Materials and methods for modulating expression

Abstract

The present disclosure relates to methods for modulating the transcription of target genes using transcriptional modulators, termed RNA-based transcriptional modulators or "RPMs," which attract transcriptional regulatory factors to those genes.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 63 / 440,060, filed January 19, 2023, which is incorporated herein by reference in its entirety.

[0002] INCORPORATION-BY-REFERENCE TO SEQUENCE LISTING This application contains as a separate part of the disclosure a Sequence Listing in computer readable format (Filename: 56269_Seqlisting.xml, Size: 151,499 bytes, Created: January 18, 2024), which is incorporated herein in its entirety.

[0003] The present disclosure relates to methods for regulating the transcription of target genes using RNA-based promoter modulators (RPMs), which attract transcriptional regulators to those genes. [Background technology]

[0004] The U7 small nuclear RNA was originally identified as a component of the U7snRNP, a ribonucleoprotein complex specialized for the processing of histone mRNAs.

[0005] Since its initial discovery, the U7 small nuclear RNA has been modified for use in gene therapy through transcriptional splicing modification in spinal muscular atrophy, amyotrophic lateral sclerosis, Duchenne muscular dystrophy, and β-thalassemia / hemoglobin E disorders.

[0006] There continues to be a need in the art for products and methods for regulating transcription and treating conditions that result from aberrant transcription. Summary of the Invention

[0007] The present disclosure provides RNAs (referred to herein as "RPMs") designed to alter transcription of target genes by a mechanism distinct from splicing modification. RPMs include (a) a DNA-binding component that binds to regulatory regions, including but not limited to, promoter regions, of a gene of interest, and (b) a tail that includes regulatory elements that attract proteins that increase or decrease transcription, including but not limited to, transcriptional activators, transcriptional repressors, DNA-modifying enzymes, and RNA polymerase II.

[0008] While incorporating several U7 elements, RPM differs from U7 small nuclear RNAs in many ways. U7 small nuclear RNAs bind to RNA transcripts, while RPMs are designed to bind to genomic DNA. This results in differences in the orientation of some components of RPMs and U7 small nuclear RNAs. In one configuration, the binding sequence of RPM binds to the 5' DNA strand (sense strand) of a gene. The tail of the regulatory element of RPM is oriented so that proteins that bind to the regulatory element also contact the 5' DNA strand of the promoter. Furthermore, RPMs are assembled so that the sm OPT consensus sequence (which can bind to sm and sm-like proteins) and a structured RNA hairpin are located downstream of the promoter, and these components do not interfere with the binding and transcription of transcription factors or RNA polymerase II. Thus, the binding sequence of RPM is in the reverse-complementary orientation of the DNA 5' binding site, and the tail of the regulatory element is in the opposite orientation to the endogenous regulatory element (or transcription factor binding site). Alternatively, RPM can target the 3' DNA strand (antisense / non-coding strand) of a gene. The sm OPT and hairpin are important for stabilizing the U7 small nuclear RNA. The binding sequences and regulatory element tails of RPM can be tailored to tailor RPM for different effects on different target genes and transcription.

[0009] Thus, the present disclosure provides an RPM comprising (a) a regulatory element tail, (b) a binding sequence, and (c) an Sm OPT consensus sequence and a hairpin. In one example, the orientation of (a), (b), and (c) in the RPM is 5' to 3', and (b) the binding sequence binds to the sense strand of a target gene promoter.

[0010] The present disclosure provides exemplary SMN 2RPMs that include: (a) a regulatory element A tail encoded by ACCCTTCTCCGGCCGCTGAC (SEQ ID NO: 1), or a regulatory element B tail encoded by TCCGCTCTGGGGCGCGCACACCCTCGCCCGCACTTCTCCCCTCGTCCGGCACGGACTGACCGCACACGAATAACACATCCGACCAGAGCT (SEQ ID NO: 2), and (b) binding sequence 1 encoded by AGACGGGGTTTCGGCATGTT (SEQ ID NO: 3), binding sequence 2 encoded by ATTGTGTAGGCTGGTCTGA (SEQ ID NO: 4), or binding sequence 3 encoded by GGGGCAGGAAGGAAGGCAGA (SEQ ID NO: 5).

[0011] The present disclosure provides an exemplary TCF4 RPM that includes: (a) a regulatory element A tail encoded by ACCCTTCTCCGGCCGCTGAC (SEQ ID NO: 1), or a regulatory element B tail encoded by TCCGCTCTGGGGCGCGCACACCCTCGCCCGCACTTCTCCCCTCGTCCGGCACGGACTGACCGCACACGAATAACACATCCGACCAGAGCT (SEQ ID NO: 2), and (b) binding sequence 1 encoded by GTGGTAAACAGAGCGCCTAG (SEQ ID NO: 6).

[0012] The present disclosure provides a nucleic acid encoding an RPM, the nucleic acid comprising (a) a DNA encoding (i) the RPM of claim 1 or 2, (ii) the SMN2 RPM of claim 3, or (iii) the TCF4 RPM of claim 4, (b) a DNA construct depicted in Figure 7A or 7B, or (c) a DNA at least 90% identical to the DNA of (a) or the DNA construct of (b). The nucleic acid of (a) can further comprise a promoter driving expression of the RPM. The promoter can be a U7 promoter. In other examples, the promoter can be a U6 promoter, a tRNA promoter, an H1 promoter, a minimal CMV promoter, a T7 promoter, an EF1-alpha promoter, or a minimal EF1-alpha promoter.

[0013] The present disclosure provides a recombinant adeno-associated virus (rAAV) comprising a nucleic acid provided herein. The rAAV can be a single-stranded AAV (ssAAV) or a self-complementary AAV (scAAV). The rAAV can be rAAV1, rAAV2, rAAV3, rAAV4, rAAV5, rAAV6, rAAV7, rAAV8, rAAV9, rAAV10, rAAV11, rAAV12, rAAV13, rAAV-anc80, rAAV rh.74, rAAV rh.8, rAAVrh.10, AAV-B1, MyoAAV, MYOAAV1A, SLB101, M1, or M3, or a derivative thereof.

[0014] The present disclosure provides a composition comprising: (a) a nucleic acid provided herein, or an rAAV provided herein, and a pharmaceutically acceptable carrier.

[0015] The present disclosure provides methods of modulating expression of a target gene in a cell, comprising delivering to the cell an RPM provided herein.

[0016] The present disclosure provides methods for modulating expression of a target gene in a cell, the method comprising contacting the cell with (a) a nucleic acid provided herein, (b) an rAAV provided herein, or (c) a composition provided herein. The method can increase expression. The method can decrease expression.

[0017] The present disclosure provides nucleic acids, rAAVs, and compositions formulated for intramuscular injection, intrathecal injection, transdermal delivery, or injection into the bloodstream.

[0018] The present disclosure provides a method of treating spinal muscular atrophy in a subject, the method comprising delivering an SMN2 RPM to the subject.

[0019] The present disclosure provides a method of treating Pitt-Hopkins syndrome in a subject, the method comprising delivering a TCF4 RPM to the subject. [Brief explanation of the drawings]

[0020] [Figure 1] Figure 1(A) is a schematic diagram illustrating the binding of an RPM that is the reverse complement of the sense strand of a target DNA, showing the 5' to 3' arrangement of the RPM's components. (A) The RPM is oriented in the target DNA such that the regulatory element tail and binding sequence are 3' to the promoter. Figure 1(B) shows an alternative orientation of an RPM that is the reverse complement of the antisense / non-coding strand of the target DNA. [Figure 2] Binding motifs in the SMN2 promoter outside previously identified binding sites for transcription factors are shown (modified from Monami et al. 1999) (A). The sequence encoding the SMN2 promoter binding sequence of RPM is shown in sense and reverse complement orientation (B). [Figure 3]The design of the RPM regulatory elements and SMN2-binding sequences in the SMN2 RPM constructs exemplified herein is shown. SMN2 RPM constructs A1-2 feature regulatory element A having binding sequences 1-3, respectively. SMN2 RPM constructs B1-3 feature regulatory element B having binding sequences 1-3, respectively. [Figure 4] The TATA box and enhancer elements within the 2000 bp region upstream of the TCF4 exons are shown. [Figure 5] The target position of the TCF4 promoter binding sequence 1692 bp upstream of TCF4-201 EXON1 (A) is shown. The TCF4 promoter binding sequence is shown in sense and reverse complement orientation (B). [Figure 6] The design of the RPM regulatory elements and TCF4 binding sequences in the TCF4 RPM constructs exemplified herein is shown. TCF4 RPM construct A1 features regulatory element A with binding sequence 1. TCF4 RPM construct B1 features regulatory element B with binding sequence 1. [Figure 7] The TCF4 RPM DNA constructs are shown, with the cloning sites at the end of each construct indicated in uppercase letters, followed by the cloning site at the beginning of each construct, where the U7 promoter is indicated in lowercase letters, the sequence encoding the regulatory element tail is indicated in uppercase letters, the sequence encoding the binding sequence is indicated in underlined uppercase letters, the sequence encoding the sm OPT sequence is indicated in lowercase letters, and the sequence encoding the U7 terminator is shaded. [Figure 8]Figure 1 shows that the U7.TCF4 plasmid construct upregulates TCF4 expression in HEK-293 cells. U7 expression analyzed by PCR and gel electrophoresis demonstrates the presence of U7 transcripts 72 hours post-transfection in HEK-293 cells transfected with the B1.U7.TCF4 plasmid construct (A). qPCR demonstrates that the B1.U7.TCF4 plasmid construct increases total TCF4 mRNA expression by up to two-fold in 293 cells 72 hours post-transfection. The primer pair amplifies all TCF4 isoforms (B). Western blot analysis demonstrates that the B1.U7.TCF4 plasmid construct increases total TCF4 protein by up to 1.5-fold in 293 cells 72 hours post-transfection (C). [Figure 9] AAV production plasmids and sequences of the plasmids are shown: (A) pscAAV.A1-U7.SMN(5´-3´), (B) pscAAV.A2-U7.SMN(5´-3´), (C) pscAAV.A3-U7.SMN(5´-3´), (D) pscAAV.B1-U7.SMN(5´-3´), (E) pscAAV.B2-U7.SMN(5´-3´), (F) pscAAV.B3-U7.SMN(5´-3´), (G) pscAAV.A1-U7.TCF4(3´-5´), and (H) pscAAV.B1-U7.TCF4(3´-5´). [Figure 10] Figure 1 shows elevated U7 PRM expression and concomitant increase in TCF4 expression in the AAV9.U7.TCF4-treated hTcf4-H2B-EGFP-Nluc MEF cell line. HOMO MEFs are mouse embryonic fibroblasts homozygous for the humanized TCF4 promoter-driven expression. Cells were subjected to insulin-mediated transduction with AAV9.RFP or AAV9.U7.TCF4 and analyzed for U7 expression and murine TCF4 expression 72 hours after transduction. [Figure 11] Figure 1 shows increased TCF4 mRNA and protein expression following scAAV9.B1.U7.TCF4 treatment in an in vitro disease model of induced astrocytes from patients with Pitt-Hopkin's syndrome (PTHS). [Figure 12]In another in vitro disease model, co-culture of PTHS patient-derived induced astrocytes with mouse HB9-GFP neurons, we show that treatment of PTHS patient-induced astrocytes with scAAV9.B1.U7.TCF4 results in a significant rescue of neuronal survival. DETAILED DESCRIPTION OF THE INVENTION

[0021] In the RPM approach, RPMs find target sites within the genome (variously referred to herein as target motifs, binding sites, or binding motifs), attract endogenous or exogenous intracellular proteins, and alter gene expression at those sites. This approach utilizes all mammalian-derived components, can utilize endogenous proteins, and is highly specific, stable, and safe.

[0022] RPM The present disclosure provides an RPM comprising: (a) a regulatory element tail; (b) a binding sequence; and (c) an Sm OPT consensus sequence and a hairpin. In one example, the orientation of (a), (b), and (c) in the RPM is 5' to 3', and (b) the binding sequence binds to the sense strand of a target gene promoter.

[0023] 3 and 6 also show examples of sequences encoding regulatory element tails that can be used in RPMs as described herein.

[0024] 3 and 6 show examples of sequences encoding binding sequences that can be used in RPMs as described herein.

[0025] The present disclosure provides exemplary SMN2 RPMs that include: (a) a regulatory element A tail encoded by ACCCTTCTCCGGCCGCTGAC (SEQ ID NO: 1), or a regulatory element B tail encoded by TCCGCTCTGGGGCGCGCACACCCTCGCCCGCACTTCTCCCCTCGTCCGGCACGGACTGACCGCACACGAATAACACATCCGACCAGAGCT (SEQ ID NO: 2), and (b) binding sequence 1 encoded by AGACGGGGTTTCGGCATGTT (SEQ ID NO: 3), binding sequence 2 encoded by ATTGTGTAGGCTGGTCTGA (SEQ ID NO: 4), or binding sequence 3 encoded by GGGGCAGGAAGGAAGGCAGA (SEQ ID NO: 5).

[0026] The present disclosure provides an exemplary TCF4 RPM that includes: (a) a regulatory element A tail encoded by ACCCTTCTCCGGCCGCTGAC (SEQ ID NO: 1), or a regulatory element B tail encoded by TCCGCTCTGGGGCGCGCACACCCTCGCCCGCACTTCTCCCCTCGTCCGGCACGGACTGACCGCACACGAATAACACATCCGACCAGAGCT (SEQ ID NO: 2), and (b) binding sequence 1 encoded by GTGGTAAACAGAGCGCCTAG (SEQ ID NO: 6).

[0027] The present disclosure provides a nucleic acid encoding an RPM, the nucleic acid comprising (a) a DNA encoding (i) the RPM of claim 1 or 2, (ii) the SMN2 RPM of claim 3, or (iii) the TCF4 RPM of claim 4, (b) a DNA construct as shown in Figure 7A or 7B, or (c) a DNA at least 90% identical to the DNA of (a) or the DNA construct of (b). The nucleic acid of (a) can further comprise a promoter driving expression of the RPM. The promoter can be a U7 promoter. In other examples, the promoter can be a U6 promoter, a tRNA promoter, an H1 promoter, a minimal CMV promoter, a T7 promoter, an EF1-alpha promoter, or a minimal EF1-alpha promoter. The U7 expression cassette can be cloned in a forward or reverse orientation within the vector.

[0028] Delivery Vector Provided herein are vectors for delivering polynucleotides encoding RPMs to cells. Such vectors include, but are not limited to, viral vectors such as adeno-associated virus, adenovirus, retrovirus, lentivirus, equine-associated virus, alphavirus, poxvirus, herpesvirus, herpes simplex virus, poliovirus, Sindbis virus, vaccinia virus, or synthetic viruses (e.g., chimeric viruses, mosaic viruses, or pseudotyped viruses, and / or viruses containing foreign proteins, synthetic polymers, nanoparticles, or small molecules).

[0029] Recombinant adeno-associated viruses are provided for delivering DNA encoding RPM to cells.

[0030] Adeno-associated virus (AAV) is a replication-defective parvovirus whose single-stranded DNA genome is approximately 4.7 kb long and contains two 145-nucleotide inverted terminal repeats (ITRs). The term may be used to refer to the virus itself or its derivatives. The term encompasses all subtypes and both naturally occurring and recombinant forms, unless otherwise specified. There are multiple serotypes of AAV. Each AAV serotype is associated with a specific clade, whose members share serological and functional similarities. Thus, AAVs are sometimes referred to by clade. For example, AAV9 sequences are referred to as "clade F" sequences (Gao et al., J. Virol., 78:6381-6388 (2004)). The present disclosure contemplates the use of any sequence within a particular clade, e.g., clade F. The nucleotide sequences of the genomes of AAV serotypes are known.For example, the complete genome of AAV-1 is provided under GenBank accession number NC_002077, the complete genome of AAV-2 is provided under GenBank accession number NC_001401 and Srivastava et al., J. Virol., 45:555-564 (1983), the complete genome of AAV-3 is provided under GenBank accession number NC_1829, the complete genome of AAV-4 is provided under GenBank accession number NC_001829, the AAV-5 genome is provided under GenBank accession number AF085716, the complete genome of AAV-6 is provided under GenBank accession number NC_001862, at least portions of the AAV-7 and AAV-8 genomes are provided under GenBank accession numbers AX753246 and AX753249, respectively, and the AAV-9 genome is provided by Gao et al. The AAV-10 genome is provided in Mol. Ther., 13(1):67-76(2006), the AAV-11 genome is provided in Virology, 330(2):375-383(2004), a portion of the AAV-12 genome is provided under GenBank accession number DQ813647, and a portion of the AAV-13 genome is provided under GenBank accession number EU285562. The sequence of the AAV rh.74 genome is provided in U.S. Patent No. 9,434,928 (incorporated herein by reference). The sequence of the AAV-B1 genome is provided in Choudhury et al., Mol. Ther., 24(7):1247-1257(2016). Anc80 is an AAV vector that is a subset of AAV1, AAV2, AAV8, and AAV9. The sequence of Anc80 is provided in Zinn et al., Cell Reports 12:1056-1068, 2015, and Vandenberghe et al., PCT / US2014 / 060163, both of which are incorporated by reference in their entireties, and GenBank accession numbers KT235804 to KT235812.

[0031] Cis-acting sequences that direct viral DNA replication, encapsidation / packaging, and host cell chromosomal integration are contained within the ITRs. Three AAV promoters (named p5, p19, and p40 after their relative map positions) drive expression of two AAV internal open reading frames encoding the rep and cap genes. The two rep promoters (p5 and p19), coupled with differential splicing of a single AAV intron (at nucleotides 2107 and 2227), result in the production of four rep proteins (rep78, rep68, rep52, and rep40) from the rep gene. The rep proteins possess multiple enzymatic properties that ultimately contribute to viral genome replication. The cap gene is expressed from the p40 promoter and encodes three capsid proteins (VP1, VP2, and VP3). Alternative splicing and non-consensus translation start sites contribute to the production of the three related capsid proteins. A single consensus polyadenylation site is located in the AAV genome at map position 95. The life cycle and genetics of AAV are reviewed in Muzyczka, Current Topics in Microbiology and Immunology, 158:97-129 (1992).

[0032] AAV has unique characteristics that make it attractive as a vector for delivering foreign DNA to cells, for example, in gene therapy. AAV infection of cells in culture is noncytopathic, and natural infection in humans and other animals is silent and asymptomatic. Furthermore, AAV infects many mammalian cells, offering the potential for targeting many different tissues in vivo. Furthermore, AAV can transduce slowly dividing and non-dividing cells and persist essentially for the lifetime of those cells as transcriptionally active nuclear episomes (extrachromosomal elements). The native AAV proviral genome is infectious as cloned DNA in a plasmid, making the construction of recombinant genomes feasible. Furthermore, because signals directing AAV replication, genome encapsidation, and integration are contained within the ITRs of the AAV genome, some or all of the internal approximately 4.3 kb of the genome (encoding the replication and structural capsid protein, rep-cap) can be replaced with foreign DNA, such as a gene cassette containing a promoter, DNA of interest, and a polyadenylation signal. In some cases, the rep and cap proteins are provided in trans. Another important feature of AAV is that it is an extremely stable and robust virus. It easily withstands the conditions used to inactivate adenovirus (56°C–65°C for several hours), making cryopreservation of AAV less important. AAV can also be lyophilized. Finally, AAV-infected cells are not resistant to superinfection.

[0033] As used herein, the term "AAV" refers to a wild-type AAV virus or viral particle. The terms "AAV," "AAV virus," and "AAV viral particle" are used interchangeably herein. The term "rAAV" refers to a recombinant virus, infectious virus, encapsulated virus, or viral particle. The terms "rAAV," "rAAV virus," and "rAAV viral particle" are used interchangeably herein.

[0034] The term "rAAV genome" refers to a polynucleotide sequence derived from a modified native AAV genome. rAAV genomes are provided that have been modified to remove the native AAV cap and rep genes. The rAAV genome contains at least one or both endogenous 5' and 3' inverted terminal repeats (ITRs). The rAAV genome may contain ITRs from an AAV serotype different from the AAV serotype from which the AAV genome was derived.

[0035] Provided herein is a rAAV genome that contains a transgene flanked at the 5' and 3' ends by AAV ITRs.

[0036] Transgenes provided herein include, but are not limited to, transgenes comprising RPM DNA or transgenes comprising a polynucleotide that is 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to RPM DNA.

[0037] The transgenes provided herein can include an RPM polynucleotide that encodes an RPM and that hybridizes under stringent conditions to another RPM polynucleotide provided herein.

[0038] The term "stringent" refers to conditions generally understood in the art as stringent. Hybridization stringency is primarily determined by temperature, ionic strength, and the concentration of denaturing agents such as formamide. Examples of stringent conditions for hybridization and washing include, but are not limited to, 0.015 M sodium chloride, 0.0015 M sodium citrate at 65-68°C, or 0.015 M sodium chloride, 0.0015 M sodium citrate, and 50% formamide at 42°C. See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, (Cold Spring Harbor, NY 1989).

[0039] Examples of promoters contemplated herein include, but are not limited to, the U7 promoter, simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, avian leukosis virus promoter, Epstein-Barr virus immediate early promoter, Rous sarcoma virus promoter, and human gene promoters such as the actin promoter, myosin promoter, elongation factor-1a promoter, hemoglobin promoter, and creatine kinase promoter. Further provided herein are promoters that are at least 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one of the promoters having transcription-promoting activity.

[0040] Examples of transcriptional control elements are tissue-specific control elements, such as promoters that allow expression specifically in neurons or specifically in astrocytes. Examples include the neuron-specific enolase promoter and the astrocyte-specific glial fibrillary acidic protein promoter. Inducible promoters are also contemplated. Non-limiting examples of inducible promoters include, but are not limited to, the metallothionine promoter, the glucocorticoid promoter, the progesterone promoter, and the tetracycline-regulated promoter. The gene cassette may also contain an intron sequence that facilitates processing of the transgene RNA transcript when expressed in mammalian cells. One example of such an intron is the SV40 intron.

[0041] "Packaging" refers to the series of intracellular events that lead to assembly and encapsidation of AAV particles. The term "production" refers to the process of producing rAAV (infectious, encapsulated rAAV particles) by the packed cell.

[0042] The AAV "rep" and "cap" genes refer to polynucleotide sequences that encode the replication and encapsidation proteins, respectively, of the adeno-associated virus. AAV rep and cap are referred to herein as AAV "packaging genes."

[0043] A "helper virus" for AAV refers to a virus that enables AAV (e.g., wild-type AAV) to be replicated and packaged by mammalian cells. A variety of such helper viruses for AAV, including adenoviruses, herpesviruses, and poxviruses such as vaccinia, are known in the art. Adenoviruses can encompass several different subgroups, with adenovirus type 5 of subgroup C being the most commonly used. Numerous adenoviruses of human, non-human mammalian, and avian origin are known and available from depositories such as the ATCC. Herpes family viruses include, for example, herpes simplex virus (HSV) and Epstein-Barr virus (EBV), as well as cytomegalovirus (CMV), and pseudorabies virus (PRV), which are also available from depositories such as the ATCC.

[0044] "Helper virus functions" refer to functions encoded in the helper virus genome that enable AAV replication and packaging (in conjunction with other requirements for replication and packaging as described herein). As described herein, "helper virus functions" can be provided in a number of ways, such as by providing a helper virus or, for example, by providing polynucleotide sequences encoding the necessary functions to the producer cell in trans.

[0045] The rAAV genomes provided herein lack AAV rep and cap DNA. The AAV DNA in the rAAV genomes (e.g., ITRs) contemplated herein can be derived from any AAV serotype suitable for deriving recombinant viruses, including, but not limited to, AAV serotypes Anc80, Anc80L65, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV7mb, AAV-8, AAV-9, AAV-10, AAV-RH10, AAV-11, AAV-12, AAV-13, AAV rh.74, AAV-B1, MyoAAV, MYOAAV1A, SLB101, M1, and M3, and derivatives thereof. As noted above, the nucleotide sequences of the genomes of various AAV serotypes are known in the art. rAAVs with capsid mutations are also contemplated. See, e.g., Marsic et al., Molecular Therapy, 22(11):1900-1909 (2014). Modified capsids are also contemplated herein, including capsids with various post-translational modifications, such as glycosylation and deamidation. Deamidation of asparagine or glutamine side chains to convert asparagine residues to aspartic acid or isoaspartic acid residues, and conversion of glutamine to glutamic acid or isoglutamic acid are contemplated in the rAAV capsids provided herein. See, e.g., Giles et al., Molecular Therapy, 26(12):2848-2862 (2018). Modified capsids are also contemplated herein to include targeting sequences that direct the rAAV to diseased tissues and organs in need of treatment.

[0046] The DNA plasmids provided herein contain the rAAV genome described herein. The DNA plasmids can be transferred into cells permissive for infection with an AAV helper virus (e.g., adenovirus, E1-deleted adenovirus, or herpesvirus) to assemble the rAAV genome into infectious viral particles with AAV9 capsid proteins. Techniques for producing rAAV that provide cells with the packaged rAAV genome, rep and cap genes, and helper virus functions are standard in the art. Production of rAAV particles requires the presence of the rAAV genome, AAV rep and cap genes separate from (i.e., not present in) the rAAV genome, and helper virus functions in a single cell (referred to herein as a packaging cell). The AAV rep and cap genes may be derived from any AAV serotype from which a recombinant virus can be derived, or may be derived from an AAV serotype different from the rAAV genome ITRs. The production of pseudotyped rAAV is disclosed, for example, in WO01 / 83692 (incorporated herein by reference in its entirety). AAV capsid proteins can be modified to enhance delivery of recombinant rAAV. Modifications to capsid proteins are generally known in the art. See, for example, US2005 / 0053922 and US2009 / 0202490. The capsid protein of rAAV can be modified to target the rAAV to a specific target tissue of interest, such as neural cells. See, for example, WO02 / 053703.

[0047] A method for generating packaging cells is to create a cell line that stably expresses all components necessary for rAAV production. For example, a plasmid (or multiple plasmids) containing an rAAV genome lacking the AAV rep and cap genes, the AAV rep and cap genes separated from the rAAV genome, and a selectable marker (e.g., a neomycin resistance gene) can be integrated into the genome of the cell. The rAAV genome can be introduced into a bacterial plasmid by procedures such as GC tailing (Samulski et al., 1982, Proc. Natl. Acad. S6. USA, 79:2077-2081), the addition of a synthetic linker containing a restriction endonuclease cleavage site (Laughlin et al., Gene, 23:65-73 (1983)), or direct blunt-end ligation (Senapathy & Carter, J. Biol. Chem., 259:4661-4666 (1984)). The packaging cell line may then be infected with a helper virus, such as adenovirus. The advantage of this method is that the cells are selectable and are suitable for large-scale production of rAAV. Another non-limiting example of a suitable method uses adenovirus or baculovirus rather than a plasmid to introduce the rAAV genome and / or the rep and cap genes into the packaging cells.

[0048] The general principles of rAAV particle production are reviewed, for example, in Carter, Current Opinions in Biotechnology, 1533-1539 (1992) and Muzyczka, Curr. Topics in Microbial. and Immunol., 158:97-129 (1992). Various approaches have been proposed by Ratschin et al., Mol. Cell. Biol. 4:2072 (1984), Hermonat et al., Proc. Natl. Acad. Sci. USA, 81:6466 (1984), Tratschin et al., Mol. Cell. al., J. Virol., 62:1963 (1988), and Lebkowski et al., Mol. Cell. Biol., 7:349 (1988), Samulski et al. al., J. Virol., 63:3822-3828 (1989), U.S. Pat. No. 5,173,414, WO95 / 13365 and corresponding U.S. Pat. No. 5,658,776, WO95 / 13392, WO96 / 17947, PCT / US98 / 18600, WO97 / 09441 (PCT / US96 / 14423), WO97 / 08298 (PCT / US96 / 13872), WO97 / 21825 (PCT / US96 / 20777), WO97 / 06243 (PCT / FR96 / 01064), WO99 / 11764, Perrin et al., Vaccine, 13:1244-1250 (1995), Paul et al. al., Human Gene Therapy, 4:609-615 (1993), Clark et al., Gene Therapy, 3:1124-1132 (1996), U.S. Patent Nos. 5,786,211, 5,871,982, and 6,258,595. The foregoing documents are incorporated by reference herein in their entirety, with particular emphasis being placed on the sections of the documents relating to rAAV particle production.

[0049] Further provided herein are packaging cells that produce infectious rAAV particles. In one embodiment, the packaging cells can be stably transformed cancer cells such as HeLa cells, 293 cells, and PerC.6 cells (allogeneic 293 cells). In another embodiment, the packaging cells can be cells that are not transformed cancer cells, such as low-passage 293 cells (human embryonic kidney cells transformed with adenovirus E1), MRC-5 cells (human embryonic fibroblasts), WI-38 cells (human embryonic fibroblasts), Vero cells (monkey kidney cells), and FRhL-2 cells (embryonic rhesus lung cells).

[0050] Also provided herein are rAAVs (e.g., infectious, encapsidated rAAV particles) comprising the rAAV genome of the present disclosure. The genome of the rAAV lacks AAV rep and cap DNA, i.e., no AAV rep or cap DNA is present between the ITRs of the rAAV genome. The rAAV genome may be a self-complementary (sc) genome. An rAAV having an sc genome is referred to herein as an scAAV. The rAAV genome may be a single-stranded (ss) genome. An rAAV having a single-stranded genome is referred to herein as an ssAAV.

[0051] rAAV can be purified by standard methods in the art (e.g., by column chromatography or cesium chloride gradients, etc.) Methods for purifying rAAV from helper viruses are known in the art and can include, for example, the methods disclosed in Clark et al., Hum. Gene Ther., 10(6):1031-1039 (1999), Schenpp and Clark, Methods Mol. Med., 69 427-443 (2002), U.S. Patent No. 6,566,118, and WO 98 / 09657.

[0052] composition Compositions comprising rAAV are also provided. The compositions comprise rAAVs encoding RPMs. The compositions may comprise two or more rAAVs encoding different RPMs of interest.

[0053] The compositions provided herein comprise rAAV and a pharmaceutically acceptable excipient or excipients. Acceptable excipients are non-toxic to recipients, preferably inert at the dosages and concentrations used, and include, but are not limited to, buffers such as phosphate, e.g., phosphate-buffered saline (PBS), citric acid, or other organic acids; antioxidants such as ascorbic acid; proteins such as low molecular weight polypeptides, serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and / or non-ionic surfactants such as Tween; copolymers such as poloxamer 188, Pluronic (e.g., Pluronic F68), or polyethylene glycol (PEG). The compositions provided herein can include a pharmaceutically acceptable aqueous excipient containing a non-ionic hypo-osmolar compound or contrast agent, such as iobitridol, iohexol, iomeprol, iopamidol, iopentol, iopromide, ioversol, or ioxilan, and the aqueous excipient containing the non-ionic hypo-osmolar compound can have one or more of the following characteristics: an osmolality of about 180 mgI / mL, a vapor pressure osmometry osmolality of about 322 mOsm / kg of water, an osmolality of about 273 mOsm / L, an absolute viscosity of about 2.3 cp at 20° C. and about 1.5 cp at 37° C., and a specific gravity of about 1.164 at 37° C. Exemplary compositions include about 20-40% non-ionic hypo-osmolar compound, or about 25% to about 35% non-ionic hypo-osmolar compound. An exemplary composition includes scAAV or rAAV viral particles formulated in 20 mM Tris (pH 8.0), 1 mM MgCl, 200 mM NaCl, 0.001% poloxamer 188, and about 25% to about 35% of a non-ionic, hypoosmolar compound. Another exemplary composition includes scAAV formulated in 1× PBS and 0.001% Pluronic F68.It has been demonstrated that simply resuspending rAAV in phosphate-buffered saline is sufficient to provide a useful vehicle for muscle tissue expression.

[0054] For CSF delivery, including but not limited to, intrathecal delivery, the viral vector can be mixed with a contrast agent (Omnipaque or the like). For example, the composition can include a non-ionic, low-osmolarity contrast agent, including but not limited to, iobitridol, iohexol, iomeprol, iopamidol, iopentol, iopromide, ioversol, ioxilan, or combinations thereof.

[0055] Dosages may be expressed in units of viral genomes (vg). Doses contemplated herein are approximately 1 x 10 7 vg, approx. 1×10 8 vg, approx. 1×10 9 vg, approx. 5×10 9 vg, approx. 6×10 9 vg, approx. 7×10 9 vg, approx. 8×10 9 vg, approx. 9×10 9 vg, approx. 1×10 10 vg, approx. 2×10 10 vg, approx. 3×10 10 vg, approx. 4×10 10 vg, approx. 5×10 10 vg, approx. 1×10 11 vg, approx. 1.1×10 11 vg, approx. 1.2×10 11 vg, approx. 1.3×10 11 vg, approx. 1.2×10 11 vg, approx. 1.3×10 11 vg, approx. 1.4×10 11 vg, approx. 1.5×10 11 vg, approx. 1.6×10 11 vg, approx. 1.7×10 11 vg, approx. 1.8×10 11 vg, approx. 1.9×10 11 vg, approx. 2×10 11 vg, approx. 3×10 11 vg, approx. 4×10 11 vg, approx. 5×10 11vg, approx. 1×10 12 vg, approx. 1×10 13 vg, approx. 1.1×10 13 vg, approx. 1.2×10 13 vg, approx. 1.3×10 13 vg, approx. 1.5×10 13 vg, approx. 2×10 13 vg, approx. 2.5×10 13 vg, approx. 3×10 13 vg, approx. 3.5×10 13 vg, approx. 4×10 13 vg, approx. 4.5×10 13 vg, approx. 5×10 13 vg, approx. 6×10 13 vg, approx. 1×10 14 vg, approx. 2×10 14 vg, approx. 3×10 14 vg, approx. 4×10 14 vg, approx. 5×10 14 vg, approx. 1×10 15 vg, ~approx. 1×10 16 Contains the entire viral genome (vg or more). Approximately 1 x 10 9 vg~approx. 1×10 10 vg, approx. 5×10 9 vg~approx. 5×10 10 vg, approx. 1×10 10 vg~approx. 1×10 11 vg, approx. 1×10 11 vg~approx. 1×10 15 vg, approx. 1×10 12 vg~approx. 1×10 15 vg, approx. 1×10 12 vg~approx. 1×10 14 vg, approx. 1×10 13 vg~approx. 6×10 14 vg, and approximately 6 × 10 13 vg~approx. 1.0×10 14 vg, 2.0 × 10 14 vg, 3.0 × 10 14 vg, 5.0 × 10 14 Also contemplated is a dose of 1.65 x 10 11 vg.

[0056] For example, the CSF dose is approximately 1 x 10 based on age group.13 vg / patient ~ approx. 1×10 15 vg / patient. For example, an intravenously delivered dose may range from 1 x 10 13 vg / kilogram (kg) body weight ~2×10 14 vg / kg range.

[0057] Treatment methods The therapeutic methods provided herein include administering an effective dose or effective multiple doses of a composition comprising an rAAV provided herein to a subject (e.g., an animal, including, but not limited to, a human patient) in need thereof. If the dose is administered before the onset of symptoms of the condition to be treated, the administration is prophylactic. If the dose is administered after the onset of symptoms, the administration is therapeutic. An effective dose is one that alleviates (eliminates or reduces) at least one symptom associated with the condition, delays or prevents the progression of the condition, reduces the severity of the condition, results in remission (partial or complete) of the condition, and / or prolongs survival.

[0058] The therapeutic methods provided herein transduce target cells with one or more rAAVs described herein. Transduction of cells with the rAAVs of the present disclosure results in sustained expression of the RPM encoded by the rAAV.

[0059] Administration of an effective dose of a nucleic acid, viral vector, or composition of the present disclosure is contemplated to be by routes standard in the art, including, but not limited to, intramuscular, parenteral, intravascular, intravenous, oral, buccal, nasal, pulmonary, intracranial, intraventricular, intrathecal, intraosseous, intraocular, rectal, or intravaginal routes. An effective dose can be delivered by a systemic administration route, i.e., systemic administration. Examples of systemic administration include enteral administration (drug absorption through the gastrointestinal tract) or parenteral administration (generally via injection, infusion, or implantation). An effective dose can also be delivered by a combination of routes. An effective dose can include multiple administrations delivered sequentially or simultaneously. The administration route and serotype of the AAV components of the rAAV (particularly the AAV ITRs and capsid proteins) can be selected and / or adapted by those skilled in the art, taking into account the condition or status of the disease or disorder being treated, the condition, status, or age of the subject, and the target cells / tissues in which the transgene should be expressed.

[0060] The rAAV viral particles containing the transgene can be administered or delivered to the CSF of a subject, for example, by intraventricular injection, intracisternal injection, or lumbar intrathecal injection, or by other injection methods that access the CSF, or by intravenous delivery, or by a combination of such routes. Intrathecal administration refers to delivery to the subarachnoid space of the brain or spinal cord. In particular, intrathecal administration to the brain can be performed by intraventricular injection. The brain regions that are intended to be delivered include, but are not limited to, the motor cortex, the visual cortex, the cerebellum, and the brainstem.

[0061] For intrathecal administration, the subject may be held in Trendelenburg position (head position) after injection of the rAAV (e.g., for about 5 minutes, about 10 minutes, about 15 minutes, or about 20 minutes). For example, the patient may be tilted head-on at an angle of about 1 to about 30 degrees, about 15 to about 30 degrees, about 30 to about 60 degrees, about 60 to about 90 degrees, or about 90 to about 180 degrees.

[0062] kit The present disclosure also provides kits comprising a nucleic acid, vector, or composition of the present disclosure. The term "kit" refers to two or more components, one of which corresponds to a nucleic acid, vector, or composition of the present disclosure and the other of which corresponds to a container, recipient, instructions, or other item.

[0063] Kits may include one or more recipients (vials, ampoules, containers, syringes, bottles, bags, etc.) of any suitable shape, size, and material containing the nucleic acids, vectors, or compositions of the disclosure in appropriate dosages for administration (see above). Kits may additionally include directions or instructions for use (e.g., in the form of a leaflet or instruction manual), means for administering the nucleic acid, vector, or composition such as a syringe, pump, injector, etc., means for reconstituting the nucleic acid, vector, or composition, and / or means for diluting the nucleic acid, vector, or composition.

[0064] The kits may include labels and / or instructions that describe the use of the components provided in the kit. The kits also optionally include a catheter, syringe, or other delivery device for delivering one or more of the compositions used in the methods described herein.

[0065] The present disclosure also provides kits for single-dose or multi-dose administration. For example, the present disclosure provides kits including single-chamber and multi-chamber pre-filled syringes.

[0066] Other Terms and Disclosures Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Any methods and materials similar or equivalent to those provided herein can also be used in the practice or testing of the present disclosure.

[0067] All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials for which the publications are cited.

[0068] As used in this specification and the appended claims, the singular forms "a," "and," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, a reference to "an antigen" includes a plurality of such antigens; a reference to "a cell" or "the cell" includes a reference to one or more cells and equivalents thereof (e.g., a plurality of cells) known to those skilled in the art; and the like. Similarly, a reference to "a compound" or "a composition" includes a plurality of such compounds or compositions and refers to one or more compounds or compositions, respectively, unless the context clearly dictates otherwise.

[0069] It is further noted that the claims may be drafted to exclude any element, e.g., any optional element. Accordingly, this statement is intended to serve as a predicate for use of such exclusive terminology, such as "solely," "only," and the like, in connection with the recitation of claim elements or the use of a "negative" limitation.

[0070] Where a range of values ​​is provided herein, unless the context clearly dictates otherwise, it is understood that each intervening value, to the tenth of the unit of the lower limit, between the upper and lower limit of that range, and any other stated or intervening value in that stated range, is encompassed within the disclosure. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure.

[0071] When method steps are described or claimed and the steps are described as occurring in a particular order, a description of a first step occurring (or being performed) "prior to" (i.e., before) a second step has the same meaning when reworded to state that the second step occurs (or is performed) "after" the first step.

[0072] The term "about" when referring to a numerical value or numerical range means that the referenced numerical value or numerical range is approximate within experimental variation (or within statistical experimental error), and thus the numerical value or numerical range may vary between 1% and 15% of the stated numerical value or numerical range.

[0073] Throughout this specification and the claims that follow, unless the context requires otherwise, the word "comprise" and variations such as "comprises" and "comprising" should be understood to imply the inclusion of a stated element or step or group of elements or steps, but not the exclusion of any other element or step or group of elements or steps.

[0074] As used herein, "consisting of" excludes any element, step, or ingredient not specified in the claim element. As used herein, "consisting essentially of" does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claim element.

[0075] The term "comprising" (and related terms such as "comprise," or "comprises," or "having," or "including") is not intended to exclude that, for example, compositions of matter, compositions, methods, or processes provided herein may "consist of" or "consist essentially of" the recited features.

[0076] As will be apparent to one of ordinary skill in the art upon reading this disclosure, each composition and method provided and exemplified herein has distinct components and features that can be readily separated from or combined with features of any of the other compositions and methods without departing from the scope or spirit of the present disclosure. Any recited method can be carried out in the order of events recited or in any other order that is logically possible. This disclosure is intended to provide support for all such combinations.

[0077] As used herein, "contemplated," "may," "may comprise," "may be," "can," "can comprise," and "can be" all refer to what is contemplated by the inventors as functioning and usable as part of the subject matter provided. [Example]

[0078] The following examples illustrate specific embodiments, but variations and modifications will occur to those skilled in the art. Accordingly, only such limitations as appear in the claims should be placed on the invention.

[0079] Example 1 Targeting regulatory elements within the genome Forward selection of genomic targets We performed bioinformatics analysis to specifically identify relatively small endogenous regulatory elements in the human genome using EnhancerAtlas (www.enhanceratlas.org), an online database of enhancer elements. The database includes, among others, EP300 histone acetyltransferase binding sites, RNA polymerase II binding sites, DNAse I hypersensitive sites, and targets predicted by H3K4me1 and H3K27ac histone modification patterns and eRNA sequences. EnhancerAtlas (www.enhanceratlas.org) contains predicted targets from multiple human tissues, including several central nervous system (CNS) tissues (astrocytes, embryonic stem cell-derived neurons, fetal brain, fetal spinal cord, cerebellum, and retina) [Gao et al., EnhancerAtlas: a resource for enhancer annotation and analysis in 105 human cell / tissue types. doi:10.1093 / bioinformatics / btw495]. All predicted enhancers of 100 bp or less were selected (Table 1). [Table 1]

[0080] Of these, 11 were common to all tissues and were selected as pan-neuronal regulatory elements. Furthermore, fetal spinal cord contained several regulatory elements that were less than 40 bp in length, which, although not pan-neuronal, were selected as targets due to their very small size (Table 2). [Table 2]

[0081] Additionally, we selected seven very small elements (20–40 bp) identified in the spinal cord. [Table 3]

[0082] Backward selection of genomic targets Other target sites within the genome were selected after preliminary identification of 73 transcription factors expressed in the CNS. Using JASPAR software [Fornes et al., Nucleic Acids Res., 48:87-92 (2019)], consensus binding sequences for each of these transcription factors were found (Table 4). A secondary approach was to construct synthetic regulatory elements around the binding motifs of the transcription factors of interest [Fornes et al., JASPAR 2020: update of the open-access database of transcription factor binding profiles. Nucleic Acids Res., 48:87-92 (2019)]. [Table 4-1] [Table 4-2] [Table 4-3]

[0083] Example 2 Use in Spinal Muscular Atrophy (SMA) Spinal muscular atrophy (SMA) is a severe neurological disorder caused by loss-of-function mutations in the SMN1 (SMN telomere) gene, which encodes the SMN protein. In humans, a second gene, the SMN2 (SMN centromeric) gene, exists that can encode the SMN protein. The SMN2 gene is identical to the SMN1 gene except for a C-to-T substitution at position 840, which typically produces a variant of SMN lacking exon 7. However, approximately 10-15% of transcripts produce full-length SMN protein. The severity of SMA disease depends on the number of SMN2 copies a patient has.

[0084] Over the past decade, several SMA treatments have been developed, including Spinraza [Finkel et al., N. Engl. J. Med., 377:1723-1732 (2017)] and Zolgensma [Mendell, et al., N. Engl. J. Med., 377:1713-1722 (2017)], which will be used as positive controls in initial proof-of-concept experiments to demonstrate the efficacy of the six RPMs.

[0085] Six RPMs contained one of three binding sequences to the SMN2 promoter. The promoter is described in Monani & Burghes, Biochim. Biophys. Acta-Gene Struct. Expr., 1445:330-336 (1999). The three binding sequences targeted regulatory / binding sites outside of previously identified regulatory elements / binding sites for transcription factors (Figure 2).

[0086] Six RPMs also contained one of two endogenous regulatory elements (forward approach). One was a small spinal cord endogenous regulatory element, chr19:1479140-1479160, designated regulatory element A (CAGTCGCCGGCCTCTTCCCA) (reverse orientation of SEQ ID NO:1). The other was a larger, pan-neuronal regulatory element, chr5:176943840-176943910, designated regulatory element B (TCGAGACCAGCCTACACAATAAGCACACGCCAGTCAGGCACGGCCTGCTCCCCTCTTCACGCCCGCTCCCACACGCGCGGGGTCTCGCCT) (reverse orientation of SEQ ID NO:2). Both regulatory elements attract transcription factors and increase SMN2 expression.

[0087] The sequences encoding the combined regulatory element tail and binding sequence for each of the six RPMs, A1, A2, A3, B1, B2, and B3, are shown on the right side of Figure 3. These sequences are in reverse orientation so that the binding sequences target the sense strand of the SMN2 promoter.

[0088] RPMs are expressed from rAAV. The production plasmids for the six RPMs are shown in Figures 9A to 9F.

[0089] The rAAV is used to transfect humanized SMA model mouse embryonic fibroblasts (MEFs) and human SMA patient fibroblasts, and the expression of SMN2 transcripts in the cells is then measured by qPCR and / or ddPCR.

[0090] Example 3 Use in Pitt-Hopkins syndrome Pitt-Hopkins syndrome (PTHS) is a rare neurodevelopmental disorder characterized by developmental delay, distinctive facial features, apneic attacks, and a wide range of behavioral symptoms. Haploinsufficiency, caused by mutations in the TCF4 gene, results from either pathogenic variants in the TCF4 gene or deletions of the chromosomal region (18q21.2) where TCF4 is located. Currently, there is no treatment or cure for PTHS. The TCF4 gene is a large gene encoding a transcription factor with multiple isoforms, making it a challenging target for classical gene replacement therapy approaches. Due to the haploinsufficient nature of the disease, PTHS is an ideal indication for RPM therapy, as RPM therapy acts on the endogenous promoter to enhance transcription. Herein, RPM constructs are provided to bind to the single available TCF4 copy and enhance TCF4 transcription to normal levels.

[0091] A preliminary binding sequence for the TCF4 promoter was designed. Although the TCF4 promoter had not been previously characterized, using bioinformatics tools for promoter analysis, putative TATA box and enhancer elements were identified within a 2000-bp region upstream of exon 1 of the TCF4-201 transcript variant (Figure 4). A 20-bp sequence of these putative elements was selected as the binding site (Figure 5).

[0092] Two TCF4 RPM constructs were generated utilizing two different regulatory elements, targeting the identified 20-bp binding site (Figure 6). Initial testing was performed using endogenous regulatory elements (forward approach), specifically a small endogenous regulatory element in the spinal cord whose size does not interfere with U7 small nuclear RNA function, and a larger pan-neuronal regulatory element present throughout various target tissues in the central nervous system. The RNAfold web server calculates RNA secondary structure based on minimum free energy and centroid structure calculations [Gruber et al., The Vienna RNA Websuite, Nucleic Acids Res., 36 (Web Server issue): W70-74 (2008)] and can be used to select regulatory elements for use based on predicted secondary structure. The spinal cord element selected was chr19:1479140-1479160, referred to herein as regulatory element A, and the pan-neuronal element selected was chr5:176943840-176943910, referred to herein as regulatory element B. For each of these, constructs were designed with binding sequences that target the TCF4 gene (Figure 6).

[0093] As described in the Overview section above, the constructs were designed so that the RPM binding site could bind to the 5' DNA strand. The regulatory tail was oriented so that proteins that bind to the regulatory element would also contact the 5' DNA strand of the promoter. Furthermore, the entire U7 construct was assembled so that the sm OPT and hairpin were downstream of the promoter to ensure that these U7 construct components would not interfere with transcription factor or RNA polymerase II binding to the gene and transcription. Therefore, the RPM was designed so that the binding sequence was in the reverse complement orientation of the DNA 5' binding site and the regulatory element tail was in the opposite orientation to the endogenous regulatory element (e.g., transcription factor binding site). The DNA sequences encoding two constructs (A1.U7.TCF4 and B1.U7.TCF4) targeting the TCF4 gene are shown in Figure 7.

[0094] Plasmids containing constructs A1.U7.TCF4 and B1.U7.TCF4 were ordered from Genscript. Each construct contains the U7 promoter-regulatory element tail-binding sequence-smOPT / hairpin sequence-U7 terminator sequence (shown in Figure 7). The entire U7 expression cassette was further cloned in both orientations (3'-5' and 5'-3') into the pscAAV.stuffer plasmid. The plasmids (Figure 9G, H) were tested for U7 and TCF4 expression (both mRNA and protein) in HEK293 cells 72 hours post-transfection (Figure 8A, B, C, respectively).

[0095] The plasmids were further used to produce the scAAV9.U7.TCF4 vector. Self-complementary AAV was produced in 293 cells by transient transfection using each plasmid together with a plasmid encoding the Rep2Cap9 sequence and the adenovirus helper plasmid pHelper (Stratagene, Santa Clara, CA). These vectors were used to transduce mouse embryonic fibroblasts (MEFs) carrying a humanized TCF4 promoter driving eGFP+luciferase+TCF4 and human TCF4 patient-derived cells. Expression of U7 transcripts and TCF4 mRNA by qPCR and / or ddPCR demonstrates that the vector is functional and capable of increasing TCF4 transcripts. Staining and Western blot analysis demonstrate increased TCF4 protein expression. For clinical translation of the AAV9.U7.TCF4 vector, rescue experiments in TCF4 patient-derived cells will be performed to demonstrate the therapeutic potential of treatment on astrocyte differentiation, seahorse analysis, and motor neuron co-cultures.

[0096] Data from HEK293 cells demonstrate that the B1.U7.TCF4 construct is successful in increasing TCF4 mRNA and protein levels, and it is contemplated herein that the same construct may provide therapeutic benefit.

[0097] Example 4 Further Experiments - Use in Pitt-Hopkins Syndrome As described in Example 3, an hTcf4-H2B-EGFP-Nluc MEF cell line was established from transgenic mice. The transgenic mice contain a humanized TCF4 promoter driving simultaneous expression of mouse TCF4, GFP, and luciferase. HOMO MEFs represent mouse embryonic fibroblasts homozygous for hTCF4 promoter-driven expression. HOMO hTCF4 MEFs were cultured in DMEM + 10% FBS + 1% anti / anti medium and transduced with scAAV9.B1.U7.TCF4 with insulin treatment. The scAAV9.RFP vector was used as a transduction control. 72 hours after transduction, cells were harvested for RNA harvesting, followed by cDNA preparation. qPCR was performed to determine B1.U7 and msTCF4 expression.

[0098] qPCR data revealed that treatment of humanized TCF4 MEFs with scAAV9.B1.U7.TCF4 resulted in increased expression of U7.B1 compared to cells treated with scAAV9.RFP, with a concomitant increase in total TCF4 expression levels, thus again demonstrating an RPM effect on transcription (see Figure 9).

[0099] To further demonstrate the use of U7 promoter regulation in the context of PTHS, an in vitro disease model of induced astrocytes derived from PTHS patients was established. Skin biopsies were obtained from three PTHS patients with different mutations in the TCF4 gene, and skin fibroblast cultures were established. These fibroblasts were further converted into induced neural progenitor cells (iNPCs) using a direct conversion protocol. TCF4 iNPCs were further differentiated into induced astrocytes (iA) using published protocols. See, for example, Meyer et al., Proc. Natl. Acad. Sci. USA, 111(2):829-832 (2014). Five days after transduction, scAAV9.B1.U7.TCF4-treated induced astrocytes were subjected to TCF4 expression analysis. iA lines derived from two healthy individuals were treated as controls.

[0100] TCF4 mRNA expression in scAAV9.B1.U7.TCF4-treated cells was analyzed using qPCR analysis. Figure 10 shows that TCF4 patient-derived iA exhibit reduced TCF4 mRNA expression compared to healthy control iA. Treatment with scAAV9.B1.U7.TCF4 resulted in a significant increase in TCF4 expression in one patient line (3944) and a small, but not statistically significant, increase in TCF4 mRNA expression in other lines (6091, 6038).

[0101] TCF4 protein expression was also examined in all three lines using immunofluorescence analysis. scAAV9.B1.U7.TCF4-treated patient and control iA were stained with a 1 / 100 dilution of primary TCF4 antibody (ab185736, Abcam), followed by the appropriate secondary antibody. Cells were imaged using a Nikon Eclipse Ti2-E fluorescence microscope at 40x magnification. Images from 15 random fields were subjected to area and fluorescence intensity measurements using Fiji. TCF4 intensity per cell was calculated using Graphpad and compared between treated and untreated cell lines. The entire experiment was repeated six times.

[0102] The results are shown in Figure 11. Similar to mRNA expression, TCF4 iAs show reduced TCF4 protein expression compared to healthy iAs. scAAV9.B1.U7.TCF4 treatment resulted in rescue of TCF4 expression in all three patient lines (6038, 6091, and 3944) compared to their untreated counterparts, resulting in increased TCF4 signal in these lines.

[0103] Finally, the efficacy of scAAV9.B1.U7.TCF4 was tested in another in vitro disease model of PTHS. This in vitro disease model of PTHS consists of a coculture of PTHS patient-derived induced astrocytes with mouse HB9-GFP neurons. This coculture system allows for the determination of patient iA-mediated toxicity to neurons compared with healthy iA. Coculture experiments were performed using PTHS-induced iA treated with scAAV9.B1.U7.TCF4 or untreated. Two iA strains from two healthy individuals were used as controls. The experiment was repeated six times.

[0104] Co-culture data (Figure 12) demonstrated that two of the PTHS iAs (6091, 3944) were significantly toxic to GFP neurons compared to healthy iAs (S3 and 542). Importantly, treatment of patient iAs with scAAV9.B1.U7.TCF4 resulted in significant rescue of neuronal survival.

[0105] Taken together, the TCF4 expression and coculture data demonstrate that scAAV9.B1.U7.TCF4 treatment of PTHS iA results in increased TCF4 expression, leading to rescue of neuronal survival in PTHS iA. Thus, RPM regulates target gene transcription, as contemplated.

Claims

1. An RNA-based promoter modulator (RPM), comprising: (a) a regulatory element tail; (b) a binding sequence; and (c) RPM containing the Sm OPT consensus sequence and a hairpin.

2. The RPM of claim 1, wherein the orientation of (a), (b), and (c) in the RPM is from 5' to '3', and the (b) binding sequence binds to the sense strand of the target gene promoter.

3. SMN2 RPM, (a) a regulatory element A tail encoded by ACCCTTCTCCGGCCGCTGAC (SEQ ID NO: 1) or a regulatory element B tail encoded by TCCGCTCTGGGGCGCGCACACCCTCGCCCGCACTTCTCCCCCTCGTCCGGCACGGACTGACCGCACACGAATAACACATCCGACCAGAGCT (SEQ ID NO: 2); (b) an SMN2 RPM comprising: binding sequence 1 encoded by AGACGGGGTTTCGGCATGTT (SEQ ID NO: 3); binding sequence 2 encoded by ATTGTGTAGGCTGGTCTGA (SEQ ID NO: 4); or binding sequence 3 encoded by GGGGCAGGAAGGAAGGCAGA (SEQ ID NO: 5).

4. TCF4 RPM, (a) a regulatory element A tail encoded by ACCCTTCTCCGGCCGCTGAC (SEQ ID NO: 1) or a regulatory element B tail encoded by TCCGCTCTGGGGCGCGCACACCCTCGCCCGCACTTCTCCCCCTCGTCCGGCACGGACTGACCGCACACGAATAACACATCCGACCAGAGCT (SEQ ID NO: 2); (b) Binding sequence 1 encoded by GTGGTAAACAGAGCGCCTAG (SEQ ID NO: 6).

5. A nucleic acid encoding RPM, said nucleic acid comprising: (a) (i) the RPM according to claim 1 or 2; (ii) the SMN2 RPM of claim 3; or (iii) DNA encoding the TCF4 RPM according to claim 4; (b) the DNA construct of Figure 7A or 7B; or (c) A nucleic acid comprising DNA that is at least 90% identical to the DNA of (a) or the DNA construct of (b).

6. The nucleic acid of claim 5, further comprising: (a) a promoter that drives expression of the RPM.

7. 7. The nucleic acid of claim 6, wherein the promoter is any one of a U7 promoter, a U6 promoter, a tRNA promoter, an H1 promoter, a minimal CMV promoter, a T7 promoter, an EF1-alpha promoter, and a minimal EF1-alpha promoter.

8. A recombinant adeno-associated virus (rAAV) comprising a nucleic acid according to any one of claims 5 to 7.

9. The rAAV of claim 8, wherein the AAV is a single-stranded AAV (ssAAV) or a self-complementary AAV (scAAV).

10. The rAAV according to claim 8 or 9, wherein the rAAV is rAAV1, rAAV2, rAAV3, rAAV4, rAAV5, rAAV6, rAAV7, rAAV8, rAAV9, rAAV10, rAAV11, rAAV12, rAAV13, rAAV-anc80, rAAV rh.74, rAAV rh.8, rAAVrh.10, AAV-B1, MyoAAV, MYOAAV1A, SLB101, M1 and M3, or a derivative thereof.

11. The rAAV according to any one of claims 8 to 10, wherein the rAAV is rAAV9.

12. 1. A composition comprising: (a) a nucleic acid according to any one of claims 5 to 7, or (b) an rAAV according to any one of claims 8 to 11; and and a pharmaceutically acceptable carrier.

13. A method for regulating expression of a target gene in a cell, the method comprising delivering to said cell an RPM according to any one of claims 1 to 4.

14. 1. A method for modulating expression of a target gene in a cell, comprising: (a) a nucleic acid according to any one of claims 5 to 7; (b) an rAAV according to any one of claims 8 to 11, or (c) contacting with the composition of claim 12.

15. 15. The method of claim 14, wherein the expression of the target gene is increased.

16. the nucleic acid, AAV, or composition is formulated for intramuscular injection, intrathecal injection, transdermal delivery, or injection into the bloodstream; (a) a nucleic acid according to any one of claims 5 to 7; (b) an adeno-associated virus (AAV) according to any one of claims 8 to 11, or (c) The composition of claim 12.

17. 10. A method of treating spinal muscular atrophy in a subject, comprising delivering the SMN2 RPM of claim 3 to the subject.

18. 10. A method of treating Pitt-Hopkins syndrome in a subject, comprising delivering the TCF4 RPM of claim 4 to the subject.

Images