Pharmaceutical compositions and related methods for delivery of herpes simplex virus glycoprotein C, glycoprotein D, and glycoprotein E antigens

Abstract

The present disclosure provides pharmaceutical compositions and related technology (e.g., components thereof and / or methods related thereto) for delivery of HSV antigens (e.g., HSV vaccines). The present disclosure provides pharmaceutical compositions (e.g., immunogenic compositions, e.g., vaccines) and related technology (e.g., methods) for delivering specific herpes simplex virus (HSV) antigen constructs to a subject (e.g., a patient). In particular, the present disclosure provides HSV vaccine compositions and related technology (e.g., methods).

Description

[Technical Field]

[0001] This application claims priority to and claims the benefit of U.S. Provisional Patent Application No. 63 / 441,767, filed January 27, 2023, U.S. Provisional Patent Application No. 63 / 517,380, filed August 3, 2023, and U.S. Provisional Patent Application No. 63 / 594,825, filed October 31, 2023, each of which is incorporated by reference in its entirety. [Background technology]

[0002] Herpes simplex virus (HSV), commonly referred to simply as herpes, is classified as herpes simplex virus type 1 (HSV-1, or oral herpes) and herpes simplex virus type 2 (HSV-2, or genital herpes). According to the World Health Organization, an estimated 3.7 billion people under the age of 50 (67% of the world's population) are infected with HSV-1 worldwide. The prevalence of HSV-1 is understood to be highest in Africa and lowest in the Americas. Approximately 491 million people aged 15–49 worldwide (13% of the world's population) are infected with HSV-2. Because sexual transmission of HSV is more efficient from male to female than from female to male, more women are infected with HSV-2 than men. The prevalence of HSV-2 infection is estimated to be highest in Africa, followed by the United States. While the prevalence of HSV-2 has also been shown to increase with age, adolescents have historically experienced the highest number of new infections. Both HSV-1 and HSV-2 infections are lifelong. Summary of the Invention

[0003] The present disclosure provides pharmaceutical compositions (e.g., immunogenic compositions, e.g., vaccines) and related technologies (e.g., methods) for delivering certain herpes simplex virus (HSV) antigenic constructs to a subject (e.g., a patient). In particular, the present disclosure provides HSV vaccine compositions and related technologies (e.g., methods).

[0004] The present disclosure also provides that an HSV glycoprotein C (gC) antigen or an antigenic fragment thereof, an HSV glycoprotein D (gD) antigen or an antigenic fragment thereof, a glycoprotein E (gE) antigen or an antigenic fragment thereof, or a combination thereof may be useful for treating or preventing HSV, for example, in the HSV antigen constructs and / or HSV vaccines further disclosed herein.

[0005] For example, the present disclosure provides polyribonucleotides encoding one or more HSV antigens or antigenic fragments thereof. In some embodiments, the polyribonucleotides described herein encode one or more of the HSV-2 gC, gD, and / or gE antigens or antigenic fragments thereof (e.g., in a construct). In some embodiments, such polyribonucleotides can be part of an RNA construct. In some embodiments, the polyribonucleotides or RNA constructs described herein can be part of a composition (e.g., a pharmaceutical composition, e.g., an immunogenic composition, e.g., a vaccine).

[0006] In some embodiments, the technology provided herein is directed to HSV.

[0007] The drawings contained herein, comprising the following figures, are for illustration purposes only and not for limitation: [Brief explanation of the drawings]

[0008] [Figure 1] Schematic diagram of an HSV particle. [Figure 2] Schematic diagram of the HSV life cycle, modified from Ibanez, FJ, et al., "Experimental Dissection of the Lytic Replication Cycles of Herpes Simplex Virus in vitro," Front Microbiol. 2018;9:2406, which is incorporated by reference in its entirety. [Figure 3A]Expression levels in HEK293T cells transfected with nucleoside-modified RNA (modRNA) encoding HSV-2 gC (gC2), gD (gD2), or gE (gE2) antigens are shown. Cells were transfected with 0.2 μg / mL of modRNA encoding the gC2 or gD2 antigen construct, or 0.4 μg / mL of modRNA encoding the gE2 antigen, using a commercially available transfection reagent (Figure 3A-C), or with LNP-formulated RNA encoding a combination of all three antigens at a 1:1:1 mass ratio (Figure 3D-F) (concentrations indicated). Expression of gC2, gD2, and gE2 proteins was detected by flow cytometry using primary monoclonal mouse antibodies detecting the respective antigens and secondary fluorescently tagged anti-mouse antibodies. Representative data from one experiment showing the mean fluorescence intensity (MFI) of the total HEK293T population for the gC2 antigen construct (Figures A and D), the gD2 antigen construct (Figures B and E), and the gE2 antigen construct (Figures C and F). Data shown are the mean + SD of HEK293T transfections performed in triplicate. 1600: IL2 secretion signal and HSV-2 gC antigen. 1601: HSV-2 gD secretion signal and HSV-2 gD antigen. 1602: IL2 secretion signal and HSV-2 gE antigen. 3233: HSV-1 gD secretion signal and HSV-2 gC antigen. 3234: HSV-2 gD secretion signal and HSV-2 gD antigen. 3235: HSV-2 gD secretion signal and HSV-2 gE antigen. [Figure 3B]Expression levels in HEK293T cells transfected with nucleoside-modified RNA (modRNA) encoding HSV-2 gC (gC2), gD (gD2), or gE (gE2) antigens are shown. Cells were transfected with 0.2 μg / mL of modRNA encoding the gC2 or gD2 antigen construct, or 0.4 μg / mL of modRNA encoding the gE2 antigen, using a commercially available transfection reagent (Figure 3A-C), or with LNP-formulated RNA encoding a combination of all three antigens at a 1:1:1 mass ratio (Figure 3D-F) (concentrations indicated). Expression of gC2, gD2, and gE2 proteins was detected by flow cytometry using primary monoclonal mouse antibodies detecting the respective antigens and secondary fluorescently tagged anti-mouse antibodies. Representative data from one experiment showing median fluorescence intensity (MFI) of the total HEK293T population for the gC2 antigen construct (Figures A and D), gD2 antigen construct (Figures B and E), and gE2 antigen construct (Figures C and F). Data shown are the mean + SD of HEK293T transfections performed in triplicate. 1600: IL2 secretion signal and HSV-2 gC antigen. 1601: HSV-2 gD secretion signal and HSV-2 gD antigen. 1602: IL2 secretion signal and HSV-2 gE antigen. 3233: HSV-1 gD secretion signal and HSV-2 gC antigen. 3234: HSV-2 gD secretion signal and HSV-2 gD antigen. 3235: HSV-2 gD secretion signal and HSV-2 gE antigen. [Figure 3C]Expression levels in HEK293T cells transfected with nucleoside-modified RNA (modRNA) encoding HSV-2 gC (gC2), gD (gD2), or gE (gE2) antigens are shown. Cells were transfected with 0.2 μg / mL of modRNA encoding the gC2 or gD2 antigen construct, or 0.4 μg / mL of modRNA encoding the gE2 antigen, using a commercially available transfection reagent (Figure 3A-C), or with LNP-formulated RNA encoding a combination of all three antigens at a 1:1:1 mass ratio (Figure 3D-F) (concentrations indicated). Expression of gC2, gD2, and gE2 proteins was detected by flow cytometry using primary monoclonal mouse antibodies detecting the respective antigens and secondary fluorescently tagged anti-mouse antibodies. Representative data from one experiment showing median fluorescence intensity (MFI) of the total HEK293T population for the gC2 antigen construct (Figures A and D), gD2 antigen construct (Figures B and E), and gE2 antigen construct (Figures C and F). Data shown are the mean + SD of HEK293T transfections performed in triplicate. 1600: IL2 secretion signal and HSV-2 gC antigen. 1601: HSV-2 gD secretion signal and HSV-2 gD antigen. 1602: IL2 secretion signal and HSV-2 gE antigen. 3233: HSV-1 gD secretion signal and HSV-2 gC antigen. 3234: HSV-2 gD secretion signal and HSV-2 gD antigen. 3235: HSV-2 gD secretion signal and HSV-2 gE antigen. [Figure 3D]Expression levels in HEK293T cells transfected with nucleoside-modified RNA (modRNA) encoding HSV-2 gC (gC2), gD (gD2), or gE (gE2) antigens are shown. Cells were transfected with 0.2 μg / mL of modRNA encoding the gC2 or gD2 antigen construct, or 0.4 μg / mL of modRNA encoding the gE2 antigen, using a commercially available transfection reagent (Figure 3A-C), or with LNP-formulated RNA encoding a combination of all three antigens at a 1:1:1 mass ratio (Figure 3D-F) (concentrations indicated). Expression of gC2, gD2, and gE2 proteins was detected by flow cytometry using primary monoclonal mouse antibodies detecting the respective antigens and secondary fluorescently tagged anti-mouse antibodies. Representative data from one experiment showing median fluorescence intensity (MFI) of the total HEK293T population for the gC2 antigen construct (Figures A and D), gD2 antigen construct (Figures B and E), and gE2 antigen construct (Figures C and F). Data shown are the mean + SD of HEK293T transfections performed in triplicate. 1600: IL2 secretion signal and HSV-2 gC antigen. 1601: HSV-2 gD secretion signal and HSV-2 gD antigen. 1602: IL2 secretion signal and HSV-2 gE antigen. 3233: HSV-1 gD secretion signal and HSV-2 gC antigen. 3234: HSV-2 gD secretion signal and HSV-2 gD antigen. 3235: HSV-2 gD secretion signal and HSV-2 gE antigen. [Figure 3E]Expression levels in HEK293T cells transfected with nucleoside-modified RNA (modRNA) encoding HSV-2 gC (gC2), gD (gD2), or gE (gE2) antigens are shown. Cells were transfected with 0.2 μg / mL of modRNA encoding the gC2 or gD2 antigen construct, or 0.4 μg / mL of modRNA encoding the gE2 antigen, using a commercially available transfection reagent (Figure 3A-C), or with LNP-formulated RNA encoding a combination of all three antigens at a 1:1:1 mass ratio (Figure 3D-F) (concentrations indicated). Expression of gC2, gD2, and gE2 proteins was detected by flow cytometry using primary monoclonal mouse antibodies detecting the respective antigens and secondary fluorescently tagged anti-mouse antibodies. Representative data from one experiment showing median fluorescence intensity (MFI) of the total HEK293T population for the gC2 antigen construct (Figures A and D), gD2 antigen construct (Figures B and E), and gE2 antigen construct (Figures C and F). Data shown are the mean + SD of HEK293T transfections performed in triplicate. 1600: IL2 secretion signal and HSV-2 gC antigen. 1601: HSV-2 gD secretion signal and HSV-2 gD antigen. 1602: IL2 secretion signal and HSV-2 gE antigen. 3233: HSV-1 gD secretion signal and HSV-2 gC antigen. 3234: HSV-2 gD secretion signal and HSV-2 gD antigen. 3235: HSV-2 gD secretion signal and HSV-2 gE antigen. [Figure 3F]Expression levels in HEK293T cells transfected with nucleoside-modified RNA (modRNA) encoding HSV-2 gC (gC2), gD (gD2), or gE (gE2) antigens are shown. Cells were transfected with 0.2 μg / mL of modRNA encoding the gC2 or gD2 antigen construct, or 0.4 μg / mL of modRNA encoding the gE2 antigen, using a commercially available transfection reagent (Figure 3A-C), or with LNP-formulated RNA encoding a combination of all three antigens at a 1:1:1 mass ratio (Figure 3D-F) (concentrations indicated). Expression of gC2, gD2, and gE2 proteins was detected by flow cytometry using primary monoclonal mouse antibodies detecting the respective antigens and secondary fluorescently tagged anti-mouse antibodies. Representative data from one experiment showing median fluorescence intensity (MFI) of the total HEK293T population for the gC2 antigen construct (Figures A and D), gD2 antigen construct (Figures B and E), and gE2 antigen construct (Figures C and F). Data shown are the mean + SD of HEK293T transfections performed in triplicate. 1600: IL2 secretion signal and HSV-2 gC antigen. 1601: HSV-2 gD secretion signal and HSV-2 gD antigen. 1602: IL2 secretion signal and HSV-2 gE antigen. 3233: HSV-1 gD secretion signal and HSV-2 gC antigen. 3234: HSV-2 gD secretion signal and HSV-2 gD antigen. 3235: HSV-2 gD secretion signal and HSV-2 gE antigen. [Figure 4]A general overview of a study investigating a vaccine candidate against HSV-2 in guinea pigs is shown. Guinea pigs were immunized IM on days 0 and 28 with HSV-2 vaccine candidate containing total gC2 / gD2 / gE2 RNA at concentrations of 3 μg, 15 μg, or PBS control, as outlined in Table 18. Animals were bled 28 days after the second immunization, i.e., on day 56. On day 60, guinea pigs were challenged with a lethal dose of 5×10 PFU of HSV-2 strain MS (25x LD50). d = day, DRG = dorsal root ganglion, HSV-2 = herpes simplex virus-2, gC2 = glycoprotein C from herpes simplex virus-2, gD2 = glycoprotein D from herpes simplex virus-2, gE2 = glycoprotein E from herpes simplex virus-2, IM = intramuscular, PFU = plaque forming units, RNA-LNP315 = RNA lipid nanoparticles formulated with ALC-0315. [Figure 5A] Figure 1 shows serum IgG antibody titers observed one month after the second immunization in guinea pigs immunized with the HSV-2 vaccine candidate described herein. Serum antibody titers were measured by ELISA on day 56, four weeks after the second immunization with a composition containing three polyribonucleotides encoding glycoprotein C (gC), glycoprotein D (gD), and glycoprotein E (gE), respectively (the "trivalent vaccine"). Dose levels represent the total RNA content of the three RNAs encoding the gC2, gD2, and gE2 antigens, respectively, in a 1:1:1 ratio. Geometric means ± 95% confidence intervals and individual animal values ​​are shown. P values ​​were calculated using the Kruskal-Wallis test. * = p-value ≤ 0.05, ** = p-value ≤ 0.01, **** = p-value ≤ 0.0001, gC2 = glycoprotein C from herpes simplex virus-2, gD2 = glycoprotein D from herpes simplex virus-2, gE2 = glycoprotein E from herpes simplex virus-2, IgG = immunoglobulin G, RNA = ribonucleic acid, GMT = geometric mean, CI = confidence interval. As shown in Figure 5, administration of the HSV-2 vaccine candidate induced high IgG antibody titers against each of gC2 (Figure 5A), gD2 (Figure 5B), and gE2 (Figure 5C), and the 15 μg dose induced higher antibody titers against gC and gD antigens than the 3 μg dose. [Figure 5B]Figure 1 shows serum IgG antibody titers observed one month after the second immunization in guinea pigs immunized with the HSV-2 vaccine candidate described herein. Serum antibody titers were measured by ELISA on day 56, four weeks after the second immunization with a composition containing three polyribonucleotides encoding glycoprotein C (gC), glycoprotein D (gD), and glycoprotein E (gE), respectively (the "trivalent vaccine"). Dose levels represent the total RNA content of the three RNAs encoding the gC2, gD2, and gE2 antigens, respectively, in a 1:1:1 ratio. Geometric means ± 95% CI and individual animal values ​​are shown. P values ​​were calculated using the Kruskal-Wallis test. * = p-value ≤ 0.05, ** = p-value ≤ 0.01, **** = p-value ≤ 0.0001, gC2 = glycoprotein C from herpes simplex virus-2, gD2 = glycoprotein D from herpes simplex virus-2, gE2 = glycoprotein E from herpes simplex virus-2, IgG = immunoglobulin G, RNA = ribonucleic acid, GMT = geometric mean, CI = confidence interval. As shown in Figure 5, administration of the HSV-2 vaccine candidate induced high IgG antibody titers against each of gC2 (Figure 5A), gD2 (Figure 5B), and gE2 (Figure 5C), and the 15 μg dose induced higher antibody titers against gC and gD antigens than the 3 μg dose. [Figure 5C]Figure 1 shows serum IgG antibody titers observed one month after the second immunization in guinea pigs immunized with the HSV-2 vaccine candidate described herein. Serum antibody titers were measured by ELISA on day 56, four weeks after the second immunization with a composition containing three polyribonucleotides encoding glycoprotein C (gC), glycoprotein D (gD), and glycoprotein E (gE), respectively (the "trivalent vaccine"). Dose levels represent the total RNA content of the three RNAs encoding the gC2, gD2, and gE2 antigens, respectively, in a 1:1:1 ratio. Geometric means ± 95% CI and individual animal values ​​are shown. P values ​​were calculated using the Kruskal-Wallis test. * = p-value ≤ 0.05, ** = p-value ≤ 0.01, **** = p-value ≤ 0.0001, gC2 = glycoprotein C from herpes simplex virus-2, gD2 = glycoprotein D from herpes simplex virus-2, gE2 = glycoprotein E from herpes simplex virus-2, IgG = immunoglobulin G, RNA = ribonucleic acid, GMT = geometric mean, CI = confidence interval. As shown in Figure 5, administration of the HSV-2 vaccine candidate induced high IgG antibody titers against each of gC2 (Figure 5A), gD2 (Figure 5B), and gE2 (Figure 5C), and the 15 μg dose induced higher antibody titers against gC and gD antigens than the 3 μg dose. [Figure 6A]Figure 1 shows vaginal IgG antibody titers in guinea pigs one month after the second immunization with the HSV-2 modRNA vaccine described herein. Vaginal antibody titers were measured by ELISA on day 56, 4 weeks after the second immunization with the trivalent vaccine. Dose levels represent the total RNA content of the three RNAs encoding the gC2, gD2, and gE2 antigens, respectively, in a 1:1:1 ratio. Geometric means ± 95% confidence intervals and individual animal values ​​are shown. P values ​​were calculated using the Kruskal-Wallis test. * = p-value ≤ 0.05, ** = p-value ≤ 0.01, **** = p-value ≤ 0.0001; gC2 = glycoprotein C from herpes simplex virus-2; gD2 = glycoprotein D from herpes simplex virus-2; gE2 = glycoprotein E from herpes simplex virus-2; IgG = immunoglobulin G; RNA = ribonucleic acid; GMT = geometric mean; CI = confidence interval. Administration of the HSV-2 vaccine candidate induced high vaginal IgG antibody titers against each of gC2 (Figure 6A), gD2 (Figure 6B), and gE2 (Figure 6C), with the 15 μg dose inducing higher antibody titers against gE antigen than the 3 μg dose. [Figure 6B] Figure 1 shows vaginal IgG antibody titers in guinea pigs one month after the second immunization with the HSV-2 modRNA vaccine described herein. Vaginal antibody titers were measured by ELISA on day 56, 4 weeks after the second immunization with the trivalent vaccine. Dose levels represent the total RNA content of the three RNAs encoding the gC2, gD2, and gE2 antigens, respectively, in a 1:1:1 ratio. Geometric mean ± 95% CI and individual animal values ​​are shown. P values ​​were calculated using the Kruskal-Wallis test. * = p-value ≤ 0.05, ** = p-value ≤ 0.01, **** = p-value ≤ 0.0001; gC2 = glycoprotein C from herpes simplex virus-2; gD2 = glycoprotein D from herpes simplex virus-2; gE2 = glycoprotein E from herpes simplex virus-2; IgG = immunoglobulin G; RNA = ribonucleic acid; GMT = geometric mean; CI = confidence interval. Administration of the HSV-2 vaccine candidate induced high vaginal IgG antibody titers against each of gC2 (Figure 6A), gD2 (Figure 6B), and gE2 (Figure 6C), with the 15 μg dose inducing higher antibody titers against gE antigen than the 3 μg dose. [Figure 6C]Figure 1 shows vaginal IgG antibody titers in guinea pigs one month after the second immunization with the HSV-2 modRNA vaccine described herein. Vaginal antibody titers were measured by ELISA on day 56, 4 weeks after the second immunization with the trivalent vaccine. Dose levels represent the total RNA content of the three RNAs encoding the gC2, gD2, and gE2 antigens, respectively, in a 1:1:1 ratio. Geometric mean ± 95% CI and individual animal values ​​are shown. P values ​​were calculated using the Kruskal-Wallis test. * = p-value ≤ 0.05, ** = p-value ≤ 0.01, **** = p-value ≤ 0.0001; gC2 = glycoprotein C from herpes simplex virus-2; gD2 = glycoprotein D from herpes simplex virus-2; gE2 = glycoprotein E from herpes simplex virus-2; IgG = immunoglobulin G; RNA = ribonucleic acid; GMT = geometric mean; CI = confidence interval. Administration of the HSV-2 vaccine candidate induced high vaginal IgG antibody titers against each of gC2 (Figure 6A), gD2 (Figure 6B), and gE2 (Figure 6C), with the 15 μg dose inducing higher antibody titers against gE antigen than the 3 μg dose. [Figure 7] Figure 1 shows serum neutralizing antibody titers against HSV-2 in guinea pigs one month after a second immunization with the HSV-2 modRNA vaccine described herein. Neutralizing antibody titers were determined using a serum HSV-2 plaque reduction assay and were defined as the highest dilution of serum in 5% human complement that resulted in a 50% reduction in the number of HSV-2 plaques. Samples were collected on day 56, four weeks after the second immunization. Dose levels represent the total RNA content of three RNAs encoding the gC2, gD2, and gE2 antigens, respectively, in a 1:1:1 ratio. Geometric means ± 95% confidence intervals and individual animal values ​​are shown. P values ​​were calculated using the Mann-Whitney test. * = p-value ≤ 0.05; gC2 = glycoprotein C from herpes simplex virus-2; gD2 = glycoprotein D from herpes simplex virus-2; gE2 = glycoprotein E from herpes simplex virus-2; RNA = ribonucleic acid; GMT = geometric mean; CI = confidence interval. As shown in Figure 7, high neutralizing antibody titers were observed at both the 3 μg and 15 μg doses, with the 15 μg dose inducing higher neutralizing antibody titers than the 3 μg dose. [Figure 8A]Figure 8 shows weight loss after challenge with HSV-2 virus in guinea pigs administered the HSV-2 vaccine described herein. Relative body weight change in guinea pigs up to day 14 after viral challenge with a lethal intravaginal dose of HSV-2 on day 60, approximately one month after the second immunization with PBS (Figure 8A), or 3 μg (Figure 8B) or 15 μg (Figure 8C) of the trivalent vaccine. Dose levels represent the total RNA content of the three RNAs encoding the gC2, gD2, and gE2 antigens, respectively, in a 1:1:1 ratio. PBS = phosphate-buffered saline; gC2 = glycoprotein C from herpes simplex virus-2; gD2 = glycoprotein D from herpes simplex virus-2; gE2 = glycoprotein E from herpes simplex virus-2; RNA = ribonucleic acid. As shown in Figure 8, administration of a 3 μg dose of HSV-2 vaccine reduced weight loss compared to the PBS negative control, and a 15 μg dose of HSV-2 vaccine further reduced weight loss. [Figure 8B] Figure 8 shows weight loss after challenge with HSV-2 virus in guinea pigs administered the HSV-2 vaccine described herein. Relative body weight change in guinea pigs up to day 14 after viral challenge with a lethal intravaginal dose of HSV-2 on day 60, approximately one month after the second immunization with PBS (Figure 8A), or 3 μg (Figure 8B) or 15 μg (Figure 8C) of the trivalent vaccine. Dose levels represent the total RNA content of the three RNAs encoding the gC2, gD2, and gE2 antigens, respectively, in a 1:1:1 ratio. PBS = phosphate-buffered saline; gC2 = glycoprotein C from herpes simplex virus-2; gD2 = glycoprotein D from herpes simplex virus-2; gE2 = glycoprotein E from herpes simplex virus-2; RNA = ribonucleic acid. As shown in Figure 8, administration of a 3 μg dose of HSV-2 vaccine reduced weight loss compared to the PBS negative control, and a 15 μg dose of HSV-2 vaccine further reduced weight loss. [Figure 8C]Figure 8 shows weight loss after challenge with HSV-2 virus in guinea pigs administered the HSV-2 vaccine described herein. Relative body weight change in guinea pigs up to day 14 after viral challenge with a lethal intravaginal dose of HSV-2 on day 60, approximately one month after the second immunization with PBS (Figure 8A), or 3 μg (Figure 8B) or 15 μg (Figure 8C) of the trivalent vaccine. Dose levels represent the total RNA content of the three RNAs encoding the gC2, gD2, and gE2 antigens, respectively, in a 1:1:1 ratio. PBS = phosphate-buffered saline; gC2 = glycoprotein C from herpes simplex virus-2; gD2 = glycoprotein D from herpes simplex virus-2; gE2 = glycoprotein E from herpes simplex virus-2; RNA = ribonucleic acid. As shown in Figure 8, administration of a 3 μg dose of HSV-2 vaccine reduced weight loss compared to the PBS negative control, and a 15 μg dose of HSV-2 vaccine further reduced weight loss. [Figure 9] Figure 1 shows the survival rate of guinea pigs immunized with the HSV-2 vaccine described herein through 48 days after challenge with HSV-2 virus. The probability of survival of guinea pigs through 48 days after lethal intravaginal challenge with HSV-2 on day 60, approximately one month after the second immunization with 3 μg or 15 μg of the trivalent vaccine or PBS. Dose levels represent a 1:1:1 ratio of total RNA content for the three RNAs encoding the gC2, gD2, and gE2 antigens, respectively. P values ​​were calculated by the log-rank (Mantel-Cox) test. ** = p-value ≤ 0.01; PBS = phosphate-buffered saline; gC2 = glycoprotein C from herpes simplex virus-2; gD2 = glycoprotein D from herpes simplex virus-2; gE2 = glycoprotein E from herpes simplex virus-2; HSV-2 = herpes simplex virus-2; RNA = ribonucleic acid. As shown in Figure 9, administration of a 3 μg dose of HSV-2 vaccine significantly increased survival in guinea pigs, and administration of a 15 μg dose further increased survival. [Figure 10A]Figure 10 shows individual assessments of genital disease up to day 48 after challenge with a lethal intravaginal dose of HSV-2 in guinea pigs administered the RNA compositions described herein. Results are shown for day 60, approximately one month after the second vaccination with the HSV-2 modRNA vaccine. Figure 10A shows the mean number of days of genital disease during this period, and Figure 10B shows the mean severity of genital lesions on days with genital disease. Mean ± SEM and individual animal values ​​are shown. Figure 10C shows the mean number of days of urinary retention. Dose levels represent a 1:1:1 ratio of total RNA content for the three RNAs encoding gC2, gD2, and gE2 antigens, respectively. P values ​​were calculated using the Mann-Whitney test. The black circles with red outlines relate to animals that died after virus challenge in the PBS group. * = p-value ≤ 0.05, HSV-2 = herpes simplex virus-2, SEM = standard error of the mean, PBS = phosphate-buffered saline, gC2 = glycoprotein C from herpes simplex virus-2, gD2 = glycoprotein D from herpes simplex virus-2, gE2 = glycoprotein E from herpes simplex virus-2, RNA = ribonucleic acid. Because the majority of animals in the PBS control group died within 2 weeks of viral challenge, disease scores, as measured by the number of days with genital lesions and / or the severity of genital lesions, were underestimated in this group, and statistical analysis of this group was not performed. As shown in Figure 10, administration of the HSV-2 vaccine described herein reduced the number of days with observed genital lesions, reduced the severity of the observed lesions, and reduced the number of days with urinary retention. [Figure 10B]Figure 10 shows individual assessments of genital disease up to day 48 after challenge with a lethal intravaginal dose of HSV-2 in guinea pigs administered the RNA compositions described herein. Results are shown for day 60, approximately one month after the second vaccination with the HSV-2 mod RNA vaccine. Figure 10A shows the mean number of days of genital disease during this period, and Figure 10B shows the mean severity of genital lesions on days with genital disease. Mean ± SEM and individual animal values ​​are shown. Figure 10C shows the mean number of days of urinary retention. Dose levels represent a 1:1:1 ratio of total RNA content for the three RNAs encoding gC2, gD2, and gE2 antigens, respectively. P values ​​were calculated using the Mann-Whitney test. Black circles with red outlines relate to animals that died after virus challenge in the PBS group. * = p-value ≤ 0.05, HSV-2 = herpes simplex virus-2, SEM = standard error of the mean, PBS = phosphate-buffered saline, gC2 = glycoprotein C from herpes simplex virus-2, gD2 = glycoprotein D from herpes simplex virus-2, gE2 = glycoprotein E from herpes simplex virus-2, RNA = ribonucleic acid. Because the majority of animals in the PBS control group died within 2 weeks of virus challenge, disease scores, as measured by the number of days with genital lesions and / or the severity of genital lesions, were underestimated in this group, and statistical analysis of this group was not performed. As shown in Figure 10, administration of the HSV-2 vaccine described herein reduced the number of days with observed genital lesions, reduced the severity of the observed lesions, and reduced the number of days with urinary retention. [Figure 10C]Figure 10 shows individual assessments of genital disease up to day 48 after challenge with a lethal intravaginal dose of HSV-2 in guinea pigs administered the RNA compositions described herein. Results are shown for day 60, approximately one month after the second vaccination with the HSV-2 mod RNA vaccine. Figure 10A shows the mean number of days of genital disease during this period, and Figure 10B shows the mean severity of genital lesions on days with genital disease. Mean ± SEM and individual animal values ​​are shown. Figure 10C shows the mean number of days of urinary retention. Dose levels represent a 1:1:1 ratio of total RNA content for the three RNAs encoding gC2, gD2, and gE2 antigens, respectively. P values ​​were calculated using the Mann-Whitney test. Black circles with red outlines relate to animals that died after virus challenge in the PBS group. * = p-value ≤ 0.05, HSV-2 = herpes simplex virus-2, SEM = standard error of the mean, PBS = phosphate-buffered saline, gC2 = glycoprotein C from herpes simplex virus-2, gD2 = glycoprotein D from herpes simplex virus-2, gE2 = glycoprotein E from herpes simplex virus-2, RNA = ribonucleic acid. Because the majority of animals in the PBS control group died within 2 weeks of virus challenge, disease scores, as measured by the number of days with genital lesions and / or the severity of genital lesions, were underestimated in this group, and statistical analysis of this group was not performed. As shown in Figure 10, administration of the HSV-2 vaccine described herein reduced the number of days with observed genital lesions, reduced the severity of the observed lesions, and reduced the number of days with urinary retention. [Figure 11]Figure 11 shows cumulative disease scores through day 48 after challenge with a lethal intravaginal dose of HSV-2 in guinea pigs administered RNA compositions described herein. Results are shown at day 60, approximately one month after the second vaccination. The mean number of days with genital disease per group is shown over 48 days. Dose levels represent the total RNA content of three RNAs encoding the gC2, gD2, and gE2 antigens, respectively, in a 1:1:1 ratio. Animals that succumbed to viral disease were not assigned a score for days after death. HSV-2 = herpes simplex virus-2; PBS = phosphate-buffered saline; gC2 = glycoprotein C from herpes simplex virus-2; gD2 = glycoprotein D from herpes simplex virus-2; gE2 = glycoprotein E from herpes simplex virus-2; RNA = ribonucleic acid. As shown in Figure 11, administration of 3 μg of HSV-2 vaccine significantly reduced the mean cumulative days of disease, and administration of 15 μg further reduced the mean cumulative days of disease. [Figure 12A] Figure 12 shows vaginal viral titers 2 and 4 days after viral challenge in guinea pigs administered the HSV-2 vaccine described herein. Vaginal HSV-2 titers were measured by plaque assay 2 days (Figure 12A) and 4 days (Figure 12B) after lethal intravaginal challenge with HSV-2. Results are plotted as mean ± SEM and individual animal values. The mean days of genital shedding of HSV-2 DNA were analyzed by PCR and are shown in Figure 12C. HSV-2 vaccine dose levels represent a 1:1:1 ratio of total RNA content for the three RNAs encoding the gC2, gD2, and gE2 antigens, respectively. P values ​​were calculated using the Kruskal-Wallis test. SEM = standard error of the mean, gC2 = glycoprotein C from herpes simplex virus-2, gD2 = glycoprotein D from herpes simplex virus-2, gE2 = glycoprotein E from herpes simplex virus-2, HSV-2 = herpes simplex virus-2, DNA = deoxyribonucleic acid, RNA = ribonucleic acid. [Figure 12B]Figure 12 shows vaginal viral titers 2 and 4 days after viral challenge in guinea pigs administered the HSV-2 vaccine described herein. Vaginal HSV-2 titers were measured by plaque assay 2 days (Figure 12A) and 4 days (Figure 12B) after lethal vaginal challenge with HSV-2. Results are plotted as mean ± SEM and individual animal values. The mean days of genital shedding of HSV-2 DNA were analyzed by PCR and are shown in Figure 12C. HSV-2 vaccine dose levels represent a 1:1:1 ratio of total RNA content for the three RNAs encoding the gC2, gD2, and gE2 antigens, respectively. P values ​​were calculated using the Kruskal-Wallis test. SEM = standard error of the mean, gC2 = glycoprotein C from herpes simplex virus-2, gD2 = glycoprotein D from herpes simplex virus-2, gE2 = glycoprotein E from herpes simplex virus-2, HSV-2 = herpes simplex virus-2, DNA = deoxyribonucleic acid, RNA = ribonucleic acid. [Figure 12C] Figure 12 shows vaginal viral titers 2 and 4 days after viral challenge in guinea pigs administered the HSV-2 vaccine described herein. Vaginal HSV-2 titers were measured by plaque assay 2 days (Figure 12A) and 4 days (Figure 12B) after lethal vaginal challenge with HSV-2. Results are plotted as mean ± SEM and individual animal values. The mean days of genital shedding of HSV-2 DNA were analyzed by PCR and are shown in Figure 12C. HSV-2 vaccine dose levels represent a 1:1:1 ratio of total RNA content for the three RNAs encoding the gC2, gD2, and gE2 antigens, respectively. P values ​​were calculated using the Kruskal-Wallis test. SEM = standard error of the mean, gC2 = glycoprotein C from herpes simplex virus-2, gD2 = glycoprotein D from herpes simplex virus-2, gE2 = glycoprotein E from herpes simplex virus-2, HSV-2 = herpes simplex virus-2, DNA = deoxyribonucleic acid, RNA = ribonucleic acid. [Figure 13A]Figure 13 shows DNA copy numbers in the DRG and spinal cord of guinea pigs administered the HSV-2 vaccine disclosed herein 48 days after viral challenge. The HSV-2 DNA copy numbers in the DRG and spinal cord of guinea pigs 48 days after viral challenge with a lethal dose of HSV-2 were analyzed by qPCR. HSV-2 genome copies in the DRG (Figure 13A) and spinal cord (Figure 13B) relative to GAPDH expression 48 days after viral challenge are shown for immunized animals. Mean ± SEM and individual animal values ​​are shown. HSV-2 vaccine dose levels represent a 1:1:1 ratio of total RNA content for the three RNAs encoding gC2, gD2, and gE2 antigens, respectively. P values ​​were calculated using the Mann-Whitney test. DRG = dorsal root ganglion, SEM = standard error of the mean, gC2 = glycoprotein C from herpes simplex virus-2, gD2 = glycoprotein D from herpes simplex virus-2, gE2 = glycoprotein E from herpes simplex virus-2, HSV-2 = herpes simplex virus-2, DNA = deoxyribonucleic acid, RNA = ribonucleic acid. [Figure 13B] Figure 13 shows DNA copy numbers in the DRG and spinal cord of guinea pigs administered the HSV-2 vaccine disclosed herein 48 days after viral challenge. HSV-2 DNA copy numbers in the DRG and spinal cord of guinea pigs 48 days after viral challenge with a lethal dose of HSV-2 were analyzed by qPCR. HSV-2 genome copies in the DRG (Figure 13A) and spinal cord (Figure 13B) relative to GAPDH expression 48 days after viral challenge are shown for immunized animals. Mean ± SEM and individual animal values ​​are shown. HSV-2 vaccine dose levels represent a 1:1:1 ratio of total RNA content for the three RNAs encoding gC2, gD2, and gE2 antigens, respectively. P values ​​were calculated using the Mann-Whitney test. DRG = dorsal root ganglion, SEM = standard error of the mean, gC2 = glycoprotein C from herpes simplex virus-2, gD2 = glycoprotein D from herpes simplex virus-2, gE2 = glycoprotein E from herpes simplex virus-2, HSV-2 = herpes simplex virus-2, DNA = deoxyribonucleic acid, RNA = ribonucleic acid. [Figure 14A]Figure 14 shows expression levels in HEK293T cells transfected with RNA encoding HSV-2 gC (gC2), gD (gD2), and gE (gE2) antigens. Cells were transfected with 0.2 μg / mL of modRNA encoding the gC2 and gD2 antigen constructs and 0.4 μg / mL of modRNA encoding the gE2 antigen construct using a commercially available transfection reagent. Expression of gC2, gD2, and gE2 proteins was detected by flow cytometry using primary monoclonal mouse antibodies detecting the respective antigens and secondary fluorescently tagged anti-mouse antibodies. Representative data from one experiment showing the mean fluorescence intensity (MFI) of the total HEK293T population for the gC2 antigen construct (Figures 14A-C), gD2 antigen construct (Figures 14D-E), and gE2 antigen construct (Figure 14F). Data shown are the mean + SD of HEK293T transfections performed in triplicate. 1600: IL2 secretory signal and HSV-2 gC antigen (version 2). 1873: IL2 secretory signal and HSV-2 gC antigen (version 4). 2537: HSV-1 gD secretory signal and HSV-2 gC antigen (version 1). 2538: HSV-1 gD secretory signal and HSV-2 gC antigen (version 2). 2541: HSV-1 gB secretory signal and HSV-2 gC antigen (version 2). 2547: HSV-2 gE secretory signal and HSV-2 gC antigen (version 2). 1601: HSV-2 gD secretory signal and HSV-2 gD antigen (version 2). 1602: IL2 secretory signal and HSV-2 gE antigen (version 2). 2138: HSV-2 gE secretory signal and HSV-2 gC antigen (version 4). 2140: HSV-1 gD secretory signal and HSV-2 gC antigen (version 4). 2141: HSV-1 gB secretory signal and HSV-2 gC antigen (version 4). 2539: HSV-1 gD secretory signal and HSV-2 gC antigen (version 4). 2540: HSV-1 gB secretory signal and HSV-2 gC antigen (version 1). 2546: HSV-2 gE secretory signal and HSV-2 gC antigen (version 1). 2548: HSV-2 gE secretory signal and HSV-2 gC antigen (version 4).2784: HSV-2 gC secretory signal and HSV-2 gC antigen (version 2). 2785: HSV-2 gC secretory signal and HSV-2 gC antigen (version 2). 1876: IL2 secretory signal and HSV-2 gC antigen (version 3). 1874: HSV-2 gD secretory signal and HSV-2 gD antigen (version 1), 1877: HSV-2 gD secretory signal and HSV-2 gD antigen (version 3), 1659: HSV-2 gD secretory signal and HSV-2 gD antigen (version 2), 1660: HSV-2 gD secretory signal and HSV-2 gE antigen (version 2), 2143: HSV-1 gD secretory signal and HSV-2 gE antigen (version 4), 1913: HSV-2 gE secretory signal and HSV-2 gE antigen (version 2). 2553: HSV-1 gD secretion signal and HSV-2 gE antigen (version 2). [Figure 14B]Figure 14 shows expression levels in HEK293T cells transfected with RNA encoding HSV-2 gC (gC2), gD (gD2), and gE (gE2) antigens. Cells were transfected with 0.2 μg / mL of modRNA encoding the gC2 and gD2 antigen constructs and 0.4 μg / mL of modRNA encoding the gE2 antigen construct using a commercially available transfection reagent. Expression of gC2, gD2, and gE2 proteins was detected by flow cytometry using primary monoclonal mouse antibodies detecting the respective antigens and secondary fluorescently tagged anti-mouse antibodies. Representative data from one experiment showing the median fluorescence intensity (MFI) of the total HEK293T population for the gC2 antigen construct (Figures 14A-C), gD2 antigen construct (Figures 14D-E), and gE2 antigen construct (Figure 14F). Data shown are the mean + SD of HEK293T transfections performed in triplicate. 1600: IL2 secretory signal and HSV-2 gC antigen (version 2). 1873: IL2 secretory signal and HSV-2 gC antigen (version 4). 2537: HSV-1 gD secretory signal and HSV-2 gC antigen (version 1). 2538: HSV-1 gD secretory signal and HSV-2 gC antigen (version 2). 2541: HSV-1 gB secretory signal and HSV-2 gC antigen (version 2). 2547: HSV-2 gE secretory signal and HSV-2 gC antigen (version 2). 1601: HSV-2 gD secretory signal and HSV-2 gD antigen (version 2). 1602: IL2 secretory signal and HSV-2 gE antigen (version 2). 2138: HSV-2 gE secretory signal and HSV-2 gC antigen (version 4). 2140: HSV-1 gD secretory signal and HSV-2 gC antigen (version 4). 2141: HSV-1 gB secretory signal and HSV-2 gC antigen (version 4). 2539: HSV-1 gD secretory signal and HSV-2 gC antigen (version 4). 2540: HSV-1 gB secretory signal and HSV-2 gC antigen (version 1). 2546: HSV-2 gE secretory signal and HSV-2 gC antigen (version 1). 2548: HSV-2 gE secretory signal and HSV-2 gC antigen (version 4).2784: HSV-2gC secretory signal and HSV-2gC antigen (version 2). 2785: HSV-2gC secretory signal and HSV-2gC antigen (version 2). 1876: IL2 secretory signal and HSV-2gC antigen (version 3). 1874: HSV-2gD secretory signal and HSV-2gD antigen (version 1), 1877: HSV-2gD secretory signal and HSV-2gD antigen (version 3), 1659: HSV-2gD secretory signal and HSV-2gD antigen (version 2), 1660: HSV-2gD secretory signal and HSV-2gE antigen (version 2), 2143: HSV-1gD secretory signal and HSV-2gE antigen (version 4), 1913: HSV-2gE secretory signal and HSV-2gE antigen (version 2). 2553: HSV-1 gD secretion signal and HSV-2 gE antigen (version 2). [Figure 14C]Figure 14 shows expression levels in HEK293T cells transfected with RNA encoding HSV-2 gC (gC2), gD (gD2), and gE (gE2) antigens. Cells were transfected with 0.2 μg / mL of modRNA encoding the gC2 and gD2 antigen constructs and 0.4 μg / mL of modRNA encoding the gE2 antigen construct using a commercially available transfection reagent. Expression of gC2, gD2, and gE2 proteins was detected by flow cytometry using primary monoclonal mouse antibodies detecting the respective antigens and secondary fluorescently tagged anti-mouse antibodies. Representative data from one experiment showing the median fluorescence intensity (MFI) of the total HEK293T population for the gC2 antigen construct (Figures 14A-C), gD2 antigen construct (Figures 14D-E), and gE2 antigen construct (Figure 14F). Data shown are the mean + SD of HEK293T transfections performed in triplicate. 1600: IL2 secretory signal and HSV-2 gC antigen (version 2). 1873: IL2 secretory signal and HSV-2 gC antigen (version 4). 2537: HSV-1 gD secretory signal and HSV-2 gC antigen (version 1). 2538: HSV-1 gD secretory signal and HSV-2 gC antigen (version 2). 2541: HSV-1 gB secretory signal and HSV-2 gC antigen (version 2). 2547: HSV-2 gE secretory signal and HSV-2 gC antigen (version 2). 1601: HSV-2 gD secretory signal and HSV-2 gD antigen (version 2). 1602: IL2 secretory signal and HSV-2 gE antigen (version 2). 2138: HSV-2 gE secretory signal and HSV-2 gC antigen (version 4). 2140: HSV-1 gD secretory signal and HSV-2 gC antigen (version 4). 2141: HSV-1 gB secretory signal and HSV-2 gC antigen (version 4). 2539: HSV-1 gD secretory signal and HSV-2 gC antigen (version 4). 2540: HSV-1 gB secretory signal and HSV-2 gC antigen (version 1). 2546: HSV-2 gE secretory signal and HSV-2 gC antigen (version 1). 2548: HSV-2 gE secretory signal and HSV-2 gC antigen (version 4).2784: HSV-2gC secretory signal and HSV-2gC antigen (version 2). 2785: HSV-2gC secretory signal and HSV-2gC antigen (version 2). 1876: IL2 secretory signal and HSV-2gC antigen (version 3). 1874: HSV-2gD secretory signal and HSV-2gD antigen (version 1), 1877: HSV-2gD secretory signal and HSV-2gD antigen (version 3), 1659: HSV-2gD secretory signal and HSV-2gD antigen (version 2), 1660: HSV-2gD secretory signal and HSV-2gE antigen (version 2), 2143: HSV-1gD secretory signal and HSV-2gE antigen (version 4), 1913: HSV-2gE secretory signal and HSV-2gE antigen (version 2). 2553: HSV-1 gD secretion signal and HSV-2 gE antigen (version 2). [Figure 14D]Figure 14 shows expression levels in HEK293T cells transfected with RNA encoding HSV-2 gC (gC2), gD (gD2), and gE (gE2) antigens. Cells were transfected with 0.2 μg / mL of modRNA encoding the gC2 and gD2 antigen constructs and 0.4 μg / mL of modRNA encoding the gE2 antigen construct using a commercially available transfection reagent. Expression of gC2, gD2, and gE2 proteins was detected by flow cytometry using primary monoclonal mouse antibodies detecting the respective antigens and secondary fluorescently tagged anti-mouse antibodies. Representative data from one experiment showing the median fluorescence intensity (MFI) of the total HEK293T population for the gC2 antigen construct (Figures 14A-C), gD2 antigen construct (Figures 14D-E), and gE2 antigen construct (Figure 14F). Data shown are the mean + SD of HEK293T transfections performed in triplicate. 1600: IL2 secretory signal and HSV-2 gC antigen (version 2). 1873: IL2 secretory signal and HSV-2 gC antigen (version 4). 2537: HSV-1 gD secretory signal and HSV-2 gC antigen (version 1). 2538: HSV-1 gD secretory signal and HSV-2 gC antigen (version 2). 2541: HSV-1 gB secretory signal and HSV-2 gC antigen (version 2). 2547: HSV-2 gE secretory signal and HSV-2 gC antigen (version 2). 1601: HSV-2 gD secretory signal and HSV-2 gD antigen (version 2). 1602: IL2 secretory signal and HSV-2 gE antigen (version 2). 2138: HSV-2 gE secretory signal and HSV-2 gC antigen (version 4). 2140: HSV-1 gD secretory signal and HSV-2 gC antigen (version 4). 2141: HSV-1 gB secretory signal and HSV-2 gC antigen (version 4). 2539: HSV-1 gD secretory signal and HSV-2 gC antigen (version 4). 2540: HSV-1 gB secretory signal and HSV-2 gC antigen (version 1). 2546: HSV-2 gE secretory signal and HSV-2 gC antigen (version 1). 2548: HSV-2 gE secretory signal and HSV-2 gC antigen (version 4).2784: HSV-2gC secretory signal and HSV-2gC antigen (version 2). 2785: HSV-2gC secretory signal and HSV-2gC antigen (version 2). 1876: IL2 secretory signal and HSV-2gC antigen (version 3). 1874: HSV-2gD secretory signal and HSV-2gD antigen (version 1), 1877: HSV-2gD secretory signal and HSV-2gD antigen (version 3), 1659: HSV-2gD secretory signal and HSV-2gD antigen (version 2), 1660: HSV-2gD secretory signal and HSV-2gE antigen (version 2), 2143: HSV-1gD secretory signal and HSV-2gE antigen (version 4), 1913: HSV-2gE secretory signal and HSV-2gE antigen (version 2). 2553: HSV-1 gD secretion signal and HSV-2 gE antigen (version 2). [Figure 14E]Figure 14 shows expression levels in HEK293T cells transfected with RNA encoding HSV-2 gC (gC2), gD (gD2), and gE (gE2) antigens. Cells were transfected with 0.2 μg / mL of modRNA encoding the gC2 and gD2 antigen constructs and 0.4 μg / mL of modRNA encoding the gE2 antigen construct using a commercially available transfection reagent. Expression of gC2, gD2, and gE2 proteins was detected by flow cytometry using primary monoclonal mouse antibodies detecting the respective antigens and secondary fluorescently tagged anti-mouse antibodies. Representative data from one experiment showing the median fluorescence intensity (MFI) of the total HEK293T population for the gC2 antigen construct (Figures 14A-C), gD2 antigen construct (Figures 14D-E), and gE2 antigen construct (Figure 14F). Data shown are the mean + SD of HEK293T transfections performed in triplicate. 1600: IL2 secretory signal and HSV-2 gC antigen (version 2). 1873: IL2 secretory signal and HSV-2 gC antigen (version 4). 2537: HSV-1 gD secretory signal and HSV-2 gC antigen (version 1). 2538: HSV-1 gD secretory signal and HSV-2 gC antigen (version 2). 2541: HSV-1 gB secretory signal and HSV-2 gC antigen (version 2). 2547: HSV-2 gE secretory signal and HSV-2 gC antigen (version 2). 1601: HSV-2 gD secretory signal and HSV-2 gD antigen (version 2). 1602: IL2 secretory signal and HSV-2 gE antigen (version 2). 2138: HSV-2 gE secretory signal and HSV-2 gC antigen (version 4). 2140: HSV-1 gD secretory signal and HSV-2 gC antigen (version 4). 2141: HSV-1 gB secretory signal and HSV-2 gC antigen (version 4). 2539: HSV-1 gD secretory signal and HSV-2 gC antigen (version 4). 2540: HSV-1 gB secretory signal and HSV-2 gC antigen (version 1). 2546: HSV-2 gE secretory signal and HSV-2 gC antigen (version 1). 2548: HSV-2 gE secretory signal and HSV-2 gC antigen (version 4).2784: HSV-2gC secretory signal and HSV-2gC antigen (version 2). 2785: HSV-2gC secretory signal and HSV-2gC antigen (version 2). 1876: IL2 secretory signal and HSV-2gC antigen (version 3). 1874: HSV-2gD secretory signal and HSV-2gD antigen (version 1), 1877: HSV-2gD secretory signal and HSV-2gD antigen (version 3), 1659: HSV-2gD secretory signal and HSV-2gD antigen (version 2), 1660: HSV-2gD secretory signal and HSV-2gE antigen (version 2), 2143: HSV-1gD secretory signal and HSV-2gE antigen (version 4), 1913: HSV-2gE secretory signal and HSV-2gE antigen (version 2). 2553: HSV-1 gD secretion signal and HSV-2 gE antigen (version 2). [Figure 14F]Figure 14 shows expression levels in HEK293T cells transfected with RNA encoding HSV-2 gC (gC2), gD (gD2), and gE (gE2) antigens. Cells were transfected with 0.2 μg / mL of modRNA encoding the gC2 and gD2 antigen constructs and 0.4 μg / mL of modRNA encoding the gE2 antigen construct using a commercially available transfection reagent. Expression of gC2, gD2, and gE2 proteins was detected by flow cytometry using primary monoclonal mouse antibodies detecting the respective antigens and secondary fluorescently tagged anti-mouse antibodies. Representative data from one experiment showing the median fluorescence intensity (MFI) of the total HEK293T population for the gC2 antigen construct (Figures 14A-C), gD2 antigen construct (Figures 14D-E), and gE2 antigen construct (Figure 14F). Data shown are the mean + SD of HEK293T transfections performed in triplicate. 1600: IL2 secretory signal and HSV-2 gC antigen (version 2). 1873: IL2 secretory signal and HSV-2 gC antigen (version 4). 2537: HSV-1 gD secretory signal and HSV-2 gC antigen (version 1). 2538: HSV-1 gD secretory signal and HSV-2 gC antigen (version 2). 2541: HSV-1 gB secretory signal and HSV-2 gC antigen (version 2). 2547: HSV-2 gE secretory signal and HSV-2 gC antigen (version 2). 1601: HSV-2 gD secretory signal and HSV-2 gD antigen (version 2). 1602: IL2 secretory signal and HSV-2 gE antigen (version 2). 2138: HSV-2 gE secretory signal and HSV-2 gC antigen (version 4). 2140: HSV-1 gD secretory signal and HSV-2 gC antigen (version 4). 2141: HSV-1 gB secretory signal and HSV-2 gC antigen (version 4). 2539: HSV-1 gD secretory signal and HSV-2 gC antigen (version 4). 2540: HSV-1 gB secretory signal and HSV-2 gC antigen (version 1). 2546: HSV-2 gE secretory signal and HSV-2 gC antigen (version 1). 2548: HSV-2 gE secretory signal and HSV-2 gC antigen (version 4).2784: HSV-2gC secretory signal and HSV-2gC antigen (version 2). 2785: HSV-2gC secretory signal and HSV-2gC antigen (version 2). 1876: IL2 secretory signal and HSV-2gC antigen (version 3). 1874: HSV-2gD secretory signal and HSV-2gD antigen (version 1), 1877: HSV-2gD secretory signal and HSV-2gD antigen (version 3), 1659: HSV-2gD secretory signal and HSV-2gD antigen (version 2), 1660: HSV-2gD secretory signal and HSV-2gE antigen (version 2), 2143: HSV-1gD secretory signal and HSV-2gE antigen (version 4), 1913: HSV-2gE secretory signal and HSV-2gE antigen (version 2). 2553: HSV-1 gD secretion signal and HSV-2 gE antigen (version 2). [Figure 15A]Figure 15 shows expression levels in HEK293T cells transfected with RNA encoding HSV-2 gC (gC2), gD (gD2), and gE (gE2) antigens. Cells were transfected with 0.2 μg / mL of modRNA-encoded antigens using a commercially available transfection reagent. Expression of gC2, gD2, and gE2 proteins was detected by flow cytometry using a primary monoclonal mouse antibody and a secondary fluorescently tagged anti-mouse antibody, respectively, to detect the antigen. Representative data from one experiment showing the percentage of gC2 (Figure 15A) and gE2 (Figure 15B) protein-expressing cells, as well as the mean fluorescence intensity (MFI) of gC2, gD2, and gE2 of the total HEK293T population (Figures 15C, 15D, and 15E, respectively), are shown for each antigen. Data shown are the mean + SD of HEK293T transfections performed in triplicate. Cumulative total HEK expression data from experiments up to n=7 (FIG. 15F) are shown for the constructs gC2 (1600, IL2 secretion signal and HSV-2 gC antigen (version 2)), gD2 (1601, HSV-2 gD secretion signal and HSV-2 gD antigen (version 2)), or gE2 (1602, IL2 secretion signal and HSV-2 gE antigen (version 2)), respectively. The RNA constructs featured in FIG. 15 were found to produce similar or improved expression compared to constructs 1600 (IL2 secretion signal and HSV-2 gC antigen (version 2)), 1601 (HSV-2 gD secretion signal and HSV-2 gD antigen (version 2)), and 1602 (IL2 secretion signal and HSV-2 gE antigen (version 2)). 1597: IL2 secretion signal and HSV-2 gC antigen, 1598: HSV-2 gD secretion signal and HSV-2 gD antigen, 1599: IL2 secretion signal and HSV-2 gE antigen. [Figure 15B]Figure 15 shows expression levels in HEK293T cells transfected with RNA encoding HSV-2 gC (gC2), gD (gD2), and gE (gE2) antigens. Cells were transfected with 0.2 μg / mL of modRNA-encoded antigens using a commercially available transfection reagent. Expression of gC2, gD2, and gE2 proteins was detected by flow cytometry using a primary monoclonal mouse antibody and a secondary fluorescently tagged anti-mouse antibody, respectively, to detect the antigen. Representative data from one experiment showing the percentage of gC2 (Figure 15A) and gE2 (Figure 15B) protein-expressing cells, as well as the mean fluorescence intensity (MFI) of gC2, gD2, and gE2 of the total HEK293T population (Figures 15C, 15D, and 15E, respectively), are shown for each antigen. Data shown are the mean + SD of HEK293T transfections performed in triplicate. Cumulative total HEK expression data from experiments up to n=7 (FIG. 15F) are shown for the constructs gC2 (1600, IL2 secretion signal and HSV-2 gC antigen (version 2)), gD2 (1601, HSV-2 gD secretion signal and HSV-2 gD antigen (version 2)), or gE2 (1602, IL2 secretion signal and HSV-2 gE antigen (version 2)), respectively. The RNA constructs featured in FIG. 15 were found to result in similar or improved expression compared to constructs 1600 (IL2 secretion signal and HSV-2 gC antigen (version 2)), 1601 (HSV-2 gD secretion signal and HSV-2 gD antigen (version 2)), and 1602 (IL2 secretion signal and HSV-2 gE antigen (version 2)). 1597: IL2 secretion signal and HSV-2 gC antigen, 1598: HSV-2 gD secretion signal and HSV-2 gD antigen, 1599: IL2 secretion signal and HSV-2 gE antigen. [Figure 15C]Figure 15 shows expression levels in HEK293T cells transfected with RNA encoding HSV-2 gC (gC2), gD (gD2), and gE (gE2) antigens. Cells were transfected with 0.2 μg / mL of modRNA-encoded antigens using a commercially available transfection reagent. Expression of gC2, gD2, and gE2 proteins was detected by flow cytometry using a primary monoclonal mouse antibody and a secondary fluorescently tagged anti-mouse antibody, respectively, to detect the antigen. Representative data from one experiment showing the percentage of gC2 (Figure 15A) and gE2 (Figure 15B) protein-expressing cells, as well as the mean fluorescence intensity (MFI) of gC2, gD2, and gE2 of the total HEK293T population (Figures 15C, 15D, and 15E, respectively), are shown for each antigen. Data shown are the mean + SD of HEK293T transfections performed in triplicate. Cumulative total HEK expression data from experiments up to n=7 (FIG. 15F) are shown for the constructs gC2 (1600, IL2 secretion signal and HSV-2 gC antigen (version 2)), gD2 (1601, HSV-2 gD secretion signal and HSV-2 gD antigen (version 2)), or gE2 (1602, IL2 secretion signal and HSV-2 gE antigen (version 2)), respectively. The RNA constructs featured in FIG. 15 were found to result in similar or improved expression compared to constructs 1600 (IL2 secretion signal and HSV-2 gC antigen (version 2)), 1601 (HSV-2 gD secretion signal and HSV-2 gD antigen (version 2)), and 1602 (IL2 secretion signal and HSV-2 gE antigen (version 2)). 1597: IL2 secretion signal and HSV-2 gC antigen, 1598: HSV-2 gD secretion signal and HSV-2 gD antigen, 1599: IL2 secretion signal and HSV-2 gE antigen. [Figure 15D]Figure 15 shows expression levels in HEK293T cells transfected with RNA encoding HSV-2 gC (gC2), gD (gD2), and gE (gE2) antigens. Cells were transfected with 0.2 μg / mL of modRNA-encoded antigens using a commercially available transfection reagent. Expression of gC2, gD2, and gE2 proteins was detected by flow cytometry using a primary monoclonal mouse antibody and a secondary fluorescently tagged anti-mouse antibody, respectively, to detect the antigen. Representative data from one experiment showing the percentage of gC2 (Figure 15A) and gE2 (Figure 15B) protein-expressing cells, as well as the mean fluorescence intensity (MFI) of gC2, gD2, and gE2 of the total HEK293T population (Figures 15C, 15D, and 15E, respectively), are shown for each antigen. Data shown are the mean + SD of HEK293T transfections performed in triplicate. Cumulative total HEK expression data from experiments up to n=7 (FIG. 15F) are shown for the constructs gC2 (1600, IL2 secretion signal and HSV-2 gC antigen (version 2)), gD2 (1601, HSV-2 gD secretion signal and HSV-2 gD antigen (version 2)), or gE2 (1602, IL2 secretion signal and HSV-2 gE antigen (version 2)), respectively. The RNA constructs featured in FIG. 15 were found to result in similar or improved expression compared to constructs 1600 (IL2 secretion signal and HSV-2 gC antigen (version 2)), 1601 (HSV-2 gD secretion signal and HSV-2 gD antigen (version 2)), and 1602 (IL2 secretion signal and HSV-2 gE antigen (version 2)). 1597: IL2 secretion signal and HSV-2 gC antigen, 1598: HSV-2 gD secretion signal and HSV-2 gD antigen, 1599: IL2 secretion signal and HSV-2 gE antigen. [Figure 15E]Figure 15 shows expression levels in HEK293T cells transfected with RNA encoding HSV-2 gC (gC2), gD (gD2), and gE (gE2) antigens. Cells were transfected with 0.2 μg / mL of modRNA-encoded antigens using a commercially available transfection reagent. Expression of gC2, gD2, and gE2 proteins was detected by flow cytometry using a primary monoclonal mouse antibody and a secondary fluorescently tagged anti-mouse antibody, respectively, to detect the antigen. Representative data from one experiment showing the percentage of gC2 (Figure 15A) and gE2 (Figure 15B) protein-expressing cells, as well as the mean fluorescence intensity (MFI) of gC2, gD2, and gE2 of the total HEK293T population (Figures 15C, 15D, and 15E, respectively), are shown for each antigen. Data shown are the mean + SD of HEK293T transfections performed in triplicate. Cumulative total HEK expression data from experiments up to n=7 (FIG. 15F) are shown for the constructs gC2 (1600, IL2 secretion signal and HSV-2 gC antigen (version 2)), gD2 (1601, HSV-2 gD secretion signal and HSV-2 gD antigen (version 2)), or gE2 (1602, IL2 secretion signal and HSV-2 gE antigen (version 2)), respectively. The RNA constructs featured in FIG. 15 were found to result in similar or improved expression compared to constructs 1600 (IL2 secretion signal and HSV-2 gC antigen (version 2)), 1601 (HSV-2 gD secretion signal and HSV-2 gD antigen (version 2)), and 1602 (IL2 secretion signal and HSV-2 gE antigen (version 2)). 1597: IL2 secretion signal and HSV-2 gC antigen, 1598: HSV-2 gD secretion signal and HSV-2 gD antigen, 1599: IL2 secretion signal and HSV-2 gE antigen. [Figure 15F]Figure 15 shows expression levels in HEK293T cells transfected with RNA encoding HSV-2 gC (gC2), gD (gD2), and gE (gE2) antigens. Cells were transfected with 0.2 μg / mL of modRNA-encoded antigens using a commercially available transfection reagent. Expression of gC2, gD2, and gE2 proteins was detected by flow cytometry using a primary monoclonal mouse antibody and a secondary fluorescently tagged anti-mouse antibody, respectively, to detect the antigen. Representative data from one experiment showing the percentage of gC2 (Figure 15A) and gE2 (Figure 15B) protein-expressing cells, as well as the mean fluorescence intensity (MFI) of gC2, gD2, and gE2 of the total HEK293T population (Figures 15C, 15D, and 15E, respectively), are shown for each antigen. Data shown are the mean + SD of HEK293T transfections performed in triplicate. Cumulative total HEK expression data from experiments up to n=7 (FIG. 15F) are shown for the constructs gC2 (1600, IL2 secretion signal and HSV-2 gC antigen (version 2)), gD2 (1601, HSV-2 gD secretion signal and HSV-2 gD antigen (version 2)), or gE2 (1602, IL2 secretion signal and HSV-2 gE antigen (version 2)), respectively. The RNA constructs featured in FIG. 15 were found to result in similar or improved expression compared to constructs 1600 (IL2 secretion signal and HSV-2 gC antigen (version 2)), 1601 (HSV-2 gD secretion signal and HSV-2 gD antigen (version 2)), and 1602 (IL2 secretion signal and HSV-2 gE antigen (version 2)). 1597: IL2 secretion signal and HSV-2 gC antigen, 1598: HSV-2 gD secretion signal and HSV-2 gD antigen, 1599: IL2 secretion signal and HSV-2 gE antigen. [Figure 16A] 1 shows a flow diagram of Part A of Example 5. DL = dose level, P = placebo (isotonic NaCl solution), V = BNT163 vaccine. [Figure 16B] 1 shows a flow diagram of Part B of Example 5. DL = dose level, P = placebo (isotonic NaCl solution), V = BNT163 vaccine. [Figure 17]

[0033] Figure 1 illustrates the dose escalation schema for Part A of Example 5. Abbreviations: d = day, DL = dose level, IRC = internal review committee. [Figure 18A] Figure 1 shows expression levels in HEK293T cells transfected with RNA encoding HSV-2 gC (gC2), gD (gD2), or gE (gE2) antigen constructs. 1600: IL2 secretion signal and HSV-2 gC antigen. 2787: HSV-2 gD secretion signal and HSV-2 gC antigen. 2542: HSV-1 gB secretion signal and HSV-2 gC antigen. 2786: HSV-2 gC secretion signal and HSV-2 gC antigen. 1602: IL2 secretion signal and HSV-2 gE antigen. 1911: HSV-2 gD secretion signal and HSV-2 gE antigen. 2143: HSV-1 gD secretion signal and HSV-2 gE antigen. 2552: HSV-1 gD secretion signal and HSV-2 gE antigen. 2554: HSV-1gD secretory signal and HSV-2gE antigen. 2788: HSV-2gE secretory signal and HSV-2gE antigen. 2790: HSV-2gE secretory signal and HSV-2gE antigen. 2791: HSV-2gE secretory signal and HSV-2gE antigen. 2792: HSV-2gE secretory signal and HSV-2gE antigen. [Figure 18B]Figure 1 shows expression levels in HEK293T cells transfected with RNA encoding HSV-2 gC (gC2), gD (gD2), or gE (gE2) antigen constructs. 1600: IL2 secretion signal and HSV-2 gC antigen. 2787: HSV-2 gD secretion signal and HSV-2 gC antigen. 2542: HSV-1 gB secretion signal and HSV-2 gC antigen. 2786: HSV-2 gC secretion signal and HSV-2 gC antigen. 1602: IL2 secretion signal and HSV-2 gE antigen. 1911: HSV-2 gD secretion signal and HSV-2 gE antigen. 2143: HSV-1 gD secretion signal and HSV-2 gE antigen. 2552: HSV-1 gD secretion signal and HSV-2 gE antigen. 2554: HSV-1gD secretory signal and HSV-2gE antigen. 2788: HSV-2gE secretory signal and HSV-2gE antigen. 2790: HSV-2gE secretory signal and HSV-2gE antigen. 2791: HSV-2gE secretory signal and HSV-2gE antigen. 2792: HSV-2gE secretory signal and HSV-2gE antigen. [Figure 18C] Figure 1 shows expression levels in HEK293T cells transfected with RNA encoding HSV-2 gC (gC2), gD (gD2), or gE (gE2) antigen constructs. 1600: IL2 secretion signal and HSV-2 gC antigen. 2787: HSV-2 gD secretion signal and HSV-2 gC antigen. 2542: HSV-1 gB secretion signal and HSV-2 gC antigen. 2786: HSV-2 gC secretion signal and HSV-2 gC antigen. 1602: IL2 secretion signal and HSV-2 gE antigen. 1911: HSV-2 gD secretion signal and HSV-2 gE antigen. 2143: HSV-1 gD secretion signal and HSV-2 gE antigen. 2552: HSV-1 gD secretion signal and HSV-2 gE antigen. 2554: HSV-1gD secretory signal and HSV-2gE antigen. 2788: HSV-2gE secretory signal and HSV-2gE antigen. 2790: HSV-2gE secretory signal and HSV-2gE antigen. 2791: HSV-2gE secretory signal and HSV-2gE antigen. 2792: HSV-2gE secretory signal and HSV-2gE antigen. [Figure 18D]Figure 1 shows expression levels in HEK293T cells transfected with RNA encoding HSV-2 gC (gC2), gD (gD2), or gE (gE2) antigen constructs. 1600: IL2 secretion signal and HSV-2 gC antigen. 2787: HSV-2 gD secretion signal and HSV-2 gC antigen. 2542: HSV-1 gB secretion signal and HSV-2 gC antigen. 2786: HSV-2 gC secretion signal and HSV-2 gC antigen. 1602: IL2 secretion signal and HSV-2 gE antigen. 1911: HSV-2 gD secretion signal and HSV-2 gE antigen. 2143: HSV-1 gD secretion signal and HSV-2 gE antigen. 2552: HSV-1 gD secretion signal and HSV-2 gE antigen. 2554: HSV-1gD secretory signal and HSV-2gE antigen. 2788: HSV-2gE secretory signal and HSV-2gE antigen. 2790: HSV-2gE secretory signal and HSV-2gE antigen. 2791: HSV-2gE secretory signal and HSV-2gE antigen. 2792: HSV-2gE secretory signal and HSV-2gE antigen. [Figure 19A]Figure 1 shows secretion levels in HEK293T cells transfected with RNA encoding HSV-2 gC (gC2), gD (gD2), or gE (gE2) antigen constructs. 1600: IL2 secretory signal and HSV-2 gC antigen. 1873: IL2 secretory signal and HSV-2 gC antigen. 1876: IL2 secretory signal and HSV-2 gC antigen. 2138: HSV-2 gE secretory signal and HSV-2 gC antigen. 2140: HSV-1 gD secretory signal and HSV-2 gC antigen. 2140: HSV-1 gD secretory signal and HSV-2 gC antigen. 2141: HSV-1 gB secretory signal and HSV-2 gC antigen. 2537: HSV-1 gD secretory signal and HSV-2 gC antigen. 2538: HSV-1 gD secretory signal and HSV-2 gC antigen. 2539: HSV-1gD secretory signal and HSV-2gC antigen. 2540: HSV-1gB secretory signal and HSV-2gC antigen. 2541: HSV-1gB secretory signal and HSV-2gC antigen. 2542: HSV-1gB secretory signal and HSV-2gC antigen. 2546: HSV-2gE secretory signal and HSV-2gC antigen. 2547: HSV-2gE secretory signal and HSV-2gC antigen. 2548: HSV-2gE secretory signal and HSV-2gC antigen. 2784: HSV-2gC secretory signal and HSV-2gC antigen. 2785: HSV-2gC secretory signal and HSV-2gC antigen. 2786: HSV-2gC secretory signal and HSV-2gC antigen. 2787: HSV-2 gD secretory signal and HSV-2 gC antigen. 3233: HSV-1 gD secretory signal and HSV-2 gC antigen. 1601: HSV-2 gD secretory signal and HSV-2 gD antigen. 1659: HSV-2 gD secretory signal and HSV-2 gD antigen. 3234: HSV-2 gD secretory signal and HSV-2 gD antigen. 1602: IL2 secretory signal and HSV-2 gE antigen. 1911: HSV-2 gD secretory signal and HSV-2 gE antigen. 1660: HSV-2 gD secretory signal and HSV-2 gE antigen. 1913: HSV-2 gE secretory signal and HSV-2 gE antigen. 2143: HSV-1 gD secretory signal and HSV-2 gE antigen. 2552: HSV-1 gD secretory signal and HSV-2 gE antigen. 2553: HSV-1 gD secretory signal and HSV-2 gE antigen.2554: HSV-1 gD secretory signal and HSV-2 gE antigen. 2788: HSV-2 gE secretory signal and HSV-2 gE antigen. 2790: gE2 secretory signal and gE2 antigen. 2791: gE2 secretory signal and HSV-2 gE antigen. 2792: gE2 secretory signal and gE2 antigen. 3235: gD2 secretory signal and HSV-2 gE antigen. [Figure 19B]Figure 1 shows secretion levels in HEK293T cells transfected with RNA encoding HSV-2 gC (gC2), gD (gD2), or gE (gE2) antigen constructs. 1600: IL2 secretory signal and HSV-2 gC antigen. 1873: IL2 secretory signal and HSV-2 gC antigen. 1876: IL2 secretory signal and HSV-2 gC antigen. 2138: HSV-2 gE secretory signal and HSV-2 gC antigen. 2140: HSV-1 gD secretory signal and HSV-2 gC antigen. 2140: HSV-1 gD secretory signal and HSV-2 gC antigen. 2141: HSV-1 gB secretory signal and HSV-2 gC antigen. 2537: HSV-1 gD secretory signal and HSV-2 gC antigen. 2538: HSV-1 gD secretory signal and HSV-2 gC antigen. 2539: HSV-1gD secretory signal and HSV-2gC antigen. 2540: HSV-1gB secretory signal and HSV-2gC antigen. 2541: HSV-1gB secretory signal and HSV-2gC antigen. 2542: HSV-1gB secretory signal and HSV-2gC antigen. 2546: HSV-2gE secretory signal and HSV-2gC antigen. 2547: HSV-2gE secretory signal and HSV-2gC antigen. 2548: HSV-2gE secretory signal and HSV-2gC antigen. 2784: HSV-2gC secretory signal and HSV-2gC antigen. 2785: HSV-2gC secretory signal and HSV-2gC antigen. 2786: HSV-2gC secretory signal and HSV-2gC antigen. 2787: HSV-2 gD secretory signal and HSV-2 gC antigen. 3233: HSV-1 gD secretory signal and HSV-2 gC antigen. 1601: HSV-2 gD secretory signal and HSV-2 gD antigen. 1659: HSV-2 gD secretory signal and HSV-2 gD antigen. 3234: HSV-2 gD secretory signal and HSV-2 gD antigen. 1602: IL2 secretory signal and HSV-2 gE antigen. 1911: HSV-2 gD secretory signal and HSV-2 gE antigen. 1660: HSV-2 gD secretory signal and HSV-2 gE antigen. 1913: HSV-2 gE secretory signal and HSV-2 gE antigen. 2143: HSV-1 gD secretory signal and HSV-2 gE antigen. 2552: HSV-1 gD secretory signal and HSV-2 gE antigen. 2553: HSV-1 gD secretory signal and HSV-2 gE antigen.2554: HSV-1 gD secretory signal and HSV-2 gE antigen. 2788: HSV-2 gE secretory signal and HSV-2 gE antigen. 2790: gE2 secretory signal and gE2 antigen. 2791: gE2 secretory signal and HSV-2 gE antigen. 2792: gE2 secretory signal and gE2 antigen. 3235: gD2 secretory signal and HSV-2 gE antigen. [Figure 19C]Figure 1 shows secretion levels in HEK293T cells transfected with RNA encoding HSV-2 gC (gC2), gD (gD2), or gE (gE2) antigen constructs. 1600: IL2 secretory signal and HSV-2 gC antigen. 1873: IL2 secretory signal and HSV-2 gC antigen. 1876: IL2 secretory signal and HSV-2 gC antigen. 2138: HSV-2 gE secretory signal and HSV-2 gC antigen. 2140: HSV-1 gD secretory signal and HSV-2 gC antigen. 2140: HSV-1 gD secretory signal and HSV-2 gC antigen. 2141: HSV-1 gB secretory signal and HSV-2 gC antigen. 2537: HSV-1 gD secretory signal and HSV-2 gC antigen. 2538: HSV-1 gD secretory signal and HSV-2 gC antigen. 2539: HSV-1gD secretory signal and HSV-2gC antigen. 2540: HSV-1gB secretory signal and HSV-2gC antigen. 2541: HSV-1gB secretory signal and HSV-2gC antigen. 2542: HSV-1gB secretory signal and HSV-2gC antigen. 2546: HSV-2gE secretory signal and HSV-2gC antigen. 2547: HSV-2gE secretory signal and HSV-2gC antigen. 2548: HSV-2gE secretory signal and HSV-2gC antigen. 2784: HSV-2gC secretory signal and HSV-2gC antigen. 2785: HSV-2gC secretory signal and HSV-2gC antigen. 2786: HSV-2gC secretory signal and HSV-2gC antigen. 2787: HSV-2 gD secretory signal and HSV-2 gC antigen. 3233: HSV-1 gD secretory signal and HSV-2 gC antigen. 1601: HSV-2 gD secretory signal and HSV-2 gD antigen. 1659: HSV-2 gD secretory signal and HSV-2 gD antigen. 3234: HSV-2 gD secretory signal and HSV-2 gD antigen. 1602: IL2 secretory signal and HSV-2 gE antigen. 1911: HSV-2 gD secretory signal and HSV-2 gE antigen. 1660: HSV-2 gD secretory signal and HSV-2 gE antigen. 1913: HSV-2 gE secretory signal and HSV-2 gE antigen. 2143: HSV-1 gD secretory signal and HSV-2 gE antigen. 2552: HSV-1 gD secretory signal and HSV-2 gE antigen. 2553: HSV-1 gD secretory signal and HSV-2 gE antigen.2554: HSV-1 gD secretory signal and HSV-2 gE antigen. 2788: HSV-2 gE secretory signal and HSV-2 gE antigen. 2790: gE2 secretory signal and gE2 antigen. 2791: gE2 secretory signal and HSV-2 gE antigen. 2792: gE2 secretory signal and gE2 antigen. 3235: gD2 secretory signal and HSV-2 gE antigen. DETAILED DESCRIPTION OF THE INVENTION

[0009] Specific Definitions Generally, terms used herein will follow their art-understood meanings unless expressly indicated otherwise. Explicit definitions of certain terms are provided below. The meaning of these and other terms in specific instances throughout this specification will be apparent to those of ordinary skill in the art from the context. In order that the present invention may be more readily understood, certain terms are first defined. Further definitions of the following terms, and other terms, are set forth throughout the specification.

[0010] About: The term "about," when used herein with respect to a value, refers to a value that is close to, in relation to, the referenced value. Generally, the appropriate degree of variation encompassed by "about" in that context will be understood by one of ordinary skill in the art familiar with the context. For example, in some embodiments, the term "about" can encompass a range of values ​​within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less of the referenced value.

[0011] Agent: As used herein, the term "agent" may refer to a physical entity or phenomenon. In some embodiments, an agent can be characterized by a particular feature and / or effect. In some embodiments, an agent can be any chemical type of compound, molecule, or entity, including, for example, a small molecule, polypeptide, nucleic acid, sugar, lipid, metal, or combinations or complexes thereof. In some embodiments, the term "agent" may refer to a compound, molecule, or entity that comprises a polymer. In some embodiments, the term may refer to a compound or entity that comprises one or more polymer moieties. In some embodiments, the term "agent" may refer to a compound, molecule, or entity that is substantially free of a particular polymer or polymer moiety. In some embodiments, the term may refer to a compound, molecule, or entity that is devoid of or substantially free of any polymer or polymer moiety.

[0012] Amino acid: As used herein, the term "amino acid" in its broadest sense refers to a compound and / or substance that can be, is, or has been incorporated into a polypeptide chain, for example, by the formation of one or more peptide bonds. In some embodiments, an amino acid has the general structure HN-C(H)(R)-COOH. In some embodiments, an amino acid is a naturally occurring amino acid. In some embodiments, an amino acid is a non-natural amino acid, in some embodiments, an amino acid is a D-amino acid, and in some embodiments, an amino acid is an L-amino acid. A "standard amino acid" refers to any of the 20 standard L-amino acids commonly found in naturally occurring peptides. A "non-standard amino acid" refers to any amino acid other than the standard amino acids, whether prepared synthetically or obtained from a natural source. In some embodiments, amino acids, including the carboxy- and / or amino-terminal amino acids in a polypeptide, may contain structural modifications compared to the general structures above. For example, in some embodiments, an amino acid may be modified relative to the general structure by methylation, amidation, acetylation, pegylation, glycosylation, phosphorylation, and / or substitution (e.g., of an amino group, a carboxylic acid group, one or more protons, and / or a hydroxyl group). In some embodiments, such modifications may alter the circulating half-life of a polypeptide containing the modified amino acid compared to one containing an otherwise identical, unmodified amino acid. In some embodiments, such modifications do not significantly alter the relevant activity of a polypeptide containing the modified amino acid compared to one otherwise identical containing the unmodified amino acid. As is clear from the context, in some embodiments, the term "amino acid" may be used to refer to a free amino acid. In some embodiments, it may be used to refer to an amino acid residue of a polypeptide.

[0013] Antibody agent: As used herein, the term "antibody agent" refers to an agent that specifically binds to a particular antigen. In some embodiments, the term encompasses a polypeptide or polypeptide complex that contains sufficient immunoglobulin structural elements to confer specific binding. For example, in some embodiments, an antibody agent is or comprises a polypeptide whose amino acid sequence contains one or more structural elements recognized by those skilled in the art as complementarity-determining regions (CDRs). In some embodiments, an antibody agent is or comprises a polypeptide whose amino acid sequence contains at least one CDR (e.g., at least one heavy chain CDR and / or at least one light chain CDR) that is substantially identical to that present in a reference antibody. In some embodiments, the included CDRs are substantially identical to the reference CDRs, either in that they are sequence-identical or contain from one to five amino acid substitutions compared to the reference CDRs. In some embodiments, the included CDRs are substantially identical to the reference CDRs in that they exhibit at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with the reference CDRs. In some embodiments, the included CDRs are substantially identical to the reference CDRs in that they exhibit at least 96%, 96%, 97%, 98%, 99%, or 100% sequence identity with the reference CDRs. In some embodiments, the included CDRs are substantially identical to the reference CDRs in that at least one amino acid within the included CDRs has been deleted, added, or substituted compared to the reference CDRs, while the included CDRs otherwise have the same amino acid sequence as the reference CDRs. In some embodiments, the included CDR is substantially identical to the reference CDR, in that 1 to 5 amino acids within the included CDR are deleted, added, or substituted compared to the reference CDR, but the included CDR otherwise has the same amino acid sequence as the reference CDR.In some embodiments, the included CDR is substantially identical to the reference CDR in that at least one amino acid in the included CDR has been substituted relative to the reference CDR, while the included CDR otherwise has the same amino acid sequence as the reference CDR. In some embodiments, the included CDR is substantially identical to the reference CDR in that 1 to 5 amino acids in the included CDR have been deleted, added, or substituted relative to the reference CDR, while the included CDR otherwise has the same amino acid sequence as the reference CDR. In some embodiments, the antibody agent is or comprises a polypeptide whose amino acid sequence comprises structural elements recognized by those skilled in the art as an immunoglobulin variable domain. In some embodiments, the antibody agent is or comprises a polypeptide whose amino acid sequence comprises structural elements recognized by those skilled in the art as corresponding to CDR1, CDR2, and CDR3 of an antibody variable domain. In some such embodiments, an antibody agent is or comprises a polypeptide or set of polypeptides whose amino acid sequence(s) together comprise structural elements recognized by those skilled in the art as corresponding to both heavy and light chain variable region CDRs (e.g., heavy chain CDR1, CDR2, and / or CDR3 and light chain CDR1, CDR2, and / or CDR3). In some embodiments, an antibody agent is a polypeptide protein having a binding domain that is homologous or nearly homologous to an immunoglobulin binding domain. In some embodiments, an antibody agent may be or comprise a polyclonal antibody preparation. In some embodiments, an antibody agent may be or comprise a monoclonal antibody preparation. In some embodiments, an antibody agent may comprise one or more constant region sequences that are unique to a particular organism, such as camel, human, mouse, primate, rabbit, rat, etc. In many embodiments, an antibody agent may comprise one or more constant region sequences that are unique to humans. In some embodiments, an antibody agent may comprise one or more sequence elements that may be recognized by those skilled in the art as a humanized sequence, a primatized sequence, a chimeric sequence, etc.In some embodiments, the antibody agent can be a standard antibody (e.g., can comprise two heavy chains and two light chains). In some embodiments, the antibody agent can be an intact IgA, IgG, IgE, or IgM antibody, a bispecific or multispecific antibody (e.g., Zybodies®, etc.), an antibody fragment such as a Fab fragment, a Fab' fragment, a F(ab')2 fragment, an Fd' fragment, an Fd fragment, and an isolated CDR or set thereof, a single chain Fv, a polypeptide-Fc fusion, a single domain antibody (e.g., a shark single domain antibody or fragment thereof such as IgNAR), a camelid antibody, a masked antibody (e.g., Probody®), a Small Modular Immunoglobulin (SMIM), a mAb, ... The antibody may be in a format selected from, but not limited to, SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, S

[0014] Antigen: As will be apparent to those of skill in the art upon reading this specification, the term "antigen" will be understood to refer to a molecule that is recognized by the immune system (e.g., in certain embodiments, the adaptive immune system) to generate an antigen-specific immune response. In some embodiments, the antigen-specific immune response can be or can include the generation of antibodies and / or antigen-specific T cells. In some embodiments, the antigen is a peptide or polypeptide that comprises at least one epitope to which an immune response can be generated. In one embodiment, the antigen is presented by a cell of the immune system, e.g., an antigen-presenting cell such as a dendritic cell or macrophage. In one embodiment, the antigen or its processed product, e.g., a T cell epitope, is bound by a T cell receptor or a B cell receptor, or by an immunoglobulin molecule, e.g., an antibody. Thus, the antigen or its processed product can specifically react with an antibody or T lymphocyte (T cell). In one embodiment, the antigen is a parasitic antigen. According to the present disclosure, in some embodiments, the antigen can be delivered by an RNA molecule as described herein. In some embodiments, the peptide or polypeptide antigen can be 2 to 100 amino acids in length, e.g., 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids in length. In some embodiments, the peptide or polypeptide antigen can be more than 50 amino acids. In some embodiments, the peptide or polypeptide antigen can be more than 100 amino acids. In some embodiments, the antigen is recognized by an immune effector cell. In some embodiments, the antigen, when recognized by an immune effector cell, can, in the presence of an appropriate costimulatory signal, induce stimulation, priming, and / or proliferation of immune effector cells bearing an antigen receptor that recognizes the antigen. With respect to embodiments of the present disclosure, in some embodiments, the antigen can be presented or present on the surface of a cell, e.g., an antigen-presenting cell. In one embodiment, the antigen is presented by a diseased cell, such as a virus-infected cell.In one embodiment, the antigen receptor is a TCR that binds to an epitope of an antigen presented in the context of an MHC. In one embodiment, binding of a TCR, when expressed by and / or present on a T cell, to an antigen presented by a cell, such as an antigen-presenting cell, results in stimulation, priming, and / or proliferation of the T cell. In one embodiment, binding of a TCR, when expressed by and / or present on a T cell, to an antigen presented on a diseased cell results in cytolysis and / or apoptosis of the diseased cell, preferably resulting in the release of cytotoxic factors, such as perforin and granzymes, by the T cell.

[0015] Associated: As used herein, two events or entities are "associated" with one another when the presence, level, degree, type, and / or form of one correlates with that of the other. For example, a particular entity (e.g., a polypeptide, genetic trait, metabolite, microorganism, etc.) is considered to be associated with a particular disease, disorder, or condition when its presence, level, and / or form correlates (e.g., across a relevant population) with the incidence, susceptibility, severity, stage, etc. of the disease, disorder, or condition. In some embodiments, two or more entities are physically "associated" with one another when they interact directly or indirectly such that they are and / or remain physically near one another. In some embodiments, two or more entities that are physically associated with one another are covalently bonded to one another. In some embodiments, two or more entities that are physically associated with one another are not covalently bonded to one another, but are non-covalently associated, for example, by hydrogen bonding, van der Waals interactions, hydrophobic interactions, magnetism, and combinations thereof.

[0016] Binding: As will be apparent to one of skill in the art upon reading this specification, the term "binding" typically refers to non-covalent binding between or among entities or moieties. In some embodiments, binding data is expressed in terms of "IC50." As understood in the art, IC50 is the concentration of an agent being evaluated in a binding assay that is found to inhibit 50% of binding of a reference agent to a known relevant binding partner. In some embodiments, the assay is performed to determine whether these values ​​are K D The binding is performed under conditions approximating the value. Assays for determining binding are well known in the art and are described in detail in, for example, PCT publications WO94 / 20127 and WO94 / 03205, as well as other publications, such as Sidney et al., Current Protocols in Immunology 18.3.1 (1998), Sidney, et al., J. Immunol. 154:247 (1995), and Sette, et al., Mol. Immunol. 31:813 (1994). Alternatively, binding can be expressed relative to the binding by a reference standard peptide. For example, binding can be expressed as the IC of the reference standard peptide. 50 Compared to that, the IC 50Binding can also be determined using other assay systems. Such assays include those using live cells (e.g., Cepellini et al., Nature 339:392 (1989), Christnick et al., Nature 352:67 (1991), Busch et al., Int. Immunol. 2:443 (1990), Hill et al., J. Immunol. 147:189 (1991), del Guercio et al., J. Immunol. 154:685 (1995)), cell-free systems using detergent lysates (e.g., Cerundolo et al., J. Immunol 21:2069 (1991)), immobilized purified MHC (e.g., Hill et al., J. Immunol. 152,2890 (1994), Marshall et al. al., J. Immunol. 152:4946 (1994)), ELISA systems (e.g., Reay et al., EMBO J. 11:2829 (1992)), surface plasmon resonance (e.g., Khilko et al., J. Biol. Chem. 268:15425 (1993)), high-flux soluble phase assays (Hammer et al., J. Exp. Med. 180:2353 (1994)), and measurements of class I MHC stabilization or assembly (e.g., Ljunggren et al., Nature 346:476 (1990), Schumacher et al., Cell 62:563 (1990), Townsend et al., Cell 62:285 (1990), Parker et al. al., J. Immunol. 149:1896 (1992)).

[0017] Cap: As used herein, the term "cap" typically refers to a structure comprising or consisting essentially of a nucleoside-5'-triphosphate attached to the 5' end of an uncapped RNA (e.g., an uncapped RNA having a 5'-diphosphate). In some embodiments, the cap is or includes a guanine nucleotide. In some embodiments, the cap is or includes a naturally occurring RNA 5' cap (e.g., including, but not limited to, a 7-methylguanosine cap having the structure designated "m7G"). In some embodiments, the cap is or includes a synthetic cap analogue that resembles the RNA cap structure and has the ability to stabilize RNA when bound to RNA, including, but not limited to, anti-reverse cap analogues (ARCAs) known in the art. As will be apparent to one of skill in the art, methods for attaching a cap to the 5' end of an RNA are known in the art. For example, in some embodiments, capped RNA can be obtained by in vitro capping of RNA with a 5' triphosphate group or a 5' diphosphate group using a capping enzyme system (e.g., including but not limited to, the vaccinia capping enzyme system or the Saccharomyces cerevisiae capping enzyme system). Alternatively, capped RNA can be obtained by in vitro transcription (IVT) of a single-stranded DNA template in the presence of a dinucleotide or trinucleotide cap analog.

[0018] Cellular Immunity: "Cellular immunity," "cellular immunity," "cellular immune response," or similar terms are intended to encompass a cellular response to cells characterized by the expression of antigens, particularly cells characterized by the presentation of antigens with class I or class II MHC. The cellular response involves immune effector cells, particularly T cells or T lymphocytes, which act as either "helpers" or "killers." Helper T cells (CD4 +T cells, also called CD4 T cells, are responsible for the immune response and killer cells (cytotoxic T cells, cytolytic T cells, CD8 + They play a central role by regulating immune cells (also called T cells, CD8 T cells, or CTLs) to kill diseased cells, such as virus-infected cells, and prevent the production of further diseased cells.

[0019] Co-administration: As used herein, the term "co-administration" refers to the use of a pharmaceutical composition (e.g., an immunogenic composition, e.g., a vaccine) described herein with an additional therapeutic agent. The co-administration of a pharmaceutical composition (e.g., an immunogenic composition, e.g., a vaccine) described herein with an additional therapeutic agent may occur simultaneously or separately (e.g., sequentially in any order). In some embodiments, a pharmaceutical composition (e.g., an immunogenic composition, e.g., a vaccine) described herein and an additional therapeutic agent may be combined in a single pharmaceutically acceptable carrier, or they may be present in separate carriers and delivered to a target cell or administered to a subject at different times. Each of these situations is considered to be within the meaning of "co-administration" or "combination," provided that the pharmaceutical composition (e.g., an immunogenic composition, e.g., a vaccine) described herein and the additional therapeutic agent are delivered or administered sufficiently close in time to produce at least some temporally overlapping biological effect(s) on the target cell or the subject being treated, respectively.

[0020] Codon optimization: As used herein, the term "codon optimization" refers to changing the codons in the coding region of a nucleic acid molecule to reflect the typical codon usage of a host organism, preferably without changing the amino acid sequence encoded by the nucleic acid molecule. In the context of the present disclosure, in some embodiments, the coding region is codon-optimized to provide optimal expression in a subject treated using an RNA molecule described herein. In some embodiments, codon optimization can be performed such that codons available for frequently occurring tRNAs are inserted in place of "rare codons." In some embodiments, codon optimization can include increasing the guanosine / cytosine (G / C) content of the coding region of an RNA described herein relative to the G / C content of the corresponding coding sequence of a wild-type RNA. Here, the amino acid sequence encoded by the RNA is preferably unmodified relative to the corresponding amino acid sequence.

[0021] Combination therapy: As used herein, the term "combination therapy" refers to a situation in which a subject is exposed to two or more therapeutic regimens (e.g., two or more therapeutic agents) simultaneously. In some embodiments, the two or more regimens may be administered simultaneously. In some embodiments, the regimens may be administered sequentially (e.g., all "doses" of a first regimen are administered before any doses of a second regimen are administered). In some embodiments, the agents are administered in overlapping dosing regimens. In some embodiments, "administration" of a combination therapy may include administering one or more agent(s) or modality(s) in combination to a subject receiving other agent(s) or modality(s). For clarity, combination therapy does not require that the individual agents be administered together in a single composition (or even necessarily simultaneously), although in some embodiments, two or more agents or active portions thereof may be administered together in a combined composition.

[0022] Equivalent: As used herein, the term "equivalent" refers to two or more agents, entities, circumstances, sets of conditions, etc. that may not be identical to one another, but that are sufficiently similar to permit a comparison between them, such that a person skilled in the art would understand that reasonable conclusions can be drawn based on the perceived differences or similarities. In some embodiments, equivalent sets of conditions, circumstances, individuals, or populations are characterized by multiple substantially identical characteristics and one or a few different characteristics. One skilled in the art will understand the degree of identity required for two or more such agents, substances, circumstances, sets of conditions, etc. to be considered equivalent in any given situation in context. For example, one skilled in the art will understand that sets of circumstances, individuals, or populations are equivalent to one another when they are characterized by a sufficient number and type of substantially identical characteristics to warrant a reasonable conclusion that differences in results obtained or phenomena observed under or with different sets of circumstances, individuals, or populations are caused by, or indicate, variations in those characteristics.

[0023] Corresponding: As used herein, the term "corresponding" refers to a relationship between two or more entities. For example, the term "corresponding" can be used to designate the position / identity of a structural element in one compound or composition relative to another compound or composition (e.g., relative to an appropriate reference compound or composition). For example, in some embodiments, a monomer residue in a polymer (e.g., an amino acid residue in a polypeptide or a nucleic acid residue in a polynucleotide) can be identified as "corresponding" to a residue in an appropriate reference polymer. For example, one of skill in the art will understand that, for simplicity's sake, residues in a polypeptide are often designated based on the relevant reference polypeptide using a standard numbering system, so that an amino acid "corresponding" to a residue at position 190, for example, corresponds to the residue found at position 190 in the reference polypeptide, rather than necessarily being the actual 190th amino acid in a particular amino acid chain. One of skill in the art will readily understand how to identify a "corresponding" amino acid. For example, those skilled in the art will recognize various alignment strategies, e.g., software programs such as BLAST, CS-BLAST, CUSASW++, DIAMOND, FASTA, GGSEARCH / GLSEARCH, Genoogle, HMMER, HHpred / HHsearch, IDF, Infernal, KLAST, USEARCH, parasail, PSI-BLAST, PSI-Search, ScalaBLAST, Sequilab, SAM, SSEARCH, SWAPHI, SWAPHI-LS, SWIMM, or SWIPE, that can be utilized to identify "corresponding" residues in, for example, polypeptides and / or nucleic acids in accordance with the present disclosure. Those skilled in the art will also recognize that the term "corresponding" can, in some cases, be used to refer to an event or entity that bears meaningful similarity to another event or entity (e.g., an appropriate reference event or entity). As an example, a gene or protein in one organism can be described as "corresponding" to a gene or protein from another organism.The purpose, in some embodiments, is to show that it plays a similar role or performs a similar function, and / or that it exhibits a particular degree of sequence identity or homology or shares certain characteristic sequence elements.

[0024] Derived: In the context of an amino acid sequence (peptide or polypeptide) "derived from" a specified amino acid sequence (peptide or polypeptide), it refers to a structural analog of the specified amino acid sequence. In some embodiments, an amino acid sequence derived from a particular amino acid sequence has an amino acid sequence that is identical, essentially identical, or homologous to the particular sequence or a fragment thereof. An amino acid sequence derived from a particular amino acid sequence may be a variant of the particular sequence or a fragment thereof. For example, one of skill in the art will understand that antigens suitable for use herein may be altered such that the resulting sequence differs from the naturally occurring or native sequence from which it is derived, while still maintaining the desired activity of the native sequence.

[0025] Designed: As used herein, the term “designed” refers to (i) an agent whose structure is man-made or selected by man, (ii) an agent that is produced by a process that requires human intervention, and / or (iii) an agent that is distinct from natural substances and other known agents.

[0026] Dosage regimen: As will be appreciated by those skilled in the art, the term "dosage regimen" can be used to refer to a set of unit doses (typically two or more) administered separately to a subject, typically separated by a period of time. In some embodiments, a given therapeutic agent has a recommended dosing regimen, which may include one or more administrations. In some embodiments, a dosing regimen includes multiple administrations, each spaced in time from the other administrations. In some embodiments, the individual administrations are separated from each other by equally spaced periods of time. In some embodiments, a dosing regimen includes multiple administrations and at least two different periods of time separating the individual administrations. In some embodiments, all administrations within a dosing regimen are of the same unit dose. In some embodiments, different administrations within a dosing regimen are of different amounts. In some embodiments, a dosing regimen includes a first administration at a first dose, followed by one or more additional administrations at a second dose that is different from the first dose. In some embodiments, a dosing regimen includes a first administration at a first dose, followed by one or more additional administrations at a second dose that is the same as the first dose. In some embodiments, the dosing regimen correlates with a desired or beneficial outcome when administered across a relevant population (ie, is a therapeutic dosing regimen).

[0027] Code: As used herein, the terms "code" or "encoding" refer to the sequence information of a first molecule directing the production of a second molecule having a predetermined nucleotide sequence (e.g., mRNA) or a predetermined amino acid sequence. For example, a DNA molecule can encode an RNA molecule (e.g., by a transcription process involving a DNA-dependent RNA polymerase enzyme). An RNA molecule can encode a polypeptide (e.g., by a translation process). Thus, a gene, cDNA, or RNA molecule (e.g., RNA) encodes a polypeptide when the polypeptide is produced within a cell or other biological system by transcription and translation of the RNA corresponding to that gene. In some embodiments, the coding region of an RNA molecule encoding a target antigen refers to the coding strand, the nucleotide sequence of which is identical to the RNA sequence of such target antigen. In some embodiments, the coding region of an RNA molecule encoding a target antigen refers to the non-coding strand of such target antigen, which can be used as a template for transcription of a gene or cDNA.

[0028] Engineered: In general, the term "engineered" refers to aspects that have been manipulated by human beings. For example, a polynucleotide is considered "engineered" if, in the engineered polynucleotide, two or more sequences that are not naturally linked in that order have been manipulated to be directly linked to each other, and / or if particular residues in the polynucleotide are not naturally occurring and / or have been linked by human action to an entity or moiety that is not naturally linked.

[0029] Epitope: As used herein, the term "epitope" refers to a portion that is specifically recognized by a binding component of an immunoglobulin (e.g., an antibody or receptor). For example, an epitope can be recognized by a T cell, a B cell, or an antibody. In some embodiments, an epitope is composed of multiple chemical atoms or groups on an antigen. In some embodiments, such chemical atoms or groups are exposed on the surface when the antigen adopts a suitable three-dimensional conformation. In some embodiments, such chemical atoms or groups are physically close to each other in space when the antigen adopts such a conformation. In some embodiments, at least some of such chemical atoms are groups that are physically separated from each other when the antigen adopts another conformation (e.g., linear). Thus, in some embodiments, an epitope of an antigen can comprise a continuous or discontinuous portion of the antigen. In some embodiments, an epitope is or comprises a T cell epitope. In some embodiments, an epitope can have a length of about 5 to about 30 amino acids, or about 10 to about 25 amino acids, or about 5 to about 15 amino acids, or about 5 to 12 amino acids, or about 6 to about 9 amino acids.

[0030] Expression: As used herein, the term "expression" of a nucleic acid sequence refers to the production of a gene product from the nucleic acid sequence. In some embodiments, the gene product can be a transcript. In some embodiments, the gene product can be a polypeptide. In some embodiments, expression of a nucleic acid sequence involves one or more of the following: (1) production of an RNA template from the DNA sequence (e.g., by transcription), (2) processing of the RNA transcript (e.g., by splicing, editing, etc.), (3) translation of the RNA into a polypeptide or protein, and / or (4) post-translational modification of the polypeptide or protein.

[0031] 5 prime untranslated region: As used herein, the term "5 prime untranslated region" or "5'UTR" refers to the sequence of an RNA molecule between the transcription start site and the start codon of the coding region of the RNA. In some embodiments, "5'UTR" refers to the sequence of an RNA molecule beginning at the transcription start site and ending one nucleotide (nt) before the start codon (usually AUG) of the coding region of the RNA molecule (e.g., in its natural context).

[0032] Fragment: As used herein in the context of a nucleic acid sequence (e.g., an RNA sequence) or an amino acid sequence, the term "fragment" typically refers to a fragment of a reference sequence. In some embodiments, the reference sequence is a full-length sequence, e.g., a nucleic acid sequence or an amino acid sequence. Thus, a fragment generally refers to a sequence identical to a corresponding strand in a reference sequence. In some embodiments, a fragment comprises a contiguous stretch of nucleotides or amino acid residues corresponding to at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% of the total length of the reference sequence from which it is derived. In some embodiments, the term "fragment" with respect to an amino acid sequence (peptide or polypeptide) refers to a sequence representing a portion of the amino acid sequence, e.g., an amino acid sequence truncated at the N-terminus and / or C-terminus. In some embodiments, a fragment of an amino acid sequence comprises at least 6, particularly at least 8, at least 12, at least 15, at least 20, at least 30, at least 50, or at least 100 contiguous amino acids from the amino acid sequence.

[0033] Homology: As used herein, the term "homology" or "homologue" refers to the overall relatedness between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or polypeptide molecules. In some embodiments, polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or polypeptide molecules are considered to be homologous to one another if their sequences are at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical. In some embodiments, polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or polypeptide molecules are considered to be homologous to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% similar (e.g., contain residues with related chemical properties at corresponding positions). For example, as is well known to those of skill in the art, certain amino acids are typically classified as similar to one another as "hydrophobic" or "hydrophilic" amino acids and / or as having "polar" or "nonpolar" side chains. Substitution of one amino acid for another amino acid of the same type can often be considered a "homologous" substitution.

[0034] Humoral immunity: As used herein, the term "humoral immunity" or "humoral immune response" refers to antibody production and its associated processes, including, for example, Th2 activation and cytokine production, germinal center formation and isotype switching, affinity maturation, and memory cell generation. It also refers to antibody effector functions, including pathogen neutralization, classical complement activation, and opsonization of phagocytosis and pathogen clearance.

[0035] Identity: As used herein, the term "identity" refers to the overall relatedness between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or polypeptide molecules. In some embodiments, polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or polypeptide molecules are considered "substantially identical" to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical. For example, calculation of the percent identity of two nucleic acid or polypeptide sequences can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of the first and second sequences for optimal alignment, and non-identical sequences can be disregarded for comparison purposes). In certain embodiments, the length of the sequences aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or substantially 100% of the length of the reference sequence. The nucleotides at corresponding positions are then compared. If a position in the first sequence is occupied by the same residue (e.g., nucleotide or amino acid) as the corresponding position in the second sequence, the molecules are identical at that position. The percent identity between two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps and the length of each gap that need to be introduced for optimal alignment of the two sequences. Comparison of sequences and determination of the percent identity between two sequences can be achieved using a mathematical algorithm. For example, percent identity between two nucleotide sequences can be determined using the algorithm of Meyers and Miller (1989) as incorporated into the ALIGN program (version 2.0).In some embodiments, nucleic acid sequence comparisons performed with the ALIGN program use a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4. Alternatively, the percent identity between two nucleotide sequences can be determined using the NWSgapdna.CMP matrix in the GAP program in the GCG software package.

[0036] Increased, induced, or reduced: As used herein, these terms, or grammatically equivalent comparative terms, refer to a value relative to an equivalent reference measurement. For example, in some embodiments, an assessment value achieved by a provided pharmaceutical composition (e.g., an immunogenic composition, e.g., a vaccine) may be "increased" compared to an assessment value obtained by an equivalent reference pharmaceutical composition (e.g., an immunogenic composition, e.g., a vaccine). Alternatively, or additionally, in some embodiments, an assessment value achieved in a subject may be "increased" relative to an assessment value obtained in the same subject under different conditions (e.g., before or after an event, or with or without an event, such as administration of a pharmaceutical composition described herein (e.g., an immunogenic composition, e.g., a vaccine)), or in an equivalent, different subject (e.g., in a subject different from the subject of interest that has been pre-conditionally challenged with a pharmaceutical composition described herein (e.g., an immunogenic composition, e.g., a vaccine)). In some embodiments, comparative terms refer to a statistically relevant difference (e.g., one that is of sufficient spread and / or magnitude to achieve statistical relevance). Determining the extent and / or spread of difference necessary or sufficient to achieve such statistical significance in a given situation will be recognized by those of skill in the art. , as would be readily apparent to one of ordinary skill in the art. In some embodiments, the term "reduce" or equivalent terms refers to a reduction in the level of an evaluated value by at least 5%, at least 10%, at least 20%, at least 50%, at least 75%, or more relative to a comparable reference. In some embodiments, the term "reduce" or equivalent terms refers to complete or substantially complete inhibition, i.e., a reduction to zero or substantially zero. In some embodiments, the term "increased" or "induced" refers to an increase in the level of an evaluated value by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 80%, at least 100%, at least 200%, at least 500%, or more relative to an equivalent reference.

[0037] Ionizable: The term "ionizable" refers to a compound or group or atom that is charged at a particular pH. In the context of ionizable amino lipids, such lipids or their functional groups or atoms have a positive charge at a particular pH. In some embodiments, ionizable amino lipids are positively charged at acidic pH. In some embodiments, ionizable amino lipids are primarily neutral at physiological pH values, e.g., in some embodiments, about 7.0 to 7.4, but are positively charged at lower pH values. In some embodiments, ionizable amino lipids may have a pKa in the range of about 5 to about 7.

[0038] Isolated: The term "isolated" means altered or removed from the natural state. For example, a nucleic acid or peptide naturally present in a living animal is not "isolated," but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is "isolated." An isolated nucleic acid or protein may exist in a substantially purified form, or it may exist in a non-native environment, such as a host cell.

[0039] Lipid: As used herein, the terms "lipid" and "lipid-like substance" are broadly defined as molecules that contain one or more hydrophobic moieties or groups and, optionally, one or more hydrophilic moieties or groups. Molecules that contain hydrophobic and hydrophilic moieties are also commonly referred to as amphipathic molecules.

[0040] RNA-lipid nanoparticles: As used herein, the term "RNA-lipid nanoparticles" refers to nanoparticles comprising at least one lipid and RNA molecule(s). In some embodiments, the RNA-lipid nanoparticles comprise at least one ionizable amino lipid. In some embodiments, the RNA-lipid nanoparticles comprise at least one ionizable amino lipid, at least one helper lipid, and at least one polymer-conjugated lipid (e.g., PEG-conjugated lipid). In various embodiments, the RNA-lipid nanoparticles described herein can have an average size (e.g., Z-average) of about 100 nm to 1000 nm, or about 200 nm to 900 nm, or about 200 nm to 800 nm, or about 250 nm to about 700 nm. In some embodiments of the present disclosure, the RNA-lipid nanoparticles may have a particle size (e.g., Z-average) of about 30 nm to about 200 nm, or about 30 nm to about 150 nm, about 40 nm to about 150 nm, about 50 nm to about 150 nm, about 60 nm to about 130 nm, about 70 nm to about 110 nm, about 70 nm to about 100 nm, about 80 nm to about 100 nm, about 90 nm to about 100 nm, about 70 nm to about 90 nm, about 80 nm to about 90 nm, or about 70 nm to about 80 nm. In some embodiments, the average size of the lipid nanoparticles is determined by measuring the particle diameter. In some embodiments, the RNA-lipid nanoparticles may be prepared by mixing lipids with the RNA molecules described herein.

[0041] Lipidoid: As used herein, "lipidoid" refers to a lipid-like molecule. In some embodiments, a lipid is an amphipathic molecule that has one or more lipid-like physical properties. In the context of this disclosure, the term lipid is considered to encompass lipidoids.

[0042] Nanoparticles: As used herein, the term "nanoparticles" refers to particles having an average size suitable for parenteral administration. In some embodiments, nanoparticles have a longest dimension (e.g., diameter) of less than 1,000 nanometers (nm). In some embodiments, nanoparticles may be characterized by a longest dimension (e.g., diameter) of less than 300 nm. In some embodiments, nanoparticles may be characterized by a longest dimension (e.g., diameter) of less than 100 nm. In many embodiments, nanoparticles may be characterized by a longest dimension of between about 1 nm and about 100 nm, or between about 1 μm and about 500 nm, or between about 1 nm and 1,000 nm. In many embodiments, a population of nanoparticles is characterized by an average size (e.g., longest dimension) of less than about 1,000 nm, about 500 nm, about 100 nm, about 50 nm, about 40 nm, about 30 nm, about 20 nm, or about 10 nm, and often greater than about 1 nm. In many embodiments, nanoparticles are substantially spherical, and therefore their longest dimension may be their diameter. In some embodiments, the nanoparticles have a diameter of less than 100 nm, as defined by the National Institutes of Health.

[0043] Naturally-occurring: As used herein, the term "naturally-occurring" refers to an entity that can exist in nature. For example, a peptide or nucleic acid that is present in an organism (including viruses), can be isolated from a natural source, and has not been intentionally modified by man in the laboratory is naturally-occurring.

[0044] Neutralization: As used herein, the term "neutralization" refers to an event in which a binding agent, such as an antibody, binds to a biologically active site of a virus, e.g., a receptor-binding protein, thereby inhibiting parasitic infection of a cell. In some embodiments, the term "neutralization" refers to an event in which the ability of the binding agent to infect a cell is eliminated or significantly reduced.

[0045] Nucleic acid particles: "Nucleic acid particles" can be used to deliver nucleic acids to a desired target site (e.g., a cell, tissue, organ, etc.). Nucleic acid particles can include at least one cationic lipid or cationically ionizable lipid or at least one cationic lipid-like material or cationically ionizable lipid-like material, at least one cationic polymer such as protamine, or a mixture thereof, and nucleic acid. In some embodiments, the nucleic acid particles are lipid nanoparticles. In some embodiments, the nucleic acid particles are lipoplex particles.

[0046] Nucleic Acid / Polynucleotide: As used herein, the term "nucleic acid" refers to a polymer of at least 10 or more nucleotides. In some embodiments, a nucleic acid is or comprises DNA. In some embodiments, a nucleic acid is or comprises RNA. In some embodiments, a nucleic acid is or comprises peptide nucleic acid (PNA). In some embodiments, a nucleic acid is or comprises single-stranded nucleic acid. In some embodiments, a nucleic acid is or comprises double-stranded nucleic acid. In some embodiments, a nucleic acid comprises both single-stranded and double-stranded portions. In some embodiments, a nucleic acid comprises a backbone comprising one or more phosphodiester bonds. In some embodiments, a nucleic acid comprises a backbone having both phosphodiester and non-phosphodiester bonds. For example, in some embodiments, a nucleic acid can comprise a backbone comprising one or more phosphorothioate or 5'-N-phosphoramidite bonds and / or one or more peptide bonds, e.g., "peptide nucleic acids." In some embodiments, a nucleic acid comprises one or more, or all, naturally occurring residues (e.g., adenine, cytosine, deoxyadenosine, deoxycytidine, deoxyguanosine, deoxythymidine, guanine, thymine, uracil). In some embodiments, a nucleic acid comprises one or more, or all, non-naturally occurring residues. In some embodiments, the non-natural residue comprises a nucleoside analog (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, 6-O-methylguanine, 2-thiocytidine, methylated bases, intercalating bases, and combinations thereof).In some embodiments, the non-natural residue comprises one or more modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose) compared to that of the natural residue. In some embodiments, the nucleic acid has a nucleotide sequence that encodes a functional gene product, such as an RNA or a polypeptide. In some embodiments, the nucleic acid has a nucleotide sequence that includes one or more introns. In some embodiments, nucleic acids can be prepared by isolation from natural sources, enzymatic synthesis (e.g., polymerization based on a complementary template in vivo or in vitro, replication in a recombinant cell or system, or chemical synthesis. In some embodiments, nucleic acids are at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 20, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 750, 800, 850, 900, 950, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2250, 2500, 2750, 3000, 3250, 3500, 3750, 4000, 4250, 4500, 4750, 5000, 6000, 7500, 8000, 9500, 10000, 10000, 10000, 10000, 10000, 10000, 10000, 1000 00, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000, 9500, 10,000, 10,500, 11,000, 11,500, 12,000, 12,500 In some embodiments, the amino acid sequence is 00, 13,000, 13,500, 14,000, 14,500, 15,000, 15,500, 16,000, 16,500, 17,000, 17,500, 18,000, 18,500, 19,000, 19,500 or 20,000 or more residues or nucleotides in length.

[0047] Nucleotide: As used herein, the term "nucleotide" refers to its art-recognized meaning. When a number of nucleotides is used, for example, as an indicator of the size of a polynucleotide, a specific number of nucleotides refers to the number of nucleotides on a single strand, for example, a polynucleotide.

[0048] Patient: As used herein, the term "patient" refers to any organism suffering from or at risk for a disease, disorder, or condition. Typical patients include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and / or humans). In some embodiments, the patient is human. In some embodiments, the patient is suffering from or susceptible to one or more diseases, disorders, or conditions. In some embodiments, the patient exhibits one or more symptoms of a disease, disorder, or condition. In some embodiments, the patient has been diagnosed with one or more diseases, disorders, or conditions. In some embodiments, the disease, disorder, or condition suitable for the provided technologies is or includes an HSV infection. In some embodiments, the patient is undergoing or has undergone a particular therapy to diagnose and / or treat the disease, disorder, or condition. In some embodiments, the patient is suffering from or susceptible to an HSV infection.

[0049] PEG-conjugated lipid: The term "PEG-conjugated lipid" refers to a molecule comprising a lipid moiety and a polyethylene glycol moiety.

[0050] Pharmaceutical composition: As used herein, the term "pharmaceutical composition" refers to an active agent formulated with one or more pharmaceutically acceptable carriers. In some embodiments, the active agent is present in a unit dose suitable for administration in a treatment regimen that exhibits a statistically significant probability of achieving a predetermined therapeutic effect when administered to an appropriate population. In some embodiments, the pharmaceutical composition can be specially formulated for parenteral administration, e.g., by subcutaneous, intramuscular, or intravenous injection, e.g., as a sterile solution or suspension formulation.

[0051] Pharmaceutically effective amount: The term "pharmaceutically effective amount" or "therapeutically effective amount" refers to an amount that, alone or together with further doses, produces a desired response or a desired effect. When treating a particular disease, in some embodiments, the desired response relates to inhibiting the course of the disease. In some embodiments, such inhibition may include slowing the progression of the disease and / or halting or reversing the progression of the disease. In some embodiments, the desired response in treating a disease may be delaying or preventing the onset of the disease or condition, or may include delaying or preventing the onset of the disease or condition. The effective amount of a pharmaceutical composition (e.g., an immunogenic composition, e.g., a vaccine) described herein will depend, for example, on the disease or condition being treated, the severity of such disease or condition, individual parameters of the patient (e.g., age, physiological condition, size and weight, duration of treatment, type of concomitant therapy (if any), particular route of administration, and similar factors). Thus, the dose of a pharmaceutical composition (e.g., an immunogenic composition, e.g., a vaccine) described herein will depend on such various parameters. If the patient responds inadequately to the initial dose, a higher dose (or an effectively higher dose provided by another, more localized route of administration) may be used.

[0052] Poly(A) sequence: As used herein, the term "poly(A) sequence" or "poly(A tail" refers to a continuous or interrupted sequence of adenylic acid residues typically located at the 3'-end of an RNA molecule. Poly(A) sequences are known to those skilled in the art and may follow the 3'-UTR in the RNA described herein. A continuous poly(A) sequence is characterized by consecutive adenylic acid residues. Continuous poly(A) sequences are typical in nature. The RNA disclosed herein may have a poly(A) sequence, which is either attached to the free 3'-end of the RNA by a template-independent RNA polymerase after transcription, or is encoded by DNA and transcribed by a template-dependent RNA polymerase.

[0053] Polypeptide: As used herein, the term "polypeptide" refers to a polymeric chain of amino acids. In some embodiments, a polypeptide has a naturally occurring amino acid sequence. In some embodiments, a polypeptide has a non-naturally occurring amino acid sequence. In some embodiments, a polypeptide has an engineered amino acid sequence, in that it has been designed and / or produced by human activity. In some embodiments, a polypeptide can include or consist of natural amino acids, unnatural amino acids, or both. In some embodiments, a polypeptide can include only natural amino acids or only unnatural amino acids, or can consist of only natural amino acids or only unnatural amino acids. In some embodiments, a polypeptide can include D-amino acids, L-amino acids, or both. In some embodiments, a polypeptide can include only D-amino acids. In some embodiments, a polypeptide can include only L-amino acids. In some embodiments, a polypeptide can include one or more pendant groups or other modifications, e.g., one or more amino acid side chains modified or attached to one or more amino acid side chains at the N-terminus of the polypeptide, the C-terminus of the polypeptide, or any combination thereof. In some embodiments, such pendant groups or modifications include acetylation, amidation, lipidation, methylation, pegylation, and the like (including combinations thereof). In some embodiments, a polypeptide may be cyclic and / or include a cyclic moiety. In some embodiments, a polypeptide is not cyclic and / or does not include a cyclic moiety. In some embodiments, a polypeptide is linear. In some embodiments, a polypeptide may be or include a stapled polypeptide. In some embodiments, the term "polypeptide" may be applied to the name of a reference polypeptide, activity, or structure, and in such cases, it is used to refer to polypeptides that share a related activity or structure and therefore may be considered members of the same class or family of polypeptides.For each such class, the present specification provides, and / or one of skill in the art would be aware of, exemplary polypeptides within the class whose amino acid sequence and / or function are known. In some embodiments, such exemplary polypeptides are reference polypeptides for a class or family of polypeptides. In some embodiments, members of a class or family of polypeptides exhibit significant sequence homology or identity with the reference polypeptide of the class (and in some embodiments, with all polypeptides in the class), share common sequence motifs (e.g., characteristic sequence elements), and / or share a common activity (in some embodiments, a similar level or activity within a specified range) with the reference polypeptide of the class (and in some embodiments, with all polypeptides in the class). For example, in some embodiments, a member polypeptide has an overall degree of sequence homology or identity with a reference polypeptide of at least about 30-40%, often about 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more, and / or a member polypeptide contains at least one region (e.g., a conserved region which, in some embodiments, may be or may contain a distinctive sequence element) that exhibits very high sequence identity (often greater than 90%, or even greater than 95%, 96%, 97%, 98%, or 99%). Such conserved regions typically encompass at least 3-4, and often up to 20 or more amino acids, and in some embodiments, the conserved region encompasses at least one stretch of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more consecutive amino acids. In some embodiments, the related polypeptide may comprise or consist of a fragment of the parent polypeptide.

[0054] Prevent: As used herein, the term "prevent" or "prevention," when used in reference to the occurrence of a disease, disorder, and / or condition, means reducing the risk of developing the disease, disorder, and / or condition and / or delaying the onset of one or more characteristics or symptoms of the disease, disorder, or condition. Prevention may be considered complete if the onset of the disease, disorder, or condition has been delayed for a predefined period of time.

[0055] Recombinant: In the context of the present disclosure, the term "recombinant" means "produced by genetic engineering." In some embodiments, a "recombinant" entity, such as a recombinant nucleic acid, in the context of the present disclosure is not naturally occurring.

[0056] Reference: As used herein, the term "reference" refers to a standard or control for comparison. For example, in some embodiments, an agent, animal, individual, population, sample, sequence, or value of interest is compared to a reference or control agent, animal, individual, population, sample, sequence, or value. In some embodiments, the reference or control is tested and / or measured substantially simultaneously with the test or measurement of interest. In some embodiments, the reference or control is a historical reference or control, optionally embodied in a tangible medium. Typically, as will be apparent to one of skill in the art, the reference or control is measured or characterized under conditions or circumstances comparable to those being evaluated. One of skill in the art will understand when there is sufficient similarity to justify reliance on and / or comparison to a particular reference or control considered.

[0057] Ribonucleic acid (RNA): As used herein, the term "RNA" or "polyribonucleotide" refers to a polymer of ribonucleotides. In some embodiments, the RNA is single-stranded. In some embodiments, the RNA is double-stranded. In some embodiments, the RNA contains both single-stranded and double-stranded portions. In some embodiments, the RNA may contain a backbone structure described in the definition of "nucleic acid / polynucleotide" above. The RNA may be a regulatory RNA (e.g., siRNA, microRNA, etc.) or a messenger RNA (mRNA). In some embodiments, the RNA is an mRNA. In some embodiments, the RNA is an mRNA, the RNA typically contains a poly(A) region at its 3' end. In some embodiments, the RNA is an mRNA, the RNA typically contains a cap structure at its 5' end, e.g., known in the art for recognition and binding of mRNA to ribosomes to initiate translation. In some embodiments, the RNA is synthetic RNA. Synthetic RNA includes RNA synthesized in vitro (e.g., by enzymatic and / or chemical synthesis).

[0058] Ribonucleotide: As used herein, the term "ribonucleotide" encompasses unmodified ribonucleotides and modified ribonucleotides. For example, unmodified ribonucleotides include the purine bases adenine (A) and guanine (G) and the pyrimidine bases cytosine (C) and uracil (U). Modified ribonucleotides may contain one or more modifications, examples of which include, but are not limited to, (a) terminal modifications, such as 5'-terminal modifications (e.g., phosphorylation, dephosphorylation, conjugation, reverse conjugation, etc.) and 3'-terminal modifications (e.g., conjugation, reverse conjugation, etc.); (b) base modifications, such as substitution with a modified base, a stabilizing base, a destabilizing base, or a base that base-pairs with a wide repertoire of partners, or a conjugate base; (c) sugar modifications (e.g., at the 2' or 4' position) or sugar substitutions; and (d) internucleoside linkage modifications, including modifications or substitutions of phosphodiester bonds. The term "ribonucleotide" also encompasses ribonucleotide triphosphates, including modified and unmodified ribonucleotide triphosphates.

[0059] Risk: As will be understood from the context, "risk" of a disease, disorder, and / or condition refers to the likelihood that a particular individual will develop the disease, disorder, and / or condition. In some embodiments, risk is expressed as a percentage. In some embodiments, risk is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90-100%. In some embodiments, risk is expressed relative to the risk associated with a reference sample or group of reference samples. In some embodiments, the reference sample or group of reference samples has a known risk for the disease, disorder, condition, and / or onset. In some embodiments, the reference sample or group of reference samples is derived from an individual comparable to the particular individual. In some embodiments, the relative risk is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more. In some embodiments, risk may reflect one or more genetic traits, which may, for example, predispose an individual to (or prevent) developing a particular disease, disorder, and / or condition. In some embodiments, risk may reflect one or more epigenetic events or traits and / or one or more lifestyle or environmental events or traits.

[0060] RNA lipoplex particles: As used herein, the term "RNA lipoplex particles" refers to a complex comprising a liposome (particularly a cationic liposome) and an RNA molecule. Without wishing to be bound by theory, electrostatic interactions between the positively charged liposome and the negatively charged RNA lead to complex formation and the spontaneous formation of the RNA lipoplex particles. In some embodiments, the positively charged liposome may comprise a cationic lipid (e.g., in some embodiments, DOTMA) and another lipid (e.g., in some embodiments, DOPE). In one embodiment, the RNA lipoplex particles are nanoparticles.

[0061] Selective or specific: As used herein with respect to an active agent, the terms "selective" or "specific" mean that the agent exhibits a differential affinity for targetable entities, conditions, or cells, as will be apparent to one of skill in the art. For example, in some embodiments, when an agent is said to bind "specifically" to its target, the agent preferentially binds to that target in the presence of one or more competing targets. In many embodiments, the specific interaction depends on the presence of a particular structural feature of the targeting entity (e.g., an epitope, cleft, binding site). Of course, specificity need not be absolute. In some embodiments, specificity can be assessed relative to the specificity of a target binding site relative to one or more other targetable entities (e.g., competitors). In some embodiments, specificity can be assessed relative to the specificity of a reference specific binding site. In some embodiments, specificity can be assessed relative to the specificity of a reference specific binding site.

[0062] Stable: As used herein, the term "stable" in the context of the present disclosure refers to a pharmaceutical composition (e.g., an immunogenic composition, e.g., a vaccine) as a whole and / or its components meeting or exceeding predetermined acceptance criteria. For example, in some embodiments, a stable pharmaceutical composition (e.g., an immunogenic composition, e.g., a vaccine) does not exhibit unacceptable levels of microbial growth and exhibits no or substantially no degradation or deterioration of the biologically active molecular component(s). In some embodiments, a stable pharmaceutical composition (e.g., an immunogenic composition, e.g., a vaccine) refers to a composition in which the integrity of the RNA molecules is maintained at least about 90% or more. In some embodiments, a stable pharmaceutical composition (e.g., an immunogenic composition, e.g., a vaccine) refers to a composition in which at least 90% or more (e.g., including at least 95%, at least 96%, at least 97%, or more) of the RNA molecules are encapsulated and maintained within the lipid nanoparticles. In some embodiments, a stable pharmaceutical composition (e.g., an immunogenic composition, e.g., a vaccine) refers to a composition in which the formulation is capable of inducing a desired immune response when administered to a subject. In some embodiments, a pharmaceutical composition (eg, an immunogenic composition, eg, a vaccine) is stable under certain conditions for a predetermined period of time.

[0063] Subject: As used herein, the term "subject" refers to an organism to which a composition described herein is administered (e.g., for experimental, diagnostic, prophylactic, and / or therapeutic purposes). Typical subjects include animals (e.g., mice, rats, rabbits, non-human primates, household pets, etc.) and humans. In some embodiments, the subject is a human subject. In some embodiments, the subject is suffering from a disease, disorder, or condition (e.g., HSV infection). In some embodiments, the subject is susceptible to a disease, disorder, or condition (e.g., HSV infection). In some embodiments, the subject exhibits one or more symptoms or characteristics of a disease, disorder, or condition (e.g., HSV infection). In some embodiments, the subject exhibits one or more non-specific symptoms of a disease, disorder, or condition (e.g., HSV infection). In some embodiments, the subject does not exhibit any symptoms or characteristics of a disease, disorder, or condition (e.g., HSV infection). In some embodiments, the subject has one or more characteristics characteristic of being susceptible to or at risk for a disease, disorder, or condition (e.g., HSV infection). In some embodiments, the subject is a patient. In some embodiments, the subject is an individual for whom and / or to whom a diagnosis and / or therapy is being administered.

[0064] Suffering from: An individual who is "suffering from" a disease, disorder, and / or condition has been diagnosed with or displays one or more symptoms of the disease, disorder, and / or condition.

[0065] Susceptible: An individual who is "susceptible" to a disease, disorder, and / or condition is an individual who is at a higher risk than the general population of developing the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may not have been diagnosed with the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may not exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition will develop the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition will not develop the disease, disorder, and / or condition.

[0066] Synthetic: As used herein, the term "synthetic" refers to an entity that is man-made, or that is created with human intervention, or that is derived synthetically rather than occurring in nature. For example, in some embodiments, a synthetic nucleic acid or synthetic polynucleotide refers to a nucleic acid molecule that is chemically synthesized (e.g., in some embodiments, by solid-phase synthesis). In some embodiments, the term "synthetic" refers to an entity that is made outside of a living cell. For example, in some embodiments, a synthetic nucleic acid or polynucleotide refers to a nucleic acid molecule (e.g., RNA) that is generated by in vitro transcription using a template.

[0067] Therapy: The term "therapy" refers to the administration or delivery of an agent or intervention that has a therapeutic effect and / or induces a desired biological and / or pharmacological effect (e.g., that has a demonstrated statistically likely likelihood of having such an effect when administered to a relevant population). In some embodiments, a therapeutic agent is any substance that can be used to alleviate, ameliorate, relieve, inhibit, prevent, delay the onset, reduce the severity, and / or reduce the incidence of one or more symptoms or characteristics of a disease, disorder, and / or condition. In some embodiments, a therapeutic agent or therapy is a medical intervention (e.g., surgery, radiation, phototherapy) that can be performed to alleviate, reduce, inhibit, delay the onset, reduce the severity, and / or reduce the incidence of one or more symptoms or characteristics of a disease, disorder, and / or condition.

[0068] 3 prime untranslated region: As used herein, the term "3 prime untranslated region" or "3'UTR" refers to the sequence of an RNA molecule that begins following the stop codon of the coding region of an open reading frame sequence. In some embodiments, the 3'UTR begins immediately after the stop codon of the coding region of an open reading frame sequence, e.g., in its natural context. In other embodiments, the 3'UTR does not begin immediately after the stop codon of the coding region of an open reading frame sequence, e.g., in its natural context.

[0069] Threshold level (e.g., pass / fail criteria): As used herein, the term "threshold level" refers to a level used as a reference to classify and / or inform the results of a measurement (e.g., a measurement obtained in an assay). For example, in some embodiments, a threshold level refers to a value measured in an assay that defines a boundary between two subsets of a population (e.g., batches that meet quality control standards versus batches that do not meet quality control standards). Thus, values ​​at or above the threshold level define one subset of the population, and values ​​below the threshold level define another subset of the population. A threshold level can be determined based on one or more control samples or for a population of control samples. A threshold level can be determined before, simultaneously with, or after performing the measurement of interest. In some embodiments, a threshold level can be a range of values.

[0070] Treatment: As used herein, the terms "treat," "treatment," or "treating" refer to any method used to partially or completely alleviate, ameliorate, relieve, inhibit, prevent, delay the onset, reduce the severity, and / or reduce the incidence of one or more symptoms or characteristics of a disease, disorder, and / or condition. Treatment may be administered to a subject who does not exhibit signs of the disease, disorder, and / or condition. In some embodiments, treatment may be administered to a subject who exhibits only early signs of the disease, disorder, and / or condition, e.g., to reduce the risk of developing conditions associated with the disease, disorder, and / or condition. In some embodiments, treatment may be administered to a subject at a later stage of the disease, disorder, and / or condition.

[0071] Vaccination: As used herein, the term "vaccination" refers to the administration of a composition intended to generate an immune response (e.g., against a disease-associated agent (e.g., a disease-causing agent)). In some embodiments, vaccination can occur before, during, and / or after exposure to the disease-associated agent, and in certain embodiments, can occur before, during, and / or immediately after exposure to the agent. In some embodiments, vaccination involves multiple, appropriately spaced administrations of a vaccine composition. In some embodiments, vaccination generates an immune response against an infectious agent.

[0072] Vaccine: As used herein, the term "vaccine" refers to a composition that induces an immune response when administered to a subject. In some embodiments, the induced immune response results in protective immunity.

[0073] Variant: As used herein with respect to a molecule, e.g., a nucleic acid, protein, or small molecule, the term "variant" refers to a molecule that exhibits significant structural identity with a reference molecule while structurally differing from the reference molecule (e.g., differing in the presence or absence, or level, of one or more chemical moieties compared to the reference entity). In some embodiments, a variant also differs functionally from its reference molecule. Typically, whether a particular molecule is properly considered a "variant" of a reference molecule is based on its degree of structural identity with the reference molecule. As will be apparent to those skilled in the art, any biological or chemical reference molecule possesses certain characteristic structural elements. A variant is, by definition, a molecule that shares one or more such characteristic structural elements with the reference molecule but differs from it in at least one aspect. In some embodiments, a variant polypeptide or nucleic acid differs from a reference polypeptide or nucleic acid as a result of one or more differences in amino acid or nucleotide sequence and / or chemical moieties (e.g., carbohydrates, lipids, phosphate groups) that are covalent components of the polypeptide or nucleic acid (e.g., attached to the backbone of the polypeptide or nucleic acid). In some embodiments, the mutant polypeptide or nucleic acid exhibits an overall sequence identity to the reference polypeptide or nucleic acid that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99%. In some embodiments, the mutant polypeptide or nucleic acid does not share at least one characteristic sequence element with the reference polypeptide or nucleic acid. In some embodiments, the reference polypeptide or nucleic acid has one or more biological activities. In some embodiments, the mutant polypeptide or nucleic acid shares one or more of the biological activities of the reference polypeptide or nucleic acid. In some embodiments, the mutant polypeptide or nucleic acid lacks one or more of the biological activities of the reference polypeptide or nucleic acid. In some embodiments, the mutant polypeptide or nucleic acid has a reduced level of one or more biological activities compared to the reference polypeptide or nucleic acid.In some embodiments, when a polypeptide or nucleic acid of interest is considered a "variant" of a reference polypeptide or nucleic acid, it has an amino acid sequence or nucleotide sequence identical to that of the reference, but has a small number of sequence changes at specific positions. Typically, the variant has about 20%, about 15%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, or about 2% of the residues substituted, inserted, or deleted compared to the reference. In some embodiments, the mutant polypeptide or nucleic acid contains about 10, about 9, about 8, about 7, about 6, about 5, about 4, about 3, about 2, or about 1 substituted residue compared to the reference. Often, the mutant polypeptide or nucleic acid has a very small number (e.g., less than about 5, about 4, about 3, about 2, or about 1) of functional residues (i.e., residues involved in a specific biological activity) substituted, inserted, or deleted compared to the reference. In some embodiments, the variant polypeptide or nucleic acid has fewer than about 5, about 4, about 3, about 2, or about 1 additions or deletions, and in some embodiments, no additions or deletions, compared to the reference. In some embodiments, the variant polypeptide or nucleic acid has fewer than about 25, about 20, about 19, about 18, about 17, about 16, about 15, about 14, about 13, about 10, about 9, about 8, about 7, about 6, usually fewer than about 5, about 4, about 3, or about 2 additions or deletions. In some embodiments, the reference polypeptide or nucleic acid is naturally occurring.

[0074] Vector: As used herein, refers to a nucleic acid molecule capable of binding to and transporting another nucleic acid. One type of vector is a "plasmid," which refers to a circular double-stranded DNA loop into which additional DNA segments can be ligated. Another type of vector is a viral vector, in which additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) can be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, some vectors are capable of directing the expression of genes to which they are operably linked. Such vectors are referred to herein as "expression vectors." In some embodiments, known techniques can be used, for example, for the production or manipulation of recombinant DNA, for oligonucleotide synthesis, and for tissue culture and transformation (e.g., electroporation, lipofection). Enzymatic reactions and purification techniques can be performed according to manufacturer's specifications or as commonly accomplished in the art or as described herein. The foregoing techniques and procedures can generally be carried out according to conventional methods well known in the art and as described in various general and more specific references cited and described throughout this specification, see, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual (4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, (2012)), which is incorporated herein by reference for all purposes.

[0075] All literature and similar materials cited in this application, including, but not limited to, patents, patent applications, papers, books, articles, and web pages, regardless of the format of such literature and similar materials, are expressly incorporated by reference in their entirety. In the event that one or more of the incorporated literature and similar materials differs from or conflicts with this application (including, but not limited to, defined terms, term usage, described techniques, etc.), this application controls. The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described in any way.

[0076] Detailed Description of Specific Embodiments As described above, the present disclosure provides pharmaceutical compositions (e.g., immunogenic compositions, e.g., vaccines) and related technologies (e.g., methods) for delivering specific herpes simplex virus (HSV) antigen constructs (e.g., HSV-1 antigen constructs, HSV-2 antigen constructs, or combinations thereof) to a subject (e.g., a patient). In particular, the present disclosure provides HSV (e.g., HSV-1, HSV-2, or both) vaccine compositions and related technologies (e.g., methods).

[0077] For example, the present disclosure provides polyribonucleotides, e.g., encoding one or more HSV antigens. In some embodiments, such polyribonucleotides can be part of an RNA construct. In some embodiments, the polyribonucleotides or RNA constructs described herein can be part of a composition (e.g., a pharmaceutical composition, e.g., an immunogenic composition, e.g., a vaccine).

[0078] In some embodiments, the technology provided herein is directed to HSV. A description and certain exemplary characteristics of HSV are provided below.

[0079] I. Herpes simplex virus (HSV) Herpes simplex viruses (HSVs) belong to the alpha subfamily of the human herpesvirus family and include two types: HSV-1 and HSV-2. The structure of HSV-1 and HSV-2 primarily comprises (from inside to outside) a DNA core, capsid, tegument, and envelope. Each HSV-1 and HSV-2 has a double-stranded DNA genome of approximately 153 kb encoding at least 80 genes. The DNA core is enclosed by an icosapentahedral capsid consisting of 162 capsomeres, 150 hexons, and 12 pentons, which are composed of six different viral proteins. The DNA is surrounded by at least 20 different viral tegument proteins, which have structural and regulatory roles. Some of these proteins are involved in capsid transport to the nucleus and other organelles, viral DNA entry into the nucleus, activation of early gene transcription, inhibition of cellular protein biosynthesis, and mRNA degradation. The viral envelope surrounding the tegument has at least 12 different glycoproteins (BN) on its surface, which may exist as heterodimers (H / L and E / I), but most exist as monomers.

[0080] HSV-1 and HSV-2 cause a range of mild, moderate, and severe lesions, including oral and genital ulcers, viral blindness, viral encephalitis, and disseminated infections in newborns. HSV-1 and HSV-2 typically infect through different routes and affect different areas of the body, but the signs and symptoms they cause can overlap. Infections caused by HSV-1 represent one of the more widespread infections of the orofacial region, commonly resulting in herpes labialis, herpetic stomatitis, and keratitis. HSV-2 typically causes genital herpes and is primarily transmitted by direct sexual contact with the lesions. While most genital HSV infections are caused by HSV-2, an increasing number of genital HSV infections are attributable to HSV-1. Genital HSV-1 infections are typically less severe and less common than genital HSV-2 infections.

[0081] HSV infection is transmitted by contact with herpetic lesions, mucosal surfaces, genital secretions, or oral secretions. The average incubation period after exposure is usually 4 days, but can range from 2 to 12 days. HSV particles can infect neuronal extensions that activate peripheral tissues and establish latency in these cells, namely, the trigeminal ganglia and dorsal root ganglia in the spinal region, where they can sporadically reactivate. Furthermore, like other herpesviruses, HSV infection is lifelong and generally asymptomatic. Without wishing to be bound by any particular theory, it is understood that HSV particles can be shed from infected individuals regardless of the development of clinical symptoms.

[0082] HSV infection is characterized by painful blisters that may rupture, though they are rarely fatal. There are few clear differences in clinical symptoms depending on the type of infecting virus. However, as mentioned above, HSV-1 infections tend to be less severe than HSV-2 infections, and patients infected with HSV-2 generally occur in clusters.

[0083] A. Life Cycle As described herein, to initiate infection, HSV (HSV-1 or HSV-2) particles bind to the cell surface using viral glycoproteins and fuse their envelope with the plasma membrane (see, e.g., Figure 2, step 1). After membrane fusion, the viral capsid and tegument proteins are internalized into the cytoplasm (see, e.g., Figure 2, step 2). Once in the cytoplasm, the viral capsid accumulates in the nucleus and releases viral DNA into the nucleus (see, e.g., Figure 2, step 3). HSV replicates through three rounds of transcription that produce the α (immediate-early) proteins, which primarily control viral replication; the β (early) proteins, which synthesize and package DNA; and the γ (late) proteins, most of which are virion proteins (see Whitley et al., Lancet 2001 May 12;357(9267); Taylor et al., Front Biosci. 2002 Mar 1;7:d752-64; and Ibanez et al., Front Microbiol. 2018 Oct 11;9:2406) (each of which is incorporated herein by reference in its entirety) (see, e.g., Figure 2, steps 4-6).

[0084] HSV capsids are assembled in the nucleus of infected cells (see, e.g., Figure 2, step 7). Once viral capsid assembly is complete in the nucleus, these particles continue their maturation process in this same compartment to acquire tegument proteins. After leaving the nucleus, additional tegument proteins are added to the capsid. Meanwhile, glycoproteins are translated and glycosylated in the endoplasmic reticulum, processed in the trans-Golgi network (TGN), and then targeted to multivesicular bodies (see, e.g., Figure 2, step 8). They are then transported to plasma membrane glycoproteins within early endosomes (see, e.g., Figure 2, step 9). Subsequently, viral capsids in the cytoplasm fuse with HSV-glycoprotein-containing endosomes to form infectious virions within the vesicles (see, e.g., Figure 2, steps 10–12).

[0085] HSV (HSV-1 or HSV-2) can establish a latent infection. After primary infection, HSV productively replicates in epithelial cells or enters the axons of sensory neurons and migrates to the nucleus of the neuron. There, viral DNA remains circular, extrachromosomal, and does not express lytic genes. However, latency-associated transcripts are expressed and then spliced ​​to produce mRNA. This general transcriptional silencing may allow the virus to remain hidden intracellularly by evading immune surveillance. In some aspects, provided herein are techniques (e.g., compositions and methods) for enhancing, inducing, promoting, enhancing, and / or improving the immune response to HSV (e.g., HSV-1 and / or HSV-2) or components thereof (e.g., proteins or portions thereof). In some embodiments, the techniques provided herein are designed to enhance, induce, promote, enhance, and / or improve immune memory against HSV or components thereof (e.g., proteins or portions thereof). In some embodiments, the technology described herein is designed to act as an immunological boost to a primary vaccine, such as a vaccine against an epitope and / or epitopes of HSV (e.g., HSV-1 and / or HSV-2).

[0086] The virus remains in this state for the lifetime of the host or until an appropriate signal reactivates the virus and new progeny are generated, which then migrate through the neuronal axis to the site of primary infection and restart the lytic replication cycle.

[0087] B. HSV genome The genomes of HSV-1 and HSV-2 are both approximately 150 kb long, double-stranded DNAs that vary slightly between subtypes and strains. The genomes encode over 80 genes and have a high GC content: 67% and 69% for HSV-1 and HSV-2, respectively (Whitley et al., Lancet 2001 May 12;357(9267); Taylor et al., Front Biosci. 2002 Mar 1;7:d752-64; and Jiao et al., Microbiol Resour Announc. 2019 Sep;8(39):e00993-19, which are incorporated herein by reference in their entireties).

[0088] Genomes are organized into unique long regions (UL) and unique short regions (US). ULs are typically bounded by terminal long (TRL) and internal long (IRL) repeats. USs are typically bounded by terminal short (IRS) and internal short (TRS) repeats. Genes found in unique regions are present in the genome as a single copy, while genes encoded in repeat regions are present in two copies (see Whitley et al., Lancet 2001 May 12;357(9267); Taylor et al., Front Biosci. 2002 Mar 1;7:d752-64; and Jiao et al., Microbiol Resour Announc. 2019 Sep;8(39):e00993-19) (incorporated herein by reference in their entireties).

[0089] HSV contains three origins of replication within its genome, named according to their location within either the long (oriL) or short (oriS) region of the genome. oriL is found as a single copy in the UL segment, while oriS is located in the repeat region of the short segment; therefore, it is present in the genome in two copies. Both oriL and oriS are palindromic sequences consisting of an AT-rich central region flanked by inverted repeats containing multiple binding sites with different affinities for the viral origin-binding protein (UL9). Either the oriL or oriS sequence is sufficient for viral replication (see Whitley et al., Lancet 2001 May 12;357(9267); Taylor et al., Front Biosci. 2002 Mar 1;7:d752-64; and Jiao et al., Microbiol Resour Announc. 2019 Sep;8(39):e00993-19, which are incorporated herein by reference in their entireties).

[0090] The viral genome also contains signals that regulate the proper processing of newly synthesized genomes for packaging into preformed capsids. Progeny genomes are generated in long concatemers that require cleavage into unit-length monomers. To this end, the viral genome contains two DNA sequence elements, pac1 and pac2, that ensure the proper cleavage and packaging of unit-length progeny genomes. These elements are located within direct repeats (DRs) found within the terminal inverted repeat regions of the viral genome (see Whitley et al., Lancet 2001 May 12;357(9267); Taylor et al., Front Biosci. 2002 Mar 1;7:d752-64; and Jiao et al., Microbiol Resour Announc. 2019 Sep;8(39):e00993-19, the entire contents of which are incorporated herein by reference).

[0091] C. HSV vaccine Several HSV vaccines have been developed and evaluated in human clinical trials, primarily focusing on the generation of neutralizing antibodies (nAbs) targeting HSV-2 and the viral envelope glycoprotein D, which is a correlate of immune protection. See Table 1 below. Although these vaccines have demonstrated protection against HSV in preclinical and in some cases Phase 2 trials, none of these vaccines have demonstrated sufficient efficacy for further development or commercialization.

[0092] The present disclosure provides insight that many previous strategies for developing pharmaceutical compositions (e.g., immunogenic compositions, e.g., vaccines) for the treatment and / or protection against HSV infection have focused primarily or almost exclusively on the development of neutralizing antibodies targeting surface glycoproteins. The present disclosure recognizes challenges with such strategies, including, for example, a failure to recognize the value or importance of ensuring that the induced immune response includes significant T cell activity (in some embodiments, CD4 T cell activity, in some embodiments, CD8 T cell activity, or in some embodiments, both). In some embodiments, for example, pharmaceutical compositions (e.g., immunogenic compositions, e.g., vaccines) that include or deliver CD4 and CD8 epitope(s) of one or more HSV antigens (e.g., HSV-1 antigens, HSV-2 antigens, or a combination thereof) in addition to one or more B cell antigens and / or epitopes may be used to treat and / or protect against HSV infection. [Table 1-1] [Table 1-2]

[0093] D. Antiviral Treatment for HSV The present disclosure provides the recognition that the constructs and / or compositions described herein may be administered as part of a regimen with other therapeutic agents. The present disclosure also recognizes that a subject receiving the constructs and / or compositions described herein may have previously received other therapeutic agents.

[0094] In some embodiments, for example, the subject may be receiving or have previously received an antiviral agent for HSV. In some embodiments, the antiviral agent may be administered to treat HSV-1 or HSV-2 infection or recurrent episodes. In some embodiments, the antiviral agent is or includes acyclovir, valacyclovir, famciclovir, or a combination thereof. Table 2 below provides specific information regarding selected antiviral agents. [Table 2]

[0095] II. Constructs A. Antigen The present disclosure provides that certain HSV-2 antigens (e.g., gC, gD, and / or gE antigens) and antigenic fragments thereof can be useful for preventing or treating HSV infection (e.g., HSV-2 infection, HSV-1 infection, or both). The present disclosure provides that antigenic portions of such HSV-2 antigens can be delivered, for example, in HSV-2 antigen constructs and / or HSV compositions (e.g., immunogenic compositions, e.g., vaccines), e.g., as further disclosed herein.

[0096] The polyribonucleotides provided herein comprise an antigenic portion of an HSV-2 antigen (e.g., an HSV-2 glycoprotein). In some embodiments, the polyribonucleotides described herein encode an HSV-2 gC antigen or an antigenic fragment thereof. In some embodiments, the polyribonucleotides described herein encode an HSV-2 gD antigen or an antigenic fragment thereof. In some embodiments, the polyribonucleotides described herein encode an HSV-2 gE antigen or an antigenic fragment thereof.

[0097] In some embodiments, the polyribonucleotides described herein encode an antigenic portion of an HSV-2 gC antigen. In some embodiments, the polyribonucleotides described herein encode an antigenic portion of an HSV-2 gD antigen. In some embodiments, the polyribonucleotides described herein encode an antigenic portion of an HSV-2 gE antigen.

[0098] A brief description of HSV-2 gC, gD, and gE is included below.

[0099] Glycoprotein C (gC) Mature HSV glycoprotein C (gC) is a 56 kDa protein that plays a key role in the initial binding of HSV to its host targets. Glycoprotein C is a type I membrane glycoprotein and is considered the major attachment protein and primary viral ligand for binding to heparin sulfate proteoglycans (HSPGs) on the cell surface of target hosts. This may occur through the interaction of gC with HSPG-rich regions found in F-actin-rich membrane protrusions called filopodia.

[0100] Glycoprotein C has also been shown to regulate cell entry and infection by increasing the pH threshold for acid-induced conformational changes in gB. Low pH induces reversible conformational changes in gB domains I and V, functional regions containing hydrophobic loops important for the fusion process. By positively regulating the low-pH-induced conformational changes in gB, glycoprotein C enhances the ability of HSV to enter cell types, such as epithelial cells, that require a low-pH mechanism for entry.

[0101] In addition to its role in adhesion, glycoprotein C has also been shown to play an important role in immune evasion. Glycoprotein C is one of the primary targets for lymphocyte cytotoxicity in certain cell types and can bind to complement component C3b, inhibiting complement activation. Furthermore, neutralizing epitopes present in other HSV glycoproteins, such as gB, are protected by the presence of gC, preventing the immune response from interfering with fusion.

[0102] Glycoprotein D (gD) Glycoprotein D is a 46-kDa type I membrane glycoprotein. The N-terminal ectodomain consists of 316 amino acids. Glycoprotein D is not conserved among viruses in the Herpesviridae family, but it is essential for HSV cell entry. Glycoprotein D promotes invasion by interacting with several cell surface receptors, including herpesvirus entry mediator (HVEM), nectin-1 or nectin-2, and heparin sulfate, which contain specific modifications. These host receptors do not function as coreceptors, as each glycoprotein interacts with the host receptor independently. Binding of gD to one of these cellular receptors induces a conformational change that converts gD from its closed, autoinhibited state to an active state that transmits one of the two signals thought to be required for gH / gL activation. HVEM, the first identified gD receptor, belongs to the tumor necrosis factor (TNF) receptor family and is commonly found on T cells, B cells, dendritic cells, natural killer cells, macrophages, as well as non-immune cell types such as neurons and epithelial cells. Within the N-terminus of glycoprotein D, there is a 37-residue hairpin structure that forms the entire site for binding to the host receptor HVEM. Specifically, residues 1–32 of the N-terminal domain of glycoprotein D bind to the cysteine-rich domain 1 (CDR1) of HVEM. This N-terminal extension adopts an extended, flexible conformation when not in contact with HVEM.

[0103] All clinical strains of HSV-1 and HSV-2, regardless of their origin, use nectin-1 for host cell invasion. However, some variants of HSV-1 and HSV-2 utilize nectin-2. Furthermore, heparin sulfate is utilized by HSV-1 but not by HSV-2. The interaction of glycoprotein D with net-1 has been shown to be essential in some cell types, such as neurons, even when other receptors for glycoproteins are present on the cell surface.

[0104] Glycoprotein E (gE) Glycoprotein E is approximately 53 kDa. Glycoprotein E interacts with glycoprotein I to form a heterodimeric complex that plays an important role in cell-to-cell spread and virus-induced fusion. gE / gI (different from gB, gD, and gH / gL) is not required for fusion and cell entry but is important for cell-to-cell spread. Because the lytic cycle of this virus is highly dependent on cell-to-cell spread, disruption of gE / gI complex formation has a significant impact on HSV replication. The mechanism by which gE / gI promotes cell-to-cell spread is poorly understood, but its function is thought to depend on several tegument proteins. Cooperation of the tegument proteins UL11, UL16, and UL21 is thought to be important for gE processing, transport, and biological activity. [Table 3-1] [Table 3-2]

[0105] Examples of amino acid sequences for specific HSV gC, gD, and gE polypeptides are provided below in Table 4, examples of deoxyribonucleic acid sequences encoding specific HSV gC, gD, and gE polypeptides are provided below in Table 5, and examples of ribonucleic acid sequences encoding specific HSV gC, gD, and gE polypeptides are provided below in Table 6. [Table 4-1] [Table 4-2] [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4] Table 5-5 Table 5-6 Table 5-7 Table 5-8 Table 5-9 Table 5-10 Table 5-11 Table 5-12 Table 5-13 Table 5-14 Table 5-15 Table 5-16 Table 5-17 Table 5-18 Table 5-19 Table 5-20 Table 5-21 Table 5-22 Table 5-23 Table 5-24 Table 5-25 Table 5-26 Table 5-27 Table 5-28 Table 5-29 Table 5-30 Table 5-31 Table 5-32 Table 5-33 Table 6-1 Table 6-2 Table 6-3 Table 6-4 Table 6-5 Table 6-6 Table 6-7 Table 6-8 Table 6-9 Table 6-10 Table 6-11 Table 6-12 Table 6-13 Table 6-14 Table 6-15 Table 6-16 Table 6-17 Table 6-18 Table 6-19 Table 6-20 Table 6-21 Table 6-22 Table 6-23 Table 6-24 Table 6-25 Table 6-26 Table 6-27 Table 6-28 Table 6-29 Table 6-30 Table 6-31 Table 6-32 Table 6-33

[0106] Provided herein are polyribonucleotides encoding polypeptides. In some embodiments, the polypeptides comprise one or more HSV glycoprotein C (gC) antigens or antigenic fragments thereof. In some embodiments, the antigens comprise an antigenic portion of HSV gC. In some embodiments, the antigenic portion of HSV gC comprises an amino acid sequence or a portion thereof that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 1. In some embodiments, the antigenic portion of HSV gC has an amino acid sequence identical to the amino acid sequence of SEQ ID NO: 1. In some embodiments, the antigenic portion of HSV gC comprises an amino acid sequence that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 260. In some embodiments, the antigenic portion of HSV gC has an amino acid sequence identical to the amino acid sequence of SEQ ID NO:260.

[0107] In some embodiments, the polyribonucleotide comprises a ribonucleic acid sequence that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, or 100% identical to the ribonucleic acid sequence of any of SEQ ID NOs: 16-19, 147, and 274-281.

[0108] In some embodiments, the polypeptide comprises one or more HSV glycoprotein D (gC) antigens or antigenic fragments thereof. In some embodiments, the polypeptide comprises an antigenic portion of HSV gD. In some embodiments, the antigenic portion of HSV gD comprises an amino acid sequence or portion thereof that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to an amino acid sequence identical to the amino acid sequence of SEQ ID NO:2. In some embodiments, the antigenic portion of HSV gD has an amino acid sequence identical to the amino acid sequence of SEQ ID NO:2.

[0109] In some embodiments, the polyribonucleotide comprises a ribonucleic acid sequence that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, or 100% identical to the ribonucleic acid sequence of any of SEQ ID NOs: 20-23, 143, and 286.

[0110] In some embodiments, the polypeptide comprises one or more HSV glycoprotein E (gE) antigens or antigenic fragments thereof. In some embodiments, the polypeptide comprises an antigenic portion of HSV gE. In some embodiments, the antigenic portion of HSV gE comprises an amino acid sequence or portion thereof that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the amino acid sequence of SEQ ID NO:3. In some embodiments, the antigenic portion of HSV gE has an amino acid sequence identical to the amino acid sequence of SEQ ID NO:3.

[0111] In some embodiments, the polyribonucleotide comprises a ribonucleic acid sequence that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a ribonucleic acid sequence according to any of SEQ ID NOs: 24-27 and 282-285.

[0112] B. Secretion signal Provided herein is a polypeptide comprising (i) an HSV antigen or antigenic fragment thereof and (ii) a secretory signal. Also provided herein is a polyribonucleotide encoding a polypeptide comprising (i) an HSV antigen or antigenic fragment thereof and (ii) a secretory signal. In some embodiments, the secretory signal functions in mammalian cells. In some embodiments, the secretory signal comprises or consists of a human secretory signal. In some embodiments, the secretory signal comprises or consists of an IL2 secretory signal.

[0113] In some embodiments, the secretory signal comprises or consists of a viral secretory signal. In some embodiments, the viral secretory signal comprises or consists of an HSV secretory signal (e.g., an HSV-1 or HSV-2 secretory signal). In some embodiments, the secretory signal comprises or consists of an HSV-1 secretory signal. In some embodiments, the secretory signal comprises or consists of an HSV-2 secretory signal.

[0114] In some embodiments, the HSV secretion signal comprises or consists of an HSV glycoprotein D (gD) secretion signal (e.g., an HSV-1 or HSV-2 secretion signal). In some embodiments, the HSV secretion signal comprises or consists of an HSV-1 gD secretion signal. In some embodiments, the HSV-1 gD secretion signal comprises one or more additional amino acids. In some embodiments, the HSV-1 gD secretion signal comprises KY at the C-terminus of the signal sequence. In some embodiments, the HSV secretion signal comprises or consists of an HSV-2 gD secretion signal. In some embodiments, the HSV-2 gD secretion signal comprises one or more additional amino acids. In some embodiments, the HSV-2 gD secretion signal comprises KYA or KYALA at the C-terminus of the signal sequence.

[0115] In some embodiments, the HSV secretory signal comprises or consists of an HSV glycoprotein C (gC) secretory signal (e.g., an HSV-1 or HSV-2 secretory signal). In some embodiments, the HSV secretory signal comprises or consists of an HSV-2 gC secretory signal.

[0116] In some embodiments, the HSV secretory signal comprises or consists of an HSV glycoprotein E (gE) secretory signal (e.g., an HSV-1 or HSV-2 gE secretory signal). In some embodiments, the HSV secretory signal comprises or consists of an HSV-1 gE secretory signal. In some embodiments, the HSV secretory signal comprises or consists of an HSV-2 gE secretory signal. In some embodiments, the HSV-2 gE secretory signal comprises one or more additional amino acids. In some embodiments, the HSV-2 gE secretory signal comprises an RTS. In some embodiments, the HSV-2 secretory signal comprises an A20V, A21V, or A22V substitution.

[0117] In some embodiments, the HSV secretion signal comprises or consists of an HSV glycoprotein B (gB) secretion signal (e.g., an HSV-1 or HSV-2 gB secretion signal). In some embodiments, the HSV secretion signal comprises or consists of an HSV-1 gB secretion signal. In some embodiments, the HSV-1 gB secretion signal comprises one or more additional amino acids. In some embodiments, the HSV-1 gB secretion signal comprises an AP at the C-terminus of the signal sequence. In some embodiments, the HSV secretion signal comprises or consists of an HSV-2 gB secretion signal.

[0118] In some embodiments, the HSV secretion signal comprises or consists of an HSV glycoprotein I (gI) secretion signal (e.g., an HSV-1 or HSV-2 gI secretion signal). In some embodiments, the HSV secretion signal comprises or consists of an HSV-1 gI secretion signal. In some embodiments, the HSV-1 gI secretion signal comprises one or more additional amino acids. In some embodiments, the HSV secretion signal comprises or consists of an HSV-2 gI secretion signal. In some embodiments, the HSV-2 gI secretion signal comprises an additional leucine residue at the C-terminus of the signal sequence.

[0119] In some embodiments, the secretory signal comprises or consists of the Ebola virus spike glycoprotein (EboZ). In some embodiments, the EboZ secretory signal comprises one or more additional amino acids. In some embodiments, the EboZ secretory signal comprises an IP at the C-terminus of the signal sequence.

[0120] In some embodiments, the secretory signal is characterized by a length of about 15 to 30 amino acids.

[0121] In some embodiments, the secretory signal is located at the N-terminus of the polyribonucleotide. In some embodiments, the secretory signal preferably enables transport of the polyribonucleotide with which it is associated to a defined cellular compartment, preferably the cell surface, the endoplasmic reticulum (ER), or an endosomal-lysosomal compartment.

[0122] In some embodiments, the polyribonucleotide comprising the HSV antigen does not comprise a secretory signal. In some embodiments, the polyribonucleotide comprising the HSV antigen further comprises a codon initiation start site.

[0123] In some embodiments, the secretory signal is one listed in Table 7 or a secretory signal that differs by 1, 2, 3, 4, or 5 amino acids therefrom. In some embodiments, the secretory signal is selected from those included in Table 7 below and / or those encoded by the sequences in Table 8 and / or Table 9 below. [Table 7] [Table 8-1] [Table 8-2] [Table 8-3] [Table 8-4] [Table 8-5] [Table 8-6] [Table 9-1] [Table 9-2] [Table 9-3] [Table 9-4] [Table 9-5] [Table 9-6]

[0124] C. Certain Exemplary Antigen-Secretory Signal Combinations In some embodiments, the polyribonucleotide encodes a polypeptide, the polypeptide comprising an HSV-2 glycoprotein antigen or an antigenic fragment thereof and a secretory signal. In some embodiments, the polyribonucleotide encodes a polypeptide, the polypeptide comprising an HSV-2 glycoprotein antigen and a secretory signal.

[0125] Exemplary polyribonucleotide constructs encoding the gC, gD, or gE antigens described herein are shown in Table 10 below. [Table 10-1] [Table 10-2] [Table 10-3] [Table 10-4] [Table 10-5] [Table 10-6] [Table 10-7]

[0126] In some embodiments, a polypeptide described herein (or encoded by a polyribonucleotide described herein) comprises an HSV-2 gC antigen and a secretory signal. Exemplary combinations of HSV-2 gC antigen and secretory signal, along with exemplary corresponding amino acid sequences, are shown in Table 11 below.

[0127] In some embodiments, a polypeptide described herein (or encoded by a polyribonucleotide described herein) comprises an HSV-2 gD antigen and a secretory signal. Exemplary combinations of HSV-2 gD antigen and secretory signal, along with exemplary corresponding amino acid sequences, are shown in Table 11 below.

[0128] In some embodiments, a polypeptide described herein (or encoded by a polyribonucleotide described herein) comprises an HSV-2 gE antigen and a secretory signal. Exemplary combinations of HSV-2 gE antigens and secretory signals, along with exemplary corresponding amino acid sequences, are shown in Table 11 below. Exemplary nucleotide sequences are shown in Tables 12 and 13. [Table 11-1] [Table 11-2] [Table 11-3] [Table 11-4] [Table 11-5] [Table 11-6] [Table 11-7] [Table 12-1] Table 12-2 Table 12-3 Table 12-4 Table 12-5 Table 12-6 Table 12-7 Table 12-8 Table 12-9 Table 12-10 Table 12-11 Table 12-12 Table 12-13 Table 12-14 Table 12-15 Table 12-16 Table 12-17 Table 12-18 Table 12-19 Table 12-20 Table 12-21 Table 12-22 Table 12-23 Table 12-24 Table 12-25 Table 12-26 Table 12-27 Table 12-28 Table 12-29 Table 12-30 Table 12-31 Table 12-32 Table 12-33 Table 12-34 Table 12-35 Table 12-36 Table 12-37 Table 12-38 Table 12-39 Table 12-40 Table 12-41 Table 12-42 Table 12-43 Table 12-44 Table 12-45 Table 12-46 Table 12-47 Table 12-48 Table 12-49 Table 12-50 Table 12-51 Table 12-52 Table 12-53 Table 12-54 Table 12-55 Table 12-56 Table 12-57 Table 12-58 Table 12-59 Table 12-60 Table 12-61 Table 12-62 Table 12-63 Table 12-64 Table 12-65 Table 12-66 Table 13-1 Table 13-2 Table 13-3 Table 13-4 Table 13-5 Table 13-6 Table 13-7 Table 13-8 Table 13-9 Table 13-10 Table 13-11 Table 13-12 Table 13-13 Table 13-14 Table 13-15 Table 13-16 Table 13-17 Table 13-18 Table 13-19 Table 13-20 Table 13-21 Table 13-22 Table 13-23 Table 13-24 Table 13-25 Table 13-26 Table 13-27 Table 13-28 Table 13-29 Table 13-30 Table 13-31 Table 13-32 Table 13-33 Table 13-34 Table 13-35 Table 13-36 Table 13-37 Table 13-38 Table 13-39 Table 13-40 Table 13-41 Table 13-42 Table 13-43 Table 13-44 Table 13-45 Table 13-46 Table 13-47 Table 13-48 Table 13-49 Table 13-50 Table 13-51 Table 13-52 Table 13-53 Table 13-54 Table 13-55 Table 13-56 Table 13-57 Table 13-58 Table 13-59 Table 13-60 Table 13-61 Table 13-62 Table 13-63 Table 13-64 Table 13-65 Table 13-66

[0129] D. Membrane penetration field In some embodiments, the polypeptides described herein comprise a transmembrane region. In some embodiments, the polyribonucleotides described herein encode a polypeptide comprising a transmembrane region. In some embodiments, the transmembrane region is located at the N-terminus of the polypeptide. In some embodiments, the transmembrane region is located at the C-terminus of the polypeptide. In some embodiments, the transmembrane region is not located at the N-terminus or C-terminus of the polypeptide. In some embodiments, the polypeptide does not comprise a transmembrane region.

[0130] Transmembrane regions are known in the art, any of which can be utilized in the polypeptides described herein. In some embodiments, the transmembrane region comprises or is a transmembrane domain of influenza virus hemagglutinin (HA), HIV-1 Env, equine infectious anemia virus (EIAV), murine leukemia virus (MLV), mouse mammary tumor virus, vesicular stomatitis virus (VSV) G protein, rabies virus, or a seven-transmembrane domain receptor. In some embodiments, the polypeptide comprises an HSV transmembrane region. In some embodiments, the HSV transmembrane region is an HSV-1 or HSV-2 transmembrane region. In some embodiments, the HSV transmembrane region is an HSV-2 gD transmembrane region. In some embodiments, the HSV transmembrane region is an HSV-2 gC transmembrane region. In some embodiments, the HSV transmembrane region is an HSV-2 gE transmembrane region.

[0131] III. Polyribonucleotides A. Exemplary Polyribonucleotide Characteristics The present disclosure also provides RNA constructs comprising the polyribonucleotides described herein. In some embodiments, the RNA constructs provided herein comprise polyribonucleotides encoding an HSV-2 gC antigen or an antigenic fragment thereof. In some embodiments, the RNA constructs provided herein comprise polyribonucleotides encoding an HSV-2 gD antigen or an antigenic fragment thereof. In some embodiments, the RNA constructs provided herein comprise polyribonucleotides encoding an HSV-2 gE antigen or an antigenic fragment thereof.

[0132] In some embodiments, the RNA constructs provided herein comprise a polyribonucleotide encoding an HSV-2 gC antigen. In some embodiments, the RNA constructs provided herein comprise a polyribonucleotide encoding an HSV-2 gD antigen. In some embodiments, the RNA constructs provided herein comprise a polyribonucleotide encoding an HSV-2 gE antigen.

[0133] In some embodiments, the RNA constructs provided herein comprise polyribonucleotides encoding an HSV-2 gC antigen and a secretory signal. In some embodiments, the RNA constructs provided herein comprise polyribonucleotides encoding an HSV-2 gD antigen and a secretory signal. In some embodiments, the RNA constructs provided herein comprise polyribonucleotides encoding an HSV-2 gE antigen and a secretory signal.

[0134] In some embodiments, the polyribonucleotides described herein can include a nucleotide sequence encoding a 5' UTR and / or a 3' UTR. In some embodiments, the polynucleotides described herein can include a nucleotide sequence encoding a poly-A tail. In some embodiments, the polyribonucleotides described herein can include a 5' cap, which can be incorporated during transcription or attached to the polyribonucleotide after transcription.

[0135] 1.5' Cap A structural feature of RNA is the cap structure at the 5'-prime (5') end. Naturally occurring eukaryotic RNAs have a 7-methylguanosine cap attached to the RNA via a 5'-to-5' triphosphate bond, resulting in the cap0 structure (m7GpppN). In most eukaryotic RNAs and some viral RNAs, further modifications occur at the 2'-hydroxyl group (2'-OH) of the first and subsequent nucleotides (e.g., the 2'-hydroxyl group can be methylated to form 2'-O-Me), forming "cap1" and "cap2" 5' ends, respectively. Diamond, et al. (2014) Cytokine & Growth Factor Reviews, 25:543-550 (incorporated herein by reference in its entirety) reported that cap0-mRNAs are not translated as efficiently as cap1-mRNAs, where the role of the 2'-O-Me at the penultimate position of the RNA's 5' end is a determining factor. The absence of 2'-O-met has been shown to induce innate immunity and activate IFN responses (Daffis, et al. (2010) Nature, 468:452-456, and Zust et al. (2011) Nature Immunology, 12:137-143), each of which is incorporated herein by reference in its entirety.

[0136] Capping of RNA has been well studied and is described, for example, in Decroly E et al. (2012) Nature Reviews 10: 51-65 and Ramanathan A. et al., (2016) Nucleic Acids Res;44(16):7511-7526, the contents of each of which are incorporated herein by reference. For example, in some embodiments, 5' cap structures that may be suitable in the context of the present invention are cap0 (methylation of the first nucleobase, e.g., m7GpppN), cap1 (additional methylation of the ribose of the nucleotide adjacent to m7GpppN), cap2 (additional methylation of the ribose of the second nucleotide downstream from m7GpppN), cap3 (additional methylation of the ribose of the third nucleotide downstream from m7GpppN), cap4 (additional methylation of the ribose of the fourth nucleotide downstream from m7GpppN), ARCA ("anti-reverse cap analog"), modified ARCA (e.g., phosphothioate-modified ARCA), inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.

[0137] As used herein, the term "5' cap" refers to the structure found at the 5' end of RNA, e.g., mRNA, and generally comprises a guanosine nucleotide linked to RNA, e.g., mRNA, via a 5'-to-5' triphosphate linkage (also referred to as Gppp or G(5')ppp(5')). In some embodiments, the guanosine nucleoside comprised within the 5' cap can be modified, for example, by methylation at one or more positions (e.g., position 7) on the base (guanosine) and / or methylation at one or more positions on the ribose. In some embodiments, the guanosine nucleoside comprised within the 5' cap comprises a 3'O-methylation on the ribose (3'OMeG). In some embodiments, the guanosine nucleoside comprised within the 5' cap comprises a methylation at position 7 of guanine (m7G). In some embodiments, the guanosine nucleoside comprised within the 5' cap comprises a methylation at position 7 of guanine and a 3'O-methylation on the ribose (m7(3'OMeG)). The notation used in the above paragraph, e.g., "(m2 7,3’-O It will be understood that "m7(3'OMeG)" or "m7(3'OMeG)" also applies to other structures described herein.

[0138] In some embodiments, RNAs with a 5' cap disclosed herein can be obtained by in vitro transcription, where the 5' cap can be co-transcriptionally expressed onto the RNA strand or post-transcriptionally attached to the RNA using a capping enzyme. In some embodiments, co-transcriptional capping with a disclosed cap improves the capping efficiency of the RNA compared to co-transcriptional capping with an appropriate reference comparator. In some embodiments, improving capping efficiency can improve the translation efficiency and / or translation rate of the RNA and / or increase expression of the encoded polypeptide. In some embodiments, modifications to the polynucleotide result in a non-hydrolyzable cap structure, which can, for example, prevent decapping and extend RNA half-life.

[0139] In some embodiments, the 5' cap utilized is a cap0 structure, a cap1 structure, or a cap2 structure. See, e.g., Figure 1 of Ramanathan A et al. and Figure 1 of Decroly E et al., each of which is incorporated herein by reference in its entirety. See, e.g., Figure 1 of Ramanathan A et al. and Figure 1 of Decroly E et al., each of which is incorporated herein by reference in its entirety. In some embodiments, the RNA described herein comprises a cap1 structure. In some embodiments, the RNA described herein comprises a cap2 structure.

[0140] In some embodiments, the RNA described herein comprises a cap0 structure. In some embodiments, the cap0 structure comprises a guanosine nucleoside methylated at the 7-position of the guanine ((m 7 In some embodiments, such cap structures are attached to the RNA via a 5' to 5' triphosphate bond, herein referred to as (m 7 )Gppp. In some embodiments, the cap structure comprises a guanosine nucleoside methylated at the 2' position of the ribose of the guanosine. In some embodiments, the cap structure comprises a guanosine nucleoside methylated at the 3' position of the ribose of the guanosine. In some embodiments, the guanosine nucleoside contained within the 5' cap comprises methylation at the 7' position of the guanine and the 2' position of the ribose ((m2 7,2’-O In some embodiments, the guanosine nucleoside contained within the 5' cap comprises methylation at the 7-position of the guanine and the 2'-position of the ribose ((m2 7,3’-O )G).

[0141] In some embodiments, the cap1 structure comprises a guanosine nucleoside ((m)) methylated at the 7-position of the guanine and optionally methylated at the 2' or 3' position of the ribose. 7 )G), and the 2'O-methylated first nucleotide in the RNA ((m 2’-O In some embodiments, the cap1 structure comprises a guanine at position 7 ((m 7 )G) and guanosine nucleosides in which the 3' position of the ribose is methylated, and the first nucleoside in RNA that is 2'O-methylated ((m 2’-O In some embodiments, the cap1 structure is connected to the RNA via a 5'-5' triphosphate linkage, herein referred to as ((m 7 )Gppp( 2’-O )N1) or (m2 7,3’-O )Gppp( 2’-O )N1), where N1 is as defined and described herein. In some embodiments, the cap1 structure includes a second nucleotide N2 at the second position that is selected from A, G, C, or U, e.g., (m 7 )Gppp( 2’-O )N1pN2, or (m2 7,3’-O )Gppp( 2’-O )N1pN2, where each of N1 and N2 is as defined and described herein.

[0142] In some embodiments, the cap2 structure is methylated at the 7th position of the guanine ((m 7 )G), as well as guanosine nucleosides optionally methylated at the 2' or 3' position of the ribose, and the first and second nucleotides in RNA that are 2'O-methylated ((m 2’-O )N1p(m 2’-O In some embodiments, the cap2 structure comprises a guanine at position 7 ((m 7 )G) and a guanosine nucleoside methylated at the 3' position of the ribose, and the first and second nucleotides in the RNA are 2'O-methylated. In some embodiments, the cap2 structure is linked to the RNA via a 5' to 5' triphosphate linkage, and is referred to herein, for example, as ((m 7 )Gppp( 2’-O )N1p( 2’-O )N2), or (m27,3’-O )Gppp( 2’-O )N1p( 2’-O )N2), where each of N1 and N2 is as defined and described herein.

[0143] In some embodiments, the 5' cap is a dinucleotide cap structure. In some embodiments, the 5' cap is a dinucleotide cap structure comprising N1, where N1 is as defined and described herein. In some embodiments, the 5' cap is a dinucleotide cap G*N1, where N1 is as defined above and herein, and G* is a structure of formula (I):

[0144] [ka]

[0145] (I)

[0146] or a salt thereof,

[0147] In the formula, each R 2 and R 3 is -OH or -OCH3, and X is O or S.

[0148] In some embodiments, R 2 is —OH. In some embodiments, R 2 is —OCH. In some embodiments, R 3 is —OH. In some embodiments, R 3 is —OCH. In some embodiments, R 2 is -OH and R 3 is —OH. In some embodiments, R 2 is OH and R 3 is —CH3. In some embodiments, R 2 is -CH3 and R 3 is —OH. In some embodiments, R 2is -CH3 and R 3 is -CH3.

[0149] In some embodiments, X is O. In some embodiments, X is S.

[0150] In some embodiments, the 5' cap is a dinucleotide cap structure (e.g., (m 7 )GpppN1, (m2 7,2’-O )GpppN1, (m2 7,3’-O )GpppN1, (m 7 )GppSpN1, (m2 7,2’-O )GppSpN1, or (m2 7,3’-O )GppSpN1), where N1 is as defined and described herein. In some embodiments, the 5' cap is a dinucleotide cap0 structure (e.g., (m 7 )GpppN1, (m2 7,2’-O )GpppN1, (m2 7,3’-O )GpppN1, (m 7 )GppSpN1, (m2 7,2’-O )GppSpN1, or (m2 7,3’-O )GppSpN1), where N1 is G. In some embodiments, the 5' cap is a dinucleotide cap0 structure (e.g., (m 7 )GpppN1, or (m2 7,2’-O )GpppN1, (m2 7,3’-O )GpppN1, (m 7 )GppSpN1, (m2 7,2’-O )GppSpN1, or (m2 7,3’-O )GppSpN1), where N1 is A, U, or C. In some embodiments, the 5' cap is a dinucleotide cap1 structure (e.g., (m 7 )Gppp(m 2’-O )N1, (m2 7,2’-O )Gppp(m 2’-O )N1, (m2 7,3’-O )Gppp(m 2’-O )N1, (m 7 )GppSp(m 2’-O )N1, (m2 7,2’-O)GppSp(m 2’-O )N1, or (m2 7,3’-O )GppSp(m 2’-O )N1, where N1 is as defined and described herein. In some embodiments, the 5' cap is (m 7 )GpppG("Ecap0"), (m 7 )Gppp(m 2’-O )G("Ecap1"), (m2 7,3’-O ) GpppG ("ARCA" or "D1"), and (m2 7,2’-O ) GppSpG (“β-S-ARCA”). In some embodiments, the 5′ cap has the following structure: 7 )GpppG("Ecap0") or

[0151] [ka]

[0152] or a salt thereof.

[0153] In some embodiments, the 5' cap has the following structure: 7 )Gppp(m 2’-O )G("Ecap1") or

[0154] [ka]

[0155] or a salt thereof.

[0156] In some embodiments, the 5' cap has the following structure: 7,3’-O ) GpppG ("ARCA" or "D1"),

[0157] [ka]

[0158] or a salt thereof.

[0159] In some embodiments, the 5' cap has the following structure: 7,2’-O ) GppSpG ("β-S-ARCA"),

[0160] [ka]

[0161] or a salt thereof.

[0162] In some embodiments, the 5' cap is a trinucleotide cap structure. In some embodiments, the 5' cap is a trinucleotide cap structure comprising N1pN2, where N1 and N2 are as defined and described herein. In some embodiments, the 5' cap is a dinucleotide cap G*N1pN2, where N1 and N2 are as defined above and herein, and G* is a structure of formula (I):

[0163] [ka]

[0164] (I)

[0165] or a salt thereof, wherein R 2 , R 3 and X are as defined and described herein.

[0166] In some embodiments, the 5' cap is a trinucleotide cap structure (e.g., (m 7 )GpppN1pN2, (m2 7,2’-O )GpppN1pN2, or (m2 7,3’-O )GpppN1pN2), where N1 and N2 are as defined and described herein. In some embodiments, the 5' cap is a trinucleotide cap1 structure (e.g., (m7 )Gppp(m 2’-O )N1pN2, (m2 7,2’-O )Gppp(m 2’-O )N1pN2, (m2 7,3’-O )Gppp(m 2’-O )N1pN2), where N1 and N2 are as defined and described herein. In some embodiments, the 5' cap is a trinucleotide cap2 structure (e.g., (m 7 )Gppp(m 2’-O )N1p(m 2’-O )N2, (m2 7,2’-O )Gppp(m 2’-O )N1p(m 2’-O )N2, (m2 7,3’-O )Gppp(m 2’-O )N1p(m 2’-O )N2), where N1 and N2 are as defined and described herein. In some embodiments, the 5' cap is (m2 7,3’-O )Gppp(m 2’-O )ApG("CleanCap AG", "CC413"), (m2 7,3’-O )Gppp(m 2’-O )GpG("CleanCap GG"), (m 7 )Gppp(m 2’-O )ApG, (m 7 )Gppp(m 2’-O )GpG, (m2 7,3’-O )Gppp(m2 6,2’-O ) ApG, and (m 7 )Gppp(m 2’-O )ApU.

[0167] In some embodiments, the 5' cap has the following structure: 7,3’-O )Gppp(m 2’-O ) ApG("CleanCap AG", "CC413") or

[0168] [ka]

[0169] or a salt thereof.

[0170] In some embodiments, the 5' cap has the following structure: 7,3’-O )Gppp(m 2’-O ) GpG ("CleanCap GG"), or

[0171] [ka]

[0172] or a salt thereof.

[0173] In some embodiments, the 5' cap has the following structure: 7 )Gppp(m 2’-O )ApG or

[0174] [ka]

[0175] or a salt thereof.

[0176] In some embodiments, the 5' cap has the following structure: 7 )Gppp(m 2’-O )GpG or

[0177] [ka]

[0178] or a salt thereof.

[0179] In some embodiments, the 5' cap has the following structure: 7,3’-O )Gppp(m2 6,2’-O )ApG or

[0180] [ka]

[0181] or a salt thereof.

[0182] In some embodiments, the 5' cap has the following structure: 7 )Gppp(m 2’-O )ApU or

[0183] [ka]

[0184] or a salt thereof.

[0185] In some embodiments, the 5' cap is a tetranucleotide cap structure. In some embodiments, the 5' cap is a tetranucleotide cap structure comprising N1pN2pN3, where N1, N2, and N3 are as defined and described herein. In some embodiments, the 5' cap is a tetranucleotide cap G*N1pN2pN3, where N1, N2, and N3 are as defined above and herein, and G* is a structure of formula (I):

[0186] [ka]

[0187] (I)

[0188] or a salt thereof, wherein R 2 , R 3 and X are as defined and described herein.

[0189] In some embodiments, the 5' cap is a tetranucleotide cap structure (e.g., (m 7 )GpppN1pN2pN3, (m2 7,2’-O )GpppN1pN2pN3, or (m2 7,3’-O)GpppN1N2pN3), where N1, N2, and N3 are as defined and described herein. In some embodiments, the 5' cap is a tetranucleotide Cap1 structure (e.g., (m 7 )Gppp(m 2’-O )N1pN2pN3, (m2 7,2’-O )Gppp(m 2’-O )N1pN2pN3, (m2 7,3’-O )Gppp(m 2’-O )N1pN2N3), where N1, N2, and N3 are as defined and described herein. In some embodiments, the 5' cap is a tetranucleotide Cap2 structure (e.g., (m 7 )Gppp(m 2’-O )N1p(m 2’-O )N2pN3, (m2 7,2’-O )Gppp(m 2’-O )N1p(m 2’-O )N2pN3, (m2 7,3’-O )Gppp(m 2’-O )N1p(m 2’-O )N2pN3), where N1, N2, and N3 are as defined and described herein. In some embodiments, the 5' cap is (m2 7,3’-O )Gppp(m 2’-O )Ap(m 2’-O )GpG, (m2 7,3’-O )Gppp(m 2’-O )Gp(m 2’-O ) GpC, (m 7 )Gppp(m 2’-O )Ap(m 2’-O )UpA, and (m 7 )Gppp(m 2’-O )Ap(m 2’-O ) GpG.

[0190] In some embodiments, the 5' cap has the following structure: 7,3’-O )Gppp(m 2’-O )Ap(m 2’-O )GpG or

[0191] [ka]

[0192] or a salt thereof.

[0193] In some embodiments, the 5' cap has the following structure: 7,3’-O )Gppp(m 2’-O )Gp(m 2’-O ) GpC or

[0194] [ka]

[0195] or a salt thereof.

[0196] In some embodiments, the 5' cap has the following structure: 7 )Gppp(m 2’-O )Ap(m 2’-O ) UpA or

[0197] [ka]

[0198] or a salt thereof.

[0199] In some embodiments, the 5' cap has the following structure: 7 )Gppp(m 2’-O )Ap(m 2’-O )GpG or

[0200] [ka]

[0201] or a salt thereof.

[0202] 2. Cap-proximal Sequencing In some embodiments, a 5' UTR utilized in accordance with the present disclosure comprises a cap-proximal sequence, e.g., as disclosed herein. In some embodiments, the cap-proximal sequence comprises a sequence adjacent to the 5' cap. In some embodiments, the cap-proximal sequence comprises a nucleotide at position +1, +2, +3, +4, and / or +5 of the RNA polynucleotide.

[0203] In some embodiments, the cap structure comprises one or more polynucleotides of the cap-proximal sequence. 7 In some embodiments, the cap structure comprises a guanosine cap and nucleotide +1 (N1) of the RNA polynucleotide. 7 In some embodiments, the cap structure comprises a guanosine cap and nucleotide +2 (N2) of the RNA polynucleotide. 7 The cap structure comprises a guanosine cap and nucleotides +1 and +2 (N1 and N2) of an RNA polynucleotide. In some embodiments, the cap structure comprises a 7 It includes the guanosine cap and nucleotides +1, +2, and +3 (N1, N2, and N3) of the RNA polynucleotide.

[0204] Those skilled in the art will understand, upon reading this disclosure, that in some embodiments, one or more residues of the cap-proximal sequence (e.g., one or more of residues +1, +2, +3, +4, and / or +5) may be included in the RNA by being included in a cap entity (e.g., a cap1 or cap2 structure); alternatively, in some embodiments, at least a portion of the residues in the cap-proximal sequence may be added enzymatically (e.g., by a polymerase such as T7 polymerase). For example, m2 7,3’-O Gppp(m1 2’-O In certain exemplary embodiments where an ApG cap is utilized, +1 (i.e., N1) and +2 (i.e., N2) are the (m1 2’-O) A and G residues, and +3, +4, and +5 are added by a polymerase (e.g., T7 polymerase).

[0205] In some embodiments, the 5' cap is a dinucleotide cap structure and the cap-proximal sequence comprises 5' cap N1, where N1 is any nucleotide, e.g., A, C, G, or U. In some embodiments, the 5' cap is a trinucleotide cap structure (e.g., a trinucleotide cap structure described above and herein) and the cap-proximal sequence comprises 5' cap N1 and N2, where N1 and N2 are independently any nucleotide, e.g., A, C, G, or U. In some embodiments, the 5' cap is a tetranucleotide cap structure (e.g., a trinucleotide cap structure described above and herein) and the cap-proximal sequence comprises 5' cap N1, N2, and N3, where N1, N2, and N3 are any nucleotide, e.g., A, C, G, or U.

[0206] In some embodiments, for example, the 5' cap is a dinucleotide cap structure and the cap-proximal sequence includes N1, and N2, N3, N4, and N5 of the 5' cap, where N1-N5 correspond to positions +1, +2, +3, +4, and / or +5 of the RNA polynucleotide. In some embodiments, for example, the 5' cap is a trinucleotide cap structure and the cap-proximal sequence includes N1 and N2, and N3, N4, and N5 of the 5' cap, where N1-N5 correspond to positions +1, +2, +3, +4, and / or +5 of the RNA polynucleotide. In some embodiments, for example, the 5' cap is a tetranucleotide cap structure and the cap-proximal sequence includes N1, N2, and N3, and N4 and N5 of the 5' cap, where N1-N5 correspond to positions +1, +2, +3, +4, and / or +5 of the RNA polynucleotide.

[0207] In some embodiments, N1 is A. In some embodiments, N1 is C. In some embodiments, N1 is G. In some embodiments, N1 is U. In some embodiments, N2 is A. In some embodiments, N2 is C. In some embodiments, N2 is G. In some embodiments, N2 is U. In some embodiments, N3 is A. In some embodiments, N3 is C. In some embodiments, N3 is G. In some embodiments, N3 is U. In some embodiments, N4 is A. In some embodiments, N4 is C. In some embodiments, N4 is G. In some embodiments, N4 is U. In some embodiments, N5 is A. In some embodiments, N5 is C. In some embodiments, N5 is G. In some embodiments, N5 is U. It should be understood that each of the embodiments (e.g., for N1-N5) described above and herein can be used alone or in combination, and / or can be combined with other embodiments of the modifications (e.g., 5' cap) described above and herein.

[0208] In some embodiments, the cap-proximal sequence comprises A1 and G2 of the Cap1 structure and further comprises a sequence comprising A3A4U5 (SEQ ID NO: 150) at positions +3, +4, and +5 of the polyribonucleotide, respectively.

[0209] 3.5'UTR In some embodiments, the nucleic acid (e.g., DNA, RNA) utilized in accordance with the present disclosure comprises a 5'-UTR. In some embodiments, the 5'-UTR may comprise multiple distinct sequence elements, and in some embodiments, such multiple sequence elements may be or comprise multiple copies of one or more specific sequence elements (e.g., may be derived from a particular source or may otherwise be known as functional or characteristic sequence elements). In some embodiments, the 5'-UTR comprises multiple distinct sequence elements.

[0210] The term "untranslated region" or "UTR" is commonly used in the art to refer to a region of a DNA molecule that is transcribed but not translated into an amino acid sequence, or to the corresponding region of an RNA polynucleotide (e.g., an RNA molecule). An untranslated region (UTR) can be located 5' (upstream) of an open reading frame (5'-UTR) and / or 3' (downstream) of an open reading frame (3'-UTR). As used herein, the term "5 prime untranslated region" or "5'UTR" refers to a sequence of polyribonucleotides between the 5' end of a polyribonucleotide (e.g., a transcription start site) and the start codon of the coding region of the polyribonucleotide. In some embodiments, "5'UTR" refers to a sequence of polyribonucleotides that, e.g., in its natural context, begins at the 5' end of a polyribonucleotide (e.g., a transcription start site) and ends one nucleotide (nt) before the start codon (usually AUG) of the coding region of the polyribonucleotide. In some embodiments, the 5'UTR comprises a Kozak sequence. A 5'-UTR is downstream of a 5' cap (if present), e.g., immediately adjacent to the 5' cap. In some embodiments, a 5' UTR disclosed herein comprises a cap-proximal sequence (e.g., as defined and described herein). In some embodiments, the cap-proximal sequence comprises a sequence adjacent to the 5' cap.

[0211] Exemplary 5'UTRs include human alpha globin (hAg) 5'UTR or a fragment thereof, TEV 5'UTR or a fragment thereof, HSP70 5'UTR or a fragment thereof, or c-Jun 5'UTR or a fragment thereof.

[0212] In some embodiments, the RNA disclosed herein comprises the hAg 5'UTR or a fragment thereof.

[0213] In some embodiments, the RNA disclosed herein comprises a 5'UTR that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a 5'UTR having the sequence AGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACC (SEQ ID NO: 151). In some embodiments, the RNA disclosed herein comprises a 5'UTR having the sequence AGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACC (SEQ ID NO: 151).

[0214] In some embodiments, the RNA disclosed herein comprises a 5'UTR that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a 5'UTR having the sequence AACUAGUAUUCUUCUGGUCCCCACAGACUCAGAGAGAACCCGCCACC (SEQ ID NO: 152) (hAg-Kozak / 5'UTR). In some embodiments, the RNA disclosed herein comprises a 5'UTR having the sequence AACUAGUAUUCUUCUGGUCCCCACAGACUCAGAGAGAACCCGCCACC (SEQ ID NO: 152) (hAg-Kozak / 5'UTR).

[0215] 4. PolyA tail In some embodiments, a polynucleotide (e.g., DNA, RNA) disclosed herein comprises a polyadenylic acid (polyA) sequence, e.g., as described herein. In some embodiments, the polyA sequence is located downstream of the 3'-UTR, e.g., adjacent to the 3'-UTR.

[0216] As used herein, the term "poly(A) sequence" or "poly(A tail)" refers to an uninterrupted or interrupted sequence of adenylate residues typically located at the 3' end of an RNA polynucleotide. Poly(A) sequences are known to those skilled in the art and may follow the 3'-UTR in the RNAs described herein. A continuous poly(A) sequence is characterized by consecutive adenylate residues. Continuous poly(A) sequences are typical in nature. In some embodiments, the polynucleotides disclosed herein comprise a continuous poly(A) sequence. In some embodiments, the polynucleotides disclosed herein comprise interrupted poly(A) sequences. In some embodiments, the RNAs disclosed herein may have a poly(A) sequence attached to the free 3' end of the RNA by a template-independent RNA polymerase after transcription, or a poly(A) sequence encoded by DNA and transcribed by a template-dependent RNA polymerase.

[0217] Poly(A) sequences of approximately 120 A nucleotides have been shown to have a beneficial effect on RNA levels in transfected eukaryotic cells, as well as on the levels of proteins translated from open reading frames located upstream (5') of the poly(A) sequence (Holtkamp et al., 2006, Blood, vol. 108, pp. 4009-4017, incorporated herein by reference).

[0218] In some embodiments, poly(A) sequences according to the present disclosure are not limited to a particular length, and in some embodiments, the poly(A) sequence can be any length. In some embodiments, the poly(A) sequence comprises, consists essentially of, or consists of at least 20, at least 30, at least 40, at least 80, or at least 100 A nucleotides, and no more than 500, 400, 300, 200, or 150 A nucleotides, particularly about 120 A nucleotides. In this context, "consisting essentially of" means that most nucleotides in the poly(A) sequence, typically at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% by number of nucleotides in the poly(A) sequence, are A nucleotides, while allowing for the remaining nucleotides to be nucleotides other than A nucleotides, such as U nucleotides (uridylic acid), G nucleotides (guanylic acid), or C nucleotides (cytidylic acid). In this context, "consisting of" means that all nucleotides in the poly(A) sequence, i.e., 100% of the number of nucleotides in the poly(A) sequence, are A nucleotides. The term "A nucleotide" or "A" refers to adenylic acid.

[0219] In some embodiments, poly(A) sequences are attached during RNA transcription, e.g., during preparation of in vitro transcribed RNA, based on a DNA template containing repetitive dT nucleotides (deoxythymidylic acid) in the strand complementary to the coding strand. The DNA sequence encoding the poly(A) sequence (coding strand) is referred to as a poly(A) cassette.

[0220] In some embodiments, the poly(A) cassette present in the coding strand of DNA consists essentially of dA nucleotides, interrupted by a random sequence of four nucleotides (dA, dC, dG, and dT). Such a random sequence can be 5-50, 10-30, or 10-20 nucleotides in length. Such cassettes are disclosed in WO2016 / 005324A1, which is incorporated herein by reference in its entirety. Any of the poly(A) cassettes disclosed in WO2016 / 005324A1, which is incorporated herein by reference in its entirety, may be used in accordance with the present disclosure. Poly(A) cassettes consisting essentially of dA nucleotides but interrupted by random sequences with an equal distribution of the four nucleotides (dA, dC, dG, dT) and lengths of, for example, 5-50 nucleotides, exhibit consistent propagation of plasmid DNA in E. coli at the DNA level, yet are associated with beneficial properties at the RNA level related to support of RNA stability and translation efficiency. In some embodiments, the poly(A) sequences contained in the RNA polynucleotides described herein consist essentially of A nucleotides but are interrupted by random sequences of the four nucleotides (A, C, G, U). Such random sequences can be 5-50, 10-30, or 10-20 nucleotides in length.

[0221] In some embodiments, no nucleotides other than A nucleotides flank the poly(A) sequence at its 3' end, i.e., the poly(A) sequence is not masked by or followed by a nucleotide other than A at its 3' end.

[0222] In some embodiments, the poly(A) sequence may comprise at least 20, at least 30, at least 40, at least 80, or at least 100 nucleotides and no more than 500, 400, 300, 200, or 150 nucleotides. In some embodiments, the poly(A) sequence may consist essentially of at least 20, at least 30, at least 40, at least 80, or at least 100 nucleotides and no more than 500, 400, 300, 200, or 150 nucleotides. In some embodiments, the poly(A) sequence may consist of at least 20, at least 30, at least 40, at least 80, or at least 100 nucleotides and no more than 500, 400, 300, 200, or 150 nucleotides. In some embodiments, the poly(A) sequence comprises at least 100 nucleotides. In some embodiments, the poly(A) sequence comprises about 150 nucleotides. In some embodiments, the poly(A) sequence comprises about 120 nucleotides.

[0223] In some embodiments, the poly-A tail comprises a particular number of adenosines, for example, about 50 or more, about 60 or more, about 70 or more, about 80 or more, about 90 or more, about 100 or more, about 120, or about 150, or about 200. In some embodiments, the poly-A tail of a concatenated construct may comprise 200 or fewer A residues. In some embodiments, the poly-A tail of a sequence construct may comprise about 200 A residues. In some embodiments, the poly-A tail of a sequence construct may comprise 180 or fewer A residues. In some embodiments, the poly-A tail of a sequence construct may comprise about 180 A residues. In some embodiments, the poly-A tail may comprise 150 or fewer residues.

[0224] In some embodiments, the RNA comprises a poly(A) sequence comprising the nucleotide sequence AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCATATGACTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO: 153), or a nucleotide sequence that is at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identical to AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCATATGACTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO: 153). In some embodiments, the poly(A) tail comprises multiple A residues interrupted by a linker. In some embodiments, the linker comprises the nucleotide sequence GCATATGAC (SEQ ID NO: 154).

[0225] In some embodiments, the RNA comprises a poly(A) sequence comprising the nucleotide sequence AAAAAAAAAAAAAAAAAAAAAAAAAAAGCAUAUGACUAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO: 155), or a nucleotide sequence that is at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identical to the nucleotide sequence AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCAUAUGACUAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO: 155). In some embodiments, the poly(A) tail comprises multiple A residues interrupted by a linker. In some embodiments, the linker comprises the nucleotide sequence GCAUAUGAC (SEQ ID NO: 156).

[0226] 5.3'UTR In some embodiments, the RNA utilized in accordance with the present disclosure comprises a 3'-UTR. As used herein, the term "three prime untranslated region," "3' untranslated region," or "3'UTR" refers to the sequence of an RNA molecule that begins after the stop codon of the coding region of an open reading frame sequence. In some embodiments, the 3'UTR begins immediately after the stop codon of the coding region of an open reading frame sequence, for example, in its natural context. In other embodiments, the 3'UTR does not begin immediately after the stop codon of the coding region of an open reading frame sequence, for example, in its natural context. The term "3'UTR" preferably does not include a poly(A) sequence. Thus, the 3'UTR is upstream of the poly(A) sequence (if present), for example, immediately adjacent to the poly(A) sequence.

[0227] In some embodiments, the RNA disclosed herein comprises a 3'UTR comprising an F element and / or an I element. In some embodiments, the 3'UTR or a sequence proximal thereto comprises a restriction site. In some embodiments, the restriction site is a BamHI site. In some embodiments, the restriction site is a XhoI site.

[0228] In some embodiments, the RNA construct comprises an F element. In some embodiments, the F element sequence is the 3'-UTR of the amino-enhancer (AES) of the split.

[0229] In some embodiments, an RNA disclosed herein comprises a 3'UTR that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a 3'UTR having the sequence of CTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACC (SEQ ID NO: 157). In some embodiments, an RNA disclosed herein comprises a 3'UTR having the sequence of CTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACC (SEQ ID NO: 157).

[0230] In some embodiments, an RNA disclosed herein comprises a 3'UTR that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a 3'UTR having the sequence of CUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCUCCCCCGACCUCGGGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCCAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACC (SEQ ID NO: 158). In some embodiments, an RNA disclosed herein comprises a 3'UTR having the sequence of CUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCUCCCCCGACCUCGGGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCCAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACC (SEQ ID NO: 158).

[0231] In some embodiments, the 3'UTR is an FI element as described in WO2017 / 060314, which is incorporated by reference in its entirety.

[0232] B.RNA form At least three distinct forms useful for RNA compositions (e.g., pharmaceutical compositions) have been developed: unmodified uridine containing RNA (uRNA), nucleoside-modified RNA (modRNA), and self-amplifying RNA (saRNA). Each of these platforms exhibits unique characteristics. Typically, in all three formats, the RNA is capped and contains an open reading frame (ORF) flanked by untranslated regions (UTRs), with a polyA tail at the 3' end. The ORFs of uRNA and modRNA vectors encode antibody agents or fragments thereof. saRNA contains multiple ORFs.

[0233] In some embodiments, the RNA described herein can have modified nucleosides. In some embodiments, the RNA includes a modified nucleoside in place of at least one (e.g., all) uridines.

[0234] As used herein, the term "uracil" refers to one of the nucleobases that can be present in RNA nucleic acids. The structure of uracil is as follows:

[0235] [ka] is.

[0236] As used herein, the term "uridine" refers to one of the nucleosides that can occur in RNA. The structure of uridine is as follows:

[0237] [ka] is.

[0238] UTP (uridine 5' triphosphate) has the following structure:

[0239] [ka]

[0240] Pseudo-UTP (pseudouridine 5'-triphosphate) has the following structure:

[0241] [ka]

[0242] "Pseudouridine" is an example of a modified nucleoside that is an isomer of uridine in which uracil is attached to the pentose ring via a carbon-carbon bond instead of a nitrogen-carbon glycosidic bond.

[0243] Another exemplary modified nucleoside is N1-methyl-pseudouridine (m1Ψ), which has the following structure:

[0244] [ka]

[0245] N1-methyl-pseudo-UTP has the following structure:

[0246] [ka]

[0247] Another exemplary modified nucleoside is 5-methyl-uridine (m5U), which has the structure:

[0248] [ka] It has.

[0249] In some embodiments, one or more uridines in the RNA described herein are replaced with a modified nucleoside, hi some embodiments, the modified nucleoside is a modified uridine.

[0250] In some embodiments, the RNA comprises a modified nucleoside in place of at least one uridine. In some embodiments, the RNA comprises a modified nucleoside in place of each uridine.

[0251] In some embodiments, the modified nucleosides are independently selected from pseudouridine (ψ), N1-methyl-pseudouridine (m1ψ), and 5-methyl-uridine (m5U). In some embodiments, the modified nucleoside comprises pseudouridine (ψ). In some embodiments, the modified nucleoside comprises N1-methyl-pseudouridine (m1ψ). In some embodiments, the modified nucleoside comprises 5-methyl-uridine (m5U). In some embodiments, the RNA may comprise more than one modified nucleoside, wherein the modified nucleosides are independently selected from pseudouridine (ψ), N1-methyl-pseudouridine (m1ψ), and 5-methyl-uridine (m5U). In some embodiments, the modified nucleoside comprises pseudouridine (ψ) and N1-methyl-pseudouridine (m1ψ). In some embodiments, modified nucleosides include pseudouridine (ψ) and 5-methyl-uridine (m5U). In some embodiments, modified nucleosides include N1-methyl-pseudouridine (m1ψ) and 5-methyl-uridine (m5U). In some embodiments, modified nucleosides include pseudouridine (ψ), N1-methyl-pseudouridine (m1ψ), and 5-methyl-uridine (m5U).

[0252] In some embodiments, the modified nucleoside replacing one or more, e.g., all, uridines in the RNA is 3-methyl-uridine (m3U), 5-methoxy-uridine (mo5U), 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s2U), 4-thio-uridine (s4U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine (ho5U), 5-aminoallyl-uridine, 5-halo-uridine (e.g., 5-iodo-uridine, or 5-bromo-uridine). uridine), uridine 5-oxyacetic acid (cmo5U), uridine 5-oxyacetic acid methyl ester (mcmo5U), 5-carboxymethyl-uridine (cm5U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine (chm5U), 5-carboxyhydroxymethyl-uridine methyl ester (mchm5U), 5-methoxycarbonylmethyl-uridine (mcm5U), 5-methoxycarbonylmethyl-2-thio-uridine (mcm5s2U), 5-aminomethyl-2-thio-uridine (nm5s2U), 5-methyl 5-methylaminomethyl-uridine (mnm5U), 1-ethyl-pseudouridine, 5-methylaminomethyl-2-thio-uridine (mnm5s2U), 5-methylaminomethyl-2-seleno-uridine (mnm5se2U), 5-carbamoylmethyl-uridine (ncm5U), 5-carboxymethylaminomethyl-uridine (cmnm5U), 5-carboxymethylaminomethyl-2-thio-uridine (cmnm5s2U), 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyl-uridine (mnm5U), 1-taurinomethyl-uridine (mnm5s2U), tir-pseudouridine, 5-taurinomethyl-2-thio-uridine (τm5s2U), 1-taurinomethyl-4-thio-pseudouridine), 5-methyl-2-thio-uridine (m5s2U), 1-methyl-4-thio-pseudouridine (m1s4ψ), 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine (m3ψ), 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine (D), dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine (m5D), 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine (acp3U), 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine (acp3ψ), 5-(isopentenylaminomethyl)uridine (inm5U), 5-(isopentenylaminomethyl)-2-thio-uridine (inm5s2U), α-thio-uridine, 2'-O-methyl-uridine (Um), 5,2'-O-dimethyl-uridine (m5Um), 2'-O-methyl-pseudouridine The modified uridine may be any one or more of uridine (ψm), 2-thio-2'-O-methyl-uridine (s2Um), 5-methoxycarbonylmethyl-2'-O-methyl-uridine (mcm5Um), 5-carbamoylmethyl-2'-O-methyl-uridine (ncm5Um), 5-carboxymethylaminomethyl-2'-O-methyl-uridine (cmnm5Um), 3,2'-O-dimethyl-uridine (m3Um), 5-(isopentenylaminomethyl)-2'-O-methyl-uridine (inm5Um), 1-thio-uridine, deoxythymidine, 2'-F-ara-uridine, 2'-F-uridine, 2'-OH-ara-uridine, 5-(2-carbomethoxyvinyl)uridine, 5-[3-(1-E-propenylamino)uridine, or any other modified uridine known in the art.

[0253] In some embodiments, the RNA includes other modified nucleosides or additional modified nucleosides, such as modified cytidines. For example, in some embodiments, 5-methylcytidine is substituted for some or all, preferably all, of the cytidines in the RNA. In some embodiments, the RNA includes 5-methylcytidine and one or more selected from pseudouridine (ψ), N1-methyl-pseudouridine (m1ψ), and 5-methyl-uridine (m5U). In some embodiments, the RNA includes 5-methylcytidine and N1-methyl-pseudouridine (m1ψ). In some embodiments, the RNA includes 5-methylcytidine in place of each cytidine and N1-methyl-pseudouridine (m1ψ) in place of each uridine.

[0254] In some embodiments of the present disclosure, the RNA is a "replicon RNA" or simply a "replicon," particularly a "self-replicating RNA" or "self-amplifying RNA." In one particularly preferred embodiment, the replicon or self-replicating RNA is derived from or includes elements derived from a single-stranded (ss) RNA virus, particularly a positive-sense ssRNA virus, such as an alphavirus. Alphaviruses are a typical example of a positive-sense RNA virus. Alphaviruses replicate in the cytoplasm of infected cells (for a discussion of the alphavirus life cycle, see Jose et al., Future Microbiol., 2009, vol. 4, pp. 837-856, incorporated herein by reference in its entirety). The total genome length of many alphaviruses typically ranges from 11,000 to 12,000 nucleotides, and the genomic RNA typically has a 5' cap and a 3' poly(A) tail. The genome of an alphavirus encodes nonstructural proteins (involved in viral RNA transcription, modification, and replication, as well as protein modification) and structural proteins (which form the virus particle). The genome typically contains two open reading frames (ORFs). The four nonstructural proteins (nsP1 through nsP4) are typically co-encoded by the first ORF, which begins near the 5' end of the genome, while the structural proteins of alphaviruses are co-encoded by the second ORF, which is downstream of the first ORF and extends toward the 3' end of the genome. The first ORF is typically larger than the second ORF, with a ratio of approximately 2:1. In cells infected with alphaviruses, only the nucleic acid sequences encoding the nonstructural proteins are translated from the genomic RNA, while the genetic information encoding the structural proteins can be translated from subgenomic transcripts, which are RNA molecules similar to eukaryotic messenger RNA (mRNA; Gould et al., 2010, Antiviral Res., vol. 87 pp. 111-124, incorporated herein by reference in its entirety). After infection, i.e., early in the viral life cycle, the (+)-strand genomic RNA acts directly like messenger RNA to translate the open reading frame encoding the nonstructural polyprotein (nsP1234).

[0255] Alphavirus-derived vectors have been proposed for delivering foreign genetic information to target cells or organisms. In a simple approach, a first ORF encodes an alphavirus-derived RNA-dependent RNA polymerase (replicase), which, upon translation, mediates RNA self-amplification. A second ORF, encoding alphavirus structural proteins, is replaced by an open reading frame encoding the HSV-2 construct described herein. Alphavirus-based trans-replication systems rely on alphavirus nucleotide sequence elements carried on two separate nucleic acid molecules: one encoding the viral replicase and the other capable of being replicated in trans by the replicase (hence the term trans-replication system). Trans-replication requires the presence of both of these nucleic acid molecules in a particular host cell. A nucleic acid molecule capable of being replicated in trans by the replicase must contain specific alphavirus sequence elements to enable recognition by the alphavirus replicase and RNA synthesis.

[0256] Characteristics of the unmodified uridine platform may include, for example, one or more of an inherent adjuvant effect and good tolerability and safety. Characteristics of the modified uridine (e.g., pseudouridine) platform may include a reduced adjuvant effect, a blunted immune innate immune sensor activation ability, and therefore good tolerability and safety. Characteristics of the self-amplifying platform may include, for example, a long duration of protein expression, good tolerability and safety, and a higher likelihood of achieving efficacy with a very low vaccine dose.

[0257] The present disclosure provides specific RNA constructs that are optimized for, e.g., improved manufacturability, packaging, level (and / or timing) of expression, etc. Specific components are described below, and certain preferred embodiments are exemplified herein.

[0258] C. Codon optimization and GC enrichment As used herein, the term "codon optimization" refers to the modification of codons in the coding region of a nucleic acid molecule (e.g., a polyribonucleotide) to reflect the typical codon usage of a host organism (e.g., a subject receiving the nucleic acid molecule (e.g., a polyribonucleotide)), preferably without modifying the amino acid sequence encoded by the nucleic acid molecule. In the context of the present disclosure, in some embodiments, the coding region is codon-optimized to provide optimal expression in a subject treated with an RNA molecule described herein. In some embodiments, codon optimization can be performed such that frequently occurring tRNA-available codons are inserted in place of "rare codons." In some embodiments, codon optimization can include increasing the guanosine / cytosine (G / C) content of the coding region of an RNA described herein relative to the G / C content of the corresponding coding sequence of a wild-type RNA. Here, the amino acid sequence encoded by the RNA is preferably unmodified relative to the corresponding amino acid sequence.

[0259] In some embodiments, the coding sequence (also referred to as a "coding region") is codon optimized for expression in a subject (e.g., a human) to which the composition (e.g., pharmaceutical composition) is administered. Thus, in some embodiments, the sequence within such a polynucleotide (e.g., polyribonucleotide) may differ compared to the wild-type sequence encoding the relevant antigen, or fragment or epitope thereof, even when the amino acid sequence of the antigen, or fragment or epitope thereof, is wild-type.

[0260] In some embodiments, there are strategies for codon optimization for expression in a relevant subject (e.g., a human), and in some cases even strategies for codon optimization for expression in a particular cell or tissue.

[0261] Various species exhibit specific biases for specific codons for specific amino acids. Without wishing to be bound by theory, codon bias (differences in codon usage among organisms) is often correlated with the efficiency of messenger RNA (mRNA) translation, which in turn is thought to depend, inter alia, on the characteristics of the codons being translated and the availability of specific transfer RNA (tRNA) molecules. The dominance of selected tRNAs within a cell may generally reflect the codons most frequently used in peptide synthesis. Therefore, genes can be tailored for optimal gene expression in a particular organism based on codon optimization. Codon usage tables are available, for example, at the "Codon Usage Database" at www.kazusa.orjp / codon / , and these tables can be used in a variety of ways. Computer algorithms are also available for optimizing codons for specific sequences for expression in a particular subject or cell (e.g., Gene Forge (Aptagen; Jacobus, PA)).

[0262] In some embodiments, polynucleotides (e.g., polyribonucleotides) of the disclosure are codon-optimized, such that the codons in the polynucleotide (e.g., polyribonucleotide) are adapted to human codon usage (referred to herein as "human codon-optimized polynucleotides"). In some embodiments, a portion of the polyribonucleotide is codon-optimized (e.g., a portion of or encoding a glycoprotein, or a portion encoding a secretion signal). In some embodiments, the entire polyribonucleotide is codon-optimized. Codons encoding the same amino acid occur at different frequencies in a subject, e.g., a human. Thus, in some embodiments, the coding sequence of a polynucleotide of the disclosure has been modified so that the frequencies of codons encoding the same amino acid correspond to the frequencies at which the codons naturally occur according to human codon usage, e.g., as shown in Table 14. For example, for the amino acid Ala, the wild-type coding sequence is preferably adapted so that the codon "GCC" is used at a frequency of 0.40, the codon "GCT" is used at a frequency of 0.28, the codon "GCA" is used at a frequency of 0.22, and the codon "GCG" is used at a frequency of 0.10 at 30 (see Table 14). Thus, in some embodiments, such a procedure (as exemplified for Ala) is applied for each amino acid encoded by the coding sequence of the polynucleotide to obtain a sequence adapted to human codon usage. [Table 14-1] [Table 14-2]

[0263] Specific strategies for codon optimization and / or G / C enrichment for human expression are described in WO2002 / 098443 (incorporated herein by reference in its entirety). In some embodiments, coding sequences can be optimized using multiparametric optimization methods. In some embodiments, optimization parameters can include parameters that affect protein expression, which can affect, for example, the transcription level, RNA level, and / or translation level. In some embodiments, exemplary optimization parameters include, but are not limited to, transcription level parameters (e.g., including GC content, consensus splice sites, cryptic splice sites, SD sequences, TATA boxes, termination signals, artificial recombination sites, and combinations thereof), RNA level parameters (e.g., including RNA instability motifs, ribosome entry sites, repeat sequences, and combinations thereof), translation level parameters (e.g., including codon usage, premature poly(A) sites, ribosome entry sites, secondary structures, and combinations thereof), or combinations thereof. In some embodiments, optimization can be performed using the GeneOptimizer algorithm.The GeneOptimizer algorithm is described in Fath et al., "Multiparameter RNA and Codon Optimization: A Standardized Tool to Assess and Enhance Autologous Mammalian Gene Expression," PLoS ONE 6(3):e17596, incorporated herein by reference in its entirety; Rabb et al., "The GeneOptimizer Algorithm: using a sliding window approach to cope with the vast sequence space in multiparameter DNA sequence optimization," Systems and Synthetic Biology (2010) 4:215-225; and Graft et al., "Codon-optimized genes that enable increased heterologous expression in mammalian cells and elicit efficient immune responses in mice after vaccination of naked DNA," Methods Mol Med (2004) 94:197-210, the entire contents of each of which are incorporated herein for purposes described herein. In some embodiments, the coding sequence may be optimized by Eurofin's adaptation and optimization algorithm "GENEius" as described in Eurofin's application note "Eurofin's adaptation and optimization software "GENEius"" in comparison to other optimization algorithms (the entire contents of which are incorporated by reference for purposes herein).

[0264] In some embodiments, the coding sequences utilized in accordance with the present disclosure have an increased G / C content compared to the coding sequences for the HSV gC, gD, and / or gE (or fragments thereof) constructs described herein. In some embodiments, the guanosine / cytidine (G / C) content of the coding region has been altered relative to the equivalent coding sequences of the HSV gC, gD, and / or gE (or fragments thereof) constructs described herein, but the amino acid sequence encoded by the polyribonucleotide has not been altered.

[0265] Without wishing to be bound by any particular theory, it can be said that GC enrichment improves the translation of payload sequences. In general, sequences enriched in G (guanosine) / C (cytidine) are more stable than sequences enriched in A (adenosine) / U (uridine). Taking into account the fact that several codons encode the same amino acid (the so-called degeneracy of the genetic code), it is possible to determine the codons most favorable for stability (the so-called alternative codon usage). Depending on the amino acids encoded by the polyribonucleotide, there are various possibilities for modifying the ribonucleic acid sequence relative to the wild-type sequence. In particular, codons containing A and / or U nucleosides can be modified by replacing these codons with other codons encoding the same amino acids but without A and / or U or with a reduced content of A and / or U nucleosides.

[0266] In some embodiments, the G / C content of the coding region of the polyribonucleotides described herein is increased by at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, or even more compared to the G / C content of the coding region before codon optimization, e.g., the G / C content of wild-type RNA. In some embodiments, the G / C content of the coding region of the polyribonucleotides described herein is increased by at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, or even more compared to the G / C content of the coding region before codon optimization, e.g., the G / C content of wild-type RNA.

[0267] In some embodiments, the stability and translation efficiency of polyribonucleotides may incorporate one or more factors established to contribute to polyribonucleotide stability and / or translation efficiency, and exemplary such factors are described, for example, in PCT / EP2006 / 009448, which is incorporated herein by reference. In some embodiments, to increase expression of polyribonucleotides used in accordance with the present disclosure, the polyribonucleotides may be modified within the coding region, i.e., within the sequence encoding the expressed peptide or protein, without altering the sequence of the expressed peptide or protein; for example, the polyribonucleotides may be modified to increase GC content to increase mRNA stability and / or perform codon optimization, thereby enhancing translation in the cell, without altering the sequence of the expressed peptide or protein.

[0268] D. Certain Exemplary RNA Constructs In some embodiments, the polyribonucleotide provided herein encodes a polypeptide comprising an amino acid sequence according to SEQ ID NO: 65. In some embodiments, an RNA construct comprises a 5' cap, a 5' UTR, a polyribonucleotide encoding a polypeptide, wherein the polypeptide comprises an amino acid sequence according to SEQ ID NO: 65, a 3' UTR, and a poly-A tail.

[0269] In some embodiments, the polyribonucleotides provided herein encode a polypeptide comprising an amino acid sequence according to SEQ ID NO: 70. In some embodiments, an RNA construct comprises a 5' cap, a 5' UTR, a polyribonucleotide encoding a polypeptide, wherein the polypeptide comprises an amino acid sequence according to SEQ ID NO: 70, a 3' UTR, and a poly-A tail.

[0270] In some embodiments, the polyribonucleotide provided herein encodes a polypeptide comprising an amino acid sequence according to SEQ ID NO: 73. In some embodiments, an RNA construct comprises a 5' cap, a 5' UTR, a polyribonucleotide encoding a polypeptide, wherein the polypeptide comprises an amino acid sequence according to SEQ ID NO: 73, a 3' UTR, and a poly-A tail.

[0271] In some embodiments, the polyribonucleotide provided herein encodes a polypeptide comprising an amino acid sequence according to SEQ ID NO: 67. In some embodiments, an RNA construct comprises a 5' cap, a 5' UTR, a polyribonucleotide encoding a polypeptide, wherein the polypeptide comprises an amino acid sequence according to SEQ ID NO: 67, a 3' UTR, and a poly-A tail.

[0272] In some embodiments, the polyribonucleotides provided herein encode a polypeptide comprising an amino acid sequence according to SEQ ID NO: 68. In some embodiments, an RNA construct comprises a 5' cap, a 5' UTR, a polyribonucleotide encoding a polypeptide, wherein the polypeptide comprises an amino acid sequence according to SEQ ID NO: 68, a 3' UTR, and a polyA tail.

[0273] In some embodiments, the polyribonucleotides provided herein encode a polypeptide comprising an amino acid sequence according to SEQ ID NO: 75. In some embodiments, an RNA construct comprises a 5' cap, a 5' UTR, a polyribonucleotide encoding a polypeptide, wherein the polypeptide comprises an amino acid sequence according to SEQ ID NO: 75, a 3' UTR, and a polyA tail.

[0274] In some embodiments, a polyribonucleotide provided herein encodes a polypeptide comprising an amino acid sequence according to SEQ ID NO: 131. In some embodiments, an RNA construct comprises a 5' cap, a 5' UTR, a polyribonucleotide encoding a polypeptide, wherein the polypeptide comprises an amino acid sequence according to SEQ ID NO: 131, a 3' UTR, and a poly-A tail.

[0275] In some embodiments, the polyribonucleotide provided herein encodes a polypeptide comprising an amino acid sequence according to SEQ ID NO: 132. In some embodiments, an RNA construct comprises a 5' cap, a 5' UTR, a polyribonucleotide encoding a polypeptide, wherein the polypeptide comprises an amino acid sequence according to SEQ ID NO: 132, a 3' UTR, and a polyA tail.

[0276] In some embodiments, a polyribonucleotide provided herein encodes a polypeptide comprising an amino acid sequence according to SEQ ID NO: 159. In some embodiments, an RNA construct comprises a 5' cap, a 5' UTR, a polyribonucleotide encoding a polypeptide, wherein the polypeptide comprises an amino acid sequence according to SEQ ID NO: 159, a 3' UTR, and a poly-A tail.

[0277] In some embodiments, the polyribonucleotide provided herein encodes a polypeptide comprising an amino acid sequence according to SEQ ID NO: 160. In some embodiments, an RNA construct comprises a 5' cap, a 5' UTR, a polyribonucleotide encoding a polypeptide, wherein the polypeptide comprises an amino acid sequence according to SEQ ID NO: 160, a 3' UTR, and a polyA tail.

[0278] In some embodiments, the polyribonucleotide provided herein encodes a polypeptide comprising an amino acid sequence according to SEQ ID NO: 161. In some embodiments, an RNA construct comprises a 5' cap, a 5' UTR, a polyribonucleotide encoding a polypeptide, wherein the polypeptide comprises an amino acid sequence according to SEQ ID NO: 161, a 3' UTR, and a poly-A tail.

[0279] In some embodiments, the polyribonucleotide provided herein encodes a polypeptide comprising an amino acid sequence according to SEQ ID NO: 162. In some embodiments, an RNA construct comprises a 5' cap, a 5' UTR, a polyribonucleotide encoding a polypeptide, wherein the polypeptide comprises an amino acid sequence according to SEQ ID NO: 162, a 3' UTR, and a polyA tail.

[0280] In some embodiments, the polyribonucleotide provided herein encodes a polypeptide comprising an amino acid sequence according to SEQ ID NO: 163. In some embodiments, an RNA construct comprises a 5' cap, a 5' UTR, a polyribonucleotide encoding a polypeptide, wherein the polypeptide comprises an amino acid sequence according to SEQ ID NO: 163, a 3' UTR, and a polyA tail.

[0281] In some embodiments, the polyribonucleotides provided herein encode a polypeptide comprising an amino acid sequence according to SEQ ID NO: 164. In some embodiments, an RNA construct comprises a 5' cap, a 5' UTR, a polyribonucleotide encoding a polypeptide, wherein the polypeptide comprises an amino acid sequence according to SEQ ID NO: 164, a 3' UTR, and a polyA tail.

[0282] In some embodiments, a polyribonucleotide provided herein encodes a polypeptide, wherein the polypeptide comprises an amino acid sequence according to SEQ ID NO: 327. In some embodiments, an RNA construct comprises a 5' cap, a 5' UTR, a polyribonucleotide encoding a polypeptide, wherein the polypeptide comprises an amino acid sequence according to SEQ ID NO: 327, a 3' UTR, and a polyA tail.

[0283] In some embodiments, the polyribonucleotides provided herein encode a polypeptide comprising an amino acid sequence according to SEQ ID NO: 328. In some embodiments, an RNA construct comprises a 5' cap, a 5' UTR, a polyribonucleotide encoding a polypeptide, wherein the polypeptide comprises an amino acid sequence according to SEQ ID NO: 328, a 3' UTR, and a polyA tail.

[0284] IV.RNA delivery technology The provided polyribonucleotides can be delivered for the therapeutic uses described herein using any suitable method known in the art, including, for example, delivery as naked RNA or delivery mediated by viral and / or non-viral vectors, polymer-based vectors, lipid compositions, nanoparticles (e.g., lipid nanoparticles, polymer nanoparticles, lipid-polymer hybrid nanoparticles, etc.), and / or peptide-based vectors. For information regarding various approaches that may be useful for delivering polyribonucleotides described herein, see, for example, Wadhwa et al. "Opportunities and Challenges in the Delivery of mRNA-Based Vaccines" Pharmaceutics (2020) 102 (27 pages), the contents of which are incorporated herein by reference.

[0285] In some embodiments, one or more polyribonucleotides may be formulated with lipid nanoparticles for delivery (eg, administration).

[0286] In some embodiments, lipid nanoparticles can be designed to protect polyribonucleotides from extracellular RNases and / or engineered for systemic delivery of RNA to target cells. In some embodiments, such lipid nanoparticles can be particularly useful for delivering polyribonucleotides when the polyribonucleotides are administered intravenously or intramuscularly to a subject.

[0287] A. Lipid Composition 1. Lipids and lipid-like materials The terms "lipid" and "lipid-like substance" are broadly defined as molecules containing one or more hydrophobic moieties or groups and, optionally, one or more hydrophilic moieties or groups. Molecules containing both hydrophobic and hydrophilic moieties are often referred to as amphiphiles. Lipids are typically poorly soluble in water. In aqueous environments, their amphiphilic nature allows them to self-assemble into organized structures and distinct phases. One such phase consists of lipid bilayers, such as those found in vesicles, multilamellar / unilamellar liposomes, or membranes in aqueous environments. Hydrophobicity can be imparted by the inclusion of apolar groups, including, but not limited to, long-chain saturated and unsaturated aliphatic hydrocarbon groups, and groups substituted with one or more aromatic, alicyclic, or heterocyclic group(s). Hydrophilic groups can include polar and / or charged groups, including carbohydrate groups, phosphate groups, carboxylate groups, sulfate groups, amino groups, sulfhydryl groups, nitro groups, hydroxyl groups, and other similar groups.

[0288] Amphipathic compounds often have a polar head attached to a long hydrophobic tail. In some embodiments, the polar portion is soluble in water, while the non-polar portion is insoluble in water. In addition, the polar portion can have either a formal positive charge or a formal negative charge. Alternatively, the polar portion can have both a formal positive and negative charge, or can be a zwitterion or an inner salt. For purposes of this disclosure, an amphipathic compound can be, but is not limited to, one or more natural or non-natural lipids and lipid-like compounds.

[0289] "Lipid-like materials" are substances that are structurally and / or functionally related to lipids, but may not be considered lipids in the strict sense. For example, this term includes compounds that can form amphiphilic layers when present in vesicles, multilamellar / unilamellar liposomes, or membranes in an aqueous environment, and includes surfactants or synthetic compounds that share both hydrophilic and hydrophobic moieties. Generally speaking, this term refers to molecules that contain hydrophilic and hydrophobic moieties with different structural configurations that may or may not be similar to those of lipids.

[0290] Specific examples of amphiphilic compounds that can be included in the amphiphilic layer include, but are not limited to, phospholipids, aminolipids, and sphingolipids.

[0291] Generally, lipids can be divided into eight categories: fatty acids, glycerolipids, glycerophospholipids, sphingolipids, glycolipids, polyketides (derived from the condensation of ketoacyl subunits), sterols, and prenol lipids (derived from the condensation of isoprene subunits). The term "lipid" is often used as a synonym for fat, but fats are a subgroup of lipids called triglycerides. Lipids also include molecules such as fatty acids and their derivatives (including triglycerides, diglycerides, monoglycerides, and phospholipids), as well as sterol-containing metabolites, such as cholesterol.

[0292] Fatty acids are a diverse group of molecules made up of hydrocarbon chains terminating in a carboxylic acid group. This configuration gives the molecule a polar, hydrophilic end and a nonpolar, hydrophobic end that is insoluble in water. The carbon chains are typically 4-24 carbons in length but can be saturated or unsaturated and can be attached to functional groups containing oxygen, halogens, nitrogen, and sulfur. When fatty acids contain double bonds, either cis or trans geometric isomerism can exist, which significantly affects the molecular configuration. Cis double bonds cause the fatty acid chain to bend, an effect that increases with the number of double bonds in the chain. Other major lipid classes within the fatty acid category are fatty acid esters and fatty acid amides.

[0293] Glycerolipids are composed of mono-, di-, and tri-substituted glycerols, the most well-known of which are fatty acid triesters of glycerol, called triglycerides. The term "triacylglycerol" is sometimes used synonymously with "triglyceride." In these compounds, the three hydroxyl groups of glycerol are each typically esterified with a different fatty acid. A further subclass of glycerolipids is represented by glycosylglycerol, which is characterized by the presence of one or more sugar residues attached to glycerol via glycosidic bonds.

[0294] Glycerophospholipids are amphipathic molecules (containing both hydrophobic and hydrophilic regions) containing a glycerol core linked by ester bonds to two fatty acid-derived "tails" and one "head" group by a phosphate ester bond. Examples of glycerophospholipids, commonly called phospholipids (although sphingomyelin is also classified as a phospholipid), are phosphatidylcholine (also called PC, GPCho, or lecithin), phosphatidylethanolamine (PE or GPEtn), and phosphatidylserine (PS or GPSer).

[0295] Sphingolipids are members of a complex family of compounds that share a common structural feature: a sphingoid base backbone. The predominant sphingoid base in mammals is commonly referred to as sphingosine. Ceramides (N-acylsphingoid bases) are a major subclass of sphingoid base derivatives with amide-linked fatty acids. The fatty acids are typically saturated or monounsaturated, with chain lengths of 16 to 26 carbon atoms. While the predominant sphingophospholipid in mammals is sphingomyelin (ceramide phosphocholine), insects primarily contain ceramide phosphoethanolamine, and fungi have phytoceramide phosphoinositol and mannose-containing head groups. Glycosphingolipids are a distinct family of molecules composed of one or more sugar residues linked to a sphingoid base via glycosidic bonds. Examples of these are simple and complex glycosphingolipids such as cerebrosides and gangliosides.

[0296] Sterols, such as cholesterol and its derivatives, or tocopherol and its derivatives, are important components of membrane lipids, together with glycerophospholipids and sphingomyelins.

[0297] Glycolipids are compounds in which fatty acids are directly linked to a sugar backbone, forming structures compatible with membrane bilayers. In glycolipids, the glycerol backbone present in glycerolipids and glycerophospholipids is replaced by a monosaccharide. The best-known glycolipid is the acylated glucosamine precursor of the lipid A component of the lipopolysaccharide of Gram-negative bacteria. A typical lipid A molecule is a disaccharide of glucosamine derivatized with as many as seven fatty acid acyl chains. The minimal lipopolysaccharide required for growth in E. coli is Kdo2-lipid A, a hexaacylated disaccharide of glucosamine glycosylated with two 3-deoxy-D-manno-octulosonic acid (Kdo) residues.

[0298] Polyketides are synthesized by the polymerization of acetyl and propionyl subunits by classical enzymes as well as iterative and multimodular enzymes that share mechanistic features with fatty acid synthases. They constitute a large number of secondary metabolites and natural products from animal, plant, bacterial, fungal, and marine sources and are rich in structural diversity. Many polyketides are cyclic molecules that are often further modified at the backbone by glycosylation, methylation, hydroxylation, oxidation, or other processes.

[0299] Lipids and lipid-like materials may be cationic, anionic, or neutral. Neutral lipids or lipid-like materials exist in an uncharged or neutral zwitterionic form at a selected pH.

[0300] In some embodiments, suitable lipids or lipid-like materials for use in the present disclosure include those described in WO2020 / 128031 and US20200163878, the entire contents of each of which are incorporated herein by reference for the purposes described herein.

[0301] 2. Cationic or cationically ionizable lipids or lipid-like materials In some embodiments, cationic or cationically ionizable lipids or lipid-like materials contemplated for use herein include any cationic or cationically ionizable lipid or lipid-like material that can electrostatically bind to nucleic acids. In one embodiment, cationic or cationizable lipids or lipid-like substances contemplated for use herein can associate with nucleic acids, for example, by forming a complex with the nucleic acid or by forming vesicles that encase or encapsulate the nucleic acid.

[0302] Cationic lipids or lipid-like materials are characterized by their net positive charge (e.g., at the relevant pH). Cationic lipids or lipid-like substances bind to negatively charged nucleic acids through electrostatic interactions. Generally, cationic lipids have a lipophilic moiety, such as a sterol, an acyl chain, or a diacyl or higher acyl chain, and the head group of the lipid is typically positively charged.

[0303] In certain embodiments, cationic lipids or lipid-like substances have a net positive charge only at a certain pH, particularly at acidic pH, while at a different pH, preferably at a higher pH, such as physiological pH, they preferably have no net positive charge, preferably have no charge, i.e., are neutral. This ionizable behavior is believed to increase efficacy by aiding in escape from endosomes and reducing toxicity compared to particles that remain cationic at physiological pH.

[0304] In some embodiments, the cationic or cationically ionizable lipid or lipid-like material comprises a head group that includes at least one nitrogen atom (N) that is positively charged or capable of being protonated.

[0305] Examples of cationic lipids include 1,2-dioleoyl-3-trimethylammonium propane (DOTAP), N,N-dimethyl-2,3-dioleyloxypropylamine (DODMA), 1,2-di-O-octadecenyl-3-trimethylammonium propane (DOTMA), 3-(N-(N',N'-dimethylaminoethane)-carbamoyl)cholesterol (DC-Chol), dimethyldioctadecylammonium (DDAB), 1,2-dioleoyl-3-dimethylammonium propane (DODAP), 1,2-diacyloxy -3-dimethylammonium propane, 1,2-dialkyloxy-3-dimethylammonium propane, dioctadecyldimethylammonium chloride (DODAC), 1,2-distearyloxy-N,N-dimethyl-3-aminopropane (DSDMA), 2,3-di(tetradecoxy)propyl-(2-hydroxyethyl)-dimethylazanium (DMRIE), 1,2-dimyristoyl-sn-glycero-3-ethylphosphocholine (DMEPC), 1,2-dimyristoyl-3-trimethylammonium propane (DMTAP), 1,2- Dioleyloxypropyl-3-dimethyl-hydroxyethylammonium bromide (DORIE), 2,3-dioleoyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl-1-propanammonium trifluoroacetate (DOSPA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), dioctadecylamidoglycylspermine (DOGS), 3-dimethylamino-2-(cholest-5)-methyl-2-methylpropanol (DOSPA), and 2,3-dioleoyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl-1-propanammonium trifluoroacetate (DOSPA). N,N-dimethyl-3,4-dioleyloxybenzylamine (DMOBA), 1,2-N,N'-dioleylcarbamyl-3-dimethylaminopropane (DOcarbDAP), 2,3-dilinoleoyloxy-N,N-Dimethylpropylamine (DLinDAP), 1,2-N,N'-Dilinoleylcarbamyl-3-dimethylaminopropane (DLincarbDAP), 1,2-Dilinoleoylcarbamyl-3-dimethylaminopropane (DLinCDAP), 2,2-Dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-K-XTC2-DMA), 2,2-Dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane Oxolane (DLin-KC2-DMA), heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butanoate (DLin-MC3-DMA), N-(2-hydroxyethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)-1-propanaminium bromide (DMRIE), (±)-N-(3-aminopropyl)-N,N-dimethyl-2,3-bis(cis-9-tetradecenyloxy)-1-propanaminium bromide (GAP-DMORIE), (±)-N-(3-aminopropyl)-N,N- Dimethyl-2,3-bis(dodecyloxy)-1-propanaminium bromide (GAP-DLRIE), (±)-N-(3-aminopropyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)-1-propanaminium bromide (GAP-DMRIE), N-(2-aminoethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)-1-propanaminium bromide (βAE-DMRIE), N-(4-carboxybenzyl)-N,N-dimethyl-2,3-bis(oleoyloxy)propanaminium (DOBAQ), 2- ({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA), 1,2-dimyristoyl-3-dimethylammonium-propane (DMDAP), 1,2-dipalmitoyl-3-dimethylammonium-propane (DPDAP), N1-[2-((1S)-1-[(3-aminopropyl)amino]-4-[di(3-aminopropyl)amino]butylcarboxamido)ethyl]-3,4-Di[oleyloxy]benzamide (MVL5), 1,2-dioleoyl-sn-glycero-3-ethylphosphocholine (DOEPC), 2,3-bis(dodecyloxy)-N-(2-hydroxyethyl)-N,N-dimethylpropane-1-ammonium bromide (DLRIE), N-(2-aminoethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)propane-1-aminium bromide (DMO RIE), di(Z)-non-2-en-1-yl)8,8'-((((2(dimethylamino)ethyl)thio)carbonyl)azanediyl)dioctanoate (ATX), N,N-dimethyl-2,3-bis(dodecyloxy)propan-1-amine (DLDMA), N,N-dimethyl-2,3-bis(tetradecyloxy)propan-1-amine (DMDMA), di((Z)-non-2-en-1-yl)-9-(( 4-(dimethylaminobutanoyl)oxy)heptadecanedioate (L319), N-dodecyl-3-((2-dodecylcarbamoyl-ethyl)-{2-[(2-dodecylcarbamoyl-ethyl)-2-{(2-dodecylcarbamoyl-ethyl)-[2-(2-dodecylcarbamoyl-ethylamino)-ethyl]-amino}-ethylamino]propionamide (Lipidoid 98N12-5), 1-[2-[bis( [2-hydroxydodecyl)amino]ethyl-[2-[4-[2-[bis(2hydroxydodecyl)amino]ethyl]piperazin-1-yl]ethyl]amino]dodecan-2-ol (lipidoid C12-200), LIPOFECTIN® (commercially available cationic liposomes containing DOTMA and 1,2-dioleoyl-sn-3 phosphoethanolamine (DOPE), GIBCO / BRL, Grand Island, NY), LIPOFECTAMINE® (commercially available cationic liposomes containing N-(1-(2,3 dioleyloxy)propyl)-N-(2-(sperminecarboxamido)ethyl)-N,N-dimethylammonium trifluoroacetate (DOSPA) and (DOPE), GIBCO / BRL), and TRANSFECTAM® (Promega Corp. Madison,These include, but are not limited to, commercially available cationic lipids including dioctadecylamidoglycylcarboxyspermine (DOGS) in ethanol, commercially available from Wis., or any combination of the foregoing. Further suitable cationic lipids for use in the present disclosure include those described in WO2020 / 128031 and US20200163878, the entire contents of each of which are incorporated herein by reference for purposes described herein. Further suitable cationic lipids for use in the present disclosure include those described in WO2010 / 053572 (including Cl 2-200 as described in paragraph

[0225] ) and WO2012 / 170930, both of which are incorporated herein by reference for purposes described herein. Additional suitable cationic lipids for use in the present disclosure include HGT4003, HGT5000, HGTS001, HGT5001, and HGT5002 (see US20150140070A1, which is incorporated herein by reference in its entirety).

[0306] In some embodiments, formulations useful in the pharmaceutical compositions (e.g., immunogenic compositions, e.g., vaccines) described herein can include at least one cationic lipid. Representative cationic lipids include 1,2-dilinoleyloxy-3-(dimethylamino)acetoxypropane (DLin-DAC), 1,2-dilinoleyloxy-3-morpholinopropane (DLin-MA), 1,2-dilinoleoyl-3-dimethylaminopropane (DLinDAP), 1,2-dilinoleylthio-3-dimethylaminopropane (DLin-S-DMAP), 1-linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1,2-dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.CI), 1,2-dilinoleyl-3-trimethylaminopropane chloride salt (DLin-TAP.CI), and 1,2-dilinoleyloxy-3-(N-methylpiperazino)propane. (DLin-MPZ), 3-(N,N-dilinoleylamino)-1,2-propanediol (DLinAP), 3-(N,N,dioleylamino)-1,2-propanediol (DOAP), 1,2-dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), and 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleylmethyl-4-dimethylaminobutyric acid (DLin-MC3-DMA), MC3 (US20100324120, incorporated herein by reference in its entirety).

[0307] In some embodiments, the amino or cationic lipid useful in accordance with the present disclosure has at least one protonatable or deprotonatable group, so that the lipid is positively charged at a pH below physiological pH (e.g., pH 7.4) and neutral at a second pH, preferably above physiological pH.Of course, it will be understood that the addition or removal of protons as a function of pH is an equilibrium process, and the reference to charged or neutral lipids refers to the nature of the predominant species, and does not require that all lipids exist in a charged or neutral form.Lipids with two or more protonated or deprotonated groups, or lipids that are zwitterionic, are not excluded and may also be suitable in the context of the present invention.

[0308] In some embodiments, the protonatable lipid has a pKa of the protonatable group in the range of about 4 to about 11, for example, a pKa of about 5 to about 7.

[0309] In some embodiments, the cationic lipids may comprise from about 10 mol% to about 100 mol%, from about 20 mol% to about 100 mol%, from about 30 mol% to about 100 mol%, from about 40 mol% to about 100 mol%, or from about 50 mol% to about 100 mol% of the total lipids present in the lipid compositions utilized in accordance with the present disclosure.

[0310] 3. Additional lipids or lipid-like materials In some embodiments, formulations utilized in accordance with the present disclosure may include lipids or lipid-like materials other than cationic lipids or cationically ionizable lipids or lipid-like materials, i.e., non-cationic lipids or lipid-like materials (including non-cationically ionizable lipids or lipid-like materials). Anionic and neutral lipids or lipid-like materials are collectively referred to herein as non-cationic lipids or lipid-like materials. In some embodiments, optimizing the formulation of nucleic acid particles by adding other hydrophobic moieties, such as cholesterol and lipids, in addition to ionizable / cationic lipids or lipid-like materials can enhance, for example, particle stability and nucleic acid delivery efficacy.

[0311] In some embodiments, lipids or lipid-like materials may be incorporated, which may or may not affect the overall charge of the particle, hi certain embodiments, such lipids or lipid-like materials are non-cationic lipids or lipid-like materials.

[0312] In some embodiments, the non-cationic lipids may include, for example, one or more anionic lipids and / or neutral lipids. An "anionic lipid" is negatively charged (e.g., at a selected pH).

[0313] "Neutral lipids" exist either uncharged or in a neutral zwitterionic form (e.g., at a selected pH). In some embodiments, the formulation includes one of the following neutral lipid components: (1) a phospholipid, (2) cholesterol or a derivative thereof, or (3) a mixture of phospholipid and cholesterol or a derivative thereof. Examples of cholesterol derivatives include cholestanol, cholestanone, cholestenone, coprostanol, cholesteryl-2 ’ -Hydroxyethyl ether, cholesteryl-4 ’ -hydroxybutyl ether, tocopherol and its derivatives, and mixtures thereof.

[0314] Examples of specific phospholipids that can be used include, but are not limited to, phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidic acid, phosphatidylserine, or sphingomyelin.Such phospholipids include, in particular, diacylphosphatidylcholines, such as distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dimyristoylphosphatidylcholine (DMPC), dipentadecanoylphosphatidylcholine, dilauroylphosphatidylcholine, dipalmitoylphosphatidylcholine (DPPC), diarachidoylphosphatidylcholine (DAPC), dibehenoylphosphatidylcholine ( DBPC), ditricosanoylphosphatidylcholine (DTPC), dilignoceroylphosphatidylcholine (DLPC), palmitoyloleoyl-phosphatidylcholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), and phosphatidylethanolamines, in particular diacylphosphatidylethanolamines such as dioleoylphosphatidylethanolamine (DOPE), distearoyl-phosphatidylethanolamine (DSPE), dipalmitoyl-phosphatidylethanolamine (DPPE), dimyristoyl-phosphatidylethanolamine (DMPE), dilauroyl-phosphatidylethanolamine (DLPE), diphytanoyl-phosphatidylethanolamine (DPyPE), and further phosphatidylethanolamine lipids with different hydrophobic chains.

[0315] In certain embodiments, formulations utilized in accordance with the present disclosure comprise DSPC or DSPC and cholesterol.

[0316] In certain embodiments, formulations utilized in accordance with the present disclosure include both a cationic lipid and an additional (non-cationic) lipid.

[0317] In some embodiments, the formulations herein include a polymer-conjugated lipid, such as a pegylated lipid. A "pegylated lipid" includes both a lipid moiety and a polyethylene glycol moiety. Pegylated lipids are known in the art.

[0318] Without wishing to be bound by theory, the amount of (total) cationic lipid relative to the amount of other lipid(s) in the formulation can affect important characteristics such as nucleic acid charge, particle size, stability, tissue selectivity, and bioactivity. In some embodiments, the molar ratio of at least one cationic lipid to at least one additional lipid is about 10:0 to about 1:9, about 4:1 to about 1:2, or about 3:1 to about 1:1.

[0319] In some embodiments, non-cationic lipids, particularly neutral lipids (e.g., one or more phospholipids and / or cholesterol), may comprise from about 0 mol% to about 90 mol%, from about 0 mol% to about 80 mol%, from about 0 mol% to about 70 mol%, from about 0 mol% to about 60 mol%, or from about 0 mol% to about 50 mol% of the total lipids present in the formulation.

[0320] 4. Lipoplex Particles In certain embodiments of the present disclosure, the RNA described herein may be present in an RNA lipoplex particle.

[0321] "RNA lipoplex particles" contain lipids, particularly cationic lipids, and RNA. Electrostatic interactions between positively charged liposomes and negatively charged RNA result in complexation and spontaneous formation of RNA lipoplex particles. Positively charged liposomes are typically synthesized using cationic lipids such as DOTMA and additional lipids such as DOPE. In one embodiment, the RNA lipoplex particles are nanoparticles.

[0322] In certain embodiments, the RNA lipoplex particles comprise both a cationic lipid and an additional lipid, hi some embodiments, the cationic lipid is DOTMA and the additional lipid is DOPE.

[0323] In some embodiments, the molar ratio of the at least one cationic lipid to the at least one additional lipid is about 10:0 to about 1:9, about 4:1 to about 1:2, or about 3:1 to about 1:1. In specific embodiments, the molar ratio can be about 3:1, about 2.75:1, about 2.5:1, about 2.25:1, about 2:1, about 1.75:1, about 1.5:1, about 1.25:1, or about 1:1. In an exemplary embodiment, the molar ratio of the at least one cationic lipid to the at least one additional lipid is about 2:1.

[0324] In some embodiments, the RNA lipoplex particles have an average diameter in the range of about 200 nm to about 1000 nm, about 200 nm to about 800 nm, about 250 to about 700 nm, about 400 to about 600 nm, about 300 nm to about 500 nm, or about 350 nm to about 400 nm. In certain embodiments, the RNA lipoplex particles have an average diameter of about 200 nm, about 225 nm, about 250 nm, about 275 nm, about 300 nm, about 325 nm, about 350 nm, about 375 nm, about 400 nm, about 425 nm, about 450 nm, about 475 nm, about 500 nm, about 525 nm, about 550 nm, about 575 nm, about 600 nm, about 625 nm, about 650 nm, about 700 nm, about 725 nm, about 750 nm, about 775 nm, about 800 nm, about 825 nm, about 850 nm, about 875 nm, about 900 nm, about 925 nm, about 950 nm, about 975 nm, or about 1000 nm. In one embodiment, the RNA lipoplex particles have an average diameter ranging from about 250 nm to about 700 nm. In another embodiment, the RNA lipoplex particles have an average diameter ranging from about 300 nm to about 500 nm, hi some embodiments, the average diameter of the RNA lipoplex particles is about 400 nm.

[0325] The RNA lipoplex particles and compositions comprising the RNA lipoplex particles described herein are useful for delivering RNA to target tissues after parenteral administration, particularly intravenous administration. The RNA lipoplex particles can be prepared using liposomes, which can be obtained by injecting a solution of lipids in ethanol into water or a suitable aqueous phase. In one embodiment, the aqueous phase has an acidic pH. In one embodiment, the aqueous phase contains acetic acid, for example, in an amount of about 5 mM. Liposomes can be used to prepare RNA lipoplex particles by mixing the liposomes with RNA. In one embodiment, the liposomes and RNA lipoplex particles contain at least one cationic lipid and at least one additional lipid. In one embodiment, the at least one cationic lipid comprises 1,2-di-O-octadecenyl-3-trimethylammoniumpropane (DOTMA) and / or 1,2-dioleoyl-3-trimethylammoniumpropane (DOTAP). In one embodiment, the at least one additional lipid comprises 1,2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphoethanolamine (DOPE), cholesterol (Chol), and / or 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC). In one embodiment, the at least one cationic lipid comprises 1,2-di-O-octadecenyl-3-trimethylammoniumpropane (DOTMA), and the at least one additional lipid comprises 1,2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphoethanolamine (DOPE). In one embodiment, the liposome and RNA lipoplex particle comprise 1,2-di-O-octadecenyl-3-trimethylammoniumpropane (DOTMA) and 1,2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphoethanolamine (DOPE).

[0326] WO 2013 / 143683, incorporated herein by reference, describes spleen-targeting RNA lipoplex particles. It has been discovered that RNA lipoplex particles with a net negative charge can be used to preferentially target spleen tissue or cells, such as antigen-presenting cells, particularly dendritic cells. Thus, RNA accumulation and / or expression occurs in the spleen after administration of the RNA lipoplex particles. Therefore, the RNA lipoplex particles of the present disclosure can be used to express RNA within the spleen. In one embodiment, RNA accumulation and / or expression does not or essentially does not occur in the lung and / or liver after administration of the RNA lipoplex particles. In one embodiment, RNA accumulation and / or expression occurs in antigen-presenting cells, such as professional antigen-presenting cells, in the spleen after administration of the RNA lipoplex particles. Thus, the RNA lipoplex particles of the present disclosure can be used to express RNA within such antigen-presenting cells. In one embodiment, the antigen-presenting cells are dendritic cells and / or macrophages.

[0327] 5. Lipid Nanoparticles (LNPs) In some embodiments, nucleic acids such as RNA described herein are administered in the form of lipid nanoparticles (LNPs). In some embodiments, LNPs can include any lipid that can form particles to which one or more nucleic acid molecules can be attached or in which one or more nucleic acid molecules can be encapsulated.

[0328] In some embodiments, the LNPs comprise one or more cationic lipids and one or more stabilizing lipids, including neutral lipids and PEGylated lipids.

[0329] In some embodiments, the LNP comprises a cationic lipid, a neutral lipid, a sterol, a polymer-conjugated lipid, and RNA encapsulated within or associated with the lipid nanoparticle.

[0330] In some embodiments, the neutral lipid is selected from the group consisting of DSPC, DPPC, DMPC, DOPC, POPC, DOPE, DOPG, DPPG, POPE, DPPE, DMPE, DSPE, and SM. In some embodiments, the neutral lipid is selected from the group consisting of DSPC, DPPC, DMPC, DOPC, POPC, DOPE, and SM. In some embodiments, the neutral lipid is DSPC.

[0331] In some embodiments, the sterol is cholesterol.

[0332] In some embodiments, the polymer-conjugated lipid is a PEGylated lipid. In some embodiments, the PEGylated lipid has the following structure:

[0333] [ka]

[0334] or a pharmaceutically acceptable salt, tautomer, or stereoisomer thereof, wherein R 12 and R 13 are each independently a linear or branched, saturated or unsaturated alkyl chain containing 10 to 30 carbon atoms, the alkyl chain optionally being interrupted by one or more ester linkages, and w has an average value ranging from 30 to 60. In some embodiments, R 12 and R 13 are each independently a linear saturated alkyl chain containing 12 to 16 carbon atoms. In some embodiments, w ranges from an average of 40 to 55. In some embodiments, the average w is about 45. In some embodiments, R 12 and R 13 is each independently a straight saturated alkyl chain containing about 14 carbon atoms, and w has an average value of about 45.

[0335] In some embodiments, the pegylated lipid is DMG-PEG 2000, e.g., having the following structure:

[0336] [ka]

[0337] In some embodiments, the cationic lipid component of the LNP has the structure of formula (III):

[0338] [ka]

[0339] (III)

[0340] or a pharmaceutically acceptable salt, tautomer, prodrug or stereoisomer thereof, wherein:

[0341] L 1 or L 2 One of the following is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O) x -, -SS-, -C(=O)S-, SC(=O)-, -NR a C(=O)-, -C(=O)NR a -, NR a C(=O)NR a -, -OC(=O)NR a -, or -NR a C(=)O- and L 1 or L 2 The other is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O) x -, -SS-, -C(=O)S-, SC(=O)-, -NR a C(=O)-, -C(=O)NR a -, NR a C(=O)NR a -, -OC(=O)NR a -, or -NR a C(=O)O-, or a direct bond;

[0342] G 1 and G 2 are each independently an unsubstituted C-C12 Alkylene or C1-C 12 alkenylene;

[0343] G 3 is C1-C 24 Alkylene, C1-C 24 alkenylene, C3-C8 cycloalkylene, C3-C8 cycloalkenylene;

[0344] R a is H, or C1-C 12 is alkyl;

[0345] R 1 and R 2 are each independently C6-C 24 Alkyl, or C6-C 24 is alkenyl;

[0346] R 3 H, OR 5 , CN, -C(=O)OR 4 , -OC(=O)R 4 , or -NR 5 C(=O)R 4 and

[0347] R 4 is C1-C 12 is alkyl,

[0348] R 5 is H, or C1-C6 alkyl;

[0349] x is 0, 1 or 2.

[0350] In some of the above embodiments of formula (III), the lipid has either the following structure (IIIA) or (IIIB):

[0351] [ka]

[0352] (IIIA) (IIIB)

[0353] During the ceremony,

[0354] A is a 3- to 8-membered cycloalkyl or cycloalkylene ring;

[0355] R 6 is, at each occurrence, independently H, OH, or C1-C 24 is alkyl,

[0356] n is an integer ranging from 1 to 15.

[0357] In some of the above embodiments of formula (III), the lipid has structure (IIIA), and in other embodiments, the lipid has structure (IIIB).

[0358] In other embodiments of formula (III), the lipid has either one of the following structures (IIIC) or (IIID):

[0359] [ka]

[0360] (IIIC) (IIID)

[0361] In the formula, y and z are each independently an integer ranging from 1 to 12.

[0362] In any of the above embodiments of formula (III), L 1 or L 2 One of the groups is —O(C═O)—. For example, in some embodiments, L 1 and L 2 Each of the above is —O(C═O)—. In several different embodiments of any of the above, L 1 and L 2 are each independently -(C=O)O-, or -O(C=O)-. For example, in some embodiments, L 1 and L 2 Each of is —(C═O)O—.

[0363] In some different embodiments of formula (III), the lipid has either one of the following structures (IIIE) or (IIIF):

[0364] [ka]

[0365] (IIIE) (IIIF).

[0366] In some of the above embodiments of formula (III), the lipid has any one of the following structures (IIIG), (IIIH), (IIII) or (IIIJ):

[0367] [ka]

[0368] (IIIG) (IIIH)

[0369] [ka]

[0370] (III) (IIIJ).

[0371] In some of the above embodiments of Formula (III), n is an integer ranging from 2 to 12, e.g., from 2 to 8 or from 2 to 4. For example, in some embodiments, n is 3, 4, 5, or 6. In some embodiments, n is 3. In some embodiments, n is 4. In some embodiments, n is 5. In some embodiments, n is 6.

[0372] In some other of the above embodiments of Formula (III), y and z are each independently an integer ranging from 2 to 10. For example, in some embodiments, y and z are each independently an integer ranging from 4 to 9, or from 4 to 6.

[0373] In some of the above embodiments of formula (III), R 6 is H. In other of the above embodiments, R 6 is C1-C 24 In another embodiment, R 6 is OH.

[0374] In some embodiments of Formula (III), G 3 In other embodiments, G is substituted. In various different embodiments, G 3 is a linear C1-C 24 Alkylene, or linear C1-C 24 It is alkenylene.

[0375] In some other of the above embodiments of formula (III), R 1 Or R 2 , or both of them, C6-C 24 For example, in some embodiments, R 1 and R 2 each independently have the structure:

[0376] [ka]

[0377] During the ceremony,

[0378] R 7a and R 7b is, for each occurrence, independently H or C1-C 12 is alkyl,

[0379] a is an integer from 2 to 12,

[0380] R 7a , R 7b and a are R 1 and R 2are each independently selected to contain 6 to 20 carbon atoms. For example, in some embodiments, a is an integer ranging from 5 to 9, or from 8 to 12.

[0381] In some of the above embodiments of formula (III), occurrences of R 7a At least one of R is H. For example, in some embodiments, 7a In another different embodiment of the above, each occurrence of R 7b At least one of is C1-C8 alkyl. For example, in some embodiments, the C1-C8 alkyl is methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-hexyl, or n-octyl.

[0382] In different embodiments of formula (III), R 1 Or R 2 , or both of them have one of the following structures:

[0383] [ka]

[0384] In some of the above embodiments of formula (III), R 3 OH, CN, -C(=O)OR 4 , -OC(=O)R 4 , or -NHC(=O)R 4 In some embodiments, R 4 is methyl or ethyl.

[0385] In various different embodiments, the cationic lipid of formula (III) has one of the structures shown in Table 15 below. [Table 15-1] [Table 15-2] [Table 15-3] [Table 15-4] [Table 15-5] [Table 15-6]

[0386] In various different embodiments, the cationic lipid has one of the structures shown in Table 16 below. [Table 16]

[0387] In some embodiments, the LNPs comprise cationic lipids that are ionic lipid-like materials (lipidoids). In some embodiments, the cationic lipids have the following structure:

[0388] [ka]

[0389] In some embodiments, lipid nanoparticles can have an average size (e.g., average diameter) of about 30 nm to about 150 nm, about 40 nm to about 150 nm, about 50 nm to about 150 nm, about 60 nm to about 130 nm, about 70 nm to about 110 nm, about 70 nm to about 100 nm, about 70 nm to about 90 nm, or about 70 nm to about 80 nm. In some embodiments, lipid nanoparticles according to the present disclosure can have an average size (e.g., average diameter) of about 50 nm to about 100 nm. In some embodiments, lipid nanoparticles can have an average size (e.g., average diameter) of about 50 nm to about 150 nm. In some embodiments, lipid nanoparticles can have an average size (e.g., average diameter) of about 60 nm to about 120 nm. In some embodiments, lipid nanoparticles according to the present disclosure can have an average size (e.g., average diameter) of about 30 nm, 35 nm, 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm. The term "average diameter" or "mean diameter" refers to the average hydrodynamic diameter of particles as measured by dynamic laser light scattering (DLS), which uses the so-called Cumalt algorithm for data analysis, resulting in the so-called Z-average for the linear dimension and the dimensionless polydispersity index (PI) (Koppel, D., J. Chem. Phys. 57, 1972, pp. 4814-4820, ISO 13321, incorporated herein by reference). Herein, the terms "average diameter", "mean diameter", "diameter" or "particle size" of particles are used synonymously with this value of Z-average.

[0390] In some embodiments, the lipid nanoparticles described herein may exhibit a polydispersity index of less than about 0.5, less than about 0.4, less than about 0.3, or about 0.2 or less. By way of example, the lipid nanoparticles may exhibit a polydispersity index in the range of about 0.1 to about 0.3, or about 0.2 to about 0.3. "Polydispersity" is preferably calculated based on dynamic light scattering measurements by so-called Cumult analysis, as mentioned in the definition of "average diameter." Under certain conditions, it can be interpreted as a measure of the particle size distribution of an ensemble of ribonucleic acid nanoparticles (e.g., ribonucleic acid nanoparticles).

[0391] The lipid nanoparticles described herein can be characterized by the "N / P ratio," which is the molar ratio of cationic (nitrogen) groups in the cationic polymer ("N" in N / P) to anionic (phosphate) groups in the RNA ("P" in N / P). The cationic groups may be in cationic form (e.g., N + ), or a group that is ionizable to become cationic. The use of a single number in an N / P ratio (e.g., an N / P ratio of about 5) is intended to refer to that number being greater than 1; for example, an N / P ratio of about 5 is intended to mean 5:1. In some embodiments, the lipid nanoparticles described herein have an N / P ratio of 5 or greater. In some embodiments, the lipid nanoparticles described herein have an N / P ratio that is about 5, 6, 7, 8, 9, or 10. In some embodiments, the N / P ratio of the lipid nanoparticles described herein is about 10 to about 50. In some embodiments, the N / P ratio of the lipid nanoparticles described herein is about 10 to about 70. In some embodiments, the N / P ratio of the lipid nanoparticles described herein is about 10 to about 120.

[0392] B. Exemplary Methods for Making Lipid Nanoparticles Lipids and lipid nanoparticles containing nucleic acids and methods for their preparation are known in the art, see, e.g., U.S. Pat. Nos. 8,569,256, 5,965,542 and U.S. Patent Publication Nos. 2016 / 0199485, 2016 / 0009637, 2015 / 0273068, 2015 / 0265708, 2015 / 0203446, 2015 / 0005363, 2014 / 0308304, 2014 / 0200257, 2013 / 086373, 2013 / 0338210, 2013 / 0323269, 2013 / 0245107, 2013 / 0195920, and 2013 / 0123338, Same No. 2013 / 0022649, No. 2013 / 0017223, No. 2012 / 0295832, No. 2012 / 018 No. 3581, No. 2012 / 0172411, No. 2012 / 0027803, No. 2012 / 0058188, No. 201 1 / 0311583, 2011 / 0311582, 2011 / 0262527, 2011 / 0216622, Same No. 2011 / 0117125, No. 2011 / 0091525, No. 2011 / 0076335, No. 2011 / 0060 032, 2010 / 0130588, 2007 / 0042031, 2006 / 0240093, 2006 / 0083780, 2006 / 0008910, 2005 / 0175682, 2005 / 017054, 2005 / 0118253, 2005 / 0064595, 2004 / 0142025, 2007 / 0042031, 1999 / 009076, and PCT Publication Nos. WO99 / 39741, WO2018 / 081480, W and WO2001 / 07548 (the entire disclosures of each of which are incorporated herein by reference in their entirety for purposes set forth herein).

[0393] For example, in some embodiments, cationic lipids, neutral lipids (e.g., DSPC and / or cholesterol), and polymer-conjugated lipids can be solubilized in ethanol at a predetermined molar ratio (e.g., as described herein). In some embodiments, a plurality of lipid nanoparticles (lipid nanoparticles) are prepared at a weight ratio of total lipid to polyribonucleotide of approximately 10:1 to 30:1. In some embodiments, such polyribonucleotides can be diluted to 0.2 mg / mL in acetate buffer.

[0394] In some embodiments, using the ethanol injection technique, colloidal lipid dispersions containing polyribonucleotides can be formed as follows: an ethanol solution containing lipids, such as cationic lipids, neutral lipids, and polymer-conjugated lipids, is injected into an aqueous solution containing polyribonucleotides (e.g., those described herein).

[0395] In some embodiments, lipid and polyribonucleotide solutions can be mixed at room temperature by pumping each solution into a mixing unit at a controlled flow rate, for example, using a piston pump. In some embodiments, the flow rates of lipid solution and RNA solution into the mixing unit are maintained at a ratio of 1:3. By mixing, nucleic acid-lipid particles are formed as the ethanolic lipid solution is diluted with the aqueous polyribonucleotide solution. As the solubility of lipids decreases, the positively charged cationic lipids interact with the negatively charged RNA.

[0396] In some embodiments, the solution containing RNA-encapsulated lipid nanoparticles may be processed by one or more of concentration adjustment, buffer exchange, formulation, and / or filtration.

[0397] In some embodiments, the RNA-encapsulated lipid nanoparticles may be processed by filtration.

[0398] In some embodiments, the particle size and / or internal structure of the lipid nanoparticles (with or without RNA) can be monitored by suitable techniques such as, for example, small angle X-ray scattering (SAXS) and / or transmission electron microscopy (CryoTEM).

[0399] V. Pharmaceutical Compositions The present disclosure provides compositions, such as pharmaceutical compositions, comprising one or more polyribonucleotides described herein. Pharmaceutical formulations may additionally contain pharmaceutically acceptable excipients, which, as used herein, include any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersing or suspending aids, surfactants, isotonicity agents, thickening or emulsifying agents, preservatives, solid binders, lubricants, and the like, appropriate for the particular dosage form desired. Remington's *The Science and Practice of Pharmacy*, 21st Edition, A.R. Gennaro (Lippincott, Williams & Wilkins, Baltimore, MD, 2006; incorporated herein by reference) discloses various excipients used in formulating pharmaceutical compositions and known techniques for their preparation. The use of any conventional excipient medium is considered within the scope of the present disclosure unless it is incompatible with the substance or its derivatives, such as by producing some undesirable biological effect or by interacting in a deleterious manner with any other component(s) of the pharmaceutical composition.

[0400] In some embodiments, the excipients are approved for human and veterinary use. In some embodiments, the excipients are approved by the U.S. Food and Drug Administration. In some embodiments, the excipients are pharmaceutical grade. In some embodiments, the excipients meet the standards of the United States Pharmacopoeia (USP), the European Pharmacopoeia (EP), the British Pharmacopoeia, and / or the International Pharmacopoeia.

[0401] Pharmaceutically acceptable excipients used in the preparation of pharmaceutical compositions include, but are not limited to, inert diluents, dispersing and / or granulating agents, surfactants and / or emulsifying agents, disintegrating agents, binders, preservatives, buffers, lubricants, and / or oils. Such excipients may be included in pharmaceutical preparations as needed. Excipients such as cocoa butter and suppository waxes, coloring agents, coating agents, sweeteners, flavoring agents, and / or perfumes may be present in the composition, according to the discretion of the formulator.

[0402] General considerations regarding the formulation and / or manufacture of pharmaceuticals can be found, for example, in Remington: The Science and Practice of Pharmacy 21st ed., Lippincott Williams & Wilkins, 2005 (incorporated herein by reference).

[0403] In some embodiments, the pharmaceutical compositions provided herein can be formulated using one or more pharmaceutically acceptable carriers or diluents, as well as any other known adjuvants and excipients, according to conventional methods, e.g., as disclosed in Remington: The Science and Practice of Pharmacy 21st ed., Lippincott Williams & Wilkins, 2005 (incorporated herein by reference).

[0404] The pharmaceutical compositions described herein can be administered by any suitable method known in the art. As will be apparent to those skilled in the art, the route and / or mode of administration may depend on several factors, including, but not limited to, the stability and / or pharmacokinetics and / or pharmacodynamics of the pharmaceutical compositions described herein.

[0405] In some embodiments, the pharmaceutical compositions described herein are formulated for parenteral administration. Parenteral administration includes modes of administration other than enteral and topical administration (usually by injection), including, but not limited to, intravenous, intramuscular, intraarterial, intradermal, subcutaneous, subcuticular, or intraarticular injection and infusion. In preferred embodiments, the pharmaceutical compositions described herein are formulated for intravenous, intramuscular, or subcutaneous administration. In particularly preferred embodiments, the pharmaceutical compositions described herein are formulated for intramuscular administration.

[0406] In some embodiments, the pharmaceutical compositions described herein are formulated for intravenous administration. In some embodiments, pharmaceutically acceptable excipients that may be useful for intravenous administration include sterile aqueous solutions or dispersions and sterile powders for preparing sterile injectable solutions or dispersions.

[0407] Therapeutic compositions typically must be sterile and stable under the conditions of manufacture and storage. The compositions can be formulated as a solution, microemulsion, lipid nanoparticle, or other ordered structure suitable for high drug concentration. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.), and suitable mixtures thereof. For example, a surfactant can be used to maintain proper fluidity. In many cases, it is preferable to include an isotonic agent, for example, a sugar, a polyalcohol such as mannitol or sorbitol, or sodium chloride in the composition. In some embodiments, prolonged absorption of an injectable composition can be achieved by including an agent that delays absorption, for example, monostearate salts and gelatin in the composition.

[0408] Sterile injectable solutions can be prepared by incorporating the required amount of active compound into an appropriate solvent containing one or a combination of the above ingredients, followed by sterilization and / or microfiltration, as necessary. In some embodiments, pharmaceutical compositions can be prepared as described herein and / or by methods known in the art. In some embodiments, the pharmaceutical composition contains ALC-0315, ALC-0159, DSPC, cholesterol, sucrose, NaCl, KCl, NaHPO, KHPO, and water for injection. In some embodiments, saline (isotonic 0.9% NaCl) is used as a diluent.

[0409] These compositions may also contain auxiliary agents such as preservatives, wetting agents, emulsifying agents, and dispersing agents. Prevention of the presence of microorganisms can be ensured both by sterilization procedures and by the addition of various antibacterial and antifungal agents (e.g., parabens, chlorobutanol, phenol, sorbic acid, etc.). It may also be desirable to include isotonic agents, such as sugars and sodium chloride, in the pharmaceutical compositions described herein. Furthermore, prolonged absorption of injectable pharmaceutical forms can be brought about by the addition of agents that delay absorption, such as aluminum monostearate and gelatin.

[0410] The formulations of the pharmaceutical compositions described herein can be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the steps of bringing the active ingredient(s) into contact with a diluent or other excipient and / or one or more other accessory ingredients, and then, as necessary and / or desired, shaping and / or packaging the product into a desired single- or multi-dose unit.

[0411] Pharmaceutical compositions according to the present disclosure may be prepared, packaged, and / or sold in bulk, as a single unit dose, and / or as a plurality of single unit doses. As used herein, a "unit dose" is a discrete amount of a pharmaceutical composition comprising a predetermined amount of at least one RNA product produced using the systems and / or methods described herein.

[0412] In a pharmaceutical composition, the relative amounts of polyribonucleotides, pharmaceutically acceptable excipients, and / or any additional components encapsulated in lipid nanoparticles may vary depending on the subject, target cell, disease, or disorder being treated, and may further vary depending on the route of administration of the composition.

[0413] In some embodiments, the pharmaceutical compositions described herein are formulated into pharmaceutically acceptable dosage forms by conventional methods known to those skilled in the art. The actual dosage level of the active ingredient (e.g., polyribonucleotide encapsulated in lipid nanoparticles) in the pharmaceutical compositions described herein can be varied to obtain an amount of the active ingredient effective to achieve the desired therapeutic response without causing toxicity to the patient for a particular patient, composition, and mode of administration. The selected dosage level will depend on a variety of pharmacokinetic factors, including the activity of the particular composition of the present disclosure used, the route of administration, the time of administration, the excretion rate of the particular compound used, the duration of treatment, other drugs, compounds, and / or substances used in combination with the particular composition used, the age, sex, weight, condition, general health, and previous medical history of the patient being treated, and similar factors well known in the medical field.

[0414] A doctor with ordinary skill in the art can easily determine and prescribe the required effective amount of pharmaceutical composition.For example, the doctor can start the dosage of the active ingredient (for example, the polyribonucleotide encapsulated in lipid nanoparticles) used in the pharmaceutical composition at a level lower than that required to achieve the desired therapeutic effect, and gradually increase the dosage until the desired effect is achieved.

[0415] In some embodiments, the pharmaceutical composition is formulated to deliver a dose of about 5 mg RNA / kg (eg, without limitation, for intravenous, intramuscular, or subcutaneous administration).

[0416] In some embodiments, the pharmaceutical compositions described herein may further comprise one or more additives, which may, for example, in some embodiments, enhance the stability of such compositions under certain conditions. Examples of additives may include, but are not limited to, salts, buffers, preservatives, and carriers. For example, in some embodiments, the pharmaceutical compositions may further comprise a cryoprotectant (e.g., sucrose) and / or an aqueous buffer solution, and in some embodiments, may include one or more salts, including, for example, alkali metal or alkaline earth metal salts, such as sodium, potassium, and / or calcium salts.

[0417] In some embodiments, the pharmaceutical compositions provided herein are preservative-free, sterile RNA-lipid nanoparticle dispersions for intravenous or intramuscular administration.

[0418] Although the description of pharmaceutical compositions provided herein is primarily directed to pharmaceutical compositions suitable for administration to humans, those skilled in the art will appreciate that such compositions are generally suitable for administration to animals of all kinds. Modifications of pharmaceutical compositions suitable for administration to humans to make them suitable for administration to a variety of animals are well understood, and an ordinarily skilled veterinary pharmacologist can design and / or implement such modifications with no more than routine experimentation, if at all.

[0419] A. Certain Exemplary Pharmaceutical Compositions Provided herein is a combination comprising two or more polyribonucleotides as described herein.In some embodiments, the combination comprises three or more polyribonucleotides as described herein.In some embodiments, the combination comprises three polyribonucleotides as described herein.

[0420] Also provided herein are combinations comprising two or more pharmaceutical compositions, each pharmaceutical composition comprising a ...

Claims

1. 1. A combination comprising a polyribonucleotide encoding an HSV glycoprotein C (gC) antigen or an antigenic fragment thereof, a polyribonucleotide encoding an HSV glycoprotein D (gD) antigen or an antigenic fragment thereof, and a polyribonucleotide encoding an HSV glycoprotein E (gE) antigen or an antigenic fragment thereof: (i) the polyribonucleotide encoding the HSV gC antigen or antigenic fragment thereof comprises a ribonucleic acid sequence having at least 90% sequence identity to SEQ ID NO: 336; (ii) the polyribonucleotide encoding the HSV gD antigen or antigenic fragment thereof comprises a ribonucleic acid sequence having at least 90% sequence identity to SEQ ID NO: 340; (iii) the polyribonucleotide encoding the HSV gE antigen or antigenic fragment thereof comprises a ribonucleic acid sequence having at least 90% sequence identity to SEQ ID NO: 283; or (iv) any combination thereof.

2. The combination of claim 1 , wherein the polyribonucleotide encoding the HSV gC antigen or antigenic fragment thereof further encodes a secretion signal.

3. The combination of claim 2 , wherein the secretory signal comprises an HSV secretory signal.

4. The combination of claim 3 , wherein the HSV secretory signal is the HSV glycoprotein D (gD) secretory signal.

5. The combination of claim 4, wherein the HSV gD secretion signal is an HSV1 gD secretion signal.

6. The combination of claim 5 , wherein the HSV1 gD secretion signal comprises an amino acid sequence according to SEQ ID NO:

213.

7. 7. The combination of claim 6, wherein the polyribonucleotide encoding the HSV gC antigen or antigenic fragment thereof comprises a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO:

240.

8. The combination according to any one of claims 1 to 7, wherein the polyribonucleotide encoding the HSV gD antigen or an antigenic fragment thereof further encodes a secretion signal.

9. The combination of claim 8 , wherein the secretory signal comprises an HSV secretory signal.

10. The combination of claim 9 , wherein the HSV secretory signal comprises an HSV gD secretory signal.

11. The combination of claim 10, wherein the HSV gD secretory signal comprises an HSV2 gD secretory signal.

12. The combination of claim 11 , wherein the HSV2 gD secretion signal comprises an amino acid sequence according to SEQ ID NO:

29.

13. 13. The combination of claim 12, wherein the polyribonucleotide encoding the HSV gD antigen or antigenic fragment thereof comprises a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO:

56.

14. The combination according to any one of claims 1 to 13, wherein the polyribonucleotide encoding the HSV gD antigen or an antigenic fragment thereof further encodes a secretion signal.

15. The combination of claim 14 , wherein the secretory signal comprises an HSV secretory signal.

16. 16. The combination of claim 15, wherein the HSV secretory signal comprises an HSV gD secretory signal.

17. 17. The combination of claim 16, wherein the HSV gD secretory signal comprises an HSV2 gD secretory signal.

18. 18. The combination of claim 17, wherein the HSV2 gD secretion signal comprises an amino acid sequence according to SEQ ID NO:

30.

19. 19. The combination of claim 18, wherein the polyribonucleotide encoding the HSV gD antigen or antigenic fragment thereof comprises a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO:

59.

20. 20. The combination of any one of claims 1 to 19, wherein the polyribonucleotide encoding the HSV gC antigen or antigenic fragment thereof comprises a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO:

349.

21. 21. The combination of any one of claims 1 to 20, wherein the polyribonucleotide encoding the HSV gD antigen or antigenic fragment thereof comprises a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO:

352.

22. 22. The combination of any one of claims 1 to 21, wherein the polyribonucleotide encoding the HSV gE antigen or antigenic fragment thereof comprises a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO:

353.

23. 23. The combination of any one of claims 1 to 22, wherein at least one of the polyribonucleotides comprises a modified uridine.

24. 24. The combination according to any one of claims 1 to 23, wherein the modified uridine is N1-methyl-pseudouridine.

25. One or more of the polyribonucleotides are, in 5' to 3' order: (i) a 5′ UTR; (ii) a polyribonucleotide according to any one of claims 1 to 24; (iii) a 3′UTR, and (iv) a polyA tail sequence.

26. (i) the 5'UTR comprises or consists of a modified human α-globin 5'-UTR; (ii) the 3'UTR comprises or consists of a first sequence from a split amino-terminal enhancer (AES) messenger RNA and a second sequence from a mitochondrially encoded 12S ribosomal RNA.

27. 27. The combination according to claim 25 or 26, wherein the 5'UTR consists of a ribonucleic acid sequence according to SEQ ID NO:

152.

28. The combination according to any one of claims 25 to 27, wherein the 3'UTR consists of a ribonucleic acid sequence according to SEQ ID NO:

158.

29. The combination according to any one of claims 25 to 28, wherein the polyA tail sequence is a split polyA tail sequence.

30. 30. The combination of claim 29, wherein the split polyA tail sequence consists of a ribonucleic acid sequence according to SEQ ID NO:

155.

31. The combination of any one of claims 25 to 30, further comprising a 5' cap.

32. 32. The combination of claim 31, further comprising a cap-proximal sequence comprising positions +1, +2, +3, +4, and +5 of the polyribonucleotide.

33. The 5' cap is m7(3'OMeG)(5')ppp(5')(2'OMeA １ ) pG ２ A １ is at position +1 of the polyribonucleotide, and G ２ is at position +2 of the polyribonucleotide.

34. The cap-proximal sequence is A of the Cap1 structure １ and G ２ and at positions +3, +4, and +5 of said polyribonucleotide, A ３ A ４ U ５ 34. The combination of claim 32 or 33, comprising a sequence comprising: (SEQ ID NO: 150).

35. The combination of any one of claims 1 to 34, wherein the composition further comprises one or more HSV glycoproteins.

36. 36. The combination of claim 35, wherein the one or more HSV glycoproteins comprise an HSV glycoprotein B (gB) antigen or an antigenic fragment thereof, an HSV glycoprotein E (gE) antigen or an antigenic fragment thereof, an HSV glycoprotein G (gG) antigen or an antigenic fragment thereof, an HSV glycoprotein H (gH) antigen or an antigenic fragment thereof, an HSV glycoprotein I (gI) antigen or an antigenic fragment thereof, an HSV glycoprotein L (gL) antigen or an antigenic fragment thereof, or a combination thereof.

37. 37. The combination of any one of claims 1 to 36, wherein the one or more polyribonucleotides are fully or partially encapsulated within a lipid nanoparticle, a polyplex (PLX), a lipidated polyplex (LPLX), or a liposome.

38. The combination according to any one of claims 1 to 37, wherein the polyribonucleotide sequences are in a single composition.

39. 39. A combination according to any one of claims 1 to 38 for use in the prevention of HSV infection, comprising administering one or more doses of the pharmaceutical composition to a subject.

40. 39. A combination according to any one of claims 1 to 38 for use in the treatment of an HSV infection comprising administering one or more doses of said pharmaceutical composition to a subject.

41. A composition comprising a combination according to any one of claims 1 to 38.

42. A pharmaceutical composition comprising a combination according to any one of claims 1 to 38.

43. A method comprising administering to a subject a combination according to any one of claims 1 to 38.

44. 42. A method comprising administering to a subject the composition of claim 41.

45. 43. A method comprising administering to a subject one or more doses of the pharmaceutical composition of claim 42.

46. The method according to any one of claims 43 to 45, wherein the method is a method for treating an HSV infection.

47. The method according to any one of claims 43 to 45, wherein the method is a method for preventing HSV infection.

48. 39. Use of a combination according to any one of claims 1 to 38 in the prevention of HSV infection.

49. 42. Use of the composition of claim 41 in the prevention of HSV infection.

50. 43. Use of the pharmaceutical composition of claim 42 in the prevention of HSV infection.

51. 40. The use of a combination according to any one of claims 1 to 38 in the treatment of HSV infection.

52. 42. Use of the composition of claim 41 in the treatment of HSV infection.

53. 43. Use of the pharmaceutical composition of claim 42 in the treatment of HSV infection.

54. (i) an amino acid sequence having at least 90% identity to SEQ ID NO: 213; and (ii) a polyribonucleotide encoding a polypeptide comprising an amino acid sequence having at least 90% identity to SEQ ID NO: 260; (i) an amino acid sequence having at least 90% identity to SEQ ID NO: 29; and (ii) a polyribonucleotide encoding a polypeptide comprising an amino acid sequence having at least 90% identity to SEQ ID NO:2; and (i) an amino acid sequence having at least 90% identity to SEQ ID NO: 30; and (ii) a polyribonucleotide encoding a polypeptide comprising an amino acid sequence having at least 90% identity to SEQ ID NO:

3.

55. a polyribonucleotide encoding a polypeptide comprising an amino acid sequence having at least 90% identity to SEQ ID NO: 159; a polyribonucleotide encoding a polypeptide comprising an amino acid sequence having at least 90% identity to SEQ ID NO: 70; and 55. The combination of claim 54, comprising a polyribonucleotide encoding a polypeptide comprising an amino acid sequence having at least 90% identity to SEQ ID NO:75.

Images