Antibiotic resistance gene-free miniplasmid, its preparation method, and application

Abstract

The present application provides an antibiotic resistance gene-free miniplasmid containing a nucleotide sequence encoding an antitoxin protein and a replicon. The antibiotic resistance gene-free miniplasmid of the present application has a relatively small backbone, controlled to within 1000 bp, reducing redundant and unnecessary fragments and not containing an antibiotic resistance gene expression cassette, thereby improving the utilization of target sequences in the plasmid and reducing production burden. It has higher efficiency and safety in genetic engineering applications such as plasmid DNA-mediated non-viral vector delivery, gene therapy, vaccination, virus production, and antibody production. The present application also provides a system for producing a plasmid based on a toxin-antitoxin system, in which the bacterial host cell contains a gene expression cassette capable of inducing the expression of a toxin protein, and the antibiotic resistance gene-free miniplasmid contains a gene expression cassette expressing an antitoxin protein to efficiently maintain replication and amplification of the antibiotic resistance gene-free miniplasmid.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority from Chinese Patent Application No. 2023100729561, filed January 13, 2023. This application incorporates all of the above-mentioned Chinese patent applications by reference.

[0002] The present application belongs to the technical field of biotechnology, and relates to an antibiotic resistance gene-free miniplasmid and its applications, and further to a system for efficiently producing an antibiotic resistance gene-free miniplasmid and a genetically engineered strain thereof. [Background technology]

[0003] Gene therapy has been attracting increasing attention, with thousands of clinical trials already approved worldwide. Meanwhile, the field of intracellular or intracellular "non-viral" gene therapy based on plasmid DNA is steadily developing, which has led to an increasing demand for and variety of plasmids.

[0004] A major concern is the antibiotic safety of plasmids. In plasmid production, when a plasmid is passed to progeny bacteria or cells, the bacterial system can ensure stable replicative production only if all progeny cells contain at least one copy of the plasmid. However, plasmids actually impose an additional metabolic burden on the production strain, strongly affecting its growth rate, while plasmid-free cells have a growth advantage and can overgrow the entire population. To solve this problem, plasmid DNA production requires applying selective pressure favoring bacteria containing the desired plasmid after bacterial transformation and during the amplification process. Genes conferring antibiotic resistance are typically used as plasmid selection markers, and bacteria must be cultured in antibiotic-containing media. However, using antibiotic resistance genes as selection markers in plasmid production poses safety issues frequently cited by regulatory authorities. For example, horizontal gene transfer to patient bacteria cannot be ruled out, and residual antibiotics in the final product may cause allergic reactions in sensitive individuals. In light of this, next-generation plasmid backbones without antibiotic resistance markers have emerged to improve the safety of non-viral gene therapy trials. The second concern is that the size of the plasmid and the bacterial-derived DNA fragments affect the function of the plasmid. For example, a smaller plasmid allows it to enter the cell nucleus more easily, thereby improving the integration efficiency of the plasmid DNA. A smaller plasmid contains fewer bacterial-derived CpG DNA motifs, which reduces immunogenicity, which is advantageous for recombinant gene expression.

[0005] Existing antibiotic resistance gene-free plasmid maintenance strategies mainly involve complementation of auxotrophic strains, toxin-antitoxin systems, operon-repressor control, RNA control, etc. They also involve enzymatic cleavage of the antibiotic resistance gene and replicon DNA sequence in the mother vector by recombinase to form antibiotic resistance gene-free microloop or microlinear plasmids.

[0006] The toxin-antitoxin (TA) system was first discovered in 1983 on a low-copy plasmid, and was once considered a plasmid-dependent system due to its importance for the stability and propagation of plasmids in the population. TA systems are widely present in the chromosomes and plasmids of prokaryotes and archaea. This system consists of two co-expressed genes, encoding a stable toxin protein and a cleavable protein, respectively. They encode easily digestible antitoxins. Toxins generally exert toxic effects by inhibiting bacterial growth, while antitoxins can neutralize the toxicity. Isolating some TA systems and converting them into killing systems has become a method of selecting plasmids instead of antibiotics. The principle is the post-separation lethal effect (PSK) of the TA system toxin and antitoxin. After the plasmid is lost in progeny cells, the antitoxin molecule, which has a relatively short half-life, rapidly degrades, releasing the free toxin protein and exerting molecular toxicity, ultimately resulting in the death of the progeny cells that have lost the plasmid, thereby ensuring the stability of the plasmid in the population.

[0007] For example, the E. coli CcdB protein from Escherichia coli is an inhibitor of gyrase, which is necessary for growth, and is toxic to Enterobacteriaceae but not to eukaryotic cells, and the E. coli ccdA gene encodes an antidote that interacts with the toxin. Once the ccdB toxin gene is integrated into the bacterial chromosome, the ccdA gene is inserted into the expression plasmid. If the plasmid is missing or defective, a toxin is produced, inducing cell death. Separating the two components ensures effective killing of plasmid-free cells and increases the production of plasmid-containing bacteria and plasmids. Figure 1 shows the operating principle of the antibiotic resistance gene-free mini-plasmid screening system.

[0008] Many types of bacterial toxin-antitoxin systems have been reported in nature, including CcdB (CcdA antitoxin), Kis (Kid antitoxin), Phd (Doc antitoxin), RelB (RelE antitoxin), PasB (or PasC) (PasA antitoxin), and MazF (MazE antitoxin), and the various toxins and antitoxins vary among different bacterial species. Due to differences in the lethality of toxins from different species, the size of antidote genes, and toxin neutralization efficiency, those skilled in the art are well aware that not all types of toxin and antitoxin systems are applicable to antibiotic resistance gene-free plasmid production systems. Summary of the Invention [Problem to be solved by the invention]

[0009] To solve the above technical problems, the present application provides an antibiotic resistance gene-free miniplasmid, a system for producing the antibiotic resistance gene-free miniplasmid using a toxin-antitoxin system, and applications of the antibiotic resistance gene-free miniplasmid. The antibiotic resistance gene-free miniplasmid of the present application avoids the use of antibiotic resistance genes and is capable of stable replication and efficient production. The antibiotic resistance gene-free miniplasmid has a relatively small plasmid backbone and can be used in genetic engineering applications such as non-viral vector delivery, gene therapy, DNA vaccination, virus production, and antibody production. The antibiotic resistance gene-free miniplasmid of the present application is also known as a "tini plasmid." [Means for solving the problem]

[0010] A first aspect of the present application provides an antibiotic resistance gene-free miniplasmid comprising a replicon and a nucleotide sequence encoding an antitoxin protein, wherein the antitoxin protein has the amino acid sequence (1) set forth in SEQ ID NO: 1 or an amino acid sequence having one or more mutations of E24D, I36V, and V43I compared to SEQ ID NO: 1, or (2) set forth in SEQ ID NO: 9 or an amino acid sequence having one or more mutations of T6I, T43A, K47E, A50S, E51D, G52A, and N54K compared to SEQ ID NO: 9, and the length of the replicon is ≦800 bp, preferably ≦600 bp or ≦300 bp.

[0011] Preferably, the amino acid sequence of the antitoxin protein is SEQ ID NO: 1, SEQ ID NO: 2 , SEQ ID NO: 3, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 12.

[0012] Preferably, said replicon is selected from ColE1, ColE2, pMB1, pSC101, RSF, R6K, pUC57, RK2 and p15A, preferably R6K or pUC57.

[0013] wherein the antitoxin protein is derived from a toxin-antitoxin system according to the present application, the toxin-antitoxin system comprising a nucleotide sequence encoding a toxin protein and a nucleotide sequence encoding an antitoxin protein, and the toxin protein and the antitoxin protein are selected from the group consisting of: (1) The amino acid sequence of the toxin protein is shown in SEQ ID NO: 4, and the amino acid sequence of the antitoxin protein is shown in SEQ ID NO: 3; (2) The amino acid sequence of the toxin protein is shown in SEQ ID NO: 13, and the amino acid sequence of the antitoxin protein is shown in SEQ ID NO: 12.

[0014] In a preferred embodiment, the toxin-antitoxin system is selected from any of the following groups: (1) The nucleotide sequence encoding the toxin protein is set forth in SEQ ID NO: 6, and the nucleotide sequence encoding the antitoxin protein is set forth in SEQ ID NO: 5, or the nucleotide sequence set forth in SEQ ID NO: 5 does not contain a CpG motif; (2) The nucleotide sequence encoding the toxin protein is set forth in SEQ ID NO: 15, and the nucleotide sequence encoding the antitoxin protein is set forth in SEQ ID NO: 14, or the nucleotide sequence set forth in SEQ ID NO: 14 does not contain a CpG motif.

[0015] Preferably, the antibiotic resistance gene-free miniplasmid has a plasmid backbone length of ≦1000 bp, preferably ≦900 bp, ≦800 bp or ≦600 bp.

[0016] The nucleotide sequence encoding the antitoxin protein does not contain a CpG motif, and preferably, the nucleotide sequence encoding the antitoxin protein is set forth in SEQ ID NO:7 or SEQ ID NO:16.

[0017] Preferably, the nucleotide sequence of said replicon does not contain any CpG motifs, for example the R6K replicon does not contain the CpG motif shown in SEQ ID NO:20.

[0018] In a preferred embodiment, the antibiotic resistance gene-free miniplasmid does not contain a gene of interest, the nucleotide sequence is shown in SEQ ID NO: 8 or 17, and the spectral structure of the plasmid is shown in Figures 15-16.

[0019] Preferably, the antibiotic resistance gene-free miniplasmid comprises a structured DNA sequence selected from polyA repeats, an SV40 replication origin, a viral LTR, a lentiviral LTR, a retroviral LTR, a transposon IR / DR repeat sequence, an AAV ITR, a transposon ITR, a CMV enhancer, and an SV40 enhancer.

[0020] Preferably, the antibiotic resistance gene-free miniplasmid is selected from a viral vector, a lentiviral vector, a retroviral vector, an AAV vector, an Ad vector, a Sleeping Beauty transposon vector, a PiggyBac transposon vector, a ZB transposon vector, a PS transposon vector, a Tol2 transposon vector, and a polyA-containing mRNA vector.

[0021] Preferably, said antibiotic resistance gene-free miniplasmid comprises a foreign gene, preferably said foreign gene encodes a chimeric antigen receptor and / or an antibody.

[0022] A second aspect of the present application provides a recombinant host cell characterized by comprising the antibiotic resistance gene-free miniplasmid of the present application.

[0023] A third aspect of the present application provides a method for producing a cell, the method comprising introducing the antibiotic resistance gene-free miniplasmid of the present application into a cell.

[0024] Preferably, the cell is of animal origin, such as a vertebrate or invertebrate, preferably a mammal, more preferably a human, and / or the cell is an immune cell, preferably a T cell.

[0025] The introduction includes transfection of the cells by electroporation, microinjection, calcium phosphate precipitation, cationic polymers, dendrimers, liposomes, biolistic bombardment, fugene, direct sonic loading, cell extrusion, optical transfection, protoplast fusion, impalefection, magnetic transfection, nuclear transfection or any combination thereof, preferably transfection of the cells by electroporation.

[0026] A fourth aspect of the present application provides a pharmaceutical composition comprising the antibiotic resistance gene-free miniplasmid or recombinant host cell of the present application, and optionally a pharmaceutically acceptable excipient.

[0027] A fifth aspect of the present application provides a plasmid production system comprising a host cell comprising a nucleotide sequence encoding a toxin protein and a plasmid comprising a nucleotide sequence encoding an antitoxin protein, wherein the amino acid sequence of the toxin protein is set forth in SEQ ID NO: 4 and comprises the amino acid sequence of SEQ ID NO: 1, or an amino acid sequence having one or more mutations of E24D, I36V, and V43I compared to SEQ ID NO: 1, or the amino acid sequence of the toxin protein is set forth in SEQ ID NO: 13 and comprises the amino acid sequence of SEQ ID NO: 9, or an amino acid sequence having one or more mutations of T6I, T43A, K47E, A50S, E51D, G52A, and N54K compared to SEQ ID NO: 9.

[0028] Preferably, the amino acid sequence of the toxin protein is set forth in SEQ ID NO: 4 and the amino acid sequence of the antitoxin protein is set forth in SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or the amino acid sequence of the toxin protein is set forth in SEQ ID NO: 13 and the amino acid sequence of the antitoxin protein is set forth in SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ ID NO: 12.

[0029] Preferably, the host cell is a Gram-negative bacterium, preferably Escherichia coli, such as E. coli strain GT115, Top10, DH5a, or BL21(DE3). Preferably, the bacterial host cell is Escherichia coli that contains the Pai protein required for the R6K replicon (origin).

[0030] Preferably, the host cell comprises a gene expression cassette capable of inducing expression of a toxin, and the gene expression cassette for the toxin protein comprises an operon or promoter capable of inducing expression of the toxin protein, and preferably the operon or promoter is a Lac gene. The promoter is selected from the group consisting of the L-arabinose inducible pBAD promoter, the L-rhamnose inducible rhapBAD promoter, and the λPL / PR-clts857 temperature-sensitive promoter.

[0031] Preferably, said plasmid comprises a replicon, preferably said replicon is selected from ColE1, ColE2, pMB1, pSC101, RSF, R6K, pUC57, RK2 and p15A, preferably the R6K or pUC57 replicon.

[0032] The plasmid does not contain an antibiotic resistance gene and / or the length of the plasmid backbone is ≦1000 bp, preferably ≦900 bp, ≦800 bp or ≦600 bp.

[0033] In a preferred embodiment, when the replicon in the plasmid backbone of the antibiotic resistance gene-free miniplasmid is pUC57, ColE1, or pMB1, the length of the plasmid backbone is ≦1000 bp.

[0034] In a preferred embodiment, when the replicon in the plasmid backbone of said antibiotic resistance gene-free miniplasmid is the R6K replicon, the length of the plasmid backbone is ≦600 bp.

[0035] Preferably, the nucleotide sequences encoding said replicon and / or antitoxin proteins, after being optimized, do not contain CpG motifs.

[0036] A sixth aspect of the present application provides a method for producing a plasmid using the system described herein, comprising: (1) transforming a plasmid containing a nucleotide sequence encoding an antitoxin protein into a host cell containing a nucleotide sequence encoding a toxin protein; (2) inducing expression of the toxin protein during continuous culture of the bacterial host cells to express the antitoxin protein; (3) obtaining the plasmid.

[0037] Preferably, said plasmid is an antibiotic resistance gene-free miniplasmid of the present application.

[0038] The present application provides a method for producing a recombinant peptide, polypeptide, or protein of interest using the system described herein, wherein the plasmid further comprises a gene expression cassette encoding the recombinant peptide, polypeptide, or protein of interest, the method comprising culturing the system and recovering the recombinant peptide, polypeptide, or protein of interest.

[0039] In a preferred embodiment, expression of the gene encoding the toxin protein is induced by adding arabinose during culture.

[0040] A seventh aspect of the present application provides a genetically engineered bacterium, the genetically engineered bacterium comprising within its cell a nucleotide sequence encoding a toxin protein, the amino acid sequence of the toxin protein being set forth in SEQ ID NO: 4 or 13, and preferably the nucleotide sequence encoding the toxin protein being within the genome of the genetically engineered bacterium.

[0041] Preferably, the genetically engineered bacteria contains a nucleoside encoding an antitoxin protein. and further comprising a plasmid containing the nucleotide sequence, The amino acid sequence of the toxin protein is set forth in SEQ ID NO: 4, and the amino acid sequence of the antitoxin protein comprises the amino acid sequence set forth in SEQ ID NO: 1, or an amino acid sequence having one or more of the following mutations compared to SEQ ID NO: 1: E24D, I36V, V43I; or The amino acid sequence of the toxin protein is set forth in SEQ ID NO: 13, and the amino acid sequence of the antitoxin protein has the amino acid sequence set forth in SEQ ID NO: 9, or an amino acid sequence having one or more of the following mutations compared to SEQ ID NO: 9: T6I, T43A, K47E, A50S, E51D, G52A, N54K. Preferably, the plasmid is an antibiotic resistance gene-free miniplasmid described herein.

[0042] Preferably, the genetically engineered bacterium is a Gram-negative bacterium, preferably Escherichia coli, such as the E. coli strain GT115, Top10, DH5a or BL21(DE3).

[0043] In some embodiments, the bacterial host cell is Escherichia coli that contains the Pai protein required for the R6K origin, and the Pai protein is expressed by the pir gene.

[0044] The present application further provides kits comprising the antibiotic resistance gene-free miniplasmids, recombinant host cells, systems or genetically engineered bacteria described herein.

[0045] The present application further provides applications of the antibiotic resistance gene-free miniplasmids, recombinant host cells, systems or genetically engineered bacteria, and kits described herein in the preparation of gene therapy drugs, the preparation of cell therapy drugs, DNA vaccines, virus production, or antibody production.

[0046] The present application further provides an application of antibiotic resistance gene-free miniplasmids, recombinant host cells, systems or genetically engineered bacteria, kits for maintaining plasmid stability in bacterial host cells.

[0047] The present application further provides an application of the toxin-antitoxin system for maintaining plasmid stability in a bacterial host cell, wherein the plasmid may contain an antibiotic resistance gene and the toxin-antitoxin system can further improve the stability of the plasmid, or the plasmid may not contain an antibiotic resistance gene and the toxin-antitoxin system can alone maintain the stability of the plasmid.

[0048] The present application further provides a method for screening a toxin-antitoxin system, the screening method comprising: (I) inserting a gene expression cassette capable of inducing expression of a toxin protein into a bacterial host genome to induce expression of an antitoxin protein; (II) inserting a gene expression cassette capable of inducing expression of a toxin protein into a bacterial host genome, and introducing a plasmid containing an antitoxin gene into the bacterium to induce expression of the antitoxin protein; The gene expressing the toxin protein and the expressed antitoxin gene belong to the same group of toxin-antitoxin systems; The method is characterized by screening for an effective toxin-antitoxin system when the bacterial host cells in (I) exhibit a suicide effect, the bacterial host cells in (II) grow normally, and the plasmid is stably passaged.

[0049] The present application relates to a toxin protein in the toxin-antitoxin system described herein. Further provided is a method for inserting a nucleotide sequence encoding a toxin protein into a bacterial genome, which comprises cloning a gene encoding the toxin protein into an arabinose-inducible expression plasmid and inserting said gene into the lacZ locus in the bacterial genome by the method of homologous recombination. [Effects of the Invention]

[0050] The antibiotic resistance gene-free miniplasmid of the present application is relatively short, reduces redundant and useless fragments, and does not contain an antibiotic resistance gene expression cassette, improving the utilization of the target sequence in the plasmid and reducing production burden.The backbone of the antibiotic resistance gene-free miniplasmid is controlled to within 1000 bp, ensuring low toxicity of the plasmid and improving plasmid expression.Compared to conventional plasmids, the antibiotic resistance gene-free plasmid of the present application can improve the expression of foreign genes and has low immunogenicity through CpG optimization.The antibiotic resistance gene-free miniplasmid does not contain an antibiotic resistance gene, improving safety in use. [Brief explanation of the drawings]

[0051] [Figure 1] 1 is a diagram showing the operating principle of the antibiotic resistance gene-free mini-plasmid screening system. [Figure 2] Schematic diagram of toxin insertion into the GT115 genome. [Figure 3] Schematic diagram of the insertion of the toxin gene into pBAD33-oriT. [Figure 4] 1 shows the PCR verification results of positive transformants. [Figure 5] FIG. 1 is a schematic diagram of the fusion PCR fragment used for insertion into the GT115 genome. [Figure 6] PCR identification using GT115 genome verification primers. [Figure 7] Growth curves of the GT115::Ara promoter (control), GT115::SO_1444, GT115::ccdB(43009), GT115::ccdB(E. coli), and GT115::0636 strains. A: After overnight incubation, the initial OD was adjusted to 0.1, and the growth of the different strains was measured at 2, 4, 6, and 8 hours. During the incubation, 0.2% glucose was added to suppress the arabinose promoter activity. B: Colony counts for each strain at 8 hours after gradient dilution. [Figure 8]Toxicity detection after toxin expression in six candidate TA systems. A: Experimental flowchart. After overnight culture, the strains were transferred to LB medium containing 0.2% Glu (glucose) and 0.3% Ara (arabinose) at 1% each. After 2 h of induction, each strain was spotted on an LB plate and the bacterial survival rate was calculated. B: Detection of the CcdA / CcdB (E. coli) toxin ccdAE.coli as a control. C: Toxin expression in three TA systems (SO_1444 / SO_1445, CcdA / CcdB (43009), and GF_0636 / GF_0637) was cytotoxic. Three TA systems (VagC1 / VagD1, PrpT / PrpA, and HepT / MntA) showed no cytotoxicity after toxin expression. [Figure 9] Toxin toxicity is used to screen for the antibiotic resistance gene-free plasmid pCpG-antitoxin into which an antitoxin has been inserted. A: Schematic diagram of the construction of the antibiotic resistance gene-free plasmid pCpG-antitoxin into which an antitoxin has been inserted. B: PCR verification diagram of the transformation of the antibiotic resistance gene-free plasmid pCpG-antitoxin into which the corresponding antitoxin has been inserted in a toxin-expressing host. [Figure 10] This study compares the effects of constructing a TA system on the growth of bacterial strains. [Figure 11] Insertion of the target gene egfp using the antibiotic resistance gene-free miniplasmid pCpG-antitoxin. A: Schematic diagram of insertion of the target gene egfp using the antibiotic resistance gene-free miniplasmid pCpG-antitoxin. B: Detection of the recombinant plasmid with egfp inserted and PCR verification of efficiency. [Figure 12] The antibiotic resistance gene-free miniplasmid was transferred and cultured for three consecutive days to measure the plasmid content. pCpG: pCpGfree-MCS, ccdA43009: pCpG-ccdA43009, SO_1445: pCpG-SO_1445, GF_0637: pCpG-GF_0637, ccdAE.coli: CpG-ccdAE.coli. [Figure 13] These are plasmid gel images 0 days, 3 days, and 6 days after serial passage of an antibiotic resistance gene-free miniplasmid into which egfp had been inserted (experiment for the second lot). [Figure 14] Plasmid concentrations at 0 d, 3 d, and 6 d after serial passage of an antibiotic resistance gene-free miniplasmid into which egfp had been inserted. [Figure 15] Schematic diagram of pCpGfree MCS-0637 empty miniplasmid, the corresponding nucleotide sequence of which is shown in SEQ ID NO:8. [Figure 16] pCpGfree MCS-43009 is an empty miniplasmid spectrum, the corresponding nucleotide sequence of which is shown in SEQ ID NO: 17. [Figure 17] pCpGfree MCS-1445 is an empty miniplasmid spectrum, the corresponding nucleotide sequence of which is shown in SEQ ID NO: 18. [Figure 18] pCpGfree MCS-ccdA is an E. coli empty miniplasmid spectrum, the corresponding nucleotide sequence of which is shown in SEQ ID NO: 19. [Figure 19] FIG. 1 is a schematic diagram of the pCpG-ccdA43009-EGFP plasmid. [Figure 20] FIG. 1 is a schematic diagram of the pCpG-GF-0637-EGFP plasmid. [Figure 21] Efficacy expression of antibiotic resistance gene-free miniplasmid after antitoxin protein cleavage. [Figure 22] 10 is a flow cytometry chart of Example 8, analyzing the expression levels and persistence of expression of different plasmids. [Figure 23] Fluorescence photographs of Example 8, analyzing the expression levels and persistence of expression of different plasmids. [Figure 24] This shows the positive rate of ZB transposase integrating the eGFP expression cassette carried on the plasmid into Jurkat cells. [Figure 25] This shows the positive rate of ZB transposase integrating the eGFP expression cassette carried on the plasmid into PBMC cells. [Figure 26] 1 is a nucleic acid electrophoresis diagram of pucTA-6.5A-MDR1-EGFP-90A plasmid extracted from different clones in Example 10. [Figure 27] 1 shows nucleic acid electropherograms of pucTA-6.5A-MDR1-EGFP-90A plasmids extracted from different generations in Example 10. DETAILED DESCRIPTION OF THE INVENTION

[0052] The term "toxin-antitoxin" (TA) refers to a pair of a toxin protein and an antitoxin protein, where the toxin protein is toxic to host cells, and the antitoxin protein can neutralize the toxicity of the toxin protein to host cells. When an antitoxin gene encoded by a chromosome or a plasmid is present in a cell, the antitoxin protein is continuously expressed, neutralizing the toxin protein and maintaining cell viability. When the plasmid carrying the antitoxin gene is deleted from the cell, the synthesized toxin protein remains longer than the antitoxin protein and can kill the cell or inhibit cell growth. As used herein, the terms "toxin protein" and "toxin" are used interchangeably and refer to a protein in a toxin-antitoxin system that can kill cells or inhibit cell growth. The terms "antitoxin protein" and "antitoxin" are used interchangeably and refer to a protein that forms a complex with a toxin protein in a toxin-antitoxin system and neutralizes the toxicity of the toxin protein.

[0053] The term "codon optimization" refers to a technique for converting / substituting a DNA sequence of certain nucleotides with another nucleotide sequence to improve the translation efficiency of a gene of interest and maximize the expression of the protein in an organism. Codon optimization involves replacing wild-type DNA sequences and rare codons with more expressible sequences and frequently occurring codons without changing the protein.

[0054] CpG motifs refer to immunostimulatory CpG oligonucleotides, i.e., short, single-stranded synthetic nucleic acid molecules, containing cytosine triphosphate deoxynucleotides ("C") and guanine triphosphate deoxynucleosides ("G"). The "p" refers to a phosphodiester or phosphorothioate bond between consecutive nucleotides. Unmethylated CpG motifs are considered pathogen-associated molecular patterns (PAMPs) because they are abundant in microbial genomes but rare in vertebrate genomes. The present application removes CpG motifs in the nucleotide sequence encoding the toxin protein by codon optimization.

[0055] Toxin-antitoxin systems are widely present in the chromosomes and plasmids of prokaryotes and archaea, but not all toxin-antitoxin systems can be used to maintain plasmid stability. For example, some toxins have low lethality and cannot be screened efficiently. Some toxin-antitoxin systems have genes that are too large, resulting in large plasmid backbones. Some toxin-antitoxins have low replication and expression efficiencies, which affect the application of the plasmid. This application screens for suitable toxin-antitoxin systems based on the goal of creating an antibiotic resistance gene-free miniplasmid.

[0056] The present application provides a toxin-antitoxin system suitable for antibiotic resistance gene-free miniplasmids, the toxin-antitoxin system being derived from the marine strain Roseivirga spongicola_GF047 and including a nucleotide sequence encoding the toxin protein GF_0636 and the antitoxin protein GF_0637, or the toxin-antitoxin system being derived from the marine strain Vibrio sp. 43009 and including a nucleotide sequence encoding the toxin protein CcdB (43009) or the antitoxin protein CcdA (43009). The toxin-antitoxin system of the present application is shorter than the toxin-antitoxin system derived from the marine strain Shewanella oneidensis MR-1 (which includes a nucleotide sequence encoding the toxin protein SO_1444 (abbreviated as 1444) and the antitoxin protein SO_1445 (abbreviated as 1445)). Therefore, the antibiotic resistance gene-free miniplasmid can be made smaller and less toxic, and when used as a vector for a transposon system, the transposition efficiency can be increased.

[0057] In some embodiments, the amino acid sequence of the marine strain toxin protein GF_0636 is set forth in SEQ ID NO:4, and the amino acid sequence of the marine strain antitoxin protein GF_0637 is set forth in SEQ ID NO:3.

[0058] In some embodiments, the nucleotide sequence encoding the toxin protein GF_0636 is set forth in SEQ ID NO: 6, and the nucleotide sequence encoding the antitoxin protein GF_0637 is set forth in SEQ ID NO: 5, or the sequence set forth in SEQ ID NO: 5 does not contain any CpG motifs.

[0059] In some embodiments, the nucleotide sequence encoding the antitoxin protein GF_0637 is optimized to be free of CpG motifs, such as those shown in SEQ ID NO:7.

[0060] In some embodiments, the amino acid sequence of the toxin CcdB (43009) from the marine strain Vibrio sp. 43009 is set forth in SEQ ID NO:13, and the amino acid sequence of the antitoxin CcdA (43009) is set forth in SEQ ID NO:12.

[0061] In some embodiments, the nucleotide sequence encoding the toxin CcdB (43009) is set forth in SEQ ID NO: 15, the nucleotide sequence encoding the antitoxin CcdA (43009) is set forth in SEQ ID NO: 14, or the sequence set forth in SEQ ID NO: 14 does not contain any CpG motifs.

[0062] In some embodiments, the nucleotide sequence encoding the antitoxin CcdA (43009) is optimized to contain no CpG motifs, such as those set forth in SEQ ID NO:16.

[0063] The amino acid sequence encoding the toxin SO_1444 of the marine strain Shewanella oneidensis MR-1 is set forth in SEQ ID NO: 22, the amino acid sequence encoding the antitoxin SO_1445 is set forth in SEQ ID NO: 21, the nucleotide sequence encoding the toxin SO_1444 is set forth in SEQ ID NO: 24, and the nucleotide sequence encoding the antitoxin SO_1445 is set forth in SEQ ID NO: 23.

[0064] The term "antibiotic resistance gene-free plasmid" refers to a plasmid that does not contain an antibiotic resistance gene. The term "miniplasmid" or "small plasmid" refers to a small (less than 4 kb) circular plasmid derivative isolated from all prokaryotic vector portions (i.e., containing no bacterial DNA sequences) that is used as a recombinant vector for the genetic modification of mammalian cells. Miniplasmids and their uses are described in "Minicircle and Miniplasmid DNA Vectors: The Future of Nonviral and Viral Gene Transfer," Dr. Martin Schleef, May 2013, Wiley-Blackwell, p. 258. The term "antibiotic resistance gene-free miniplasmid" refers to a miniplasmid that does not contain an antibiotic resistance gene.

[0065] The term "plasmid backbone" refers to a DNA sequence that contains at least the elements necessary for the autonomous replication of a plasmid in a bacterial host.

[0066] The term "replicon (origin)" refers to a part of a DNA sequence that can autonomously replicate in bacteria, a plasmid, or a vector and maintain a normal copy number, and is also called "origin of replication" in some literature.

[0067] The toxin-antitoxin system of the present application can maintain the stable presence of the plasmid in the host cell, so the plasmid may contain other genes of interest and stably express the genes of interest in the host cell, for example, to produce a polypeptide. Similarly, the plasmid may contain a foreign gene, but the foreign gene is not expressed in the bacterial host cell. By stable replication and passage of the plasmid, an antibiotic resistance gene-free mini-plasmid containing the foreign gene, but not containing the antibiotic resistance gene, can be directly obtained and used for gene editing, gene therapy, etc.

[0068] The present application provides an antibiotic resistance gene-free miniplasmid comprising a nucleotide sequence and a replicon encoding an antitoxin protein, the amino acid sequence of which is (1) the amino acid sequence shown in SEQ ID NO: 1 or, compared to SEQ ID NO: 1, or (2) an amino acid sequence having one or more mutations of E24D, I36V, and V43I, or (3) an amino acid sequence as set forth in SEQ ID NO: 9, or an amino acid sequence having one or more mutations of T6I, T43A, K47E, A50S, E51D, G52A, and N54K compared to SEQ ID NO: 9, wherein the length of the replicon is ≦800 bp, preferably ≦600 bp or ≦300 bp. The E24D mutation refers to a mutation of the 24th amino acid from E to D, and the same applies to other mutations.

[0069] The amino acid sequence shown in SEQ ID NO: 1 is the cleavage sequence of the antitoxin protein GF_0637, which is the shortest sequence required to achieve the antitoxin function and can further shorten the length of the plasmid. The antitoxin protein GF_0637 is derived from the marine fungus Roseivirga spongicola_GF047. Natural mutations occur in the antitoxin protein during strain cultivation. Known natural mutations include E24D, I36V, and V43I. The mutated antitoxin protein can still achieve the same antitoxin function. Therefore, the antitoxin protein GF_0637 and its cleavage sequence may contain one or more of the mutations E24D, I36V, and V43I. Similarly, the amino acid sequence shown in SEQ ID NO: 9 is a cleavage sequence of the antitoxin protein CcdA (43009), and known natural mutations include T6I, T43A, K47E, A50S, E51D, G52A, and N54K, and therefore the antitoxin protein and its cleavage sequence may contain one or more mutations of T6I, T43A, K47E, A50S, E51D, G52A, and N54K.

[0070] In some embodiments, the amino acid sequence of the antitoxin protein is set forth in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12.

[0071] The replicon is selected from ColE1, ColE2, pMB1, pSC101, RSF, R6K, pUC57, RK2, and p15A, and is preferably R6K or pUC57 in consideration of the plasmid copy number, plasmid toxicity, and plasmid backbone size. The antibiotic resistance gene-free miniplasmid can be cultured and amplified in bacterial host cells, and the number of copies within the bacterial host cells increases, allowing a large amount of antibiotic resistance gene-free miniplasmid to be obtained in a relatively short time.

[0072] The plasmid backbone of existing miniplasmids is generally smaller than 4000 bp, and the length of the antibiotic resistance gene contained in the plasmid is generally 810 bp. Therefore, the length of the plasmid backbone of existing miniplasmids is generally greater than 1200 bp. On the other hand, the antibiotic resistance gene-free miniplasmid of the present application uses an antitoxin protein instead of an antibiotic resistance gene, thereby significantly reducing the length of the plasmid backbone. The length of the nucleotide sequence of the antitoxin protein of the present application is ≦300 bp, and the length of the plasmid backbone of the antibiotic resistance gene-free miniplasmid of the present application is ≦1000 bp, for example ≦900 bp, 800 bp, or 600 bp.

[0073] In a preferred embodiment, when the replicon in the plasmid backbone of the antibiotic resistance gene-free miniplasmid is pUC57, ColE1, or pMB1, the length of the plasmid backbone is ≦1000 bp.

[0074] In a preferred embodiment, when the replicon in the plasmid backbone of said antibiotic resistance gene-free miniplasmid is the R6K replicon, the length of the plasmid backbone is ≦600 bp.

[0075] The plasmid contains a nucleotide sequence encoding an antitoxin protein, When used in mammals such as mammals, codon optimization can be used to remove CpG motifs in the nucleotide sequence encoding the antitoxin protein, thereby reducing immunogenicity. Because the nucleotide sequence encoding the toxin protein and the nucleotide sequence encoding the antitoxin protein are not on the same plasmid, it is not necessary to remove CpG motifs from the nucleotide sequence encoding the toxin protein.

[0076] The nucleotide sequence encoding the replicon and / or antitoxin protein does not contain CpG motifs after optimization. In some embodiments, the nucleotide sequence encoding the antitoxin protein is set forth in SEQ ID NO: 7 or SEQ ID NO: 16. In some embodiments, the R6K replicon does not contain CpG motifs, such as those set forth in SEQ ID NO: 20.

[0077] The gene expression cassette of the antibiotic resistance gene-free miniplasmid that expresses the antitoxin protein contains a promoter, preferably a bacterial promoter such as, but not limited to, EM2K, J23119, or Tac, which allows the antitoxin protein to be continuously expressed in bacterial host cells.

[0078] The antibiotic resistance gene-free miniplasmid described in this application does not need to contain a gene of interest. The antibiotic resistance gene-free miniplasmid system produced in this application can be used to directly obtain an empty plasmid, the nucleotide sequence of which is shown in SEQ ID NO: 8 or 17, and the spectral structure of the plasmid is shown in Figures 15-16.

[0079] The antibiotic resistance gene-free miniplasmid of the present application may contain a gene of interest. Because the plasmid length is relatively small after carrying the gene of interest, the antibiotic resistance gene-free miniplasmid of the present application has great potential for non-viral vector delivery. The gene of interest may be an antibody gene, a chimeric antigen receptor gene, a gene editing enzyme gene, an antigen gene, a viral gene, etc. In the present application, to verify the efficacy of the antibiotic resistance gene-free miniplasmid, the gene of interest may be a reporter gene such as an EGFP reporter gene. The spectral structure of a typical antibiotic resistance gene-free miniplasmid is shown in Figures 19 and 20.

[0080] The pCpGfree MCS-1445 empty miniplasmid spectrum is shown in FIG. 17, and the pCpGfree MCS-ccdA E. coli empty miniplasmid spectrum is shown in FIG.

[0081] In some embodiments, the antibiotic resistance gene-free miniplasmid comprises a structured DNA sequence selected from a polyA repeat, an SV40 origin of replication, a viral LTR, a lentiviral LTR, a retroviral LTR, a transposon IR / DR repeat sequence, an AAV ITR, a transposon ITR, a CMV enhancer, and an SV40 enhancer.

[0082] In some embodiments, the antibiotic resistance gene-free miniplasmid is selected from a viral vector, a lentiviral vector, a retroviral vector, an AAV vector, an Ad vector, a Sleeping Beauty transposon vector, a PiggyBac transposon vector, a ZB transposon vector, a PS transposon vector, a Tol2 transposon vector, and a polyA-containing mRNA vector, wherein the ZB transposon vector may refer to CN105018523B, and the PS transposon vector may refer to CN110257425B.

[0083] In some embodiments, the antibiotic resistance gene-free miniplasmid is Preferably, the exogenous gene encodes a chimeric antigen receptor and / or an antibody. For example, the antibiotic resistance gene-free miniplasmid may contain an exogenous gene encoding a chimeric antigen receptor for preparing chimeric antigen receptor immune cells such as CAR-T. The antibiotic resistance gene-free miniplasmid may contain an exogenous gene encoding an antibody, such as a PD-1 antibody gene. The antibiotic resistance gene-free miniplasmid may simultaneously contain an exogenous gene encoding a chimeric antigen receptor and an exogenous gene encoding an antibody, and these may be used in the same antibiotic resistance gene-free miniplasmid or in combination in different antibiotic resistance gene-free miniplasmids.

[0084] The present application further provides a recombinant host cell comprising the antibiotic resistance gene-free miniplasmid of the present application. A method for preparing the recombinant host cell includes introducing the antibiotic resistance gene-free miniplasmid of the present application into a cell.

[0085] Preferably, the cell is of animal origin, such as a vertebrate or invertebrate, preferably a mammal, more preferably a human, and / or the cell is an immune cell, preferably a T cell.

[0086] Preferably, said introducing comprises transfecting said cells by electroporation, microinjection, calcium phosphate precipitation, cationic polymers, dendrimers, liposomes, biolistic bombardment, fugene, direct sonic loading, cell extrusion, optical transfection, protoplast fusion, impalefection, magnetic transfection, nuclear transfection or any combination thereof, preferably transfecting said cells by electroporation.

[0087] The present application provides a pharmaceutical composition comprising the antibiotic resistance gene-free miniplasmid or recombinant host cell of the present application, and optionally a pharmaceutically acceptable excipient.

[0088] The present application also provides a plasmid production system comprising a host cell comprising a nucleotide sequence encoding a toxin protein and a plasmid comprising a nucleotide sequence encoding an antitoxin protein, the amino acid sequence of which is set forth in SEQ ID NO: 4, and the amino acid sequence of the antitoxin protein comprises the amino acid sequence set forth in SEQ ID NO: 1, or an amino acid sequence having one or more of the following mutations compared to SEQ ID NO: 1: E24D, I36V, V43I; The amino acid sequence of the toxin protein is set forth in SEQ ID NO: 13, and the amino acid sequence of the antitoxin protein comprises the amino acid sequence set forth in SEQ ID NO: 9, or an amino acid sequence having one or more mutations of T6I, T43A, K47E, A50S, E51D, G52A, and N54K compared to SEQ ID NO: 9.

[0089] In some embodiments, the amino acid sequence of the toxin protein is set forth in SEQ ID NO: 4 and the amino acid sequence of the antitoxin protein is set forth in SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or the amino acid sequence of the toxin protein is set forth in SEQ ID NO: 13 and the amino acid sequence of the antitoxin protein is set forth in SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ ID NO: 12.

[0090] The plasmid production system of the present invention is based on the principle of maintaining the stability of the plasmid in bacterial host cells by utilizing a toxin-antitoxin system, and efficiently producing the plasmid by replicating and amplifying the plasmid as the bacterial host cells are cultured and grown. The antibiotic resistance gene-free miniplasmid production system of the present application comprises bacterial host cells and a plasmid, and the plasmid is introduced into the bacterial host cells by directly culturing the bacterial host cells. Alternatively, the plasmid and bacterial host cells can be stored separately and the bacterial host cells transfected with the plasmid when in use.

[0091] In some embodiments, the plasmid contains an antibiotic resistance gene that can maintain the stability of the plasmid, and the system can further enhance the stability of the plasmid by including a toxin-antitoxin system, and therefore the system can be used to produce plasmids containing antibiotic resistance genes.

[0092] In some embodiments, the plasmid does not contain an antibiotic resistance gene, and the stability of the plasmid depends on a toxin-antitoxin system. In this case, the system of the present application is used to produce an antibiotic resistance gene-free plasmid. Considering only the production of the plasmid, the size of the antibiotic resistance gene-free plasmid is not particularly limited. Considering the application of the antibiotic resistance gene-free plasmid, a relatively small antibiotic resistance gene-free plasmid can be obtained by selecting an appropriate replicon, for example, with a backbone length of ≦1000 bp, preferably ≦900 bp, ≦800 bp, or ≦600 bp. Preferably, the antibiotic resistance gene-free plasmid is the antibiotic resistance gene-free miniplasmid of the present application.

[0093] In some embodiments, the host cell is a Gram-negative bacterium, preferably Escherichia coli, such as the E. coli strain GT115, Top10, DH5a, or BL21(DE3).

[0094] In some embodiments, the bacterial host cell is Escherichia coli that contains the Pai protein required for the R6K origin, and the Pai protein is expressed by the pir gene.

[0095] In some embodiments, the toxin bacterial host cell contains a gene expression cassette capable of inducing expression of a toxin protein, and the toxin protein is expressed under induction conditions, and bacterial host cells containing the plasmid are screened. In some embodiments, the gene expression cassette expressing the toxin protein may be inserted into the genome of the bacterial host cell or may be located on a plasmid. The gene expression cassette expressing the toxin protein is inserted into the genome of the bacterial host cell and is stably present and expressed in the host cell, more preferably, inserted into the lacZ region of the GT115 E. coli genome, for example. The gene expression cassette expressing the toxin protein may also be located on a plasmid other than the produced plasmid, in which case the other plasmid may further contain an antibiotic resistance gene, avoiding plasmid deletion and preventing overuse of the antibiotic resistance gene because the other plasmid is not the final product and is not used in gene therapy. The gene expression cassette capable of inducing expression of the toxin protein comprises an operon or promoter, which expresses the toxin protein under induction conditions, and the operon or promoter is selected from the group consisting of the Lac lactose operon, the L-arabinose-inducible pBAD promoter, the L-rhamnose-inducible rhapBAD promoter, and the λPL / PR-clts857 temperature-sensitive promoter.

[0096] In some embodiments, the connection scheme between the promoter and the toxin protein gene expression cassette is shown in FIG.

[0097] In some embodiments, depending on the type of promoter or operon, culture conditions can be adjusted to induce expression of the toxin protein; for example, when the L-arabinose-inducible pBAD promoter is used, arabinose can be added during culture to induce expression of the gene encoding the toxin protein.

[0098] In some embodiments, the plasmid contains a gene expression cassette that expresses an antitoxin protein. The plasmid is present in a bacterial host cell, and the antitoxin gene in the plasmid and the toxin gene in the bacterial genome or another plasmid constitute a toxin-antitoxin system, and the plasmid is used in combination with bacterial host cells containing the antitoxin gene. During the cultivation of the bacterial host cells, the toxin protein and the antitoxin protein are simultaneously expressed, and the plasmid is stably present in the cultured bacterial host cells due to the screening action of the toxin-antitoxin system.

[0099] In some embodiments, the replicon is an R6K replicon, the nucleotide sequence of which is set forth in SEQ ID NO: 20. In some embodiments, the replicon and antitoxin gene expression cassette sequences in the antibiotic resistance gene-free miniplasmid do not contain CpG motifs after being optimized.

[0100] Preferably, the antitoxin gene expression cassette sequence containing no CpG motif is shown in SEQ ID NO: 7 or 16.

[0101] The systems described herein can be used to produce plasmids, for example by fermenting bacterial host cells in a culture system to obtain the plasmids.

[0102] The present application further provides a method for producing a plasmid using the system, comprising the steps of:

[0103] Preferably, said plasmid is an antibiotic resistance gene-free miniplasmid of the present application.

[0104] The fermentation conditions may be conventional antibiotic resistance gene-free subculture, such as fermentation in LB medium. During the culture process, the culture conditions are adjusted according to the type of promoter or operon to induce expression of the toxin protein. Since expression of the toxin protein causes death or growth inhibition of bacterial host cells, controllable inducible expression is employed. The induced expression may be carried out at the initial stage of culture or after a certain period of time after subculturing the bacterial host cells. The antitoxin protein expression does not significantly affect the bacterial host cells and can be continuously expressed during the culture process. After the culture is completed, the bacterial cells are harvested and the plasmid is extracted to obtain the antibiotic resistance gene-free miniplasmid.

[0105] The present application further provides a method for producing a recombinant peptide, polypeptide or protein of interest using the system, wherein the plasmid further comprises a gene expression cassette encoding the recombinant peptide, polypeptide or protein of interest, the method comprising culturing the system and recovering the recombinant peptide, polypeptide or protein of interest.

[0106] Plasmid production differs from plasmid production in that the latter is primarily concerned with the copy number of the plasmid and the end product is to obtain the plasmid, and does not involve the expression of a recombinant peptide, polypeptide, or protein by the plasmid.Recombinant peptide, polypeptide, or protein production expression similarly involves the copy number of the plasmid and requires the expression of the recombinant peptide, polypeptide, or protein by the plasmid, with the ultimate goal being to obtain the recombinant peptide, polypeptide, or protein.

[0107] Examples of peptides, polypeptides or proteins produced by the methods of the present application include enzymes, regulatory proteins, receptors, peptides (e.g., peptide hormones), cytokines, antibodies , nanobodies, membrane proteins or transporters.

[0108] In some embodiments, the host cell further comprises a nucleic acid sequence encoding a protein that directs expression of a peptide, polypeptide, or protein of interest, preferably located in a gene expression cassette that encodes the recombinant peptide, polypeptide, or protein of interest.

[0109] The present application provides a genetically engineered bacterium, the genetically engineered bacterium comprising within its cell a nucleotide sequence encoding a toxin protein, the amino acid sequence of the toxin protein being set forth in SEQ ID NO: 4 or 13, and preferably the nucleotide sequence encoding the toxin protein being within the genome of the genetically engineered bacterium.

[0110] the genetically engineered bacterium further comprises a plasmid comprising a nucleotide sequence encoding an antitoxin protein; The amino acid sequence of the toxin protein is set forth in SEQ ID NO: 4, and the amino acid sequence of the antitoxin protein comprises the amino acid sequence set forth in SEQ ID NO: 1, or an amino acid sequence having one or more of the following mutations compared to SEQ ID NO: 1: E24D, I36V, V43I; or The amino acid sequence of the toxin protein is set forth in SEQ ID NO: 13, and the amino acid sequence of the antitoxin protein has the amino acid sequence set forth in SEQ ID NO: 9, or an amino acid sequence having one or more mutations of T6I, T43A, K47E, A50S, E51D, G52A, N54K compared to SEQ ID NO: 9; Preferably, the plasmid is an antibiotic resistance gene-free miniplasmid as described herein.

[0111] Preferably, the host cell is a Gram-negative bacterium, preferably Escherichia coli, such as the E. coli strain GT115, Top10, DH5a or BL21(DE3).

[0112] The present application further provides kits comprising the antibiotic resistance gene-free miniplasmids, recombinant host cells, systems or genetically engineered bacteria described herein.

[0113] The present application further provides applications of the antibiotic resistance gene-free miniplasmids, recombinant host cells, systems or genetically engineered bacteria, and kits described herein in the preparation of gene therapy drugs, the preparation of cell therapy drugs, DNA vaccines, virus production, or antibody production.

[0114] In some embodiments, the application is selected from any one of the following (1) to (6): (1) Application in the preparation of drugs or reagents that integrate a target gene expression cassette into the host cell genome (2) Application in the preparation of tools for integrating target gene expression cassettes into the host cell genome (3) Applications in the preparation of genetically modified animals and genetically modified cells (4) Applications in the preparation of drugs or pharmaceuticals for genome research, gene therapy, cell therapy, or stem cell induction and post-induced differentiation (5) Applications in genome research, gene therapy, cell therapy, or preparation of tools for stem cell induction and post-induced differentiation (6) Application in the preparation of kits, engineered immune cells, or pharmaceutical compositions

[0115] This application relates to antibiotic resistance gene-free miniplasmids, recombinant host cells, systems or kits for maintaining plasmid stability in bacterial host cells. Further provide.

[0116] The present application further provides an application of the toxin-antitoxin system for maintaining plasmid stability in a bacterial host cell, wherein the plasmid may contain an antibiotic resistance gene and the toxin-antitoxin system can further improve the stability of the plasmid, or the plasmid may not contain an antibiotic resistance gene and the toxin-antitoxin system can alone maintain the stability of the plasmid.

[0117] In some specific embodiments, the maintenance of plasmid stability can be divided into the following situations: The bacterial plasmid contains the antitoxin protein and antibiotic resistance gene, and the bacterial genome contains the toxin protein gene. The bacterial plasmid contains the toxin protein, the antitoxin protein, and the antibiotic resistance gene. The bacterial plasmid contains the antitoxin protein gene and no antibiotic resistance gene, and the bacterial genome contains the toxin protein gene.

[0118] The present application provides a method for screening a toxin-antitoxin system, the screening method comprising: (I) inserting a gene expression cassette capable of inducing expression of a toxin protein into a bacterial host genome to induce expression of an antitoxin protein; (II) inserting a gene expression cassette capable of inducing expression of a toxin protein into a bacterial host genome, and introducing a plasmid containing an antitoxin gene into the bacterium to induce expression of the antitoxin protein; The gene expressing the toxin protein and the expressed antitoxin gene belong to the same group of toxin-antitoxin systems; If the bacterial host cells in (I) exhibit a suicide effect, the bacterial host cells in (II) grow normally, and the plasmid is stably passaged, an effective toxin-antitoxin system is screened and obtained.

[0119] The present invention will be further described below by way of examples, but the present invention is not limited to the scope of the examples. In the following examples, experimental methods for which specific conditions are not specified are selected according to conventional methods and conditions or product instructions.

[0120] Example 1. Preparation of a plasmid-producing strain by inserting an inducible lethal toxin gene expression cassette into the bacterial genome

[0121] (1) Selection of insertion site in the GT115 genome The lacZ gene of E. coli is a common genomic insertion site for exogenously expressed genes. Primers were designed based on the genome sequence of the model strain MG1655 in a public database, and the lacZ gene DNA in the E. coli GT115 genome (purchased from Invivogen) was amplified and sequenced to confirm the sequence information of the insertion site. Sequencing verification revealed that the lacZ region of the GT115 strain (sequence shown below) was completely identical to that of MG1655, and this region (underlined represents the sequence replaced by the toxin) was selected as the toxin insertion site. TCATACAGAACTGGCGATCGTTCGGCGTATCGCCAAAATCACCGCCGTAAGCCGACCACGGGTTGCCGTTTTCATCATATTTAATCAGCGACTGATCCACCCAGTCCCAGACGAAGCCGCCCTGTAAACGGGGATACTGACGAAACGCCTGCCAGTATTTAGCGAAACCGCCAAGACTGTTACCCATCGCGTGGGCGTA

[0122] FIG. 2 shows a schematic diagram of the insertion of the toxin gene into the GT115 genome.

[0123] (2) Cloning of the toxin gene under the control of the arabinose operon The toxin gene DNA for the TA system was synthesized, and the DNA fragment was cloned into the arabinose-inducible expression pBAD33-oriT plasmid (between the Xba I and Hind III enzyme cleavage sites, with the ORF orientation from Xba I to Hind III) to obtain the toxin-inducible expression element in the form of a plasmid, as shown in Figure 3.

[0124] The positive transformants were then PCR-verified, and the results are shown in Figure 4. The sample order was 1444, ccdB (43009), 1102, hepT, vagD1, 0636, and EcccdB (blank control). Sequencing confirmed that the sequences of the seven pBAD33-oriT-induced expression plasmids containing the toxin were all correct.

[0125] (3) Fusion of the toxin gene and a gentamicin (Gm) resistance screening marker Using the pBAD33-oriT plasmid containing the toxin gene as a template, the complete arabinose operon (1428 bp + toxin gene) was amplified using the ara-toxin-F and ara-toxin-R primers, and then ligated to a gentamicin (Gm) resistance gene sequence flanked by FRT sequences by fusion PCR to obtain a DNA fragment for insertion into the GT115 genome. The locations of each element in the fragment and the fusion PCR primers are shown in Figure 5 (where each toxin gene was already present within its respective MCS), and the up-arm and down-arm portions at both ends are shown. showed the upper and lower arm sequences that were recombined with the GT115 genome.

[0126] (4) Insertion of the fusion toxin gene fragment

[0127] 4.1 Preparation of GT115 electrotransformation competent The pKD46 plasmid was transferred to the GT115 host by chemical transformation. Positive transformants were screened at 30°C using Car300 (carbenicillin, final concentration 300 μg / ml). The positive transformants, GT115 / pKD46 monoclonal cells, were inoculated into liquid LB medium and grown overnight at 30°C. The following day, they were transferred to an Erlenmeyer flask containing 25 ml of fresh LB+Car300 liquid medium at a 1:100 ratio and cultured at 30°C with shaking until the OD. y was 1.0. After adding arabinose to a final concentration of 3 mg / mL, the cells were cultured for approximately 2 hours, immediately cooled to 4°C, and centrifuged at 5,000 rpm at 4°C. The cells were then collected, washed twice with pre-chilled 10% glycerol, and finally dissolved in 10% glycerol and stored in a -80°C refrigerator for use.

[0128] 4.2 Electrotransformation and screening of toxin-inserted strains Approximately 1 μg of the fusion toxin gene fragment and 100 μl of GT115 / pKD46 competent were mixed in an electric transformation cup, and an electric shock was applied for 5 ms at 1250 V using an electroporator. The product was then immediately mixed with 900 μl of liquid LB medium, aspirated, and left to stand in a 30°C incubator for 8 hours to allow homologous recombination between the toxin gene fragment and the GT115 genome to occur.

[0129] 900 μl of the supernatant was centrifuged, and the remaining 100 μl was resuspended and spread onto solid LB+Gm30 (gentamicin final concentration 30 μg / ml)+Glu20 (glucose final concentration 2 mg / ml) plates. The purpose of adding glucose was to minimize toxin leakage due to background expression of the arabinose operon. The plates were incubated overnight at 37°C, under which the temperature-sensitive pKD46 plasmid was automatically deleted. Monoclonal samples were selected and cultured in liquid LB+Gm30 (gentamicin final concentration 30 μg / ml)+Glu20 (glucose final concentration 2 mg / ml) at 37°C. PCR identification was performed using the GT115 genome verification primers, as shown in Figure 6. Sample order: 1444, ccdB (43009), 1102, hepT, vagD1, 0636, EcccdB, and arabinose operon control.

[0130] The size of the GT115 genome control stripe was 1018 bp (not shown), the size after insertion of the arabinose operon without the toxin gene was 2850 bp, and the size after insertion of the arabinose operon with the toxin gene was 2850 + toxin orf.

[0131] Sequencing confirmed that all toxin sequences inserted into the GT115 genome were correct.

[0132] 4.3 Identification of pKD46 plasmid deletion in the GT115::toxin strain The GT115 strain with the toxin gene correctly inserted was scribed onto a solid LB+Gm30 (gentamicin final concentration 30 μg / ml)+Glu20 (glucose final concentration 2 mg / ml) plate and cultured at 37°C to obtain single colonies. Single colonies were then selected and simultaneously spotted onto Gm30+Glu20 and Car300+Glu20 plates. Single colonies that grew normally on Gm30+Glu20 but did not grow on Car300+Glu20 were obtained, i.e., GT115 toxin-inserted strains lacking the pKD46 plasmid.

[0133] Example 2. Screening of TA system toxin genes that can efficiently induce expression in lethal-producing strains Six pairs of potential TA system toxin lethal genes were selected and integrated into the genome (Table 1). These were the RelB / RelE TA pairing system from the marine roseivirga Roseivirga spongicola_GF047 (shown in SEQ ID NOS: 5-6), the CcdB / CcdA (Vibrio) TA pairing system from the marine bacterium Vibrio sp. SCSIO 43009 (shown in SEQ ID NOS: 14-15), the 1444 and 1445 TA pairing system from Shewanella oneidensis MR-1 SO_1444 / SO_1445 (shown in SEQ ID NOS: 23-24), the VagC1 / VagD1 TA pairing system from E. coli 14EC022-1 (shown in SEQ ID NOS: 25-26), and the Pseudoalteromonas sp. SCSIO 43009 TA pairing system from the marine bacterium Vibrio sp. SCSIO 43009 (shown in SEQ ID NOS: 14-15). The TA pairing system was the PrpT / PrpA TA pairing system derived from E. coli 6842 (shown in SEQ ID NOs: 29-30), the HepT / MntA TA pairing system derived from E. coli 14EC01 (shown in SEQ ID NOs: 29-30), and the CcdA / CcdB (E. coli) TA pairing system derived from E. coli O157 (shown in SEQ ID NOs: 35-36).

[0134] First, the toxin gene was fused to an arabinose-inducible promoter, and then inserted into the lacZ gene of the GT115 genome by homologous recombination (specifically described in Example 1). Seven GT115::toxin strains were obtained: GT115::GF_0636, GT115::SO_1444, GT115::ccdB 43009 , GT115::prpT, GT115::vagD1, GT115::ccdB E.coli , and GT115::hepT was obtained. [Table 1]

[0135] By detecting the lethality of the strains under toxin-inducible expression conditions, we screened for TA system toxin genes suitable for antibiotic resistance gene-free plasmid-producing strains. Glucose can repress the pBAD promoter and prevent toxin leakage. Arabinose can activate the pBAD promoter and induce overexpression of toxin. Therefore, we transferred overnight cultured GT115::toxin strains to LB medium containing 0.2% glucose and 0.3% arabinose at 1% each. After 2 h of induction, we spotted the strains on LB plates and calculated the bacterial survival rate.

[0136] The growth of the overnight culture strain is shown in FIG. 7, and the bacterial survival rate after induction is shown in FIG.

[0137] The results showed that when the toxins of the three TA systems (SO_1444, CcdB(43009), and GF_0636) were not induced in addition to the control CcdB toxin (E. coli), the strains showed no obvious growth defects (Figure 7). After induction, the strains all exhibited a significant suicide effect, with lethality rates exceeding 99%, meeting the requirements for antibiotic resistance gene-free plasmid-induced lethal production strains. Further experiments can be conducted to verify the stability of accessory plasmid production in the above-screened strains. The three TA systems (VagC1 / VagD1, PrpT / PrpA, and HepT / MntA) did not show any obvious cytotoxicity after toxin gene expression, and the production strains rarely died, demonstrating that these three TA systems are not suitable for the production of antibiotic resistance gene-free plasmids.

[0138] Example 3. Preparation of clones of antibiotic resistance gene-free miniplasmid mother vectors and their effect on the growth stability of production strains

[0139] The results of Example 2 demonstrated that only the induced expression of the appropriate toxin type can effectively induce efficient suicide in a plasmid-free production strain. This example demonstrated that a production strain expressing an antitoxin can survive only if the accompanying plasmid expressing the antitoxin gene is present in the cells. Based on this, we cultured GT115::toxin by adding arabinose to the medium to induce toxin expression, and then inserted the corresponding antitoxin gene into the plasmid. Only strains with the correctly inserted and expressed antitoxin gene survived. Using the basic framework of the pCpGfree MCS plasmid, which is widely used in eukaryotic expression, the bleomycin resistance gene (bleoR) of the original plasmid was replaced with an antitoxin gene matching the toxin-containing production strain (Figure 9A). The specific manipulation method is as follows: 1. Linearized pCpGfree MCS plasmid was obtained by PCR amplification. 2.An antitoxin gene expression cassette was synthesized without CpG DNA motifs and had a 20 bp sequence at the 5' end that was homologous to the vector end. 3. Using a commercial recombination kit, the antitoxin gene was recombined into the pCpGfree MCS plasmid to replace the bleomycin resistance expression cassette. 4. The recombinant product CaCl2 was transformed into GT115::toxin competent cells, and the cells were plated on LB+Gm10+0.6% Ara (arabinose). Primer PCR was used to verify whether the target gene was inserted into the transformants, and the positive transformants were further purified.

[0140] F2 / R2 amplified a fragment containing the R6K antibiotic resistance gene-free miniplasmid replicon and antitoxin gene (Figure 5A). Eight clones were randomly selected from the LB+Gm10+0.6% Ara plate and PCR validation was performed using the F2 / R2 primers. The result was GT115::ccdB E.coli , GT115::SO_1444, GT115::ccdB43009 Both the GT115::GF_0636 toxin-expressing production strains contained the antibiotic resistance gene-free plasmid pCpG-ccdA, into which the corresponding antitoxin had been inserted. E.coli , pCpG-SO_1445, pCpG-ccdA 43009 , pCpG-GF_0636 can be obtained, and the frequencies are The results showed that the efficiencies were (8 / 8) 100%, (6 / 8) 75%, (8 / 8) 100%, and (5 / 8) 62.5% (Figure 9B).

[0141] To examine whether GT115::toxin / pCpG-antitoxin affects the growth of the strains, we used GT115 with the pBAD promoter (GT115::pBAD) as a control, and strains GT115::SO_1444 / pCpG-SO_1445, GT115::ccdB 43009 / pCpG-ccdA 43009 , GT115::GF_0636 / pCpG-GF_0637, GT115::ccdB E.coli / pCpG-ccdA E.coli OD of the LB medium containing 0.3% arabinose for 0, 4, and 8 hours. 600 The results showed that the strains containing these four TA systems showed no significant difference in growth compared to the control (Figure 10).

[0142] Example 4. Cloning method and efficiency of foreign genes using pCpG-antitoxin antibiotic resistance gene-free miniplasmid

[0143] To verify the cloning efficiency of the pCpG-antitoxin plasmid, we cloned the egfp gene into pCpG-ccdA E.coli , pCpG-SO_1445, pCpG-ccdA 43009 The fragments were inserted into pCpG-GF_0637. The specific procedure is as follows. 1. Using pCpG-antitoxiN as a template, the linearized pCpG-antitoxin plasmid was obtained by reverse amplification with pCpG-BglII-F / pCpG-NheI-R primers. 2. The egfp gene was amplified with EGFP-F / -R primers, and homologous fragments of the terminal ends of the pCpG-antitoxin insertion site were introduced at both ends of the EGFP-F / -R primers. 3. Using commercially available recombinase, egfp was inserted between BglII and NheI on pCpG-antitoxin. 4. The recombinant product was transformed into GT115::toxin competent cells and plated on LB+Gm10+0.6% Ara (arabinose). 5. Using two pairs of primers, F2 / R2 and EGFP-F / -R, we verified whether the antitoxin gene and egfp were inserted into the transformants by PCR. Positive transformants were further purified.

[0144] F2 / R2 amplified a fragment containing the R6K replicon and antitoxin gene, where the antitoxin gene expression cassette codons were optimized to lack CpG DNA motifs. EGFP-F / -R amplified eGFP (shown in Figure 11A). Eight or 16 clones were randomly selected from the LB + Gm10 + 0.6% Ara plate and PCR validation was performed using F2 / R2 and EGFP-F / -R primers. GT115::ccdB E.coli , GT115::SO_1444, GT115::ccdB 43009 Among the GT115::GF_0636 toxin-expressing strains, egfp was expressed using the corresponding antibiotic resistance gene-free plasmid pCpG-ccdA E.coli , pCpG-SO_1445, pCpG-ccdA 43009 , successfully inserted into pCpG-GF_0637, and the recombinant plasmid pCpG-ccdA E.coli -egfp, pCpG-SO_1445-egfp, pCpG-ccdA 43009pCpG-GF_0637-egfp and pCpG-GF_0637-egfp were obtained, and the efficiencies were shown to be (6 / 8) 75%, (5 / 8) 62.5%, (7 / 8) 87.5%, and (5 / 16) 31.25%, respectively (Figure 11B).

[0145] Example 5. Antibiotic resistance gene-free miniplasmid pCpG-antitoxin Detection of production passage stability

[0146] To examine the stability of antibiotic resistance gene-free miniplasmid production in the present production strain, we used the pCpGfree-MCS plasmid as a control and the pCpG-SO_1445 and pCpG-ccdA plasmids that did not contain the antitoxin expression cassette DNA. E.coli , pCpG-ccdA 43009 Subculture and stability testing were performed on the pCpG-GF_0637 plasmid. Two monoclonal clones per sample were randomly selected and inoculated into liquid LB medium for overnight incubation. One-hundredth of the clones were transferred to 25 mL of liquid LB medium in an Erlenmeyer flask for antibiotic resistance gene-free subculture. The cells were collected every 12 hours, and the plasmid was extracted. The plasmid DNA concentration was measured on an agarose gel. The DNA gel image and plasmid concentration distribution are shown in Figure 12 and Table 2. These results indicate that the antibiotic resistance gene-free miniplasmid pCpG-antitoxin subculture was stable in 25 mL of LB medium in the medium culture system, especially pCpG-ccdA. 43009 After two days of passaging, the plasmid yield was significantly higher than that of the control pCpGfree-MCS and pCpG-ccdA. E.coli was shown to be higher. [Table 2]

[0147] Example 6. Detection of the production and passage stability of plasmid pCpG-antitoxin-egfp

[0148] To examine the stability of the antibiotic resistance gene-free miniplasmid after the eGFP foreign gene was inserted, we used the pCpGfree-MCS plasmid as a control (using a toxin-free host), pCpG-SO_1445-egfp, pCpG-ccdA 43009 Subculture was performed on pCpG-SO_1445-egfp, pCpG-GF_0637-egfp. First, these four plasmids were purified and maintained in bacteria. Two monoclonal clones were randomly selected and subcultured in LB medium to remove antibiotic resistance genes. The cells were transferred every 12 hours to collect the bacterial cells, extract the plasmids, and measure the concentration of the plasmid DNA on an agarose gel. In the experiment, after a total of six days of subculture, pCpG-SO_1445-egfp, pCpG-ccdA 43009 The results of the three single bacteria, pCpG-GF_0637-egfp, and pCpG-GF_0637-egfp, were consistently stable, and the yields were higher than those of the control pCpGfree-MCS (Figures 13 and 14, Table 3). [Table 3]

[0149] where pCpG: pCpGfree-MCS, ccdA 43009 -egfp:pCpG-ccdA 43009 -egfp, GF_0637-egfp:pCpG-GF_0637-egfp, SO_1445-egfp: pCpG-SO_1445-egfp.

[0150] Example 7: Efficacy of truncated antitoxin in producing antibiotic resistance gene-free miniplasmids

[0151] To further reduce the DNA length of the antibiotic resistance gene-free miniplasmid, we performed various C-terminal truncations on the expression cassette of the antitoxin GF_0637, including 60 aa (SEQ ID NO: 2), 50 aa (SEQ ID NO: 1), 40 aa (SEQ ID NO: 43), and 30 aa (SEQ ID NO: 44) (Figure 21A). Plasmids carrying the uncleaved and cleaved antitoxin GF_0637 and a plasmid carrying the toxin GF_0636 were cotransfected into E. coli. Overexpression of GF_0636 and an empty vector in E. coli caused significant growth inhibition, while coexpression of GF_0637 completely neutralized GF_0636 (Figure 21B). The results were as expected: different C-terminal truncations of GF_0637 exhibited different abilities to antagonize GF_0636 toxicity. Growth and CFU results indicated that GF_0637, including 60-amino acid or 50-amino acid truncated fragments, was useful as a full-length antitoxin. GF_0637 truncated to 40 amino acids and 30 amino acids completely lost its ability to neutralize toxin toxicity (Figure 21B). To confirm this result, based on the GF_0636 / GF_0637 selection system, we cloned the GF_0637 truncated fragments GF_06371-50 and GF_06371-40 into the pCpGfree plasmid to replace full-length GF_0637 and test their efficiency. As expected, the first 50 amino acids of GF_0637 were the minimum required for antitoxin function in DNA cloning (Figure 21C).

[0152] Based on the same strategy and principle, we also performed corresponding truncations on the expression cassette of ccdA 43009, and the results showed that truncation of amino acids 2 to 9 and / or 78 to 81 of ccdA 43009 was also effective, and the cleavage sequences are shown in SEQ ID NOs: 9 to 11. Therefore, those skilled in the art are well aware that even if these antitoxins are truncated to some extent, the conventional functions can be properly maintained and the production of antibiotic resistance gene-free miniplasmids can be maintained.

[0153] Example 8: Application and effect of antibiotic resistance gene-free miniplasmid as a foreign gene expression vector in eukaryotic cells

[0154] Research purpose: In CHO cells, we compared the biological functions of antibiotic resistance gene-free miniplasmids pCpG-ccdA43009-egfp and pCpG-GF_0637-egfp with the antibiotic backbone-containing pCpGfree-MCS plasmid, and observed the expression levels and persistence of expression of the different plasmids.

[0155] Research method: Jurkat cells, a type of immune cell line, were used. Approximately 4 μg of cells were electrotransfected and continuously observed for one week. Fluorescence images were taken, and the persistence of expression was analyzed by flow cytometry for 2, 4, and 6 days. The cell groupings are shown in the table below. TIFF2026502581000004.tif74158

[0156] The test results are shown in Figures 22 and 23. Both the fluorescence photographs and flow cytometry results showed that the expression level and persistence of the cells grouped with the antibiotic resistance gene-free miniplasmid of the present application were better, indicating that the antibiotic resistance gene-free miniplasmid of the present application contributes to the expression of the plasmid in eukaryotic cells.

[0157] Example 9: Application and effectiveness of antibiotic resistance gene-free miniplasmid as a gene integration donor in eukaryotic cells

[0158] In this example, ZB transposase was used to integrate an eGFP expression cassette carried on an antibiotic resistance gene-free miniplasmid into Jurkat and PBMCs, and the effect of antibiotic resistance gene-free miniplasmid transposon-mediated gene integration on transposition efficiency was examined.

[0159] The ZB transposase was the transposase in CN105018523B. The ZB transposon vectors corresponding to the ZB transposase were an antibiotic resistance gene-free miniplasmid and a puc57 plasmid, respectively. The antibiotic resistance gene-free miniplasmid pTini-ZB-dCGEGFP carried an eGFP expression cassette in the pCpGfree MCS-0637 plasmid and employed the R6K replicon. The control plasmid was the puc57 replicon plasmid pZB-dCG EGFP. The puc57 plasmid was used to carry an eGFP expression cassette. Zb transposase was used in the form of mRNA, and 20 μg was used. The Zb transposon vectors pTini-ZB-dCGEGFP and pZB-dCG EGFP V3.0 were used in the form of mRNA, each at 4 μg. Experiments were divided into four groups: pZB-dCG EGFP V3.0, pZB-dCG EGFP V3.0 + ZB mRNA, pTini-ZB-dCGEGFP, and pTini-ZB-dCGEGFP + ZB mRNA, with three experimental batches per group.

[0160] Using the Lonza2b electrotransformation program, Jurkat cells and PBMCs were electrotransformed with ZB transposase and the transposon vector, followed by continuous culture and passage in complete medium. Jurkat cells were sampled on days 5, 9, and 13 after electrotransformation and EGFP expression was monitored by flow cytometry. PBMCs were sampled on days 7 and 14 after electrotransformation and EGFP expression was monitored by flow cytometry. The results are shown in Figures 24 and 25. As can be seen, on day 13, the final positive rate for Jurkat cells was higher with the antibiotic resistance gene-free miniplasmid, and on day 14, the final positive rate for PBMCs was higher with the antibiotic resistance gene-free miniplasmid. Therefore, the results of this example demonstrate that the antibiotic resistance gene-free miniplasmid of the present invention can significantly improve the transposon-mediated gene integration transposition efficiency, up to 100%.

[0161] Example 10: Use of the TA system in the production of transcription template plasmids and in the preparation of size-reduced, antibiotic resistance gene-free puc57 replicon plasmids

[0162] The ampicillin resistance gene expression cassette on the original mRNA transcription template plasmid pT7-6.5-MDR1-EGFP (shown in SEQ ID NO: 45) was replaced with the antitoxin expression cassette to obtain the plasmid pucTA-6.5A-MDR1-EGFP-90A (shown in SEQ ID NO: 46).

[0163] The pucTA-6.5A-MDR1-EGFP-90A strain was scribed onto a TB solid plate containing 0.3% L-arabinose. Monoclonal clones were selected and inoculated into 2 ml of TB medium containing 0.3% L-arabinose. After overnight incubation, 1.4 ml of each culture was sampled for plasmid extraction. Quantification was performed using a nanodrop ultra-microspectrophotometer. The plasmid yields of clones 1-4 were 3.7 μg / ml, 3.8 μg / ml, 4.8 μg / ml, and 4.7 μg / ml, respectively. Agarose gel electrophoresis revealed that the plasmids extracted from all four clones were of the expected size and of high purity, as shown in Figure 26.

[0164] In addition, one clone was selected and subcultured every 24 hours for nine consecutive generations, and a small amount of plasmid was extracted. The yield of the plasmid was 3 μg / ml to 5 μg / ml in each case, and the agarose gel electrophoresis detection is shown in Figure 27. The results showed that the plasmid was stably present in the bacteria under the screening pressure of 0.3% L-arabinose.

[0165] The above experimental results showed that the antibiotic resistance gene-free production system could also be successfully applied to similar types of plasmids such as puc57, ColE1, and pMB1. Replacing the antibiotic expression cassette not only reduced the size of the plasmid but also increased the safety of plasmid production.

Claims

1. An antibiotic resistance gene-free miniplasmid comprising a nucleotide sequence encoding an antitoxin protein and a replicon, The amino acid sequence of the antitoxin protein is (1) the amino acid sequence shown in SEQ ID NO: 1, or an amino acid sequence having one or more mutations of E24D, I36V, and V43I compared to SEQ ID NO: 1, or (2) the amino acid sequence shown in SEQ ID NO: 9, or an amino acid sequence having one or more mutations of T6I, T43A, K47E, A50S, E51D, G52A, and N54K compared to SEQ ID NO: 9; An antibiotic resistance gene-free miniplasmid, characterized in that the length of the replicon is ≦800 bp, preferably ≦600 bp or ≦300 bp.

2. The antibiotic resistance gene-free miniplasmid of claim 1, characterized in that the amino acid sequence of the antitoxin protein is set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO:

12.

3. 2. The antibiotic resistance gene-free miniplasmid of claim 1, wherein the replicon is selected from ColE1, ColE2, pMB1, pSC101, RSF, R6K, pUC57, RK2 and p15A, preferably R6K or pUC57.

4. 4. The antibiotic resistance gene-free miniplasmid according to any one of claims 1 to 3, characterized in that the length of the plasmid backbone of the antibiotic resistance gene-free miniplasmid is ≦1000 bp, preferably ≦900 bp, ≦800 bp or ≦600 bp.

5. The antibiotic resistance gene-free miniplasmid according to any one of claims 1 to 4, characterized in that the nucleotide sequence encoding the antitoxin protein does not contain a CpG motif, and preferably the nucleotide sequence encoding the antitoxin protein is set forth in SEQ ID NO: 7 or SEQ ID NO:

16.

6. The antibiotic resistance gene-free miniplasmid according to any one of claims 1 to 5, characterized in that the nucleotide sequence of the replicon does not contain any CpG motifs.

7. The antibiotic resistance gene-free miniplasmid according to any one of claims 1 to 6, characterized in that the antibiotic resistance gene-free miniplasmid comprises a structured DNA sequence selected from polyA repeats, SV40 replication origin, viral LTR, lentiviral LTR, retroviral LTR, transposon IR / DR repeat sequence, AAV ITR, transposon ITR, CMV enhancer, and SV40 enhancer.

8. 8. The antibiotic resistance gene-free miniplasmid according to claim 7, wherein the antibiotic resistance gene-free miniplasmid is selected from a Sleeping Beauty transposon vector, a PiggyBac transposon vector, a ZB transposon vector, a PS transposon vector, a Tol2 transposon vector, and a polyA-containing mRNA vector.

9. The antibiotic resistance gene-free miniplasmid according to any one of claims 1 to 8, characterized in that the antibiotic resistance gene-free miniplasmid comprises a foreign gene, preferably the foreign gene encodes a chimeric antigen receptor and / or an antibody.

10. A recombinant host cell comprising an antibiotic resistance gene-free miniplasmid according to any one of claims 1 to 9.

11. A method for preparing cells, comprising introducing the antibiotic resistance gene-free miniplasmid according to any one of claims 1 to 9 into cells.

12. 12. The method of claim 11, wherein the cell is derived from an animal, such as a vertebrate or invertebrate, preferably a mammal, more preferably a human, and / or the cell is an immune cell, preferably a T cell.

13. 13. The method of claim 11 or 12, wherein the introducing comprises transfection of the cells by electroporation, microinjection, calcium phosphate precipitation, cationic polymers, dendrimers, liposomes, biolistic bombardment, fugene, direct sonic loading, cell extrusion, optical transfection, protoplast fusion, impalefection, magnetic transfection, nuclear transfection or any combination thereof, preferably transfection of the cells by electroporation.

14. A pharmaceutical composition comprising an antibiotic resistance gene-free miniplasmid according to any one of claims 1 to 9 or a recombinant host cell according to claim 10, and optionally a pharmaceutically acceptable excipient.

15. A plasmid production system comprising a host cell comprising a nucleotide sequence encoding a toxin protein and a plasmid comprising a nucleotide sequence encoding an antitoxin protein, The amino acid sequence of the toxin protein is set forth in SEQ ID NO: 4, and the amino acid sequence of the antitoxin protein comprises the amino acid sequence set forth in SEQ ID NO: 1, or an amino acid sequence having one or more of the following mutations compared to SEQ ID NO: 1: E24D, I36V, V43I; or A plasmid production system characterized in that the amino acid sequence of the toxin protein is set forth in SEQ ID NO: 13, and the amino acid sequence of the antitoxin protein comprises the amino acid sequence set forth in SEQ ID NO: 9, or an amino acid sequence having one or more mutations of T6I, T43A, K47E, A50S, E51D, G52A, and N54K compared to SEQ ID NO:

9.

16. The system of claim 15, wherein the amino acid sequence of the toxin protein is set forth in SEQ ID NO: 4 and the amino acid sequence of the antitoxin protein is set forth in SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or the amino acid sequence of the toxin protein is set forth in SEQ ID NO: 13 and the amino acid sequence of the antitoxin protein is set forth in SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ ID NO:

12.

17. 17. The system according to claim 15 or 16, wherein the host cell is a Gram-negative bacterium, preferably Escherichia coli, such as the E. coli strain GT115, Top10, DH5a or BL21(DE3).

18. The system according to any one of claims 15 to 17, characterized in that the host cell comprises a gene expression cassette capable of inducing expression of a toxin, and the gene expression cassette for the toxin protein comprises an operon or promoter capable of inducing expression of the toxin protein, preferably the operon or promoter is selected from the group consisting of the Lac lactose operon, the L-arabinose-inducible pBAD promoter, the L-rhamnose-inducible rhapBAD promoter, or the λPL / PR-clts857 temperature-sensitive promoter.

19. 19. The system of any one of claims 15 to 18, wherein the plasmid comprises a replicon, preferably the replicon is selected from ColE1, ColE2, pMB1, pSC101, RSF, R6K, pUC57, RK2 and p15A, preferably the R6K or pUC57 replicon.

20. 20. The system of any one of claims 15 to 19, wherein the plasmid does not contain an antibiotic resistance gene and / or the length of the plasmid backbone is ≦1000 bp, preferably ≦900 bp, ≦800 bp or ≦600 bp.

21. 21. The system of claim 19 or 20, wherein the nucleotide sequence encoding the replicon and / or antitoxin protein does not contain CpG motifs.

22. A method for producing a plasmid using the system according to any one of claims 15 to 21, comprising: (1) transforming a plasmid containing a nucleotide sequence encoding an antitoxin protein into a host cell containing a nucleotide sequence encoding a toxin protein; (2) inducing expression of the toxin protein during cultivation of the bacterial host cell to express the antitoxin protein; (3) obtaining the plasmid, Preferably, the plasmid is an antibiotic resistance gene-free miniplasmid according to any one of claims 1 to 9.

23. 22. A method for producing a recombinant peptide, polypeptide or protein of interest using the system of any one of claims 15 to 21, wherein the plasmid further comprises a gene expression cassette encoding the recombinant peptide, polypeptide or protein of interest, the method comprising culturing the system and recovering the recombinant peptide, polypeptide or protein of interest.

24. a genetically engineered bacterium, the genetically engineered bacterium comprising, within the cell thereof, a nucleotide sequence encoding a toxin protein; The amino acid sequence of the toxin protein is set forth in SEQ ID NO: 4 or 13, and preferably the nucleotide sequence encoding the toxin protein is within the genome of the genetically engineered bacterium.

25. the genetically engineered bacterium further comprises a plasmid comprising a nucleotide sequence encoding an antitoxin protein; The amino acid sequence of the toxin protein is set forth in SEQ ID NO: 4, and the amino acid sequence of the antitoxin protein comprises the amino acid sequence set forth in SEQ ID NO: 1, or an amino acid sequence having one or more of the following mutations compared to SEQ ID NO: 1: E24D, I36V, V43I; or The amino acid sequence of the toxin protein is set forth in SEQ ID NO: 13, and the amino acid sequence of the antitoxin protein has the amino acid sequence set forth in SEQ ID NO: 9, or an amino acid sequence having one or more mutations of T6I, T43A, K47E, A50S, E51D, G52A, N54K compared to SEQ ID NO: 9; 25. The genetically engineered bacterium according to claim 24, characterized in that the plasmid is preferably an antibiotic resistance gene-free miniplasmid according to any one of claims 1 to 9.

26. 26. The genetically engineered bacterium according to claim 24 or 25, wherein the genetically engineered bacterium is a Gram-negative bacterium, preferably Escherichia coli, such as the E. coli strain GT115, Top10, DH5a or BL21(DE3).

27. A kit comprising an antibiotic resistance gene-free miniplasmid according to any one of claims 1 to 9, a recombinant host cell according to claim 10, a system according to any one of claims 15 to 21 or a genetically engineered bacterium according to any one of claims 24 to 26.

28. Application of the antibiotic resistance gene-free miniplasmid of any one of claims 1 to 9, the recombinant host cell of claim 10, the system of any one of claims 15 to 21, the genetically engineered bacterium of any one of claims 24 to 26 or the kit of claim 27 in the preparation of gene therapy drugs, the preparation of cell therapy drugs, DNA vaccines, virus production or antibody production.

29. 28. Application of an antibiotic resistance gene-free miniplasmid according to any one of claims 1 to 9, a recombinant host cell according to claim 10, a system according to any one of claims 15 to 21, a genetically engineered bacterium according to any one of claims 24 to 26 or a kit according to claim 27 for maintaining plasmid stability in a bacterial host cell.

Images