Expression systems for product manufacturing

Genetically modified Vibrio natriegens cells address the challenges of antibiotic-free biomolecule production by enhancing growth and plasmid yields, reducing endotoxin secretion, and preventing antibiotic resistance.

JP2026503706APending Publication Date: 2026-01-29ノベル バイオテクノロジー ユーエスエー インコーポレイテッド
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025543713
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-22
Filing Date
2024-01-25
Publication Date
2026-01-29

AI Technical Summary

Technical Problem

Existing bacterial expression systems face challenges in efficiently producing biomolecules without the use of antibiotics, which can lead to contamination and the emergence of multi-antibiotic-resistant microorganisms, and often result in high endotoxin secretion and suboptimal growth rates.

Method used

Genetically modified Vibrio natriegens bacterial cells with specific genetic modifications to reduce endotoxin secretion, eliminate or reduce expression of essential genes, and enhance plasmid replication, allowing for biomolecule production in antibiotic-free media with increased growth rates and plasmid yields.

Benefits of technology

The modified cells achieve rapid growth and high plasmid production in antibiotic-free conditions, reducing endotoxin secretion and minimizing the risk of antibiotic resistance, while maintaining efficient biomolecule expression.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026503706000001_ABST
    Figure 2026503706000001_ABST
Patent Text Reader

Abstract

The present disclosure provides engineered bacterial cells with one or more genetic modifications that result in increased production of expression products, such as increased production of plasmids with reduced occurrence of plasmid concatemers or multimers. Also disclosed herein are expression systems for product production in media with reduced antibiotic concentrations, as well as methods for producing cells for use in expression systems. The cells and expression systems can increase the growth rate and production of biomolecules produced in host bacterial host cells without the use of antibiotics, and produce products with little or no endotoxin.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] cross reference This application claims the benefit of U.S. Provisional Patent Application No. 63 / 481,499, filed January 25, 2023, and U.S. Provisional Patent Application No. 63 / 613,843, filed December 22, 2023, both of which are incorporated by reference herein in their entirety. Summary of the Invention [Means for solving the problem]

[0002] overview One aspect of the invention features a genetically modified Vibrio natriegens bacterial cell having a genetic modification relative to a parent Vibrio natriegens bacterial strain selected from the group consisting of the Vibrio natriegens bacterial strain deposited under accession number NCIMB857, the Vibrio natriegens bacterial strain deposited under accession number ATCC14048, the Vibrio natriegens bacterial strain deposited under accession number DSM759, and the Vibrio natriegens bacterial strain deposited under accession number NBRC15636, wherein the genetic modification results in reduced expression of a polypeptide encoded by chromosome 1 gene of the parent Vibrio natriegens bacterial strain, and the chromosome 1 gene has the polynucleotide sequence of SEQ ID NO:1 prior to modification. Also disclosed herein is a genetically modified Vibrio natriegens bacterial cell having a genetic modification relative to a parent Vibrio natriegens bacterial strain, wherein the genetic modification results in reduced expression of a polypeptide encoded by chromosome 1 gene of the parent Vibrio natriegens bacterial strain, and the chromosome 1 gene has a polynucleotide sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% sequence identity to SEQ ID NO:1 before modification. In some embodiments, the genetically modified Vibrio natriegens bacterial cell further comprises a genetic modification to one or more genes of a parent Vibrio natriegens bacterial strain, wherein the one or more genes are selected from the group consisting of DAM, DNS, KDO, KdsD, gutQ, kdsA, kdsB, waaA, msbA, yhiD, IpxL, IpxM, and any combination thereof. In other embodiments, the genetically modified Vibrio natriegens bacterial cell comprises a genetic modification to a DNS gene.In some embodiments, the genetically modified Vibrio natriegens bacterial cells comprise a genetic modification to the DAM gene. In some embodiments, the genetically modified Vibrio natriegens bacterial cells comprise a genetic modification to the KdsD gene, the IpxL gene, or the IpxM gene. In some embodiments, when the genetically modified Vibrio natriegens bacterial cells are cultured in a growth medium, the genetically modified Vibrio natriegens bacterial cells replicate with reduced secretion of endotoxin into the growth medium compared to the amount of endotoxin secreted by a comparable bacterial strain lacking the genetic modification replicated in the growth medium over the same amount of time. In some embodiments, the parent Vibrio natriegens bacterial strain is the Vibrio natriegens bacterial strain deposited under accession number NCIMB857. In other embodiments, the genetic modification comprises a deletion of a gene having the polynucleotide sequence of SEQ ID NO: 1.

[0003] In some embodiments, upon transformation of a template plasmid into genetically modified Vibrio natriegens bacterial cells, the genetically modified Vibrio natriegens bacterial cells express the template plasmid with reduced amounts of plasmid multimers or concatemers compared to the amount of plasmid multimers or concatemers produced in the same amount of time upon transformation of the template plasmid into bacterial cells of an equivalent bacterial strain lacking the genetic modification. In some embodiments, upon transformation of a template plasmid into genetically modified Vibrio natriegens bacterial cells, the genetically modified Vibrio natriegens bacterial cells replicate the template plasmid at an increased level or express the transgene encoded by the template plasmid at an increased level compared to the level of template plasmid replication or transgene expression, respectively, produced in the same amount of time upon transformation of the template plasmid into bacterial cells of an equivalent bacterial strain lacking the genetic modification. In some embodiments, upon transformation of the template plasmid into the genetically modified Vibrio natriegens bacterial cells, the genetically modified Vibrio natriegens bacterial cells replicate the template plasmid at an increased level compared to the level of template plasmid replication produced in the same amount of time upon transformation of the template plasmid into bacterial cells of an equivalent bacterial strain lacking the genetic modification.

[0004] In other embodiments, upon transformation of a template plasmid into genetically modified Vibrio natriegens bacterial cells, the genetically modified Vibrio natriegens bacterial cells replicate the template plasmid at a level at least 200% greater than the level of template plasmid replication produced in the same amount of time upon transformation of the template plasmid into bacterial cells of an equivalent bacterial strain lacking the genetic modification. In some embodiments, when the genetically modified Vibrio natriegens bacterial cells are cultured in a growth medium, the genetically modified Vibrio natriegens bacterial cells have a cell replication rate, as measured by optical density at 600 nm, that is at least 150% greater than the replication rate of bacterial cells of an equivalent bacterial strain lacking the genetic modification replicated in the growth medium over the same amount of time. In other embodiments, when the genetically modified Vibrio natriegens bacterial cells are cultured in a growth medium, the genetically modified Vibrio natriegens bacterial cells replicate with a doubling time of about 75 minutes, as measured by optical density at 600 nm. In some embodiments, the equivalent bacterial strain is a derivative of the K12 or B strain of E. coli. In some embodiments, the equivalent bacterial strain is a parent Vibrio natriegens bacterial strain.

[0005] Also provided herein are expression products produced by the genetically modified Vibrio natriegens bacterial cells disclosed herein.

[0006] Provided herein is a system for replicating genetically modified Vibrio natriegens bacterial cells, the system comprising: the genetically modified Vibrio natriegens bacterial cells disclosed herein; and a growth medium.

[0007] Another aspect of the present invention is a method for producing a genetically modified Vibrio natriegens bacterial cell, the method comprising the steps of: obtaining a parent Vibrio natriegens bacterial strain, wherein the parent Vibrio natriegens bacterial strain is selected from the group consisting of the Vibrio natriegens bacterial strain deposited under accession number NCIMB857, the Vibrio natriegens bacterial strain deposited under accession number ATCC14048, the Vibrio natriegens bacterial strain deposited under accession number DSM759, and the Vibrio natriegens bacterial strain deposited under accession number NBRC15636; and making a modification to the parent Vibrio natriegens bacterial strain that results in reduced expression of a polypeptide encoded by chromosome 1 gene, thereby producing a genetically modified Vibrio natriegens bacterial cell, wherein the chromosome 1 gene has the polynucleotide sequence of SEQ ID NO:1 before modification.

[0008] Also provided herein is a method for replicating a template plasmid with reduced generation of plasmid multimers or concatemers in genetically modified Vibrio bacterial cells, the method comprising the steps of obtaining genetically modified Vibrio bacterial cells, wherein the genetically modified Vibrio bacterial cells comprise a genetic modification for one or more genes selected from the group consisting of DAM, DNS, RecA, KDO, KdsD, gutQ, kdsA, kdsB, waaA, msbA, yhiD, IpxL1, IpxM, and any combination thereof; and transforming the template plasmid into the genetically modified Vibrio bacterial cells, thereby replicating the template plasmid in the genetically modified Vibrio bacterial cells, wherein the template plasmid is replicated in the genetically modified Vibrio bacterial cells with reduced levels of plasmid multimers or concatemers compared to the amount of plasmid multimers or concatemers produced in the same amount of time upon transformation of the template plasmid into bacterial cells of an equivalent bacterial strain lacking the genetic modification. In some embodiments, the plasmid is produced by a method described herein.

[0009] Another aspect of the invention features genetically modified cells, comprising: a genetic modification that results in the elimination or reduced expression of a polypeptide encoded by a nicotinamide adenine dinucleotide (NAD) biosynthesis gene, relative to an otherwise equivalent cell lacking the genetic modification; and an exogenously introduced polypeptide encoded by the nicotinamide adenine dinucleotide (NAD) biosynthesis gene, or a functional equivalent or functional variant thereof, wherein the genetically modified cells comprising the genetic modification exhibit reduced cell growth or cell survival in antibiotic-free medium in the absence of the exogenously introduced polypeptide, relative to an otherwise equivalent cell lacking the genetic modification; and the exogenously introduced polypeptide promotes growth of the genetically modified cells in antibiotic-free medium.

[0010] In some embodiments, the exogenously introduced polypeptide is introduced via a plasmid containing a sequence encoding the polypeptide. In some embodiments, the genetically modified cell comprises a modification to an NAD biosynthesis gene or a non-coding region operably linked to the NAD biosynthesis gene. In other embodiments, the NAD biosynthesis gene is selected from the group consisting of NadA, NadB, NadC, NadD, NadE1, and NadE2. In some embodiments, the genetically modified cell also comprises a genetic modification that results in reduced endotoxin secretion compared to an otherwise equivalent cell that does not comprise the genetic modification. In other embodiments, the genetic modification that results in reduced endotoxin secretion comprises a modification to a gene involved in endotoxin production or a non-coding region operably linked to a gene involved in endotoxin production. In some embodiments, the gene involved in endotoxin production is a lipopolysaccharide (LPS) biosynthesis gene. In other embodiments, the LPS biosynthesis gene is selected from the group consisting of KDO, KdsD, gutQ, kdsA, kdsB, waaA, msbA, yhiD, IpxL, and IpxM.

[0011] In some embodiments, the genetically modified cells also contain genetic modifications that result in less phosphodiester cleavage of DNA compared to otherwise equivalent cells that do not contain genetic modifications that result in less phosphodiester cleavage of DNA. In other embodiments, the genetic modifications that result in less phosphodiester cleavage of DNA include modifications to a deoxyribonuclease (Dns) gene or a non-coding region operably linked to a Dns gene. In some embodiments, at least one engineered Dns gene is replaced by one or more catalase genes. In other embodiments, the genetically modified cells also contain genetic modifications that result in less DNA methylation compared to otherwise equivalent cells that do not contain genetic modifications that result in less DNA methylation. In some embodiments, the genetic modifications that result in less DNA methylation include modifications to a DNA methylase (Dam) gene or a non-coding region operably linked to a Dam gene. In other embodiments, the genetically modified cells also contain genetic modifications that result in less DNA repair compared to otherwise equivalent cells that do not contain genetic modifications that result in less DNA repair. In some embodiments, the genetic modification that results in less DNA repair comprises a modification to a recombinase A (RecA) gene or a non-coding region operably linked to the RecA gene. In some embodiments, at least one engineered RecA gene is replaced by one or more catalase genes.

[0012] In some embodiments, the genetically modified cell is a genetically modified bacterial cell, hi other embodiments, the genetically modified bacterial cell is a Gram-negative bacterium. In some embodiments, the Gram-negative bacteria are Escherichia spp., Shigella spp., Salmonella spp., Campylobacter spp., Neisseria spp., Haemophilus spp., Aeromonas spp., Francisella spp., Yersinia spp., Klebsiella spp., Bordetella spp., Legionella spp., Citrobacter spp., Chlamydia spp., Brucella spp., Pseudomonas spp., Helicobacter spp., Moraxella spp., Stenotrophomonas spp., Bdellovibrio spp., Acinetobacter spp., Enterobacter spp., and Vibrio spp. In some embodiments, the bacteria is E. coli or V. Natriegens. In other embodiments, the plasmid also comprises one or more of a LacZa fragment, a multiple cloning site (MSC), a lac operator, a lac promoter, a cap binding site, an origin of replication, and M13 forward and reverse priming sites. In some embodiments, the exogenously introduced plasmid further comprises a sequence encoding a biomolecule or a functional fragment thereof.

[0013] Another aspect of the present invention features genetically modified cells, comprising: a genetic modification that results in reduced endotoxin secretion compared to an otherwise equivalent cell that does not contain the genetic modification; a genetic modification that results in the elimination or reduced expression of a polypeptide encoded by the nicotinamide adenine dinucleotide synthase E1 (NadE1) gene compared to an otherwise equivalent cell that lacks the genetic modification that results in the elimination or reduced expression of a polypeptide encoded by the NadE1 gene; and an exogenously introduced polypeptide encoded by the NadE1 gene or a functional equivalent or functional variant thereof. In some embodiments, the exogenously introduced polypeptide is introduced via a plasmid containing a sequence encoding the polypeptide. In some embodiments, the modified cell is a Gram-negative bacterial cell. In some embodiments, the Gram-negative bacterial cell is E. coli or V. Natriegens.

[0014] Another aspect of the present invention features genetically modified bacterial cells, including: a genetic modification that results in reduced endotoxin secretion compared to an otherwise equivalent cell that does not include the genetic modification; a genetic modification that results in the elimination or reduced expression of a polypeptide encoded by an essential gene compared to an otherwise equivalent cell that lacks the genetic modification that results in the elimination or reduced expression of the polypeptide encoded by the essential gene; an exogenously introduced polypeptide encoded by an essential gene or a functional equivalent or functional variant thereof; and a genetic modification that results in reduced DNA methylation compared to an otherwise equivalent cell that does not include the genetic modification; wherein the genetically modified bacterial cell is a Gram-negative bacterial cell. In some embodiments, the exogenously introduced polypeptide is introduced via a plasmid containing a sequence encoding the polypeptide.

[0015] One aspect of the present invention features a system for expression of genetically modified cells in antibiotic-free medium, comprising genetically modified cells and antibiotic-free medium. In some embodiments, the genetically modified cells, when grown in a growth medium, replicate a non-native plasmid with at least a 200% increase in plasmid production per mg compared to the corresponding production of the non-native plasmid in an equivalent expression system comprising wild-type K12 E. coli cells grown in the growth medium for the same amount of growth time. In other embodiments, the genetically modified cells replicate at a rate at least 150% faster in the growth medium compared to the corresponding cell replication rate of wild-type K12 E. coli cells grown in the growth medium for the same amount of growth time, as measured by optical density at 600 nm. In yet other embodiments, the genetically modified cells replicate in a doubling time of less than 75 minutes in the growth medium compared to the corresponding doubling time of wild-type K12 E. coli cells grown in the growth medium for the same amount of growth time, as measured by optical density at 600 nm. In some embodiments, the genetically modified cells replicate with reduced secretion of endotoxin into the growth medium compared to the corresponding doubling time of wild-type K12 E. coli cells grown in the growth medium for the same amount of growth time.

[0016] Another aspect of the invention features a method of modifying a cell, including: making a genetic modification that results in reduced endotoxin secretion compared to an otherwise equivalent cell that does not include the genetic modification that results in reduced endotoxin secretion; and making a genetic modification that results in the elimination or reduced expression of a polypeptide encoded by a nicotinamide adenine dinucleotide (NAD) biosynthesis gene compared to an otherwise equivalent cell lacking the genetic modification.

[0017] In some embodiments, the genetic modification that results in reduced endotoxin secretion comprises a modification to a gene involved in endotoxin production or a non-coding region operably linked to a gene involved in endotoxin production. In other embodiments, the endotoxin gene is a lipopolysaccharide (LPS) biosynthesis gene. In some embodiments, the LPS biosynthesis gene is selected from the group consisting of KDO, KdsD, gutQ, kdsA, kdsB, waaA, msbA, yhiD, IpxL, and IpxM. In other embodiments, the genetic modification that results in the elimination or reduced expression of a polypeptide encoded by an NAD biosynthesis gene comprises a modification to an NAD biosynthesis gene or a non-coding region operably linked to an NAD biosynthesis gene. In some embodiments, the NAD biosynthesis gene is selected from the group consisting of NadA, NadB, NadC, NadD, NadE1, and NadE2.

[0018] In some embodiments, the method also includes making a genetic modification that results in less phosphodiester cleavage of DNA compared to an otherwise equivalent cell that does not include the genetic modification that results in less phosphodiester cleavage of DNA. In other embodiments, the genetic modification that results in less phosphodiester cleavage of DNA includes a modification to a deoxyribonuclease (Dns) gene or a non-coding region operably linked to the Dns gene. In some embodiments, the Dns gene is replaced by one or more catalase genes. In other embodiments, the method also includes making a genetic modification that results in less DNA methylation compared to an otherwise equivalent cell that does not include the genetic modification that results in less DNA methylation. In some embodiments, the genetic modification that results in less DNA methylation includes a modification to a DNA methylase (Dam) gene or a non-coding region operably linked to the Dam gene.

[0019] In some embodiments, the method also comprises carrying out a genetic modification that results in less DNA repair compared to an otherwise equivalent cell that does not contain a genetic modification that results in less DNA repair.In other embodiments, the genetic modification that results in less DNA repair comprises a modification to a recombinase A gene (RecA) gene or a non-coding region operably linked to the RecA gene.In some embodiments, at least one engineered RecA gene is replaced by one or more catalase genes.In other embodiments, the cell is a bacterial cell. In still other embodiments, the bacterial cells are Escherichia spp., Shigella spp., Salmonella spp., Campylobacter spp., Neisseria spp., Haemophilus spp., Aeromonas spp., Francisella spp., Yersinia spp., Klebsiella spp., Bordetella spp., Legionella spp., Citrobacter spp., Chlamydia spp., Brucella spp., Pseudomonas spp., Helicobacter spp., Moraxella spp., Stenotrophomonas spp., Bdellovibrio spp., Acinetobacter spp., Enterobacter spp., and Vibrio spp. In other embodiments, the bacterial cells are E. coli or V. Natriegens.

[0020] In some embodiments, one or more genetic modifications are carried out using an endonuclease system.In other embodiments, the endonuclease system is a meganuclease, a zinc finger nuclease, a transcription activator-like effector-based nuclease (TALEN), or a CRISPR system.In some embodiments, the endonuclease system is a CRISPR system, and the CRISPR system is a CRISPR / Cas9 system.In other embodiments, the CRISPR / Cas9 system is provided on a first vector or plasmid, and the guide RNA (gRNA) is provided on a second vector or plasmid.In some embodiments, the genetic modifications that result in less phosphodiester cleavage of DNA are carried out using one or more guide RNA sequences selected from the group consisting of TTGGTGTCACTATTACCGCGCGG, CAGCTGCAATGCTGGCAAAGCGG, TCGAGCGGTAATAGTGAACGCGG, and TCCATTTCACTATTACCGAGCGG. In other embodiments, the genetic modification resulting in less DNA methylation is carried out using one or more guide RNA sequences selected from the group consisting of GCGTCGTTTATACCACGGAG, CCACGCTCAAATCCGCTCCCG, GACGCGTTAATGTTGTATCG, and AAGTTTGCGGTATTTGAAAG.

[0021] Another aspect of the invention features a method of expressing a plasmid in a genetically modified cell contained in antibiotic-free medium, where the genetically modified cell comprises a genetic modification that results in the elimination or reduced expression of a polypeptide encoded by a nicotinamide adenine dinucleotide (NAD) biosynthesis gene relative to an otherwise equivalent cell lacking the genetic modification, and the plasmid comprises a sequence encoding the polypeptide encoded by the NAD biosynthesis gene, or a functional equivalent or functional variant thereof; the method includes transforming the genetically modified cell with the plasmid; selecting for the transformed cells in antibiotic-free growth medium; and isolating the amplified plasmid from the transformed cell.

[0022] In some embodiments, the plasmid is produced by any of the methods described herein.

[0023] Another aspect of the invention features a method of expressing a biomolecule encoded by a plasmid in a genetically modified cell contained in antibiotic-free medium, wherein the genetically modified cell comprises a genetic modification that results in the elimination or reduced expression of a polypeptide encoded by a nicotinamide adenine dinucleotide (NAD) biosynthesis gene relative to an otherwise equivalent cell lacking the genetic modification, and the plasmid comprises a sequence encoding the polypeptide encoded by the NAD biosynthesis gene, or a functional equivalent or functional variant thereof; and a sequence encoding the biomolecule or a functional fragment thereof, the method including transforming the genetically modified cell with the plasmid; selecting for the transformed cells in antibiotic-free growth medium; and purifying the biomolecule or functional fragment thereof from the transformed cells.

[0024] In some embodiments, the biomolecule is produced by any of the methods described herein.

[0025] Incorporation by Reference All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

[0026] BRIEF DESCRIPTION OF THE DRAWINGS The features of the present disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure can be obtained by reference to the following detailed description and the accompanying drawings, which set forth illustrative embodiments, which utilize the principles of the present disclosure. [Brief explanation of the drawings]

[0027] [Figure 1] Figure 1 provides growth curves showing the faster growth rate of V. natriegens compared to E. coli. At 10 hours, AM2 showed the fastest growth rate, followed by AM3, AM1, AM4, AM5, and E. coli, respectively. V. natriegens (AM1-5) were grown under the following conditions: animal-component-free peptone (5-10 g / L), yeast extract (5-10 g / L), sodium chloride (5-30 g / L), double-distilled water to a total volume of 1000 mL, pH adjusted to 6.5-7.5, temperature ranged from 25°C to 37°C, and shaking at 100-300 rpm. E. coli was grown in optimal growth medium (LB broth) at 37°C with shaking at 100-300 rpm.

[0028] [Figure 2] FIG. 2 provides growth curves showing that the growth rate of an exemplary bacterial cell (NB) of the present disclosure is significantly higher (approximately 1.9-fold) compared to an E. coli-based system grown under identical conditions using the same growth medium.

[0029] [Figure 3]Figures 3A-3B provide a table and bar graphs showing that exemplary bacterial cells of the present disclosure have faster cell doubling times and greater plasmid yields compared to E. coli systems. Figure 3A shows the estimated doubling times of exemplary bacterial cells of the present disclosure compared to E. coli grown in the same medium, based on two independent runs performed in triplicate. Figure 3B shows that exemplary bacterial cells of the present disclosure have greater total plasmid yields (mg) for a variety of plasmids ranging in size from 2,500 bp to 7,900 bp. Estimates were based on E. coli growth times (approximately 12 to approximately 14 hours).

[0030] [Figure 4A] Figures 4A-4B provide exemplary plasmid DNA preparations isolated from unmodified strains or genetically modified bacterial cells containing genetic modifications for DNA strand exchange proteins described herein. Figure 4A (labeled "Plasmid Example 1") shows purified plasmid DNA isolated from two independent transformed colonies in either the unmodified strain or the genetically modified bacterial cells described herein. Figure 4B (labeled "Plasmid Example 2") shows similar results with an entirely different plasmid DNA. In both cases, it can be observed that the native strain produces undesired multimeric species in addition to the desired plasmid (resulting in a lower-quality preparation). [Figure 4B] Figures 4A-4B provide exemplary plasmid DNA preparations isolated from unmodified strains or genetically modified bacterial cells containing genetic modifications for DNA strand exchange proteins described herein. Figure 4A (labeled "Plasmid Example 1") shows purified plasmid DNA isolated from two independent transformed colonies in either the unmodified strain or the genetically modified bacterial cells described herein. Figure 4B (labeled "Plasmid Example 2") shows similar results with an entirely different plasmid DNA. In both cases, it can be observed that the native strain produces undesired multimeric species in addition to the desired plasmid (resulting in a lower-quality preparation). DETAILED DESCRIPTION OF THE INVENTION

[0031] Detailed Description It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not to be construed as restricting the present disclosure.

[0032] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter of the described invention. All documents or portions of documents cited in this application (including, but not limited to, patents, patent applications, articles, books, and treatises) are expressly incorporated herein by reference in their entirety for any purpose.

[0033] Disclosed herein are genetically modified bacterial cells, expression systems comprising the same, and methods for making expression systems comprising the same that increase the growth rate and production of biomolecules produced within the cells.

[0034] Antibiotic resistance genes and antibiotics themselves have become undesirable due to the potential for multi-antibiotic-resistant microorganisms to evolve in natural environments. Furthermore, the U.S. FDA's guidance for human somatic cell therapy and gene therapy recommends avoiding penicillin and other β-lactam antibiotics during manufacturing due to severe hypersensitivity reactions in patients, because these antibiotics can become contaminants after manufacturing. Accordingly, genetically modified bacterial cells are disclosed herein that have one or more genetic modifications that result in the elimination or reduced expression of an expression product (e.g., a polypeptide or gene) encoded by an essential gene, where the genetically modified bacterial cells can be transformed with a template plasmid, replicate the template plasmid with reduced levels of plasmid multimers or concatemers compared to otherwise identical cells lacking the genetic modifications, and complement through an exogenous polynucleotide (e.g., a plasmid) containing a sequence encoding the expression product. By constructing a polynucleotide encoding the expression product of an essential gene to produce a biomolecule, the cells can produce the biomolecule by plasmid selection without the use of antibiotics. Further genetic modifications to the cells to reduce or eliminate secretion of endotoxins into the growth medium, as well as genetic modifications to improve growth rate and plasmid / biomolecule yield, are also contemplated herein.

[0035] definition Unless otherwise indicated, all technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Unless otherwise indicated or clear from the context, the following terms have the following meanings:

[0036] As used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. For example, the term "sample" includes plural samples (including mixtures thereof).

[0037] Any reference herein to "or" is intended to encompass "and / or" unless otherwise indicated. As used herein, the term "and / or" includes any and all combinations of one or more of the associated listed items.

[0038] Use of the term "including" and other forms such as "includes" and "included" is not limiting.

[0039] As used herein, the term "comprise" and its grammatical equivalents specify the presence of stated features, integers, steps, operations, elements, and / or components, but do not exclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or groups thereof.

[0040] As used herein, the term "about" in reference to a numerical value or range of values ​​is understood to mean the stated numerical value and + / -10% of that numerical value, or for values ​​recited for a range, 10% below the recited lower limit and 10% above the recited upper limit, as well as variations of ±5%, ±1%, ±0.5%, and even ±0.1%.

[0041] The terms "% identical," "% identity," and "percent identity," or their grammatical equivalents, refer to the degree to which two sequences (nucleotides or amino acids) have identical residues at identical positions in an alignment. For example, "an amino acid sequence is X% identical to SEQ ID NO: Y" can refer to the % identity of an amino acid sequence to SEQ ID NO: Y, detailing that X% of the residues in the amino acid sequence are identical to the residues of the sequence disclosed in SEQ ID NO: Y. Generally, computer programs can be used for such calculations.

[0042] As used herein, the terms "essential gene" and "auxotroph" refer to a gene required for cell growth and / or survival, and an organism lacking the required gene is referred to as an auxotroph. Essential bacterial genes can be identified by targeted gene deletion and / or random mutagenesis and screening (see, e.g., Zhang and Lin, "DEG 5.0, a database of essential genes in both prokaryotes and eukaryotes," Nucl Acids Res, 2009;37:D455-D458 and Gerdes et al., "Essential Genes on metabolic maps," Curr Opin Biotechnol, 2006;17(5):448-456).

[0043] The term "enhance" or "increase" refers to an increase in a particular parameter by at least about 1.25-fold, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 8-fold, 10-fold, 12-fold, 15-fold, etc.

[0044] As used herein, the terms "inhibit" or "reduce" or grammatical variations thereof refer to a decrease or reduction in a particular level or activity of at least about 15%, 25%, 35%, 40%, 50%, 60%, 75%, 80%, 90%, 95% or more. In certain embodiments, inhibition or reduction results in little or essentially no detectable activity (at most, an insignificant amount, e.g., less than about 10%, 5%, 1%, 0.1%, or even 0.005%).

[0045] As used herein, "non-native" and "exogenous" nucleic acid sequences or polynucleotides refer to nucleic acid sequences not normally present in bacteria, such as extra copies of endogenous sequences, or heterologous sequences (such as sequences from a different species, strain, or substrain of bacteria, or sequences that are modified and / or mutated compared to an unmodified sequence from the same subtype of bacteria). In some embodiments, the non-native nucleic acid sequence is a synthetic, non-naturally occurring sequence (see, e.g., Purcell et al., 2013). A non-native nucleic acid sequence or polynucleotide can be a regulatory region, promoter, gene, and / or one or more genes within a gene cassette. In some embodiments, "non-native" refers to two or more nucleic acid sequences that are not found in the same relationship to each other in nature. The non-native nucleic acid sequences can be present on a plasmid or chromosome. Additionally, multiple copies of any regulatory region, promoter, gene, and / or gene cassette can be present in the bacterium, where one or more copies of the regulatory region, promoter, gene, and / or gene cassette can be mutated or otherwise altered as described herein. In some embodiments, the genetically engineered bacterium is engineered to contain multiple copies of the same regulatory region, promoter, gene, and / or gene cassette to enhance copy number or to contain multiple different components of the gene cassette that perform multiple different functions.

[0046] The terms "protein," "peptide," and "polypeptide" are used interchangeably to refer to an oligomer of two or more linked amino acids or derivatives thereof. The term "exogenously introduced polypeptide" refers to a polypeptide encoded by an exogenous polynucleotide.

[0047] As used herein, the terms "transforming" or "transformation" refer to the transfer of a nucleic acid fragment into a host bacterial cell, resulting in genetically stable inheritance. Host bacterial cells containing the transformed nucleic acid fragment are referred to as "recombinant" or "transgenic" or "transformed" organisms.

[0048] As used herein, the terms "complementary" and "complementarity" with respect to nucleic acid molecules or nucleotide sequences refer to the characteristic of a polynucleotide having nucleotides (C and G; or A and T) that base-pair with their Watson-Crick counterparts in a reference nucleic acid. For example, if every nucleotide in a polynucleotide base-pairs with a reference nucleic acid, the polynucleotide is said to be 100% complementary to the reference nucleic acid. In a double-stranded DNA or RNA sequence, the top (sense) strand sequence is generally understood to proceed from its 5' end to its 3' end, and the complementary sequence is therefore understood to be the sequence of the bottom (antisense) strand in the same orientation as the top strand. Following the same logic, the reverse sequence is understood to be the sequence of the top strand in the direction from its 3' end to its 5' end, while the "reverse complementary" or "reverse complementary" sequence is understood to be the sequence of the bottom strand in the direction from its 5' end to its 3' end. Each nucleotide in a double-stranded DNA or RNA molecule pairs with its Watson-Crick counterpart, called its complementary nucleotide.

[0049] The term "length" as applied to nucleic acids (polynucleotides) or polypeptides can be expressed as "kilobases" (kb) or "base pairs (bp)" and can be used interchangeably with the term "linked nucleosides." Thus, a length of 1 kb refers to a length of 1000 linked nucleosides, and a length of 500 bp refers to a length of 500 linked nucleosides. Similarly, a protein having a length of 500 linked amino acids can also be simply described as having a length of 500 amino acids.

[0050] As used herein, the term "guide nucleic acid" refers to a nucleic acid that comprises a nucleotide sequence that can hybridize to a target nucleic acid and to a portion of an additional nucleic acid bound by a nuclease.

[0051] The term "genetic modification" as used herein refers to any genetic change.Exemplary genetic modifications include, for example, those that increase, decrease, or eliminate the expression of genes, including the modification of native chromosomal or extrachromosomal genetic material.Exemplary genetic modifications also include the introduction of at least one plasmid; the modification, mutation, base deletion, base addition, base substitution, and / or codon modification of chromosomal or extrachromosomal gene sequence(s); gene overexpression; gene amplification; gene suppression; promoter modification or replacement; gene addition (either single copy or multiple copies); antisense expression or antisense suppression; or any other change to the genetic elements of host cells, regardless of whether this change causes a phenotype change.

[0052] As used herein, the terms "non-naturally occurring," "engineered," "genetically modified," "genetically modified," and grammatical equivalents are used interchangeably and indicate the involvement of human hands. The terms, when referring to a cell or expression system, refer to a cell or expression system that is substantially free of at least one other characteristic naturally associated with it in nature and / or that contains a modification (e.g., gene editing, chemical modification, nucleotide sequence, or amino acid sequence) that is not present in a naturally occurring cell or expression system.

[0053] The term "biomolecule" as used herein refers to a polypeptide or polynucleotide expressed by the cell or expression system of the present invention described herein.A biomolecule may be, for example, a therapeutic polypeptide or polynucleotide used to alleviate or relieve the symptoms of a disease or condition, or for health, nutritional, or cosmetic benefits in a subject.Examples include, but are not limited to, antibodies, messenger RNA, antisense oligonucleotides, and small interfering RNA.

[0054] Engineered bacterial cells Disclosed herein are engineered genetically modified cells that have one or more genetic modifications. Such cells can be modified to impart or neutralize specific cellular traits. In some embodiments, the cells are bacterial cells. In some embodiments, the cells can be gram-negative bacteria. For example, a non-limiting list of bacteria that may be useful for modifying specific cellular traits includes Escherichia spp., Shigella spp., Salmonella spp., Campylobacter spp., Neisseria spp., Haemophilus spp., Aeromonas spp., Francisella spp., Yersinia spp., Klebsiella spp., Bordetella spp., Legionella spp., Citrobacter spp., Chlamydia spp., Brucella spp., Pseudomonas spp., Helicobacter spp., Moraxella spp., Stenotrophomonas spp., Bdellovibrio spp., Acinetobacter spp., Enterobacter spp., and Vibrio spp.

[0055] In some embodiments, the genetically modified bacterium can be any organism of the Escherichia genus. Some examples of Escherichia organisms include, but are not limited to, Escherichia alberti, Escherichia coli, Escherichia fergusonii, Escherichia hermannii, Escherichia marmotae, and Escherichia vulneris; however, the expression system can be applied to any Escherichia sp. organism or any combination or subcombination of Escherichia spp. In some embodiments, the genetically modified bacterial cell is Escherichia coli. Examples of Escherichia coli include, but are not limited to, Escherichia coli K-12 strains (such as strains W3110 (ATCC 27325) and MG1655 (ATCC 47076)), Escherichia coli K5 strains (ATCC 23506), and Escherichia coli B.

[0056] In some embodiments, the genetically modified bacterium comprises one or more genetic modifications described herein, wherein the genetic modifications are for a particular bacterial strain. In some embodiments, the genetic modifications described herein are for the bacterial strain deposited under accession number NCIMB857. In some embodiments, the genetic modifications described herein are for the bacterial strain deposited under accession number ATCC14048. In some embodiments, the genetic modifications described herein are for the bacterial strain deposited under accession number NBRC15636. In some embodiments, the genetic modifications described herein are for the bacterial strain deposited under accession number DSM759. In some embodiments, the genetic modifications described herein are for the bacterial strain deposited under accession number CIP75.07. In some embodiments, the genetic modifications described herein are for the bacterial strain deposited under accession number LMD73.19. In some embodiments, the genetic modifications described herein are for the bacterial strain deposited under accession number LMG10935. In some embodiments, the genetic modifications described herein are made to the bacterial strain deposited under accession number CAIM12. In some embodiments, the genetic modifications described herein are made to the bacterial strain deposited under accession number CCUG16371. In some embodiments, the genetic modifications described herein are made to the bacterial strain deposited under accession number IFO15636. In some embodiments, the genetic modifications described herein are made to the bacterial strain deposited under accession number NCCB73019. In some embodiments, the genetic modifications described herein are made to the bacterial strain designated P. Baumann111. In some embodiments, the bacterial strain is NCIMB857.

[0057] In some embodiments, the bacterium can be any organism in the Escherichia family. In some embodiments, the bacterium can be any organism in the Vibrionaceae family. The Vibrio sp. organism can be any species in the Vibrio genus. Some examples of Vibrio organisms include, but are not limited to, Vibrio natriegens, Vibrio cholerae, Vibrio fischeri, Vibrio parahaemolyticus, Vibrio campbellii, and Vibrio vulnificus; however, the expression system can be applied to any Vibrio sp. organism or any combination or subcombination of Vibrio sp. organisms listed herein. In one embodiment, the engineered or genetically modified organism is Vibrio natriegens. In another embodiment, the engineered or genetically modified organism is Vibrio cholerae. In another embodiment, the engineered or genetically modified organism described herein is Vibrio fischeri. In another embodiment, the engineered or genetically modified organism is Vibrio parahaemolyticus. In another embodiment, the engineered or genetically modified organism described herein is Vibrio vulnificus. In some embodiments, the genetically modified bacterium described herein is Vibrio natriegens, deposited under accession number NCIMB857.

[0058] Vibrio spp. have several advantages as host cells over other bacteria for many molecular biology applications. One advantage is their rapid growth rate. One of the most time-intensive steps in modern biotechnology workflows is waiting for host cells to grow to sufficient density before DNA / protein / products can be harvested or phenotypes can be assessed. E. coli is considered to have one of the fastest growth rates compared to other organisms used in the biotechnology sector, and this has been one of its strengths. Because Vibrio spp. have a growth rate two to three times faster than commonly used E. coli strains, a dramatic reduction in the time required for host growth can be achieved, accelerating research efforts.

[0059] An additional advantage is the compatibility of Vibrio spp. with standard laboratory protocols: Unlike organisms that require specialized techniques or methods, Vibrio spp. are compatible with many standard cloning vectors, growth media, workflows, and commercially available kits developed for E. coli or for DNA recovery.

[0060] An additional advantage is the nutritional versatility of Vibrio spp., allowing them to grow on a variety of different growth media, including inexpensive, minimal media. This feature, combined with their rapid growth rate, allows for industrial-scale production in less time and at lower cost.

[0061] In some embodiments, the altered chromosome II may serve as a vector or plasmid or artificial chromosome carrying exogenous or heterologous DNA, and for the construction, cloning, maintenance, and / or recovery of large DNAs, and for the expression, production, and secretion of proteins or peptides or other biomolecules. In some embodiments, the polynucleotides, plasmids, vectors, or artificial chromosomes described herein containing DNA inserts or essential genetic elements can be replicated and maintained in a host organism, which may be Vibrio spp., E. coli, or other Gram-negative bacteria.

[0062] While specific types of modifications are provided below, the present disclosure encompasses bacterial cells having one or more of the types of modifications described below (including any combination of the modifications provided below).

[0063] Endotoxin-free (or reduced endotoxin levels) Disclosed herein are genetically modified bacterial cells that replicate with reduced secretion of endotoxins. Non-toxic or reduced-toxin (e.g., endotoxin-free) cells (e.g., Gram-negative bacterial cells, such as E. coli) are also provided herein. The present disclosure is not limited to a particular method for providing non-toxic cells. Lipopolysaccharides (LPS) are large molecules composed of lipids and polysaccharides that are bacterial toxins. They are found in the outer membrane of Gram-negative bacteria and consist of an O antigen, an outer core, and an inner core, all covalently linked. Lipopolysaccharides can have a substantial impact on human health, primarily through their interaction with the immune system. LPS is a potent activator of the immune system and a pyrogen (a factor that causes fever). In severe cases, LPS can play a role in inducing septic shock. There is evidence that, at lower levels and for longer periods, LPS may play an important and harmful role in autoimmunity, obesity, depression, and cellular aging. The term endotoxin is often used interchangeably with LPS. The LPS layer is essential for both the morphology and function of the OM of Gram-negative bacteria, resulting in their pathogenicity and survival. The LPS of various Gram-negative bacteria generally conforms to a common structural pattern, including, among other things, lipid A embedded in the outer membrane. Lipid A is the most conserved LPS domain among Gram-negative bacteria and is the structural component responsible for biological activity within the host. Lipid A in LPS can be referred to as the endotoxin moiety. Most Gram-negative bacteria possess an inner core containing at least one 2-keto-3-deoxy-D-mannooctulosonic acid (KDO) molecule. KDO is an essential component of LPS and is a conserved residue found in nearly all LPS structures. For example, the minimal LPS structure required for E. coli growth consists of two KDO residues attached to lipid A (KDO2-lipid A), demonstrating the importance of KDO in maintaining bacterial cell integrity and viability. The biosynthetic pathway of the LPS structure is initiated by d-arabinose 5-phosphate (A5P) isomerase (API / KdsD / yrbH), an enzyme that converts the pentose pathway intermediate d-ribulose 5-phosphate to A5P.Subsequently, A5P is condensed with phosphoenolpyruvate to form KDO8-phosphate (KD08P) by KDO8-phosphate synthase, which is hydrolyzed to KDO by KDO8-phosphate phosphatase, activated to the sugar nucleotide CMP-KDO by CMP-KDO synthase, and finally transferred from CMP-KDO to the acceptor lipid IVA by KDO synthase. Lauroyl acyltransferase and myristoyl-acyl carrier protein-dependent acyltransferase transfer the fatty acids lauric acid and myristic acid, respectively, to KDO2-lipid IVA to form the characteristic acyloxyacyl unit of hexaacylated KDO-lipid A.

[0064] Disruption of a gene in the LPS biosynthetic pathway is achieved by genetic modification of at least one gene encoding a protein selected from the group consisting of D-arabinose 5-phosphate isomerase, KD08P synthase, CMP-KDO synthetase, KD08P phosphatase, and KDO transferase. Such modification can be modification of the expression or coding sequence of the gene encoding the listed protein. Such modification can provide reduced or eliminated expression of one or more genes encoding such D-arabinose 5-phosphate isomerase, KD08P synthase, CMP-KDO synthetase, KD08P phosphatase, and / or KDO transferase.

[0065] The disruption of the outer membrane biosynthetic pathway can result from modification of or expression of at least one gene encoding a protein selected from the group consisting of gutQ, kdsD, kdsA, kdsB, kdsC, and waaA, where gutQ and kdsD encode D-arabinose 5-phosphate isomerase, kdsA encodes KD08P synthase, kdsB encodes CMP-KDO synthetase, kdsC encodes KD08P phosphatase, and waaA encodes KDO transferase. In some embodiments, the at least one genetic modification reduces or inhibits expression of a gene. In some embodiments, surviving host cells with an altered outer membrane biosynthetic pathway leading to disruption of the pathway include mutations in the expression or coding sequence of any one or more of genes encoding proteins selected from the group consisting of poly-β-1,6-N-acetyl-D-glucosamine outer membrane porin, poly-β-1,6-N-acetyl-D-glucosamine N-deacetylase, and / or poly-N-acetyl-D-glucosamine synthase, and display lipid lVA in the outer membrane. Such cells further have altered expression of at least one gene encoding a protein selected from the group consisting of lauroyl acyltransferase and myristoyl-acyl carrier protein-dependent acyltransferase, or the expression of at least one such gene. The alteration can be in the expression or coding sequence of a gene encoding the listed protein. Such alterations provide for reduced or eliminated expression of one or more genes encoding such lauroyl acyltransferase and myristoyl-acyl carrier protein-dependent acyltransferase. The lpxL and lpxM genes encode fatty acid transferases involved in membrane formation. In some embodiments, the host cell may have at least one gene selected from the group consisting of IpxL and / or IpxM or the expression of such at least one gene modified.

[0066] Provided herein are non-toxic or reduced-toxin (e.g., endotoxin-free) cells (e.g., Gram-negative bacterial cells such as E. coli). The disclosure is not limited to a particular method of providing non-toxic cells. In some embodiments, non-toxic cells are provided through suppression of LPS expression. The disclosure is not limited to a particular method of suppressing LPS expression. In some embodiments, LPS expression is suppressed through suppression of API / KdsD / yrbH protein expression. In some embodiments, API / KdsD / yrbH expression is suppressed through suppression of KDO protein expression. In some embodiments, KDO protein expression is suppressed, for example, through modification of the gutQ and kdsD genes. In some embodiments, KDO protein expression at the outer membrane is prevented due to the lack of association of the KDO protein with lipid IVA, resulting in only lipid IVA being transported to the outer membrane. For example, modification of the gutQ, kdsD, kdsA, kdsB, waaA msbA, and / or yhjD genes or mutation of any other biosynthetic, processing, or transport gene eliminates the formation or membrane presentation of the (KDO)2-Lipid IVA complex, e.g., only Lipid IVA molecules are transported to the outer membrane without subsequent LPS formation.

[0067] In some embodiments, non-toxic Gram-negative bacteria are used as hosts for the production of endotoxin-free biomolecules. The present disclosure is not limited to a particular biomolecule. Traditionally, the production of biomolecules in Gram-negative bacteria has been plagued by the presence of endotoxins derived from the bacterial host, whether they are outer membrane vesicles for vaccines, LPS-type molecules (such as monophosphoryl lipid A (MPLA)) used as adjuvants, recombinant pharmaceutical proteins, macromolecules, or DNA for mammalian cell transfection / gene therapy. The immunogenic potential of LPS is well documented, making endotoxin contamination of therapeutic molecules a concern. Current production strategies to mitigate endotoxin contamination include various purification techniques (such as commercially available kits for purifying endotoxin-free DNA plasmids) followed by assays to measure endotoxin levels. Thus, the non-toxic Gram-negative bacterial cells (e.g., endotoxin-free cells) of the present disclosure provide an improved method for isolating endotoxin-free biomolecules. Therefore, some cells of the present disclosure do not produce endotoxins, and therefore, such purification steps are not required. For example, the endotoxin-free cells of the present disclosure can be hosts for the production of commercially important biomolecules in an endotoxin-free environment using Gram-negative bacteria. Furthermore, cells containing modifications of genes encoding any one or more of D-arabinose 5-phosphate isomerase, KD08P synthase, CMP-KDO synthetase, KD08P phosphatase and / or KDO transferase, ATP-dependent translocator, inner membrane protein (e.g., gutQ, kdsD, kdsA, kdsB, waaA, msbA, yhjD genes), or any other biosynthetic, processing (e.g., IpxL or IpxM), or transport bacterial genes can be hosts for the production of commercially important biomolecules in an endotoxin-free environment using Gram-negative bacteria.

[0068] In some embodiments, a gene involved in endotoxin production described herein is itself modified to eliminate or reduce endotoxin production. In some embodiments, a non-coding portion of a gene involved in endotoxin production described herein (such as a promoter, polyadenylation site, 5' untranslated region, or 3' untranslated region) is modified to eliminate or reduce endotoxin production. In some embodiments, an upstream or downstream gene that affects endotoxin production described herein is modified to eliminate or reduce endotoxin production.

[0069] In some embodiments, the lauroyl and / or myristoyl acyltransferase polypeptide to be modified has at least 85% amino acid sequence identity to Genbank Accession No. ANQ15862, or a fragment thereof having lauroyl and / or myristoyl transferase activity. The amino acid sequence of an exemplary lauroyl and / or myristoyl acyltransferase is as follows: [ka]

[0070] In some embodiments, the lauroyl and / or myristoyl transferase polynucleotide encodes a lauroyl and / or myristoyl transferase polypeptide. The polynucleotide sequence of an exemplary lauroyl and / or myristoyl transferase to be modified is provided in Genbank Accession No. CP016347 (region: 198524..199474), which is reproduced below: [ka]

[0071] In some embodiments, the lauroyl and / or myristoyl acyltransferase polypeptide to be modified has at least 85% amino acid sequence identity to Genbank Accession No. ANQ17067, or a fragment thereof having lauroyl and / or myristoyl transferase activity. The amino acid sequence of an exemplary lauroyl and / or myristoyl acyltransferase is as follows: [ka]

[0072] In some embodiments, the lauroyl and / or myristoyl-transferase polynucleotide encodes a lauroyl and / or myristoyl-transferase polypeptide. The polynucleotide sequence of an exemplary lauroyl and / or myristoyl-transferase to be modified is provided in Genbank Accession No. CP016347 (region: 1624028..1624978), which is reproduced below: [ka]

[0073] In some embodiments, the D-arabinose 5-phosphate isomerase (KdsD / yrbH) polypeptide to be modified has at least 85% amino acid sequence identity to Genbank Accession No. ANQ18079, or a fragment thereof that has isomerase activity. An exemplary KdsD amino acid sequence is as follows: [ka]

[0074] In some embodiments, the D-arabinose 5-phosphate isomerase (KdsD / yrbH) polynucleotide encodes a KdsD polypeptide. An exemplary KdsD polynucleotide sequence to be modified is provided in Genbank Accession No. CP016347 (region: 2865123..2866094), which is reproduced below: [ka]

[0075] Endotoxin refers to the complex lipopolysaccharide (LPS) substance present in the outer membrane of Gram-negative organisms, such as E. coli and Vibrio spp. These substances, collectively referred to as "endotoxins," are toxic to mammals and other vertebrates. Endotoxins can be released when cells are ruptured or otherwise disintegrated. Thus, when these organisms are used to clone nucleic acids, vectors, or plasmids, or to produce proteins, polypeptides, or peptides, or other biomolecules, the products may be contaminated with unacceptable levels of endotoxins. The engineered or genetically modified cells described herein (e.g., bacterial cells of Escherichia spp. organisms, Vibrio spp. organisms, etc.) are substantially lower in in vitro endotoxin assays compared to native, unmodified, or wild-type organisms under identical conditions; i.e., the recombinant organisms produce or contain substantially less endotoxin or LPS substance or are substantially less endotoxic to humans and other mammals (e.g., dogs, cats, horses, cows, or pigs). Substantially less endotoxin or less endotoxicity means that the organism may have less than 50%, or less than 40%, or less than 30%, or less than 20%, or less than 10%, or less than 5%, or less than 3%, or less than 2%, or less than 1%, or less than 0.90%, or less than 0.50%, or less than 0.10% of its endotoxin content compared to a corresponding unmodified or wild-type bacterial cell (e.g., Escherichia spp. organism, Vibrio spp. organism) (or one lacking the genetic modification for API, lpxL, and / or lpxM) cultured and measured under the same conditions. The endotoxin content or concentration, or endotoxicity, of the compared organisms can be measured using any commonly accepted in vitro endotoxin assay (any of those accepted in the art as a valid endotoxin assay, such as the HEKTm-Blue LPS assay, which can measure activation of the TLR4 receptor in response to an endotoxin sample from an organism).

[0076] Additionally, the engineered or genetically modified cells described herein can produce endotoxin concentrations that are less than 50%, or less than 40%, or less than 30%, or less than 20%, or less than 10%, or less than 5%, or less than 1%, or less than 0.50%, or less than 0.10% of the endotoxin concentrations produced by unmodified or wild-type E. coli organisms (or those without genetic modifications to LPS biosynthetic genes such as API, lpxL, and / or lpxM) cultured under corresponding conditions. In some embodiments, BL21(DE3) can be used as the unmodified or wild-type E. coli. Endotoxin concentrations or levels can be determined using any commonly accepted LPS or endotoxin assay (such as an art-accepted in vitro LPS or endotoxin assay).

[0077] Additionally, the engineered or genetically modified cells described herein may produce an endotoxin-induced immune response that is less than 50%, 40%, 30%, 20%, 10%, 5%, 1%, 0.50%, or 0.10% of the response of E. coli organisms containing deletions of gutQ, kdsD, lpxL, lpxM, pagP, lpxP, and eptA, or any subcombination thereof, produced under identical or comparable conditions. The E. coli organisms being compared may also contain compensatory mutations in the msbA gene (e.g., msbA148). (E. coli cells containing all of the above deletions and msbA mutations are commercially available under the trademark ClearColi®.) Endotoxin-induced immune responses (or endotoxicity) can be determined or measured using in vitro LPS or endotoxin assays. The immune response or endotoxicity can be relative to or relative to an immune response in human or other mammalian cells, and activation of the TLR4 receptor can be measured. [Also, the engineered or genetically modified cells described herein can have or produce less endotoxin (lower amounts, as described herein and above) than the aforementioned E. coli organisms (e.g., "ClearColi®" organisms), and endotoxin levels can be measured using endotoxin-induced immune responses.]

[0078] The engineered or genetically modified cells described herein can have an average endotoxin level of less than 50 EU / ml, or less than 25 EU / ml, or less than 15 EU / ml, or less than 10 EU / ml, or less than 5 EU / ml, or less than 5 EU / ml, or less than 4 EU / ml, or less than 3 EU / ml, or less than 2 EU / ml, or less than 1 EU / ml, or less than 0.80 EU / ml, or less than 0.70 EU / ml, or less than 0.50 EU / ml, or less than 0.30 EU / ml, or less than 0.20 EU / ml, or less than 0.10 EU / ml, as measured by an in vitro endotoxin assay for purified LPS molecules. Endotoxin levels can be measured according to any commonly accepted method. Additionally, any of the cells described herein can have the stated endotoxin levels disclosed herein within plus or minus 10% of the stated values.

[0079] essential genes Disclosed herein are cells containing genetic modifications that result in the elimination or reduced expression of a polypeptide encoded by an essential gene, the absence of which is detrimental to cell growth, compared to otherwise equivalent cells lacking such genetic modifications. In some embodiments, the genetic modifications include the disabling, reduction, or knockout of one or more essential genes necessary for cell growth and / or survival. Any essential gene can be disabled, reduced, or knocked out. For example, an enzyme required for the metabolism of a particular nutrient (e.g., an amino acid, sugar, or other nutrient) or the synthesis of a particular nutrient can be disabled, and the resulting cell will grow and / or survive only if that nutrient is provided. Other essential genes include, but are not limited to, DNA synthesis genes (such as thyA), cell wall synthesis genes (such as dapA), and amino acid genes (such as serA and metA). In some embodiments, the reduction or elimination of a polypeptide encoded by an essential gene can be cured by the introduction of the polypeptide, delivered exogenously either directly or indirectly, to re-establish cell survival in the presence of the polypeptide. For example, a plasmid encoding a copy of an essential gene, or a functional equivalent or variant thereof, can be introduced to facilitate cell survival. The exogenous copy of the essential gene, or a functional equivalent or variant thereof, can then be used as a marker of cell transformation.

[0080] Examples of other essential genes that can be disabled, reduced, or knocked out in the genetically modified bacteria of the present disclosure include yhbV, yagG, hemB, secD, secF, ribD, ribE, thiL, dxs, ispA, dnaX, adk, hemH, lpxH, cysS, fold, rplT, infC, thrS, nadE, gapA, yeaZ, aspS, argS, pgsA, yefM, metG, folE, yejM, gyrA, nrdA, nrdB, folC, accD, fabB, gltX, ligA, zipA, dapE, dapA, der, hisS, ispG, suhB, tadA, acpS, era, me, ftsB, eno, pyrG, chpR, lgt, fbaA, pgk, yqgD, m etK, yqgF, plsC, ygiT, pare, ribB, cca, ygjD, tdcF, yraL, yihA, ftsN, murl, murB, birA, secE, nusG , rplJ, rplL, rpoB, rpoC, ubiA, plsB, lexA, dnaB, ssb, alsK, groS, psd, om, yjeE, rpsR, chpS, ppa, v alS, yjgP, yjgQ, dnaC, ribF, IspA, ispH, dapB, folA, imp, yabQ, ftsL, ftsl, murE, murF, mraY, murD , ftsW, murG, murC, ftsQ, ftsA, ftsZ, lpxC, secM, secA, can, folK, hemL, yadR, dapD, map, rpsB, infB ,nusA, ftsH, obgE, rpmA, rplU, ispB, murA, yrbB, yrbK, yhbN, rpsl, rplM, degS, mreD, mreC, mreB, accB, accC, yrdC, def , fmt, rplQ, rpoA, rpsD, rpsK, rpsM, entD, mrdB, mrdA, nadD, hlepB, rpoE, pssA, yfiO, rplS, trmD, rpsP, ffh, grpE, vfjB.csrA, ispF, ispD, rplW, rplD, rplC, rpsJ, fusA, rpsG, rpsL, trpS, yrfF, asd, rpoH, ftsX, ftsE, ftsY, frr, dxr, ispU, rfaK, kdtA, coaD, rpmB, dfp, dut, gmk, spot, gyrB, dnaN, dnaA, rpmH, mpA, yidC, tnaB, glmS, glmU, wzyE, hemD, hemC, yigP, ubiB, ubiD, hemG, secY, rplO, rpmD, rpsE, rplR, rplF, rpsH, rpsN, rplE, rplX, rplN, rpsQ, rpmC, rplP, rpsC, rplV, rpsS, rplB, cdsA, yaeL, yaeT, lpxD, fabZ, lpxA, lpxB, dnaE, accA, tilS, proS, yafF, tsf, pyrH, olA, rlpB, leuS, lnt, glnS, fldA, cydA, infA, cydC, ftsK, lolA, serS, rpsA, msbA, lpxK, kdsB, mukF, mukE, mukB, asnS, fab A, mviN, rne, yceQ, fabD, fabG, acpP, tmk, holB, lolC, lolD, lolE, purB, ymffC, minE, mind, pth, rsA, ispE, lolB, hemA, prfA, prmC, kdsA, topA, ribA, fabl, racR, dicA, ydfB, tyrS, ribC, ydiL, pheT, pheS, yhhQ, bcsB, glyQ, yibJ, and gpsA, among others, but not limited to these.

[0081] In some embodiments, the essential genes described herein themselves are modified to eliminate or reduce expression of the polypeptide encoded by the essential gene. In some embodiments, non-coding portions of the essential genes described herein (such as promoters, polyadenylation sites, 5' untranslated regions, or 3' untranslated regions) are modified to eliminate or reduce expression of the polypeptide encoded by the essential gene. In some embodiments, upstream or downstream genes that affect expression of the polypeptide encoded by the essential genes described herein are modified to eliminate or reduce expression of the polypeptide encoded by the essential gene.

[0082] In some embodiments, the genetically modified bacterial cell has a genetic modification to an essential gene, wherein the essential gene is an endogenous DNA strand exchange gene. In some embodiments, the endogenous DNA strand exchange gene has the following polynucleotide sequence: [ka]

[0083] In some embodiments, the genetically modified bacterial cell has a genetic modification to an essential gene, wherein the essential gene is an endogenous DNA strand exchange gene. In some embodiments, the endogenous DNA strand exchange gene has the following polynucleotide sequence: [ka]

[0084] One central biosynthetic pathway involves the biosynthesis of nicotinamide adenine dinucleotide (NAD). NAD is a coenzyme central to metabolism. Found in all living cells, NAD is called a dinucleotide because it consists of two nucleotides linked through their phosphate groups. One nucleotide contains the adenine nucleobase, and the other contains nicotinamide. NAD exists in two forms, oxidized and reduced, abbreviated as NAD+ and NADH (H stands for hydrogen), respectively.

[0085] In metabolism, nicotinamide adenine dinucleotide participates in oxidation-reduction reactions, carrying electrons from one reaction to another. Thus, the cofactor is found in two forms within cells: NAD+, an oxidizing agent, which accepts electrons from other molecules and becomes reduced. This reaction also involves H+ to form NADH, which can then be used as a reducing agent to donate electrons. These electron transfer reactions are the primary function of NAD. However, it is also used as a substrate for enzymes in other cellular processes, most notably post-translational modifications, which add or remove chemical groups to or from proteins.

[0086] In living organisms, NAD can be synthesized de novo from simple building blocks, either tryptophan or aspartate. As a general rule, most prokaryotes utilize the aspartate de novo pathway, in which the nicotinate portion of NAD is synthesized from aspartate. Briefly, aspartate is converted to iminoaspartate by nadB, which is then converted to quinolinic acid by nadA. Quinolinic acid is then converted to nicotinic acid mononucleotide by nadC, which is then converted to nicotinic acid adenine dinucleotide by nadD. Finally, nicotinic acid adenine dinucleotide is converted to nicotinamide adenine dinucleotide (NAD) by either nadE1 or nadE2 through either the amine-dependent or glutamine-dependent pathway.

[0087] In some embodiments, the genetically modified cells of the present disclosure can include genetic modifications that result in the elimination or reduction of expression of a polypeptide encoded by any one or more of the genes associated with the NAD biosynthetic pathway, including nadA, nadB, nadC, nadD, nadE1, and nadE2.

[0088] In some embodiments, the modified nicotinamide adenine dinucleotide synthetase (NadE) polypeptide has at least 85% amino acid sequence identity to Genbank Accession No. UUI14161.1, or a fragment thereof that has synthetase activity. An exemplary NadE amino acid sequence is as follows: [ka]

[0089] In some embodiments, the nicotinamide adenine dinucleotide synthetase (NadE) polynucleotide encodes a NadE polypeptide. The polynucleotide sequence of an exemplary NadE to be modified is provided in Genbank Accession No. CP101906.1, which is reproduced below: [ka]

[0090] methylase enzyme In some embodiments, genetically modified cells can contain genetic modifications that result in reduced DNA methylation. If a DNA polymerase makes an error during DNA synthesis, resulting in mismatched base pairs or small insertions or deletions, the cell will repair the DNA through a pathway called mismatch repair. However, the cell must be able to distinguish between the template strand and the newly synthesized strand. In some bacteria, DNA strands are methylated by Dam methylase, and therefore, immediately after replication, the DNA will be hemimethylated. The repair enzyme MutS binds to mismatches in the DNA, recruits MutL, and subsequently activates the endonuclease MutH. MutH binds to hemimethylated GATC sites and, when activated, selectively cleaves the unmethylated daughter strand, allowing helicases and exonucleases to excise the nascent strand in the region surrounding the mismatch. The strand is then resynthesized by DNA polymerase III.

[0091] Described herein are genetically modified cells and expression systems comprising genetically modified methylase enzymes (e.g., with reduced or disabled activity), as well as uses thereof. In some embodiments, the engineered or genetically modified methylase enzyme is disabled, thereby disabling the mismatch repair pathway. The disabled methylase enzyme can enable more efficient gene editing than a comparable cell in which the native methylase enzyme is present. In other words, gene editing in cells with disabled methylases can persist longer in the cells without being repaired by the mismatch repair pathway, compared to cells containing the native methylase enzyme.

[0092] In some embodiments, the gene encoding a methylase described herein is itself modified to eliminate or reduce expression of the methylase. In some embodiments, a non-coding portion of a gene encoding a methylase described herein (such as a promoter, polyadenylation site, 5' untranslated region, or 3' untranslated region) is modified to eliminate or reduce expression of the methylase. In some embodiments, an upstream or downstream gene that affects expression of a methylase described herein is modified to eliminate or reduce the methylase.

[0093] In some embodiments, the genetically modified methylase enzyme comprises a modified adenine methylase enzyme or a modified cytosine methylase enzyme. In some embodiments, the modified methylase enzyme comprises a modified Class I methylase or a modified Class II methylase. In other embodiments, the modified methylase can comprise a modified histone methylase, a modified N-terminal methylase, a modified DNA adenine methylase (Dam), a modified RNA methylase, a modified natural product methylase, a modified non-S-adenosylmethionine (SAM)-dependent methylase, or a modified radical SAM methylase. In some embodiments, the modified methylase is an RNA methylase.

[0094] In some embodiments, the modified DNA adenine methylase (Dam) polypeptide has at least 85% amino acid sequence identity to Genbank Accession No. ANQ18149.1, or a fragment thereof that has methylase activity. An exemplary DNA adenine methylase amino acid sequence is as follows: [ka]

[0095] In some embodiments, the DNA adenine methylase (Dam) polynucleotide encodes a DNA adenine methylase polypeptide. The polynucleotide sequence of an exemplary DNA adenine methylase to be modified is provided in Genbank Accession No. CP016347.1, which is reproduced below: [ka]

[0096] Deoxyribonuclease In some embodiments, the genetically modified bacterial cells can contain a genetic modification that results in less phosphodiester cleavage of DNA compared to otherwise equivalent cells that do not contain the genetic modification. In some embodiments, the genetic modification that results in less phosphodiester cleavage of DNA comprises a modification to a deoxyribonuclease (Dns) enzyme. Dns is an enzyme that catalyzes the hydrolytic cleavage of phosphodiester bonds in the DNA backbone, thus degrading DNA. A wide variety of deoxyribonucleases are known, each with different substrate specificities, chemical mechanisms, and biological functions.

[0097] Some DNases cut or "cut" only residues at the ends of DNA molecules (exodeoxyribonucleases, a type of exonuclease); others cut anywhere along the strand (endodeoxyribonucleases, a subset of endonucleases). Some DNases are fairly promiscuous about the DNA sequence they cut, while others, including restriction enzymes, are highly sequence-specific. Some cut only double-stranded DNA; others are specific for single-stranded molecules; and still others are active on both.

[0098] In some embodiments, the genetically modified cells can include genetic modifications that result in the reduction or elimination of polypeptides encoded by one or more deoxyribonuclease genes, hi some embodiments, one or more disabled Dns genes are replaced with one or more catalase genes.

[0099] In some embodiments, the genes encoding the methylases described herein are themselves modified to eliminate or reduce expression of the desoxyribonuclease genes described herein. In some embodiments, non-coding portions of the desoxyribonuclease genes described herein (such as promoters, polyadenylation sites, 5' untranslated regions, or 3' untranslated regions) are modified to eliminate or reduce expression of the desoxyribonuclease genes described herein. In some embodiments, upstream or downstream genes that affect expression of the desoxyribonuclease genes described herein are modified to eliminate or reduce expression of the desoxyribonuclease genes.

[0100] In some embodiments, the catalase polypeptide to be added has at least 85% amino acid sequence identity to Genbank Accession No. EPM39386.1, or a fragment thereof having catalase activity. An exemplary catalase amino acid sequence is as follows: [ka]

[0101] In some embodiments, the catalase polynucleotide encodes a catalase polypeptide. An additional exemplary catalase polynucleotide sequence is provided in Genbank Accession No. ATFJ01000037.1, which is reproduced below: [ka]

[0102] In some embodiments, the modified deoxyribonuclease (Dns) polypeptide has at least 85% amino acid sequence identity to Genbank Accession No. ANQ17872.1, or a fragment thereof that has nuclease activity. An exemplary deoxyribonuclease amino acid sequence is as follows: [ka]

[0103] In some embodiments, the deoxyribonuclease (Dns) polynucleotide encodes a deoxyribonuclease polypeptide. The polynucleotide sequence of an exemplary deoxyribonuclease to be modified is provided in Genbank Accession No. CP016347.1, which is reproduced below: [ka]

[0104] RecA recombinase In some embodiments, genetically modified bacterial cells can contain a genetic modification that results in reduced DNA repair compared to otherwise equivalent cells that do not contain the genetic modification. In some embodiments, the genetic modification is directed to the recombinase A (RecA) gene. RecA recombinase has multiple functions, all related to DNA repair. E. coli strains are often genetically modified to contain mutant recA alleles, which ensure the stability of extrachromosomal DNA segments known as plasmids. In a process called transformation, plasmid DNA is incorporated into bacteria under various conditions (e.g., heat shock, electroporation). Bacteria containing exogenous plasmids are called "transformants." Transformants retain the plasmid throughout cell division so that it can be recovered and used in other applications. In the absence of a functional RecA polypeptide, the exogenous plasmid DNA remains unchanged by the bacteria.

[0105] In some embodiments, the genetically modified bacterial cell can contain a genetic modification that results in a reduction or disabling of the RecA recombinase polypeptide, which can increase the stability of the intact plasmid. In other embodiments, the disabled RecA recombinase polypeptide can allow for the purification of the intact plasmid from the bacterial culture, which can then be used in other applications, such as, for example, high-fidelity PCR amplification of the original plasmid sequence. In other embodiments, one or more disabled RecA genes are replaced with one or more catalase genes (such as the exemplary catalase sequences provided herein).

[0106] In some embodiments, the gene encoding the RecA described herein itself is modified to eliminate or reduce expression of the polypeptide encoded by RecA. In some embodiments, a non-coding portion of the RecA gene described herein (such as a promoter, polyadenylation site, 5' untranslated region, or 3' untranslated region) is modified to eliminate or reduce expression of the polypeptide encoded by the RecA described herein. In some embodiments, an upstream or downstream gene that affects expression of the RecA gene described herein is modified to eliminate or reduce expression of the RecA polypeptide.

[0107] In some embodiments, the modified RecA recombinase polypeptide has at least 85% amino acid sequence identity to Genbank Accession No. AAO18662.1, or a fragment thereof that has DNA repair activity. An exemplary RecA recombinase amino acid sequence is as follows: [ka]

[0108] In some embodiments, the RecA recombinase polynucleotide encodes a RecA recombinase polypeptide. An exemplary RecA recombinase polynucleotide sequence (promoter region and complete coding sequence) to be modified is provided in Genbank Accession No. AY198129.1, which is reproduced below: [ka]

[0109] Polynucleotides, Plasmids, Vectors, and Replicons Disclosed herein are vectors for use with the genetically modified cells described herein, which can be any particle (e.g., a plasmid, cosmid, lambda phage) used as a vehicle to artificially transport a foreign nucleic acid sequence—usually DNA—into another cell, where it can be replicated and / or expressed. Four major types of vectors are plasmids, viral vectors, cosmids, and artificial chromosomes. In some embodiments, a vector, plasmid, or replicon containing one or more essential genes and biomolecules is used to transform a host cell.

[0110] Extrachromosomal DNA (e.g., a plasmid, vector, or replicon) can be transformed into cells by any suitable method, for example, bacterial conjugation (e.g., E. coli to Vibrio spp.), electroporation of electrocompetent cells, chemical transformation into chemically competent cells, biolistics, transduction, or via natural competence. The efficiency of transformation can be, for example, at least 1 x 10 using any of the above methods. 5 or at least 1×10 6 , at least 1 x 10 7 , at least 1 x 10 8 cfu / μg DNA.

[0111] Plasmids are small extrachromosomal DNA molecules within a cell that are physically separate from chromosomal DNA and can replicate independently. Plasmids can be considered replicons, units of DNA that can replicate autonomously within a suitable host.

[0112] In some embodiments, a viral vector is used. In some of these embodiments, the viral vector is AAV. In some embodiments, the viral vector corresponds to a virus of a specific serotype. In some examples, the serotype is selected from AAV1 serotype, AAV2 serotype, AAV3 serotype, AAV4 serotype, AAV5 serotype, AAV6 serotype, AAV7 serotype, AAV8 serotype, AAV9 serotype, AAV10 serotype, AAV11 serotype, AAV12 serotype, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, and any other AAV currently known or later discovered. For example, see Bernard N. Fields et al., VIROLOGY, volume 2, chapter 69 (4th edition, Lippincott-Raven Publishers). Several relatively new AAV serotypes and clades have been identified (see, for example, Gao et al., (2004) Virology 78:6381-6388; Morris et al., (2004) Virology 33-375-383; and Table 3). In some embodiments, the AAV vector is a recombinant vector, a hybrid AAV vector, a chimeric AAV vector, a self-complementary AAV (scAAV) vector, a single-stranded AAV, or any combination thereof. The scAAV genome contains both DNA strands that can anneal to each other to form double-stranded DNA.

[0113] In some embodiments, the method for producing a delivery vector herein comprises packaging an engineered guide disclosed herein into an AAV vector. In some examples, the method for producing a delivery vector described herein comprises: (a) introducing into a cell a viral genome comprising (i) a polynucleotide encoding any of the engineered guides disclosed herein; and (ii) a replication (Rep) gene and a capsid (Cap) gene encoding a wild-type AAV capsid protein or a modified version thereof; (b) expressing the wild-type AAV capsid protein or a modified version thereof in the cell; (c) assembling AAV particles; and (d) packaging a polynucleotide encoding the engineered polynucleotide into the AAV particle, thereby producing an AAV delivery vector. In some embodiments, the engineered guide, promoter, stuffer sequence, and any combination thereof disclosed herein can be packaged into an AAV vector. In some examples, the AAV vector can package 1, 2, 3, 4, or 5 copies of the engineered guide. In some embodiments, the recombinant vector comprises one or more inverted terminal repeats, the inverted terminal repeats comprising a 5' inverted terminal repeat, a 3' inverted terminal repeat, and a mutated inverted terminal repeat. In some examples, the mutated terminal repeat lacks a terminal resolution site.

[0114] In some embodiments, hybrid AAV vectors are produced by capsid conversion (e.g., packaging inverted terminal repeats (ITRs) from a first serotype into a capsid of a second serotype), where the first and second serotypes may not be the same. In some examples, the Rep gene and ITRs from a first AAV serotype (e.g., AAV2) may be used in a capsid from a second AAV serotype (e.g., AAV9), where the first and second serotypes may not be the same. As a non-limiting example, a hybrid AAV serotype comprising AAV2 ITRs and AAV9 capsid proteins may be designated AAV2 / 9. In some examples, the hybrid AAV delivery vector comprises an AAV2 / 1, AAV2 / 2, AAV2 / 4, AAV2 / 5, AAV2 / 8, or AAV2 / 9 vector.

[0115] In some embodiments, the AAV vector can be a chimeric AAV vector. In some embodiments, the chimeric AAV vector comprises exogenous amino acid or amino acid substitution, or the capsid protein from two or more serotypes. In some examples, the chimeric AAV vector can be genetically engineered to increase transduction efficiency, selectivity, or a combination thereof.

[0116] In some examples, the delivery vector may be a eukaryotic vector, a prokaryotic vector (e.g., a bacterial vector), a viral vector, or any combination thereof. In some embodiments, the delivery vehicle may be a non-viral vector. In some embodiments, the delivery vehicle may be a plasmid. In some embodiments, the plasmid comprises DNA. In some embodiments, the plasmid comprises RNA. In some examples, the plasmid comprises circular double-stranded DNA. In some examples, the plasmid may be linear. In some examples, the plasmid comprises one or more genes of interest (e.g., essential genes and biomolecules) and one or more regulatory elements. In some examples, the plasmid comprises a bacterial backbone containing an origin of replication and an antibiotic resistance gene or other selection marker (e.g., essential genes) for plasmid amplification within bacteria. In some examples, the plasmid may be a minicircle plasmid. In some examples, the plasmid comprises one or more genes that provide a selection marker to induce target cells to retain the plasmid. In some examples, the plasmid may be prepared for delivery via electroporation or heat shock. In some examples, the plasmid may be engineered through synthetic or other suitable means. For example, in some embodiments, genetic elements may be assembled by restriction digesting a desired genetic sequence from a donor plasmid or organism to produce DNA ends that can later be easily ligated to another genetic sequence.

[0117] In some embodiments, the vector is a non-viral vector, and physical or chemical methods are used for delivery into bacterial cells. Exemplary physical methods include electroporation, heat shock, gene gun, sonoporation, magnetofection, or hydrodynamic delivery. Exemplary chemical methods include delivery of recombinant polynucleotides via liposomes, such as cationic lipids or neutral lipids; dendrimers; nanoparticles; or cell-penetrating peptides. In some embodiments, the non-viral vector comprises nanoparticles, such as lipid nanoparticles, gold nanoparticles, or a combination thereof.

[0118] In some embodiments, the fusion proteins described herein are inserted into a vector, which optionally includes one or more promoters, enhancers, operators, ribosome binding sites, RNA splice sites, polyadenylation sites, origins of replication, multiple cloning sites (MCS), cap binding sites, LacZa fragments, M13 forward priming sites and M13 reverse priming sites, and / or transcription terminator sequences.

[0119] Generally, the plasmids and vectors described herein include at least one promoter. In some embodiments, the promoter is a constitutive promoter. In other embodiments, the promoter is an inducible promoter. In further embodiments, the promoter is a prokaryotic promoter (e.g., driving expression of a gene in a prokaryotic cell). In some embodiments, the promoter is a eukaryotic promoter (e.g., driving expression of a gene in a eukaryotic cell). Exemplary promoters include, but are not limited to, promoters of CMV, EF1a, SV40, PGK1, Ubc, human β-actin, CAG, TRE, UAS, Ac5, polyhedron, CaMKIIa, GAL1-10, TEF1, GDS, ADH1, CaMV35S, Ubi, H1, U6, CaMV35S, SV40, CMV, and HSV TK. In some embodiments, the promoter is a lac promoter.

[0120] In some embodiments, the vector is a bicistronic or polycistronic vector (e.g., having or containing two or more loci responsible for the production of proteins) with an internal ribosome entry site (IRES) for translation initiation in a cap-independent manner.

[0121] In some embodiments, the vector contains an enhancer. Enhancers are nucleotide sequences that have the effect of enhancing promoter activity. In some embodiments, enhancers increase transcription regardless of the orientation of their sequence. In some embodiments, enhancers activate transcription from distances of several kilobase pairs. Furthermore, enhancers are optionally located upstream or downstream of the transcribed gene region and / or within the gene to activate transcription. Exemplary enhancers include, but are not limited to, the WPRE; the CMV enhancer; the R-U5' segment in the LTR of HTLV-I (Mol. Cell. Biol., Vol. 8(1), p. 466-472, 1988); the SV40 enhancer; the intron sequence between exons 2 and 3 of rabbit β-globin (Proc. Natl. Acad. Sci. USA., Vol. 78(3), p. 1527-31, 1981); and the genomic region of human growth hormone (J. Immunol., Vol. 155(3), p. 1286-95, 1995).

[0122] In some embodiments, the vector comprises an operator, which is a nucleotide sequence that has the effect of repressing transcription upon binding of a repressor element, hi some embodiments, the operator is the lac operator.

[0123] Gene editing The genes disclosed herein can be disabled by genetic modification of any organism (e.g., bacteria) through genome editing. Gene editing involves making highly specific, targeted changes by inserting, deleting, or replacing genetic material in the DNA of an organism to achieve the desired change to the DNA. Examples of gene editing include CRISPR, zinc finger nucleases, transcription activator-like effector nucleases (TALENs), oligonucleotide-directed mutagenesis, site-specific nucleases, and meganucleases. The genes disclosed herein can also be disabled by using traditional gene knockout methods (e.g., homologous recombination, such as natural selection (cotransformation of unlinked genetic markers), or chemical / radiation mutagenesis). Other examples of gene editing systems include signature tagged mutagenesis or insertional inactivation using transposases (e.g., sleeping beauty) or Argonaute proteins to edit the gene of interest. In some embodiments, more than one type of editing system can be used to generate an expression system. For example, natural selection can be used to introduce gene editing, and then CRISPR (e.g., CRISPR / Cas9) can target the wild-type sequence, resulting in cell death of unedited cells (Stukenberg, D., Hoff, J., Faber, A. et al. NT-CRISPR, combining natural transformation and CRISPR-Cas9 counterselection for markerless and scarless genome editing in Vibrio natriegens. Commun Biol 5, 265 (2022)).

[0124] The engineered or genetically modified bacterial cells edited herein can be screened using a selection marker, which can be utilized with altered chromosome II or extrachromosomal DNA or any of the constructs described herein. In some embodiments, the selection marker is a resistance gene, such as a gene that confers resistance to tetracycline, chloramphenicol, ampicillin, bleomycin, carbenicillin, gentamicin, glyphosate, hygromycin, kanamycin, neomycin, nourseothricin, phleomycin, puromycin, spectinomycin, streptomycin, or another antibiotic. In some embodiments, the resistance gene is ampicillin or kanamycin. Resistance genes can also have origins of replication from various sources.

[0125] Guide nucleic acid The compositions, systems, and methods of the present disclosure can comprise guide nucleic acid, also referred to herein as guide RNA.In some embodiments, guide nucleic acid can comprise a sequence that hybridizes to the target sequence of double-stranded DNA molecule.In some embodiments, guide nucleic acid also binds to nuclease.Such guide RNA can be used in the CRISPR system described herein to carry out site-specific genetic modification to the genome of bacterial cell (for example, to disable or knock out the gene described herein).

[0126] CRISPR systems The modifications provided herein can be performed using gene editing. In some embodiments, gene editing can be performed using a clustered regularly interspaced short palindromic repeats (CRISPR) system. As disclosed herein, the CRISPR system can utilize a guide RNA that hybridizes to a target nucleic acid and an endonuclease that cleaves the target nucleic acid. In some embodiments, the endonuclease can be a CRISPR-associated ("Cas") protein, such as a Cas9 protein or a Cas12 protein. Examples of Cas9 proteins include Cas9 nickase and inactive (dead) Cas9 (dCas9). Examples of Cas12 proteins include Cas12 nickase and inactive (dead) Cas12 (dCas12).

[0127] How to grow Gram-negative bacteria Growth conditions for measuring growth rates or comparing relative endotoxin concentrations or levels of Gram-negative genetically modified bacterial cells (e.g., Escherichia spp., Vibrio spp.) engineered or modified as described herein or wild-type Gram-negative bacteria can be any standardized or corresponding growth conditions generally accepted in the art as equivalent. In one embodiment, growth rates or other activities can be calculated or performed in LBv2 medium or LB (or LB-Miller) medium or peptone, animal-component-free peptone, or yeast extract at approximately 30°C or another suitable temperature (e.g., 25-37°C) with shaking (e.g., shaking at 100-300 rpm). Growth conditions can be used to compare growth rates among Gram-negative or other organisms, as known and generally accepted in the art. In any of the embodiments, a suitable medium (including, but not limited to, any of those described herein) having about 5 g NaCl / L to about 30 g NaCl / L or about 1% NaCl can be used. The medium can optionally contain functional amounts of glucose and / or magnesium, and may contain minimal or no calcium.

[0128] Corresponding growth conditions are those recognized in the art as suitable for providing comparative measurements. In some embodiments, the growth rate of Vibrio spp. organisms can be compared to E. coli organisms under corresponding conditions by growing Vibrio spp. in LBv2 medium and E. coli in LB (also called LB-Miller) medium or peptone, animal-component-free peptone, or yeast extract (as the organisms prefer these respective media). The organisms can be grown at the same temperature (e.g., about 30°C, about 37°C, or about 25°C), or corresponding conditions include growing Vibrio spp. at about 30°C and E. coli at about 37°C. In one embodiment, Vibrio spp. and E. coli organisms can also be compared by growing them both in LBv2 medium; in another embodiment for comparison, the corresponding conditions are Vibrio spp. can be grown in LBv2 medium at about 30° C. and E. coli can be grown in LB (or LB-Miller) medium at about 37° C. Any of these various conditions can be used to compare any property of the organisms, whether wild-type or recombinant.

[0129] Growth rate Genetic modification (e.g., deletion, inactivation, insertion, attenuation, inversion, disruption, or downregulation) of the API, lpxL, and / or lpxM genes in Gram-negative bacterial cells would be expected to result in organisms with significantly lower growth rates than the unmodified wild-type organism. However, in various embodiments, the engineered or modified Gram-negative bacterial cells described herein, except where the Gram-negative bacterial cells have an engineered msbA mutation (or "suppressor mutation") that enables lipid IV(A) transport, have a faster growth rate than comparable Escherichia spp., growing at a growth rate that is 10% or more, or 25% or more, or 50% or more, or 75% or more, or 100% or more, or 150% or more, or 200% or more, or 300% or more, or 500% or more, or 750% or more of the growth rate of unmodified or wild-type Gram-negative bacterial cells. Various mutations in msbA exist that allow for increased growth and are known to those skilled in the art. However, the present inventors have unexpectedly discovered that the engineered Vibrio spp. Gram-negative bacterial cells of the present disclosure can have genetic modifications in one or more of the API, lpxL, lpxM, Dns, Dam, and / or RecA genes and still be culturable and retain high growth rates, thereby making them useful for producing the biomolecules described herein. These engineered or genetically modified Gram-negative bacterial cells also have the advantage of conferring a substantially reduced or eliminated immune response (or being substantially less endotoxic) to humans and other mammals.

[0130] Bacterial growth: Population doubling occurs at regular time intervals. Bacterial growth proceeds exponentially (e.g., 1, 2, 4, 8, etc., or 2 0 , 2 1 , 2 2 , 2 3 ...2 n(where n is the number of generations). However, only part of the bacterial life cycle involves exponential growth; therefore, bacterial growth curves typically have an exponential portion and a stationary portion. The growth rate can be calculated during the exponential portion of the life cycle. The exponential growth phase involves balanced growth in which cells divide regularly and grow exponentially. The exponential growth rate (or growth rate) of a bacterial culture can be expressed as the generation time or doubling time of a bacterial population. Generation time (G) is defined as the time (t) per generation (n = number of generations). Thus, the formula: G = time (t) ÷ (n) represents the doubling time or generation time. G can be expressed in minutes (or hours) or any suitable time unit. For example, a generation time (G) of 10 minutes means that it will take 10 minutes for the population to double in size. In various embodiments, generation time can be measured by the number of organisms, biomass, the optical density of the cell culture measured at 600 nm (OD), or other measurements that are convenient and scientifically recognized as valid. Another common way to describe growth kinetics is the specific growth rate (SGR). The specific growth rate is expressed in units of the reciprocal of time ( / hr or hr -1 ) Specific growth rate (SGR) and generation time (G) are related through the following formula: G = ln(2) / SGR. Therefore, a large SGR will correspond to a small G, and vice versa. SGR can also be converted to doublings / hour by the following formula: doubling time = ln(2) / specific growth rate.

[0131] In some embodiments, the engineered Vibrio sp. of the present disclosure can be measured for at least 0.30 hours, which can be conveniently measured in any suitable medium and at any suitable temperature (e.g., as described herein). -1 ( / hour) or at least 0.40 or at least 0.50 or at least 0.60 or at least 0.70 or at least 0.80 or at least 0.85hr -1 or 0.40 to 0.95 hours -1or 0.50 to 0.95 or 0.60 to 0.72 or 0.60 to 0.75 or 0.60 to 0.95 or 0.65 to 0.90 or 0.70 to 0.95 or 0.80 to 0.95 or 0.85 to 0.95 or 0.30 to 0.90 or 0.40 to 0.90 or 0.50 to 0.90 or 0.60 to 0.90 or 0.70 to 0.90 or 0.80 to 0.90hr -1 The doubling time indicates a specific growth rate in units of doublings per hour or minutes per doubling or simple generation time, or specific growth rate (SGR). Thus, growth rate can be expressed in doublings per hour or minutes per doubling or simple generation time, or specific growth rate (SGR). In one embodiment, the doubling time of an organism can be measured in LBv2 medium at 30°C. However, any suitable medium can be used, e.g., LB medium (or LB-Miller medium) or peptone, animal-component-free peptone, or yeast extract. Growth can be assessed in any suitable vessel, e.g., a fermentor or shake flask, but in one embodiment, the organism can be assessed in a culture plate or assay plate (e.g., a 24-, 48-, 96-, or 384-well plate). The vessel can be a flat-bottom microtiter plate, a round-bottom microtiter plate, or another suitable vessel with advantageously shaped wells (e.g., flower-shaped wells) (e.g., a FlowerPlate® microtiter plate). Any suitable vessel and conditions can be used to measure growth rate. Growth rates or specific growth rates can also be assessed at various temperatures, including, but not limited to, growth at about 25°C or about 30°C or about 37°C or about 40°C or about 42°C or about 25-30°C or 25-32°C or 25-37°C or about 30-37°C or about 37-42°C, or any temperature between 16-42°C. The growth rates disclosed herein are achievable on the media provided herein without any further supplementation of the media (e.g., without supplementation with arabinose 5-phosphate or glucose 6-phosphate). In some embodiments, the Gram-negative bacterial cells described herein can have all wild-type genes and can have no deletions or genetic mutations in any genes, except as otherwise described herein.

[0132] In various embodiments, the engineered or genetically modified Gram-negative bacterial cells described herein have a doubling time in LB or LBv2 medium or peptone, animal component-free peptone, or yeast extract of about 60 minutes at 30°C, or 50-90 minutes, or 40-60 minutes, or 30-40 minutes, or less than 30 minutes, or less than 22 minutes at 37°C, or less than 21 minutes at 42°C.

[0133] The engineered or genetically modified Vibrio spp. bacterial cells described herein can grow more rapidly than corresponding or wild-type bacterial cells. Thus, in various embodiments, the engineered or genetically modified Vibrio spp. bacterial cells can grow at a rate at least 40% greater, or at least 50% greater, or at least 55% greater, or at least 60% greater, or at least 65% greater, or at least 70% greater, or at least 80% greater, or at least 85% greater, or at least 90% greater, or 50-70% greater, or 55-70% greater, or 55-65% greater, or 55-80% greater, or 55-90% greater, than corresponding or wild-type bacterial cells under the same or corresponding conditions. The growth rate can be 0% greater, 60-70% greater, 60-65% greater, 60-80% greater, 60-90% greater, 60-95% greater, 65-90% greater, 70-90% greater, 75-90% greater, 55-95% greater, 65-95% greater, 70-90% greater, 70-95% greater, or 75-95% greater (and also, for any of these, greater than 100%, greater than 95%, or greater than 90%, as appropriate). For example, if a bacterial cell has a doubling time of 10 minutes, 65% of its growth rate can be calculated as 10 / 0.65 = 15.4 minutes. Growth rates can be measured over any convenient culture period during the exponential phase (e.g., over 4 hours, or over 6 hours, or 8 hours, or 9 hours, or 10 hours, or 12 hours, or 15 hours, or 18 hours, or 24 hours, or only between 0-3 hours, or 0-4 hours, or 0-6 hours, or 0-8 hours, or 6-8 hours, or 8-10 hours, or 8-12 hours, or 10-12 hours).Thus, the engineered or genetically modified Vibrio spp. bacterial cells described herein may have a doubling time or generation time that is 50% or more, or 55% or more, or 60% or more, or 65% or more, or 70% or more, or 75% or more, or 80% or more, or 85% or more, compared to a wild-type organism or an organism that does not have a genetic modification of the RecA, Dam, KdsD, gutQ, kdsA, kdsB, waaA, msbA, yhiD, IpxL, and / or IpxM genes. or greater, or 90% or greater, or 95% or greater (or 55-70%, or 55-65%, or 55-90%, or 55-95%, or 60-70%, or 60-65%, or 60-80%, or 60-90%, or 60-95%, or 65-90%, or 65-95%, or 70-90%, or 75-90%, or 80-90%, or 75-95%, or 80-95%). Doubling time can be expressed as any suitable unit of time, although doublings / hour is convenient and commonly used.

[0134] Additionally, any of the recombinant Vibrio spp. bacterial cells described herein can have a growth rate that is at least 100% greater, or at least 200% greater, or at least 300% greater, or at least 400% greater, or at least 500% greater, or at least 600% greater, or at least 700% greater, or at least 900% greater than E. coli having a deletion of the following genes: ΔRecA, ΔDam, ΔDns, ΔKdsD, ΔgutQ, ΔkdsA, ΔkdsB, ΔwaaA, ΔmsbA, ΔyhiD, ΔIpxL1, ΔIpxM, and a mutated msbA gene (a suppressor mutation). Such E. coli is commercially available under the trademark ClearColi®.

[0135] Any of the engineered or genetically modified Vibrio spp. bacterial cells described herein can exhibit sustained growth at higher temperatures (e.g., at 40°C, or above 40°C, or at about 42°C, or above 42°C, or at about 37-42°C, or at about 38-42°C), for a period of, e.g., at least 12 hours, or at least 18 hours, or at least 24 hours, or at least 48 hours. In some embodiments, the cells can be re-cultured after exposure to the described conditions.

[0136] Low temperature resistance Reactive oxygen species (ROS), such as singlet oxygen, superoxide anion, hydrogen peroxide, and hydroxyl radicals, are the result of aerobic metabolism and can cause cellular damage through the oxidation of biomolecules. These oxygen species can be produced in increased amounts as a result of various types of cellular stress, including low-temperature stress. In some embodiments, engineered or modified bacterial cells (e.g., Escherichia spp., Vibrio spp.) contain one or more nucleotide sequence(s) encoding one or more enzyme(s) from an ROS detoxification system. The one or more enzymes can be selected from one or more of peroxidases, dismutases, reductases, and transferases, or any combination thereof, and the enzymes can be enzymes from algae, microalgae, bacteria, cyanobacteria, or other types or sources. The enzyme can be selected from one or more of glutathione peroxidase (which can have reduced monomeric glutathione (GSH) as a substrate), superoxide dismutase, guaiacol peroxidase (GPX), enzymes of the ascorbate-glutathione (AsA-GSH) cycle (ascorbate peroxidase (APX), monohydroascorbate reductase (MDHAR), dehydroascorbate reductase (DHAR), glutathione reductase (GR)), catalase peroxidase (e.g., katG and / or katE), alkyl hydroperoxide reductase, and glutathione S-transferase. The nucleotide sequence(s) can be exogenous or heterologous, and one or more enzymes can be exogenous or heterologous enzymes.

[0137] In some embodiments, engineered or modified bacterial cells (e.g., Escherichia spp., Vibrio spp.) contain a heterologous or exogenous nucleic acid sequence encoding at least one enzyme from a ROS detoxification system, which may be present on a plasmid or other vector. The engineered or modified bacterial cells are more able to tolerate cold stress than unengineered or unmodified bacterial cells and thus can retain viability and culturability after incubation at lower temperatures for substantially longer periods than unengineered bacterial cells. The ROS detoxification system can convert any of the reactive oxygen species into one or more of oxygen or water. The enzyme from the ROS system may be operably linked under the control of an exogenous or heterologous promoter and / or other regulatory sequence.

[0138] In some embodiments, vectors, cells, expression systems, or biomolecules produced by the aforementioned cells or expression systems can be frozen for long-term storage. In some embodiments, vectors, cells, expression systems, or biomolecules produced by the aforementioned cells or expression systems are frozen and stored at temperatures below -4°C, -20°C, -80°C, or -196°C. In other embodiments, vectors, cells, expression systems, or biomolecules produced by the aforementioned cells or expression systems are frozen and stored for 1 to 7 days, 8 to 30 days, 31 to 90 days, 91 to 365 days, 1 to 5 years, or more than 5 years.

[0139] Plasmid / transgene production Disclosed herein is a genetically modified bacterial cell that exhibits increased plasmid or transgene production compared to the production of plasmid or transgene in unmodified bacteria.In some embodiments, the genetically modified bacterial cell exhibits increased plasmid or transgene production compared to the production of plasmid or transgene in bacterial expression strains that lack the genetic modifications described herein.Also provided herein is a method for expressing plasmid in genetically modified cells.

[0140] In some embodiments, the genetically modified bacterial cells replicate the non-native plasmid with at least a 10%, 25%, 50%, 75%, 100%, 125%, 150%, 175%, 200%, 225%, 250%, 275%, or 300% increase in plasmid production per mg compared to the corresponding production of the non-native plasmid in an equivalent expression system lacking the genetic modifications described herein. In some embodiments, the genetically modified bacterial cells replicate the non-native plasmid with a 10% or greater, 25% or greater, 50% or greater, 75% or greater, 100% or greater, 125% or greater, 150% or greater, 175% or greater, 200% or greater, 225% or greater, 250% or greater, 275% or greater, or 300% or greater increase in plasmid production per mg compared to the corresponding production of the non-native plasmid in an equivalent expression system lacking the genetic modifications described herein grown in growth medium for the same growth period. In some embodiments, the equivalent expression system comprises wild-type K12 E. coli.

[0141] In some embodiments, the genetically modified bacterial cells replicate the non-native plasmid to produce a plasmid with reduced levels of plasmid multimers and / or concatemers. In some embodiments, the genetically modified bacterial cells produce at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 99% fewer multimers and / or concatemers compared to unmodified bacterial cells. In some embodiments, the genetically modified bacterial cells produce at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 99% more monomeric plasmid species compared to unmodified bacterial cells. In some embodiments, the genetically modified bacterial cells produce at least a 10%, at least a 20%, at least a 30%, at least a 40%, at least a 50%, at least a 60%, at least a 70%, at least a 80%, at least a 90%, or at least a 99% increase in supercoiled plasmid DNA compared to unmodified bacterial cells. In some embodiments, the plasmids produced by the genetically modified bacterial cells described herein may comprise an increased ratio of monomeric and supercoiled plasmid DNA to multimers and concatemers compared to unmodified bacterial cells.

[0142] In some embodiments, non-native plasmids produced by genetically modified bacterial cells can be purified. Those skilled in the art can refer to known plasmid purification processes to provide a scheme that produces a suitable grade of DNA plasmid purity. For example, PCT International Application Nos. PCT / US95 / 09749 (WO96 / 02658) and PCT / US96 / 07083 (WO96 / 36706) provide guidance on alternative downstream chromatography-based processes that can be used in combination with the core purification steps described in this paragraph to provide an effective purification protocol.

[0143] Methods for expressing biomolecules In some embodiments, non-toxic, Gram-negative, genetically modified bacterial cells are used as hosts for the production of endotoxin-free biomolecules. The present disclosure is not limited to a particular biomolecule. Traditionally, the production of biomolecules in Gram-negative bacteria has been plagued by the presence of endotoxins derived from the bacterial host, whether they are outer membrane vesicles for vaccines, LPS-type molecules (such as monophosphoryl lipid A (MPLA)) used as adjuvants, recombinant pharmaceutical proteins, macromolecules, or DNA for mammalian cell transfection / gene therapy. The immunogenic potential of LPS is well documented, making endotoxin contamination of therapeutic molecules a concern. Current production strategies to mitigate endotoxin contamination include various purification techniques (such as commercially available kits for purifying endotoxin-free DNA plasmids) followed by assays to measure endotoxin levels. Thus, the non-toxic Gram-negative bacterial cells (e.g., endotoxin-free cells) of the present disclosure provide an improved method for isolating endotoxin-free biomolecules. Therefore, some cells of the present disclosure do not produce endotoxins, and therefore, such purification steps are not required. For example, the endotoxin-free cells of the present disclosure can be hosts for the production of commercially important biomolecules in an endotoxin-free environment using Gram-negative bacteria. Furthermore, cells containing modifications of genes encoding any one or more of D-arabinose 5-phosphate isomerase, KD08P synthase, CMP-KDO synthetase, KD08P phosphatase and / or KDO transferase, ATP-dependent translocator, inner membrane protein (e.g., gutQ, kdsD, kdsA, kdsB, waaA, msbA, yhjD genes), or any other biosynthetic, processing (e.g., IpxL1 or IpxM), or transport bacterial genes can be hosts for the production of commercially important biomolecules in an endotoxin-free environment using Gram-negative bacteria. [Example]

[0144] Example The following examples are included for illustrative purposes only and are not intended to limit the scope of the present disclosure. Those skilled in the art will appreciate that numerous and varied modifications can be made to achieve essentially similar results without departing from the spirit of the present disclosure.

[0145] Example 1: Preparation of an engineered V. Natriegens strain for antibiotic-free plasmid production An engineered V. natriegens strain was prepared for endotoxin-free, antibiotic-free plasmid production. Modifications to the bacterial chromosome were made using the CRISPR-Cas9 system. The following bacterial chromosomal genes were edited (knocked out) in this strain: (a) Extracellular deoxyribonuclease (Dns) activity is highly prominent in this organism. This activity causes plasmid degradation during the transformation and plasmid isolation steps. Deoxyribonuclease activity also adversely affects the stability of the plasmid itself. The Dns gene was edited using the CRISPR / Cas9 gene editing system to produce a nonfunctional truncated Dns protein. Thus, the exonuclease activity of Dns was permanently lost, allowing for better stability and less degradation during plasmid isolation. (b) Arabinose 5-phosphate isomerase (KdsD) activity is one of the key steps in endotoxin production by this organism, making it difficult to remove contaminants during plasmid production and purification. KdsD gene knockout inhibited lipopolysaccharide (LPS) biosynthesis, contributing to very low levels of endotoxin in the isolated plasmid. (c) Lipid A biosynthesis lauroyltransferase (IpxL_1) activity is one of the key steps in endotoxin production by this organism, making it difficult to remove contaminants during plasmid production and purification. IpxL_1 gene knockout inhibited lipopolysaccharide (LPS) biosynthesis and contributed to very low levels of endotoxin in the isolated plasmid. (d) Lipid A biosynthesis myristoyltransferase (IpxM): Activity is one of the key steps in endotoxin production by this organism, making it difficult to remove contaminants during plasmid production and purification. IpxM gene knockout inhibited lipopolysaccharide (LPS) biosynthesis, resulting in very low levels of endotoxin in the isolated plasmid. (e) DNA adenine methylase (Dam) can reduce gene expression by inhibiting the binding of transcription factors to sensitive genes. Knocking out this gene renders the organism dam- / -, allowing the synthesis and expression of dam-sensitive plasmids. Dam- / - strains were generated by knocking out the DNA adenine methylase gene. (f) Glutamine-dependent NAD(+) synthetase (nadE_1) is one of the essential genes for the survival of an organism. Knockout of this gene resulted in the death of the organism unless the enzyme was supplemented from a source other than genomic DNA. To select only transformed bacteria containing the plasmid, this gene was inserted into the target plasmid and introduced into glutamine-dependent NAD(+) synthase knockout bacteria. This process allowed for antibiotic-free selection of organisms containing the transformed plasmid.

[0146] Bacterial gene editing was performed using a modified CRISPR-Cas9 system that uses two unique plasmids, designated NB_Cas9 and NB_gRNA.

[0147] The NB_Cas9 plasmid consisted of gene sequences corresponding to the PSCI01 origin, Rep101, Lac promoter, Lac inhibitor, Lac operator, lambda T3 terminator, kanamycin resistance gene, 5′→3′ double-stranded exonuclease from the lambda Red system, single-stranded DNA-binding recombinase in the lambda Red system, inhibitor of host RecBCD nuclease in the lambda Red system, Shine-Dalgarno sequence, promoter of the E. coli L-arabinose operon, L-arabinose regulatory protein, and kanamycin resistance gene.

[0148] The NB_gRNA plasmid consisted of an origin of replication, an ampicillin resistance gene, an ampicillin resistance gene promoter, a J23119 (SpeI) promoter, a gRNA sequence, and a gRNA scaffold.

[0149] Homologous recombination DNA templates (which were different for the various gene knockouts) were also part of the gene editing system.

[0150] Bacteria were transformed with the modified Cas9 plasmid, gRNA plasmid, and homology repair templates specific to each gene to be knocked out or knocked in. Transformation was performed using electroporation or heat shock. Transformed bacteria were selected using kanamycin and / or ampicillin resistance. Selected bacteria were screened for genomic alterations using sequencing, and plasmids were cured by growing the organisms at 37-42°C.

[0151] The growth rates of the engineered V. natriegens strains were then compared to E. coli controls. V. natriegens was grown in a medium containing: 1) animal-component-free peptone (5–10 g / L), yeast extract (5–10 g / L), sodium chloride (5–30 g / L), double-distilled water to a volume of 1000 mL, and pH adjusted to 6.5–7.5. The bacterial host was grown at 25–37°C with shaking at 100–300 rpm. As shown in Figures 1–2, the V. natriegens strains exhibited robust growth rates at OD600nm compared to the E. coli control. Cell doubling times were also much faster in the engineered V. natriegens (NB) strains compared to the E. coli cell strains (Figure 3A). This resulted in improved total plasmid yields (mg) for six different sized plasmids (Figure 3B).

[0152] Example 2: Preparation of genetically engineered E. coli for low-endotoxin, antibiotic-free selection The engineered E. coli strain was prepared for antibiotic-free selection with low endotoxin production. Modifications to the bacterial chromosome were made using the CRISPR-Cas9 system. The following bacterial chromosomal genes were edited (knocked out) in this strain: (a) Arabinose 5-phosphate isomerase (KdsD) activity is one of the key steps in endotoxin production by this organism, making it difficult to remove contaminants during plasmid production and purification. KdsD gene knockout inhibited lipopolysaccharide (LPS) biosynthesis, resulting in very low levels of endotoxin in the isolated plasmid. (b) Lipid A biosynthesis lauroyltransferase (lpxL_1) activity is one of the key steps in endotoxin production by this organism, making it difficult to remove contaminants during plasmid production and purification. IpxL_1 gene knockout inhibited lipopolysaccharide (LPS) biosynthesis and contributed to very low levels of endotoxin in the isolated plasmid. (c) Lipid A biosynthesis myristoyltransferase (IpxM): activity is one of the key steps in endotoxin production by this organism, making it difficult to remove contaminants during plasmid production and purification. IpxM gene knockout inhibited lipopolysaccharide (LPS) biosynthesis, resulting in very low levels of endotoxin in the isolated plasmid. (d) DNA adenine methylase (Dam) can reduce gene expression by inhibiting the binding of transcription factors to sensitive genes. Knocking out this gene renders the organism dam- / -, allowing the synthesis and expression of dam-sensitive plasmids. Dam- / - strains were generated by knocking out the DNA adenine methylase gene. (e) Glutamine-dependent NAD(+) synthetase (nadE_1) is one of the essential genes for the survival of an organism. Knockout of this gene resulted in the death of the organism unless the enzyme was supplemented from a source other than genomic DNA. To select only transformed bacteria containing the plasmid, this gene was inserted into the target plasmid and introduced into glutamine-dependent NAD(+) synthase knockout bacteria. This process allowed for antibiotic-free selection of organisms containing the transformed plasmid.

[0153] Bacterial gene editing was performed using a modified CRISPR-Cas9 system that uses two unique plasmids, designated NB_Cas9 and NB_gRNA.

[0154] The NB_Cas9 plasmid consisted of gene sequences corresponding to the PSCI01 origin, Rep101, Lac promoter, Lac inhibitor, Lac operator, lambda T3 terminator, kanamycin resistance gene, 5′ → 3′ double-stranded exonuclease from the lambda Red system, single-stranded DNA-binding recombinase in the lambda Red system, inhibitor of host RecBCD nuclease in the lambda Red system, Shine-Dalgarno sequence, promoter of the E. coli L-arabinose operon, L-arabinose regulatory protein, and kanamycin resistance gene.

[0155] The NB_gRNA plasmid consisted of an origin of replication, an ampicillin resistance gene, an ampicillin resistance gene promoter, a J23119 (SpeI) promoter, a gRNA sequence, and a gRNA scaffold.

[0156] Homologous recombination DNA templates (different for various gene knockouts) were also part of the gene editing system.

[0157] Bacteria were transformed with the modified Cas9 plasmid, gRNA plasmid, and homology repair templates specific to each gene to be knocked out or knocked in. Transformation was performed using electroporation or heat shock. Transformed bacteria were selected using kanamycin and / or ampicillin resistance. Selected bacteria were screened for genomic alterations using sequencing, and plasmids were cured by growing the organisms at 37-42°C.

[0158] The above CRISPR / Cas9 editing was performed by using the following exemplary guide sequences: [Table 1] [Table 2]

[0159] Example 3: Removal of DNA strand exchange proteins to improve plasmid stability Genetically engineered strains of Vibrio natriegens were prepared for the production of endotoxin-free plasmids and / or transgenes, and the produced plasmids contained reduced levels of plasmid multimers or concatamers.

[0160] When transformed with plasmid DNA, wild-type Vibrio natriegens strains produce plasmid species with higher molecular weights than the expected plasmid. These higher molecular weight species represent multimers and / or concatemers of the plasmid generated by endogenous mechanisms in the strain. These multimers and / or concatemers severely impact plasmid quality by contaminating the desired species (monomeric, supercoiled plasmid DNA) with additional species, reducing yield and complicating purification procedures.

[0161] Therefore, modifications to the bacterial chromosome to remove the endogenous DNA strand exchange protein would reduce the ability of these strains to produce these undesirable high molecular weight species and thus improve plasmid quality. The entire coding sequence of the predicted DNA strand exchange protein (SEQ ID NO: 1) was replaced with an antibiotic resistance marker using natural competence-mediated homologous recombination, as previously described (ACS Synth. Biol. 2018, 7, 2245-2255).

[0162] V. natriegens cells were made naturally competent through expression of the V. cholera tfoX protein from a plasmid, activating the cells' natural competence mechanism. The naturally competent cells were transformed with a DNA cassette consisting of a chloramphenicol resistance gene flanked by homology arms to the locus of interest, which guides the DNA cassette to the appropriate locus and allows for a recombination event. In this case, the result is replacement of the DNA strand exchange protein gene with a chloramphenicol resistance marker. The resulting chloramphenicol-resistant transformants were screened by colony PCR to confirm the desired knockout and then passaged in the absence of antibiotic to cure the strain of the tfoX expression plasmid.

[0163] Plasmid DNA was then introduced into this strain as previously described (Nature Methods. 2016, 13:849-851) and cultured in liquid growth medium supplemented with antibiotics to ensure plasmid maintenance. Plasmids were isolated from the culture using commercially available DNA purification columns (Qiagen) according to the manufacturer's protocol. The isolated plasmid DNA was run on a TAE 1% agarose gel to visualize the plasmid topology and confirm that the genome modification improved the quality of the plasmid DNA preparation by reducing the presence of high-molecular-weight multimers / concatamers (Figure 4A-B).

[0164] Example 4: Knockout of nadC in V. natriegens via natural competency transformation Identification and location of nadC, encoding QAPRTase, in V. natriegens was performed using the blastn algorithm. To knock out nadC, a protocol for natural competency-mediated transformation was used as described elsewhere (Conley et al.). A DNA cassette encoding a chloramphenicol resistance marker flanked on each side by 3 kb homologous arms to the region upstream of nadC in V. natriegens and 3 kb homologous arms to the region downstream of nadC was constructed, with the intention of replacing the nadC gene with a chloramphenicol resistance cassette via homologous recombination.

[0165] To perform natural competency transformation, a 10 mL culture of V. natriegens / TfoX plasmid was grown for 16 hours at 30°C and 250 rpm in LBv2 medium (LB: 10.0 g / L tryptone, 5.0 g / L yeast extract, 10.0 g / L NaCl; 204 mM NaCl, 4.2 mM KCl, 23.14 mM MgCl) supplemented with antibiotics (100 μg / mL carbenicillin) and 1 μM IPTG. Transformation reactions were set up in 2 mL Eppendorf tubes with the following mixture: 350μL 2× Instant Ocean 150ng knockout cassette DNA (10µL at 15ng / µL) 3.5 μL 10 mM IPTG 3.5 μL of a culture grown for 16 hours.

[0166] The transformation reaction was then incubated at 30°C for 5 hours using a heat block. The reaction tube was then transferred to a culture tube containing 1 mL of LBv2 and grown at 30°C and 250 rpm for 2 hours. 100 μL of the culture was then spread onto an LB-Miller plate containing chloramphenicol (5 μg / mL) and grown overnight in an incubator at 30°C. Grown colonies were screened, and colony PCR was used to confirm the sequences of successful transformants of V. natriegens nadC.

[0167] Example 5: Verification of NAD auxotrophy of a V. natriegens nadC knockout strain by growth assay and restoration with a complementing plasmid To construct a complementary nadC-supplying plasmid, two different gene cassettes encoding nadC from V. natriegens were cloned into pUC19 via isothermal assembly. To maximize the assurance that regulatory elements were fully acquired and functional for nadC expression, one design (pNadC1) utilized a cassette starting 142 bp before the upstream gene (ampD) of nadC, totaling 1,803 kb in size. The other design (pNadC2) utilized a cassette starting 30 bp inside the ampD CDS, totaling 1,445 kb in size. Chemically competent V. natriegens nadC- cells were then generated and subsequently transformed with each plasmid to produce V. natriegens nadC- / pNadC1 and V. natriegens nadC- / pNadC2 strains.

[0168] The four strains tested in the growth assay were V. natriegens (carrying a plasmid conferring ampicillin resistance but not carrying the nadC gene on the plasmid), V. natriegens nadC- (in which nadC has been replaced with a chloramphenicol resistance marker using the methodology discussed in the previous section), V. natriegens nadC- / pNadC1, and V. natriegens nadC- / pNadC2. Test strains were inoculated from glycerol stocks and grown for 24 h at 30°C and 250 rpm in 5 mL cultures of LBv2 medium (LB: 10.0 g / L tryptone, 5.0 g / L yeast extract, 10.0 g / L NaCl; 204 mM NaCl, 4.2 mM KCl, 23.14 mM MgCl) supplemented with the appropriate antibiotic (100 μg / mL carbenicillin and / or 17 μg / mL chloramphenicol). For growth assays, each strain was grown in 2 mL of M9 medium (250 mL of 2x M9 salts (Thermofisher), 1 mL of 1 M MgSO, 50 μL of 1 M CaCl, ddH2O added to a final volume of 500 mL) supplemented with 0.4% (w / v) glucose, 2% (w / v) NaCl, and the appropriate antibiotic (100 μg / mL carbenicillin and / or 17 μg / mL chloramphenicol) in the presence or absence of 10 μg / mL nicotinic acid (NA), at 30°C and 250 rpm for 24 h. After the growth period, the OD600 of each culture was measured using a cuvette and a spectrophotometer (NanoDrop One). [Table 3]

[0169] Table 3 above shows data from experiments showing engineered V. natriegens strains grown in media that are auxotrophic for V. natriegens nadC in the absence of nicotinic acid (NA), and tested for recovery using V. natriegens nadC complemented with nadC on plasmids (pNadC1 and pNadC2). Growth of each strain culture was measured as the optical density (OD) of the grown culture from a 24-hour growth period.600 ) Data shown are the mean and standard deviation of three technical replicates.

[0170] Growth assay results confirmed that V. natriegens, with its nadC knockout and therefore lacking the QAPRTase enzyme for de novo NAD synthesis, was unable to grow, thus confirming NAD auxotrophy in NA-free M9 medium for the knockout strain. Once the nadC-supplying plasmid (pNadC1 or pNadC2) was present in the knockout strain, the strain was able to resume growth in NA-free M9. Thus, the strain no longer exhibits NAD auxotrophy. Under these conditions, cells must maintain this plasmid to survive, resulting in its maintenance in the strain in the absence of antibiotics. These results demonstrate a baseline condition under which a framework utilizing V. natriegens nadC and an engineered plasmid carrying nadC expression can be used as a means for antibiotic-free plasmid selection.

[0171] The nadC introduced above was generated by using the following exemplary cassette sequence: [Table 4-1] [Table 4-2]

[0172] While preferred embodiments of the present disclosure have been shown and described herein, such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will occur to those skilled in the art without departing from the present disclosure. It should be understood that various alternatives to the embodiments described herein may be used. It is intended that the appended claims define the scope of the disclosure, and that methods and structures within the scope of these claims and their equivalents be covered thereby.

Claims

1. 1. A genetically modified Vibrio natriegens bacterial cell having a genetic modification with respect to a parent Vibrio natriegens bacterial strain selected from the group consisting of the Vibrio natriegens bacterial strain deposited under accession number NCIMB857, the Vibrio natriegens bacterial strain deposited under accession number ATCC14048, the Vibrio natriegens bacterial strain deposited under accession number DSM759, and the Vibrio natriegens bacterial strain deposited under accession number NBRC15636, wherein the genetic modification results in reduced expression of a polypeptide encoded by a chromosomal gene 1 of the parent Vibrio natriegens bacterial strain, and the chromosomal gene 1 has the polynucleotide sequence of SEQ ID NO: 1 prior to the modification. natrigens bacterial cells.

2. 2. The genetically modified Vibrio natriegens bacterial cell of claim 1, wherein the genetically modified Vibrio natriegens bacterial cell further comprises a genetic modification to one or more genes of the parent Vibrio natriegens bacterial strain, wherein the one or more genes are selected from the group consisting of DAM, DNS, KDO, KdsD, gutQ, kdsA, kdsB, waaA, msbA, yhiD, IpxL, IpxM, and any combination thereof.

3. 3. The genetically modified Vibrio natriegens bacterial cell of claim 2, wherein the genetically modified Vibrio natriegens bacterial cell comprises a genetic modification to the DNS gene.

4. 3. The genetically modified Vibrio natriegens bacterial cell of claim 2, wherein the genetically modified Vibrio natriegens bacterial cell comprises a genetic modification to the DAM gene.

5. 3. The genetically modified Vibrio natriegens bacterial cell of claim 2, wherein the genetically modified Vibrio natriegens bacterial cell comprises a genetic modification to the KdsD gene, the IpxL gene, or the IpxM gene.

6. 3. The genetically modified Vibrio natriegens bacterial cell of claim 2, wherein when the genetically modified Vibrio natriegens bacterial cell is cultured in a growth medium, the genetically modified Vibrio natriegens bacterial cell replicates with reduced secretion of endotoxin into the growth medium compared to the amount of endotoxin secreted by an equivalent bacterial strain lacking the genetic modification replicated in the growth medium over the same amount of time.

7. 2. The genetically modified Vibrio natriegens bacterial cell of claim 1, wherein the parent Vibrio natriegens bacterial strain is the Vibrio natriegens bacterial strain deposited under accession number NCIMB857.

8. 2. The genetically modified Vibrio natriegens bacterial cell of claim 1, wherein the genetic modification resulting in the reduced expression of the polypeptide encoded by the first chromosome gene comprises a deletion of a gene having the polynucleotide sequence of SEQ ID NO:

1.

9. 9. The genetically modified Vibrio natriegens bacterial cell of any one of claims 1 to 8, wherein, upon transformation of a template plasmid into the genetically modified Vibrio natriegens bacterial cell, the genetically modified Vibrio natriegens bacterial cell expresses the template plasmid with a reduced amount of plasmid multimers or concatemers compared to the amount of plasmid multimers or concatemers produced in the same amount of time upon transformation of the template plasmid into bacterial cells of an equivalent bacterial strain lacking the genetic modification.

10. Upon transformation of a template plasmid into said genetically modified Vibrio natriegens bacterial cells, said genetically modified Vibrio natriegens bacterial cells exhibit a level of template plasmid replication or transgene expression, respectively, that is produced in an identical amount of time upon transformation of said template plasmid into bacterial cells of an equivalent bacterial strain lacking said genetic modification. (a) replicating the template plasmid at increased levels; or (b) expressing an increased level of the transgene encoded by the template plasmid; The genetically modified Vibrio natriegens bacterial cell of claim 1 .

11. 11. The genetically modified Vibrio natriegens bacterial cell of claim 10, wherein upon transformation of the template plasmid into the genetically modified Vibrio natriegens bacterial cell, the genetically modified Vibrio natriegens bacterial cell replicates the template plasmid at an increased level compared to the level of template plasmid replication produced in the same amount of time upon transformation of the template plasmid into bacterial cells of the equivalent bacterial strain lacking the genetic modification.

12. 12. The genetically modified Vibrio natriegens bacterial cell of claim 11, wherein, upon transformation of the template plasmid into the genetically modified Vibrio natriegens bacterial cell, the genetically modified Vibrio natriegens bacterial cell replicates the template plasmid at a level that is at least 200% greater than the level of template plasmid replication produced in the same amount of time upon transformation of the template plasmid into bacterial cells of the equivalent bacterial strain lacking the genetic modification.

13. 2. The genetically modified Vibrio natriegens bacterial cell of claim 1, wherein when the genetically modified Vibrio natriegens bacterial cell is cultured in a growth medium, the genetically modified Vibrio natriegens bacterial cell has a cell replication rate, as measured by optical density at 600 nm, that is at least 150% faster than the replication rate of bacterial cells of an equivalent bacterial strain lacking the genetic modification replicated in the growth medium over the same amount of time.

14. 14. The genetically modified Vibrio natriegens bacterial cell of claim 13, wherein when the genetically modified Vibrio natriegens bacterial cell is cultured in the growth medium, the genetically modified Vibrio natriegens bacterial cell replicates with a doubling time of about 75 minutes as measured by optical density at 600 nm.

15. 15. The genetically modified Vibrio natriegens bacterial cell of any one of claims 9 to 14, wherein the equivalent bacterial strain is a derivative of the K12 or B strain of E. coli.

16. The genetically modified Vibrio natriegens bacterial cell according to any one of claims 9 to 14, wherein said equivalent bacterial strain is said parent Vibrio natriegens bacterial strain.

17. 17. An expression product produced by the genetically modified Vibrio natriegens bacterial cell of any one of claims 1 to 16.

18. 1. A system for replicating genetically modified Vibrio natriegens bacterial cells, comprising: (a) a genetically modified Vibrio natriegens bacterial cell according to any one of claims 1 to 16; and (b) Growth medium Including, the system.

19. 1. A method for producing a genetically modified Vibrio natriegens bacterial cell, comprising: (a) obtaining a parent Vibrio natriegens bacterial strain, wherein the parent Vibrio natriegens bacterial strain is selected from the group consisting of the Vibrio natriegens bacterial strain deposited under accession number NCIMB857, the Vibrio natriegens bacterial strain deposited under accession number ATCC14048, the Vibrio natriegens bacterial strain deposited under accession number DSM759, and the Vibrio natriegens bacterial strain deposited under accession number NBRC15636; and (b) performing a modification that results in reduced expression of a polypeptide encoded by a chromosomal gene 1 of the parent Vibrio natriegens bacterial strain, thereby generating the genetically modified Vibrio natriegens bacterial cell, wherein the chromosomal gene 1 has the polynucleotide sequence of SEQ ID NO: 1 prior to the modification. A method comprising:

20. 1. A method for replicating a template plasmid with reduced generation of plasmid multimers or concatemers in genetically modified Vibrio bacterial cells, comprising: (a) obtaining the genetically modified Vibrio bacterial cell, wherein the genetically modified Vibrio bacterial cell comprises a genetic modification for one or more genes selected from the group consisting of DAM, DNS, RecA, KDO, KdsD, gutQ, kdsA, kdsB, waaA, msbA, yhiD, IpxL1, IpxM, and any combination thereof; (b) transforming the template plasmid into the genetically modified Vibrio bacterial cells, thereby replicating the template plasmid in the genetically modified Vibrio bacterial cells. Including, wherein the template plasmid replicates in the genetically modified Vibrio bacterial cells with reduced levels of plasmid multimers or concatemers compared to the amount of plasmid multimers or concatemers produced in the same amount of time upon transformation of the template plasmid into bacterial cells of an equivalent bacterial strain lacking the genetic modification.

21. A plasmid produced by the method of claim 20.

22. 1. A genetically modified cell comprising: (a) a genetic modification that results in the elimination or reduced expression of a polypeptide encoded by a nicotinamide adenine dinucleotide (NAD) biosynthesis gene relative to an otherwise equivalent cell lacking the genetic modification; and (b) an exogenously introduced polypeptide encoded by the nicotinamide adenine dinucleotide (NAD) biosynthesis gene or a functional equivalent or functional variant thereof. Including, wherein said genetically modified cells comprising said genetic modification exhibit reduced cell growth or cell survival in antibiotic-free medium in the absence of said exogenously introduced polypeptide compared to said otherwise equivalent cells lacking said genetic modification; A genetically modified cell, wherein the exogenously introduced polypeptide promotes growth of the genetically modified cell in antibiotic-free medium.

23. 23. The genetically modified cell of claim 22, wherein the exogenously introduced polypeptide is introduced via a plasmid containing a sequence encoding the polypeptide.

24. 24. The genetically modified cell of claim 22 or 23, wherein the genetic modification comprises a modification to the NAD biosynthesis gene or a non-coding region operably linked to the NAD biosynthesis gene.

25. 25. The genetically modified cell of any one of claims 22 to 24, wherein the NAD biosynthesis genes are selected from the group consisting of NadA, NadB, NadC, NadD, NadEl, and NadE2.

26. 26. The genetically modified cell of any one of claims 22 to 25, further comprising a genetic modification that results in reduced endotoxin secretion compared to an otherwise equivalent cell that does not contain said genetic modification.

27. 27. The genetically modified cell of claim 26, wherein the genetic modification that results in reduced endotoxin secretion comprises a modification to a gene involved in endotoxin production or a non-coding region operably linked to the gene involved in endotoxin production.

28. 28. The genetically modified cell of claim 27, wherein the gene involved in endotoxin production is a lipopolysaccharide (LPS) biosynthesis gene.

29. 29. The genetically modified cell of claim 28, wherein the LPS biosynthesis gene is selected from the group consisting of KDO, KdsD, gutQ, kdsA, kdsB, waaA, msbA, yhiD, IpxL1, and IpxM.

30. 30. The genetically modified cell of any one of claims 1 to 29, further comprising a genetic modification that results in less phosphodiester cleavage of DNA compared to an otherwise equivalent cell that does not contain said genetic modification that results in less phosphodiester cleavage of DNA.

31. 31. The genetically modified cell of claim 30, wherein the genetic modification that results in less phosphodiester cleavage of DNA comprises a modification to a deoxyribonuclease (Dns) gene or a non-coding region operably linked to the Dns gene.

32. 32. The genetically modified cell of claim 31, wherein the at least one engineered Dns gene is replaced by one or more catalase genes.

33. 33. The genetically modified cell of any one of claims 22 to 32, further comprising a genetic modification that results in less DNA methylation compared to an otherwise equivalent cell that does not contain said genetic modification that results in less DNA methylation.

34. 34. The genetically modified cell of claim 33, wherein the genetic modification that results in less DNA methylation comprises a modification to a DNA methylase (Dam) gene or a non-coding region operably linked to the Dam gene.

35. 35. The genetically modified cell of any one of claims 22 to 34, further comprising a genetic modification that results in less DNA repair compared to an otherwise equivalent cell that does not contain said genetic modification that results in less DNA repair.

36. 36. The genetically modified cell of claim 35, wherein the genetic modification that results in less DNA repair comprises a modification to a recombinase A gene (RecA) gene or a non-coding region operably linked to the RecA gene.

37. 37. The genetically modified cell of claim 36, wherein the at least one engineered RecA gene is replaced by one or more catalase genes.

38. The genetically modified cell of any one of claims 22 to 37, wherein the genetically modified cell is a genetically modified bacterial cell.

39. 39. The genetically modified bacterial cell of claim 38, wherein the genetically modified bacterial cell is a Gram-negative bacterium.

40. The Gram-negative bacteria are selected from Escherichia spp., Shigella spp., Salmonella spp., Campylobacter spp., Neisseria spp., Haemophilus spp., Aeromonas spp., Francisella spp., Yersinia spp., Klebsiella spp., Bordetella spp., Legionella spp., Citrobacter spp., Chlamydia spp., and Brucella spp.

40. The genetically modified cell of claim 39, wherein the bacterial strain is selected from the group consisting of Bacillus subtilis, Pseudomonas spp., Helicobacter spp., Moraxella spp., Stenotrophomonas spp., Bdellovibrio spp., Acinetobacter spp., Enterobacter spp., and Vibrio spp.

41. 41. The genetically modified bacterial cell of claim 40, wherein the bacterium is E. coli or V. natriegens.

42. 42. The genetically modified cell of claim 41, wherein the plasmid further comprises one or more of a LacZa fragment, a multiple cloning site (MSC), a lac operator, a lac promoter, a cap binding site, an origin of replication, and M13 forward and reverse priming sites.

43. 43. The genetically modified cell of any one of claims 22 to 42, wherein the exogenously introduced plasmid further comprises a sequence encoding a biological molecule or a functional fragment thereof.

44. 1. A genetically modified cell comprising: (a) a genetic modification that results in reduced endotoxin secretion compared to an otherwise equivalent cell that does not contain the genetic modification; (b) a genetic modification that results in the elimination or reduced expression of a polypeptide encoded by the nicotinamide adenine dinucleotide synthase E1 (NadE1) gene, compared to an otherwise equivalent cell lacking said genetic modification that results in the elimination or reduced expression of a polypeptide encoded by said NadE1 gene; (c) an exogenously introduced polypeptide encoded by the NadE1 gene or a functional equivalent or functional variant thereof. A genetically modified cell comprising:

45. 45. The genetically modified cell of claim 44, wherein the exogenously introduced polypeptide is introduced via a plasmid comprising a sequence encoding the polypeptide.

46. 46. ​​The genetically modified cell of claim 45, wherein the modified cell is a gram-negative bacterial cell.

47. 47. The genetically modified cell of claim 46, wherein the Gram-negative bacterial cell is E. coli or V. natriegens.

48. 1. A genetically modified bacterial cell comprising: (a) a genetic modification that results in reduced endotoxin secretion compared to an otherwise equivalent cell that does not contain the genetic modification; (b) a genetic modification that results in the elimination or reduced expression of a polypeptide encoded by an essential gene, compared to an otherwise equivalent cell lacking the genetic modification that results in the elimination or reduced expression of a polypeptide encoded by the essential gene; (c) an exogenously introduced polypeptide encoded by the essential gene or a functional equivalent or functional variant thereof; (d) a genetic modification that results in less DNA methylation compared to an otherwise identical cell that does not contain the genetic modification; Including, wherein the genetically modified bacterial cell is a Gram-negative bacterial cell.

49. 1. A system for expression of genetically modified cells in antibiotic-free medium, comprising: (a) a genetically modified cell according to any one of claims 1 to 48; and (b) Antibiotic-free medium Including, the system.

50. 50. The system of claim 49, wherein the genetically modified cells, when grown in said growth medium, replicate the non-native plasmid with at least a 200% increase in plasmid production on a mg basis compared to the corresponding production of the non-native plasmid in an equivalent expression system comprising wild-type K12 E. coli cells grown in said growth medium for the same amount of growth time.

51. 50. The system of claim 49, wherein the genetically modified cells replicate at a rate that is at least 150% faster in the growth medium compared to the corresponding cell replication rate of wild-type K12 E. coli cells grown in the growth medium for the same amount of growth time, as measured by optical density at 600 nm.

52. 50. The system of claim 49, wherein the genetically modified cells replicate in the growth medium with a doubling time of less than 75 minutes, as measured by optical density at 600 nm, compared to the corresponding doubling time of wild-type K12 E. coli cells grown in the growth medium for the same amount of growth time.

53. 50. The system of claim 49, wherein the genetically modified cells replicate with reduced secretion of endotoxin into the growth medium compared to the corresponding doubling time of wild-type K12 E. coli cells grown in the growth medium for the same amount of growth time.

54. 1. A method for modifying a cell, comprising: a) effecting a genetic modification that results in reduced endotoxin secretion compared to an otherwise equivalent cell that does not contain said genetic modification; b) performing a genetic modification that results in the elimination or reduced expression of a polypeptide encoded by a nicotinamide adenine dinucleotide (NAD) biosynthesis gene relative to an otherwise equivalent cell lacking said genetic modification; A method comprising:

55. 55. The method of claim 54, wherein the genetic modification that results in reduced endotoxin secretion comprises a modification to a gene involved in endotoxin production or a non-coding region operably linked to said gene involved in endotoxin production.

56. 56. The method of claim 55, wherein the endotoxin gene is a lipopolysaccharide (LPS) biosynthesis gene.

57. 56. The method of claim 54 or 55, wherein the LPS biosynthesis genes are selected from the group consisting of KDO, KdsD, gutQ, kdsA, kdsB, waaA, msbA, yhiD, IpxL, and IpxM.

58. 58. The method of any one of claims 54 to 57, wherein the genetic modification that results in the elimination or reduced expression of the polypeptide encoded by the NAD biosynthesis gene comprises a modification to the NAD biosynthesis gene or a non-coding region operably linked to the NAD biosynthesis gene.

59. 59. The method of claim 58, wherein the NAD biosynthesis genes are selected from the group consisting of NadA, NadB, NadC, NadD, NadEl, and NadE2.

60. 60. The method of any one of claims 54-59, further comprising the step of effecting a genetic modification that results in less phosphodiester cleavage of DNA compared to an otherwise equivalent cell that does not contain said genetic modification that results in less phosphodiester cleavage of DNA.

61. 61. The method of claim 60, wherein the genetic modification that results in less phosphodiester cleavage of DNA comprises a modification to a deoxyribonuclease (Dns) gene or a non-coding region operably linked to the Dns gene.

62. 62. The method of claim 61 , wherein the Dns gene is replaced by one or more catalase genes.

63. 63. The method of any one of claims 54 to 62, further comprising the step of effecting a genetic modification that results in less DNA methylation compared to an otherwise equivalent cell that does not contain said genetic modification that results in less DNA methylation.

64. 64. The method of claim 63, wherein the genetic modification that results in less DNA methylation comprises a modification to a DNA methylase (Dam) gene or a non-coding region operably linked to the Dam gene.

65. 65. The method of any one of claims 54 to 64, further comprising the step of effecting a genetic modification that results in less DNA repair compared to an otherwise equivalent cell that does not contain said genetic modification that results in less DNA repair.

66. 66. The method of claim 65, wherein the genetic modification that results in less DNA repair comprises a modification to a recombinase A gene (RecA) gene or a non-coding region operably linked to the RecA gene.

67. 67. The method of claim 66, wherein the at least one engineered RecA gene is replaced by one or more catalase genes.

68. 68. The method of any one of claims 54 to 67, wherein the cell is a bacterial cell.

69. The bacterial cell may be Escherichia spp. , Shigella spp. , Salmonella spp. , Campylobacter spp. , Neisseria spp. , Haemophilus spp. , Aeromonas spp. , Francisella spp. , Yersinia spp. , Klebsiella spp. , Bordetella spp. , Legionella spp. , Citrobacter spp. , Chlamydia spp. , Brucella spp.

69. The method of claim 68, wherein the bacterial species selected from the group consisting of Pseudomonas spp., Helicobacter spp., Moraxella spp., Stenotrophomonas spp., Bdellovibrio spp., Acinetobacter spp., Enterobacter spp., and Vibrio spp.

70. 68. The method of claim 67, wherein the bacterial cell is E. coli or V. natriegens.

71. 71. The method of any one of claims 54 to 70, wherein one or more genetic modifications are made using an endonuclease system.

72. 72. The method of claim 71, wherein the endonuclease system is a meganuclease, a zinc finger nuclease, a transcription activator-like effector-based nuclease (TALEN), or a CRISPR system.

73. 73. The method of Claim 72, wherein said endonuclease system is a CRISPR system and said CRISPR system is a CRISPR / Cas9 system.

74. 74. The method of Claim 73, wherein the CRISPR / Cas9 system is provided on a first vector or plasmid and the gRNA is provided on a second vector or plasmid.

75. 75. The method of claim 73 or 74, wherein the genetic modification resulting in less phosphodiester cleavage of DNA is carried out using one or more guide RNA sequences selected from the group consisting of TTGGTGTCACTATTACCGCGCGG, CAGCTGCAATGCTGGCAAAGCGG, TCGAGCGGTAATAGTGAACGCGG, and TCCATTTCACTATTACCGAGCGG.

76. 75. The method of claim 73 or 74, wherein the genetic modification resulting in less DNA methylation is carried out using one or more guide RNA sequences selected from the group consisting of GCGTCGTTTATACCACGGAG, CCACGCTCAAATCCGCTCCG, GACGCGTTAATGTTGTATCG, and AAGTTTGCGGTATTTGAAAG.

77. 1. A method of expressing a plasmid in a genetically modified cell contained in an antibiotic-free medium, wherein the genetically modified cell comprises a genetic modification that results in the elimination or reduced expression of a polypeptide encoded by a nicotinamide adenine dinucleotide (NAD) biosynthesis gene relative to an otherwise equivalent cell lacking the genetic modification, and the plasmid comprises a sequence encoding the polypeptide encoded by the NAD biosynthesis gene or a functional equivalent or functional variant thereof; (a) transforming the genetically modified cell with the plasmid; (b) selecting the transformed cells in antibiotic-free growth medium; and (c) isolating the amplified plasmid from the transformed cells. A method comprising:

78. 78. A plasmid produced by the method of claim 77.

79. 1. A method for expressing a biological molecule encoded by a plasmid in a genetically modified cell contained in an antibiotic-free medium, wherein the genetically modified cell comprises a genetic modification that results in the elimination or reduced expression of a polypeptide encoded by a nicotinamide adenine dinucleotide (NAD) biosynthesis gene relative to an otherwise equivalent cell lacking the genetic modification, and wherein the plasmid (i) a sequence encoding the polypeptide encoded by the NAD biosynthesis gene or a functional equivalent or functional variant thereof; and (ii) a sequence encoding said biomolecule or a functional fragment thereof; Including, The method comprises: (a) transforming the genetically modified cell with the plasmid; (b) selecting the transformed cells in antibiotic-free growth medium; and (c) purifying the biomolecule or functional fragment thereof from the transformed cells. A method comprising:

80. 80. A biomolecule produced by the method of claim 79.