dsRNA agents produced in cells by processing with Dicer and similar enzymes are typically in the 19-22 base pair range. One strand of the duplex region of an HSD17B13 dsDNA agent contains a sequence that is substantially complementary to a region of a target HSD17B13 RNA. The two strands that form the duplex structure can be formed from a single RNA molecule having at least one self-complementary region, or can be formed from two or more separate RNA molecules.When the duplex region is formed from two strands of a single molecule, the molecule can have a duplex region separated by a single strand of nucleotides (referred to herein as a "hairpin loop") between the 3' end of one strand and the 5' end of the other strand that forms the duplex structure. In some embodiments of the present invention, the hairpin loop contains at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more unpaired nucleotides. When the two substantially complementary strands of an HSD17B13 dsRNA agent are composed of separate RNA molecules, the molecules do not need to be covalently connected, but can be. When the two strands are covalently connected by means other than a hairpin loop, the connecting structure is referred to as a "linker." The term "siRNA" is also used herein to refer to the dsRNA agents described herein.

[0137] In some embodiments of the present invention, an HSD17B13 dsRNA agent may comprise a sense sequence and an antisense sequence that do not have unpaired nucleotides or nucleotide analogs at one or both ends of the dsRNA agent. Ends without unpaired nucleotides are referred to as "blunt ends" and are considered to have no nucleotide overhangs. If both ends of a dsRNA agent are blunt, the dsRNA is referred to as "blunt-ended." In some embodiments of the present invention, the first end of the dsRNA agent is blunt, and in some embodiments, the second end of the dsRNA agent is blunt, and in certain embodiments of the present invention, both ends of an HSD17B13 dsRNA agent are blunt.

[0138] In some embodiments of the dsRNA agent of the present invention, the dsRNA does not have one or two blunt ends. In such cases, at least one unpaired nucleotide is present at the end of the strand of the dsRNA agent. For example, a nucleotide overhang exists when the 3' end of one strand of the dsRNA extends beyond the 5' end of the other strand, or vice versa. The dsRNA can include an overhang of at least e1, 2, 3, 4, 5, 6, or more nucleotides. The nucleotide overhang can comprise or consist of nucleotide / nucleoside analogs, including deoxynucleotides / nucleosides. In some embodiments, the nucleotide overhang is located on the sense strand of the dsRNA agent, on the antisense strand of the dsRNA agent, or at both ends of the dsRNA agent, and it will be understood that the nucleotides of the overhang can be located at the 5' end, 3' end, or both ends of either the antisense strand or the sense strand of the dsRNA. In certain embodiments of the present invention, one or more of the nucleotides in the overhang are substituted with a nucleoside thiophosphate.

[0139] As used herein, the term "antisense strand" or "guide strand" refers to the strand of an HSD17B13 dsRNA agent that includes a region that is substantially complementary to an HSD17B13 target sequence. As used herein, the term "sense strand" or "passenger strand" refers to the strand of an HSD17B13 dsRNA agent that includes a region that is substantially complementary to a region of the antisense strand of the HSD17B13 dsRNA agent.

[0140] qualification In some embodiments of the present invention, the RNA of the HSD17B13 RNAi agent is chemically modified to enhance stability and / or one or more other beneficial properties. In certain embodiments of the present invention, the nucleic acids may be synthesized and / or modified by methods well established in the art, such as those described in "Current protocols in Nucleic Acid Chemistry," Beaucage, SL et al. (Eds.), John Wiley & Sons, Inc., New York, NY, USA, which is incorporated herein by reference. Modifications that may be present in certain embodiments of the HSD17B13 dsRNA agents of the present invention include, for example, (a) terminal modifications, such as 5'-end modifications (phosphorylation, conjugation, reverse linkage, etc.), 3'-end modifications (DNA nucleotides, reverse linkage, etc.), (b) base modifications, such as substitution with stabilizing bases, destabilizing bases, or bases that form base pairs with an expanded repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases, (c) sugar modifications (e.g., at the 2' or 4' position) or sugar substitution, and (d) backbone modifications, including modification or substitution of phosphodiester bonds. Specific examples of RNA compounds useful in certain embodiments of the HSD17B13 dsRNA agents, HSD17B13 antisense polynucleotides, and HSD17B13 sense polynucleotides of the present invention include, but are not limited to, RNAs containing modified backbones or non-natural internucleoside linkages. As a non-limiting example, RNAs with modified backbones may not have a phosphorus atom in the backbone. RNAs that do not have a phosphorus atom in their internucleoside backbone may be referred to as oligonucleosides. In certain embodiments of the invention, modified RNAs have a phosphorus atom in their internucleoside backbone.

[0141] It will be understood that the term "RNA molecule" or "RNA" or "ribonucleic acid molecule" includes not only RNA molecules expressed or found in nature, but also RNA analogs and derivatives that contain one or more ribonucleotide / ribonucleoside analogs or derivatives described herein or known in the art. As used herein, the terms "ribonucleoside" and "ribonucleotide" may be used interchangeably. RNA molecules can be modified, for example, within the nucleobase structure or the ribose-phosphate backbone structure, as described herein below, and molecules that contain ribonucleoside analogs or derivatives must retain the ability to form duplexes. As non-limiting examples, the RNA molecules can also include at least one modified ribonucleoside, including, but not limited to, a 2'-O-methyl modified nucleoside, a nucleoside containing a 5' phosphorothioate group, a terminal nucleoside linked to a cholesteryl derivative or a dodecanoic acid bisdecylamide group, a locked nucleoside, an abasic nucleoside, a 2'-deoxy-2'-fluoro modified nucleoside, a 2'-amino modified nucleoside, a 2'-alkyl modified nucleoside, a morpholino nucleoside, a phosphoramidate, or a non-natural base containing nucleoside, or any combination thereof. In some embodiments of the invention, an RNA molecule includes at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or up to the full length of the ribonucleosides in the HSD17B13 dsRNA agent molecule, modified ribonucleosides. The modifications need not be identical for each of the multiple modified ribonucleosides in such an RNA molecule.

[0142] In some embodiments, the dsRNA agents, HSD17B13 antisense polynucleotides, and / or HSD17B13 sense polynucleotides of the present invention may contain one or more independently selected modified nucleotides and / or one or more independently selected non-phosphodiester linkages. As used herein, the terms "internucleotide linkage," "internucleoside linkage," "linkage," and "linker" may be used interchangeably and refer to a linking group between unmodified or modified nucleosides and / or between an unmodified or modified nucleoside and one or more targeting groups within an oligonucleotide chain. In some embodiments, linkages may be independently selected from phosphodiester (PO) linkages, phosphorothioate (PS) linkages, and / or phosphorodithioate (PS2) linkages of dinucleotides at any position in a single-stranded or double-stranded oligonucleotide. As used herein, the term "independently selected" when used with respect to selected elements such as modified nucleotides and non-phosphodiester linkages means that two or more selected elements can be identical to each other, but need not be identical.

[0143] As used herein, a "nucleotide base," "nucleotide," or "nucleobase" refers to a heterocyclic pyrimidine or purine compound that is a standard component of all nucleic acids, including the bases that form the nucleotides adenine, guanine, cytosine, thymine, and uracil. Nucleobases can be further modified to include, but are not limited to, universal bases, hydrophobic bases, promiscuous bases, size-extended bases, and fluorinated bases. As used herein, the term "ribonucleotide" or "nucleotide" can refer to an unmodified nucleotide, a modified nucleotide, or an alternative replacement moiety. Those skilled in the art will recognize that guanine, cytosine, adenine, and uracil can be substituted with other moieties without substantially altering the base pairing properties of an oligonucleotide containing a nucleotide having such a replacement moiety.

[0144] As used herein, "optionally" or "optionally" means that the event or circumstance described below may occur, but need not occur, and includes cases where the event or circumstance occurs or does not occur. For example, "C alkyl optionally substituted with halogen or cyano" means that halogen or cyano may be present, but is not necessarily present, and includes cases where the alkyl is substituted with halogen or cyano and cases where the alkyl is not substituted with halogen and cyano.

[0145] In the chemical structures of the compounds of the present disclosure, the bonds used herein are [ka] represents a non-specific configuration, i.e., if chiral isomers exist in a chemical structure, the bond [ka] teeth, [ka] Some of the structural formulas above are depicted as isomers for simplicity, but the present disclosure includes all isomers, including tautomers, rotamers, and mixtures thereof. Suitable chiral compounds include geometric isomers, diastereomers, racemates, and enantiomers.

[0146] As used herein, the compounds used in the chemical formulas of the present disclosure [ka] may be attached to any one or more groups in accordance with the scope of the invention described herein.

[0147] In one embodiment, the modified RNA considered for use in the methods and compositions described herein is a peptide nucleic acid (PNA) that has the ability to form the required double-stranded structure, and enables or mediates the specific degradation of target RNA via the RISC pathway.In certain embodiments of the present invention, HSD17B13 RNA interference agents include single-stranded RNA that interacts with target HSD17B13 RNA sequence and induces the cleavage of target HSD17B13 RNA.

[0148] Modified RNA backbones can include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates, including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates, including 3'-aminophosphoramidates and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates with normal 3'-5' linkages, their 2'-5' linked analogs, and those with reversed polarity, in which adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts, and free acid forms are also included. Means for preparing phosphorus-containing linkages are routinely practiced in the art, and such methods can be used to prepare the specific modified HSD17B13 dsRNA agents, specific modified HSD17B13 antisense polynucleotides, and / or specific modified HSD17B13 sense polynucleotides of the invention.

[0149] Modified RNA backbones that do not contain phosphorus atoms have backbones formed by short alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short heteroatom or heterocyclic internucleoside linkages, including morpholino linkages (formed in part from the sugar portion of the nucleoside), siloxane backbones, sulfide, sulfoxide, sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamic acid backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and others with mixed N, O, S, and CH moieties. Means for preparing modified RNA backbones that do not contain a phosphorus atom are routinely practiced in the art, and such methods can be used to prepare certain modified HSD17B13 dsRNA agents, certain modified HSD17B13 antisense polynucleotides, and / or certain modified HSD17B13 sense polynucleotides of the invention.

[0150] In certain embodiments of the present invention, HSD17B13 dsRNA, HSD17B13 antisense polynucleotide, and / or HSD17B13 sense polynucleotide contain RNA mimics, including, but not limited to, novel substitutions of the sugar and internucleoside linkages, i.e., backbone, of nucleotide units. In such embodiments, the base units are maintained for hybridization with appropriate HSD17B13 nucleic acid target compounds. One such oligomeric compound is an RNA mimic, known as a peptide nucleic acid (PNA), which has been shown to have excellent hybridization properties. In PNA compounds, the sugar backbone of RNA is replaced with an amide-containing backbone, particularly an aminoethylglycine backbone. The nucleobases are retained and are directly or indirectly linked to the aza nitrogen atoms of the amide portion of the backbone. Means for preparing RNA mimics are routinely practiced in the art, and such methods can be used to prepare certain modified HSD17B13 dsRNA agents of the present invention.

[0151] Some embodiments of the present invention include RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones, specifically -CH2-NH-CH2-, -CH2-N(CH3)-O-CH2- (known as methylene(methylimino) or MMI backbones), -CH2-ON(CH3)-CH2-, -CH2-N(CH3)-N(CH3)-CH2-, and -N(CH3)-CH2- (the natural phosphodiester backbone is represented as -OPO-CH2-). Means for preparing RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones are routinely practiced in the art, and such methods can be used to prepare specific modified HSD17B13 dsRNA agents, specific HSD17B13 antisense polynucleotides, and / or specific HSD17B13 sense polynucleotides of the invention.

[0152] Modified RNAs can contain one or more substituted sugar moieties. The HSD17B13 dsRNAs, HSD17B13 antisense polynucleotides, and / or HSD17B13 sense polynucleotides of the present invention can contain any of the following at the 2' position: OH, F, O-, S-, or N-alkyl, O-, S-, or N-alkenyl, O-, S-, or N-alkynyl, or O-alkyl-O-alkyl, where alkyl, alkenyl, and alkynyl are substituted or unsubstituted C1-C6. 10 Alkyl or C2-C 10 It may be alkenyl or alkynyl. Examples of suitable modifications include O[(CH2) n O] m CH3, O(CH2) n OCH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n ONH2 and O(CH2) n ON[(CH2) n CH3)]2, and n and m are from 1 to about 10. In other embodiments, the dsRNA comprises any of the following at the 2' position: C1 to C 10lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, RNA cleaving groups, reporter groups, intercalators, groups which improve the pharmacokinetic properties of an HSD17B13 dsRNA agent, or groups for improving the pharmacodynamic properties of an HSD17B13 dsRNA agent, HSD17B13 antisense polynucleotide, and / or HSD17B13 sense polynucleotide, and other substituents with similar properties. In some embodiments, modifications include 2'-methoxyethoxy (2'-O-CH2CHOCH3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504), i.e., an alkoxy-alkoxy group. Another exemplary modification is 2'-dimethylaminooxyethoxy, i.e., O(CH2)2ON(CH3)2, known as 2'-DMAOE and described herein in the Examples below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O-CH2-O-CH2-N(CH2). Means for preparing modified RNAs as described are routinely practiced in the art, and such methods can be used to prepare certain modified HSD17B13 dsRNA agents of the invention.

[0153] Other modifications include 2'-methoxy (2'-OCH), 2'-aminopropoxy (2'-OCHCHCHNH), and 2'-fluoro (2'-F). Similar modifications can also be made at other positions on the RNA of an HSD17B13 dsRNA agent, HSD17B13 antisense polynucleotide, and / or HSD17B13 sense polynucleotide of the invention, particularly on the 3'-terminal nucleotide or the 3'-position of the sugar of a 2'-5'-linked HSD17B13 dsRNA, HSD17B13 antisense polynucleotide, or HSD17B13 sense polynucleotide, and the 5'-position of the 5'-terminal nucleotide. HSD17B13 dsRNA agents, HSD17B13 antisense polynucleotides, and / or HSD17B13 sense polynucleotides can also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Means for preparing modified RNAs as described are routinely practiced in the art, and such methods can be used to prepare specific modified HSD17B13 dsRNA agents, HSD17B13 antisense polynucleotides, and / or HSD17B13 sense polynucleotides of the invention.

[0154] HSD17B13 dsRNA agents, HSD17B13 antisense polynucleotides, and / or HSD17B13 sense polynucleotides may, in some embodiments, include modifications or substitutions of nucleobases (often referred to in the art simply as "bases"). As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine and guanine, and the pyrimidine bases thymine, cytosine, and uracil. Modified nucleobases include 5-methylcytosine (5-Me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), Other synthetic and natural nucleobases include uracil, 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-dazaadenine, and 3-deazaguanine and 3-deazaadenine.Additional nucleobases that may be included in certain embodiments of the HSD17B13 dsRNA agents of the invention are known in the art, see, e.g., Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. Ed. Wiley-VCH, 2008; The Concise Encyclopedia of Polymer Science and Engineering, pp. 858-859, Kroschwitz, JL, Ed. John Wiley & Sons, 1990; English et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pp. 289-302, Crooke, ST and Lebleu, B. Ed., CRC Press, 1993. Means for preparing dsRNA, HSD17B13 antisense strand polynucleotides, and / or HSD17B13 sense strand polynucleotides containing nucleobase modifications and / or substitutions as described herein are routinely practiced in the art, and such methods can be used to prepare particular modified HSD17B13 dsRNA agents, HSD17B13 sense polynucleotides, and / or HSD17B13 antisense polynucleotides of the invention.Teachings regarding the synthesis of specific modified oligonucleotides can be found in the following publications: U.S. Pat. No. 5,218,105 for polyamine-conjugated oligonucleotides; U.S. Pat. No. 5,541,307 for oligonucleotides with modified backbones; U.S. Pat. No. 5,521,302 for processes for preparing oligonucleotides with chiral phosphorus linkages; U.S. Pat. No. 5,539,082 for peptide nucleic acids; U.S. Pat. No. 5,554,746 for oligonucleotides with 3-lactam backbones; U.S. Pat. No. 5,571,902 for methods and materials for the synthesis of oligonucleotides; U.S. Pat. No. 5,571,902 for nucleosides having alkylthio groups, which may be used as linkers to other moieties attached at any of various positions on the nucleoside; No. 8,718, U.S. Pat. No. 5,587,361 relating to oligonucleotides having phosphorothioate linkages of high chiral purity, U.S. Pat. No. 5,506,351 relating to a process for preparing 2'-O-alkylguanosine and related compounds, including 2,6-diaminopurine compounds, U.S. Pat. No. 5,587,469 relating to oligonucleotides having N-2 substituted purines, U.S. Pat. No. 5,587,470 relating to oligonucleotides having 3-deazapurines, U.S. Pat. No. 5,608,046 both relating to conjugated 4'-desmethyl nucleoside analogs, U.S. Pat. No. 5,610,289 relating to backbone-modified oligonucleotide analogs, and U.S. Pat. No. 6,262,241 relating to a method for synthesizing 2'-fluoro oligonucleotides, among others.

[0155] Certain embodiments of the HSD17B13 dsRNA agents, HSD17B13 antisense polynucleotides, and / or HSD17B13 sense polynucleotides of the present invention include RNAs modified to contain one or more locked nucleic acids (LNAs). A locked nucleic acid is a nucleotide with a modified ribose moiety that includes an additional bridge connecting the 2' and 4' carbons. This structure effectively "locks" the ribose in a 3'-endo structural conformation. The addition of a locked nucleic acid to an HSD17B13 dsRNA agent, HSD17B13 antisense polynucleotide, and / or HSD17B13 sense polynucleotide of the invention can improve serum stability and reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, OR. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). Means for preparing dsRNA agents, HSD17B13 antisense polynucleotides, and / or HSD17B13 sense polynucleotides containing locked nucleic acids are routinely practiced in the art, and such methods can be used to prepare certain modified HSD17B13 dsRNA agents of the invention.

[0156] Certain embodiments of the HSD17B13 dsRNA compounds, sense polynucleotides, and / or antisense polynucleotides of the present invention include at least one modified nucleotide, and the at least one modified nucleotide is selected from the group consisting of 2'-O-methyl nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2'3'-seconucleotide mimics, locked nucleotides, 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, mopholino nucleotides, and 3'-OMe nucleotides, nucleotides containing 5'-phosphorothioate groups, nucleosides containing vinyl phosphonates, and the like. The 5'-terminal nucleotides include nucleotides containing 2'-deoxythymidine-3'-phosphate, nucleotides containing adenosine glycol nucleic acid (GNA), nucleotides containing thymidine glycol nucleic acid (GNA) S-isomers, nucleotides containing 2'-deoxythymidine-3'-phosphate, nucleotides containing 2'-deoxyguanosine-3'-phosphate, nucleotides containing 2'-deoxyadenosine-3'-phosphate, nucleotides containing 2'-deoxycytidine-3'-phosphate, nucleotides containing 2'-deoxyuridine-3'-phosphate, or unnatural bases including terminal nucleotides, 2'-amino-modified nucleotides, phosphoramidates, or nucleotides linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group. In some embodiments, the HSD17B13 dsRNA compound includes an E-vinylphosphonate nucleotide at the 5'-end of the antisense strand, also referred to herein as the guide strand.

[0157] Certain embodiments of the HSD17B13 dsRNA compounds of the present invention, the 3' and 5' ends of the sense polynucleotides, and / or the 3' end of the antisense polynucleotides contain at least one modified nucleotide, including an abasic nucleotide, ribitol, an inverted nucleotide, an inverted abasic nucleotide, an inverted 2'-OMe nucleotide, or an inverted 2'-deoxynucleotide. Those skilled in the art are aware that the inclusion of an abasic nucleotide or an inverted abasic nucleotide at the end of an oligonucleotide improves stability (Czauderna et al., Structural variations and stabilizing modifications of synthetic siRNAs in mammalian cells. Nucleic Acids Res. 2003;31(11):2705-2716, doi:10.1093 / nar / gkg393). In some embodiments, the HSD17B13 dsRNA compounds contain one or more inverted abasic residues (invab) at either the 3' or 5' end, or at both the 3' and 5' ends. Examples of inverted abasic residues (invabs) include, but are not limited to:

[0158] [ka] Certain embodiments of the HSD17B13 dsRNA compounds of the present invention, the 3' and 5' ends of the sense polynucleotides, and / or the 3' end of the antisense polynucleotides comprise at least one modified nucleotide, wherein the at least one modified nucleotide comprises an isomannide nucleotide. Specific examples of isomannide nucleotides include, but are not limited to, the following:

[0159] [ka] wherein each term "Olig" independently represents a polynucleotide moiety. Exemplary isomannide residues (imanes) include, but are not limited to:

[0160] [ka]

[0161] In certain embodiments, the isomannide nucleotides may be further conjugated to one or more targeting groups or delivery molecules, such as a GalNAc moiety.

[0162] Certain embodiments of the HSD17B13 dsRNA compounds and antisense polynucleotides of the present invention include at least one modified nucleotide, including an unlocked nucleic acid nucleotide (UNA) and / or a glycol nucleic acid nucleotide (GNA). Those skilled in the art are aware that UNA and GNA are thermally destabilizing chemical modifications that can significantly improve the off-target profile of siRNA compounds (Janas et al., Selection of GalNAc-conjugated siRNAs with limited off-target-driven rat hepatotoxicity. Nat Commun. 2018;9(1):723. doi:10.1038 / s41467-018-02989-4; Laursen et al., Utilization of unlocked nucleic acid (UNA) to enhance siRNA performance in vitro and in vivo. Mol BioSyst. 2010;6:862-70).

[0163] Certain embodiments of the HSD17B13 dsRNA compound, antisense polynucleotide of the present invention further comprise a phosphate moiety.As used herein, a phosphate moiety refers to the phosphate group that comprises a phosphate or phosphate mimic attached to the sugar moiety (for example, ribose or deoxyribose or their analogues) of nucleotide.The nucleotide that comprises a phosphate mimic can also be defined as a phosphonate-modified nucleotide.

[0164] In some embodiments, the phosphate mimetic is a 5'-vinyl phosphonate (VP). In an exemplary embodiment, a vinyl phosphonate of the disclosure has the following structure:

[0165] [ka] The vinyl phosphonates of the present disclosure can be attached to either the antisense or sense strand of the dsRNA of the present disclosure. In certain preferred embodiments, the vinyl phosphonates of the present disclosure are attached to the antisense strand of the dsRNA, optionally at the 5' end of the antisense strand of the dsRNA.

[0166] In certain embodiments, the vinylphosphonate-modified nucleotides of the present disclosure have the structure of formula (IV):

[0167] [ka] X is O or S; R is hydrogen, hydroxy, fluoro, or C 1-20 alkoxy (e.g., methoxy or n-hexadecyloxy); R5' is =C(H)-P(O)(OH)2, and the double bond between the C5' carbon and R5' is in the E or Z orientation (e.g., the E orientation); and B is a nucleobase or a modified nucleobase, optionally B is adenine, guanine, cytosine, thymine, or uracil.

[0168] In certain embodiments, R is ═C(H)—P(O)(OH) and the double bond between the C carbon and R is in the E orientation. In certain embodiments, R is methoxy, R is ═C(H)—P(O)(OH) and the double bond between the C carbon and R is in the E orientation. In certain embodiments, X is S, R is methoxy, R is ═C(H)—P(O)(OH) and the double bond between the C carbon and R is in the E orientation.

[0169] Vinyl phosphonate modifications are also contemplated in the dsRNAs, compositions, and methods of this disclosure. Exemplary vinyl phosphonate structures are as follows:

[0170] [ka] In certain embodiments, the vinylphosphonate modified nucleotide is VPu*, which has the structure: [ka]

[0171] Protecting groups are often used during the preparation of the compounds of the present invention. As used herein, the term "protected" means that a protecting group is attached to the indicated moiety. In some embodiments of the present invention, the compounds contain one or more protecting groups. A wide variety of protecting groups can be employed in the methods of the present invention. Generally, protecting groups render chemical functional groups inert to specific reaction conditions and can be added to or removed from such functional groups within a molecule without causing substantial damage to the remainder of the molecule. Protecting groups in general, and hydroxyl protecting groups in particular, are well known in the art (Greene and Wuts, Protective Groups in Organic Synthesis, Chapter 2, 2nd Edition, John Wiley & Sons, New York, 1991).

[0172] Examples of protecting groups (e.g., hydroxyl protecting groups) used herein include methyl, ethyl, benzyl (Bn), phenyl, isopropyl, tert-butyl, acetyl, chloroacetyl, trichloroacetyl, trifluoroacetyl, pivaloyl, tert-butoxymethyl, methoxymethyl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, allyl, cyclohexyl, 9-fluorenylmethoxycarbonyl (Fmoc), methanesulfonate, toluenesulfonate, triflate, benzoyl, benzoylformate, p-phenylbenzoyl, 4-methoxybenzyl, monomethoxytrityl, dimethoxytrityl, trimethoxytrityl, 4-chlorobenzyl, 4-nitrobenzyl, 2,4-dinitrophenyl, 4-acyloxybenzyl, 2-methylphenyl, 2,6-dimethylphenyl, 2-chlorophenyl, 2,6-dichlorobenzyl, diphenylmethyl, triphenylmethyl, 4-methylthio-1-butyl, S-acetylthioacetate (SATA), 2- Cyanoethyl, 2-cyanol, 1-dimethylethyl (CDM), 4-cyano-2-butenyl, 2-(trimethylsilyl)ethyl (TSE), 2-(phenylthio)ethyl, 2-(triphenylsilyl)ethyl, 2-(benzylsulfonyl)ethyl, 2,2,2-trichloroethyl, 2,2,2-tribromoethyl, 2,3-dibromopropyl, 2,2,2-trifluoroethyl, phenylthio, 2-chloro-4-tritylphenyl, 2-bromophenyl, 2-[N-isopropyl-N-(4- 4-(N-trifluoroacetylamino)butyl, 4-oxopentyl, 4-tritylaminophenyl, 4-benzylaminophenyl, tetrahydropyranyl, morpholino, trimethylsilyl, triethylsilyl, tert-butyldimethylsilyl, tert-butyldiphenylsilyl, triphenylsilyl, triisopropylsilyl, pivaloyloxymethyl (POM), and 9-phenylxanthin-9-yl.

[0173] As used herein, examples of amino-protecting groups include, but are not limited to, carbamate protecting groups such as 2-trimethylsilylethoxycarbonyl (Teoc), 1-methyl-1-(4-biphenyl)ethoxycarbonyl (Bpoc), tert-butyloxycarbonyl (BOC), allyloxycarbonyl (Alloc), 9-fluorenylmethoxycarbonyl (Fmoc), and benzyloxycarbonyl (Cbz); amide protecting groups such as formyl, acetyl, pivaloyl, trihaloacetyl, benzoyl, and 2-nitrobenzenesulfonyl; and imine and cyclic imide protecting groups such as phthalimide and dithiasuccinoyl. Equivalents of these amino-protecting groups are also encompassed by the compounds and methods of the present invention.

[0174] Another modification that may be included in the RNA of certain embodiments of the HSD17B13 dsRNA agents, HSD17B13 antisense polynucleotides, and / or HSD17B13 sense polynucleotides of the present invention includes chemically linking to the RNA one or more ligands, moieties, or conjugates that enhance one or more properties of the HSD17B13 dsRNA agent, HSD17B13 antisense polynucleotide, and / or HSD17B13 sense polynucleotide, respectively. Non-limiting examples of properties that may be enhanced include the activity of the HSD17B13 dsRNA agent, HSD17B13 antisense polynucleotide, and / or HSD17B13 sense polynucleotide, cellular distribution, delivery of the HSD17B13 dsRNA agent, pharmacokinetic properties of the HSD17B13 dsRNA agent, and cellular uptake of the HSD17B13 dsRNA agent. In some embodiments of the present invention, an HSD17B13 dsRNA agent comprises one or more targeting groups or linking groups, which in certain embodiments of an HSD17B13 dsRNA agent of the present invention are conjugated to the sense strand. Non-limiting examples of targeting groups include compounds containing N-acetylgalactosamine (GalNAc). As used herein, the terms "targeting group," "targeting agent," "linking agent," "targeting compound," and "targeting ligand" may be used interchangeably. In certain embodiments of the present invention, an HSD17B13 dsRNA agent comprises a targeting compound conjugated to the 5' end of the sense strand. In certain embodiments of the present invention, an HSD17B13 dsRNA agent comprises a targeting compound conjugated to the 3' end of the sense strand. In some embodiments of the present invention, an HSD17B13 dsRNA agent comprises a targeting group comprising GalNAc. In certain embodiments of the present invention, an HSD17B13 dsRNA agent does not comprise a targeting compound conjugated to one or both of the 3' and 5' ends of the sense strand. In certain embodiments of the invention, an HSD17B13 dsRNA agent does not include a GalNAc-containing targeting compound conjugated to one or both of the 5' and 3' ends of the sense strand.

[0175] Additional targeting agents and linking agents are well known in the art; for example, targeting agents and linking agents that may be used in certain embodiments of the invention include cholesterol moieties (Letsinger et al., Proc. Natl. Acids Sci. USA, 1989, 86:6553-6556), cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060), thioethers, e.g., beryl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770), thiocholesterols (Oberhauser et al., Nucl. Acids Res., 1992, 20:533-538), aliphatic chains such as dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al., Biochimie, 1993, 75:49-54), phospholipids such as di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654; Shea et al., Nucl. Acids Res., 1990, 18:3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), palmityl moieties (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), or lipid moieties such as octadecylamine or hexylaminocarbonyloxycholesterol moieties (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923-937).

[0176] Certain embodiments of compositions comprising an HSD17B13 dsRNA agent, an HSD17B13 antisense polynucleotide, and / or an HSD17B13 sense polynucleotide may include a ligand that alters the distribution, targeting, etc., of the HSD17B13 dsRNA agent. In some embodiments of compositions comprising an HSD17B13 dsRNA agent of the invention, the ligand enhances affinity for a selected target, e.g., a molecule, a cell or cell type, a compartment, e.g., a cell or organ compartment, a tissue, an organ, or a region of the body, compared to a species in which such ligand is absent. Ligands useful in the compositions and / or methods of the invention can be naturally occurring substances such as proteins (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulins), carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid), or lipids. Ligands can also be recombinant or synthetic molecules, such as synthetic polymers, e.g., synthetic polyamino acids or polyamines. Examples of polyamino acids include polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-glycolic acid) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, or polyphosphazine. Examples of polyamines include polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamines, pseudopeptide polyamines, peptidomimetic polyamines, dendrimeric polyamines, arginine, amidine, protamine, cationic lipids, cationic porphyrins, quaternary salts of polyamines, or alpha helical peptides.

[0177] The ligand included in the compositions and / or methods of the invention may comprise a targeting group, non-limiting examples of which include a cell or tissue targeting agent, such as a lectin, glycoprotein, lipid, or protein, e.g., an antibody that binds to a specific cell type, such as a kidney cell or liver cell. The targeting group can be thyroid stimulating hormone, melanotropin, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetylgalactosamine, N-acetylglucosamine multivalent mannose, multivalent fucose, glycosylated polyamino acids, multivalent galactose, transferrin, bisphosphonate, polyglutamic acid, polyaspartic acid, lipid, cholesterol, steroid, bile acid, folic acid, vitamin B12, vitamin A, biotin, or an RGD peptide or RGD peptidomimetic.

[0178] Other examples of ligands include dyes, intercalating agents (e.g., acridine), crosslinkers (e.g., psoralens, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine, etc.), artificial endonucleases (e.g., EDTA), lipophilic molecules, such as cholesterol, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3 -(oleoyl)cholenoic acid, dimethoxytrityl, phenoxazine, etc.), and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g., biotin), transport / absorption enhancers (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bis-imidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu complexes of tetraazamacrocycles), dinitrophenyl, HRP, or AP.

[0179] The ligand included in the compositions and / or methods of the invention may be a protein, e.g., a glycoprotein or peptide, e.g., a molecule with a specific affinity for a co-ligand, or an antibody, e.g., an antibody that binds to a specific cell type, such as cancer cells, endothelial cells, cardiac cells, or bone cells. Ligands useful in embodiments of the compositions and / or methods of the invention may be hormones or hormone receptors. Ligands useful in embodiments of the compositions and / or methods of the invention may be lipids, lectins, carbohydrates, vitamins, coenzymes, multivalent lactose, multivalent galactose, N-acetylgalactosamine, N-acetylglucosamine, multivalent mannose, or multivalent fucose. Ligands useful in embodiments of the compositions and / or methods of the invention may be substances that can increase cellular uptake of HSD17B13 dsRNA agents, e.g., by disrupting the cytoskeleton of cells, e.g., by disrupting cellular microtubules, microfilaments, and / or intermediate filaments. Non-limiting examples of such agents include taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, and myoservin.

[0180] In some embodiments, the ligand attached to the HSD17B13 dsRNA agent of the present invention functions as a pharmacokinetic (PK) modulator. Examples of PK modulators that can be used in the compositions and methods of the present invention include, but are not limited to, lipophilic substances, bile acids, steroids, phospholipid analogs, peptides, protein binders, PEG, vitamins, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglycerides, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin, aptamers that bind to serum proteins, and the like. Oligonucleotides containing multiple phosphorothioate linkages are also known to bind to serum proteins, and therefore, short oligonucleotides containing multiple phosphorothioate linkages in the backbone, e.g., oligonucleotides of about 5, 10, 15, or 20 bases, can also be used as ligands in the compositions and / or methods of the present invention.

[0181] HSD17B13 dsRNA agent composition In some embodiments of the present invention, the HSD17B13 dsRNA agent is present in a composition. The compositions of the present invention may include one or more HSD17B13 dsRNA agents and, optionally, one or more of a pharmaceutically acceptable carrier, a delivery agent, a targeting agent, a detectable label, etc. Non-limiting examples of targeting agents that may be useful in accordance with some embodiments of the methods of the present invention include agents that direct the HSD17B13 dsRNA agent of the present invention to and / or within cells to be treated. The targeting agent selected will depend on factors such as the nature of the HSD17B13-related disease or condition and the type of cell to be targeted. As a non-limiting example, in some embodiments of the present invention, it may be desirable to target the HSD17B13 dsRNA agent to and / or within liver cells. In some embodiments of the methods of the present invention, the therapeutic agent will be understood to include an HSD17B13 dsRNA agent that includes only a delivery agent, such as a delivery agent that includes N-acetylgalactosamine (GalNAc), without any additional attachment elements. For example, in some embodiments of the invention, an HSD17B13 dsRNA agent may be attached to a delivery compound that includes GalNAc, included in a composition that includes a pharmaceutically acceptable carrier, and administered to a cell or subject without a detectable label or targeting agent attached to the HSD17B13 dsRNA agent.

[0182] When the HSD17B13 dsRNA agents of the present invention are administered with and / or attached to one or more delivery agents, targeting agents, labeling agents, etc., a skilled artisan will recognize and select suitable agents for use in the methods of the present invention. Labeling agents may be used in certain methods of the present invention to determine the location of the HSD17B13 dsRNA agent in cells and tissues, or to determine the cell, tissue, or organ location of a therapeutic composition containing an HSD17B13 dsRNA agent administered in a method of the present invention. Procedures for attaching and utilizing labeling agents, such as enzyme labels, dyes, and radioactive labels, are well known in the art. It will be understood that in some embodiments of the compositions and methods of the present invention, a labeling agent is attached to one or both of the sense and antisense polynucleotides contained in the HSD17B13 dsRNA agent.

[0183] Delivery of HSD17B13 dsRNA agents and HSD17B13 antisense polynucleotide agents Certain embodiments of the methods of the present invention include delivering an HSD17B13 dsRNA agent into cells. As used herein, the term "delivery" refers to promoting or achieving cellular uptake or absorption. Absorption or uptake of an HSD17B13 dsRNA agent can occur through unassisted diffusion processes or active cellular processes, or by using delivery agents, targeting agents, etc., which can be associated with the HSD17B13 dsRNA agent of the present invention. Delivery means suitable for use in the methods of the present invention include, but are not limited to, in vivo delivery, in which the HSD17B13 dsRNA agent is injected into a tissue site or administered systemically. In some embodiments of the present invention, the HSD17B13 dsRNA agent is attached to a delivery agent.

[0184] Non-limiting examples of methods that can be used to deliver HSD17B13 dsRNA agents to cells, tissues, and / or subjects include HSD17B13 dsRNA-GalNAc conjugates, SAMiRNA technology, LNP-based delivery methods, and naked RNA delivery. These and other delivery methods have been successfully used in the art to deliver therapeutic RNAi agents for the treatment of various diseases and conditions, including, but not limited to, liver disease, acute intermittent porphyria (AIP), hemophilia, pulmonary fibrosis, etc. Details of various delivery means can be found in publications such as Nikam, R.R. & K.R. Gore (2018) Nucleic Acid Ther, 28(4), 209-224, Aug 2018; Springer A.D. & S.F. Dowdy (2018) Nucleic Acid Ther. Jun 1;28(3):109-118; Lee, K. et al., (2018) Arch Pharm Res, 41(9), 867-874; and Nair, J.K. et al., (2014) J.Am.Chem.Soc. 136:16958-16961, the contents of each of which are incorporated herein by reference.

[0185] Some embodiments of the present invention include using lipid nanoparticles (LNPs) to deliver HSD17B13 dsRNA agents of the present invention to cells, tissues, and / or subjects. LNPs are routinely used for in vivo delivery of HSD17B13 dsRNA agents, including therapeutic HSD17B13 dsRNA agents. One advantage of using LNPs or other delivery agents is that the stability of the HSD17B13 RNA agent is improved when delivered to a subject using LNPs or other delivery agents. In some embodiments of the present invention, the LNPs comprise cationic LNPs loaded with one or more HSD17B13 RNAi molecules of the present invention. When the LNPs containing the HSD17B13 RNAi molecules are administered to a subject, the LNPs and their attached HSD17B13 RNAi molecules are taken up by the cells by endocytosis, resulting in the release of the RNAi trigger molecule and mediating RNAi.

[0186] Another non-limiting example of a delivery agent that can be used in embodiments of the present invention to deliver an HSD17B13 dsRNA agent of the present invention to a cell, tissue, and / or subject is an agent containing GalNAc attached to the HSD17B13 dsRNA agent of the present invention and delivering the HSD17B13 dsRNA agent to a cell, tissue, and / or subject. Additional examples of specific delivery agents containing GalNAc that can be used in certain embodiments of the methods and compositions of the present invention are disclosed in PCT Application WO2020191183A1 (incorporated herein in its entirety). Non-limiting examples of GalNAc targeting ligands that can be used in the compositions and methods of the present invention to deliver an HSD17B13 dsRNA agent to a cell include targeting ligand clusters. Examples of targeting ligand clusters provided herein are referred to as GalNAc ligands with phosphodiester linkages (GLO) and GalNAc ligands with phosphorothioate linkages (GLS). The term "GLX-n" may be used herein to indicate that the attached GalNAc-containing compound is any one of compounds GLS-1, GLS-2, GLS-3, GLS-4, GLS-5, GLS-6, GLS-7, GLS-8, GLS-9, GLS-10, GLS-11, GLS-12, GLS-13, GLS-14, GLS-15, GLS-16, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, the structures of each of which are shown below, with the right-hand end of each structure indicating the position of attachment of a GalNAc targeting ligand to an RNAi agent of the invention (" [ka] "). It will be understood that any RNAi and dsRNA molecule of the present invention can be attached to GLS-1, GLS-2, GLS-3, GLS-4, GLS-5, GLS-6, GLS-7, GLS-8, GLS-9, GLS-10, GLS-11, GLS-12, GLS-13, GLS-14, GLS-15, GLS-16, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16. The structures of GLO-1 through GLO-16 and GLS-1 through GLS-16 are shown below.

[0187] [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4]

[0188] In certain embodiments, the aforementioned isomannide nucleotides may be further conjugated to one or more GalNAc targeting ligands. Specific examples of isomannide nucleotides conjugated to GalNAc targeting ligands include: [ka] and the term "oligo" independently refers to a polynucleotide moiety.

[0189] In some embodiments of the present invention, in vivo delivery can be achieved using a beta-glucan delivery system, such as those described in U.S. Patent Nos. 5,032,401 and 5,607,677, and U.S. Publication No. 2005 / 0281781, which are incorporated herein by reference in their entireties. In vitro introduction of an HSD17B13 RNAi agent into cells can be achieved using known methods, such as electroporation and lipofection. In certain embodiments of the methods of the present invention, HSD17B13 dsRNA is delivered without a targeting agent. These RNAs can be delivered as "naked" RNA molecules. As a non-limiting example, the HSD17B13 dsRNA of the present invention can be administered to a subject in the form of a pharmaceutical composition containing an RNAi agent but not a targeting agent, such as a GalNAc targeting compound, to treat a subject's HSD17B13-related disease or condition, such as liver disease.

[0190] It will be understood that in addition to the specific delivery means described herein, RNAi delivery means, including but not limited to those described herein and those used in the art, can be used with the HSD17B13 RNAi agent and method of treatment embodiments described herein.

[0191] The HSD17B13 dsRNA agents of the present invention can be administered to a subject in an amount and manner effective to reduce the level and activity of HSD17B13 polypeptide in a cell and / or subject. In some embodiments of the methods of the present invention, one or more HSD17B13 dsRNA agents are administered to a cell and / or subject to treat a disease or condition associated with HSD17B13 expression and activity. In some embodiments, the methods of the present invention comprise administering one or more HSD17B13 dsRNA agents to a subject in need of such treatment to alleviate a disease or condition associated with HSD17B13 expression in the subject. The HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents of the present invention can be administered to reduce HSD17B13 expression and / or activity in one or more of in vitro, ex vivo, and in vivo cells.

[0192] In some embodiments of the present invention, delivery (e.g., introduction) of an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent into a cell reduces the level and, therefore, activity of HSD17B13 polypeptide within the cell. Targeting agents and methods can be used to assist in the delivery of an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent to specific cell types, cell subtypes, organs, or spatial regions within a subject and / or subcellular region within a cell. In certain methods of the present invention, an HSD17B13 dsRNA agent can be administered alone or in combination with one or more additional HSD17B13 dsRNA agents. In some embodiments, two, three, four, or more independently selected HSD17B13 dsRNA agents are administered to a subject.

[0193] In certain embodiments of the present invention, an HSD17B13 dsRNA agent is administered to a subject in combination with one or more additional therapeutic regimens for treating an HSD17B13-related disease or condition, thereby treating the HSD17B13-related disease or condition. Non-limiting examples of additional therapeutic regimens include administering one or more HSD17B13 antisense polynucleotides of the present invention, administering a non-HSD17B13 dsRNA therapeutic agent, and behavioral modification. The additional therapeutic regimen can be administered at one or more time points before, simultaneously with, and after administration of the HSD17B13 dsRNA agent of the present invention. As used herein, "simultaneously" refers to within 5 minutes of time zero, within 10 minutes of time zero, within 30 minutes of time zero, within 45 minutes of time zero, and within 60 minutes of time zero, and "time zero" is understood to refer to the time when the HSD17B13 dsRNA agent of the present invention is administered to the subject. Non-limiting examples of non-HSD17B13 dsRNA therapeutic agents include pyridoxine, ACE inhibitors (angiotensin-converting enzyme inhibitors), such as benazepril (Lotensin), angiotensin II receptor blockers (ARBs) (e.g., losartan potassium, such as Merck & Co.'s Cozaar®), such as candesartan (Atacand), HMG-CoA reductase inhibitors (e.g., statins), calcium binders, such as sodium cellulose phosphate (Calcibind), diuretics, such as thiazide diuretics, such as hydrochlorothiazide (Microzide), insulin sensitizers, such as the PPARγ agonist pioglitazone, glp-1r agonists, such as liraglutatide, vitamin E, SGLT2 inhibitors, DPPIV inhibitors, and kidney / liver transplantation, or any combination of the foregoing. Non-limiting examples of behavioral modification include dietary therapy, counseling, and exercise therapy. These and other therapeutic agents and behavioral modifications are known in the art and are used to treat HSD17B13 diseases or conditions in a subject, and may be administered to a subject in combination with administration of one or more HSD17B133 dsRNA agents of the invention to treat an HSD17B13 disease or condition.An HSD17B13 dsRNA agent of the invention administered to a cell or subject to treat an HSD17B13-associated disease or condition may act synergistically with one or more other therapeutic agents or therapeutic activities to enhance the effectiveness of the one or more therapeutic agents or therapeutic activities and / or enhance the effectiveness of the HSD17B13 dsRNA agent in treating an HSD17B13-associated disease or condition.

[0194] Therapeutic methods of the invention involving administration of an HSD17B13 dsRNA agent can be used before the onset of an HSD17B13-related disease or condition and / or when an HSD17B13-related disease or condition is present, including early, middle, and late stages of the disease or condition, as well as any time before or after these stages. The methods of the invention can also treat subjects who have previously been treated for an HSD17B13-related disease or condition with one or more other therapeutic agents and / or activities that have not been effective, have had little effect, and / or are no longer effective in treating the HSD17B13-related disease or condition in the subject.

[0195] Vector-encoded dsRNA In certain embodiments of the present invention, HSD17B13 dsRNA agents can be delivered into cells using vectors. The HSD17B13 dsRNA agent transcription unit can be contained in a DNA or RNA vector. The preparation and use of such vectors encoding transgenes for delivering sequences to cells and / or subjects is well known in the art. In the methods of the present invention, vectors can be used to transiently express HSD17B13 dsRNA, for example, for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 hours or more, or for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 weeks or more. The length of transient expression can be determined using routine methods based on factors such as, but not limited to, the particular vector construct selected and the target cell and / or tissue. Such transgenes can be introduced as linear constructs, circular plasmids, or viral vectors, which can be integrative or non-integrative vectors. Transgenes can also be constructed to be inherited as extrachromosomal plasmids (Gassmann et al., Proc. Natl. Acad. Sci. USA (1995) 92:1292).

[0196] One or more individual strands of HSD17B13 dsRNA agent can be transcribed from a promoter on an expression vector.For example, when expressing two separate strands to produce dsRNA, two separate expression vectors can be co-introduced into cells using means such as transfection or infection.In certain embodiments, each individual strand of the HSD17B13 dsRNA agent of the present invention can be transcribed by a promoter contained in the same expression vector.In certain embodiments of the present invention, the HSD17B13 dsRNA agent is expressed as an inverted repeat polynucleotide joined by a linker polynucleotide sequence, so that the HSD17B13 dsRNA agent has a stem and loop structure.

[0197] Non-limiting examples of RNA expression vectors include DNA plasmids or viral vectors. The expression vectors useful in embodiments of the present invention are compatible with eukaryotic cells. Eukaryotic cell expression vectors are routinely used in the art and are available from many commercial sources. The HSD17B13 dsRNA expression vector can be delivered systemically, such as by intravenous or intramuscular administration, by administration to target cells removed from a subject and then reintroduced into the subject, or by any other means that allows introduction into desired target cells.

[0198] Viral vector systems that can be included in method embodiments include, but are not limited to, (a) adenoviral vectors, (b) retroviral vectors, including but not limited to lentiviral vectors and Moloney murine leukemia virus, (c) adeno-associated virus vectors, (d) herpes simplex virus vectors, (e) SV40 vectors, (f) polyomavirus vectors, (g) papillomavirus vectors, (h) picornavirus vectors, (i) poxvirus vectors, such as orthopox, e.g., vaccinia virus vectors, or avipox, e.g., canarypox or fowlpox, and (j) helper-dependent or helpless adenoviruses. Constructs for recombinant expression of HSD17B13 dsRNA agents may include regulatory elements, such as promoters and enhancers, which can be selected to provide constitutive or regulated / inducible expression. The use of viral vector systems, promoters, and enhancers, etc., is routine in the art and can be used in conjunction with the methods and compositions described herein.

[0199] Certain embodiments of the present invention include the use of viral vectors to deliver HSD17B13 dsRNA agents to cells.In the art, a number of adenovirus-based delivery systems are routinely used, for example, to deliver to lung, liver, central nervous system, endothelial cell, muscle, etc.The non-limiting examples of viral vectors that can be used in the method of the present invention include AAV vectors, smallpox viruses such as vaccinia virus, modified virus Ankara (MVA), NYVAC, avian pox viruses such as fowl pox or canary pox.

[0200] Certain embodiments of the present invention include the method of using vector to deliver HSD17B13 dsRNA agent to cell, and such vector can be present in pharmaceutically acceptable carrier, and can comprise, but not necessarily comprise, the slow-release matrix in which gene delivery vehicle is embedded.In some embodiments, the vector for delivering HSD17B13 dsRNA can be produced from recombinant cell, and the pharmaceutical composition of the present invention can comprise one or more cells that produce HSD17B13 dsRNA delivery system.

[0201] Pharmaceutical compositions containing HSD17B13 dsRNA or ssRNA agents Certain embodiments of the present invention include the use of pharmaceutical compositions containing an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent and a pharmaceutically acceptable carrier. Pharmaceutical compositions containing an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent can be used in the methods of the present invention to reduce intracellular HSD17B13 gene expression and HSD17B13 activity, and are useful for treating HSD17B13-related diseases or conditions. Such pharmaceutical compositions can be formulated based on the delivery mode. Non-limiting examples of delivery mode formulations include compositions formulated for subcutaneous delivery, compositions formulated for systemic administration via parenteral delivery, compositions formulated for intravenous (IV) delivery, compositions formulated for intrathecal delivery, and compositions formulated for direct delivery into the brain. The pharmaceutical compositions of the present invention for intracellular delivery of HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents can be administered using one or more means, such as topically (e.g., via a transdermal patch), pulmonary, e.g., by inhalation or insufflation of powder or aerosol using a nebulizer, intratracheally, intranasally, epidermally, and transdermally, orally, or parenterally. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion, e.g., subcutaneous administration via an implantable device, or intracranial administration, e.g., intraparenchymal, intrathecal, or intraventricular administration. HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents can also be delivered directly to target tissues, e.g., directly to the liver or directly to the kidney. It will be understood that "delivering an HSD17B13 dsRNA agent" or "delivering an HSD17B13 antisense polynucleotide agent" to a cell encompasses direct delivery of the HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent, respectively, as well as expression of the HSD17B13 dsRNA agent within the cell from an encoding vector delivered to the cell or by any suitable means by which the HSD17B13 dsRNA or HSD17B13 antisense polynucleotide agent becomes present within the cell.The preparation and use of formulations and means for delivering inhibitory RNA are well known and routinely used in the art.

[0202] As used herein, a "pharmaceutical composition" comprises a pharmacologically effective amount of an HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent of the present invention and a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable carrier" refers to a carrier for administering a therapeutic agent. Such carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. This term specifically excludes cell culture media. For orally administered agents, pharmaceutically acceptable carriers include, but are not limited to, pharmaceutically acceptable excipients such as inert diluents, disintegrants, binders, lubricants, sweeteners, flavoring agents, coloring agents, and preservatives. Suitable inert diluents include sodium and calcium carbonate, sodium and calcium phosphate, and lactose, while corn starch and alginic acid are suitable disintegrating agents. Binders may include starch or gelatin, while lubricants, if present, are usually magnesium stearate, stearic acid, or talc. If desired, the tablets may be coated with a material such as glyceryl monostearate or glyceryl distearate to delay absorption in the gastrointestinal tract. Drugs included in the formulation are further described below.

[0203] As used herein, the terms "pharmacologically effective amount," "therapeutically effective amount," and "effective amount" refer to the amount of an HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent of the present invention to produce the intended pharmacological, therapeutic, or preventive result.For example, if a given clinical treatment is considered effective when a measurable parameter related to a disease or disorder is reduced by at least 10%, the therapeutically effective amount of an agent for treating that disease or disorder is the amount necessary to reduce that parameter by at least 10%.For example, a therapeutically effective amount of an HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent can reduce the level of HSD17B13 polypeptide by at least 10%.

[0204] Effective dose In some aspects, the methods of the invention comprise contacting a cell with an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent in an amount effective to reduce HSD17B13 gene expression in the contacted cell. Particular embodiments of the methods of the invention comprise administering to a subject an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent in an amount effective to reduce HSD17B13 gene expression and treat an HSD17B13-related disease or condition in the subject. An "effective amount," as used to reduce HSD17B13 expression and / or treat an HSD17B13-related disease or condition, is an amount necessary or sufficient to achieve a desired biological effect. For example, an effective amount of an HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent for treating an HSD17B13-related disease or condition can be the amount necessary to (i) slow or halt the progression of the disease or condition, or (ii) reverse, alleviate, or eliminate one or more symptoms of the disease or condition. In some embodiments of the present invention, an effective amount is the amount of an HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent that, when administered to a subject in need of treatment for an HSD17B13-related disease or condition, results in a therapeutic response that prevents and / or treats the disease or condition. According to some embodiments of the present invention, an effective amount is the amount that, when administered in combination or simultaneously with another therapeutic treatment for an HSD17B13-related disease or condition, results in a therapeutic response that prevents and / or treats the disease or condition. In some embodiments of the invention, the biological effect of treating a subject with an HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent of the invention can be an improvement and / or complete elimination of symptoms caused by an HSD17B13-related disease or condition. In some embodiments of the invention, the biological effect is complete disappearance of an HSD17B13-related disease or condition, as evidenced, for example, by a diagnostic test showing that the subject is free of an HSD17B13-related disease or condition.Non-limiting examples of physiological symptoms that may be detected include a decrease in HSD17B13 levels in the liver of a subject after administration of an agent of the invention. Additional means known in the art for assessing the status of an HSD17B13-related disease or condition can be used to determine the effect of the agents and / or methods of the invention on an HSD17B13-related disease or condition.

[0205] Typically, an effective amount of an HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent that reduces HSD17B13 polypeptide activity to a level that allows treatment of an HSD17B13-associated disease or condition is determined in a clinical trial to establish effective dosages in blinded studies for test and control populations. In some embodiments, an effective amount is an amount that produces a desired response, e.g., an amount that alleviates an HSD17B13-associated disease or condition in cells, tissues, and / or subjects with the disease or condition. Thus, an effective amount of an HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent for treating an HSD17B13-related disease or condition treatable by reducing HSD17B13 polypeptide activity will be an amount that, upon administration, is capable of reducing HSD17B13 polypeptide activity in a subject to an amount less than the amount that would be present in the cell, tissue, and / or subject in the absence of administration of the HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent. In certain embodiments of the invention, the level of HSD17B13 polypeptide activity and / or HSD17B13 gene expression present in a cell, tissue, and / or subject that has not been contacted with or administered an HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent of the invention is referred to as a "control" amount. In some embodiments of the methods of the present invention, the control amount for a subject is the pre-treatment amount for the subject; in other words, the level in the subject before administration of the HSD17B13 agent serves as the control level for the subject, and can be compared with the level of HSD17B13 polypeptide activity and / or HSD17B13 gene expression in the subject after administration of the siRNA to the subject. When treating an HSD17B13-related disease or condition, the desired response can be the reduction or elimination of one or more symptoms of the disease or condition in a cell, tissue, and / or subject. The reduction or elimination can be temporary or permanent. It is understood that the status of an HSD17B13-related disease or condition can be monitored using methods to determine HSD17B13 polypeptide activity, HSD17B13 gene expression, symptomatic assessment, clinical trials, etc.In some aspects of the present invention, the desired response to treatment of an HSD17B13-associated disease or condition is to delay or even prevent the onset of the disease or condition.

[0206] The effective amount of a compound that reduces HSD17B13 polypeptide activity can also be determined by assessing the physiological effects of administering an HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent to a cell or subject, such as a reduction in HSD17B13-related disease or symptoms after administration. Subject assays and / or symptom monitoring can be used to determine the effectiveness of the HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent of the present invention, which may be administered in the pharmaceutical composition of the present invention, and to determine whether or not there is a response to treatment. Non-limiting examples include one or more art-known tests for alanine aminotransferase (ALT) or aspartate aminotransferase (AST) profile. As another non-limiting example, one or more known tests for liver function can be used to determine the status of a HSD17B13-related liver disease or condition in a subject before and after treatment with an HSD17B13 dsRNA agent of the present invention.

[0207] Some embodiments of the present invention include methods for determining the effectiveness of a dsRNA agent or HSD17B13 antisense polynucleotide agent of the present invention administered to a subject in treating an HSD17B13-related disease or condition by assessing and / or monitoring one or more "physiological characteristics" of the HSD17B13-related disease or condition in the subject. Non-limiting examples of physiological characteristics of an HSD17B13-related disease or condition include HSD17B13 mRNA levels, HSD17B13 protein levels, or HSD17B13 enzyme activity, or lipid levels, triglyceride levels, cholesterol levels (including LDL-C, HDL-C, VLDL-C, IDL-C, and total cholesterol), free fatty acid levels, or liver fat and / or lipid droplet levels in plasma or tissue samples in the subject. Standard means for determining such physiological characteristics are known in the art and include, but are not limited to, blood tests, imaging tests, physical examinations, etc.

[0208] It will be understood that the amount of HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent administered to a subject can be varied, at least in part, based on the determination of the state and / or physiological characteristics of the disease and / or condition determined for the subject. The therapeutic amount can be varied, for example, by increasing or decreasing the amount of HSD17B13-dsRNA agent or HSD17B13 antisense polynucleotide agent, changing the composition in which the HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent, respectively, is administered, changing the route of administration, changing the timing of administration, etc. The effective amount of HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent will vary depending on the particular condition being treated, the age and physical condition of the subject being treated, the severity of the condition, the duration of treatment, the nature of concomitant therapy (if any), the particular route of administration, and other factors within the knowledge and expertise of the medical professional. For example, the effective amount may depend on the desired level of HSD17B13 polypeptide activity and / or HSD17B13 gene expression effective for treating an HSD17B13-related disease or condition. A skilled artisan can empirically determine the effective amount of a particular HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent of the present invention for use in the methods of the present invention without undue experimentation. In combination with the teachings provided herein, by selecting from the various HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents of the present invention and considering factors such as potency, relative bioavailability, patient weight, severity of adverse side effects, and preferred mode of administration, an effective prophylactic or therapeutic treatment regimen for treating a particular subject can be designed. When used in embodiments of the present invention, an effective amount of an HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent of the present invention may be an amount that, when contacted with a cell, produces a desired biological effect in the cell.

[0209] It will be appreciated that HSD17B13 gene silencing can be determined in any cell that expresses HSD17B13, either constitutively or by genome engineering, and by any suitable assay. In some embodiments of the present invention, administration of an HSD17B13 dsRNA agent of the present invention reduces HSD17B13 gene expression by at least 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%. In some embodiments of the invention, administration of an HSD17B13 dsRNA agent of the invention reduces HSD17B13 gene expression by 5% to 10%, 5% to 25%, 10% to 50%, 10% to 75%, 25% to 75%, 25% to 100%, or 50% to 100%.

[0210] dosage HSD17B13 dsRNA agents and HSD17B13 antisense polynucleotide agents are delivered in pharmaceutical compositions at doses sufficient to inhibit expression of the HSD17B13 gene. In certain embodiments of the invention, the dose of the HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent ranges from 0.01 to 200.0 milligrams per kilogram of recipient body weight per day, generally ranging from 1 to 50 mg / kilogram of body weight, 5 to 40 mg / kg of body weight, 10 to 30 mg / kg of body weight, 1 to 20 mg / kg of body weight, 1 to 10 mg / kg of body weight, and 4 to 15 mg / kg of body weight per day, inclusive. For example, HSD17B13 The dsRNA agent or HSD17B13 antisense polynucleotide agent may be administered at a dose of about 0.01 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 1 mg / kg, 1.1 mg / kg, 1.2 mg / kg, 1.3 mg / kg, 1.4 mg / kg, 1.5 mg / kg, 1.6 mg / kg, 1.7 mg / kg, 1.8 mg / kg, 1.9 mg / kg, 2 mg / kg, 2.1 mg / kg, 2.2 mg / kg, 2.3 mg / kg, 2.4 mg / kg, 2.5 mg / kg, 2.6 mg / kg, 2.7 mg / kg, 2.8 mg / kg, 2.9 mg / kg, 3.0 mg / kg, 3.1 mg / kg, 3.2 mg / kg, 3.3 mg / kg, 3.4 mg / kg, 3.5 mg / kg, 3.6 mg / kg, 3.7 mg / kg, 3.8 mg / kg, 3.9 mg / kg, 3.9 mg / kg, 3.10 mg / kg, 3.11 mg / kg, 3.12 mg / kg, 3.13 mg / kg, 3.14 mg / kg, 3.15 mg / kg, 3.16 mg / kg, 3.17 mg / kg, 3.18 mg / kg, 3.19 mg / kg, 3.26 mg / kg, 3.27 mg / kg, 3.28 mg / kg, 3.29 mg / kg, 3.30 mg / kg, 3.31 mg / kg, 3.32 mg / kg, 3.34 mg / kg, 3.35 mg / kg, 3.36 mg / kg, 3 3mg / kg, 3.4mg / kg, 3.5mg / kg, 3.6mg / kg, 3.7mg / kg, 3.8mg / kg, 3.9mg / kg, 4mg / kg, 4.1mg / kg, 4. 2mg / kg, 4.3mg / kg, 4.4mg / kg, 4.5mg / kg, 4.6mg / kg, 4.7mg / kg, 4.8mg / kg, 4.9mg / kg, 5mg / kg, 5.1 mg / kg, 5.2mg / kg, 5.3mg / kg, 5.4mg / kg, 5.5mg / kg, 5.6mg / kg, 5.7mg / kg, 5.8mg / kg, 5.9mg / kg, 6 mg / kg, 6.1mg / kg, 6.2mg / kg, 6.3mg / kg, 6.4mg / kg, 6.5mg / kg, 6.6mg / kg, 6.7mg / kg, 6.8mg / kg, 6.9mg / kg, 7mg / kg, 7.1mg / kg, 7.2mg / kg, 7.3mg / kg, 7.4mg / kg, 7.5mg / kg, 7.6mg / kg, 7.7mg / kg , 7.8mg / kg, 7.9mg / kg, 8mg / kg, 8.1mg / kg, 8.2mg / kg, 8.3mg / kg, 8.4mg / kg, 8.5mg / kg, 8.6mg / kg, 8.7mg / kg, 8.8mg / kg, 8.9mg / kg, 9mg / kg, 9.1mg / kg, 9.2mg / kg, 9.3mg / kg, 9.4mg / kg, 9. 5mg / kg, 9.6mg / kg, 9.7mg / kg, 9.8mg / kg, 9.9mg / kg, 10mg / kg, 11mg / kg, 12mg / kg, 13mg / kg, 1 It can be administered in the following amounts: 4mg / kg, 15mg / kg, 16mg / kg, 17mg / kg, 18mg / kg, 19mg / kg, 20mg / kg, 21mg / kg, 22mg / kg, 23mg / kg, 24mg / kg, 25mg / kg, 26mg / kg, 27mg / kg, 28mg / kg, 29mg / kg, 30mg / kg, 31mg / kg, 32mg / kg, 33mg / kg, 34mg / kg, 35mg / kg, 36mg / kg, 37mg / kg, 38mg / kg, 39mg / kg, 40mg / kg, 41mg / kg, 42mg / kg, 43mg / kg, 44mg / kg, 45mg / kg, 46mg / kg, 47mg / kg, 48mg / kg, 49mg / kg, and 50mg / kg.

[0211] Various factors can be taken into consideration when determining the dosage and delivery timing of the HSD17B13 dsRNA agent of the present invention.The absolute amount of the HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent to be delivered will depend on various factors, including concurrent treatment, administration frequency, and individual subject parameters such as age, physical condition, size, and weight.These are factors well known to those skilled in the art and can be addressed by simple experimentation.In some embodiments, the maximum dosage, i.e., the maximum safe dosage according to sound medical judgment, can be used.

[0212] In some embodiments, the methods of the present invention may include administering to a subject one, two, three, four, five, six, seven, eight, nine, ten, or more doses of an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent. In some cases, a pharmaceutical compound (e.g., comprising an HSD17B13 dsRNA agent or comprising an HSD17B13 antisense polynucleotide agent) can be administered to a subject at least daily, every other day, weekly, biweekly, monthly, etc. Doses can be administered once a day or more than once a day, for example, two, three, four, five, or more times within a 24-hour period. The pharmaceutical compositions of the present invention may be administered once a day, or the HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent may be administered in divided doses two, three, or more times at appropriate intervals throughout the day, or may be administered using continuous infusion or delivery via a controlled-release formulation. In some embodiments of the methods of the invention, a pharmaceutical composition of the invention is administered to a subject one or more times daily, one or more times weekly, one or more times monthly, or one or more times yearly.

[0213] In some embodiments, the methods of the present invention involve administering a pharmaceutical compound alone or in combination with one or more other HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents, and / or in combination with other medications or therapeutic activities or regimens administered to a subject with an HSD17B13-related disease or condition. The pharmaceutical compound may be administered as a pharmaceutical composition. The pharmaceutical compositions used in the methods of the present invention are sterile and may contain an amount of HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent in a weight or volume suitable for administration to a subject, sufficient to reduce the activity of an HSD17B13 polypeptide to a level sufficient to produce the desired response. The dose at which a pharmaceutical composition containing an HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent is administered to a subject to reduce HSD17B13 protein activity can be selected depending on various parameters, particularly the mode of administration used and the condition of the subject. Other factors include the desired duration of treatment. If the subject does not respond adequately to the initial dose administered, a larger dose (or a larger dose made effective using a different, more localized route of administration) may be used as tolerated by the patient.

[0214] treatment HSD17B13-related diseases and conditions in which reduced levels and / or activity of HSD17B13 polypeptide are effective in treating the disease or condition can be treated by inhibiting HSD17B13 expression using the methods and HSD17B13 dsRNA agents of the present invention. Examples of diseases and conditions that can be treated by the HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents of the present invention and the treatment methods of the present invention include, but are not limited to, hepatitis, liver fibrosis, nonalcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), cirrhosis, alcoholic steatohepatitis (ASH), alcoholic fatty liver disease (ALD), HCV-related cirrhosis, drug-induced liver injury, hepatocellular necrosis, and HSD17B13-related obesity. Herein, such diseases and conditions may be referred to as "HSD17B13-related diseases and conditions" and "diseases and conditions caused and / or regulated by HSD17B13."

[0215] In certain embodiments of the present invention, a subject may be administered with an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent of the present invention at one or more times before or after the diagnosis of an HSD17B13-related disease or condition. In some embodiments of the present invention, a subject has or is at risk of developing an HSD17B13-related disease or condition. A subject at risk of developing an HSD17B13-related disease or condition is a subject who has a higher probability of developing an HSD17B13-related disease or condition compared to a control risk of developing an HSD17B13-related disease or condition. In some embodiments of the present invention, the level of risk may be statistically significant compared to the control level of risk. At-risk subjects can include, for example, subjects who have a pre-existing disease and / or genetic abnormality and thereby are or will be more susceptible to an HSD17B13-associated disease or condition than control subjects without the pre-existing disease or genetic abnormality, subjects who have a family and / or personal history of an HSD17B13-associated disease or condition, and subjects who have previously been treated for an HSD17B13-associated disease or condition. It will be understood that a pre-existing disease and / or genetic abnormality that makes a subject more susceptible to an HSD17B13-associated disease or condition can be a disease or genetic abnormality that, when present, has previously been identified to be correlated with a higher likelihood of developing an HSD17B13-associated disease or condition.

[0216] It will be understood that HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents can be administered to a subject based on the individual subject's medical condition. For example, the healthcare provider providing the subject may assess the HSD17B13 level measured in a sample obtained from the subject and determine that it is desirable to administer an HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent of the present invention to reduce the subject's HSD17B13 level. In this example, even if the subject has not been diagnosed with an HSD17B13-related disease as disclosed herein, the HSD17B13 level may be considered a physiological characteristic of an HSD17B13-related condition. The healthcare provider may monitor changes in the subject's HSD17B13 level as a measure of the effectiveness of the administered HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent of the present invention. For example, a biological sample such as blood or serum sample can be obtained from a subject, and the HSD17B13 level of the subject in the sample can be determined.An HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent can be administered to a subject, and after administration, blood or liver samples can be obtained from the subject, and the HSD17B13 level can be determined using this sample, and the result can be compared with the result determined in the subject's pre-administration (pre-) sample.A decrease in the subject's HSD17B13 level in the post-administration sample compared to the pre-administration level indicates that the administered HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent has the effect of reducing the subject's lipid level, liver fat, or liver lipid droplets.

[0217] Certain embodiments of the methods of the present invention include adjusting a treatment comprising administering a dsRNA agent or HSD17B13 antisense polynucleotide agent of the present invention to a subject based at least in part on an assessment of a change in one or more physiological characteristics of the subject with an HSD17B13-related disease or condition that occurs as a result of the treatment. For example, in some embodiments of the present invention, the effect of an administered dsRNA agent or HSD17B13 antisense polynucleotide agent of the present invention is determined for the subject, which can then be used to assist in adjusting the amount of the dsRNA agent or HSD17B13 antisense polynucleotide agent of the present invention administered to the subject. As a non-limiting example, a dsRNA agent or HSD17B13 antisense polynucleotide agent of the present invention is administered to a subject, the subject's HSD17B13 level is determined after administration, and based at least in part on the determined level, it is determined that a larger amount of the dsRNA agent or HSD17B13 antisense polynucleotide agent is desirable to enhance the physiological effect of the administered agent, for example, to reduce or further reduce the subject's HSD17B13 level. In another non-limiting example, it is desirable to administer to a subject a dsRNA agent or HSD17B13 antisense polynucleotide agent of the invention, determine the subject's HSD17B13 level after administration, and decrease the amount of the dsRNA agent or HSD17B13 antisense polynucleotide agent administered to the subject based at least in part on the determined level.

[0218] Accordingly, some embodiments of the invention include assessing changes in one or more physiological characteristics resulting from a subject's previous treatment and subsequently adjusting the amount of a dsRNA agent or HSD17B13 antisense polynucleotide agent of the invention administered to the subject. Some embodiments of the methods of the invention include determining a physiological characteristic of an HSD17B13-related disease or condition one, two, three, four, five, six, or more times to assess and / or monitor the effectiveness of an administered HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent of the invention, and optionally using the determination to adjust one or more of the dose, administration regimen, and / or administration frequency of the dsRNA agent or HSD17B13 antisense polynucleotide agent of the invention to treat the subject's HSD17B13-related disease or condition. In some embodiments of the methods of the invention, the desired result of administering an effective amount of a dsRNA agent or HSD17B13 antisense polynucleotide agent of the invention to a subject is a decrease in the subject's HSD17B13 mRNA level, HSD17B13 protein level, or HSD17B13 enzymatic activity in the subject, or lipid levels, triglyceride levels, cholesterol levels (including LDL-C, HDL-C, VLDL-C, IDL-C, and total cholesterol), free fatty acid levels, or fat levels and / or lipid droplet levels in the liver, etc., compared to previous levels or control levels measured in the subject.

[0219] As used herein, the terms "treat," "treated," or "treating" when used in reference to an HSD17B13-related disease or condition can refer to prophylactic treatment that reduces the likelihood that a subject will develop an HSD17B13-related disease or condition, or can refer to treatment administered after a subject has developed an HSD17B13-related disease or condition in order to eliminate or reduce the level of the HSD17B13-related disease or condition, prevent the HSD17B13-related disease or condition from progressing further (e.g., becoming more severe), and / or slow the progression of the HSD17B13-related disease or condition in a subject compared to a subject not receiving treatment that reduces the activity of an HSD17B13 polypeptide in the subject.

[0220] Certain embodiments of the agents, compositions and methods of the present invention can be used to inhibit the expression of HSD17B13 gene.As used herein, the terms "inhibit", "silencing", "reduce", "down-regulate" and "knockdown" in relation to the expression of HSD17B13 gene refer to the fact that when a cell, a group of cells, a tissue, an organ or a subject in which the HSD17B13 gene is transcribed is contacted (e.g., treated) with an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent of the present invention, the expression of the HSD17B13 gene is measured by one or more of the level of RNA transcribed from the HSD17B13 gene, the level of HSD17B13 activity expressed, and the level of HSD17B13 polypeptide, protein or protein subunit translated from mRNA in the cell, and are reduced, respectively, compared to the control level of RNA transcribed from the HSD17B13 gene, the level of HSD17B13 activity expressed, and the level of HSD17B13 translated from mRNA. In some embodiments, the control level is the level in a cell, tissue, organ, or subject not contacted (eg, untreated) with an HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent.

[0221] Administration method The methods of the present invention can employ various routes of administration for HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents. The particular administration method selected will depend, at least in part, on the particular condition being treated and the dosage required for therapeutic effect. Generally speaking, the methods of the present invention may be carried out using any medically acceptable mode of administration, i.e., any mode that produces effective levels for treating HSD17B13-related diseases or conditions without causing clinically unacceptable side effects. In some embodiments of the present invention, HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents may be administered orally, enterally, mucosally, subcutaneously, and / or parenterally. The term "parenteral" includes subcutaneous, intravenous, intrathecal, intramuscular, intraperitoneal, and intrasternal injection or infusion techniques. Other administration routes include, but are not limited to, nasal (e.g., via a gastronasogastric tube), cutaneous, vaginal, rectal, sublingual, and inhalation. Delivery routes of the present invention may include intrathecal, intraventricular, or intracranial. In some embodiments of the present invention, the HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent may be placed in a sustained-release matrix and administered to a subject by placing the matrix in the subject. In some aspects of the present invention, the HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent may be delivered to a target cell using nanoparticles coated with a delivery agent that targets a specific cell or organelle. Various delivery means, methods, and agents are known in the art. Non-limiting examples of delivery methods and delivery agents are further described elsewhere herein.In some embodiments of the invention, the term "delivery" with respect to an HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent can refer to administering one or more "naked" HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent sequences to a cell or subject; in particular embodiments of the invention, "delivery" refers to administering to a cell or subject via transfection means, delivering to a subject a cell comprising an HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent, delivering to a cell and / or subject a vector encoding the HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent, etc. Delivery of an HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent using transfection means can include administering the vector to a cell and / or subject.

[0222] In some methods of the present invention, one or more HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents are administered in a formulation, which is administered in a pharmaceutically acceptable solution, which may routinely contain pharmaceutically acceptable concentrations of salts, buffers, preservatives, compatible carriers, adjuvants, and optionally other therapeutic ingredients. In some embodiments of the present invention, an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent may be formulated with another therapeutic agent for simultaneous administration. According to the methods of the present invention, an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent may be administered as a pharmaceutical composition. Generally, a pharmaceutical composition comprises an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent and, optionally, a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers are well known to those skilled in the art. As used herein, a pharmaceutically acceptable carrier refers to a non-toxic substance that does not interfere with the effectiveness of the biological activity of the active ingredient, e.g., the ability of an HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent to inhibit HSD17B13 gene expression in a cell or subject. Numerous methods for administering and delivering dsRNA agents or HSD17B13 antisense polynucleotide agents for therapeutic purposes are known in the art and can be used in the methods of the invention.

[0223] Pharmaceutically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials known in the art. Exemplary pharmaceutically acceptable carriers are described in U.S. Patent No. 5,211,657, and other carriers are known to those skilled in the art. Such formulations may routinely contain salts, buffers, preservatives, compatible carriers, and, optionally, other therapeutic agents. While salts for pharmaceutical use must be pharmaceutically acceptable, non-pharmaceutically acceptable salts may also be conveniently used to prepare pharmaceutically acceptable salts and are not excluded from the scope of the present invention. Such pharmacological and pharmaceutically acceptable salts include, but are not limited to, those prepared from acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, formic acid, malonic acid, and succinic acid. Pharmaceutically acceptable salts may also be prepared as alkali metal or alkaline earth metal salts, such as sodium, potassium, and calcium salts.

[0224] Some embodiments of the methods of the present invention include administering one or more HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents directly to a tissue. In some embodiments, the tissue to which the compound is administered is a tissue in which an HSD17B13-related disease or condition exists or may occur, including, but not limited to, the liver or kidney. Direct tissue administration can be achieved by direct injection or other means. Many orally administered compounds naturally migrate to and pass through the liver and kidney. Some embodiments of the therapeutic methods of the present invention include orally administering one or more HSD17B13 dsRNA agents to a subject. The HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents may be administered alone or in combination with other therapeutic agents, either once or, alternatively, in multiple doses. When administered multiple times, the HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents may be administered by different routes. For example, and not by way of limitation, the first (or first few) doses may be administered subcutaneously, and one or more additional doses may be administered orally and / or systemically.

[0225] In embodiments of the invention in which systemic administration of an HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent is desired, the HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent can be formulated for parenteral administration, for example, by injection via bolus injection or continuous infusion. Injectable formulations can be provided in unit dosage form, for example, in ampoules or multi-dose containers, with or without added preservatives. Formulations of HSD17B13 dsRNA agents (also referred to as pharmaceutical compositions) can take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles and can contain formulatory agents such as suspending, stabilizing, and / or dispersing agents.

[0226] Formulations for parenteral administration include aqueous or non-aqueous sterile solutions, suspensions, and emulsions. Examples of non-aqueous solvents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions, or suspensions, including saline and buffered media. Parenteral carriers include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Vehicles for intravenous administration include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present, such as antibacterial agents, antioxidants, chelating agents, and inert gases. Other forms of administration, such as intravenous administration, require lower dosages. If the subject does not respond adequately to the initial dose, a higher dose (or a higher dose efficacious using a different, more localized route of administration) may be used, as tolerated by the patient. Multiple doses per day may be administered as needed to achieve adequate systemic or local levels of one or more HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents to adequately reduce HSD17B13 protein activity.

[0227] In yet other embodiments, the methods of the present invention include the use of a delivery vehicle, such as a biocompatible microparticle, nanoparticle, or implant, suitable for implantation into a recipient, e.g., a subject. Exemplary biodegradable implants that may be useful according to this method are described in PCT Publication No. WO 95 / 24929 (incorporated herein by reference), which describes biocompatible, biodegradable polymeric matrices for housing biopolymers.

[0228] In the methods of the present invention, both non-biodegradable and biodegradable polymer matrices can be used to deliver one or more HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents to a subject. In some embodiments, the matrix can be biodegradable. The matrix polymer can be a natural or synthetic polymer. The polymer can be selected based on the desired period of release, typically ranging from a few hours to a year or more. Typically, release periods ranging from a few hours to 3-12 months can be used. The polymer is optionally in the form of a hydrogel capable of absorbing up to about 90% of its weight in water and, further, optionally crosslinked with multivalent ions or other polymers.

[0229] Generally, in some embodiments of the present invention, HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents can be delivered by diffusion or by degradation of a polymer matrix using biodegradable implants. Exemplary synthetic polymers for such use are well known in the art. Biodegradable and non-biodegradable polymers can be used to deliver HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents using methods known in the art. Bioadhesive polymers, such as biodegradable hydrogels (see H.S.Sawhney, C.P.Pathak, and J.A.Hubell, Macromolecules, 1993, 26, 581-587, the teachings of which are incorporated herein by reference), can also be used to deliver HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents for the treatment of HSD17B13-related diseases or conditions. Additional suitable delivery systems can include time-release, delayed-release, or sustained-release delivery systems. Such systems can avoid repeated administration of the HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent, improving convenience for patients and medical professionals. Many types of release delivery systems are available and known to those skilled in the art. (See, e.g., U.S. Patent Nos. 5,075,109, 4,452,775, 4,675,189, 5,736,152, 3,854,480, 5,133,974, and 5,407,686, the teachings of which are incorporated herein by reference.) In addition, pump-based hardware delivery systems can also be used, some of which are adapted for implantation.

[0230] The use of long-term sustained-release implants may be suitable for prophylactic treatment of subjects or for subjects at risk of recurrence of HSD17B13-related diseases or symptoms. As used herein, long-term release means that the implant is constructed and arranged to deliver therapeutic levels of an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent for at least 10 days, 20 days, 30 days, 60 days, 90 days, 6 months, 1 year, or more. Long-term sustained-release implants are well known to those skilled in the art and include some of the release systems described above.

[0231] Therapeutic formulations of HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents can be prepared for storage in the form of a lyophilized formulation or aqueous solution by mixing the molecule or compound having the desired purity with any pharmaceutically acceptable carrier, excipient, or stabilizer [Remington's Pharmaceutical Sciences 21 stedition, (2006)]. Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed and include buffers such as phosphate, citrate, and other organic acid salts, antioxidants including ascorbic acid and methionine, preservatives (such as octadecyldimethylbenzylammonium chloride, hexamethonium chloride, benzalkonium chloride, benzethonium chloride, phenol, butyl or benzyl alcohol, alkyl parabens such as methyl or propyl paraben, catechol, resorcinol, cyclohexanol, 3-pentanol, and m-cresol), low molecular weight (less than about 10 residues) polypeptides, serum albumin, gelatin, etc. or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose, or sorbitol; salt-forming counterions such as sodium; metal complexes (e.g., Zn-protein complexes); and / or non-ionic surfactants such as TWEEN®, PLURONICS®, or polyethylene glycol (PEG).

[0232] Cells, subjects, and controls The methods of the present invention can be used in conjunction with cells, tissues, organs, and / or subjects. In some embodiments of the present invention, the subject is a vertebrate, including, but not limited to, a human or a primate, such as a dog, cat, horse, cow, goat, mouse, rat, or monkey. Thus, the present invention can be used to treat HSD17B13-related diseases or conditions in human and non-human subjects. In some embodiments of the present invention, the subject can be a farm animal, a zoo animal, a livestock animal, or a non-livestock animal, and the methods of the present invention can be used in veterinary prophylactic and therapeutic regimens. In some embodiments of the present invention, the subject is a human, and the methods of the present invention can be used in human prophylactic and therapeutic regimens.

[0233] Non-limiting examples of subjects to which the present invention is applicable include subjects who have been diagnosed with, are suspected of having, or are at risk for a disease or condition associated with higher than desired levels of HSD17B13 expression and / or activity, also referred to as "elevated HSD17B13 expression levels." Non-limiting examples of diseases and conditions associated with higher than desired levels of HSD17B13 expression and / or activity are described elsewhere herein. The methods of the present invention may be applied to subjects who, upon treatment, have been diagnosed with a disease or condition associated with higher than desired levels of HSD17B13 expression and / or activity, or subjects believed to have or be at risk for developing a disease or condition associated with higher than desired levels of HSD17B13 expression and / or activity. In some embodiments of the present invention, the disease or condition associated with higher than desired levels of HSD17B13 expression and / or activity is an acute disease or condition, while in certain embodiments of the present invention, the disease or condition associated with higher than desired levels of HSD17B13 expression and / or activity is a chronic disease or condition.

[0234] As a non-limiting example, the HSD17B13 dsRNA agent of the present invention is administered to a subject who has been diagnosed with, is suspected of having, or is at risk for statin-resistant hypercholesterolemia, a disease for which it is desirable to reduce the expression of HSD17B13. The method of the present invention can be applied to subjects who have been diagnosed with a disease or condition, or who are thought to have or be at risk for developing a disease or condition, at the time of treatment.

[0235] In another non-limiting example, the HSD17B13 dsRNA agent of the present invention is administered to a subject who has been diagnosed with, is suspected of having, or is at risk of having hyperlipidemia, a disease for which it is desirable to reduce the expression of HSD17B13. The method of the present invention can be applied to a subject who has been diagnosed with a disease or condition, or a subject who is thought to have or be at risk of developing a disease or condition at the time of treatment.

[0236] Cells to which the methods of the present invention can be applied include in vitro, in vivo, and ex vivo cells. Cells may be in a subject, in culture, and / or in suspension, or under other suitable conditions. Cells to which the methods of the present invention can be applied may be liver cells, hepatocytes, cardiac cells, pancreatic cells, cardiovascular cells, kidney cells, or other types of vertebrate cells, including human and non-human mammalian cells. In certain aspects of the present invention, cells to which the methods of the present invention can be applied are healthy, normal cells that are not known to be diseased cells. In certain embodiments of the present invention, the cells to which the methods and compositions of the present invention can be applied are liver cells, hepatocytes, cardiac cells, pancreatic cells, cardiovascular cells, and / or kidney cells. While in certain aspects of the present invention, the control cells are normal cells, it will be understood that cells with a disease or condition can also serve as control cells in certain situations, such as when comparing the results of treated cells with a disease or condition to untreated cells with a disease or condition.

[0237] According to the methods of the present invention, the level of HSD17B13 polypeptide activity can be determined and compared to a control level of HSD17B13 polypeptide activity. The control can be a predetermined value, which can take various forms. It can be a single cutoff value, such as a median or mean value. It can be established based on comparison groups, such as a group with normal levels of HSD17B13 polypeptide and / or HSD17B13 polypeptide activity and a group with increased levels of HSD17B13 polypeptide and / or HSD17B13 polypeptide activity. Other non-limiting examples of comparison groups include a group with one or more symptoms of an HSD17B13-related disease or condition or a diagnosis thereof, a group without one or more symptoms of a disease or condition or a diagnosis thereof, a group of subjects administered an siRNA treatment of the present invention, and a group of subjects not administered an siRNA treatment of the present invention. Typically, the control can be based on apparently healthy normal individuals or apparently healthy cells of an appropriate age group. It will be understood that the control according to the present invention can be a predetermined value as well as a sample of material tested in parallel with the experimental material. Examples include samples from a control population or control samples generated through manufacturing for testing in parallel with experimental samples. In some embodiments of the invention, the control includes cells or subjects that have not been contacted or treated with an HSD17B13 dsRNA agent of the invention, in which case the level of HSD17B13 polypeptide and / or HSD17B13 polypeptide activity in the control can be compared to the level of HSD17B13 polypeptide and / or HSD17B13 polypeptide activity in cells or subjects that have been contacted with an HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent of the invention.

[0238] In some embodiments of the present invention, the level of HSD17B13 polypeptide determined for a subject can serve as a control level to which the level of HSD17B13 polypeptide determined for the same subject at a different time point is compared. As a non-limiting example, the level of HSD17B13 is determined in a biological sample obtained from a subject not receiving the HSD17B13 treatment of the present invention. In some embodiments, the biological sample is a serum sample. In some embodiments, the biological sample is a liver sample. The level of HSD17B13 polypeptide determined in a sample obtained from a subject can serve as a baseline or control value for the subject. In the treatment methods of the present invention, after one or more administrations of an HSD17B13 dsRNA agent to the subject, one or more additional serum samples can be collected from the subject, and the level of HSD17B13 polypeptide in the subsequent sample or samples can be compared to the subject's control / baseline level. Such comparisons can be used to assess the onset, progression, or regression of an HSD17B13-related disease or condition in a subject. For example, a higher level of HSD17B13 polypeptide in a baseline sample obtained from a subject than the level obtained from the same subject after administering to the subject an HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent of the present invention indicates regression of the HSD17B13-associated disease or condition and indicates the effectiveness of the administered HSD17B13 dsRNA agent of the present invention for treating the HSD17B13-associated disease or condition.

[0239] In some aspects of the invention, one or more values ​​of the level of HSD17B13 polypeptide and / or HSD17B13 polypeptide activity determined for a subject serve as a control value to which the level of HSD17B13 polypeptide and / or HSD17B13 activity in the same subject can later be compared, thereby assessing changes from a "baseline" HSD17B13 polypeptide activity in the subject. Thus, an initial HSD17B13 polypeptide level and / or initial HSD17B13 polypeptide activity level may be present and / or measured in a subject, and methods and compounds of the invention may be used to reduce the level of HSD17B13 polypeptide and / or HSD17B13 polypeptide activity in a subject, with the initial level serving as the control level for that subject.

[0240] Using the methods of the present invention, HSD17B13 dsRNA agents and / or HSD17B13 antisense polynucleotide agents of the present invention can be administered to a subject.The effectiveness of the administration and treatment of the present invention can be assessed if the level of HSD17B13 polypeptide in a serum sample obtained from the subject is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more, compared to the pre-administration level of HSD17B13 polypeptide in a serum sample obtained from the subject at a previous time point, or compared to a non-contact control level, for example, the level of HSD17B13 polypeptide in a control serum sample.It will be understood that both the level of HSD17B13 polypeptide and the level of HSD17B13 polypeptide activity are correlated with the level of HSD17B13 gene expression. Certain embodiments of the methods of the present invention include administering to a subject an HSD17B13 dsRNA and / or HSD17B13 antisense agent of the present invention in an amount effective to inhibit HSD17B13 gene expression, thereby reducing the level of HSD17B13 polypeptide in the subject and reducing the level of HSD17B13 polypeptide activity.

[0241] Some embodiments of the present invention include determining the presence, absence, and / or amount (also referred to herein as level) of HSD17B13 polypeptide in one or more biological samples obtained from one or more subjects. This determination can be used to assess the effectiveness of a treatment of the present invention. For example, the methods and compositions of the present invention can be used to determine the level of HSD17B13 polypeptide in a biological sample obtained from a subject previously treated with an HSD17B13 dsRNA agent and / or HSD17B13 antisense agent of the present invention. A level of HSD17B13 polypeptide determined in a serum sample obtained from the treated subject that is at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more lower than the pre-treatment level of HSD17B13 polypeptide determined for the subject or compared to the level in an untreated control biological sample indicates a level of effectiveness of the treatment administered to the subject.

[0242] In some embodiments of the present invention, the physiological characteristics of an HSD17B13-related disease or condition determined for a subject can be compared with a control determination of the physiological characteristics of the same subject at a different time point. As a non-limiting example, physiological characteristics such as a subject's HSD17B13 mRNA level, HSD17B13 protein level, or HSD17B13 enzyme activity, or lipid levels, triglyceride levels, cholesterol levels, free fatty acid levels, or fat levels and / or lipid droplet levels in plasma or tissue samples, are determined in a biological sample, such as a liver or serum sample, obtained from a subject who has not been administered the HSD17B13 treatment of the present invention. The HSD17B13 mRNA level (and / or other physiological characteristics of an HSD17B13 disease or condition) determined in a sample obtained from the subject can serve as a baseline value or control value for the subject. In the treatment methods of the present invention, after one or more administrations of an HSD17B13 dsRNA agent to a subject, one or more additional liver or serum samples can be obtained from the subject, and the HSD17B13 mRNA level and / or HSD17B13 protein level in the subsequent one or more samples can be compared to the subject's control / baseline level and / or ratio, respectively. Such comparisons can be used to assess the onset, progression, or regression of an HSD17B13-related disease or condition in the subject. For example, a higher HSD17B13 mRNA level in a baseline sample obtained from a subject than the HSD17B13 mRNA level determined in a sample obtained from the same subject after administration of an HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent of the present invention to the subject indicates regression of an HSD17B13-related disease or condition and indicates the effectiveness of administering an HSD17B13 dsRNA agent of the present invention for treating an HSD17B13-related disease or condition.

[0243] In some embodiments of the invention, the value of one or more physiological characteristics of an HSD17B13-related disease or condition determined for a subject may serve as a control value for subsequent comparison of physiological characteristics of the same subject, allowing for assessment of changes from a "baseline" physiological characteristic of the subject. Thus, an initial physiological characteristic may be present and / or determined in a subject, and the methods and compounds of the invention may be used to reduce the level of HSD17B13 polypeptide and / or HSD17B13 polypeptide activity in the subject, with the initial physiological characteristic determination serving as a control for that subject.

[0244] Using the methods of the present invention, HSD17B13 dsRNA agents and / or HSD17B13 antisense polynucleotide agents of the present invention can be administered to a subject in an amount effective to treat an HSD17B13 disease or condition. The effectiveness of the administration and treatment of the present invention can be assessed by determining changes in one or more physiological characteristics of an HSD17B13 disease or condition. In a non-limiting example, the HSD17B13 mRNA level in a serum sample obtained from the subject is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more compared to pre-administration lipids in a serum sample obtained from the subject at a previous time point, or compared to an untreated control level, e.g., the HSD17B13 mRNA level in a control serum sample. It will be understood that the HSD17B13 mRNA level, HSD17B13 protein level, or HSD17B13 enzymatic activity in a subject, or the lipid levels, triglyceride levels, cholesterol levels, free fatty acid levels in plasma or tissue samples, or the fat levels and / or lipid droplet levels in the liver, each correlate with the level of HSD17B13 gene expression. Certain embodiments of the methods of the present invention comprise administering to a subject an HSD17B13 dsRNA and / or HSD17B13 antisense agent of the present invention in an amount effective to inhibit HSD17B13 gene expression and thereby reduce HSD17B13 mRNA level, HSD17B13 protein level, or HSD17B13 enzymatic activity in the subject, or positively affect the physiological characteristics of an HSD17B13-related disease or condition in the subject.

[0245] Some embodiments of the present invention include, but are not limited to, determining the presence, absence, and / or alteration of physiological characteristics of a disease or condition associated with HSD17B13 using methods such as: (1) evaluating one or more biological samples obtained from one or more subjects for physiological characteristics, (2) imaging the subjects (e.g., but not limited to, obtaining liver images), and (3) physical examination of the subjects, which can be used to assess the effectiveness of the treatment methods of the present invention.

[0246] kit The present invention also encompasses kits containing one or more HSD17B13 dsRNA agents and / or HSD17B13 antisense polynucleotide agents and instructions for their use in the methods of the present invention. The kits of the present invention may include one or more of HSD17B13 dsRNA agents, HSD17B13 sense polynucleotides, and HSD17B13 antisense polynucleotide agents that can be used to treat HSD17B13-related diseases or conditions. Kits containing one or more HSD17B13 dsRNA agents, HSD17B13 sense polynucleotides, and HSD17B13 antisense polynucleotide agents can be prepared for use in the therapeutic methods of the present invention. The components of the kits of the present invention can be packaged in either aqueous media or lyophilized form. The kits of the present invention may include a compartmentalized carrier for hermetically containing one or more container means or a series of container means, such as test tubes, vials, flasks, bottles, syringes, etc. A first container means or series of container means may contain one or more compounds, such as an HSD17B13 dsRNA agent and / or an HSD17B13 sense or antisense polynucleotide agent. A second container means or series of container means may contain a targeting agent, labeling agent, delivery agent, etc., which may be included as part of the HSD17B13 dsRNA agent and / or HSD17B13 antisense polynucleotide agent administered in method of treatment embodiments of the present invention.

[0247] Kits of the invention may also include instructions, typically in written form, that provide guidance for carrying out the treatment provided by the kit and for making decisions based on that treatment.

[0248] The following examples are provided to illustrate specific embodiments of the practice of the present invention and are not intended to limit the scope of the invention. As will be apparent to those skilled in the art, the present invention has application in a variety of compositions and methods. [Example]

[0249] Example 1 Preparation of Intermediate A and Intermediate B.

[0250] As shown in Scheme 1 below, intermediate A was synthesized by treating commercially available galactosamine pentaacetate with trimethylsilyl trifluoromethanesulfonate (TMSOTf) in dichloromethane (DCM). Subsequent glycosylation with Cbz-protected 2-(2-aminoethoxy)ethan-1-ol afforded compound II. The Cbz-protecting group was removed by hydrogenation to afford intermediate A as the trifluoroacetate (TFA) salt. Intermediate B was synthesized according to the same scheme, except that Cbz-protected 2-(2-(2-aminoethoxy)ethoxy)ethan-1-ol was used as the starting material.

[0251] [ka] Scheme 1 To a solution of compound I (20.0 g, 51.4 mmol) in 100 mL of 1,2-dichloroethane (DCE), TMSOTf (17.1 g, 77.2 mmol) was added. The resulting reaction solution was stirred at 60 °C for 2 h and then at 25 °C for 1 h. Cbz-protected 2-(2-aminoethoxy)ethan-1-ol (13.5 g, 56.5 mmol) in DCE (100 mL) dried over 4 Å powdered molecular sieves (10 g) was added dropwise to the above reaction solution at 0 °C under a N atmosphere. The resulting reaction mixture was stirred at 25 °C for 16 h under a N atmosphere. The reaction mixture was filtered and washed with saturated NaHCO (200 mL), water (200 mL), and saturated brine (200 mL). The organic layer was dried over anhydrous NaSO, filtered, and concentrated under reduced pressure to give the crude product, which was triturated with 2-methyltetrahydrofuran / heptane (5 / 3, v / v, 1.80 L) for 2 h. The resulting mixture was filtered and dried to give compound II (15.0 g, 50.3% yield) as a white solid.

[0252] To a dry, argon-purged hydrogenation bottle, 10% Pd / C (1.50 g) was carefully added, followed by 10 mL of tetrahydrofuran (THF), followed by a solution of compound II (15.0 g, 26.4 mmol) in THF (300 mL) and TFA (trifluoroacetic acid, 3.00 g, 26.4 mmol). The resulting mixture was degassed, purged with H2 three times, and stirred under an atmosphere of H2 (45 psi) at 25 °C for 3 h. Thin-layer chromatography (TLC, solvent: DCM:MeOH = 10:1) indicated that compound II was completely consumed. The reaction mixture was filtered and concentrated under reduced pressure. The residue was dissolved in anhydrous DCM (500 mL) and concentrated. This process was repeated three times to give intermediate A (14.0 g, 96.5% yield) as a foamy white solid. 1 H NMR (400 MHz DMSO-d6): δppm7.90(d,J=9.29Hz, 1H), 7.78(br s, 3H), 5.23(d, J=3.26Hz, 1H), 4.98(dd, J=11.29, 3.26Hz, 1H), 4.56(d, J=8. 53Hz, 1H), 3.98~4.07(m, 3H), 3.79~3.93(m, 2H), 3.55~3.66(m, 5H), 2.98(br d, J=4.77Hz, 2H), 2.11(s, 3H), 2.00(s, 3H), 1.90(s, 3H), 1.76(s, 3H).

[0253] Intermediate B was synthesized using a procedure similar to that of Intermediate A. 1 H NMR(400MHz DMSO-d6):δppm7.90(br d, J=9.03Hz, 4H), 5.21(d, J=3.51Hz, 1H), 4.97(dd, J=11.1Hz, 1H), 4.54(d, J=8.53Hz, 1H), 3.98~4.06(m, 3H), 3.88(dt, J=10.9Hz, 1H), 3.76~3.83(m, 1H), 3.49~3.61(m, 9H), 2.97(br s, 2H), 2.10(s, 3H), 1.99(s, 3H), 1.88(s, 3H), 1.78(s, 3H). C 20 H 34 N2O 11 Calculated mass: 478.22; Found: 479.3 (M+H + ).

[0254] Example 2 Synthesis of GalNAc Ligand Cluster Phosphoramidites GLPA1, GLPA2, and GLPA15.

[0255] To prepare GLPA1 and GLPA2, the following scheme 2 was followed. Starting from benzyl-protected propane-1,3-diamine, alkylation with tert-butyl 2-bromoacetate gave triester compound I. The benzyl protecting group was removed by hydrogenation to give secondary amine compound II. Amide coupling with 6-hydroxyhexanoic acid gave compound III. Subsequent treatment with HCl in dioxane removed the tert-butyl protecting group to generate triacid compound IV. Amide coupling of triacid compound IV with intermediate A or intermediate B gave compound Va or Vb. Phosphoramidite GLPA1 or GLPA2 was synthesized by phosphitylation of compound Va or Vb with 2-cyanoethyl N,N-diisopropylchlorophosphoramidite and a catalytic amount of 1H-tetrazole.

[0256] [ka] Scheme 2 To a solution of N-benzyl-1,3-propanediamine (5.00 g, 30.4 mmol) in dimethylformamide (DMF, 100 mL) was added tert-butyl 2-bromoacetate (23.7 g, 121 mmol), followed by the dropwise addition of diisopropylethylamine (DIEA, 23.61 g, 182 mmol). The resulting reaction mixture was stirred at 25–30 °C for 16 h. LCMS showed that N-benzyl-1,3-propanediamine was completely consumed. The reaction mixture was diluted with HO (500 mL) and extracted with EtOAc (500 mL × 2). The combined organics were washed with saturated brine (1 L), dried over anhydrous NaSO, filtered, and concentrated under reduced pressure to give the crude product, which was purified by silica gel column chromatography (gradient: petroleum ether:ethyl acetate 20:1 to 5:1). Compound I (12.1 g, 78.4% yield) was obtained as a colorless oil. 1 H NMR (400MHz, CDCl3): δppm7.26~7.40(m,5H),3.79(s,2H),3.43(s,4H),3.21(s,2) H), 2.72 (dt, J=16.9, 7.34Hz, 4H), 1.70 (quin, J=7.2Hz, 2H), 1.44~1.50 (m, 27H).

[0257] A dry hydrogenation bottle was purged with argon three times. Pd / C (200 mg, 10%) was added, followed by MeOH (5 mL), followed by a solution of compound I (1.00 g, 1.97 mmol) in MeOH (5 mL). The reaction mixture was degassed under vacuum and refilled with H. This process was repeated three times. The mixture was stirred under an H (15 psi) atmosphere at 25 °C for 12 h. LCMS showed that compound I was completely consumed. The reaction mixture was filtered under reduced pressure under a N atmosphere. The filtrate was concentrated under reduced pressure to give compound II (655 mg, 79.7% yield) as a yellow oil, which was used in the next step without further purification. 1H NMR (400MHz, CDCl3): δppm3.44(s,4H),3.31(s,2H),2.78(t,J=7.1Hz,2H),2.68(t,J=6.9Hz,2H),1.88(br s, 1H), 1.69 (quin, J=7.03Hz, 2H), 1.44~1.50 (s, 27H).

[0258] A mixture of compound II (655 mg, 1.57 mmol), 6-hydroxyhexanoic acid (249 mg, 1.89 mmol), DIEA (1.02 g, 7.86 mmol), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI, 904 mg, 4.72 mmol), and 1-hydroxybenzotriazole (HOBt, 637 mg, 4.72 mmol) in DMF (6 mL) was degassed and purged with N three times, then stirred under N at 25 °C for 3 h. LCMS showed the desired product. The reaction mixture was diluted with HO (10 mL) and extracted with 20 mL of EtOAc (2 x 10 mL). The organics were combined, washed with saturated brine (20 mL), dried over anhydrous NaSO, filtered, and concentrated to give the crude product, which was purified by silica gel column chromatography (gradient: petroleum ether:ethyl acetate 5:1 to 1:1) to give compound III (650 mg, 77.8% yield) as a yellow oil. 1 H NMR (400MHz, CDCl3): δppm3.90~3.95(s, 2H), 3.63(t,J=6.40Hz, 2H), 3.38~3.45(m, 6 H), 2.72(t, J=6.65Hz, 2H), 2.40(t, J=7.28Hz, 2H), 1.55~1.75(m, 8H), 1.44(s, 27H). C 27 H 50 Calculated mass of N2O8: 530.36; Found: 531.3 (M+H + ).

[0259] A mixture of compound III (5.5 g, 10.3 mmol) in HCl / dioxane (2 M, 55 mL) was stirred at 25 °C for 3 h. LCMS showed that compound III was completely consumed. The reaction mixture was filtered, washed with EtOAc (50 mL), and dried under reduced pressure to give the crude product, which was dissolved in CHCN (50 mL) and the volatiles were removed under vacuum. This process was repeated three times to give compound IV (2.05 g, 54.5% yield) as a white solid. 1 H NMR (400MHz, D2O): δppm4.21(s, 1H), 4.07(d,J=4.5Hz, 4H), 3.99(s, 1H), 3.4 5~3.52(m, 3H), 3.42(t, J=6.5Hz, 1H), 3.32~3.38(m, 1H), 3.24~3.31(m, 1H), 2.37(t, J=7.4Hz, 1H), 2.24(t, J=7.4Hz, 1H), 1.99(dt, J=15.5, 7.53Hz, 1H), 1.85~1.94(m, 1H), 1.85~1.94(m, 1H), 1.39~1.56(m, 4H), 1.19~1.31(m, 2H).

[0260] A mixture of compound IV (500 mg, 1.05 mmol), intermediate A (2.02 g, 3.67 mmol), DIEA (813 mg, 6.30 mmol), EDCI (704 mg, 3.67 mmol), and HOBt (496 mg, 3.67 mmol) in DMF (10 mL) was degassed and purged with N three times, after which the mixture was stirred under a N atmosphere at 25 °C for 3 h. LCMS showed the desired product. The reaction mixture was quenched by the addition of H2O (10 mL) and extracted with DCM (10 mL x 2). The combined organics were extracted with 10% citric acid (20 mL). The aqueous phase was neutralized with saturated NaHCO3 solution and re-extracted with DCM (10 mL x 2). The organics were dried over sodium sulfate, filtered, and concentrated under reduced pressure to provide compound Va (570 mg, 0.281 mmol, 26.8% yield) as a white solid. 1H NMR: (400MHz, CDCl3)ppmδ7.84~8.12(m,3H),6.85~7.15(m,2H),6.66~6.81(m,1H),5.36(br d,J=2.7Hz, 3H), 5.11~5.27(m, 3H), 4.63~4.85(m, 3H), 3.90~4.25(m, 18H), 3.37~3.75(m, 28H), 3.15~3.28(m, 4H), 2.64(br d. t, J=7.0Hz, 2H).

[0261] To a solution of compound Va (260 mg, 0.161 mmol) in anhydrous DCM (5 mL) was added diisopropylammonium tetrazolide (30.3 mg, 0.177 mmol), followed by the dropwise addition of 3-bis(diisopropylamino)phosphanyloxypropanenitrile (194 mg, 0.645 mmol) at ambient temperature under N2. The reaction mixture was stirred at 20-25 °C for 2 h. LCMS indicated that compound Va was completely consumed. After cooling to -20 °C, the reaction mixture was added to stirred brine / saturated aqueous NaHCO3 (1:1, 5 mL) at 0 °C. After stirring for 1 min, DCM (5 mL) was added. The layers were separated. The organics were washed with brine / saturated aqueous NaHCO3 (1:1, 5 mL), dried over Na2SO4, filtered, and concentrated to a volume of 1 mL. The remaining solution was added dropwise to 20 mL of methyl tert-butyl ether (MTBE) with stirring. This resulted in the precipitation of a white solid. The mixture was centrifuged, and the solid was collected. The solid was redissolved in 1 mL of DCM and precipitated by the addition of MTBE (20 mL). The solid was again separated by centrifugation. The collected solid was dissolved in anhydrous CH3CN. The volatiles were removed. This process was repeated two more times to obtain the GalNAc ligand phosphoramidite compound GLPA1 (153 mg, 84.4 μmol) as a white solid. 1H NMR (400MHz, CDCl3):ppmδ7.71~8.06(m,2H),6.60~7.06(m,3H),5.37(b rd,J=3.0Hz,3H),5.18~5.32(m,3H),4.70~4.86(m,3H),3.92~4.25(m,18H),3.42~3.85(m,30H),3.25(m ,4H),2.59~2.75(m,4H),2.27~2.44(m,2H),2.15~2.20(s,9H)2.07(s,9H),1.96~2.03(m,18H),1.65(br s, 4H), 1.44(br d, J=7.28Hz, 2H), 1.14~1.24(m, 12H). 31 P NMR (CDCl3): ppm δ 147.15.

[0262] The GalNAc ligand phosphoramidite compound GLPA2 was synthesized using the same procedure except that intermediate B was used. 1 H NMR (400MHz, CDCl3):ppmδ7.94~8.18(m,1H),7.69(br s,1H),6.66~7.10(m,3H),5.35(d,J=3.5Hz,3H),5.07~5.25(m,3H),4.76~4 .86(m, 3H), 4.01~4.31(m, 10H), 3.91~4.01(m, 8H), 3.74~3.86(m, 4H), 3.52~ 3.71(m, 30H), 3.42~3.50(m, 6H), 3.15~3.25(m, 4H), 2.52~2.70(m, 4H), 2.2 2~2.45(m, 2H), 2.15~2.22(s, 9H), 2.06(s, 9H), 1.95~2.03(m, 18H), 1.77(br s, 2H), 1.58~1.66(m, 4H), 1.40(m, 2H), 1.08~1.24(m, 12H). 31 P NMR (CDCl3): ppm δ 147.12.

[0263] To prepare GLPA15, the following scheme 3 was followed.

[0264] [ka] Scheme 3 Starting from secondary amine compound I (compound II in Scheme 2), Cbz protection was introduced to give compound II. The tert-butyl group of compound II was removed by acid treatment to give triacid compound III. Amide coupling of compound III with intermediate A gave compound IV. The Cbz protecting group of compound IV was removed by hydrogenation to give secondary amine compound V, which was reacted with glutaric anhydride to give carboxyl compound VI. Compound VI was reacted with piperidin-4-ol under amide coupling reaction conditions to give compound VII. Phosphoramidite compound GLPA15 was synthesized by treating compound VII with 2-cyanoethyl N,N-diisopropylchlorophosphoramidite and a catalytic amount of 1H-tetrazole. 1 H NMR (400MHz in DMSO-d6): δppm8.05(br d,J=6.50Hz,2H),7.81(br d,J=9.01Hz,3H),5.22(d,J=3.25Hz,3H),4.98(dd,J=11.26,3.25Hz,3H),4.55(br d,J=8.50Hz,3H),4.03(s,9H),3.64~3.97(m,12H),3.55~3.63(m,6H),3.50(br s,5H),3.40(br d,J=6.13Hz,6H),3.17~3.30(m,9H),3.07(br d, J=14.26Hz, 4H), 2.76(t, J=5.82Hz, 2H), 2.18~2.47(m, 6H), 2.10(s, 9H), 1 .99(s, 9H), 1.89(s, 9H), 1.78(s, 9H), 1.52~1.74(m, 6H), 1.12~1.19(m, 12H). 31P NMR (DMSO-d6): ppmδ145.25.

[0265] In one study, the method used to attach a targeting group containing GalNAc (also referred to herein as a GalNAc delivery compound) to the 5' end of the sense strand involved using a GalNAc phosphoramidite (GLPA1) in the final coupling step of solid-phase synthesis, using a synthetic process similar to the process used when oligonucleotide chain propagation is performed to add nucleotides to the 5' end of the sense strand.

[0266] Some studies have used a solid support (CPG) containing GLO-n as a method for attaching a GalNAc-containing targeting group to the 3'-end of the sense strand. Other studies have used a solid support (CPG) containing GLO-n as a method for attaching a GalNAc-containing targeting group to the 3'-end of the sense strand. Other studies have used a CPG solid support containing the GalNAc-containing targeting group via an ester bond, and then used the resulting CPG with the attached GalNAc-containing targeting group during synthesis of the sense strand, resulting in the attachment of a GalNAc-containing targeting group to the 3'-end of the sense strand.

[0267] Example 3 Phosphoramidite Compound 2 [ka] DMTrCl (232 g, 684 mmol, 1.0 equiv.) in pyridine (400 mL) was added to a solution of isomannide compound A (100 g, 684 mmol, 1.0 equiv.) in pyridine (600 mL), and the mixture was stirred at 25 °C for 12 h. LC-MS analysis showed that compound A was completely consumed and one main peak with the desired mass was detected. The resulting reaction mixture was diluted with water (500 mL) and extracted with DCM (500 mL × 2). The combined organic phases were washed with brine (500 mL), dried over NaSO, and concentrated in vacuo to give a residue. The residue was purified by column chromatography (DCM / MeOH = 100 / 1 to 50 / 1, 0.1% EtN) to give compound B (150 g, 48.9% yield) as a yellow solid. 1H NMR:EC4783-404-P1B1_C(400MHz, DMSO-d6)δppm7.46(br d, J=7.63Hz, 2H)7.28~7.37(m, 6H)7.19~7.25(m, 1H)6.90(br d, J=7.88Hz, 4H) 4.70(d, J=6.50Hz, 1H) 3.99~4.09(m, 6H) 3.88~3.96(m, 2H) 3.83(br dd, J=7.82, 6.94Hz, 1H) 3.74(s, 6H) 3.41(br t, J=8.13Hz, 1H)3.05(t, J=8.44Hz, 1H)2.85(br t, J = 7.50 Hz, 1H).

[0268] A solution of compound B (80.0 g, 178 mmol, 1.0 equiv) in DCM (800 mL) was added dropwise to 2H-tetrazole (0.45 M, 436 mL, 1.1 equiv) at 25 °C under a N atmosphere, and then compound C (80.6 g, 267 mmol, 85.0 mL, 1.5 equiv) in DCM (200 mL) was added dropwise to the mixture. The reaction mixture was stirred at 25 °C for 1.0 h. LC-MS showed that compound B was completely consumed and one main peak with the desired mass was detected. The resulting reaction mixture was cooled to -20 °C, poured into ice-cold saturated NaHCO (500 mL), extracted with DCM (500 mL × 3), and the combined organic layers were washed with saturated NaHCO / brine (1:1, 300 mL / 300 mL), dried over NaSO, and concentrated in vacuo (35 °C) to give a residue (100 mL). The residue was purified by column chromatography (AlO, DCM / MeOH (100 / 1 to 50 / 1, 0.1% EtN) to give compound 2 (77 g, 119 mmol, 66.5% yield) as a white solid. 1H NMR: EC4783-423-P1B1_C (400MHz, DMSO-d6) δppm7.22 (br d, J=7.50Hz, 2H) 7.05~7.14 (m, 6H) 6.96~7.02 (m, 1H) 6.67 (br dd, J=8.82, 1.81Hz, 4H) 3.95~4.07(m, 2H) 3.73~3.83(m, 1H) 3.62~3.72(m, 2H) 3.48~3.53(m , 6H) 3.27~3.37(m, 3H) 3.11(s, 6H) 2.82(td, J=8.54, 2.31Hz, 1H) 2.47~2.63(m, 3H) 2.28(br d, J=1.63Hz, 3H)0.82~1.00(m, 13H).

[0269] Phosphoramidite Compound 1 [ka] To a solution of compound B (500 mg, 1.11 mmol, 1.0 equiv) in DCM (5.0 mL) was added compound D (607 mg, 3.34 mmol, 3.0 equiv) and DIEA (432 mg, 3.34 mmol, 582 μL, 3.0 equiv) under a N atmosphere at 0-5 °C, and the mixture was stirred at 25 °C for 1.0 h. LC-MS showed that compound B was completely consumed, and several new peaks were observed on LC-MS, with ~70.9% of the desired compound being detected. The resulting reaction mixture was cooled to -20 °C, poured into cold (0-5 °C) saturated NaHCO3 (5.0 mL), extracted with DCM (5.0 mL × 2), and the combined organic layers were washed with cold (0-5 °C) saturated NaHCO3 / brine (1:1, 5.0 mL / 5.0 mL), dried over Na2SO4, and concentrated in vacuo to give a residue (~5 mL). The residue was purified by column chromatography (alkali Al2O3, petroleum ether / ethyl acetate (10:1 to 5:1, 0.1% Et3N) to give compound 1 (280 mg, 471 μmol, 42.3% yield) as a white solid. 1 H NMR:EC10615-49-P1N(400MHz, DMSO-d6) δppm7.44(br d, J=7.63Hz, 2H), 7.31(br t, J=7.94Hz, 6H), 7.18~7.26(m, 1H), 6.89(brd, J=8.00Hz, 4H), 4.08~4.13(m, 1H), 3.95~4 .03(m, 1H), 3.84~3.93(m, 1H), 3.77~3.83(m, 1H), 3.74(s, 6H), 3.43~3.53(m, 3H), 3.38(br d, J=6.75Hz, 1H), 2.94~3.04(m, 1H), 2.70~2.85(m, 1H), 1.09~1.15(m, 12H), 1.07(br s, 3H).

[0270] Other phosphoramidites can be prepared according to the procedures described herein and / or prior art such as, but not limited to, US Pat. No. 4,262,220 and WO 02 / 36743.

[0271] Example 4 Preparation of a solid support containing phosphoramidite monomers of the present invention [ka] [ka] represents the amine methyl polyethylene macroporous resin carrier moiety.

[0272] Under nitrogen protection, dichloromethane (19.50 kg) was added to a 50 L glass kettle and stirring was initiated. The temperature was controlled at 20-30 °C, and DMTr(2H) ...)))))))))))). The system was maintained at 20-30 °C for 18 hours, and a sample was taken to terminate the reaction. Saturated sodium bicarbonate solution (22.50 kg) was added to the reaction system, and the mixture was stirred for 10-20 minutes, allowing the layers to separate. The organic phase was separated, and the aqueous phase was extracted twice with dichloromethane. The combined organic phases were dried over anhydrous sodium sulfate, filtered, and concentrated under vacuum to yield a residue that formed a gray to off-white solid (1.83 kg).

[0273] N,N-Dimethylformamide (23.50 kg) was added to a 100 L glass kettle and stirred. The temperature was controlled at 20-30°C. Under nitrogen protection, the products of the previous step, O-benzotriazole tetramethylurea hexafluorophosphate (0.33 kg) and N,N-diisopropylethylamine (0.13 kg), were added to the 100 L glass kettle through a solids feed funnel, stirred for 10-30 minutes, and then discharged into a 50 L zinc barrel for use. Macroporous amine methyl resin (3.25 kg) (purchased from Tianjin Nankai Hecheng Science and Technology Co., Ltd., batch number HA2X1209, loading capacity 0.48 mmol / g) was added to the aforementioned 100 L solid-phase synthesis reactor through a solid feed funnel. The temperature was controlled at 20-30 °C, and N,N-dimethylformamide (21.00 kg + 21.00 kg) and the reaction solution in the zinc barrel from the previous step were added to the solid-phase synthesis reactor. The system was subjected to an adiabatic reaction, and the solid loading was monitored until it reached ≥ 250 µmol / g. The loading detection method was UV. The system was filtered under nitrogen pressure, and the filter cake was washed three times with N,N-dimethylformamide (26.00 kg + 26.10 kg + 26.00 kg). The filter cake was left in the kettle. CAP.A (4.40 kg + 4.42 kg + 4.30 kg) and CAP.B (4.40 kg + 4.40 kg + 4.47 kg) were added to an 80 L glass kettle and stirred for 3-8 minutes before use. This procedure was repeated three times, then the kettle was capped and acetonitrile (18.00 kg + 18.00 kg + 18.00 kg + 17.50 kg + 17.50 kg) was added to the solid-phase synthesis kettle. Nitrogen was sparged for 10-30 minutes, followed by filter pressing. This procedure was repeated four times, and the filter cake was purged with nitrogen in the solid-phase synthesis kettle for 2-4 hours before being transferred to a 50 L filter press tank. The temperature was controlled at 15-30 °C, and drying was continued. After drying, a yellow to white solid product weighing 3.516 kg was obtained.

[0274] Example 5 Synthesis of HSD17B13 RNAi Agent The HSD17B13 RNAi agent duplexes shown in Tables 2-3 above were synthesized according to the following general procedure.

[0275] The sequences of the sense and antisense strands of siRNA were synthesized on an oligonucleotide synthesizer using an established solid-phase synthesis method based on phosphoramidite chemistry. Oligonucleotide chain propagation is achieved through a four-step cycle of deprotection, condensation, capping, and an oxidation or sulfurization step for each nucleotide addition. Synthesis was performed on a solid support made of controlled pore glass (CPG, 1000 Å). Monomeric phosphoramidites may be commercially purchased or may be the phosphoramidite compounds described in Example 3 and WO 2016 / 028649. The phosphoramidite compounds herein may be attached to the 3' end as monomeric phosphoramidites and further attached to the CPG solid support. When attached to the 5' end, the phosphoramidite compound may be used in a final coupling reaction and, if desired, can be further conjugated to a target ligand.

[0276] Phosphoramidites bearing GalNAc ligand clusters (non-limiting examples: GLPA1, GLPA2, and GLPA15) were synthesized according to the procedures in Examples 1-2 herein. For siRNAs used in in vitro screening (Table 2), synthesis was performed at a 2 μmol scale, and for siRNAs used in in vivo testing (Table 3), synthesis was performed at a 5 μmol or larger scale. When a GalNAc ligand (non-limiting example: GLO-0) was attached to the 3' end of the sense strand, a CPG solid support with a GalNAc ligand attached was used. When a GalNAc ligand (non-limiting example: GLS-5 or GLS-15) was attached to the 5' end of the sense strand, a GalNAc phosphoramidite (non-limiting example: GLPA1, GLPA2, or GLPA15) was used in the final coupling reaction.

[0277] The sense and antisense strands were synthesized by solid-phase synthesis in a four-step cycle, as detailed below. The 4,4'-dimethoxytrityl protecting group (DMT) was deprotected using 3% trichloroacetic acid (TCA) in dichloromethane or 10% dichloroacetic acid (DCA) in toluene. 5-Ethylthio-1H-tetrazole was used as the activator in the coupling step. Capping was performed with CapA (acetic anhydride in acetonitrile) / CapB (pyridine / NMI / acetonitrile) (v / v, 1:1). I2 in Py / HO and phenylacetyl disulfide (PADS) in pyridine / MeCN or xanthan gum hydride (DDTT) in pyridine were used for the oxidation and sulfurization reactions, respectively.

[0278] After the final solid-phase synthesis step, the solid-support-bound oligomer was cleaved and the protecting groups removed by treatment with a 1:1 volume solution of 40% methylamine (by weight) and 28% ammonium hydroxide in water. Solid-support-bound oligomers containing monomeric phosphomimetic moieties were optionally treated with MeCN:TMSI:pyridine (50:2:2, v / v / v) prior to C&D (cleavage and protection). For the synthesis of siRNAs used in in vitro screening, the crude mixture was concentrated. The remaining solid was dissolved in 1.0 M NaOAc and ice-cold EtOH was added to precipitate the single-stranded product as the sodium salt, which was used for annealing without further purification. For the synthesis of multitarget molecules used in in vivo testing, the crude single-stranded product was further purified by ion-pair reverse-phase HPLC (IP-RP-HPLC). The purified single-stranded oligonucleotide product from IP-RP-HPLC was converted to the sodium salt by dissolving in 1.0 M NaOAc and precipitating with ice-cold EtOH. Equimolar amounts of complementary sense and antisense oligonucleotides were annealed in water to form double-stranded siRNA products, which were lyophilized to yield soft white solids.

[0279] Example 6 In vitro screening of HSD17B13 siRNA duplexes Huh7 cells were trypsinized to the appropriate density and seeded into 96-well plates. Simultaneously with seeding, cells were transfected with test or control siRNA using Lipofectamine RNAiMax (Invitrogen-13778-150) according to the manufacturer's recommended protocol. siRNAs were tested in triplicate at different concentrations (5 nM, 1 nM, 0.05 nM, 0.005 nM).

[0280] Day 0, psiCHECK™-2 vector transfection (1 plate) (1) Transfer 2.5 μg of psiCHECK™-2 vector plasmid to an RNASE-free Eppendorf tube (Solution Mix #1). (2) Add trypsin to detach Huh7 cells in one flask, count the cell number using a Vi-Cell counter, and adjust the cell density to 1 x 10^5 / mL.

[0281] (3) Transfer 7.5 μL of Fugene-HD to the Solution Mix #1 tube and mix.

[0282] (4) Add the solution from step 3 to the cell suspension, mix, and dispense the suspension into a 96-well plate (100 μL / well).

[0283] Day 1, siRNA transfection (1) Dilute Lipofectamine® RNAiMAX Reagent with Opti-MEM® medium.

[0284] (2) Dilute siRNA with RNA-free water to make a 12x stock.

[0285] (3) Mix equal amounts of diluted RNAiMax and siRNA, and incubate the mixture at room temperature for 15 minutes to allow complex formation.

[0286] (4) Add 45 μL / well of the compound Lipofectamine® RNAiMAX (Opti-MEM) mixture to 225 μL / well of DMEM fresh medium, discard the supernatant from the assay plate, and add 120 μL / well of the mixed compound to the 96-well plate.

[0287] (5) No-compound control wells were defined as cells transfected with the psiCHECK™-2 vector and without siRNA treatment, and blank controls were wells with cells only.

[0288] Day 2, Dual-Glo® Luciferase Assay (1) Add the reagent to the assay plate and wait 10 minutes for cell lysis to occur.

[0289] (2) Transfer 100 μL of the cell lysate to a plate and measure firefly luminescence.

[0290] (3) Add 50 μL of Dual-Glo® Stop&Glo® Reagent to the assay plate, mix, wait 10 minutes, and then measure Renilla luminescence.

[0291] (4) Calculate the relative expression Data analysis Ratio of sample well = (sample Renilla luminescence - background blank) / (sample firefly luminescence - background blank) Ratio of compound-free control wells = (control Renilla luminescence - background blank) / (control sample firefly luminescence - background blank) Inhibition rate (%) = 100 - (ratio of sample wells / average ratio of compound-free control) x 100% [Table 6-1] [Table 6-2] [Table 6-3] [Table 6-4]

[0292] [Table 7]

[0293] [Table 8-1] [Table 8-2] [Table 8-3]

[0294] [Table 9-1] [Table 9-2] [Table 9-3]

[0295] [Table 10]

[0296] [Table 11]

[0297] Example 7 In vivo testing of HSD17B13 siRNA duplexes On day 1, female C57BL / 6J mice (4 per group) were infected intravenously with an adeno-associated virus 8 (AAV8) vector encoding human HSD17B13 and luciferase genes. On day 8, mice received a single subcutaneous injection of 4 mg / kg HSD17B13 siRNA or PBS. Blood samples were collected on days 8, 15, and 22 before siRNA administration, and serum samples were isolated and their luciferase activity was measured according to the manufacturer's recommended protocol. Because the expression level of human HSD17B13 correlates with the expression level of luciferase, the percentage of remaining HSD17B13 was calculated by comparing the luciferase activity in siRNA-treated samples before and after treatment and normalizing it by the change in luciferase activity in control-treated samples over the same period.

[0298] [Table 12]

[0299] [Table 13]

[0300] [Table 14]

[0301] [Table 15]

[0302] [Table 16]

[0303] Equivalents While several embodiments of the present invention have been described and illustrated herein, those skilled in the art will readily envision numerous other means and / or structures for performing the functions and / or obtaining one or more of the results and / or advantages described herein, and each such variation and / or modification is deemed to be within the scope of the present invention. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are intended to be exemplary, and that the actual parameters, dimensions, materials, and / or configurations will depend on the specific application or applications for which the teachings of the present invention are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, numerous equivalents to the specific embodiments of the present invention described herein. Accordingly, the foregoing embodiments are presented by way of example only, and it should be understood that, within the scope of the appended claims and their equivalents, the invention may be practiced otherwise than as specifically described and claimed. The present invention relates to each individual feature, system, article, material, and / or method described herein. Furthermore, any combination of two or more such features, systems, articles, materials, and / or methods is within the scope of the present invention, unless such features, systems, articles, materials, and / or methods are mutually inconsistent.

[0304] All definitions and definitions used herein should be understood to take precedence over dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms.

[0305] The indefinite articles "a" and "an," as used in the specification and claims, unless expressly stated to the contrary, should be understood to mean "at least one."

[0306] As used herein, the term "or" means "and / or" and is used interchangeably with the latter unless the context clearly excludes it. The phrase "and / or" as used in the specification and claims should be understood to mean "either or both" of the elements so conjoined, i.e., elements that are sometimes conjunctive and other times disjunctive. When there are more than one element and they are separated by a comma, the comma before "and / or" has the same meaning as "and / or" and denotes "and" or "or," respectively. Unless expressly stated to the contrary, other elements may optionally be present other than the elements specifically identified by the term "and / or," whether or not they are related to those specifically identified elements.

[0307] All references, patents, patent applications, and publications cited or referred to in this application are incorporated herein by reference in their entirety.

Claims

1. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13), the dsRNA agent comprising a sense strand and an antisense strand, the sense strand comprising at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO:1, and the antisense strand comprising at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO:

2. dsRNA agents.

2. the sense strand comprises at least 15 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from any one of nucleotides 45-85, 49-85, 576-606, 651-681, 659-689, 666-696, 760-790, 769-799, 772-802, 817-847, 841-871, 876-906, 959-989, 1000-1030, or 1508-1538 of the nucleotide sequence of SEQ ID NO:1; The dsRNA agent of claim 1.

3. the dsRNA agent comprises a sense strand and an antisense strand that form a double-stranded region at least 15, 16, 17 nucleotides in length, wherein the sense strand comprises at least 15, 16, 17, 18, 19, or 20 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from any one of nucleotides 45-65, 46-66, 47-67, 48-68, 49-69, 50-70, 51-71, 52-72, 53-73, 54-74, 55-75, 56-76, 57-77, 58-78, 59-79, 60-80, 61-81, 62-82, 63-83, 64-84, or 65-85 of the nucleotide sequence of SEQ ID NO:1; and the antisense strand comprises at least 15 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from the corresponding nucleotide sequence of SEQ ID NO:

2. The dsRNA agent of claim 1.

4. The antisense strand of the dsRNA has the nucleotide sequence SI:5'-z １ AGAAGCAGAAGGAUUUz ２ -3', z １ and z ２ each independently represent a nucleotide sequence of 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length, wherein said nucleotide sequence SI is substantially or completely complementary to a portion of an HSD17B13 mRNA transcript; The dsRNA agent of claim 1.

5. The dsRNA has the nucleotide sequence SII:5'-z ３ AAAUCCUUCUGCUUCUz ４ -3', and z ３ and z ４ each independently represent a nucleotide sequence of 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length, wherein said nucleotide sequence SI is substantially or completely complementary to said nucleotide sequence SII; The dsRNA agent of claim 4.

6. The antisense strand of the dsRNA has the nucleotide sequence SIII:5'-z ５ GUGAUCAGAAGCAGAAz ６ -3', z ５ and z ６ each independently represent a nucleotide sequence of 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length, wherein the nucleotide sequence SIII is substantially or completely complementary to a portion of an HSD17B13 mRNA transcript; The dsRNA agent of claim 1.

7. The dsRNA has the nucleotide sequence SIV:5'-z ７ UUCUGCUUCUGAUCACz ８ -3', and z ７ and z ８ each independently represent a nucleotide sequence of 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length, wherein said nucleotide sequence SIII is substantially or completely complementary to said nucleotide sequence SIV; The dsRNA agent of claim 6.

8. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13), the dsRNA agent comprising a sense strand and an antisense strand, wherein nucleotide positions 2-18 of the antisense strand comprise a region of complementarity to an HSD17B13 RNA transcript, the region of complementarity comprising at least 15 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from one of the antisense sequences listed in one of Tables 1-3, and optionally comprising a targeting ligand. dsRNA agents.

9. the region of complementarity to the HSD17B13 RNA transcript comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ by no more than 3 nucleotides from one of the antisense sequences listed in one of Tables 1-3; 9. The dsRNA agent of claim 8.

10. The antisense strand of the dsRNA is at least substantially complementary or fully complementary to any one of the target regions of SEQ ID NO: 1, and preferably the dsRNA agent comprises an antisense strand sequence set forth in any one of Tables 1-3. The dsRNA agent of any one of claims 1 to 9.

11. The sense strand sequence is at least substantially complementary, or perfectly complementary, to the antisense strand sequence in the dsRNA agent, preferably the dsRNA agent comprises a sense strand sequence set forth in any one of Tables 1-3. The dsRNA agent of any one of claims 1 to 10.

12. the dsRNA agent comprises a sequence set forth as a duplex sequence in any of Tables 1-3. The dsRNA agent of claim 1.

13. the dsRNA agent comprises at least one modified nucleotide. The dsRNA according to any one of claims 1 to 12.

14. all or substantially all of the nucleotides of the sense strand and / or the antisense strand are modified nucleotides; The dsRNA agent of any one of claims 1 to 13.

15. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13), the dsRNA agent comprising a sense strand and an antisense strand, the sense strand being complementary to the antisense strand, and the antisense strand comprising a region complementary to a portion of an mRNA encoding HSD17B13, each strand being about 14 to about 30 nucleotides in length, and the sense strand sequence may be represented by formula (I): 【Chemistry 1】 During the ceremony, Each N' Ｆ represents a 2'-fluoro modified nucleotide, Each N' Ｎ１ , N' Ｎ２ , N' Ｎ３ , N' Ｎ４ , N' Ｎ５ , and N' Ｎ６ independently represent a modified or unmodified nucleotide, N' Ｎ１ N' Ｎ２ N' Ｎ３ and N' Ｎ４ N' Ｎ５ N' Ｎ６ each independently represents a motif comprising at least two different modified nucleotides; Each N' Ｌ independently represent a modified or unmodified nucleotide, but does not represent a 2'-fluoro modified nucleotide; m' and n' are each independently an integer from 0 to 7; dsRNA agents.

16. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13), the dsRNA agent comprising a sense strand and an antisense strand, the sense strand being complementary to the antisense strand, the antisense strand comprising a region complementary to a portion of an mRNA encoding HSD17B13, each strand being about 14 to about 30 nucleotides in length, and the antisense strand sequence being represented by formula (II): 【Chemistry 2】 During the ceremony, Each N Ｆ represents a 2'-fluoro modified nucleotide, Each N Ｍ１ , N Ｍ２ , N Ｍ３ , N Ｍ４ , N Ｍ５ , N Ｍ６ , N Ｍ７ , and N Ｍ８ independently represent a modified or unmodified nucleotide, preferably N Ｍ２ , N Ｍ３ , and N Ｍ６ each independently represent a 2'-fluoro modified nucleotide; Each N Ｌ independently represent a modified or unmodified nucleotide, but do not represent a 2'-fluoro modified nucleotide; n is an integer from 0 to 7; dsRNA agents.

17. The antisense strand sequence is further represented by formula (II'): 【Transformation 3】 During the ceremony, N Ｚ is a vinylphosphonate modified nucleotide, preferably N Ｚ is the structure 【Chemistry 4】 VPu* having 17. The dsRNA agent of claim 16.

18. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13), the dsRNA agent comprising a sense strand and an antisense strand, the sense strand and the antisense strand forming a dsRNA duplex, the sense strand being complementary to the antisense strand, the antisense strand comprising a region of complementarity to an mRNA encoding HSD17B13, the region of complementarity comprising at least 15 contiguous nucleotides, the dsRNA duplex being represented by formula (III): 【Transformation 5】 During the ceremony, each strand is about 17 to about 30 nucleotides in length; Each N Ｆ and N' Ｆ independently represents a 2'-fluoro modified nucleotide; N Ｍ１ , N Ｍ２ , N Ｍ３ , N Ｍ４ , N Ｍ５ , N Ｍ６ , N Ｍ７ , N Ｍ８ , N' Ｎ１ , N' Ｎ２ , N' Ｎ３ , N' Ｎ４ , N' Ｎ５ , and N' Ｎ６ each independently represent a modified or unmodified nucleotide, Each N Ｌ and N' Ｌ independently represent a modified or unmodified nucleotide, but do not represent a 2'-fluoro modified nucleotide; m', n', and n are each independently an integer from 0 to 7; dsRNA agents.

19. The dsRNA duplex may further be represented by formula (III'): 【Transformation 6】 During the ceremony, N Ｚ is a vinylphosphonate modified nucleotide, preferably N Ｚ is the structure 【Transformation 7】 VPu* having 19. The dsRNA agent of claim 18.

20. the one or more modified nucleotides are independently selected from the group consisting of 2'-O-methyl nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2'3'-seconucleotide mimics, locked nucleotides, unlocked nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides, isomannide nucleotides, inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, nucleotides comprising a 5'-phosphorothioate group, 5'-phosphonate modified nucleotides, terminal nucleotides attached to a cholesteryl derivative or a dodecanoic acid bisdecylamide group, 2'-amino modified nucleotides, phosphoramidates, or unnatural base containing nucleotides; The dsRNA agent of any one of claims 1 to 19.

21. containing an E-vinyl phosphonate nucleotide at the 5' end of the guide strand; The dsRNA agent of any one of claims 1 to 20.

22. the dsRNA agent includes at least one phosphorothioate internucleoside linkage. The dsRNA agent of any one of claims 1 to 21.

23. The sense strand contains at least one phosphorothioate internucleoside bond, and preferably, the at least one phosphorothioate (PS) bond is introduced at the 5'-end, 3'-end, or both ends of the sense strand. The dsRNA agent of any one of claims 1 to 22.

24. The antisense strand contains at least one phosphorothioate internucleoside bond, and preferably, the at least one phosphorothioate (PS) bond is introduced at the 5'-end, 3'-end, or both ends of the antisense strand. The dsRNA agent of any one of claims 1 to 22.

25. The sense strand contains 1, 2, 3, 4, 5, or 6 phosphorothioate internucleoside linkages, and preferably, the 1, 2, 3, 4, 5, or 6 phosphorothioate (PS) linkages are introduced at the 5'-end, 3'-end, or both ends of the sense strand. The dsRNA agent of any one of claims 1 to 22.

26. The antisense strand contains 1, 2, 3, 4, 5, or 6 phosphorothioate internucleoside linkages, and preferably 1, 2, 3, 4, 5, or 6 phosphorothioate (PS) linkages are introduced at the 5'-end, 3'-end, or both ends of the antisense strand. The dsRNA agent of any one of claims 1 to 22.

27. The modified sense strand is modified in the pattern shown in formula (I) of claim 15. The dsRNA agent of any one of claims 1 to 26.

28. The modified antisense strand is modified in the pattern shown in formula (II) of claim 16 or formula (II') of claim 17. The dsRNA agent of any one of claims 1 to 26.

29. The modified sense strand is a modified sense strand sequence set forth in one of Tables 2-3. The dsRNA agent of any one of claims 1 to 26.

30. The modified antisense strand is a modified antisense strand sequence set forth in one of Tables 2-3. The dsRNA agent of any one of claims 1 to 26.

31. the sense strand is complementary or substantially complementary to the antisense strand, and the region of complementarity is between 16 and 23 nucleotides in length; The dsRNA agent of any one of claims 1 to 30.

32. the complementary region is 19 to 21 nucleotides in length; The dsRNA agent of any one of claims 1 to 30.

33. Each strand is 30 nucleotides or less in length; The dsRNA agent of any one of claims 1 to 32.

34. Each strand is no longer than 25 nucleotides in length. The dsRNA agent of any one of claims 1 to 32.

35. Each strand is no longer than 23 nucleotides. The dsRNA agent of any one of claims 1 to 32.

36. the dsRNA agent comprises at least one modified nucleotide and further comprises one or more targeting or linking groups. The dsRNA agent of any one of claims 1 to 35.

37. the one or more targeting or linking groups are conjugated to the sense strand; 37. The dsRNA agent of claim 36.

38. the targeting group or linking group comprises N-acetylgalactosamine (GalNAc); 38. The dsRNA agent of claim 36 or 37.

39. The targeting group has the structure: Table 1-1 Table 1-2 Table 1-3 Table 1-4 39. The dsRNA agent of claim 37 or 38.

40. the dsRNA agent comprises a targeting group conjugated to the 5' end of the sense strand.

40. The dsRNA agent of any one of claims 1 to 39.

41. the dsRNA agent comprises a targeting group conjugated to the 3' end of the sense strand.

40. The dsRNA agent of any one of claims 1 to 39.

42. the antisense strand comprises one inverted abasic residue at the 3' end; 40. The dsRNA agent of any one of claims 1 to 39.

43. the sense strand contains one or two inverted abasic or iman residues at the 3'-end or / and 5'-end; 40. The dsRNA agent of any one of claims 1 to 39.

44. the dsRNA agent has two blunt ends.

44. The dsRNA agent of any one of claims 1 to 43.

45. At least one strand comprises a 3' overhang of at least one nucleotide; 44. The dsRNA agent of any one of claims 1 to 43.

46. At least one strand comprises a 3' overhang of at least two nucleotides; 44. The dsRNA agent of any one of claims 1 to 43.

47. 47. A composition comprising the dsRNA agent of any one of claims 1-46.

48. further comprising a pharmaceutically acceptable carrier, 48. The composition of claim 47.

49. further comprising one or more additional therapeutic agents, 49. The composition of claim 48.

50. The composition is packaged in a kit, container, pack, dispenser, pre-filled syringe, or vial.

50. The composition of claim 49.

51. The composition is formulated for subcutaneous administration or formulated for intravenous (IV) administration. The composition according to any one of claims 47 to 50.

52. 47. A cell comprising the dsRNA agent of any one of claims 1-46, optionally wherein the cell is a mammalian cell, optionally a human cell. cell.

53. 1. A method for inhibiting expression of the HSD17B13 gene in a cell, comprising: (i) preparing a cell comprising an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1 to 46 or a composition according to any one of claims 37 to 51; method.

54. (ii) further comprising inhibiting expression of the HSD17B13 gene in the cells prepared in claim 53(i) by maintaining the cells for a time sufficient to obtain degradation of the mRNA transcript of the HSD17B13 gene; 54. The method of claim 53.

55. the cell is present in a subject and the dsRNA agent is administered subcutaneously to the subject.

54. The method of claim 53.

56. the cell is present in a subject and the dsRNA agent is administered to the subject by IV administration.

54. The method of claim 53.

57. further comprising assessing inhibition of the HSD17B13 gene after administering the dsRNA agent to the subject, wherein said assessing means comprises: (i) determining one or more physiological characteristics of an HSD17B13-associated disease or condition in said subject; (ii) comparing the determined physiological characteristic with a baseline pre-treatment physiological characteristic for the HSD17B13-related disease or condition, and / or with a control physiological characteristic for the HSD17B13-related disease or condition; The comparison indicates one or more of the presence or absence of inhibition of expression of the HSD17B13 gene in the subject.

57. The method of claim 55 or 56.

58. The physiological characteristic determined is one or more of HSD17B13 mRNA level, HSD17B13 protein level, or HSD17B13 enzymatic activity, or lipid level, triglyceride level, cholesterol level, free fatty acid level in plasma or tissue sample, or lipid level and / or lipid droplet level in liver in the subject.

58. The method of claim 57.

59. a decrease in one or more of the subject's HSD17B13 mRNA level, HSD17B13 protein level, or enzymatic activity of HSD17B13 in the subject, and / or a decrease in one or more of lipids, triglycerides, cholesterol (including LDL-C, HDL-C, VLDL-C, IDL-C, and total cholesterol), or free fatty acids in plasma or tissue samples, and / or a decrease in fat accumulation and / or lipid droplet expansion in the liver, indicates a decrease in HSD17B13 gene expression in the subject.

59. The method of claim 58.

60. 52. A method for inhibiting expression of the HSD17B13 gene in a subject, comprising administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1 to 46 or a composition according to any one of claims 47 to 51. method.

61. the dsRNA agent is administered subcutaneously to the subject.

61. The method of claim 60.

62. the dsRNA agent is administered to the subject by IV administration; 61. The method of claim 60.

63. further comprising assessing inhibition of the HSD17B13 gene after administration of the dsRNA agent, wherein said assessing means comprises: (i) determining one or more physiological characteristics of an HSD17B13-associated disease or condition in said subject; (ii) comparing the determined physiological characteristic with a baseline pre-treatment physiological characteristic for the HSD17B13-related disease or condition, and / or with a control physiological characteristic for the HSD17B13-related disease or condition; The comparison indicates one or more of the presence or absence of inhibition of expression of the HSD17B13 gene in the subject.

63. The method of any one of claims 60 to 62.

64. The physiological characteristic determined is one or more of HSD17B13 mRNA level, HSD17B13 protein level, or HSD17B13 enzymatic activity, or lipid level, triglyceride level, cholesterol level, free fatty acid level in plasma or tissue sample, or lipid level and / or lipid droplet level in liver in the subject.

64. The method of claim 63.

65. a decrease in one or more of the subject's HSD17B13 mRNA level, HSD17B13 protein level, or enzymatic activity of HSD17B13 in the subject, and / or a decrease in one or more of lipids, triglycerides, cholesterol (including LDL-C, HDL-C, VLDL-C, IDL-C, and total cholesterol), or free fatty acids in plasma or tissue samples, and / or a decrease in fat accumulation and / or lipid droplet expansion in the liver, indicates a decrease in HSD17B13 gene expression in the subject.

55. The method of claim 54.

66. A method for treating a disease or condition associated with the presence of HSD17B13 protein, comprising administering to a subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1 to 46, or a composition according to any one of claims 47 to 51, to inhibit expression of the HSD17B13 gene. method.

67. the disease or condition is one or more of hepatitis, liver fibrosis, non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), cirrhosis, alcoholic steatohepatitis (ASH), alcoholic fatty liver disease (ALD), HCV-associated cirrhosis, drug-induced liver injury, hepatocellular necrosis, and HSD17B13-associated obesity; 67. The method of claim 66.

68. further comprising administering an additional therapeutic regimen to said subject.

67. The method of claim 66.

69. The additional treatment regimen comprises administering to the subject one or more HSD17B13 antisense polynucleotides of the present invention, administering to the subject a non-HSD17B13 dsRNA therapeutic agent, and behavior modification in the subject.

69. The method of claim 68.

70. The non-HSD17B13 dsRNA therapeutic agent is one of pyridoxine, ACE inhibitors (angiotensin converting enzyme inhibitors), e.g., benazepril (Lotensin), angiotensin II receptor blockers (ARBs) (e.g., losartan potassium, such as Cozaar® from Merck & Co.), e.g., candesartan (Atacand), HMG-CoA reductase inhibitors (e.g., statins), calcium binders, e.g., sodium cellulose phosphate (Calcibind), diuretics, e.g., thiazide diuretics, such as hydrochlorothiazide (Microzide), insulin sensitizers, such as the PPARγ agonist pioglitazone, glp-1r agonists, such as liraglutatide, vitamin E, SGLT2 inhibitors, DPPIV inhibitors, and kidney / liver transplantation, or any combination of the foregoing.

70. The method of claim 69.

71. the dsRNA agent is administered subcutaneously to the subject.

71. The method of any one of claims 66 to 70.

72. the dsRNA agent is administered to the subject by IV administration; 71. The method of any one of claims 66 to 70.

73. further comprising determining the efficacy of the administered double-stranded ribonucleic acid (dsRNA) agent in the subject.

71. The method of any one of claims 66 to 70.

74. The means for determining the effectiveness of the treatment in the subject comprises: (i) determining one or more physiological characteristics of said HSD17B13-associated disease or condition in said subject; (ii) comparing the determined physiological characteristic with a baseline pre-treatment physiological characteristic for the HSD17B13-associated disease or condition; The comparison indicates one or more of the presence or absence of administration of the double-stranded ribonucleic acid (dsRNA) agent to the subject and the level of efficacy.

74. The method of claim 73.

75. The physiological characteristic determined is HSD17B13 mRNA level, HSD17B13 protein level, or HSD17B13 enzyme activity in the subject, or lipid level, triglyceride level, cholesterol level, free fatty acid level in plasma or tissue sample, or fat level and / or lipid droplet level in liver; 75. The method of claim 74.

76. a decrease in one or more of HSD17B13 mRNA level, HSD17B13 protein level, or HSD17B13 enzymatic activity in the subject, and / or a decrease in one or more of lipids, triglycerides, cholesterol (including LDL-C, HDL-C, VLDL-C, IDL-C, and total cholesterol), or free fatty acids in the plasma or tissue sample, and / or a decrease in fat accumulation and / or lipid droplet expansion in the liver, indicates the presence of efficacy of administering the double-stranded ribonucleic acid (dsRNA) agent to the subject.

76. The method of claim 75.

77. 52. A method of reducing the level of HSD17B13 protein in a subject compared to the subject's baseline pre-treatment level of HSD17B13 protein, comprising administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1 to 46, or a composition according to any one of claims 47 to 51, to reduce the level of HSD17B13 gene expression. method.

78. the dsRNA agent is administered subcutaneously to the subject or administered IV to the subject; 78. The method of claim 77.

79. 52. A method for altering the physiological characteristics of a HSD17B13-related disease or condition in a subject compared to the subject's baseline pre-treatment physiological characteristics of the HSD17B13-related disease or condition, comprising administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1 to 46, or a composition according to any one of claims 47 to 51, to alter the physiological characteristics of the HSD17B13-related disease or condition in the subject. method.

80. the dsRNA agent is administered subcutaneously to the subject or administered IV to the subject; 80. The method of claim 79.

81. The physiological characteristic is one or more of HSD17B13 mRNA level, HSD17B13 protein level, or HSD17B13 enzyme activity, or lipid level, triglyceride level, cholesterol level, free fatty acid level, or fat level and / or lipid droplet level in the liver in a plasma or tissue sample in the subject; 80. The method of claim 79.

Images