Epstein-Barr virus mRNA vaccine

Abstract

The present disclosure provides mRNA vaccines for treating or preventing Epstein-Barr virus infection, wherein the mRNA vaccines encode lytic and / or latent EBV antigens.

Description

[Technical Field]

[0001] Related Applications This application claims the benefit under 35 U.S.C. §119(e) to U.S. Provisional Application No. 63 / 482,272, entitled "Epstein-Barr Virus mRNA Vaccine," filed January 30, 2023, the entire contents of which are incorporated herein by reference.

[0002] Electronic Sequence Listing Reference The contents of the electronic sequence listing (M137870226WO00-VLJ-SEQ.xml; size: 133,651 bytes; and creation date: January 29, 2024) are incorporated herein by reference in their entirety. [Background technology]

[0003] Epstein-Barr virus (EBV) is a complex, large, double-stranded gammaherpesvirus with a global prevalence of approximately 94% in adulthood. It is associated with several severe acute and chronic conditions, including infectious mononucleosis, nasopharyngeal carcinoma, Burkitt's and Hodgkin's lymphoma, gastric cancer, post-transplant lymphoproliferative disorder (PTLD), and more recently, systemic lupus erythematosus and multiple sclerosis. Infectious mononucleosis is a clinical syndrome characterized by fever, fatigue, sore throat, and lymphadenopathy, which can lead to prolonged symptoms, hospitalization, and splenic rupture.

[0004] Post-transplant lymphoproliferative disorders (PTLDs) are a group of clinical disorders that occur after transplantation and are characterized by the abnormal proliferation of lymphocytes in the setting of iatrogenic immunosuppression. These disorders are associated with both solid organ transplants and hematopoietic stem cell transplants and occur in both EBV-seropositive and EBV-seronegative transplant recipients. Indeed, in the first year after solid organ transplantation, over 90% of B-cell PTLD cases have evidence of the EBV genome, likely reflecting primary EBV infection in seronegative transplant recipients. A bimodal distribution of PTLD incidence has been described, with an initial increase in the first year after transplantation associated with EBV-positive recipients and a second spike 5–15 years after transplantation associated with EBV-negative recipients. The cumulative incidence of PTLD per 100 patient-years continues to increase consistently for approximately 20 years after transplantation.

[0005] Multiple sclerosis is an autoimmune disease of the central nervous system that primarily affects young women. If left untreated, it is associated with significant neurological disability and shortened lifespan. It has long been known that a clinical history of infectious mononucleosis and a later age at onset of infectious mononucleosis are associated with multiple sclerosis. Evidence of a history of infection with EBV, the cause of infectious mononucleosis, is essentially universal in people with multiple sclerosis, compared with approximately 90% of the general adult population. More recent studies have shown that multiple sclerosis occurs only in people who acquire EBV before the onset of the disease. Thus, there is now compelling evidence that EBV is "essential but not sufficient" to cause multiple sclerosis. This has led to the conclusion that EBV is a major driver of multiple sclerosis pathology and disease activity. Over the past 30 years, several effective disease-modifying therapies have been developed for relapsing forms of multiple sclerosis (in which attacks of symptoms return sporadically), but these therapies are not "cures" and are not appropriate or available for all patients with multiple sclerosis. As a result, many patients with multiple sclerosis continue to have poor outcomes.

[0006] No licensed EBV vaccine is currently available. Summary of the Invention

[0007] Epstein-Barr virus (EBV) is a complex, large, double-stranded DNA gammaherpesvirus with a high seroprevalence (>90%) in adults worldwide. It is responsible for 90% of infectious mononucleosis cases worldwide, most commonly seen in adolescents and young adults with primary infection. Infectious mononucleosis is a clinical syndrome characterized by fever, fatigue, sore throat, and lymphadenopathy, which can lead to prolonged symptoms, hospitalization, and splenic rupture. EBV has also been associated with other serious diseases, including infectious mononucleosis, nasopharyngeal carcinoma, Burkitt lymphoma, Hodgkin lymphoma, gastric cancer, post-transplant lymphoproliferative disorder (PTLD), and more recently, systemic lupus erythematosus and multiple sclerosis.

[0008] EBV, with a genome approximately 175 kb in size, utilizes several surface glycoproteins to mediate viral entry into B cells and epithelial cells. These include the major glycoproteins gp350, gHgL, gp42, and gB6. Similar to other herpesviruses, EBV then establishes lifelong latency within the host, periodically cycling between lytic and latent replication (Kempkes and Robertson, 2015). EBV latency in B cells is maintained by a set of latent viral proteins, most notably the Epstein-Barr nuclear antigen (EBNA) and latent membrane protein (LMP), which are expressed at various stages of latency. While entry glycoproteins are the primary targets of neutralizing antibodies, latent antigens induce potent T cell responses following natural infection. Thus, vaccine compositions combining glycoproteins and latency antigens may significantly impact the severe outcome of EBV infection in EBV-seronegative and seropositive individuals by inducing or boosting humoral and cellular immunity against EBV and establishing immune control over latently infected B cells.

[0009] The messenger ribonucleic acid (mRNA) vaccines provided herein safely direct the body's cellular machinery to produce lytic and latent EBV antigens designed to have therapeutic immunogenic activity both inside and outside of cells. These EBV mRNA vaccines herein contain multiple mRNA polynucleotides, each encoding a different EBV lytic antigen (e.g., glycoprotein) or latent antigen protein, which collectively produce improved neutralizing antibodies and CD8 + and CD4 + The vaccines disclosed herein, which include mRNA encoding a modified EBV latent nuclear antigen (e.g., EBNA3A), induce a T cell response that can prevent EBV from re-emerging from latency (reactivation) and / or eliminate cells actively replicating and expressing the wild-type protein counterpart. For example, vaccines disclosed herein that include mRNA encoding a modified EBV latent nuclear antigen (e.g., EBNA3A) induce a CD4 T cell response with a Th1-like signature. + Vaccines containing both mRNA encoding EBV latent nuclear antigens (e.g., EBNA3A) and mRNA encoding EBV latent membrane proteins (e.g., LMP2B) induced T cell responses characterized by upregulation of cytotoxic markers, e.g., CD4 T cells, IFN-γ, TNF-α, and IL-2. + The data provided herein also demonstrate that there is no significant interference when mRNAs encoding multiple EBV latent antigens are co-administered. Indeed, for example, CD8+ T cell responses to LMP2B were increased in the presence of EBNA3A. T cell responses were also detected against glycoprotein antigens: EBV gH induces CD8 + and CD4 + Although soluble EBV gp42 and EBV gp220 isoforms induced both CD4 T cell responses and T cell responses, soluble EBV gp42 and EBV gp220 isoforms induced both CD4 T cell responses and T cell responses. +and induced T cell responses. The mRNA vaccines containing both glycoprotein and latent antigens provided herein may be useful in both EBV-seronegative and EBV-seropositive populations at risk for EBV-associated diseases, such as PTLD, systemic lupus erythematosus, multiple sclerosis, and / or cancer. The EBV mRNA vaccines provided herein can be used to induce a balanced immune response, including both cellular and humoral immunity, without many of the risks associated with DNA vaccination.

[0010] Some aspects of the present disclosure relate to an Epstein-Barr virus (EBV) messenger ribonucleic acid (mRNA) vaccine comprising: (a) one or more mRNAs, each comprising an open reading frame (ORF) encoding an EBV lytic antigen; (b) one or more mRNAs, each comprising an ORF encoding an EBV latent antigen; and (c) lipid nanoparticles, wherein at least 50% of the mass of the mRNA in the vaccine is mRNA encoding the EBV lytic antigen.

[0011] Some aspects of the present disclosure relate to a therapeutic Epstein-Barr virus (EBV) messenger ribonucleic acid (mRNA) vaccine, comprising one or more mRNAs encoding at least two EBV latent antigens, and lipid nanoparticles, wherein the EBV latent antigens are selected from EBV nuclear antigen 1 (EBNA1), EBV nuclear antigen 2 (EBNA2), EBV nuclear antigen 3A (EBNA3A), EBV nuclear antigen 3B (EBNA3B), EBV nuclear antigen 3C (EBNA3C), EBV latent membrane protein 1 (LMP1), EBV latent membrane protein 2A (LMP2A), and EBV latent membrane protein 2B (LMP2B).

[0012] Some aspects of the present disclosure relate to a therapeutic Epstein-Barr virus (EBV) messenger ribonucleic acid (mRNA) vaccine, comprising one or more mRNAs encoding an EBNA3A antigen and lipid nanoparticles, wherein the EBNA3A antigen has one or more of the following characteristics: a. lacks a C-terminal transcriptional regulator domain; b. has a length of approximately 523 amino acids; c. contains amino acid residues corresponding to amino acid residues 1-523 of naturally occurring EBNA3A; d. does not contain amino acid residues corresponding to amino acid residues 524-944 of naturally occurring EBNA3A; e. the N-terminus of EBNA3A is truncated compared to naturally occurring EBNA3A and the C-terminus of EBNA3A is truncated compared to naturally occurring EBNA3A; f. has a length of approximately 455 amino acids; g. contains amino acid residues corresponding to amino acid residues 68-523 of naturally occurring EBNA3A; h. does not contain amino acid residues corresponding to amino acid residues 1-67 and 524-944 of naturally occurring EBNA3A; i. One or more nuclear localization signals (NLSs) in EBNA3A are mutated compared to naturally occurring EBNA3A; j. 1 to 4, 2 to 4, 3 to 4, or 4 of the NLSs in EBNA3A are mutated compared to naturally occurring EBNA3A, and optionally the mutated NLSs are at amino acid positions selected from 63 to 66, 146 to 155, 375 to 381, and 394 to 398 compared to naturally occurring EBNA3A; and / or k. has a C-terminus truncated at amino acid residue 68 and the N-terminus of EBNA3A is truncated at amino acid residue 523, and the EBNA3 comprises NLS mutations at amino acid residues 146 to 155, 375 to 378, and 394 to 398 compared to naturally occurring EBNA3A.

[0013] Some embodiments of the present disclosure relate to methods for treating EBV infection, comprising administering to a subject an EBV mRNA vaccine comprising one or more mRNAs encoding at least two latent EBV antigens to induce a therapeutically effective cytotoxic CD8 T cell response against EBV-infected cells.

[0014] Some aspects of the present disclosure relate to an Epstein-Barr virus (EBV) messenger ribonucleic acid (mRNA) vaccine comprising: (a) one or more mRNAs, each encoding an EBV lytic antigen; (b) one or more mRNAs, each encoding an EBV latent antigen; and (c) lipid nanoparticles, wherein at least 50% (e.g., at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, or at least 80%) of the mRNAs in the vaccine encode an EBV lytic antigen.

[0015] In some embodiments, about 50% of the mRNA in the vaccine encodes an EBV lytic antigen.

[0016] In some embodiments, about 50% to about 80% of the mRNA in the vaccine encodes an EBV lytic antigen. In some embodiments, about 50% to about 70% of the mRNA in the vaccine encodes an EBV lytic antigen. In some embodiments, about 50% to about 60% of the mRNA in the vaccine encodes an EBV lytic antigen. In some embodiments, about 60% to about 80% of the mRNA in the vaccine encodes an EBV lytic antigen. In some embodiments, about 60% to about 70% of the mRNA in the vaccine encodes an EBV lytic antigen.

[0017] In some embodiments, about 20% to about 50% of the mRNA in the vaccine encodes an EBV latent antigen. In some embodiments, about 20% to about 40% of the mRNA in the vaccine encodes an EBV latent antigen. In some embodiments, about 20% to about 30% of the mRNA in the vaccine encodes an EBV latent antigen. In some embodiments, about 30% to about 50% of the mRNA in the vaccine encodes an EBV latent antigen. In some embodiments, about 30% to about 40% of the mRNA in the vaccine encodes an EBV latent antigen.

[0018] In some embodiments, the EBV lytic antigen is an EBV glycoprotein.

[0019] In some embodiments, the EBV glycoprotein is selected from EBV glycoprotein 350 (gp330), EBV glycoprotein 220 (gp220), EBV glycoprotein H (gH), EBV glycoprotein L (gL), EBV glycoprotein 42 (gp42), and EBV glycoprotein B (gB).

[0020] In some embodiments, the EBV glycoproteins include EBV gp220, EBV gH, EBV gL, and EBV gp42.

[0021] In some embodiments, the EBV latent antigen is selected from EBV nuclear antigen 1 (EBNA1), EBV nuclear antigen 2 (EBNA2), EBV nuclear antigen 3A (EBNA3A), EBV nuclear antigen 3B (EBNA3B), EBV nuclear antigen 3C (EBNA3C), EBV latent membrane protein 1 (LMP1), EBV latent membrane protein 2A (LMP2A), and EBV latent membrane protein 2B (LMP2B).

[0022] In some embodiments, the EBV latent antigens include EBNA3A and LMP2B.

[0023] In some embodiments, about 25% to about 45% of the mRNA encodes EBV gp220, about 10% to about 20% of the mRNA encodes EBV gH, about 5% to about 15% of the mRNA encodes EBV gL, about 5% to about 15% of the mRNA encodes EBV gp42, about 10% to about 25% of the mRNA encodes EBBA3A, and about 10% to about 25% of the mRNA encodes EBV LMP2B.

[0024] In some embodiments, about 40% to about 45% of the mRNA encodes EBV gp220, about 15% to about 20% of the mRNA encodes EBV gH, about 10% to about 15% of the mRNA encodes EBV gL, about 10% to about 15% of the mRNA encodes EBV gp42, about 10% to about 15% of the mRNA encodes EBBA3A, and about 10% to about 15% of the mRNA encodes EBV LMP2B.

[0025] In some embodiments, about 42% of the mRNAs encode EBV gp220, about 16% of the mRNAs encode EBV gH, about 10.5% of the mRNAs encode EBV gL, about 10.5% of the mRNAs encode EBV gp42, about 10.5% of the mRNAs encode EBBA3A, and about 10.5% of the mRNAs encode EBV LMP2B.

[0026] In some embodiments, about 25% to about 30% of the mRNA encodes EBV gp220, about 10% to about 15% of the mRNA encodes EBV gH, about 5% to about 10% of the mRNA encodes EBV gL, about 5% to about 10% of the mRNA encodes EBV gp42, about 20% to about 25% of the mRNA encodes EBBA3A, and about 20% to about 25% of the mRNA encodes EBV LMP2B.

[0027] In some embodiments, about 27% of the mRNAs encode EBV gp220, about 10% of the mRNAs encode EBV gH, about 6.5% of the mRNAs encode EBV gL, about 6.5% of the mRNAs encode EBV gp42, about 25% of the mRNAs encode EBBA3A, and about 25% of the mRNAs encode EBV LMP2B.

[0028] In some embodiments, the C-terminus of EBNA3A is truncated compared to naturally occurring EBNA3A.

[0029] In some embodiments, EBNA3A lacks the C-terminal transcription factor domain.

[0030] In some embodiments, EBNA3A has a length of about 523 amino acids.

[0031] In some embodiments, EBNA3A comprises amino acid residues corresponding to amino acid residues 1-523 of naturally occurring EBNA3A.

[0032] In some embodiments, EBNA3A does not contain amino acid residues corresponding to amino acid residues 524-944 of naturally occurring EBNA3A.

[0033] In some embodiments, the N-terminus of EBNA3A is truncated compared to naturally occurring EBNA3A.

[0034] In some embodiments, EBNA3A has a length of about 455 amino acids.

[0035] In some embodiments, EBNA3A comprises amino acid residues corresponding to amino acid residues 68 to 523 of naturally occurring EBNA3A.

[0036] In some embodiments, EBNA3A does not include amino acid residues corresponding to amino acid residues 1-67 and 524-944 of naturally occurring EBNA3A.

[0037] In some embodiments, one or more nuclear localization signals (NLS) in EBNA3A are mutated compared to naturally occurring EBNA3A.

[0038] In some embodiments, 1 to 4, 2 to 4, 3 to 4, or 4 of the NLSs in EBNA3A are mutated compared to naturally occurring EBNA3A.

[0039] In some embodiments, the mutated NLS is at an amino acid position selected from 63-66, 146-155, 375-381, and 394-398 relative to naturally occurring EBNA3A.

[0040] In some embodiments, the C-terminus of EBNA3A is truncated at amino acid residue 68, the N-terminus of EBNA3A is truncated at amino acid residue 523, and EBNA3 contains NLS mutations at amino acid residues 146-155, 375-378, and 394-398 compared to naturally occurring EBNA3A.

[0041] In some embodiments, the EBV gp220 comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO:1.

[0042] In some embodiments, the mRNA encoding EBV gp220 comprises an open reading frame comprising a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the nucleic acid sequence of SEQ ID NO:7.

[0043] In some embodiments, the mRNA encoding EBV gp220 comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the nucleic acid sequence of SEQ ID NO:13.

[0044] In some embodiments, the EBV gH comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO:2.

[0045] In some embodiments, the mRNA encoding EBV gH comprises an open reading frame comprising a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the nucleic acid sequence of SEQ ID NO:8.

[0046] In some embodiments, the mRNA encoding EBV gH comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the nucleic acid sequence of SEQ ID NO:14.

[0047] In some embodiments, the EBV gL comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO:3.

[0048] In some embodiments, the mRNA encoding EBV gL comprises an open reading frame comprising a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the nucleic acid sequence of SEQ ID NO:9.

[0049] In some embodiments, the mRNA encoding EBV gL comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the nucleic acid sequence of SEQ ID NO:15.

[0050] In some embodiments, the EBV gp42 is soluble.

[0051] In some embodiments, EBV gp42 comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of any one of SEQ ID NOs: 4 or 21.

[0052] In some embodiments, the mRNA encoding EBV gp42 comprises an open reading frame comprising a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the nucleic acid sequence of SEQ ID NO:10.

[0053] In some embodiments, the mRNA encoding EBV gp42 comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the nucleic acid sequence of SEQ ID NO:16.

[0054] In some embodiments, EBNA3A comprises an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to the amino acid sequence of any one of SEQ ID NOs: 5 or 22, or at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to the amino acid sequence of any one of SEQ ID NOs: 28-31.

[0055] In some embodiments, the mRNA encoding EBNA3A comprises an open reading frame comprising a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 11, or at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the nucleic acid sequence of any one of SEQ ID NOs: 24-27.

[0056] In some embodiments, the mRNA encoding EBNA3A comprises a nucleic acid sequence that has at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 17, or at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the nucleic acid sequence of any one of SEQ ID NOs: 32-35.

[0057] In some embodiments, the EBV LMP2B comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of any one of SEQ ID NOs: 6 or 23.

[0058] In some embodiments, the mRNA encoding EBV LMP2B comprises an open reading frame comprising a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the nucleic acid sequence of SEQ ID NO:12.

[0059] In some embodiments, the mRNA encoding EBV LMP2B comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the nucleic acid sequence of SEQ ID NO:18.

[0060] In some embodiments, one or more of the mRNAs comprises a chemical modification.

[0061] In some embodiments, 100% of the uracil nucleotides of one or more mRNAs comprise a chemical modification.

[0062] In some embodiments, the chemical modification is 1-methylpseudouracil.

[0063] In some embodiments, the lipid nanoparticles comprise an ionizable lipid, a neutral lipid, a sterol, and a PEG-modified lipid.

[0064] In some embodiments, the lipid nanoparticles comprise 40-60 mol % ionizable lipid, 5-20 mol % neutral lipid, 30-50 mol % sterol, and 0.5-5 mol % PEG-modified lipid.

[0065] In some embodiments, the ionizable lipid is a compound of formula (AIII): [ka] (Wherein R1 is R'M'R' or C 5-20 alkenyl, and R and R are each independently C 1-14 Alkyl and C 2-14 alkenyl, and R4 is selected from -(CH2) n Q, wherein Q is OH, n is selected from 3, 4, and 5, M and M′ are each independently —OC(O)— or —C(O)O—, R5, R6, and R7 are each H, and R′ is a linear C 1-12 Alkyl, or C 6-9Alkyl-substituted C 1-12 alkyl, and R" is C 3-14 alkyl, and m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13.

[0066] In some embodiments, R is R″M′R′, and R and R are each independently C 1-14 alkyl and R4 is -(CH2) n Q, wherein Q is OH, n is 4, M and M′ are each independently —OC(O)—, R, R 6、 and R7 are each H, and R' is C 6-9 Alkyl-substituted C 1-12 alkyl, and R" is C 3-14 alkyl and m is 6.

[0067] In some embodiments, R is C 5-20 alkenyl, and R and R are each independently C 1-14 alkyl and R4 is -(CH2) n Q, wherein Q is OH, n is 3, M is —C(O)O—, R 5 , R 6 , and R 7 are each H, and m is 6.

[0068] In some embodiments, the ionizable lipid is a compound of formula (AIII): [ka] (Wherein R1 is C 5-30 Alkyl, C 5-20 alkenyl, and -R"M'R', and R2 and R3 are selected from the group consisting of C 1-14 Alkyl and C 2-14 alkenyl, and R4 is independently selected from the group consisting of -(CH2) nQ, wherein Q is -OR, n is selected from 1, 2, 3, 4, and 5, each R is H, each R is H, M and M' are independently selected from -C(O)O- and -OC(O)-, R is H, R is H, and R' is C 1-18 Alkyl and C 2-18 alkenyl, and R" is selected from the group consisting of C 3-14 Alkyl and C 3-14 alkenyl, and m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13).

[0069] In some embodiments, the amino lipid is [ka] is.

[0070] In some embodiments, the neutral lipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC). In some embodiments, the sterol is cholesterol. In some embodiments, the PEG-modified lipid is PEG-DMG.

[0071] Another aspect of the present disclosure relates to a method comprising administering to a subject a therapeutically effective amount of an EBV mRNA vaccine according to any one of the preceding claims.

[0072] In some embodiments, the therapeutically effective amount is one or more 25-150 μg, 25-100 μg, 25-50 μg, 50-150 μg, or 50-100 μg doses of the EBV mRNA vaccine. In some embodiments, the therapeutically effective amount is one or more 25 μg doses of the EBV mRNA vaccine. In some embodiments, the therapeutically effective amount is one or more 50 μg doses of the EBV mRNA vaccine. In some embodiments, the therapeutically effective amount is one or more 100 μg doses of the EBV mRNA vaccine. In some embodiments, the therapeutically effective amount is one or more 150 μg doses of the EBV mRNA vaccine.

[0073] In some embodiments, the subject has been infected with EBV.

[0074] In some embodiments, the subject is a patient who has undergone or will undergo a solid organ transplant or a hematopoietic stem cell transplant.

[0075] In some embodiments, the subject has or is at risk of having post-transplant lymphoproliferative disorder.

[0076] In some embodiments, the subject has or is at risk of having infectious mononucleosis.

[0077] In some embodiments, the subject has or is at risk of having multiple sclerosis.

[0078] In some embodiments, the subject has or is at risk of having systemic lupus erythematosus.

[0079] In some embodiments, the subject has or is at risk of having cancer, hi some embodiments, the cancer is selected from Burkitt's lymphoma, Hodgkin's lymphoma, nasopharyngeal carcinoma, and gastric cancer.

[0080] In some embodiments, the subject is EBV seropositive. In other embodiments, the subject is EBV seronegative.

[0081] In some embodiments, the subject is between 18 and 55 years old.

[0082] In some embodiments, the EBV mRNA is administered intramuscularly, intravenously, or intranasally.

[0083] In some embodiments, the effective amount induces a neutralizing antibody response.

[0084] In some embodiments, the effective amount induces a CD4+ T cell response. In some embodiments, the effective amount induces a CD8+ T cell response. [Brief explanation of the drawings]

[0085] [Figure 1A] Figure 1 shows CD8+ T cell responses after stimulation with LMP2. The y-axis shows the percentage (%) of CD8+ T cells bearing markers selected from CD107a, IFN-γ, TNF-α, or IL-2. The x-axis shows which formulation (DP) was administered at which dose (μg mRNA). [Figure 1B] Figure 1 shows CD8+ T cell responses after stimulation with EBNA3A. The y-axis shows the percentage (%) of CD8+ T cells bearing markers selected from CD107a, IFN-γ, TNF-α, or IL-2. The x-axis shows which formulation (DP) was administered at which dose (μg mRNA). [Figure 1C] Figure 1 shows CD8+ T cell responses after stimulation with gH. The y-axis shows the percentage (%) of CD8+ T cells bearing markers selected from CD107a, IFN-γ, TNF-α, or IL-2. The x-axis shows which formulation (DP) was administered at which dose (μg mRNA). [Figure 1D] Figure 1 shows CD8+ T cell responses after stimulation with gL. The y-axis shows the percentage (%) of CD8+ T cells bearing markers selected from CD107a, IFN-γ, TNF-α, or IL-2. The x-axis shows which formulation (DP) was administered at which dose (μg mRNA). [Figure 1E] Figure 1 shows CD8+ T cell responses after stimulation with gp42. The y-axis shows the percentage (%) of CD8+ T cells bearing markers selected from CD107a, IFN-γ, TNF-α, or IL-2. The x-axis shows which formulation (DP) was administered at which dose (μg mRNA). [Figure 1F] Figure 1 shows CD8+ T cell responses after stimulation with gp220. The y-axis shows the percentage (%) of CD8+ T cells bearing markers selected from CD107a, IFN-γ, TNF-α, or IL-2. The x-axis shows which formulation (DP) was administered at which dose (μg mRNA). [Figure 2A] Figure 1 shows CD4+ T cell responses after stimulation with LMP2. The y-axis shows the percentage (%) of CD4+ T cells with markers selected from FN-γ, TNF-α, IL-2, IL-4, IL-5, or IL-13. The x-axis shows which formulation (DP) was administered at which dose (μg mRNA). [Figure 2B] 1 shows CD4+ T cell responses after stimulation with EBNA3A. The y-axis shows the percentage (%) of CD4+ T cells bearing markers selected from FN-γ, TNF-α, IL-2, IL-4, IL-5, or IL-13. The x-axis shows which formulation (DP) was administered at which dose (μg mRNA). [Figure 2C] Figure 1 shows CD4+ T cell responses after stimulation with gH. The y-axis shows the percentage (%) of CD4+ T cells bearing markers selected from FN-γ, TNF-α, IL-2, IL-4, IL-5, or IL-13. The x-axis shows which formulation (DP) was administered at which dose (μg mRNA). [Figure 2D] Figure 1 shows CD4+ T cell responses after stimulation with gL. The y-axis shows the percentage (%) of CD4+ T cells bearing markers selected from FN-γ, TNF-α, IL-2, IL-4, IL-5, or IL-13. The x-axis shows which formulation (DP) was administered at which dose (μg mRNA). [Figure 2E] Figure 1 shows CD4+ T cell responses after stimulation with gp42. The y-axis shows the percentage (%) of CD4+ T cells bearing markers selected from FN-γ, TNF-α, IL-2, IL-4, IL-5, or IL-13. The x-axis shows which formulation (DP) was administered at which dose (μg mRNA). [Figure 2F] Figure 1 shows CD4+ T cell responses after stimulation with gp220. The y-axis shows the percentage (%) of CD4+ T cells bearing markers selected from FN-γ, TNF-α, IL-2, IL-4, IL-5, or IL-13. The x-axis shows which formulation (DP) was administered at which dose (μg mRNA). [Figure 3] A-B show the results of neutralization assays of B cells (A) or epithelial cells (B). The y-axis indicates the 50% neutralization titer level (NT50) (log10). The x-axis indicates which formulation (DP) was administered at which dose (μg mRNA). The dashed line indicates the limit of detection (LOD). [Figure 4A] Figure 1 shows the results of a Luminex® assay for gHgL. The y-axis shows the percentage (log10) of the Luminex mean net mean fluorescence intensity (MFI). The x-axis shows which formulation (DP) was administered at which dose (μg mRNA). [Figure 4B] Figure 1 shows the results of a Luminex® assay for gp42. The y-axis shows the percentage (log10) of the Luminex mean net mean fluorescence intensity (MFI). The x-axis shows which formulation (DP) was administered at which dose (μg mRNA). [Figure 4C] Figure 1 shows the results of a Luminex® assay for gp220. The y-axis shows the percentage (log10) of the Luminex mean net mean fluorescence intensity (MFI). The x-axis shows which formulation (DP) was administered at which dose (μg mRNA). [Figure 5] Figure 1 shows EBNA3A- and LMP2b-specific CD8+ T cell responses. CD8+ T cell responses measured by ICS in mice immunized with EBNA3A and LMP2b. All groups received 1 μg of the specific antigen on days 1 and 29. ICS analysis of harvested spleens was performed on day 36. The Y-axis indicates the percentage of the CD8+ T cell population expressing the indicated cytokine. Error bars indicate the standard error of the mean (SEM). [Figure 6] Figure 1 shows EBNA3A- and LMP2b-specific CD4+ T cell responses. CD4+ T cell responses measured by ICS in mice immunized with EBNA3A and LMP2b. All groups received 1 μg of the specific antigen on days 1 and 29. ICS analysis of harvested spleens was performed on day 36. The Y-axis indicates the percentage of the CD4+ T cell population expressing the indicated cytokine. Error bars indicate the standard error of the mean (SEM). [Figure 7] (A-B) Graphs showing in vitro CD8+ T cell cytotoxicity against EBV-transformed lymphoblastoid B cell lines (LCLs). EBV latent antigen-specific and non-specific T cells were expanded from healthy donors by 14-day coculture with monocyte-derived dendritic cells (DCs) transfected with EBNA3A and LMP2b latent mRNA antigens or negative control mRNA. Antigen-specific T cells were isolated and cocultured with autologous EBV-transformed lymphoblastoid B cell lines (LCLs) at increasing T cell:LCL ratios (effector:target) at 37°C for 6 hours. Samples were then stained with caspase 3 / 7 detection reagent and Live / Dead stain to detect apoptotic LCLs. (A-B) Percentage of apoptotic LCLs after coincubation with autologous antigen-specific (EBV or control) CD8+ T cells. Data are shown as mean ± SEM. Samples are performed in duplicate. Background apoptosis levels (no T cells) subtracted from CD8 T cell co-incubated samples. DETAILED DESCRIPTION OF THE INVENTION

[0086] The present disclosure provides therapeutic and prophylactic vaccines containing messenger RNA (mRNA) containing open reading frames encoding Epstein-Barr virus (EBV) proteins. EBV, a gamma-herpesvirus, is an enveloped, double-stranded DNA virus of the Herpesviridae family. Epstein-Barr virus is responsible for 90% of infectious mononucleosis cases worldwide. It utilizes several surface glycoproteins to mediate viral entry into B cells and epithelial cells. These include the major glycoproteins gp350, gH, gL, gp42, and gB. The gH / gL complex is part of the herpesvirus core fusion machinery required for entry into all cell types and functions as a receptor-binding ligand for epithelial cell entry. Together, gH / gL, gp42, and gp350 are the primary targets of neutralizing antibodies that prevent EBV infection of B cells and epithelial cells.

[0087] In addition to infectious mononucleosis, EBV may be responsible for nearly 2% of all cancer deaths worldwide. Cancers with a strong causal relationship to EBV include Burkitt's lymphoma, Hodgkin's lymphoma, gastric cancer, and nasopharyngeal carcinoma. These are highly heterogeneous cancers with different pathophysiological characteristics and clinical manifestations, and therefore epidemiological data regarding risk factors are highly variable.

[0088] Autoimmune disorders, such as systemic lupus erythematosus and multiple sclerosis, are also associated with EBV infection. Data supporting the role of EBV in MS have accumulated for over 20 years, suggesting that EBV may be necessary but not sufficient to cause multiple sclerosis. For example, patients with multiple sclerosis have been found to have elevated antibody titers to EBV, and a history of infectious mononucleosis is known to increase the risk of multiple sclerosis. In a recent study of over 10 million active-duty U.S. military personnel over a 20-year period, 97% of individuals who developed multiple sclerosis and were EBV-seronegative at baseline seroconverted during follow-up, whereas only 57% of those who seroconverted did not develop multiple sclerosis.

[0089] A vaccine that prevents asymptomatic or symptomatic EBV infection could have a significant effect on these EBV-associated diseases. Like all other human herpesviruses, EBV persists within the host for life, cycling between latent and lytic states after acute infection. Key to this process are so-called "latent" viral proteins, including nuclear antigen and latent membrane protein. These proteins (antigens) play important roles in regulating gene expression during EBV latency and are potent inducers of T cell-mediated immunity. Including these antigens in vaccines that prevent B cell and epithelial cell invasion could control reactivation of latent EBV and prevent or delay the progression of several EBV-associated diseases, such as post-transplant lymphoproliferative disease (PTLD), systemic lupus erythematosus, multiple sclerosis, and cancer. Thus, in some embodiments, the present disclosure provides EBV vaccines containing structural glycoproteins (e.g., EBV gp220, gH, gL, and gp42) and latency antigens (e.g., EBNA3A and LMP2B). The EBV mRNA vaccines described herein, which contain both lytic and latent antigens, may be useful in both EBV-seronegative and EBV-seropositive humans at risk for EBV-associated disease.

[0090] The vaccines disclosed herein have been demonstrated to induce both humoral and cellular immune responses. The benefits of a dual immune response against viral infections, such as those caused by EBV, are significant. Latent viruses are difficult to treat. However, the cell-mediated immune response induced by the latent antigens found in the vaccine offers a significant advantage in reducing the latent viral reservoir.

[0091] Messenger RNA is a carrier that transfers the blueprint for protein production from genomic DNA in the nucleus to the cytoplasm, the cellular site for protein synthesis. In normal cells, mRNA is transcribed from genomic DNA in the nucleus and transported from the nucleus to the cytoplasm, where it is translated into proteins. Messenger RNA does not interact with the genome, is non-replicating, delivers only the genetic elements necessary for the expression of the encoded protein, and its effects are transient and dose-dependent. The basic structure of all forms of eukaryotic mRNA is similar: a polymer of ribonucleotides of various lengths, with each ribonucleotide linked by its terminal 3' hydroxyl group to the 5' phosphate group of the following ribonucleotide. Monomeric ribonucleotides contain the bases guanine, uracil, adenine, or cytosine covalently linked to a ribose-phosphate backbone. mRNA is single-stranded and contains ribose as the sugar. In contrast to the deoxyribose sugar of DNA, the ribose sugar has an additional hydroxyl group on the second carbon. The cap and 5'UTR allow the ribosomal complex to bind and initiate translation of the coding region. The coding region begins with an AUG nucleotide sequence, contains a sequence of codons (nucleotide triplets) that code for the individual amino acids of the encoded protein, and is read in the 5' to 3' direction and terminated by a stop codon. The 3'UTR is at the end of the coding region and is followed by a polyA tail. The polyA tail confers stability to the RNA molecule and plays a role in the termination of transcription, and is involved in the export of the mRNA molecule from the nucleus and the initiation of translation of the encoded protein.

[0092] Epstein-Barr virus protein Some aspects of the present disclosure provide vaccines comprising mRNA having an open reading frame encoding multiple EBV antigens, including EBV glycoprotein 220 (gp220), glycoprotein H (gH), glycoprotein L (gL), glycoprotein 42 (gp42), EBV nuclear antigen 3A (EBNA3A), and EBV latent membrane protein 2B (LMP2B). In some embodiments, the EBV antigen is a lytic antigen. In some embodiments, the EBV lytic antigen is an EBV glycoprotein. In some embodiments, the EBV glycoprotein is selected from EBV glycoprotein 350 (gp330), EBV glycoprotein 220 (gp220), EBV glycoprotein H (gH), EBV glycoprotein L (gL), EBV glycoprotein 42 (gp42), and EBV glycoprotein B (gB). In some embodiments, the EBV glycoprotein is selected from EBV gp220, gH, gL, and gp42. In some embodiments, the EBV antigen is an EBV latent antigen. In some embodiments, the EBV latent antigen is selected from EBV nuclear antigen 1 (EBNA1), EBV nuclear antigen 2 (EBNA2), EBV nuclear antigen 3A (EBNA3A), EBV nuclear antigen 3B (EBNA3B), EBV nuclear antigen 3C (EBNA3C), EBV latent membrane protein 1 (LMP1), EBV latent membrane protein 2A (LMP2A), and EBV latent membrane protein 2B (LMP2B). In some embodiments, the EBV latent antigen is selected from EBNA3A and LMP2B.

[0093] In some embodiments, the vaccine comprises a first mRNA comprising an open reading frame encoding EBV gp220, a second mRNA comprising an open reading frame encoding EBV gH, a third mRNA comprising an open reading frame encoding EBV gL, a fourth mRNA comprising an open reading frame encoding EBV gp42, a fifth mRNA comprising an open reading frame encoding EBV EBNA3A, and a sixth mRNA comprising an open reading frame encoding EBV LMP2B. Expression of gp220, gH, gL, gp42, EBNA3A, and LMP2B by cells containing the mRNAs elicits CD8+ and CD4+ T cell responses and neutralizing epithelial and B cell responses. Because EBV latent antigens are expressed in latently infected B cells and are important for efficient EBV-induced transformation of B cells in vitro, such vaccines are useful for generating potent neutralizing antibody responses that prevent or limit EBV infection. Furthermore, the antigens encoded by the vaccine RNA can be modified compared to wild-type EBV antigens to improve the T cell response elicited by immunization or to prevent deleterious effects of EBV protein expression (e.g., removing epitopes for autoantibodies).

[0094] The terms "naturally occurring" and "wild-type" are used interchangeably herein. A naturally occurring EBV protein is an unmodified EBV protein of an Epstein-Barr virus (e.g., EBV-1 or EBV-2) that occurs in nature, i.e., a naturally occurring isolate. As is known in the art, a naturally occurring protein has not been genetically engineered. A naturally occurring protein has not been genetically (or otherwise) modified to substitute, remove, or add any amino acids compared to a naturally occurring isolate. In some embodiments, a naturally occurring isolate of EBV is EBV strain B95-8. See, e.g., Bauer R et al. Nature. 1984 Jul;310(5974):207-11. The amino acid sequences of naturally occurring gp220, gH, gL, gp42, EBNA3A, and LMP2B of EBV strain B95-8 are provided in UniProt accession numbers P03200-1, P03231, P03212, P03205, P12977, and P13285, respectively. Wild-type nucleic acid and / or protein sequences can be obtained, for example, by sequencing the genome or certain genes of one or more viral isolates and / or proteins expressed by the genome or certain genes of one or more viral isolates.

[0095] In some embodiments, wild-type EBV gp220 comprises the amino acid sequence of SEQ ID NO: 1. In some embodiments, wild-type EBV gH comprises the amino acid sequence of SEQ ID NO: 2. In some embodiments, wild-type EBV gL comprises the amino acid sequence of SEQ ID NO: 3. In some embodiments, wild-type EBV gp42 comprises the amino acid sequence of SEQ ID NO: 21. In some embodiments, wild-type EBV EBNA3A comprises the amino acid sequence of SEQ ID NO: 22. In some embodiments, wild-type EBV LMP2B comprises the amino acid sequence of SEQ ID NO: 23. [Table 1-1] [Table 1-2]

[0096] In some embodiments, the vaccines provided herein further comprise an mRNA having an open reading frame encoding EBV gp220. In some embodiments, the vaccines provided herein further comprise an mRNA having an open reading frame encoding EBV gH. In some embodiments, the vaccines provided herein further comprise an mRNA having an open reading frame encoding EBV gL. In some embodiments, the vaccines provided herein further comprise an mRNA having an open reading frame encoding EBV gp42. In some embodiments, the vaccines provided herein further comprise an mRNA having an open reading frame encoding EBNA3A. In some embodiments, the vaccines provided herein further comprise an mRNA having an open reading frame encoding EBV LMP2B.

[0097] EBV glycoprotein 220 EBV glycoprotein 220 (gp220) is the major outer envelope glycoprotein. EBV gp220 forms a complex with EBV glycoprotein 350 (gp350). The gp220 / gp350 complex is a ligand for the B lymphocyte plasma membrane protein CR2, thus initiating B cell infection. EBV gp220 binds to CR2 with similar affinity as the gp220 / gp350 complex. EBV gp220 / gp350 is the predominant EBV ligand on B lymphocytes. An example of wild-type EBV gp220 is provided in UniProtKB:P03200-1. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBV gp220 comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of SEQ ID NO: 1. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBV gp220 comprising an amino acid sequence having at least 80% identity to the amino acid sequence of SEQ ID NO: 1. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBV gp220 comprising an amino acid sequence having at least 85% identity to the amino acid sequence of SEQ ID NO: 1. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBV gp220 comprising an amino acid sequence having at least 90% identity to the amino acid sequence of SEQ ID NO: 1. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBV gp220 comprising an amino acid sequence having at least 95% identity to the amino acid sequence of SEQ ID NO: 1. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBV gp220 comprising an amino acid sequence having at least 95% identity to the amino acid sequence of SEQ ID NO: 1.

[0098] In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 70% identity to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 75% identity to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 80% identity to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 85% identity to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the mRNA comprises an open reading frame comprising the nucleic acid sequence of SEQ ID NO:7.

[0099] EBV glycoprotein H EBV glycoprotein H (gH) is a glycoprotein important for EBV entry into both B cells and epithelial cells. EBV gH forms a complex with gL. The gHgL complex can also form a complex with gp42. The gHgL / gp42 complex, noncovalently bound to glycoprotein gB, is required for EBV fusion with the B cell membrane. An example of wild-type EBV gH is provided in UniProtKB:P03231. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBV gH comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of SEQ ID NO:2. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBV gH comprising an amino acid sequence having at least 80% identity to the amino acid sequence of SEQ ID NO:2. Some embodiments include an mRNA encoding an EBV gH comprising an amino acid sequence having at least 85% identity to the amino acid sequence of SEQ ID NO: 2. Some embodiments include an mRNA encoding an EBV gH comprising an amino acid sequence having at least 90% identity to the amino acid sequence of SEQ ID NO: 2. Some embodiments include an mRNA encoding an EBV gH comprising an amino acid sequence having at least 95% identity to the amino acid sequence of SEQ ID NO: 2. Some embodiments include an mRNA encoding an EBV gH comprising the amino acid sequence of SEQ ID NO: 2.

[0100] In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 70% identity to the nucleic acid sequence of SEQ ID NO:8. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 75% identity to the nucleic acid sequence of SEQ ID NO:8. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 80% identity to the nucleic acid sequence of SEQ ID NO:8. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 85% identity to the nucleic acid sequence of SEQ ID NO:8. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO:8. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO:8. In some embodiments, the mRNA comprises an open reading frame comprising the nucleic acid sequence of SEQ ID NO:8.

[0101] EBV glycoprotein L EBV glycoprotein L (gL) is a glycoprotein important for EBV entry into both B cells and epithelial cells. EBV gL functions as a chaperone for EBV gH. An example of wild-type EBV gL is provided in UniProtKB:P03212. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBV gL comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of SEQ ID NO:3. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBV gL comprising an amino acid sequence having at least 80% identity to the amino acid sequence of SEQ ID NO:3. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBV gL comprising an amino acid sequence having at least 85% identity to the amino acid sequence of SEQ ID NO:3. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBV gL comprising an amino acid sequence having at least 90% identity to the amino acid sequence of SEQ ID NO:3. Some embodiments include an mRNA encoding an EBV gL comprising an amino acid sequence that has at least 95% identity to the amino acid sequence of SEQ ID NO: 3. Some embodiments include an mRNA encoding an EBV gL comprising the amino acid sequence of SEQ ID NO: 3.

[0102] In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 70% identity to the nucleic acid sequence of SEQ ID NO:9. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 75% identity to the nucleic acid sequence of SEQ ID NO:9. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 80% identity to the nucleic acid sequence of SEQ ID NO:9. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 85% identity to the nucleic acid sequence of SEQ ID NO:9. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO:9. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO:9. In some embodiments, the mRNA comprises an open reading frame comprising the nucleic acid sequence of SEQ ID NO:9.

[0103] EBV glycoprotein 42 EBV glycoprotein 42 (gp42) is a glycoprotein important for EBV entry into B cells. The gHgL / gp42 complex binds to HLA class II and activates membrane fusion with B cells, whereas gp42 inhibits fusion and entry into epithelial cells. EBV gp42 interacts with HLA class II, an essential coreceptor for B cell infection, and because epithelial cells do not express HLA class II, EBV gp42 is not essential for epithelial cell entry. An example of a wild-type EBV gp42 protein is provided in UniProtKB:P03205. In some embodiments, the EBV gp42 protein encoded by the mRNA is a soluble (secreted) form of the protein. For example, EBV gp42 may contain an N-terminal truncation compared to the naturally occurring EBV gp42 protein. In some embodiments, the mRNA encodes a soluble EBV gp42 protein lacking the first 41 amino acid residues and thus lacking the protein's endogenous transmembrane anchor. In some embodiments, the endogenous transmembrane anchor of the soluble EBV gp42 protein is replaced with a secretory signal, such as the secretory signal from EBV gB, thereby producing a "soluble" or "secreted" form of EBV gp42.

[0104] In some embodiments, the mRNA vaccine comprises an mRNA encoding EBV gp42 comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of SEQ ID NO:4. In some embodiments, the mRNA vaccine comprises an mRNA encoding EBV gp42 comprising an amino acid sequence having at least 80% identity to the amino acid sequence of SEQ ID NO:4. In some embodiments, the mRNA vaccine comprises an mRNA encoding EBV gp42 comprising an amino acid sequence having at least 85% identity to the amino acid sequence of SEQ ID NO:4. In some embodiments, the mRNA vaccine comprises an mRNA encoding EBV gp42 comprising an amino acid sequence having at least 90% identity to the amino acid sequence of SEQ ID NO:4. In some embodiments, the mRNA vaccine comprises an mRNA encoding EBV gp42 comprising an amino acid sequence having at least 95% identity to the amino acid sequence of SEQ ID NO:4. In some embodiments, the mRNA vaccine comprises an mRNA encoding EBV gp42 comprising the amino acid sequence of SEQ ID NO:4.

[0105] In some embodiments, the mRNA vaccine comprises an mRNA encoding EBV gp42 comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of SEQ ID NO:21. In some embodiments, the mRNA vaccine comprises an mRNA encoding EBV gp42 comprising an amino acid sequence having at least 80% identity to the amino acid sequence of SEQ ID NO:21. In some embodiments, the mRNA vaccine comprises an mRNA encoding EBV gp42 comprising an amino acid sequence having at least 85% identity to the amino acid sequence of SEQ ID NO:21. In some embodiments, the mRNA vaccine comprises an mRNA encoding EBV gp42 comprising an amino acid sequence having at least 90% identity to the amino acid sequence of SEQ ID NO:21. In some embodiments, the mRNA vaccine comprises an mRNA encoding EBV gp42 comprising an amino acid sequence having at least 95% identity to the amino acid sequence of SEQ ID NO:21. In some embodiments, the mRNA vaccine comprises an mRNA encoding EBV gp42 comprising the amino acid sequence of SEQ ID NO:21.

[0106] In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 70% identity to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 75% identity to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 80% identity to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 85% identity to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the mRNA comprises an open reading frame comprising the nucleic acid sequence of SEQ ID NO: 10.

[0107] EBV nuclear antigen 3A EBV nuclear antigen 3A (EBNA3A) is a latency antigen. EBV EBNA3A is a protein expressed during latency produced by B cells. EBNA3A is localized intracellularly in the nucleus and is essential for B cell transformation. EBNA3A is thought to regulate gene transcription of genes involved in cell survival or proliferation. EBNA3A has been shown to regulate a specific subset of gene targets, including Hsp70. Examples of wild-type EBV EBNA3A proteins are provided in UniProtKB: A0A0B6VPX8 and P12977.

[0108] In some embodiments, the EBNA3A encoded by the mRNA provided herein is a variant form of the naturally occurring EBNA3A protein. For example, an EBNA3A variant (e.g., aa 1-523) can span residues 1-523, with point mutations in four nuclear localization signals (NLSs) within that region and a deletion of the transcription factor domain located at its C-terminus (the region spanning residues 524-944). EBNA3A NLS mutations (1-523mut) are located at residues 63-66, 146-155, 375-381, and 394-398. As another example, an EBNA3A variant (e.g., 68-523mut) can also be truncated at residue 523 with an additional N-terminal deletion that removes the 1-56 aa region (a region associated with increased antibody responses in MS patients). The EBNA3A NLS mutations (68-523mut) are located at residues 146-155, 375-378, and 394-398. In some embodiments, one or more (or all) of the nuclear localization signals in the EBNA3 protein are mutated. In some embodiments, one or more T cell epitopes on the EBNA3A protein are mutated. For example, a second T cell epitope may be mutated. In some embodiments, the RPPIFIRRL (SEQ ID NO: 97) epitope is mutated. In some embodiments, the FLRGRAYGI / L (SEQ ID NO: 98) epitope is mutated.

[0109] In some embodiments, the EBNA3A variant is truncated compared to naturally occurring EBNA3A. In some embodiments, the EBNA3A variant has a deletion of the C-terminus of EBNA3A compared to native EBNA3A. In some embodiments, the EBNA3A variant lacks the C-terminal transcriptional regulator domain. In some embodiments, the C-terminal transcriptional regulator domain is located at amino acid positions 524-944 compared to wild-type EBNA3A.

[0110] In some embodiments, EBNA3A has a length of about 525 (e.g., 450, 455, 475, 500, 523, 525, 550) amino acids. In some embodiments, EBNA3A has a length of about 450, about 455, about 475, about 500, about 523, about 525, or about 550 amino acids. In some embodiments, EBNA3A has a length of about 523 amino acids. In some embodiments, EBNA3A has a length of about 455 amino acids. In some embodiments, EBNA3A is about 400-550 (e.g., 400-550, 400-525, 400-523, 400-500, 400-475, 400-455, 400-450, 400-425, 425-550, 425-525, 425-523, 425-500, 425-475, 425-455, 425-450, 450-550, 450- 525, 450-523, 450-500, 450-475, 450-455, 455-550, 455-525, 455-523, 455-500, 455-475, 475-550, 475-525, 475-523, 475-500, 500-550, 500-525, 500-523, 523-525, 523-550, 525-550) amino acid lengths. In some embodiments, EBNA3A is about 400-550, 400-525, 400-523, 400-500, 400-475, 400-455, 400-450, 400-425, 425-550, 425-525, 425-523, 425-500, 425-475, 425-455, 425-450, 450-550, 450-525, 45 and having a length of 0 to 523, 450 to 500, 450 to 475, 450 to 455, 455 to 550, 455 to 525, 455 to 523, 455 to 500, 455 to 475, 475 to 550, 475 to 525, 475 to 523, 475 to 500, 500 to 550, 500 to 525, 500 to 523, 523 to 525, 523 to 550, and 525 to 550 amino acids.

[0111] In some embodiments, EBNA3A comprises one or more nuclear localization signals (NLSs) that are mutated compared to naturally occurring EBNA3A. In some embodiments, about one to four (e.g., one to four, one to three, one to two, two to four, two to three, or three to four) NLSs in EBNA3A are mutated compared to naturally occurring EBNA3A. In some embodiments, one to four, one to three, one to two, two to four, two to three, or three to four NLSs in EBNA3A are mutated compared to naturally occurring EBNA3A. In some embodiments, one, two, three, or four NLSs in EBNA3A are mutated compared to naturally occurring EBNA3A. In some embodiments, one NLS in EBNA3A is mutated compared to naturally occurring EBNA3A. In some embodiments, two NLSs in EBNA3A are mutated compared to naturally occurring EBNA3A. In some embodiments, three NLSs in EBNA3A are mutated compared to naturally occurring EBNA3A. In some embodiments, four of the NLSs in EBNA3A are mutated compared to naturally occurring EBNA3A.

[0112] In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBNA3A comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of SEQ ID NO:5. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBNA3A comprising an amino acid sequence having at least 80% identity to the amino acid sequence of SEQ ID NO:5. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBNA3A comprising an amino acid sequence having at least 85% identity to the amino acid sequence of SEQ ID NO:5. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBNA3A comprising an amino acid sequence having at least 90% identity to the amino acid sequence of SEQ ID NO:5. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBNA3A comprising an amino acid sequence having at least 95% identity to the amino acid sequence of SEQ ID NO:5. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBNA3A comprising the amino acid sequence of SEQ ID NO:5.

[0113] In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBNA3A comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of SEQ ID NO:22. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBNA3A comprising an amino acid sequence having at least 80% identity to the amino acid sequence of SEQ ID NO:22. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBNA3A comprising an amino acid sequence having at least 85% identity to the amino acid sequence of SEQ ID NO:22. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBNA3A comprising an amino acid sequence having at least 90% identity to the amino acid sequence of SEQ ID NO:22. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBNA3A comprising an amino acid sequence having at least 95% identity to the amino acid sequence of SEQ ID NO:22. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBNA3A comprising the amino acid sequence of SEQ ID NO:22.

[0114] In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBNA3A comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of SEQ ID NO:28. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBNA3A comprising an amino acid sequence having at least 80% identity to the amino acid sequence of SEQ ID NO:28. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBNA3A comprising an amino acid sequence having at least 85% identity to the amino acid sequence of SEQ ID NO:28. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBNA3A comprising an amino acid sequence having at least 90% identity to the amino acid sequence of SEQ ID NO:28. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBNA3A comprising an amino acid sequence having at least 95% identity to the amino acid sequence of SEQ ID NO:28. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBNA3A comprising the amino acid sequence of SEQ ID NO:28.

[0115] In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBNA3A comprising an amino acid sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the amino acid sequence of SEQ ID NO:29. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBNA3A comprising an amino acid sequence at least 80% identical to the amino acid sequence of SEQ ID NO:29. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBNA3A comprising an amino acid sequence at least 85% identical to the amino acid sequence of SEQ ID NO:29. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBNA3A comprising an amino acid sequence at least 90% identical to the amino acid sequence of SEQ ID NO:29. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBNA3A comprising an amino acid sequence at least 95% identical to the amino acid sequence of SEQ ID NO:29. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBNA3A comprising the amino acid sequence of SEQ ID NO:29.

[0116] In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBNA3A comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of SEQ ID NO: 30. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBNA3A comprising an amino acid sequence having at least 80% identity to the amino acid sequence of SEQ ID NO: 30. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBNA3A comprising an amino acid sequence having at least 85% identity to the amino acid sequence of SEQ ID NO: 30. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBNA3A comprising an amino acid sequence having at least 90% identity to the amino acid sequence of SEQ ID NO: 30. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBNA3A comprising an amino acid sequence having at least 95% identity to the amino acid sequence of SEQ ID NO: 30. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBNA3A comprising an amino acid sequence having at least 95% identity to the amino acid sequence of SEQ ID NO: 30.

[0117] In some embodiments, the mRNA vaccine comprises an mRNA encoding EBNA3A comprising an amino acid sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 31. In some embodiments, the mRNA vaccine comprises an mRNA encoding EBNA3A comprising an amino acid sequence at least 80% identical to the amino acid sequence of SEQ ID NO: 31. In some embodiments, the mRNA vaccine comprises an mRNA encoding EBNA3A comprising an amino acid sequence at least 85% identical to the amino acid sequence of SEQ ID NO: 31. In some embodiments, the mRNA vaccine comprises an mRNA encoding EBNA3A comprising an amino acid sequence at least 90% identical to the amino acid sequence of SEQ ID NO: 31. In some embodiments, the mRNA vaccine comprises an mRNA encoding EBNA3A comprising an amino acid sequence at least 95% identical to the amino acid sequence of SEQ ID NO: 31. In some embodiments, the mRNA vaccine comprises an mRNA encoding EBNA3A comprising an amino acid sequence at least 95% identical to the amino acid sequence of SEQ ID NO: 31.

[0118] In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 70% identity to the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 75% identity to the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 80% identity to the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 85% identity to the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, the mRNA comprises an open reading frame comprising the nucleic acid sequence of SEQ ID NO: 11.

[0119] In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 70% identity to the nucleic acid sequence of SEQ ID NO:24. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 75% identity to the nucleic acid sequence of SEQ ID NO:24. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 80% identity to the nucleic acid sequence of SEQ ID NO:24. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 85% identity to the nucleic acid sequence of SEQ ID NO:24. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO:24. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO:24. In some embodiments, the mRNA comprises an open reading frame comprising the nucleic acid sequence of SEQ ID NO:24.

[0120] In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 70% identity to the nucleic acid sequence of SEQ ID NO:25. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 75% identity to the nucleic acid sequence of SEQ ID NO:25. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 80% identity to the nucleic acid sequence of SEQ ID NO:25. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 85% identity to the nucleic acid sequence of SEQ ID NO:25. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO:25. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO:25. In some embodiments, the mRNA comprises an open reading frame comprising the nucleic acid sequence of SEQ ID NO:25.

[0121] In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 70% identity to the nucleic acid sequence of SEQ ID NO:26. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 75% identity to the nucleic acid sequence of SEQ ID NO:26. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 80% identity to the nucleic acid sequence of SEQ ID NO:26. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 85% identity to the nucleic acid sequence of SEQ ID NO:26. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO:26. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO:26. In some embodiments, the mRNA comprises an open reading frame comprising the nucleic acid sequence of SEQ ID NO:26.

[0122] In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 70% identity to the nucleic acid sequence of SEQ ID NO: 27. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 75% identity to the nucleic acid sequence of SEQ ID NO: 27. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 80% identity to the nucleic acid sequence of SEQ ID NO: 27. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 85% identity to the nucleic acid sequence of SEQ ID NO: 27. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO: 27. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO: 27. In some embodiments, the mRNA comprises an open reading frame comprising the nucleic acid sequence of SEQ ID NO: 27.

[0123] EBV latent membrane protein 2B EBV latent membrane protein 2B (LMP2B) is a multi-spanning membrane protein and a naturally occurring isoform of LMP2A, lacking the N-terminal 119 residues of LMP2A. Unlike LMP2A, LMP2B does not regulate B cell receptor signaling or block apoptosis; instead, it may function as a negative regulator of LMP2A isoforms. LMP2B is a latency antigen expressed during latency in EBV-infected B cells both in cell culture and in vivo. LMP2B has been shown to promote epithelial cell motility and cell spreading. Examples of wild-type EBV LMP2B proteins are provided in UniProtKB: A0A0C7U069 and P13285.

[0124] In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBV LMP2B comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of SEQ ID NO:6. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBV LMP2B comprising an amino acid sequence having at least 80% identity to the amino acid sequence of SEQ ID NO:6. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBV LMP2B comprising an amino acid sequence having at least 85% identity to the amino acid sequence of SEQ ID NO:6. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBV LMP2B comprising an amino acid sequence having at least 90% identity to the amino acid sequence of SEQ ID NO:6. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBV LMP2B comprising an amino acid sequence having at least 95% identity to the amino acid sequence of SEQ ID NO:6. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBV LMP2B comprising the amino acid sequence of SEQ ID NO:6.

[0125] In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBV LMP2B comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of SEQ ID NO: 23. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBV LMP2B comprising an amino acid sequence having at least 80% identity to the amino acid sequence of SEQ ID NO: 23. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBV LMP2B comprising an amino acid sequence having at least 85% identity to the amino acid sequence of SEQ ID NO: 23. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBV LMP2B comprising an amino acid sequence having at least 90% identity to the amino acid sequence of SEQ ID NO: 23. In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBV LMP2B comprising an amino acid sequence having at least 95% identity to the amino acid sequence of SEQ ID NO: 23. In some embodiments, the mRNA vaccine comprises an mRNA encoding EBV LMP2B comprising the amino acid sequence of SEQ ID NO:23.

[0126] In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 70% identity to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 75% identity to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 80% identity to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 85% identity to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the mRNA comprises an open reading frame comprising a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the mRNA comprises an open reading frame comprising the nucleic acid sequence of SEQ ID NO: 12.

[0127] Non-limiting examples of RNA sequences and corresponding amino acid sequences of EBV proteins of the present disclosure are provided in Table 2. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] Table 2-8 Table 2-9 Table 2-10 Table 2-11 Table 2-12 Table 2-13 Table 2-14 Table 2-15 Table 2-16 Table 2-17 Table 2-18 Table 2-19 Table 2-20 Table 2-21 Table 2-22

[0128] The mRNA of the vaccines described herein encodes an EBV protein of interest intended to enhance the immune response to EBV infection. Therefore, EBV proteins are antigenic, i.e., they are antigens. Antigenicity is the ability to be specifically recognized by antibodies generated as a result of an immune response to a given substance, such as an EBV protein. Thus, an antigen is a protein that can induce an immune response (e.g., cause the immune system to produce antibodies against the antigen). In some embodiments, an antigen is an immunogen. Immunogenicity refers to the ability of a substance to induce cellular and humoral immune responses. An mRNA vaccine does not itself contain an antigen, but rather contains an mRNA with an open reading frame encoding a protein antigen (referred to herein simply as an "EBV protein") that is expressed by cells within a subject upon delivery to the subject. Delivery of the mRNA is achieved by formulating the mRNA in an appropriate carrier or delivery vehicle (e.g., lipid nanoparticles) such that upon administration to cells, tissues, or a subject, the mRNA is taken up by cells, which then express the protein(s) encoded by the mRNA.

[0129] It will be understood that the term "protein" encompasses peptides and the term "antigen" encompasses antigen fragments.

[0130] mRNA vaccines offer unique advantages over traditional protein-based vaccination approaches, such as recombinant protein production techniques, in which protein antigens are purified or produced in vitro. mRNA vaccines contain mRNA encoding the desired EBV protein antigen(s), which, when introduced into the body, i.e., administered in vivo to a mammalian subject (e.g., a human), induces somatic cells to express the desired antigen(s). To facilitate delivery of the mRNA to somatic cells, the mRNA is encapsulated in lipid nanoparticles (LNPs). Once delivered and taken up by somatic cells, the mRNA is translated in the cytosol, and the protein antigen is produced by the host cell machinery. The protein is presented, eliciting adaptive humoral and cellular immune responses. Because neutralizing antibodies are directed against the expressed protein, proteins are considered relevant target antigens for vaccine development.

[0131] Many proteins have a quaternary or three-dimensional structure comprising multiple polypeptides or several polypeptide chains that assemble into oligomeric molecules. As used herein, the term "subunit" refers to a single protein molecule, e.g., a polypeptide or polypeptide chain resulting from the processing of a nascent protein molecule, which assembles (or "co-assembles") with other protein molecules (e.g., subunits or chains) to form a protein complex. Proteins may have a relatively small number of subunits and thus be described as "oligomers," or may consist of many subunits and thus be described as "multimers." The subunits of an oligomeric or multimeric protein may be identical, homologous, or completely different, and may be specialized for different tasks.

[0132] A protein or protein subunit may further comprise a domain. As used herein, the term "domain" refers to a distinct functional and / or structural unit within a protein. Typically, a "domain" is responsible for a specific function or interaction and contributes to the overall role of the protein. Domains can exist in a variety of biological contexts. Similar domains (i.e., domains that share structural, functional, and / or sequence homology) may exist within a single protein or in separate proteins with similar or different functions. Protein domains are often conserved portions of a given protein's tertiary structure or sequence and can function and exist independently of the rest of the protein or its subunits.

[0133] As used herein, the term "antigen" differs from the term "epitope," which refers to a substructure of an antigen. An epitope is a portion of an antigen to which an antibody binds. An epitope can be a peptide, e.g., a 7-10 amino acid peptide, or a glycosylated structure. While the art describes protein antigens, e.g., isolated proteins, that are delivered to subjects or immune cells in isolated form, the design, testing, validation, and production of protein antigens can be costly and time-consuming, especially when producing proteins on a large scale. In contrast, mRNA technology is amenable to the rapid design and testing of mRNAs encoding diverse antigens. Furthermore, rapid production of mRNA combined with formulation in an appropriate delivery vehicle (e.g., lipid nanoparticles) can proceed rapidly, allowing for the rapid production of mRNA vaccines on a large scale. Potential benefits also arise from the fact that the antigen encoded by the mRNA is expressed by the subject's cells, e.g., the human body, and thus the subject, e.g., the human body, acts as a "factory" to produce the antigen, which then elicits the desired immune response.

[0134] The vaccines provided herein may contain mRNA or multiple RNAs encoding two or more antigens of the same or different EBV strains. Also provided herein are combination vaccines containing mRNA encoding one or more EBV antigens and one or more antigens (multiple antigens) of different organisms. Thus, the mRNA vaccine may be a combination vaccine targeting one or more antigens of the same strain / species, or one or more antigens of different strains / species, for example, antigens that induce immunity against organisms found in the same geographical area with a high risk of EBV infection, or organisms to which individuals are likely to be exposed when exposed to EBV.

[0135] The vaccines provided herein may contain multiple mRNAs, each encoding a different antigen. The mass percentage (weight) of each mRNA may vary. In some embodiments, at least 50% of the mRNA in the EBV vaccine may encode one or more EBV glycoproteins (e.g., gp220, gH, gL, and / or soluble gp42). For example, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, or at least 85% of the mRNA in the EBV vaccine may encode one or more EBV glycoproteins (e.g., gp220, gH, gL, and / or soluble gp42). In some embodiments, about 50% of the mRNA in the vaccine encodes an EBV lytic antigen. In some embodiments, between about 50% and about 80% of the mRNA in the vaccine encodes an EBV lytic antigen.

[0136] In some embodiments, less than 50% of the mRNA in the EBV vaccine encodes one or more EBV latent antigens (e.g., EBNA3A and / or LMP2B). For example, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, or less than 20% of the mRNA in the EBV vaccine encodes one or more EBV latent antigens (e.g., EBNA3A and / or LMP2B). In some embodiments, about 20-50% (e.g., 20-50%, 20-45%, 20-40%, 20-35%, 20-30%, 20-25%, 25-50%, 25-45%, 25-40%, 25-35%, 25-30%, 30-50%, 30-45%, 30-40%, 30-35%, 35-50%, 35-45%, 35-40%, 40-50%, 40-45%, 45-50%) of the mRNA in the vaccine encodes an EBV latent antigen. In some embodiments, about 20-50%, about 20-45%, about 20-40%, about 20-35%, about 20-30%, about 20-25%, about 25-50%, about 25-45%, about 25-40%, about 25-35%, about 25-30%, about 30-50%, about 30-45%, about 30-40%, about 30-35%, about 35-50%, about 35-45%, about 35-40%, about 40-50%, about 40-45%, or about 45-50% of the mRNA in the vaccine encodes an EBV latent antigen. In some embodiments, about 20% to about 50% of the mRNA in the vaccine encodes an EBV latent antigen.

[0137] In some embodiments, the mRNA vaccine comprises about 20% to about 35% mRNA encoding EBV gp220, about 5% to about 20% mRNA encoding EBV gH, about 5% to about 20% mRNA encoding EBV gL, about 5% to about 20% mRNA encoding EBV soluble gp42, about 20% to about 35% mRNA encoding EBNA3A, and about 20% to about 35% mRNA encoding EBV LMP2B.

[0138] In some embodiments, the mRNA vaccine comprises about 26% to about 27% (e.g., about 26.7%) of mRNA encoding EBV gp220, about 9.5% to about 10.5% (e.g., about 10%) of mRNA encoding EBV gH, about 6% to about 7% (e.g., about 6.7%) of mRNA encoding EBV gL, about 6% to about 7% (e.g., about 6.7%) of mRNA encoding EBV soluble gp42, about 24.5% to about 25.5% (e.g., about 25%) of mRNA encoding EBV EBNA3A, and about 24.5% to about 25.5% (e.g., about 25%) of mRNA encoding EBV LMP2B.

[0139] In some embodiments, the mRNA vaccine comprises about 20% to about 35% mRNA encoding EBV gp220. For example, the mRNA may comprise about 20% to about 30%, about 20% to 25%, about 25% to 35%, or about 25% to 30% mRNA encoding EBV gp220. In some embodiments, the mRNA vaccine comprises about 25% mRNA encoding EBV gp220. In some embodiments, the mRNA vaccine comprises about 26% mRNA encoding EBV gp220. In some embodiments, the mRNA vaccine comprises about 27% mRNA encoding EBV gp220. In some embodiments, the mRNA vaccine comprises about 28% mRNA encoding EBV gp220. In some embodiments, the mRNA vaccine comprises about 29% mRNA encoding EBV gp220. In some embodiments, the mRNA vaccine comprises about 30% mRNA encoding EBV gp220. In some embodiments, the mRNA vaccine comprises about 26% to about 27% mRNA encoding EBV gp220. In some embodiments, the mRNA vaccine comprises about 26.7% mRNA encoding EBV gp220.

[0140] In some embodiments, the mRNA vaccine contains about 5% to about 20% mRNA encoding EBV gH. For example, the mRNA may contain about 5% to about 15%, about 5% to 10%, about 10% to 20%, or about 10% to 15% mRNA encoding EBV gH. In some embodiments, the mRNA vaccine contains about 8% mRNA encoding EBV gH. In some embodiments, the mRNA vaccine contains about 9% mRNA encoding EBV gH. In some embodiments, the mRNA vaccine contains about 10% mRNA encoding EBV gH. In some embodiments, the mRNA vaccine contains about 11% mRNA encoding EBV gH. In some embodiments, the mRNA vaccine contains about 12% mRNA encoding EBV gH. In some embodiments, the mRNA vaccine contains about 13% mRNA encoding EBV gH. In some embodiments, the mRNA vaccine contains about 9.5% to about 10.5% mRNA encoding EBV gH. In some embodiments, the mRNA vaccine comprises about 10% mRNA encoding EBV gH.

[0141] In some embodiments, the mRNA vaccine contains about 5% to about 20% mRNA encoding EBV gL. For example, the mRNA may contain about 5% to 15%, about 5% to 10%, about 10% to 20%, or about 10% to 15% mRNA encoding EBV gL. In some embodiments, the mRNA vaccine contains about 4% mRNA encoding EBV gL. In some embodiments, the mRNA vaccine contains about 5% mRNA encoding EBV gL. In some embodiments, the mRNA vaccine contains about 6% mRNA encoding EBV gL. In some embodiments, the mRNA vaccine contains about 7% mRNA encoding EBV gL. In some embodiments, the mRNA vaccine contains about 8% mRNA encoding EBV gL. In some embodiments, the mRNA vaccine contains about 9% mRNA encoding EBV gL. In some embodiments, the mRNA vaccine contains about 6% to about 7% mRNA encoding EBV gL. In some embodiments, the mRNA vaccine comprises about 6.7% mRNA encoding EBV gL.

[0142] In some embodiments, the mRNA vaccine contains about 5% to about 20% mRNA encoding EBV soluble gp42. For example, the mRNA may contain about 5% to 15%, about 5% to 10%, about 10% to 20%, or about 10% to 15% mRNA encoding EBV soluble gp42. In some embodiments, the mRNA vaccine contains about 4% mRNA encoding EBV soluble gp42. In some embodiments, the mRNA vaccine contains about 5% mRNA encoding EBV soluble gp42. In some embodiments, the mRNA vaccine contains about 6% mRNA encoding EBV soluble gp42. In some embodiments, the mRNA vaccine contains about 7% mRNA encoding EBV soluble gp42. In some embodiments, the mRNA vaccine contains about 8% mRNA encoding EBV soluble gp42. In some embodiments, the mRNA vaccine contains about 9% mRNA encoding EBV soluble gp42. In some embodiments, the mRNA vaccine comprises mRNA encoding about 6% to about 7% EBV soluble gp42. In some embodiments, the mRNA vaccine comprises mRNA encoding about 6.7% EBV soluble gp42.

[0143] In some embodiments, the mRNA vaccine contains about 20% to about 35% mRNA encoding EBNA3A. For example, the mRNA may contain about 20% to about 30%, about 20% to 25%, about 25% to 35%, or about 25% to 30% mRNA encoding EBNA3A. In some embodiments, the mRNA vaccine contains about 22% mRNA encoding EBNA3A. In some embodiments, the mRNA vaccine contains about 23% mRNA encoding EBNA3A. In some embodiments, the mRNA vaccine contains about 24% mRNA encoding EBNA3A. In some embodiments, the mRNA vaccine contains about 25% mRNA encoding EBNA3A. In some embodiments, the mRNA vaccine contains about 26% mRNA encoding EBNA3A. In some embodiments, the mRNA vaccine contains about 27% mRNA encoding EBNA3A. In some embodiments, the mRNA vaccine contains about 24.5% to about 25.5% mRNA encoding EBNA3A. In some embodiments, the mRNA vaccine comprises about 25% mRNA encoding EBNA3A.

[0144] In some embodiments, the mRNA vaccine contains about 20% to about 35% mRNA encoding EBV LMP2B. For example, the mRNA may contain about 20% to about 30%, about 20% to 25%, about 25% to 35%, or about 25% to 30% mRNA encoding EBV LMP2B. In some embodiments, the mRNA vaccine contains about 22% mRNA encoding EBV LMP2B. In some embodiments, the mRNA vaccine contains about 23% mRNA encoding EBV LMP2B. In some embodiments, the mRNA vaccine contains about 24% mRNA encoding EBV LMP2B. In some embodiments, the mRNA vaccine contains about 25% mRNA encoding EBV LMP2B. In some embodiments, the mRNA vaccine contains about 26% mRNA encoding EBV LMP2B. In some embodiments, the mRNA vaccine contains about 27% mRNA encoding EBV LMP2B. In some embodiments, the mRNA vaccine comprises about 24.5% to about 25.5% mRNA encoding EBV LMP2B. In some embodiments, the mRNA vaccine comprises about 25% mRNA encoding EBV LMP2B.

[0145] In some embodiments, the mRNA vaccine comprises about 35% to about 50% mRNA encoding EBV gp220, about 10% to about 25% mRNA encoding EBV gH, about 5% to about 20% mRNA encoding EBV gL, about 5% to about 20% mRNA encoding EBV soluble gp42, about 5% to about 20% mRNA encoding EBNA3A, and about 5% to about 20% mRNA encoding EBV LMP2B.

[0146] In some embodiments, the mRNA vaccine comprises about 42% to about 43% (e.g., about 42.1%) of mRNA encoding EBV gp220, about 15% to about 16% (e.g., about 15.8%) of mRNA encoding EBV gH, about 10% to about 11% (e.g., about 10.5%) of mRNA encoding EBV gL, about 10% to about 11% (e.g., about 10.5%) of mRNA encoding EBV soluble gp42, about 10% to about 11% (e.g., about 10.5%) of mRNA encoding EBV EBNA3A, and about 10% to about 11% (e.g., about 10.5%) of mRNA encoding EBV LMP2B.

[0147] In some embodiments, the mRNA vaccine contains about 35% to about 50% mRNA encoding EBV gp220. For example, the mRNA may contain about 35% to 45%, about 35% to 40%, about 40% to 50%, or about 45% to 50% mRNA encoding EBV gp220. In some embodiments, the mRNA vaccine contains about 39% mRNA encoding EBV gp220. In some embodiments, the mRNA vaccine contains about 40% mRNA encoding EBV gp220. In some embodiments, the mRNA vaccine contains about 41% mRNA encoding EBV gp220. In some embodiments, the mRNA vaccine contains about 42% mRNA encoding EBV gp220. In some embodiments, the mRNA vaccine contains about 43% mRNA encoding EBV gp220. In some embodiments, the mRNA vaccine contains about 44% mRNA encoding EBV gp220. In some embodiments, the mRNA vaccine comprises about 42 to about 43% mRNA encoding EBV gp220. In some embodiments, the mRNA vaccine comprises about 42.1% mRNA encoding EBV gp220.

[0148] In some embodiments, the mRNA vaccine comprises about 10% to about 25% mRNA encoding EBV gH. For example, the mRNA may comprise about 10% to about 20%, about 10% to 15%, about 15% to 25%, or about 15% to 20% mRNA encoding EBV gH. In some embodiments, the mRNA vaccine comprises about 12% mRNA encoding EBV gH. In some embodiments, the mRNA vaccine comprises about 13% mRNA encoding EBV gH. In some embodiments, the mRNA vaccine comprises about 14% mRNA encoding EBV gH. In some embodiments, the mRNA vaccine comprises about 15% mRNA encoding EBV gH. In some embodiments, the mRNA vaccine comprises about 16% mRNA encoding EBV gH. In some embodiments, the mRNA vaccine comprises about 17% mRNA encoding EBV gH. In some embodiments, the mRNA vaccine comprises about 15% to about 16% mRNA encoding EBV gH. In some embodiments, the mRNA vaccine comprises about 15.8% mRNA encoding EBV gH.

[0149] In some embodiments, the mRNA vaccine contains about 5% to about 20% mRNA encoding EBV gL. For example, the mRNA may contain about 5% to 15%, about 5% to 10%, about 10% to 20%, or about 10% to 15% mRNA encoding EBV gL. In some embodiments, the mRNA vaccine contains about 7% mRNA encoding EBV gL. In some embodiments, the mRNA vaccine contains about 8% mRNA encoding EBV gL. In some embodiments, the mRNA vaccine contains about 9% mRNA encoding EBV gL. In some embodiments, the mRNA vaccine contains about 10% mRNA encoding EBV gL. In some embodiments, the mRNA vaccine contains about 11% mRNA encoding EBV gL. In some embodiments, the mRNA vaccine contains about 12% mRNA encoding EBV gL. In some embodiments, the mRNA vaccine contains about 10% to about 11% mRNA encoding EBV gL. In some embodiments, the mRNA vaccine comprises about 10.5% mRNA encoding EBV gL.

[0150] In some embodiments, the mRNA vaccine contains about 5% to about 20% mRNA encoding EBV soluble gp42. For example, the mRNA may contain about 5-15%, about 5-10%, about 10-20%, or about 10-15% mRNA encoding EBV soluble gp42. In some embodiments, the mRNA vaccine contains about 7% mRNA encoding EBV soluble gp42. In some embodiments, the mRNA vaccine contains about 8% mRNA encoding EBV soluble gp42. In some embodiments, the mRNA vaccine contains about 9% mRNA encoding EBV soluble gp42. In some embodiments, the mRNA vaccine contains about 10% mRNA encoding EBV soluble gp42. In some embodiments, the mRNA vaccine contains about 11% mRNA encoding EBV soluble gp42. In some embodiments, the mRNA vaccine contains about 12% mRNA encoding EBV soluble gp42. In some embodiments, the mRNA vaccine comprises about 10% to about 11% mRNA encoding EBV soluble gp42. In some embodiments, the mRNA vaccine comprises about 10.5% mRNA encoding EBV soluble gp42.

[0151] In some embodiments, the mRNA vaccine contains about 5% to about 20% mRNA encoding EBNA3A. For example, the mRNA may contain about 5% to 15%, about 5% to 10%, about 10% to 20%, or about 10% to 15% mRNA encoding EBNA3A. In some embodiments, the mRNA vaccine contains about 7% mRNA encoding EBNA3A. In some embodiments, the mRNA vaccine contains about 8% mRNA encoding EBNA3A. In some embodiments, the mRNA vaccine contains about 9% mRNA encoding EBNA3A. In some embodiments, the mRNA vaccine contains about 10% mRNA encoding EBNA3A. In some embodiments, the mRNA vaccine contains about 11% mRNA encoding EBNA3A. In some embodiments, the mRNA vaccine contains about 12% mRNA encoding EBNA3A. In some embodiments, the mRNA vaccine contains about 10% to about 11% mRNA encoding EBNA3A. In some embodiments, the mRNA vaccine comprises about 10.5% mRNA encoding EBNA3A.

[0152] In some embodiments, the mRNA vaccine contains about 5% to about 20% mRNA encoding EBV LMP2B. For example, the mRNA may contain about 5-15%, about 5-10%, about 10-20%, or about 10-15% mRNA encoding EBV LMP2B. In some embodiments, the mRNA vaccine contains about 7% mRNA encoding EBV LMP2B. In some embodiments, the mRNA vaccine contains about 8% mRNA encoding EBV LMP2B. In some embodiments, the mRNA vaccine contains about 9% mRNA encoding EBV LMP2B. In some embodiments, the mRNA vaccine contains about 10% mRNA encoding EBV LMP2B. In some embodiments, the mRNA vaccine contains about 11% mRNA encoding EBV LMP2B. In some embodiments, the mRNA vaccine contains about 12% mRNA encoding EBV LMP2B. In some embodiments, the mRNA vaccine comprises about 10% to about 11% mRNA encoding EBV LMP2B, hi some embodiments, the mRNA vaccine comprises about 10.5% mRNA encoding EBV LMP2B.

[0153] Naturally occurring Epstein-Barr virus protein variants In some embodiments, the mRNA vaccine comprises an mRNA encoding an EBV protein variant. A protein variant is a protein (including a full-length protein and a peptide) that differs in amino acid sequence compared to a naturally occurring or reference amino acid sequence. A protein variant may have one or more substitutions, deletions, and / or insertions at certain positions within the amino acid sequence compared to a naturally occurring or reference amino acid sequence. Typically, a protein variant has at least 50% identity to a naturally occurring or reference sequence. In some embodiments, a protein variant has at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to a naturally occurring or reference sequence.

[0154] Protein variants encoded by the mRNAs of the present disclosure may contain amino acid changes that confer any of a number of desirable properties, such as enhancing their immunogenicity, enhancing their expression, and / or improving their stability or PK / PD properties in a subject. Protein variants can be generated using conventional mutagenesis techniques and appropriately assayed to determine whether they possess the desired properties. Assays for determining the expression level and immunogenicity of proteins, including protein variants, are well known in the art. Similarly, the PK / PD properties of protein variants can be measured using art-recognized techniques (e.g., by determining the expression of the protein variant over time in vaccinated subjects and / or by confirming the durability of the induced immune response). The stability of protein variants encoded by mRNAs may be measured, for example, by assaying their thermal stability or stability upon urea denaturation, or using in silico predictions. Methods for such experiments and in silico determinations are known in the art. Other methods for determining the expression level of a protein variant, the immunogenicity and / or PK / PD properties of a protein variant may also be used.

[0155] In some embodiments, the mRNA comprises an open reading frame comprising, for example, the nucleotide sequence of any one of the sequences provided herein, or a nucleotide sequence having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the nucleotide sequence of any one of the sequences provided herein (see, e.g., SEQ ID NOS: 7-12).

[0156] In some embodiments, the mRNA comprises an open reading frame encoding a protein comprising, for example, the amino acid sequence of any one of the sequences provided herein, or an amino acid sequence having at least 80%, at least 85%, at least 90%, or at least 95% identity to the amino acid sequence of any one of the sequences provided herein (see, e.g., SEQ ID NOS: 1-6).

[0157] "Identity" refers to the relationship between two or more sequences (e.g., amino acid sequences or nucleotide sequences) as determined by comparing the sequences with one another. Identity also refers to the degree of sequence relatedness between or among sequences, as determined by the number of matches between strings of amino acids (polypeptides) or between strings of nucleotides (polynucleotides). Identity is a measure of the percent of exact matches between the smaller of two or more sequences, with gapped alignment (if any), as handled by a particular mathematical model or computer program (e.g., an "algorithm"). The identity of related polypeptides and polynucleotides can be readily calculated by known methods. "Percent identity" as applied to polypeptide or polynucleotide sequences is defined as the percentage of residues (amino acid or nucleic acid residues) in a candidate (first) polypeptide or polynucleotide sequence that are identical with the residues in a second polypeptide or polynucleotide sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent identity.

[0158] Methods and computer programs for alignment are well known in the art. Identity is based on the calculation of percent identity, but it is understood that the value may vary depending on the gaps and penalties introduced into this calculation. Generally, a particular polynucleotide or polypeptide variant has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% (but less than 100%) sequence identity to a particular naturally occurring or reference sequence, as determined by sequence alignment programs and parameters described herein and known to those skilled in the art. Such alignment tools include, but are not limited to, those based on the BLAST suite (Altschul, S.F., et al. Nucleic Acids Res. 1997;25:3389-3402) and the Smith-Waterman algorithm (Smith, T.F. & Waterman, M.S.J. Mol. Biol. 1981;147:195-197). A popular global alignment technique based on dynamic programming is the Needleman-Wunsch algorithm (Needleman, SB & Wunsch, CDJ Mol. Biol. 1920;48:443-453). The Fast Optimal Global Sequence Alignment Algorithm (FOGSAA) has also been developed, which is said to produce global alignments of nucleotide and protein sequences faster than other optimal global alignment methods, including the Needleman-Wunsch algorithm.

[0159] Thus, polynucleotides and polypeptides containing substitutions, insertions, and / or deletions (e.g., indels) and covalent modifications relative to naturally occurring or reference sequences, e.g., polypeptide (e.g., protein) sequences disclosed herein, are included within the scope of the present disclosure. For example, sequence tags or amino acids, such as one or more lysine(s), can be added to a polypeptide sequence (e.g., at its N-terminus and / or C-terminus). Sequence tags can be used for detection, purification, and / or localization of the peptide. Lysines can be used to increase the solubility of the peptide or to enable biotinylation. Alternatively, amino acid residues located at the N- and / or C-terminal regions of a protein's amino acid sequence can be optionally deleted to result in a truncated sequence. Certain amino acids (e.g., C- or N-terminal amino acids) can be deleted depending on the use of the sequence (e.g., expression of the sequence as part of a larger sequence that is soluble or linked to a solid support). In some embodiments, sequences for (or encoding) signal sequences, termination sequences, transmembrane domains, linkers, multimerization domains (e.g., fold-on regions), etc. are replaced with alternative sequences that achieve the same or similar function. In some embodiments, stability can be improved by filling cavities within the core of the protein, for example, by introducing larger amino acids. In other embodiments, buried hydrogen-bonding networks are replaced with hydrophobic residues to improve stability. In yet other embodiments, glycosylation sites are removed and replaced with appropriate residues. Such sequences are readily identifiable to one of skill in the art. It should also be understood that some of the sequences provided herein include sequence tags or terminal peptide sequences (e.g., at the N- or C-terminus) that can be deleted, for example, prior to use in preparing an mRNA vaccine.

[0160] As will be recognized by those skilled in the art, protein fragments, functional protein domains, and homologous proteins are also considered within the scope of the EBV proteins provided herein. For example, any protein fragment (meaning a polypeptide sequence that is at least one amino acid residue shorter than but otherwise identical to a naturally occurring or reference sequence) of a naturally occurring or reference sequence is provided herein, provided that the fragment is immunogenic and confers a protective immune response against EBV. In addition to protein variants that are identical to a naturally occurring or reference protein but are truncated, in some embodiments, the protein contains 2, 3, 4, 5, 6, 7, 8, 9, 10, or more mutations (e.g., substitutions, insertions, and / or deletions) as shown in any sequence provided or referenced herein. The length of the protein variant can range from about 4, 6, or 8 amino acids to the full-length protein.

[0161] signal peptide In some embodiments, the mRNA contains an ORF encoding a signal peptide fused to an EBV protein. Signal peptides, which typically comprise the N-terminal 15-60 amino acids of a protein, are required for translocation across membranes in the secretory pathway and thus universally regulate entry of most proteins into the secretory pathway in both eukaryotes and prokaryotes. In eukaryotes, the signal peptide of a nascent precursor protein (preprotein) directs ribosomes to the rough endoplasmic reticulum (ER) membrane and initiates transmembrane transport of the elongating peptide chain for processing. ER processing produces a mature protein, and the signal peptide is typically cleaved from the precursor protein by ER-resident signal peptidases of the host cell, or retained uncleaved, and functions as a membrane anchor. The signal peptide can also facilitate targeting of the protein to the cell membrane.

[0162] The signal peptide may be 15 to 60 amino acids in length, for example, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 amino acids in length. In some embodiments, the length of the signal peptide is 20-60, 25-60, 30-60, 35-60, 40-60, 45-60, 50-60, 55-60, 15-55, 20-55, 25-55, 30-55, 35-55, 40-55, 45-55, 50-55, 15-50, 20-50, 25-50, 30-50, 35-50 , 40-50, 45-50, 15-45, 20-45, 25-45, 30-45, 35-45, 40-45, 15-40, 20-40, 25-40, 30-40, 35-40, 15-35, 20-35, 25-35, 30-35, 15-30, 20-30, 25-30, 15-25, 20-25, or 15-20 amino acids in length.

[0163] Signal peptides from heterologous genes (which naturally regulate the expression of genes other than EBV proteins) are known in the art and can be tested for desired properties before being incorporated into the nucleic acids of the present disclosure.

[0164] In some embodiments, the mRNA comprises an open reading frame encoding an EBV protein fused to a signal peptide comprising an amino acid sequence having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the amino acid sequence of any one of the signal peptide sequences provided herein. See, e.g., SEQ ID NOS: 50-54, which are listed in Table 3 below. In some embodiments, the mRNA comprises an open reading frame encoding an EBV protein comprising the endogenous signal peptide of a wild-type EBV protein (e.g., an mRNA encoding (wild-type or modified) EBV gB encodes the EBV gB signal peptide). [Table 3]

[0165] fusion proteins In some embodiments, the mRNA encodes a fusion protein. Thus, the encoded protein may comprise two or more proteins (e.g., proteins and / or protein fragments) joined together, with or without a linker. The fusion protein, in some embodiments, retains the functional properties of each of the individual (non-fused) proteins.

[0166] In some embodiments, the fusion protein comprises two, three, four, five, six, seven, eight, nine, or ten of the following EBV proteins: gp220, gH, gL, gp42, EBNA3A, and LMP2B.

[0167] Linkers and Cleavable Peptides In some embodiments, the mRNA encoding the fusion protein further encodes a linker located between at least one or each domain of the fusion protein. The linker can be, for example, a cleavable linker or a protease-sensitive linker. In some embodiments, the linker is selected from the group consisting of an F2A linker, a P2A linker, a T2A linker, an E2A linker, and combinations thereof (see, e.g., WO2017 / 127750). This family of self-cleaving peptide linkers, called 2A peptides, has been described in the art (see, e.g., Kim, J. Het al. PLoS ONE 2011;6:e18556). In some embodiments, the linker is an F2A linker.

[0168] In some embodiments, the linker is a GS linker. GS linkers are polypeptide linkers containing glycine and serine amino acid repeats. They contain flexible and hydrophilic residues and can be used to effect fusion of protein subunits without interfering with the folding and function of protein domains or forming secondary structures. In some embodiments, the mRNA encodes a fusion protein containing a GS linker that is 3 to 20 amino acids long. For example, the GS linker can be 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids long (or at least that length). In some embodiments, the GS linker is 15 amino acids long (or at least 15 amino acids long) (e.g., GGSGGSGSGGSGGG (SEQ ID NO: 76)). In some embodiments, the GS linker is 8 amino acids long (or at least 8 amino acids long) (e.g., GGGSGGGS (SEQ ID NO: 37)). In some embodiments, the GS linker is 7 amino acids long (or at least 7 amino acids long) (e.g., GGGSGGG (SEQ ID NO: 38)). In some embodiments, the GS linker comprises the amino acid sequence GGGSGG (SEQ ID NO: 39). In some embodiments, the GS linker is 4 amino acids long (or at least 4 amino acids long) (e.g., GGGS (SEQ ID NO: 40)). In some embodiments, the GS linker comprises (GGGS)n (SEQ ID NO: 41), where n is any integer from 1 to 5. In some embodiments, the GS linker is 4 amino acids long (or at least 4 amino acids long) (e.g., GSGG (SEQ ID NO: 43)). In some embodiments, the GS linker comprises (GSGG)n (SEQ ID NO: 43), where n is any integer from 1 to 5. In some embodiments, the linker is, for example, a glycine linker having a length of 3 amino acids (or at least 3 amino acids long) (e.g., GGG). In some embodiments, the protein encoded by the mRNA comprises two or more linkers, which may be the same as or different from one another.

[0169] Those of skill in the art will understand that other art-recognized linkers may be suitable for use in the constructs of the present disclosure (e.g., encoded by the nucleic acids of the present disclosure). Those of skill in the art will also understand that other polycistronic constructs (mRNAs that separately encode multiple proteins within the same molecule) may be suitable for use as provided herein.

[0170] Nucleic acids encoding Epstein-Barr virus proteins Nucleic acids include polymers of nucleotides (nucleotide monomers). Therefore, nucleic acids are also referred to as polynucleotides. Nucleic acids can be or include, for example, deoxyribonucleic acid (DNA), ribonucleic acid (RNA), threose nucleic acid (TNA), glycol nucleic acid (GNA), peptide nucleic acid (PNA), locked nucleic acid (LNA, including LNA with a β-D-ribo configuration, α-LNA (a diastereomer of LNA) with an α-L-ribo configuration, 2′-amino-LNA with a 2′-amino functionalization, and 2′-amino-α-LNA with a 2′-amino functionalization), ethylene nucleic acid (ENA), cyclohexenyl nucleic acid (CeNA), and / or chimeras and / or combinations thereof.

[0171] The mRNA of the mRNA vaccines described herein comprises an open reading frame (ORF) encoding an EBV protein. In some embodiments, the mRNA further comprises a 5' untranslated region (UTR), a 3' UTR, a poly(A) tail, and / or a 5' cap analog.

[0172] messenger RNA Messenger RNA (mRNA) is RNA that encodes (at least one) protein (a naturally occurring, non-naturally occurring, or modified polymer of amino acids) and can be translated in vitro, in vivo, in situ, or ex vivo to produce the encoded protein. It is understood that mRNA is not self-amplifying (i.e., self-replicating) RNA (saRNA) (for a comparison of mRNA and saRNA, see, e.g., Bloom K et al. Gene Therapy 2021;28:117-129). saRNA contains an alphavirus replicase sequence that encodes an RNA-dependent RNA polymerase. mRNA does not contain an alphavirus replicase sequence.

[0173] Unless otherwise indicated, those skilled in the art will understand that although the nucleic acid sequences set forth in this application may recite a "T" in a representative DNA sequence, if the sequence corresponds to an mRNA, the "T" is replaced with a "U." Thus, any DNA disclosed herein and identified by a particular sequence identification number also discloses the corresponding mRNA sequence complementary to that DNA, in which case each "T" in the DNA sequence is replaced with a "U."

[0174] Naturally occurring eukaryotic mRNA molecules may contain stabilizing elements (including, but not limited to, UTRs at the 5' end (5'UTR) and / or 3' end (3'UTR)) in addition to other structural features such as a 5'-cap structure or a 3'-poly(A) tail. Both the 5'UTR and 3'UTR are typically transcribed from genomic DNA and are elements of premature mRNAs. Structural features characteristic of mature mRNAs, such as the 5'-cap and 3'-poly(A) tail, are usually added to the transcribed (premature) mRNA during mRNA processing.

[0175] Examples of mRNA sequences encoding EBV proteins are provided in the Examples section elsewhere herein. In some embodiments, the mRNA comprises an ORF that is at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or identical to a sequence selected from SEQ ID NOs: 1-35. In some embodiments, the mRNA comprises a nucleotide sequence that is 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or identical to a sequence selected from SEQ ID NOs: 7-12.

[0176] Untranslated Regions (UTRs) An mRNA contains one or more regions or portions that function as untranslated regions. The term "5' untranslated region" (UTR) refers to the region of an mRNA immediately upstream (i.e., 5') from the start codon (i.e., the first codon of an mRNA transcript that is translated by a ribosome) that does not encode a polypeptide. The term "3' untranslated region" (UTR) refers to the region of an mRNA immediately downstream (i.e., 3') from the stop codon (i.e., the codon of an mRNA transcript that signals the end of translation) that does not encode a polypeptide. When an RNA transcript is being produced, the 5' UTR may contain a promoter sequence. Such promoter sequences are known in the art. It is understood that the vaccines of the present disclosure are free of such promoter sequences.

[0177] When an mRNA is designed to encode (at least one) EBV protein, the mRNA may contain a 5' UTR and / or a 3' UTR. The UTR of an mRNA is transcribed but not translated. In an mRNA, the 5' UTR begins at the transcription initiation site and continues up to, but not including, the start codon. The 3' UTR begins immediately after the stop codon and continues to the transcription termination signal. There is increasing evidence of the regulatory role that UTRs play in the stability and translation of nucleic acid molecules. Regulatory functions of UTRs can be incorporated into polynucleotides, particularly to enhance molecular stability. Specific functions can also be incorporated to ensure downregulation of transcripts in case they are misdirected to undesirable organ sites. A variety of 5' UTR and 3' UTR sequences are known.

[0178] It should also be understood that the mRNA can include any 5' UTR and / or any 3' UTR. Exemplary UTR sequences include SEQ ID NOs: 76-86. However, other UTR sequences may be used or may be substituted for any of the UTR sequences described herein.

[0179] In some embodiments, the 5'UTR comprises a sequence provided in Table 4, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a 5'UTR sequence provided in Table 4, or a variant or fragment thereof.

[0180] In certain embodiments, the 3'UTR comprises a sequence provided in Table 5, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a 3'UTR sequence provided in Table 5, or a variant or fragment thereof. [Table 4-1] [Table 4-2] [Table 4-3] [Table 5]

[0181] 5'UTRs do not encode proteins (are non-coding). Natural 5'UTRs have characteristics that play a role in translation initiation. They have signatures such as the Kozak sequence, which is commonly known to be involved in the process by which ribosomes initiate the translation of many genes. The Kozak sequence has a common CCR(A / G)CCAUGG sequence, where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), which is followed by another "G". 5'UTRs are also known to form secondary structures involved in the binding of elongation factors.

[0182] In some embodiments of the present disclosure, the 5' UTR is a heterologous UTR, i.e., a UTR found in nature in the context of a different ORF. In other embodiments, the 5' UTR is a synthetic UTR, i.e., not found in nature. Synthetic UTRs include UTRs that have been mutated to improve their properties (e.g., increase gene expression) and those that are completely synthetic. Exemplary 5' UTRs include those derived from a-globin or b-globin from Xenopus or humans (8278063, 9012219), human cytochrome b-245a polypeptide, and hydroxysteroid (17b) dehydrogenase, as well as tobacco etch virus (US8278063, 9012219). The CMV immediate early 1 (IE1) gene (US2014 / 0206753, WO2013 / 185069), sequence GGGAUCCUACC (SEQ ID NO: 44) (WO2014 / 144196), can also be used. In other embodiments, the 5'UTR is the 5'UTR of a TOP gene (e.g., WO2015 / 101414, WO2015 / 101415, WO2015 / 062738, WO2015 / 024667, WO2015 / 024667) that lacks a 5'TOP motif (oligopyrimidine tract) and is encoded by the ribosomal protein Large 5'UTR elements derived from the 5'UTR of the 32 (L32) gene (WO / 2015101414, WO2015101415, WO / 2015 / 062738), the 5'UTR element derived from the 5'UTR of the hydroxysteroid (17-beta) dehydrogenase 4 gene (HSD17B4) (WO2015024667), or the 5'UTR element derived from the 5'UTR of the ATP5A1 gene (WO2015 / 024667) may be used. In some embodiments, an internal ribosome entry site (IRES) is used in place of the 5'UTR.

[0183] The 3'UTR is non-coding and does not encode proteins. Native or wild-type 3'UTRs are known to contain stretches of adenosines and uridines. These AU-rich signatures are particularly prevalent in genes with high turnover rates. Based on sequence characteristics and functional properties, AU-rich elements (AREs) can be classified into three classes (Chen et al., 1995). Class I AREs contain several dispersed copies of the AUUUA motif within the U-rich region. C-Myc and MyoD contain class I AREs. Class II AREs have two or more overlapping UUAUUUA(U / A)(U / A) nonamers. Molecules containing this type of ARE include GM-CSF and TNF-α. Class III AREs are less well defined. These U-rich regions do not contain the AUUUA motif. c-Jun and myogenin are two well-studied examples of this class. While most proteins that bind to AREs are known to destabilize messengers, members of the ELAV family, particularly HuR, have been demonstrated to increase mRNA stability. HuR binds to all three classes of AREs. Engineering a HuR-specific binding site within the 3'UTR of a nucleic acid molecule leads to HuR binding and, therefore, message stabilization in vivo.

[0184] The introduction, removal, or modification of 3'UTR AU-rich elements (AREs) can be used to modulate the stability of the mRNAs of the present disclosure. When engineering a particular nucleic acid, one or more copies of an ARE can be introduced to reduce the stability of the nucleic acid of the present disclosure, thereby suppressing translation and reducing production of the resulting protein. Similarly, AREs can be identified and removed or mutated to increase their stability within the cell, thereby increasing translation and production of the resulting protein. Transfection experiments can be performed in relevant cell lines using nucleic acids of the present disclosure, and protein production can be assayed at various time points after transfection. For example, cells can be transfected with various ARE-engineered molecules, and ELISA kits for the relevant proteins can be used to assay protein production 6 hours, 12 hours, 1 day, 2 days, and 7 days after transfection.

[0185] Those skilled in the art will understand that heterologous or synthetic 5'UTRs can be used with any desired 3'UTR sequence, for example, heterologous or synthetic 5'UTRs can be used with synthetic or heterologous 3'UTRs.

[0186] Non-UTR sequences can also be used as regions or subregions within a nucleic acid. For example, an intron or a portion of an intron sequence can be incorporated into a region of the nucleic acid of the present disclosure. Incorporation of an intron sequence can increase protein production and nucleic acid levels.

[0187] A combination of features may be included in the flanking regions, among other features. For example, an ORF may be flanked by a 5' UTR, which may contain a strong Kozak translation initiation signal, and / or a 3' UTR, which may contain an oligo(dT) sequence for templated addition of a polyA tail. The 5' UTR may contain a first polynucleotide fragment and a second polynucleotide fragment from the same and / or different genes (e.g., the 5' UTRs described in US2010 / 0293625 and WO2015 / 085318A2, each of which is incorporated herein by reference).

[0188] It should be understood that any UTR from any gene may be incorporated into a region of a nucleic acid. Furthermore, multiple wild-type UTRs from any known gene may be utilized. It is also within the scope of the present disclosure to provide artificial UTRs that are not variants of the wild-type region. These UTRs, or portions thereof, may be positioned in the same direction as the selected transcript, or their orientation or position may be altered. Thus, a 5' or 3' UTR may be inverted, shortened, extended, or combined with one or more other 5' or 3' UTRs. As used herein, the term "altered" with respect to a UTR sequence means that the UTR has been altered in some way relative to the reference sequence. For example, a 3' or 5' UTR may be altered compared to a wild-type or naturally occurring UTR by a change in orientation or position as taught above, or by the inclusion of additional nucleotides, deletion of nucleotides, exchange, or transposition of nucleotides. Any of these alterations that result in an "altered" UTR (whether 3' or 5') constitutes a variant UTR.

[0189] In some embodiments, double, triple, or quadruple UTR can be used, for example, 5'UTR or 3'UTR.As used herein, "double" UTR refers to two copies of the same UTR that are encoded consecutively or substantially consecutively.For example, double beta-globin 3'UTR can be used as described in US2010 / 0129877 (hereby incorporated by reference).

[0190] It is also within the scope of the present disclosure to have patterned UTR.As used herein, " patterned UTR " refers to the UTR that reflects repeating or alternating patterns, such as ABABAB or AABBABBAABB or ABCABCABC, or their variants that repeat once, twice, or more than three times.In these patterns, each letter A, B, or C represents the UTR that is different at nucleotide level.

[0191] In some embodiments, the flanking region is selected from a family of transcripts (whose proteins share a common function, structure, characteristic, or property). For example, a polypeptide of interest may belong to a family of proteins expressed in a particular cell, tissue, or at a certain time during development. A UTR from any of these genes may be exchanged with any other UTR from the same or a different protein family to create a new polynucleotide. As used herein, the term "family of proteins" is used in the broadest sense to refer to a group of two or more polypeptides of interest that share at least one function, structure, characteristic, location, origin, or expression pattern.

[0192] The untranslated region may also include a translational enhancer element (TEE). By way of non-limiting example, the TEE may include those described in US2009 / 0226470, which is incorporated herein by reference, and those known in the art.

[0193] Open reading frame An open reading frame (ORF) is a contiguous stretch of DNA or RNA that begins with a start codon (e.g., methionine (ATG or AUG)) and ends with a stop codon (e.g., TAA, TAG, or TGA, or UAA, UAG, or UGA). ORFs typically encode proteins. The sequences disclosed herein may further comprise additional elements (e.g., 5' and / or 3' UTRs), although it will be understood that these elements, unlike the ORF, need not necessarily be present in the mRNA.

[0194] 5'-end capping In some embodiments, the mRNA comprises a 5'-end cap. 5'-capping of polynucleotides can be completed simultaneously during in vitro transcription reactions using, for example, the following chemical RNA cap analogs: 3'-O-Me-m7G(5')ppp(5')G [ARCA cap]; G(5')ppp(5')A; G(5')ppp(5')G; m7G(5')ppp(5')A; m7G(5')ppp(5')G to generate a 5'-guanosine cap structure according to the manufacturer's protocol (New England BioLabs, Ipswich, MA). 5'-capping of modified mRNAs can be completed post-transcriptionally, for example, using vaccinia virus capping enzyme to generate the "Cap 0" structure: m7G(5')ppp(5')G (New England BioLabs, Ipswich, MA). The cap 1 structure can be generated using both vaccinia virus capping enzyme and 2'-O methyltransferase to generate m7G(5')ppp(5')G-2'-O-methyl. The cap 2 structure can be generated by cap 1 construction followed by 2'-O-methylation of the third nucleotide from the 5' end using 2'-O methyltransferase. The cap 3 structure can be generated by cap 2 construction followed by 2'-O-methylation of the fourth nucleotide from the 5' end using 2'-O methyltransferase. The enzymes can be derived from recombinant sources. Other cap analogs may also be used.

[0195] Polyadenylation tailing A "poly(A) tail" is a region of an mRNA downstream, e.g., immediately downstream (i.e., 3') of the 3' UTR, that contains multiple consecutive adenosine monophosphates. A poly(A) tail can contain 10 to 300 adenosine monophosphates. In some cases, a poly(A) tail can contain up to about 400 adenine nucleotides. For example, a poly(A) tail can contain 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, or 300 adenosine monophosphates. In some embodiments, a poly(A) tail contains 50 to 250 adenosine monophosphates. In relevant biological environments (e.g., intracellular, in vivo), poly(A) tails function to protect mRNAs from enzymatic degradation (e.g., in the cytoplasm), assist in transcription termination, and / or transport and translation of mRNAs from the nucleus. In some embodiments, the length of the 3'-poly(A) tail can be essential for the stability of individual mRNAs. In some embodiments, the poly(A) tail has a length of about 50, about 100, about 150, about 200, about 250, about 300, about 350, or about 400 nucleotides. In some embodiments, the poly(A) tail has a length of 100 nucleotides.

[0196] Additional stabilizing elements In some embodiments, the mRNAs provided herein contain additional stabilizing elements. The stabilizing elements may include, for example, histone stem loops. A 32-kDa protein, stem-loop binding protein (SLBP), has been identified. It associates with histone stem loops at the 3' end of histone messages in both the nucleus and the cytoplasm. Its expression level is regulated by the cell cycle, peaking during S phase, when histone mRNA levels also increase. This protein has been shown to be essential for efficient 3'-end processing of histone pre-mRNAs by U7 snRNP. SLBP continues to associate with the stem loop after processing and then stimulates translation of mature histone mRNA into histone protein in the cytoplasm. The RNA-binding domain of SLBP is conserved across metazoans and protozoans, and its binding to histone stem loops depends on the structure of the loop. The minimal binding site includes at least three nucleotides 5' and two nucleotides 3' to the stem loop.

[0197] In some embodiments, the mRNA comprises an open reading frame (coding region), a histone stem loop, and optionally a poly(A) sequence or polyadenylation signal. The poly(A) sequence or polyadenylation signal should generally enhance the expression level of the encoded protein. The encoded protein, in some embodiments, is not a histone protein, a reporter protein (e.g., luciferase, GFP, EGFP, β-galactosidase, EGFP), or a marker or selection protein (e.g., alpha-globin, galactokinase, and xanthine:guanine phosphoribosyltransferase (GPT)).

[0198] In some embodiments, the mRNA comprises a combination of a poly(A) sequence or a polyadenylation signal with at least one histone stem-loop, which essentially represent alternative mechanisms but act synergistically to increase protein expression above the levels seen with either of the individual elements. The synergistic effect of the combination of poly(A) and histone stem-loop is independent of the order of the elements or the length of the poly(A) sequence.

[0199] In some embodiments, the mRNA does not contain a histone downstream element (HDE). A "histone downstream element (HDE)" comprises a purine-rich polynucleotide stretch of approximately 15-20 nucleotides 3' of a naturally occurring stem-loop, which corresponds to the binding site for U7 snRNA, which is involved in processing histone pre-mRNA to mature histone mRNA. In some embodiments, the nucleic acid does not contain an intron.

[0200] The mRNA may or may not contain enhancer and / or promoter sequences, which may be modified or unmodified, activated or unactivated. In some embodiments, histone stem-loops are generally derived from histone genes and comprise two adjacent, partially or fully reverse-complementary sequences separated by a short spacer, forming the loop of the structure. The unpaired loop region typically cannot base-pair with any of the stem-loop elements. Because it is an important component of many RNA secondary structures, it is often present in RNA, but can also be present in single-stranded DNA. The stability of the stem-loop structure generally depends on the length, the number of mismatches or bulges, and the base composition of the paired region. In some embodiments, wobble base pairs (non-Watson-Crick base pairs) may occur. In some embodiments, at least one histone stem-loop sequence comprises a length of 15-45 nucleotides.

[0201] In some embodiments, the mRNA has one or more AU-rich sequences removed. These sequences (sometimes referred to as AURES) are destabilizing sequences found in the 3'UTR. The AURES may be removed from the mRNA. Alternatively, the AURES may remain in the mRNA.

[0202] Array Optimization In some embodiments, the open reading frame encoding a protein of the present disclosure is codon-optimized. Methods of codon optimization are known in the art. Any one or more open reading frames of the sequences provided herein may be codon-optimized. In some embodiments, codon optimization may be used to match codon frequencies in the target and host organisms to ensure proper folding, bias GC content to improve mRNA stability or reduce secondary structure, minimize tandem repeat codon or base stretches that may impair gene assembly or expression, customize transcriptional and translational control regions, insert or remove protein trafficking sequences, remove / add post-translational modification sites (e.g., glycosylation sites) in the encoded protein, add, remove, or shuffle protein domains, insert or delete restriction sites, modify ribosome binding sites and mRNA degradation sites, adjust translation rates to ensure correct folding of various domains of the protein, or reduce or eliminate problematic secondary structures within the polynucleotide. Codon optimization tools, algorithms, and services are known in the art, and non-limiting examples include services from GeneArt (Life Technologies), DNA2.0 (Menlo Park, CA), and / or proprietary methods. In some embodiments, the open reading frame sequence is optimized using an optimization algorithm.

[0203] In some embodiments, the codon-optimized sequence shares less than 95% sequence identity with the open reading frame of a naturally occurring or wild-type sequence (e.g., a naturally occurring or wild-type mRNA sequence encoding an EBV protein antigen). In some embodiments, the codon-optimized sequence shares less than 90% sequence identity with a naturally occurring or wild-type sequence (e.g., a naturally occurring or wild-type mRNA sequence encoding an EBV protein). In some embodiments, the codon-optimized sequence shares less than 85% sequence identity with a naturally occurring or wild-type sequence (e.g., a naturally occurring or wild-type mRNA sequence encoding an EBV protein). In some embodiments, the codon-optimized sequence shares less than 80% sequence identity with a naturally occurring or wild-type sequence (e.g., a naturally occurring or wild-type mRNA sequence encoding an EBV protein). In some embodiments, the codon-optimized sequence shares less than 75% sequence identity with a naturally occurring or wild-type sequence (e.g., a naturally occurring or wild-type mRNA sequence encoding an EBV protein).

[0204] In some embodiments, the codon-optimized sequence shares 65% to 85% (e.g., about 67% to about 85% or about 67% to about 80%) sequence identity to a naturally occurring or wild-type sequence (e.g., a naturally occurring or wild-type mRNA sequence encoding an EBV protein). In some embodiments, the codon-optimized sequence shares 65% to 75% or about 80% sequence identity to a naturally occurring or wild-type sequence (e.g., a naturally occurring or wild-type mRNA sequence encoding an EBV protein).

[0205] In some embodiments, the codon-optimized sequence encodes an antigen that is as immunogenic or more immunogenic (e.g., at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 100%, or at least 200% more) than the EBV protein encoded by the non-codon-optimized sequence.

[0206] The modified mRNA, when transfected into a mammalian host cell, has stability of 12 to 18 hours, or more than 18 hours, for example, 24, 36, 48, 60, 72 hours, or more than 72 hours, and is capable of expression by the mammalian host cell.

[0207] In some embodiments, codon-optimized mRNA may have an increased G / C level. The G / C content of a nucleic acid molecule (e.g., mRNA) can affect mRNA stability. mRNA with increased amounts of guanine (G) and / or cytosine (C) residues may be more functionally stable than RNA containing large amounts of adenine (A) and thymine (T) or uracil (U) nucleotides. For example, WO 02 / 098443 discloses a pharmaceutical composition comprising an mRNA stabilized by sequence modification in the coding region. Due to the degeneracy of the genetic code, the modification works by replacing existing codons with ones that better promote RNA stability without changing the resulting amino acid. This approach is limited to the coding region of the mRNA.

[0208] Unmodified nucleotides In some embodiments, the mRNA is chemically unmodified and comprises standard ribonucleotides consisting of adenosine, guanosine, cytosine, and uridine. In some embodiments, the nucleotides and nucleosides comprise standard nucleoside residues (e.g., A, G, C, or U) as found in transcribed RNA. In some embodiments, the nucleotides and nucleosides comprise standard deoxyribonucleosides (e.g., dA, dG, dC, or dT) as found in DNA.

[0209] Chemically Modified Nucleotides In some embodiments, the mRNA vaccine comprises RNA having an open reading frame encoding an EBV protein, and the nucleic acid comprises nucleotides and / or nucleosides that may be standard (unmodified) or modified as known in the art. In some embodiments, the nucleotides and nucleosides of the mRNA vaccine comprise modified nucleotides or nucleosides. Such modified nucleotides and nucleosides may be naturally occurring or non-naturally occurring modified nucleotides and nucleosides. Such modifications may include art-recognized modifications in the sugar, backbone, or nucleobase moieties of the nucleotides and / or nucleosides.

[0210] In some embodiments, the naturally occurring modified nucleotides or nucleotides of the present disclosure are those generally known or recognized in the art. Non-limiting examples of such naturally occurring modified nucleotides and nucleotides can be found, inter alia, in the widely recognized MODOMICS database.

[0211] In some embodiments, the non-naturally occurring modified nucleotides or nucleosides of the present disclosure are those commonly known or recognized in the art. Non-limiting examples of such non-naturally occurring modified nucleotides and nucleosides can be found in, among others, International Publication Nos. WO2013052523A1, WO2014093924A1, WO2015051173A2, WO2015051169A2, WO2015089511A2, or WO2017153936A1, each of which is incorporated herein by reference.

[0212] Thus, nucleic acids (eg, DNA and RNA, such as mRNA) of the present disclosure can include standard nucleotides and nucleosides, naturally occurring nucleotides and nucleosides, non-naturally occurring nucleotides and nucleosides, or any combination thereof.

[0213] Nucleic acids (e.g., DNA and RNA, e.g., mRNA) of the present disclosure, in some embodiments, comprise a variety of different types of standard and / or modified nucleotides and nucleosides. In some embodiments, a particular region of a nucleic acid contains one, two, or more (optionally different) types of standard and / or modified nucleotides and nucleosides.

[0214] In some embodiments, modified mRNA introduced into a cell or organism exhibits reduced degradation in the cell or organism, respectively, compared to unmodified nucleic acids comprising standard nucleotides and nucleosides.

[0215] In some embodiments, modified mRNA introduced into a cell or organism may exhibit reduced immunogenicity (e.g., reduced innate response) in the cell or organism, respectively, compared to unmodified nucleic acids comprising standard nucleotides and nucleosides.

[0216] In some embodiments, nucleic acids (e.g., RNA, e.g., mRNA) contain non-naturally occurring modified nucleotides that are introduced during or after nucleic acid synthesis to achieve a desired function or property. Modifications can be in the internucleotide bond, the purine or pyrimidine base, or the sugar. Modifications can be introduced by chemical synthesis or by polymerase enzymes at the end of the chain or anywhere else in the chain. Any region of a nucleic acid can be chemically modified.

[0217] The present disclosure provides modified nucleosides and nucleotides of nucleic acids (e.g., RNA, e.g., mRNA). A "nucleoside" refers to a compound comprising a sugar molecule (e.g., pentose or ribose) or a derivative thereof, in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as a "nucleobase"). A "nucleotide" refers to a nucleoside comprising a phosphate group. Modified nucleotides can be synthesized in any useful manner, for example, chemically, enzymatically, or recombinantly, to include one or more modified or unnatural nucleosides. A polynucleotide can comprise a region(s) of linked nucleosides. Such regions can have variable backbone linkages. The linkages can be standard phosphodiester linkages, in which case the nucleic acid would comprise a region of nucleotides.

[0218] Base pairing of modified nucleotides encompasses not only standard adenosine-thymine, adenosine-uracil, or guanosine-cytosine base pairs, but also base pairs formed between nucleotides containing non-standard or modified bases and / or modified nucleotides, where the arrangement of hydrogen bond donors and hydrogen bond acceptors allows hydrogen bonding between the non-standard base and a standard base, or between two complementary non-standard base structures, for example, in nucleic acids having at least one chemical modification. One example of such non-standard base pairing is base pairing between the modified nucleotide inosine and adenine, cytosine, or uracil. Any combination of base / sugar or linker may also be introduced into the nucleic acid.

[0219] In some embodiments, modified nucleobases in a nucleic acid (e.g., RNA, e.g., mRNA) comprise 1-methyl-pseudouridine (m1ψ), 1-ethyl-pseudouridine (e1ψ), 5-methoxy-uridine (mo5U), 5-methyl-cytidine (m5C), and / or pseudouridine (ψ). In some embodiments, modified nucleobases in a nucleic acid (e.g., RNA, e.g., mRNA) comprise 5-methoxymethyluridine, 5-methylthiouridine, 1-methoxymethylpseudouridine, 5-methylcytidine, and / or 5-methoxycytidine. In some embodiments, the polyribonucleotide comprises a combination of at least two (e.g., two, three, or more) of any of the above modified nucleobases, including, but not limited to, chemical modifications.

[0220] In some embodiments, an mRNA of the disclosure comprises 1-methyl-pseudouridine (m1ψ) substitutions at one or more or all uridine positions in the nucleic acid.

[0221] In some embodiments, an mRNA of the disclosure comprises 1-methylpseudouridine (m1ψ) substitutions at one or more or all of the uridine positions of the nucleic acid and 5-methylcytidine substitutions at one or more or all of the cytidine positions of the nucleic acid.

[0222] In some embodiments, an mRNA of the disclosure comprises pseudouridine (ψ) substitutions at one or more or all uridine positions in the nucleic acid.

[0223] In some embodiments, an mRNA of the disclosure comprises pseudouridine (ψ) substitutions at one or more or all of the uridine positions of the nucleic acid and 5-methylcytidine substitutions at one or more or all of the cytidine positions of the nucleic acid.

[0224] In some embodiments, an mRNA of the disclosure includes a uridine at one or more or all uridine positions of the nucleic acid.

[0225] In some embodiments, mRNA is uniformly modified with a particular modification (e.g., completely modified, modified throughout the entire sequence). For example, a polynucleotide can be uniformly modified with 5-methyl-cytidine (m5C). That is, all cytosine residues in the mRNA sequence are replaced with 5-methyl-cytidine (m5C). Similarly, a nucleic acid can be uniformly modified by replacing any type of nucleoside residue present in the sequence with a modified residue such as those described above.

[0226] The nucleic acid may be partially or completely modified along the entire length of the molecule. For example, within a nucleic acid of the present disclosure, or within a given sequence region thereof (e.g., within an mRNA, including or excluding a poly(A) tail), one or more or all or a given type of nucleotide (e.g., purines or pyrimidines, or one or more or all of A, G, U, C) may be uniformly modified. In some embodiments, every nucleotide X in the nucleic acid (or sequence region thereof) is a modified nucleotide, and X may be any one of nucleotides A, G, U, C, or any one of the following combinations: A+G, A+U, A+C, G+U, G+C, U+C, A+G+U, A+G+C, G+U+C, or A+G+C.

[0227] The nucleic acid may contain modified nucleotides (either relative to the total nucleotide content or relative to one or more types of nucleotides, i.e., any one or more of A, G, U, or C) in an amount of about 1% to about 100%, or any percentage therebetween (e.g., 1% to 20%, 1% to 25%, 1% to 50%, 1% to 60%, 1% to 70%, 1% to 80%, 1% to 90%, 1% to 95%, 10% to 20%, 10% to 25%, 10% to 50%, 10% to 60%, 10% to 70%, 10% to 80%, 10% to 90%, 10% to 95%, 10% to 100%, 20% to 25%, 20% to 50%, 20% to 60%, 20% to 70%, 20% to 80%, 20% to 90%, 20% to 95%, 20% to 100%, 50% to 60%, 50% to 70%, 50% to 80%, 50% to 90%, 50% to 95%, 50% to 100%, 70% to 80%, 70% to 90%, 70% to 95%, 70% to 100%, 80% to 90%, 80% to 95%, 80% to 100%, 90% to 95%, 90% to 100% and 95% to 100%). It will be understood that any remaining percentage is accounted for by the presence of unmodified A, G, U, or C.

[0228] The mRNA may contain a minimum of 1% to a maximum of 100% modified nucleotides, or any range therebetween, for example, at least 5% modified nucleotides, at least 10% modified nucleotides, at least 25% modified nucleotides, at least 50% modified nucleotides, at least 80% modified nucleotides, or at least 90% modified nucleotides. For example, the nucleic acid may contain modified pyrimidines, such as modified uracil or cytosine. In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90%, or 100% of the uracils in the nucleic acid are replaced with modified uracils (e.g., 5-substituted uracils). The modified uracils may be replaced with a compound having a single unique structure, or with multiple compounds having different structures (e.g., two, three, four, or more unique structures). In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90%, or 100% of the cytosines in the nucleic acid are replaced with modified cytosines (e.g., 5-substituted cytosines). The modified cytosines may be replaced with a compound having a single unique structure, or may be replaced with multiple compounds having different structures (e.g., two, three, four, or more unique structures).

[0229] Nucleic acid production chemical synthesis Solid-phase chemical synthesis. The nucleic acids of the present disclosure may be produced entirely or partially using solid-phase technology. Solid-phase chemical synthesis of nucleic acids is an automated method in which molecules are immobilized on a solid support and synthesized stepwise in a reaction solution. Solid-phase synthesis is useful for site-specific introduction of chemical modifications into nucleic acid sequences.

[0230] Synthesis of nucleic acids by sequential addition of monomer building blocks can be carried out in liquid phase.

[0231] Each of the above-mentioned synthesis methods has its own advantages and limitations. To overcome these limitations, attempts have been made to combine these methods. Such combinations of methods are within the scope of this disclosure. The combination of solid-phase or liquid-phase chemical synthesis with enzymatic ligation provides an efficient method for producing long nucleic acids that cannot be obtained by chemical synthesis alone.

[0232] Ligation Ligase-mediated assembly of nucleic acids can also be used. DNA or RNA ligase promotes intermolecular ligation of the 5' and 3' ends of polynucleotide chains via the formation of phosphodiester bonds. Nucleic acids, such as chimeric polynucleotides and / or circular nucleic acids, can be prepared by ligating one or more regions or subregions. By joining DNA fragments using a ligase-catalyzed reaction, recombinant DNAs with different functions can be created. Two oligodeoxynucleotides, one containing a 5' phosphoryl group and the other containing a free 3' hydroxyl group, serve as substrates for DNA ligase.

[0233] purification Purification of nucleic acids as described herein can include, but is not limited to, nucleic acid cleanup, quality assurance, and quality control. Cleanup can be performed by methods known in the art, such as, but not limited to, AGENCOURT® beads (Beckman Coulter Genomics, Danvers, MA), poly-T beads, LNA™ Oligo-T Capture Probes (EXIQON® Inc, Vedbaek, Denmark), or HPLC-based purification methods, such as, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reverse-phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC). The term "purified," when used in reference to nucleic acids, e.g., "purified nucleic acid," refers to something that has been separated from at least one contaminant. A "contaminant" is any substance that renders another unsuitable, impure, or adulterated. Thus, purified nucleic acids (e.g., DNA and RNA) are present in a form or setting that is different from that in which they are found in nature or that is different from that in which they existed prior to being subjected to a treatment or purification method.

[0234] Quality assurance and / or quality control checks may be performed using methods such as, but not limited to, gel electrophoresis, UV absorbance, or analytical HPLC.

[0235] In some embodiments, the nucleic acid may be sequenced by methods including, but not limited to, reverse transcriptase PCR.

[0236] Quantification In some embodiments, nucleic acids may be quantified in exosomes or from one or more bodily fluids, including peripheral blood, serum, plasma, ascites, urine, cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial fluid, aqueous humor, amniotic fluid, earwax, breast milk, bronchoalveolar lavage fluid, semen, prostatic fluid, Cowper's or pre-ejaculate fluid, sweat, feces, hair, tears, cyst fluid, pleural and peritoneal fluid, pericardial fluid, lymph, chyme, chyle, bile, interstitial fluid, menstrual fluid, pus, sebum, vomit, vaginal secretions, mucosal secretions, stool, pancreatic juice, sinus lavage fluid, bronchopulmonary aspirate, blastocyl cavity fluid, and umbilical cord blood. Alternatively, exosomes may be collected from an organ selected from the group consisting of lung, heart, pancreas, stomach, intestine, bladder, kidney, ovary, testis, skin, colon, breast, prostate, brain, esophagus, liver, and placenta.

[0237] Assays may be performed using construct-specific probes, cytometry, qRT-PCR, real-time PCR, PCR, flow cytometry, electrophoresis, mass spectrometry, or a combination thereof, and exosomes may be isolated using immunohistochemistry, such as enzyme-linked immunosorbent assay (ELISA). Exosomes may also be isolated by size-exclusion chromatography, density gradient centrifugation, differential centrifugation, nanomembrane ultrafiltration, immunosorbent capture, affinity purification, microfluidic separation, or a combination thereof.

[0238] These methods allow researchers to monitor residual or delivered levels of nucleic acids in real time, which is possible because the nucleic acids, in some embodiments, differ from their endogenous forms due to structural or chemical modifications.

[0239] In some embodiments, nucleic acids can be quantified using methods such as, but not limited to, ultraviolet-visible spectroscopy (UV / Vis). A non-limiting example of a UV / Vis spectrometer is the NANODROP® spectrometer (ThermoFisher, Waltham, MA). Quantified nucleic acids can be analyzed to determine whether the nucleic acids are of the appropriate size and to confirm that nucleic acid degradation has not occurred. Nucleic acid degradation can be confirmed by methods such as, but not limited to, agarose gel electrophoresis, HPLC-based purification methods, including, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reverse-phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC), liquid chromatography-mass spectrometry (LCMS), capillary electrophoresis (CE), and capillary gel electrophoresis (CGE).

[0240] In vitro transcription The cDNA encoding the polynucleotide described herein can be transcribed using an in vitro transcription (IVT) system.In vitro transcription of mRNA is known in the art and is described in International Publication No. WO / 2014 / 152027 (incorporated herein by reference in its entirety).In some embodiments, mRNA is prepared according to any one or more of the methods described in WO2018 / 053209 or WO2019 / 036682 (each of which is incorporated herein by reference).

[0241] In some embodiments, mRNA transcripts are generated using an unamplified, linearized DNA template in an in vitro transcription reaction to produce the mRNA transcript. In some embodiments, the template DNA is isolated DNA. In some embodiments, the template DNA is cDNA. In some embodiments, the cDNA is formed by reverse transcription of RNA, for example, but not limited to, EBV mRNA. In some embodiments, cells, e.g., bacterial cells, e.g., E. coli, e.g., DH-1 cells, are transfected with a plasmid DNA template. In some embodiments, the transfected cells are cultured to replicate the plasmid DNA, which is then isolated and purified. In some embodiments, the DNA template comprises an RNA polymerase promoter, e.g., a T7 promoter, located 5' to and operably linked to the gene of interest.

[0242] In some embodiments, the in vitro transcription template encodes a 5' untranslated (UTR) region, contains an open reading frame, encodes a 3' UTR, and a poly A tail. The specific nucleic acid sequence composition and length of the in vitro transcription template depends on the mRNA encoded by the template.

[0243] In some embodiments, the nucleic acid (e.g., template DNA and / or RNA) comprises 200 to 3,000 nucleotides. For example, the nucleic acid may comprise 200 to 500, 200 to 1,000, 200 to 1,500, 200 to 3,000, 500 to 1,000, 500 to 1,500, 500 to 2,000, 500 to 3,000, 1,000 to 1,500, 1,000 to 2,000, 1,000 to 3,000, 1,500 to 3,000, or 2,000 to 3,000 nucleotides.

[0244] In vitro transcription systems typically include a transcription buffer (e.g., containing magnesium), nucleotide triphosphates (NTPs), an RNase inhibitor, and a polymerase (e.g., T7 RNA polymerase). In some embodiments, one or more of the NTPs are chemically modified NTPs (e.g., with 1-methylpseudouridine or other chemical modifications described herein and / or known in the art).

[0245] In some embodiments, the NTPs include adenosine triphosphate (ATP), cytidine triphosphate (CTP), uridine triphosphate (UTP), and guanosine triphosphate (GTP), or analogs of each NTP. The ratio of NTPs can vary. In some embodiments, the ratio of GTP:ATP:CTP:UTP is 1:1:1:1. In some embodiments, the amount of GTP or its analog is greater than the amount of UTP or its analog. In some embodiments, the amount of GTP is greater than the amount of UTP. In some embodiments, the amount of ATP is greater than the amount of UTP, and the amount of CTP is greater than the amount of UTP. In some embodiments, the amount of GTP or its analog is greater than the amount of UTP or its analog. In some embodiments, the IVT system comprises a ratio of GTP concentration to ATP concentration of at least 2:1, a ratio of GTP concentration to CTP concentration of at least 2:1, and a ratio of GTP concentration to UTP concentration of at least 4:1. In some embodiments, the IVT system comprises a ratio of GTP concentration to ATP concentration of 2:1, a ratio of GTP concentration to CTP concentration of 2:1, and a ratio of GTP concentration to UTP concentration of 4:1. In some embodiments, the IVT system comprises guanosine diphosphate (GDP). In some embodiments, the IVT system comprises a ratio of GTP + GDP concentration to ATP concentration of at least 3:1, a ratio of GTP + GDP concentration to CTP concentration of at least 6:1, and a ratio of GTP + GDP concentration to UTP concentration of at least 6:1.

[0246] NTPs may be produced in-house, selected from a supplier, or synthesized as described herein. NTPs may be selected from those described herein, including, but not limited to, natural and non-natural (modified) NTPs.

[0247] Any number of RNA polymerases or variants can be used in the methods of the present disclosure. The polymerase can be selected from, but is not limited to, phage RNA polymerases, such as T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase, and / or mutant polymerases, such as polymerases capable of incorporating modified nucleic acids and / or modified nucleotides, including, but not limited to, chemically modified nucleic acids and / or nucleotides. Some embodiments exclude the use of DNase.

[0248] The IVT system, in some embodiments, includes magnesium buffer, dithiothreitol (DTT), spermidine, pyrophosphatase, and / or an RNase inhibitor. In some embodiments, the RNase inhibitor is omitted from the IVT system. The IVT system can be incubated at 25° C. or 37° C. Other temperatures can be used, depending in part on the polymerase (e.g., the use of a variant polymerase).

[0249] In some embodiments, the mRNA transcript is capped via enzymatic capping. In some embodiments, the mRNA comprises a 5' end cap, e.g., 7mG(5')ppp(5')NlmpNp.

[0250] Identification and Ratio Determination (IDR) Sequence In some embodiments, one or more nucleic acids comprise a discrimination and ratio determining sequence. A discrimination and ratio determining (IDR) sequence is a sequence of a biomolecule (e.g., a nucleic acid or protein) that, when combined with the sequence of a target biomolecule, serves to identify the target biomolecule. Typically, an IDR sequence is a heterologous sequence that is incorporated within or added to the sequence of a target biomolecule and can be used as a reference to identify the target molecule. Thus, in some embodiments, a nucleic acid (e.g., an mRNA) comprises (i) a target sequence of interest (e.g., a coding sequence encoding a therapeutic and / or antigenic peptide or protein), and (ii) a unique IDR sequence.

[0251] An RNA species (e.g., an RNA with a given coding sequence) can contain IDR sequences that differ from the IDR sequences of other RNA species (e.g., RNA(s) with different coding sequence(s)). Thus, because each IDR sequence identifies a particular RNA species, the abundance of the IDR sequences can be measured to determine the abundance of each RNA species in an mRNA vaccine. The use of different IDR sequences to distinguish RNA species enables the analysis of polyvalent RNA compositions (e.g., containing multiple RNA species) containing RNA species with similar coding sequences and / or lengths that may otherwise be difficult to distinguish using PCR- or chromatography-based analysis of full-length RNA.

[0252] Each RNA species in a multivalent RNA composition can contain an IDR sequence that is not a sequence isomer of the IDR sequence of another RNA species in the multivalent RNA composition (e.g., an IDR sequence does not have the same number of adenosine nucleotides, the same number of cytosine nucleotides, the same number of guanine nucleotides, and the same number of uracil nucleotides as another IDR sequence in the composition, even though these sequences have different sequences). Having identical nucleotide composition causes sequence isomers to have the same mass, making it challenging to distinguish between sequence isomers using mass-based discrimination methods (e.g., mass spectrometry).

[0253] Each RNA species in the multivalent RNA composition can comprise an IDR sequence with a mass that is different from the mass of the IDR sequence of each other RNA species in the multivalent RNA composition.For example, the mass of each IDR sequence can be different from the mass of other IDR sequences by at least 9 Da, at least 25 Da, at least 25 Da, or at least 50 Da.Using IDR sequences with different masses makes it possible to distinguish the RNA fragments that contain different IDR sequences using mass-based analysis methods (such as mass spectrometry) that do not require reverse transcription, amplification, or sequencing of RNA.

[0254] Each RNA species in an RNA composition can contain IDR sequences of different lengths. For example, each IDR sequence can have a length independently selected from 0 to 25 nucleotides. Because nucleic acid length affects the rate at which a nucleic acid passes through a chromatography column, using IDR sequences of different lengths for different RNA species allows for the use of chromatography-based methods (e.g., LC-UV) to distinguish between RNA fragments with different IDR sequences.

[0255] The IDR sequences may be selected so that there are no IDR sequences containing the start codon "AUG." The lack of a start codon in the IDR sequence prevents undesired translation of nucleotide sequences within and / or downstream from the IDR sequence.

[0256] The IDR sequences can be selected so that there are no IDR sequences containing restriction enzyme recognition sites. In one example, there are no IDR sequences containing the XbaI recognition site "UCUAG." The lack of restriction enzyme recognition sites (e.g., the XbaI recognition site "UCUAG") allows the use of restriction enzymes to generate and modify DNA templates for in vitro transcription without affecting the IDR sequences or the sequence of the transcribed RNA.

[0257] Non-limiting examples of distinct IDR sequences include GAGAUUGAGUGUAGUGACUAG (SEQ ID NO: 45), GAGAUUGAGUGUAGUGAC (SEQ ID NO: 46), GAGAUUGAGUGUAGUG (SEQ ID NO: 47), GAUUGAGACUACGGG (SEQ ID NO: 48), and CAUAGACACUACG (SEQ ID NO: 49). In some embodiments of the compositions described herein, each mRNA encoding a distinct protein comprises a 3'UTR comprising a distinct IDR sequence selected from SEQ ID NOs: 45-49.

[0258] lipid composition In some embodiments, nucleic acids are formulated as lipid compositions, such as compositions comprising lipid nanoparticles, liposomes, and / or lipoplexes. In some embodiments, nucleic acids are formulated as lipid nanoparticle (LNP) compositions. Lipid nanoparticles typically comprise amino lipids, non-cationic lipids, structured lipids, and PEG-lipid components along with the nucleic acid cargo of interest. Lipid nanoparticles can be produced using components, compositions, and methods generally known in the art. For example, see PCT / US2016 / 052352, PCT / US2016 / 068300, PCT / US2017 / 037551, PCT / US2015 / 027400, PCT / US2016 / 047406, PCT / US2016 / 000129, PCT / US2016 / 014280, PCT / US2017 / 038426, PCT / US2014 / 027077, PCT / US2014 / 055394, PCT / US2016 / 052117, PCT / US2012 / 069610, PCT / US2017 / 027492, PCT / US2016 / 059575, PCT / US2016 / 069491, PCT / US2016 / 069493, and PCT / US2014 / 066242, all of which are incorporated by reference in their entireties.

[0259] In some embodiments, the lipid nanoparticles comprise at least one ionizable amino lipid, at least one non-cationic lipid, at least one sterol, and / or at least one polyethylene glycol (PEG)-modified lipid.

[0260] In some embodiments, the lipid nanoparticles comprise a molar ratio of 20-60% ionizable amino lipid, 5-25% non-cationic lipid, 25-55% structural lipid, and 0.5-15% PEG-modified lipid.

[0261] In some embodiments, the lipid nanoparticles comprise a molar ratio of 20-60% ionizable amino lipid, 5-30% non-cationic lipid, 10-55% structural lipid, and 0.5-15% PEG-modified lipid.

[0262] In some embodiments, the lipid nanoparticles comprise 40-50 mol% ionizable lipids, optionally 45-50 mol%, e.g., 45-46 mol%, 46-47 mol%, 47-48 mol%, 48-49 mol%, or 49-50 mol%, e.g., about 45 mol%, 45.5 mol%, 46 mol%, 46.5 mol%, 47 mol%, 47.5 mol%, 48 mol%, 48.5 mol%, 49 mol%, or 49.5 mol%.

[0263] In some embodiments, the lipid nanoparticles comprise 20-60 mol% ionizable amino lipids. For example, the lipid nanoparticles may comprise 20-50 mol%, 20-40 mol%, 20-30 mol%, 30-60 mol%, 30-50 mol%, 30-40 mol%, 40-60 mol%, 40-50 mol%, or 50-60 mol% ionizable amino lipids. In some embodiments, the lipid nanoparticles comprise 20 mol%, 30 mol%, 40 mol%, 50 mol%, or 60 mol% ionizable amino lipids. In some embodiments, the lipid nanoparticles comprise 35 mol%, 36 mol%, 37 mol%, 38 mol%, 39 mol%, 40 mol%, 41 mol%, 42 mol%, 43 mol%, 44 mol%, 45 mol%, 46 mol%, 47 mol%, 48 mol%, 49 mol%, 50 mol%, 51 mol%, 52 mol%, 53 mol%, 54 mol%, or 55 mol% ionizable amino lipids.

[0264] In some embodiments, the lipid nanoparticles comprise 45 to 55 mole percent (mol%) of ionizable amino lipids. For example, the lipid nanoparticles may comprise 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, or 55 mol% of ionizable amino lipids.

[0265] Ionizable amino lipids Formula (AI) In some embodiments, the ionizable amino lipid has the formula (AI): [ka] or an N-oxide thereof, or a salt or isomer thereof, In the formula, R' a is R' 分岐状 where R' 分岐状 teeth, [ka] wherein: [ka] indicates the point of attachment, R aα , R aβ , R aγ , and R aδ are independently H, C 2-12 Alkyl, and C 2-12 alkenyl, R 2 and R 3 are each independently 1-14 Alkyl and C 2-14 alkenyl, R 4 is -(CH2) n OH, where n is selected from the group consisting of 1, 2, 3, 4, and 5; and [ka] is selected from the group consisting of where [ka] indicates the point of attachment, R 10 is N(R)2, where each R is independently C 1-6 Alkyl, C 2-3 alkenyl, and H, and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; Each R 5 is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; Each R 6 is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; M and M' are each independently -C(O)O- and -OC(O)-, R' is C 1-12 Alkyl or C 2-12 is alkenyl, l is selected from the group consisting of 1, 2, 3, 4 and 5; m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12, and 13.

[0266] In some embodiments of the compound of Formula (AI), R' a is R' 分岐状 and R' 分岐状 teeth, [ka] and [ka] indicates the attachment point, and R aα , R aβ , R aγ and R aδ are H and R, respectively. 2 and R 3 are respectively, C 1-14 alkyl, and R 4 is -(CH2) n OH, n is 2, and each R 5 is H, and each R 6 is H, M and M' are each -C(O)O-, and R' is C 1-12 alkyl, l is 5, and m is 7.

[0267] In some embodiments of the compound of Formula (AI), R' a is R' 分岐状 and R' 分岐状 teeth, [ka] and [ka] indicates the attachment point, and R aα , R aβ , R aγ and R aδ are H and R, respectively. 2 and R3 are respectively, C 1-14 alkyl, and R 4 is -(CH2) n OH, n is 2, and each R 5 is H, and each R 6 is H, M and M' are each -C(O)O-, and R' is C 1-12 alkyl, l is 3, and m is 7.

[0268] In some embodiments of the compound of Formula (AI), R' a is R' 分岐状 and R' 分岐状 teeth, [ka] and [ka] indicates the attachment point, and R aα is C 2-12 alkyl, and R aβ , R aγ , and R aδ are H and R, respectively. 2 and R 3 are C 11-4 alkyl, and R 4 teeth, [ka] and R 10 is NH(C 1-6 alkyl), n is 2, and R 5 is H, and each R 6 is H, M and M' are each -C(O)O-, and R' is C 1-12 alkyl, l is 5, and m is 7.

[0269] In some embodiments of the compound of Formula (AI), R' a is R' 分岐状 and R' 分岐状 teeth [ka] and [ka] indicates the attachment point, and R aα , R aβ , and R aδ are H and R, respectively. aγ is C 2-12 alkyl, and R 2 and R 3 are C 1-14 alkyl, and R 4 Ha-(CH2) n OH, n is 2, and each R 5 is H, and each R 6 is H, M and M' are each -C(O)O-, and R' is C 1-12 alkyl, l is 5, and m is 7.

[0270] In some embodiments, the compound of formula (AI) is [ka] is selected from.

[0271] In some embodiments, the ionizable amino lipid of formula (AI) has the formula (AIa): [ka] or an N-oxide thereof, or a salt or isomer thereof, In the formula, R' a is R' 分岐状 where R' 分岐状 teeth, [ka] wherein: [ka] indicates the point of attachment, Raβ , R aγ , and R aδ are independently H, C 2-12 Alkyl, and C 2-12 alkenyl, R 2 and R 3 are each independently 1-14 Alkyl and C 2-14 alkenyl, R 4 is -(CH2) n OH, where n is selected from the group consisting of 1, 2, 3, 4, and 5; and [ka] is selected from the group consisting of where [ka] indicates the point of attachment, R 10 is N(R)2, and each R is C 1-6 Alkyl C 2-3 alkenyl, and H, and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; Each R 5 is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; Each R 6 is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; M and M' are each independently -C(O)O- and -OC(O)-, R' is C 1-12 Alkyl or C 2-12 is alkenyl, l is selected from the group consisting of 1, 2, 3, 4 and 5; m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12, and 13.

[0272] In some embodiments, the ionizable amino lipid of formula (AI) has the formula (AIb): [ka] or an N-oxide thereof, or a salt or isomer thereof, In the formula, R' a is R' 分岐状 where R' 分岐状 teeth, [ka] wherein: [ka] indicates the point of attachment, R aα , R aβ , R aγ , and R aδ are independently H, C 2-12 Alkyl, and C 2-12 alkenyl, R 2 and R 3 are each independently 1-14 Alkyl and C 2-14 alkenyl, R 4 is -(CH2) n OH, where n is selected from the group consisting of 1, 2, 3, 4, and 5; Each R 5 is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; Each R 6 is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; M and M' are each independently -C(O)O- and -OC(O)-, R' is C 1-12 Alkyl or C 2-12 is alkenyl, l is selected from the group consisting of 1, 2, 3, 4 and 5; m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12, and 13.

[0273] In some embodiments of formula (AI) or (AIb), ​​R' a is R' 分岐状 and R' 分岐状 teeth, [ka] and [ka] indicates the attachment point, and R aβ , R aγ and R aδ are H and R, respectively. 2 and R 3 are respectively, C 1-14 alkyl, and R 4 is -(CH2) n OH, n is 2, and each R 5 is H, and each R 6 is H, M and M' are each -C(O)O-, and R' is C 1-12 alkyl, l is 5, and m is 7.

[0274] In some embodiments of formula (AI) or (AIb), ​​R' a is R' 分岐状 and R' 分岐状 teeth, [ka] and [ka] indicates the attachment point, and Raβ , R aγ and R aδ are H and R, respectively. 2 and R 3 are respectively, C 1-14 alkyl, and R 4 is -(CH2) n OH, n is 2, and each R 5 is H, and each R 6 is H, M and M' are each -C(O)O-, and R' is C 1-12 alkyl, l is 3, and m is 7.

[0275] In some embodiments of formula (AI) or (AIb), ​​R' a is R' 分岐状 and R' 分岐状 teeth [ka] and [ka] indicates the attachment point, and R aβ and R aδ are H and R, respectively. aγ is C 2-12 alkyl, and R 2 and R 3 are C 1-14 alkyl, and R 4 Ha-(CH2) n OH, n is 2, and each R 5 is H, and each R 6 is H, M and M' are each -C(O)O-, and R' is C 1-12 alkyl, l is 5, and m is 7.

[0276] In some embodiments, the ionizable amino lipid of formula (AI) has the formula (AIc): [ka] or an N-oxide thereof, or a salt or isomer thereof, In the formula, R' a is R' 分岐状 where R' 分岐状 teeth, [ka] wherein: [ka] indicates the point of attachment, R aα , R aβ , R aγ , and R aδ are independently H, C 2-12 Alkyl, and C 2-12 alkenyl, R 2 and R 3 are each independently 1-14 Alkyl and C 2-14 alkenyl, R 4 teeth, [ka] and where [ka] indicates the attachment point, and R 10 is N(R)2, and each R is C 1-6 Alkyl, C 2-3 alkenyl, and H, and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; Each R 5 is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; Each R 6 is C 1-3 Alkyl, C 2-3independently selected from the group consisting of alkenyl, and H; M and M' are each independently -C(O)O- and -OC(O)-, R' is C 1-12 Alkyl or C 2-12 is alkenyl, l is selected from the group consisting of 1, 2, 3, 4 and 5; m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12, and 13.

[0277] In some embodiments, R' a is R' 分岐状 and R' 分岐状 teeth, [ka] and [ka] indicates the attachment point, and R aβ , R aγ and R aδ are H and R, respectively. aα is C 2-12 alkyl, and R 2 and R 3 are respectively, C 1-14 alkyl, and R 4 teeth, [ka] and [ka] indicates the attachment point, and R 10 is NH(C 1-6 alkyl), n2 is 2, and each R 5 is H, and each R 6 is H, M and M' are each -C(O)O-, and R' is C 1-12 alkyl, l is 5, and m is 7.

[0278] In some embodiments, the compound of formula (AIc) is [ka] is.

[0279] Formula (AII) In some embodiments, the ionizable amino lipid has the formula (AII): [ka] or an N-oxide thereof, or a salt or isomer thereof, In the formula, R' a is R' 分岐状 or R' 環状 where R' 分岐状 teeth, [ka] and R' 環状 teeth, [ka] and R' b teeth, [ka] and [ka] indicates the point of attachment, R aγ and R aδ are independently H, C 1-12 Alkyl and C 2-12 alkenyl; R aγ and R aδ At least one of 1-12 Alkyl and C 2-12 alkenyl, R bγ and R bδare independently H, C 1-12 Alkyl and C 2-12 alkenyl; R bγ and R bδ At least one of 1-12 Alkyl and C 2-12 alkenyl, R 2 and R 3 are each independently 1-14 Alkyl and C 2-14 alkenyl, R 4 is -(CH2) n OH, where n is selected from the group consisting of 1, 2, 3, 4, and 5; and [ka] is selected from the group consisting of where [ka] indicates the attachment point, and R 10 is N(R)2, and each R is C 1-6 Alkyl, C 2-3 alkenyl, and H, and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; Each R' is independently C 1-12 Alkyl or C 2-12 is alkenyl, Y a is C 3-6 is a carbocyclic ring, R*” a is C 1-15 Alkyl and C 2-15 alkenyl, s is 2 or 3, m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; 1 is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9.

[0280] In some embodiments, the ionizable amino lipid of formula (AII) has the formula (AII-a): [ka] or an N-oxide thereof, or a salt or isomer thereof, In the formula, R' a is R' 分岐状 or R' 環状 where R' 分岐状 teeth, [ka] and R' b teeth, [ka] and [ka] indicates the point of attachment, R aγ and R aδ are independently H, C 1-12 Alkyl and C 2-12 alkenyl; R aγ and R aδ At least one of 1-12 Alkyl and C 2-12 alkenyl, R bγ and R bδ are independently H, C 1-12 Alkyl and C 2-12 alkenyl; R bγ and R bδ At least one of 1-12 Alkyl and C 2-12 alkenyl, R 2 and R 3 are each independently 1-14 Alkyl and C 2-14 alkenyl, R 4 is -(CH2) n OH, where n is selected from the group consisting of 1, 2, 3, 4, and 5; and [ka] is selected from the group consisting of where [ka] indicates the attachment point, and R 10 is N(R)2, and each R is C 1-6 Alkyl, C 2-3 alkenyl, and H, and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; Each R' is independently C 1-12 Alkyl or C 2-12 is alkenyl, m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; 1 is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9.

[0281] In some embodiments, the ionizable amino lipid of formula (AII) has the formula (AII-b): [ka] or an N-oxide thereof, or a salt or isomer thereof, In the formula, R' a is R' 分岐状 or R' 環状 where R' 分岐状 teeth, [ka] and R' b teeth, [ka] and [ka] indicates the point of attachment, R aγ and R bγ are each independently 1-12 Alkyl and C 2-12 alkenyl, R 2 and R 3 are each independently 1-14 Alkyl and C 2-14 alkenyl, R 4 is -(CH2) n OH, where n is selected from the group consisting of 1, 2, 3, 4, and 5; and [ka] is selected from the group consisting of where [ka] indicates the attachment point, and R 10 is N(R)2, and each R is C 1-6 Alkyl, C 2-3 alkenyl, and H, and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; Each R' is independently C 1-12 Alkyl or C 2-12 is alkenyl, m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; 1 is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9.

[0282] In some embodiments, the ionizable amino lipid of formula (AII) has the formula (AII-c): [ka] or an N-oxide thereof, or a salt or isomer thereof, In the formula, R'a is R' 分岐状 or R' 環状 where R' 分岐状 teeth, [ka] and R' b teeth, [ka] and [ka] indicates the point of attachment, R aγ is C 1-12 Alkyl and C 2-12 alkenyl, R 2 and R 3 are each independently 1-14 Alkyl and C 2-14 alkenyl, R 4 is -(CH2) n OH, where n is selected from the group consisting of 1, 2, 3, 4, and 5; and [ka] is selected from the group consisting of where [ka] indicates the attachment point, and R 10 is N(R)2, and each R is C 1-6 Alkyl, C 2-3 alkenyl, and H, and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; R' is C 1-12 Alkyl or C 2-12 is alkenyl, m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; 1 is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9.

[0283] In some embodiments, the ionizable amino lipid of formula (AII) has the formula (AII-d): [ka] or an N-oxide thereof, or a salt or isomer thereof, In the formula, R' a is R' 分岐状 or R' 環状 where R' 分岐状 teeth, [ka] and R' b teeth, [ka] and [ka] indicates the point of attachment, R aγ and R bγ are each independently 1-12 Alkyl and C 2-12 alkenyl, R 4 is -(CH2) n OH, where n is selected from the group consisting of 1, 2, 3, 4, and 5; and [ka] is selected from the group consisting of where [ka] indicates the attachment point, and R 10 is N(R)2, and each R is C 1-6 Alkyl, C 2-3alkenyl, and H, and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; Each R' is independently C 1-12 Alkyl or C 2-12 is alkenyl, m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; 1 is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9.

[0284] In some embodiments, the ionizable amino lipid of formula (AII) has the formula (AII-e): [ka] or an N-oxide thereof, or a salt or isomer thereof, In the formula, R' a is R' 分岐状 or R' 環状 where R' 分岐状 teeth, [ka] and R' b teeth, [ka] and [ka] indicates the point of attachment, R aγ is C 1-12 Alkyl and C 2-12 alkenyl, R 2 and R 3 are each independently 1-14 Alkyl and C 2-14 alkenyl, R 4 is -(CH2) nOH, where n is selected from the group consisting of 1, 2, 3, 4, and 5; R' is C 1-12 Alkyl or C 2-12 is alkenyl, m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; 1 is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9.

[0285] In some embodiments of a compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), m and l are each independently selected from 4, 5, and 6. In some embodiments of a compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), m and l are each 5.

[0286] In some embodiments of a compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), each R′ is independently C 1-12 In some embodiments of a compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), each R' is independently C 2-5 It is alkyl.

[0287] In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R' b teeth, [ka] and R 2 and R 3 are each independently 1-14 In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R' is alkyl. b teeth, [ka] and R 2 and R 3 are each independently 6-10 In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R' is alkyl. b teeth, [ka] and R 2 and R 3 are each C8 alkyl.

[0288] In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R' 分岐状 teeth, [ka] and R' b teeth, [ka] and R aγ is C 1-12 alkyl, and R 2 and R 3 are each independently 6-10 In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R' is alkyl. 分岐状 teeth, [ka] and R' b teeth, [ka] and R aγ is C 2-6 alkyl, and R 2 and R 3are each independently 6-10 In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R' is alkyl. 分岐状 teeth, [ka] and R' b teeth, [ka] and R aγ is C 2-6 alkyl, and R 2 and R 3 are each C8 alkyl.

[0289] In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R' 分岐状 teeth, [ka] and R' b teeth, [ka] and R aγ and R bγ are respectively, C 1-12 In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R' is alkyl. 分岐状 teeth, [ka] and R' b teeth, [ka] and R aγ and R bγ are respectively, C 2-6It is alkyl.

[0290] In some embodiments of a compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), m and l are each independently selected from 4, 5, and 6; and each R′ is independently selected from C 1-12 In some embodiments of a compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), m and l are each 5 and each R' is independently C 2-5 It is alkyl.

[0291] In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R' 分岐状 teeth, [ka] and R' b teeth, [ka] wherein m and l are each independently selected from 4, 5, and 6; and each R′ is independently selected from C 1-12 alkyl, and R aγ and R bγ are respectively, C 1-12 In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R' is alkyl. 分岐状 teeth, [ka] and R' b teeth, [ka] wherein m and l are each 5; and each R' is independently C 2-5 alkyl, and R aγ and Rbγ are respectively, C 2-6 It is alkyl.

[0292] In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R' 分岐状 teeth, [ka] and R' b teeth, [ka] wherein m and l are each independently selected from 4, 5, and 6; and R′ is C 1-12 alkyl, and R aγ is C 1-12 alkyl, and R 2 and R 3 are each independently 6-10 It is alkyl.

[0293] In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R' 分岐状 teeth, [ka] and R' b teeth, [ka] wherein m and l are each 5; and R' is C 2-5 alkyl, and R aγ is C 2-6 alkyl, and R 2 and R 3 are each C8 alkyl.

[0294] In some embodiments of compound (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R4 teeth, [ka] where R 10 is NH(C 1-6 In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R 4 teeth, [ka] where R 10 is NH(CH3) and n2 is 2.

[0295] In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R' 分岐状 teeth, [ka] and R' b teeth, [ka] wherein m and l are each independently selected from 4, 5, and 6; and each R′ is independently selected from C 1-12 alkyl, and R aγ and R bγ are respectively, C 1-12 alkyl, and R 4 teeth, [ka] where R 10 is NH(C 1-6 In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R' 分岐状 teeth, [ka] and R' b teeth, [ka] wherein m and l are each 5; and each R' is independently C 2-5 alkyl, and R aγ and R bγ are respectively, C 2-6 alkyl, and R 4 teeth, [ka] where R 10 is NH(CH3) and n2 is 2.

[0296] In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R' 分岐状 teeth, [ka] and R' b teeth, [ka] wherein m and l are each independently selected from 4, 5, and 6; and R′ is C 1-12 alkyl, and R 2 and R 3 are each independently 6-10 alkyl, and R aγ is C 1-12 alkyl, and R 4 teeth, [ka] where R 10 is NH(C 1-6 In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R'分岐状 teeth, [ka] and R' b teeth, [ka] wherein m and l are each 5; and R' is C 2-5 alkyl, and R aγ is C 2-6 alkyl, and R 2 and R 3 are each C8 alkyl, and R 4 teeth, [ka] where R 10 is NH(CH3) and n2 is 2.

[0297] In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R 4 is -(CH2) n OH and n is 2, 3, or 4. In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R 4 is -(CH2) n OH and n is 2.

[0298] In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R' 分岐状 teeth [ka] and R' b teeth [ka] wherein m and l are each independently selected from 4, 5, and 6; and each R′ is independently selected from C 1-12 alkyl, and R aγ and R bγ are respectively, C 1-12 alkyl, and R 4 Ha-(CH2) n OH and n is 2, 3, or 4. In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R' 分岐状 teeth [ka] and R' b teeth [ka] wherein m and l are each 5; and each R' is independently C 2-5 alkyl, and R aγ and R bγ are respectively, C 2-6 alkyl, and R 4 Ha-(CH2) n OH and n2 is 2.

[0299] In some embodiments, the ionizable amino lipid of formula (AII) has the formula (AII-f): [ka] or an N-oxide thereof, or a salt or isomer thereof, In the formula, R' a is R' 分岐状 or R' 環状 where R' 分岐状 teeth, [ka] and R' b teeth, [ka] and [ka] indicates the point of attachment, R aγ is C 1-12 is alkyl, R 2 and R 3 are each independently 1-14 is alkyl, R 4 is -(CH2) n OH, where n is selected from the group consisting of 1, 2, 3, 4, and 5; R' is C 1-12 is alkyl, m is selected from 4, 5, and 6; 1 is selected from 4, 5, and 6.

[0300] In some embodiments of the compound of Formula (AII-f), m and l are each 5; and n is 2, 3, or 4.

[0301] In some embodiments of the compound of Formula (AII-f), R' is C 2-5 alkyl, and R aγ is C 2-6 alkyl, and R 2 and R 3 are respectively, C 6-10 It is alkyl.

[0302] In some embodiments of the compound of Formula (AII-f), m and l are each 5; n is 2, 3, or 4; and R′ is C 2-5 alkyl, and R aγ is C 2-6 alkyl, and R 2 and R 3 are respectively, C 6-10 It is alkyl.

[0303] In some embodiments, the ionizable amino lipid of formula (AII) has the formula (AII-g): [ka] or an N-oxide thereof, or a salt or isomer thereof, wherein R aγ is C 2-6 is alkyl, R' is C 2-5 is alkyl, R 4 is -(CH2) n OH, where n is selected from the group consisting of 3, 4, and 5; and [ka] is selected from the group consisting of where [ka] indicates the attachment point, and R 10 is NH(C 1-6 alkyl), and n2 is selected from the group consisting of 1, 2, and 3.

[0304] In some embodiments, the ionizable amino lipid of formula (AII) has the formula (AII-h): [ka] or an N-oxide thereof, or a salt or isomer thereof, wherein R aγ and R bγ are each independently 2-6 is alkyl, Each R' is independently C 2-5 is alkyl, R 4 is -(CH2) n OH, where n is selected from the group consisting of 3, 4, and 5; and [ka] is selected from the group consisting of where [ka] indicates the attachment point, and R 10 is NH(C 1-6 alkyl), and n2 is selected from the group consisting of 1, 2, and 3.

[0305] In some embodiments of compounds of Formula (AII-g) or (AII-h), R 4 teeth, [ka] wherein: R 10 is NH(CH3) and n2 is 2.

[0306] In some embodiments of compounds of Formula (AII-g) or (AII-h), R 4 is -(CH2)2OH.

[0307] Formula (AIII) In some embodiments, the ionizable amino lipid of the present disclosure has formula (AIII): [ka] or an N-oxide thereof, or a salt or isomer thereof, wherein R1 is C 5-30 Alkyl, C 5-20 alkenyl, -R*YR", -YR", and -R″M′R′, R2 and R3 are H, C 1-14 Alkyl, C 2-14 are independently selected from the group consisting of alkenyl, -R*YR", -YR", and -R*OR", or R2 and R3 together with the atoms to which they are attached form a heterocycle or carbocycle; R4 is hydrogen, C 3-6 Carbocyclic ring, -(CH2) n Q, -(CH2) nCHQR, -CHQR, -CQ(R)2, and unsubstituted C 1-6 alkyl, where Q is a carbocycle, a heterocycle, -OR, -O(CH2) n N(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -N(R)2, -C(O)N(R)2, -N(R)C(O)R, -N(R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -N(R)R8, -N(R)S(O)2R8, -O(CH2) n -OR, -N(R)C(=NR9)N(R), -N(R)C(=CHR9)N(R), -OC(O)N(R), -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)R, -N(OR)C(O)OR, -N(OR)C(O)N(R), -N(OR)C(S)N(R), -N(OR)C(=NR9)N(R), -N(OR)C(=CHR9)N(R), -C(=NR9)N(R), -C(=NR9)R, -C(O)N(R)OR, and -C(R)N(R)C(O)OR; each n is independently selected from 1, 2, 3, 4, and 5; Each R5 is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; Each R6 is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; M and M′ are independently selected from —C(O)O—, —OC(O)—, —OC(O)—M″—C(O)O—, —C(O)N(R′)—, —N(R′)C(O)—, —C(O)—, —C(S)—, —C(S)S—, —SC(S)—, —CH(OH)—, —P(O)(OR′)O—, —S(O)—, —SS—, an aryl group, and a heteroaryl group; M″ is a bond, C 1-13 Alkyl or C 2-13 is alkenyl, R7 is C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; R8 is C 3-6selected from the group consisting of carbocycles and heterocycles; R9 is H, CN, NO2, C 1-6 Alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C 2-6 Alkenyl, C 3-6 selected from the group consisting of carbocycles and heterocycles; Each R is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; Each R' is C 1-18 Alkyl, C 2-18 alkenyl-, -R*YR″, -YR″, and H; Each R" is independently 3-15 Alkyl and C 3-15 alkenyl, Each R* is C 1-12 Alkyl and C 2-12 alkenyl; Each Y is independently 3-6 is a carbocyclic ring, each X is independently selected from the group consisting of F, Cl, Br, and I; m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13, where R4 is -(CH2) n Q, -(CH2) n When CHQR, -CHQR, or -CQ(R), (i) Q is not -N(R) when n is 1, 2, 3, 4, or 5, or (ii) Q is not 5-, 6-, or 7-membered heterocycloalkyl when n is 1 or 2.

[0308] In some embodiments, another subset of compounds of formula (AIII) includes: R1 is C 5-30 Alkyl, C 5-20 selected from the group consisting of alkenyl, -R*YR", -YR", and -R"M'R'; R2 and R3 are H, C 1-14 Alkyl, C 2-14independently selected from the group consisting of alkenyl, -R*YR", -YR", and -R*OR", or R2 and R3 together with the atoms to which they are attached form a heterocycle or carbocycle; R4 is C 3-6 Carbocyclic ring, -(CH2) n Q, -(CH2) n CHQR, -CHQR, -CQ(R)2, and unsubstituted C 1-6 alkyl, wherein Q is selected from the group consisting of C 3-6 a carbocyclic ring, a 5- to 14-membered heteroaryl having one or more heteroatoms selected from N, O, and S, -OR; -O(CH2) n N(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -C(O)N(R)2, -N(R)C(O)R, -N( R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -CRN(R)2C(O)OR, -N(R)R8, -O(CH2) n OR, -N(R)C(=NR9)N(R)2, -N(R)C(=CHR9)N(R)2, -OC(O)N(R)2, -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)2R, -N(OR)C(O)OR, -N(OR)C(O)N(R)2, -N(OR)C(S)N(R)2, -N(OR)C(=NR9)N(R)2, -N(OR)C(=CHR9)N(R)2, -C(=NR9)N(R)2, -C(=NR9)R, -C(O)N(R)OR, and 5-14 membered heterocycloalkyl having one or more heteroatoms selected from N, O, and S (oxo(=O), OH, amino, monoalkylamino or dialkylamino, and C 1-3 substituted with one or more substituents selected from alkyl, and each n is independently selected from 1, 2, 3, 4, and 5; Each R5 is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; Each R6 is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)-, -SS-, an aryl group, and a heteroaryl group; R7 is C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; R8, C 3-6 selected from the group consisting of carbocycles and heterocycles; R9 is H, CN, NO2, C 1-6 Alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C 2-6 Alkenyl, C 3-6 selected from the group consisting of carbocycles and heterocycles; Each R is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; Each R' is C 1-18 Alkyl, C 2-18 independently selected from the group consisting of alkenyl, -R*YR″, -YR″, and H; Each R” is C 3-14 Alkyl and C 3-14 alkenyl; Each R* is C 1-12 Alkyl and C 2-12 alkenyl; Each Y is independent, C 3-6 is a carbocyclic ring, each X is independently selected from the group consisting of F, Cl, Br, and I; m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; or a salt or isomer thereof.

[0309] In some embodiments, another subset of compounds of formula (AIII) includes: R1 is C 5-30 Alkyl, C 5-20selected from the group consisting of alkenyl, -R*YR", -YR", and -R"M'R'; R2 and R3 are H, C 1-14 Alkyl, C 2-14 independently selected from the group consisting of alkenyl, -R*YR", -YR", and -R*OR", or R2 and R3 together with the atoms to which they are attached form a heterocycle or carbocycle; R4 is C 3-6 Carbocyclic ring, -(CH2) n Q, -(CH2) n CHQR, -CHQR, -CQ(R)2, and unsubstituted C 1-6 alkyl, wherein Q is selected from the group consisting of C 3-6 Carbocycle, 5-14 membered heterocycle having one or more heteroatoms selected from N, O, and S, -OR, -O(CH2) n N(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -C(O)N(R)2, -N(R)C(O)R, -N( R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -CRN(R)2C(O)OR, -N(R)R8, -O(CH2) n and (i) R4 is -(CH2)N(R)-OR, -N(R)C(=NR9)N(R), -N(R)C(=CHR9)N(R), -OC(O)N(R), -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)R, -N(OR)C(O)OR, -N(OR)C(O)N(R), -N(OR)C(S)N(R), N(OR)C(=NR9)N(R), -N(OR)C(=CHR9)N(R), -C(=NR9)R, -C(O)N(R)OR, and -C(=NR9)N(R), each n is independently selected from 1, 2, 3, 4, and 5; Q is a 5- to 14-membered heterocycle; and (ii) R4 is -(CH2)N(R), n Q (n is 1 or 2), or (ii) R4 is -(CH2) n or (iii) when R4 is -CHQR and -CQ(R)2, Q is either a 5- to 14-membered heteroaryl or an 8- to 14-membered heterocycloalkyl; Each R5 is C 1-3Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; Each R6 is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)-, -SS-, an aryl group, and a heteroaryl group; R7 is C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; R8, C 3-6 selected from the group consisting of carbocycles and heterocycles; R9 is H, CN, NO2, C 1-6 Alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C 2-6 Alkenyl, C 3-6 selected from the group consisting of carbocycles and heterocycles; Each R is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; Each R' is C 1-18 Alkyl, C 2-18 alkenyl-, -R*YR″, -YR″, and H; Each R” is C 3-14 Alkyl and C 3-14 alkenyl; Each R* is C 1-12 Alkyl and C 2-12 alkenyl; Each Y is independent, C 3-6 is a carbocyclic ring, each X is independently selected from the group consisting of F, Cl, Br, and I; m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; or a salt or isomer thereof.

[0310] In some embodiments, another subset of compounds of formula (AIII) includes: R1 is C 5-30 Alkyl, C 5-20 selected from the group consisting of alkenyl, -R*YR", -YR", and -R"M'R'; R2 and R3 are H, C 1-14 Alkyl, C 2-14 independently selected from the group consisting of alkenyl, -R*YR", -YR", and -R*OR", or R2 and R3 together with the atoms to which they are attached form a heterocycle or carbocycle; R4 is C 3-6 Carbocyclic ring, -(CH2) n Q, -(CH2) n CHQR, -CHQR, -CQ(R)2, and unsubstituted C 1-6 alkyl, wherein Q is selected from the group consisting of C 3-6 Carbocyclic ring, 5-14 membered heteroaryl having one or more heteroatoms selected from N, O, and S, -OR, -O(CH2) n N(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -C(O)N(R)2, -N(R)C(O)R, -N( R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -CRN(R)2C(O)OR, -N(R)R8, -O(CH2) n -OR, -N(R)C(=NR9)N(R), -N(R)C(=CHR9)N(R), -OC(O)N(R), -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)R, -N(OR)C(O)OR, -N(OR)C(O)N(R), -N(OR)C(S)N(R), -N(OR)C(=NR9)N(R), -N(OR)C(=CHR9)N(R), -C(=NR9)R, -C(O)N(R)OR, and -C(=NR9)N(R), wherein each n is independently selected from 1, 2, 3, 4, and 5; Each R5 is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; Each R6 is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)-, -SS-, an aryl group, and a heteroaryl group; R7 is C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; R8, C 3-6 selected from the group consisting of carbocycles and heterocycles; R9 is H, CN, NO2, C 1-6 Alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C 2-6 Alkenyl, C 3-6 selected from the group consisting of carbocycles and heterocycles; Each R is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; Each R' is C 1-18 Alkyl, C 2-18 alkenyl-, -R*YR″, -YR″, and H; Each R” is C 3-14 Alkyl and C 3-14 alkenyl; Each R* is C 1-12 Alkyl and C 2-12 alkenyl; Each Y is independent, C 3-6 is a carbocyclic ring, each X is independently selected from the group consisting of F, Cl, Br, and I; m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; or a salt or isomer thereof.

[0311] In some embodiments, another subset of compounds of formula (AIII) includes: R1 is C 5-30 Alkyl, C 5-20 selected from the group consisting of alkenyl, -R*YR", -YR", and -R"M'R'; R2 and R3 are H, C 2~14 Alkyl, C 2~14 independently selected from the group consisting of alkenyl, -R*YR", -YR", and -R*OR", or R2 and R3 together with the atoms to which they are attached form a heterocycle or carbocycle; R4 is -(CH2) n Q or -(CH2) n CHQR, where Q is —N(R)2 and n is selected from 3, 4, and 5; Each R5 is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; Each R6 is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)-, -SS-, an aryl group, and a heteroaryl group; R7 is C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; Each R is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; Each R' is C 1-18 Alkyl, C 2-18 alkenyl-, -R*YR″, -YR″, and H; Each R” is C 3-14 Alkyl and C 3-14 alkenyl; Each R* is C1-12 Alkyl and C 1-12 alkenyl; Each Y is independent, C 3-6 is a carbocyclic ring, each X is independently selected from the group consisting of F, Cl, Br, and I; m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; or a salt or isomer thereof.

[0312] In some embodiments, another subset of compounds of formula (AIII) includes: R1 is C 5-30 Alkyl, C 5-20 selected from the group consisting of alkenyl, -R*YR", -YR", and -R"M'R'; R2 and R3 are C 1-14 Alkyl, C 2-14 independently selected from the group consisting of alkenyl, -R*YR", -YR", and -R*OR", or R2 and R3 together with the atoms to which they are attached form a heterocycle or carbocycle; R4 is -(CH2) n Q, -(CH2) n -CHQR, -CHQR, and -CQ(R), wherein Q is -N(R) and n is selected from 1, 2, 3, 4, and 5; Each R5 is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; Each R6 is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)-, -SS-, an aryl group, and a heteroaryl group; R7 is C 1-3 Alkyl, C 2-3selected from the group consisting of alkenyl, and H; Each R is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; Each R' is C 1-18 Alkyl, C 2-18 alkenyl-, -R*YR″, -YR″, and H; Each R” is C 3-14 Alkyl and C 3-14 alkenyl; Each R* is C 1-12 Alkyl and C 1-12 alkenyl; Each Y is independent, C 3-6 is a carbocyclic ring, each X is independently selected from the group consisting of F, Cl, Br, and I; m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; or a salt or isomer thereof.

[0313] In some embodiments, R is R″M′R′ or C 5-20 alkenyl, and R and R are each independently C 1-14 Alkyl and C 2-14 alkenyl, and R4 is selected from -(CH2) n Q, wherein Q is OH, n is selected from 3, 4, and 5, M and M′ are each independently —OC(O)— or —C(O)O—, R5, R6, and R7 are each H, and R′ is a linear C 1-12 Alkyl, or C 6-9 Alkyl-substituted C 1-12 alkyl, and R" is C 3-14 alkyl, and m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13.

[0314] In some embodiments, R is R″M′R′, and R and R are each independently C 1-14alkyl and R4 is -(CH2) n Q, wherein Q is OH, n is 4, M and M′ are each independently —OC(O)—, R5, R6, and R7 are each H, and R′ is C 6-9 Alkyl-substituted C 1-12 alkyl, and R" is C 3-14 alkyl and m is 6.

[0315] In some embodiments, R is C 5-20 alkenyl, and R and R are each independently C 1-14 alkyl and R4 is -(CH2) n Q, wherein Q is OH, n is 3, M is —C(O)O—, R 5 , R 6 , and R 7 are each H, and m is 6.

[0316] In certain embodiments, a subset of compounds of formula (AIII) includes compounds of formula (AIII-A): [ka] or an N-oxide thereof, or a salt or isomer thereof, wherein l is selected from 1, 2, 3, 4, and 5; m is selected from 5, 6, 7, 8, and 9; M is a bond or M′; R is hydrogen, unsubstituted C 1-3 Alkyl, or -(CH2) n Q, where Q is OH, —NHC(S)N(R), —NHC(O)N(R), —N(R)C(O)R, —N(R)S(O)R, —N(R)R, —NHC(═NR)N(R), —NHC(═CHR)N(R), —OC(O)N(R), —N(R)C(O)OR, heteroaryl, or heterocycloalkyl; M and M′ are independently selected from —C(O)O—, —OC(O)—, —OC(O)—M″—C(O)O—, —C(O)N(R′)—, —P(O)(OR′)O—, —SS—, an aryl group, and a heteroaryl group; and R and R are independently selected from H, C 1-14 Alkyl, and C 2-14alkenyl. For example, m is 5, 7, or 9. For example, Q is OH, -NHC(S)N(R)2, or -NHC(O)N(R)2. For example, Q is -N(R)C(O)R, or -N(R)S(O)2R.

[0317] In certain embodiments, a subset of compounds of formula (AIII) includes compounds of formula (AIII-B): [ka] or an N-oxide thereof, or a salt or isomer thereof, wherein all variables are as defined herein. For example, m is selected from 5, 6, 7, 8, and 9; R4 is hydrogen, unsubstituted C 1-3 Alkyl, or -(CH2) n Q, where Q is H, —NHC(S)N(R), —NHC(O)N(R), —N(R)C(O)R, —N(R)S(O)R, —N(R)R, —NHC(═NR)N(R), —NHC(═CHR)N(R), —OC(O)N(R), —N(R)C(O)OR, heteroaryl, or heterocycloalkyl; M and M′ are independently selected from —C(O)O—, —OC(O)—, —OC(O)—M″—C(O)O—, —C(O)N(R′)—, —P(O)(OR′)O—, —SS—, an aryl group, and a heteroaryl group; and R and R are H, C 1-14 Alkyl, and C 2-14 alkenyl. For example, m is 5, 7, or 9. For example, Q is OH, -NHC(S)N(R)2, or -NHC(O)N(R)2. For example, Q is -N(R)C(O)R, or -N(R)S(O)2R.

[0318] In certain embodiments, a subset of compounds of formula (AIII) includes compounds of formula (AIII-C): [ka] or an N-oxide thereof, or a salt or isomer thereof, wherein l is selected from 1, 2, 3, 4, and 5; M is a bond or M'; R is hydrogen, unsubstituted C 1-3 Alkyl, or -(CH2) n Q, where n is 2, 3, or 4; Q is OH, —NHC(S)N(R), —NHC(O)N(R), —N(R)C(O)R, —N(R)S(O)R, —N(R)R, —NHC(═NR)N(R), —NHC(═CHR)N(R), —OC(O)N(R), —N(R)C(O)OR, heteroaryl, or heterocycloalkyl; M and M′ are independently selected from —C(O)O—, —OC(O)—, —OC(O)—M″—C(O)O—, —C(O)N(R′)—, —P(O)(OR′)O—, —SS—, an aryl group, and a heteroaryl group; R and R are independently selected from H, C 1-14 Alkyl, and C 2-14 alkenyl.

[0319] In some embodiments, the compound of formula (AIII) has formula (AIII-D): [ka] or an N-oxide thereof, or a salt or isomer thereof, wherein R4 is as defined herein.

[0320] In another embodiment, the compound of formula (AIII) has the formula (AIII-E) [ka] or an N-oxide thereof, or a salt or isomer thereof, wherein R4 is as defined herein.

[0321] In another embodiment, the compound of formula (AIII) has formula (AIII-F) or (AIII-G): [ka] or an N-oxide thereof, or a salt or isomer thereof, wherein R4 is as defined herein.

[0322] In another embodiment, the compound of formula (AIII) has the formula (AIII-H): [ka] or an N-oxide thereof, or a salt or isomer thereof, In the formula, M is —C(O)O— or —OC(O)—, and M″ is C 1-6 Alkyl or C 2-6 alkenyl, and R2 and R3 are C 5-14 Alkyl and C 5-14 alkenyl, wherein n is selected from 2, 3, and 4.

[0323] In a further embodiment, the compound of formula (AIII) has the formula (AIII-I): [ka] or an N-oxide thereof, or a salt or isomer thereof, wherein n is 2, 3, or 4, and m, R′, R″, and R2 through R6 are as described herein. For example, each of R2 and R3 independently can be C 5-14 Alkyl and C 5-14 alkenyl.

[0324] In some embodiments, the ionizable amino lipids of the present disclosure include compounds having the following structure: [ka]

[0325] In some embodiments, the ionizable amino lipids of the present disclosure include compounds having the following structure: [ka]

[0326] In a further embodiment, the compound of formula (AIII) has the formula (AIII-J) [ka] or an N-oxide thereof, or a salt or isomer thereof, wherein l is selected from 1, 2, 3, 4, and 5; m is selected from 5, 6, 7, 8, and 9; M1 is a bond or M'; M and M' are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M"-C(O)O-, -C(O)N(R')-, -P(O)(OR')O-, -SS-, an aryl group, and a heteroaryl group; R2 and R3 are each independently selected from H, C 1-14 Alkyl, and C 2-14 alkenyl. For example, M" is independently selected from the group consisting of C 1-6 Alkyl (e.g., C 1-4 alkyl) or C 2-6 Alkenyl (e.g., C 2-4 alkenyl). For example, R2 and R3 are independently C 5-14 Alkyl and C 5-14 alkenyl.

[0327] In some embodiments, the ionizable amino lipid is of formula (AIII), or a salt or isomer thereof, wherein: R1 is -R″M′R′, R2 and R3 each independently represent C 1-14 Alkyl and C 2-14 alkenyl, R4 is -(CH2) n Q, where Q is OH and n is selected from 3, 4, and 5; M and M' are each independently -OC(O)-; R5, R6, and R7 are each H; R' is a linear C 1-12 Alkyl, or C 6-9 Alkyl-substituted C1-12 is alkyl, R” is C 3-14 is alkyl, m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13.

[0328] In some embodiments, the ionizable amino lipid is of formula (AIII), or a salt or isomer thereof, wherein: R1 is R″M′R′, R2 and R3 each independently represent C 1-14 is alkyl, R4 is -(CH2) n Q, where Q is OH and n is 4; M and M' are each independently -OC(O)-; R5, R6, and R7 are each H; R' is C 6-9 Alkyl-substituted C 1-12 is alkyl, R” is C 3-14 is alkyl, m is 6.

[0329] In some embodiments, the ionizable amino lipids of the present disclosure include compounds having the following structure: [ka]

[0330] In some embodiments, the ionizable amino lipid is of formula (AIII), or a salt or isomer thereof, wherein: R1 is C 5-20 is alkenyl, R2 and R3 each independently represent C 1-14 Alkyl and C 2-14 alkenyl, R4 is -(CH2) n Q, where Q is OH and n is selected from 3, 4, and 5; M and M' are each independently C(O)O-; R5, R6, and R7 are each H; R' is a linear C 1-12 Alkyl, or C 6-9 Alkyl-substituted C 1-12 is alkyl, R” is C 3-14 is alkyl, m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13.

[0331] In some embodiments, the ionizable amino lipid is of formula (AIII), or a salt or isomer thereof, wherein: R1 is C 5-20 is alkenyl, R2 and R3 each independently represent C 1-14 is alkyl, R4 is -(CH2) n Q, where Q is OH and n is 3; M is —C(O)O—; R5, R6, and R7 are each H; m is 6.

[0332] In some embodiments, the ionizable amino lipids of the present disclosure include compounds having the following structure: [ka]

[0333] In some embodiments, the ionizable amino lipid is one or more of the compounds described in U.S. Application Nos. 62 / 220,091, 62 / 252,316, 62 / 253,433, 62 / 266,460, 62 / 333,557, 62 / 382,740, 62 / 393,940, 62 / 471,937, 62 / 471,949, 62 / 475,140, ​​and 62 / 475,166 and PCT Application No. PCT / US2016 / 052352.

[0334] The central amine moiety of a lipid according to formula (AIII), (AIII-A), (AIII-B), (AIII-C), (AIII-D), (AIII-E), (AIII-F), (AIII-G), (AIII-H), (AIII-I), or (AIII-J) can be protonated at physiological pH. Thus, the lipid can have a positive or partial positive charge at physiological pH. Such amino lipids are sometimes referred to as cationic lipids, ionizable lipids, cationic amino lipids, or ionizable amino lipids. Amino lipids can also be zwitterionic, i.e., neutral molecules with both positive and negative charges.

[0335] Formula (AIV) In some embodiments, the ionizable amino lipid of the present disclosure has the formula (AIV): [ka] or a salt or isomer thereof, wherein W is [ka] and Ring A is [ka] and t is 1 or 2, A1 and A2 are each independently selected from CH or N; Z is CH2 or absent, where when Z is CH2, dashed lines (1) and (2) each represent a single bond; when Z is absent, dashed lines (1) and (2) are both absent; R1, R2, R3, R4, and R5 are C 5-20 Alkyl, C 5-20 independently selected from the group consisting of alkenyl, -R"MR', -R*YR", -YR", and -R*OR"; R X1 and R X2are each independently H or C alkyl; each M is independently selected from the group consisting of -C(O)O-, -OC(O)-, -OC(O)O-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)-, -C(O)S-, -SC(O)-, an aryl group, and a heteroaryl group; M* is a C1-C6 alkyl; W 1 and W 2 are each independently -O- and -N(R6)-, Each R6 is H and C 1-5 independently selected from the group consisting of alkyl, X 1 , X 2 , and X 3 is a bond, -CH2-, -(CH2)2-, -CHR-, -CHY-, -C(O)-, -C(O)O-, -OC(O)-, -(CH2) n -C(O)-, -C(O)-(CH2) n -, -(CH2) n -C(O)O-, -OC(O)-(CH2) n -, -(CH2) n -OC(O)-, -C(O)O-(CH2) n independently selected from the group consisting of —, —CH(OH)—, —C(S)—, and —CH(SH)—; Each Y is independently 3-6 is a carbocyclic ring, Each R* is C 1-12 Alkyl and C 2-12 alkenyl; Each R is independently 1-3 Alkyl and C 3-6 is selected from the group consisting of carbocycles; Each R' is independently C 1-12 Alkyl, C 2-12 selected from the group consisting of alkenyl, and H; Each R" is independently 3-12 Alkyl, C3-12 alkenyl, and -R*MR'; n is an integer from 1 to 6, In the formula, ring A is [ka] If i)X 1 , X 2 , and X 3 is not -CH2-, and / or ii) At least one of R1, R2, R3, R4, and R5 is -R"MR'.

[0336] In some embodiments, the compound has the formula (AIVa)-(AIVh): [ka] [ka] It is one of the following.

[0337] In some embodiments, the ionizable amino lipid is [ka] or a salt thereof.

[0338] The central amine moiety of a lipid according to formula (AIV), (AIVa), (AIVb), (AIVc), (AIVd), (AIVe), (AIVf), (AIVg), or (AIVh) can be protonated at physiological pH, and thus the lipid can have a positive charge or a partial positive charge at physiological pH.

[0339] Formula (AV) In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt, tautomer, or stereoisomer thereof, wherein: R 1 is an optionally substituted C1-C 24 Alkyl or optionally substituted C-C 24 is alkenyl, R 2 and R 3 are each independently an optionally substituted C-C 36 is alkyl, R 4 and R 5 are each independently an optionally substituted C1-C6 alkyl, or R 4 and R 5 together with the N to which they are attached form a heterocyclyl or heteroaryl; L 1 , L 2 and L 3 are each independently an optionally substituted C-C 18 is alkylene, G 1 is a direct bond, -(CH2) n O(C=O)-, -(CH2) n (C=O)O- or -(C=O)-; G 2 and G 3 are each independently —(C═O)O— or —O(C═O)—, and n is an integer greater than 0.

[0340] Expression(AVI) In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt, tautomer, or stereoisomer thereof, wherein: G 1 is -N(R 3 )R 4 -OR 5 and R 1is an optionally substituted branched saturated or unsaturated C 12 -C 36 is alkyl, R 2 When L is -C(=O)-, it is an optionally substituted branched or unbranched, saturated or unsaturated C 12 -C 36 alkyl or R 2 L is C6-C 12 Alkylene, C6-C 12 When it is alkenylene or C2-C6 alkynylene, it is an optionally substituted branched or unbranched, saturated or unsaturated C4-C 36 is alkyl, R 3 and R 4 are each independently H, optionally substituted branched or unbranched saturated or unsaturated C-C alkyl, or R 3 and R 4 are independently selected when L is C6-C 12 Alkylene, C6-C 12 When it is alkenylene or C2-C6 alkynylene, it is an optionally substituted branched or unbranched saturated or unsaturated C1-C6 alkyl, or R 3 and R 4 together with the nitrogen to which they are attached form a heterocyclyl; R 5 is H or optionally substituted C1-C6 alkyl, L is -C(=O)-, C6-C 12 Alkylene, C6-C 12 alkenylene, or C2-C6 alkynylene; n is an integer from 1 to 12.

[0341] Expression (AVII) In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt thereof, wherein: Each R 1a are independently hydrogen, R 1c or R 1d and Each R 1b are independent, R 1c or R 1d and Each R 1c are independently -[CH2]2C(O)X 1 R 3 and Each R 1d are independently -C(O)R 4 and Each R 2 are independent of each other, -[C(R 2a )2] c , R 2b and Each R 2a are independently hydrogen or C1-C6 alkyl; R 2b is -N(L1-B)2, -(OCH2CH2)6OH or -(OCH2CH2) b OCH3, Each R 3 and R 4 independently, C6-C 30 is an aliphatic group, Each L1 is independent, C1-C 10 is alkylene, each B is independently hydrogen or an ionizable nitrogen-containing group; each X 1 are independently a covalent bond or O; each a is independently an integer from 1 to 10; each b is independently an integer from 1 to 10; Each c is independently an integer from 1 to 10.

[0342] Formula (AVIII) In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof, wherein: X is N and Y is absent, or X is CR and Y is NR; L 1 is -O(CO)R 1 , -(C=O)OR 1 , -C(=O)R 1 , -OR 1 , -S(O) x R 1 , -S-SR 1 , -C(=O)SR 1 , -SC(=O)R 1 , -NR a C(=O)R 1 , -C(=O)NR b R c , -NR a C(=O)NR b R c , -OC(=O)NR b R c ,or -NR a C(=O)OR 1 and L 2 is -O(C=O)R 2 , -(C=O)OR 2 , -C(=O)R 2 , -OR 2 , -S(O) x R 2 , -S-SR 2 , -C(=O)SR 2 , -SC(=O)R 2 , -NR d C(=O)R 2 , -C(=O)NR e R f , -NR d C(=O)NR e R f , -OC(=O)NR e R f , -NR d C(=O)OR 2 , or R 2 is a direct bond to L 3 is -O(C=O)R3 or -(C=O)OR 3 and G 1 and G 2 are independently C2-C 12 Alkylene or C2-C 12 is alkenylene, If X is CR and Y is NR, then G 3 is C1-C 24 Alkylene, C2-C 24 Alkenylene, C1-C 24 Heteroalkylene, or C2-C 24 When X is N and Y is absent, G 3 is C1-C 24 Heteroalkylene or C2-C 24 heteroalkenylene, R a , R b , R d and R e are each independently H, C1-C 12 Alkyl or C1-C 12 is alkenyl, R c and R f are independently C1-C 12 Alkyl or C2-C 12 is alkenyl, Each R is independently H or C1-C 12 is alkyl, R 1 , R 2 and R 3 are independently C1-C 24 Alkyl or C2-C 24 alkenyl, and x is 0, 1, or 2; Each alkyl, alkenyl, alkylene, alkenylene, heteroalkylene, and heteroalkenylene is independently substituted or unsubstituted, unless otherwise specified.

[0343] Expression (AIX) In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt, tautomer, prodrug, or stereoisomer thereof, wherein: L 1 and L 2 are each independently -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O) x -, -SS-, -C(=O)S-, -SC(=O)-, -NR a C(=O)-, -C(=O)NR a -, -NR a C(=O)NR a -, -OC(=O)NR a -, -NR a C(=O)O- or a direct bond, G 1 is C1-C2 alkylene, -(C=O)-, -O(C=O)-, -SC(=O)-, -NR a C(=O)- or a direct bond, G 2 -C(O)-, -(CO)O-, -C(=O)S-, -C(=O)NR a - or a direct bond, G 3 is C1-C6 alkylene, R a is H or C1-C 12 is alkyl, R 1a and R 1b is, independently for each occurrence, (a) H or C1-C 12 alkyl, or (b) R 1a is H or C1-C 12 alkyl, and R 1b together with the carbon atom attached to it, the adjacent R 1b and together with the carbon atom attached thereto form a carbon-carbon double bond, R 2a and R 2b is, independently for each occurrence, (a) H or C1-C 12 alkyl, or (b) R 2ais H or C1-C 12 alkyl, and R 2b together with the carbon atom attached to it, the adjacent R 2b and together with the carbon atom attached thereto form a carbon-carbon double bond, R 3a and R 3b is, independently for each occurrence, (a) H or C1-C 12 alkyl, or (b) R 3a is H or C1-C 12 alkyl, and R 3b together with the carbon atom bonded thereto, form a carbon-carbon double bond with the adjacent R and the carbon atom bonded thereto; R 4a and R 4b is, independently for each occurrence, (a) H or C1-C 12 alkyl, or (b) R 4a is H or C1-C 12 alkyl, and R 4b together with the carbon atom attached to it, the adjacent R 4b and together with the carbon atom attached thereto form a carbon-carbon double bond, R 5 and R 6 are each independently H or methyl; R 7 is H or C1-C 20 is alkyl, R 8 is OH, -N(R 9 )(C=O)R 10 , -(C=O)NR 9 R 10 , -NR 9 R 10 , -(C=O)OR” 1 or -O(C=O)R", where R 8 Ga-NR 9 R 10 If G 3 is a C4-C6 alkylene; R9 and R 10 are each independently H or C1-C 12 is alkyl, R" is aralkyl; a, b, c, and d each independently represent an integer of 1 to 24, and x represents 0, 1, or 2; Each alkyl, alkylene, and aralkyl is optionally substituted.

[0344] Expression (AX) In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof, wherein: X and X' are each independently N or CR; Y and Y′ are each independently absent, —O(C═O)—, —(C═O)O—, or NR, with the proviso that a) when X is N, then Y is absent; b) when X' is N, then Y' is absent; c) when X is CR, Y is —O(C═O)—, —(C═O)O—, or NR; d) when X' is CR, Y' is -O(C=O)-, -(C=O)O- or NR; L 1 and L 1’ are each independently -O(C=O)R', -(C=O)OR', -C(=O)R', -OR 1 , -S(O) z R', -S-SR 1 , -C(=O)SR', -SC(=O)R', -NR a C(=O)R', -C(=O)NR b R c , -NR a C(=O)NR b R c , -OC(=O)NR b R c , or -NRa C(=O)OR', L 2 and L 2’ are each independently -O(C=O)R 2 , -(C=O)OR 2 , -C(=O)R 2 , -OR 2 , -S(O) z R 2 , -S-SR 2 , -C(=O)SR 2 , -SC(=O)R 2 , -NR d C(=O)R 2 , -C(=O)NR e R f , -NR d C(=O)NR e R f , -OC(=O)NR e R f , -NR d C(=O)OR 2 or R 2 is a direct bond to G 1 , G 1’ , G 2 and G 2’ are independently C2-C 12 Alkylene or C2-C 12 is alkenylene, G is C2-C 24 Heteroalkylene or C2-C 24 heteroalkenylene, R a , R b , R d and R e independently for each occurrence, H, C1-C 12 Alkyl or C2-C 12 is alkenyl, R c and R f independently for each occurrence, C1-C 12 Alkyl or C2-C 12 is alkenyl, R, independently at each occurrence, is H or C1-C 12 is alkyl, R1 and R 2 independently for each occurrence, branched C6-C 24 Alkyl or branched C6-C 24 is alkenyl, z is 0, 1, or 2, and each alkyl, alkenyl, alkylene, alkenylene, heteroalkylene, and heteroalkenylene is independently substituted or unsubstituted, unless otherwise specified.

[0345] Formula (AXI) In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof, wherein: L 1 is -O(C=O)R 1 , -(C=O)OR 1 , -C(=O)R 1 , -OR 1 , -S(O) x R 1 , -S-SR 1 , -C(=O)SR 1 , -SC(=O)R 1 , -NR a C(=O)R 1 , -C(=O)NR b R c , -NR a C(=O)NR b R c , -OC(=O)NR b R c , or -NR a C(=O)OR 1 and L 2 is -O(C=O)R 2 , -(C=O)OR 2 , -C(=O)R 2 , -OR 2 , -S(O) x R 2 , -S-SR 2 , -C(=O)SR 2 , -SC(=O)R2 , -NR d C(=O)R 2 , -C(=O)NR e R f , -NR d C(=O)NR e R f , -OC(=O)NR e R f , -NR d C(=O)OR 2 , or R 2 is a direct bond to G 1 and G 2 are independently C2-C 12 Alkylene or C2-C 12 is alkenylene, G 3 is C1-C 24 Alkylene, C2-C 24 alkenylene, C3-C8 cycloalkylene or C3-C8 cycloalkenylene; R a , R b , R d and R e are each independently H, C1-C 12 Alkyl or C1-C 12 is alkenyl, R c and R f are independently C1-C 12 Alkyl or C2-C 12 is alkenyl, R 1 and R 2 are each independently branched C6-C 24 Alkyl or branched C6-C 24 is alkenyl, R 3 is -N(R 4 )R 5 and R 4 is C1-C 12 is alkyl, R 5 is the substitution C1-C 12 is alkyl, x is 0, 1 or 2; Each alkyl, alkenyl, alkylene, alkenylene, cycloalkylene, cycloalkenylene, aryl, and aralkyl is independently substituted or unsubstituted, unless otherwise specified.

[0346] In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof, wherein: L 1 is -O(C=O)R 1 , -(C=O)OR 1 , -C(=O)R 1 , -OR 1 , -S(O) x R 1 , -S-SR 1 , -C(=O)SR 1 , -SC(=O)R 1 , -NR a C(=O)R 1 , -C(=O)NR b R c , -NR a C(=O)NR b R c , -OC(=O)NR b R c , or -NR a C(=O)OR 1 and L 2 is -O(C=O)R 2 , -(C=O)OR 2 , -C(=O)R 2 , -OR 2 , -S(O) x R 2 , -S-SR 2 , -C(=O)SR 2 , -SC(=O)R 2 , -NR d C(=O)R 2 , -C(=O)NR e R f , -NR d C(=O)NRe R f , -OC(=O)NR e R f , -NR d C(=O)OR 2 , or R 2 is a direct bond to G 1a and G 2b are independently C2-C 12 Alkylene or C2-C 12 is alkenylene, G 1b and G 2b are independently C1-C 12 Alkylene or C2-C 12 is alkenylene, G 3 is C1-C 24 Alkylene, C2-C 24 alkenylene, C3-C8 cycloalkylene or C3-C8 cycloalkenylene; R a , R b , R d and R e are each independently H, C1-C 12 Alkyl or C2-C 12 is alkenyl, R c and R f are independently C1-C 12 Alkyl or C2-C 12 is alkenyl, R 1 and R 2 are each independently branched C6-C 24 Alkyl or branched C6-C 24 is alkenyl, R 3a is -C(=O)N(R 4a )R 5a or -C(=O)OR 6 and R 3b is -NR 4b C(=O)R 5b and R 4a is C1-C12 is alkyl, R 4b is H, C1-C 12 Alkyl or C2-C 12 is alkenyl, R 5a is H, C1-C8 alkyl or C2-C8 alkenyl, R 4b If is H, then R 5b is C2-C 12 Alkyl or C2-C 12 alkenyl, or R 4b is C1-C 12 Alkyl or C2-C 12 When R is alkenyl, 5b is C1-C 12 Alkyl or C2-C 12 is alkenyl, R 6 is H, aryl or aralkyl, x is 0, 1 or 2; Each alkyl, alkenyl, alkylene, alkenylene, cycloalkylene, cycloalkenylene, aryl, and aralkyl is independently substituted or unsubstituted.

[0347] Formula (AXII) In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof, wherein: G 1 -OH, -R 3 R 4 , -(C=O)R 5 or -R 3 (C=O)R 5 and G 2 is -CH2- or -(C=O)-, R is, independently at each occurrence, H or OH; R 1 and R2 each independently represents an optionally substituted branched saturated or unsaturated C 12 -C 36 is alkyl, R 3 and R 4 are each independently H or an optionally substituted linear or branched, saturated or unsaturated C1-C6 alkyl; R 5 is an optionally substituted linear or branched, saturated or unsaturated C1-C6 alkyl; n is an integer of 2 to 6.

[0348] Formula (AXIII) In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof, wherein: G 1 or G 2 One of the following is selected for each occurrence: -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O), -SS-, -C(=O)S-, SC(=O)-, -N(R a )C(=O)-, -C(=O)N(R a )-, -N(R a )C(=O)N(R a )-, -OC(=O)N(R a )-, or -N(R a )C(=O)O-, and G 1 or G 2 and the other of each occurrence is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O), -SS-, -C(=O)S-, -SC(=O)-, -N(R a )C(=O)-, -C(=O)N(R a )-, -N(R a )C(=O)N(R a )-, -OC(=O)N(R a )- or -N(R a)C(=O)O- or a direct bond; Each L is ~O(C=O)-, where ~ represents a covalent bond to X; X is CR a and When n is 1, Z is an alkyl, cycloalkyl, or monovalent moiety containing at least one polar functional group, or when n is greater than 1, Z is an alkylene, cycloalkylene, or polyvalent moiety containing at least one polar functional group; R a independently for each occurrence, H, C1-C 12 Alkyl, C1-C 12 Hydroxyalkyl, C1-C 12 Aminoalkyl, C1-C 12 Alkylaminylalkyl, C1-C 12 Alkoxyalkyl, C1-C 12 Alkoxycarbonyl, C1-C 12 Alkylcarbonyloxy, C1-C 12 Alkylcarbonyloxyalkyl or C1-C 12 is alkylcarbonyl, R, independently at each occurrence, is: (a) H or C1-C 12 alkyl, or (b) R, together with the carbon atom to which it is bonded, forms a carbon-carbon double bond with an adjacent R and its bonded carbon atom; R 1 and R 2 each have the following structure: [ka] a 1 and a 2 are each independently an integer from 3 to 12, and b 1 and b 2 is independently 0 or 1 for each occurrence, c 1 and c2, independently at each occurrence, is an integer from 5 to 10; 1 and d 2is independently at each occurrence an integer from 5 to 10; y is independently at each occurrence an integer from 0 to 2; and n is an integer from 1 to 6; Each alkyl, alkylene, hydroxylalkyl, aminoalkyl, alkylaminylalkyl, alkoxyalkyl, alkoxycarbonyl, alkylcarbonyloxy, alkylcarbonyloxyalkyl, and alkylcarbonyl is optionally substituted with one or more substituents.

[0349] Formula (AXIV) In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof, wherein: L 1 or L 2 One of the groups is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O) x -, -SS-, -C(=O)S-, -SC(=O)-, -R a C(=O)-, -C(=O)R a -, R a C(=O)R a -, -OC(=O)R a -or-R a C(=O)O-, and L 1 or L 2 The other of the groups is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O) x -, -SS-, -C(=O)S-, SC(=O)-, -R a C(=O)-, -C(=O)R a -, R a C(=O)R a -, -OC(=O)R a -or-NR a C(=O)O- or a direct bond, G 1 and G 2 are each independently an unsubstituted C-C 12 Alkylene or C2-C12 is alkenylene, G 3 is C1-C 24 Alkylene, C1-C 24 alkenylene, C3-C8 cycloalkylene, C3-C8 cycloalkenylene; R a is H or C1-C 12 is alkyl, R 1 and R 2 are independently C6-C 24 Alkyl or C6-C 24 is alkenyl, R 3 H, OR 5 , CN, -C(=O)OR 4 , -OC(=O)R 4 or -R 5 C(=O)R 4 and R 4 is C1-C 12 is alkyl, R 5 is H or C1-C6 alkyl, x is 0, 1, or 2.

[0350] Formula (AXV) In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt, tautomer, prodrug, or stereoisomer thereof, wherein: L 1 and L 2 are each independently -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O) x -, -SS-, -C(=O)S-, -SC(=O)-, -R a C(=O)-, -C(=O)R a -, -R a C(=O)R a -, -OC(=O)R a -, -R aC(=O)O- or a direct bond, G 1 is C1-C2 alkylene, -(C=O)-, -O(C=O)-, -SC(=O)-, -R a C(=O)- or a direct bond, G 2 -C(=O)-, -(C=O)O-, -C(=O)S-, -C(=O)NR a - or a direct bond, G 3 is C1-C6 alkylene, R a is H or C1-C 12 is alkyl, R 1a and R 1b is, independently for each occurrence, (a) H or C1-C 12 alkyl, or (b) R 1a is H or C1-C 12 alkyl, and R 1b together with the carbon atom attached to it, the adjacent R 1b and together with the carbon atom attached thereto form a carbon-carbon double bond, R 2a and R 2b is, independently for each occurrence, (a) H or C1-C 12 alkyl, or (b) R 2a is H or C1-C 12 alkyl, and R 2b together with the carbon atom attached to it, the adjacent R 2b and together with the carbon atom attached thereto form a carbon-carbon double bond, R 3a and R 3b is, independently for each occurrence, (a) H or C1-C 12 alkyl, or (b) R 3a is H or C1-C 12 alkyl, and R 3btogether with the carbon atom bonded thereto, form a carbon-carbon double bond with the adjacent R and the carbon atom bonded thereto; R 4a and R 4b is, independently for each occurrence, (a) H or C1-C 12 alkyl, or (b) R 4a is H or C1-C 12 alkyl, and R 4b together with the carbon atom attached to it, the adjacent R 4b and together with the carbon atom attached thereto form a carbon-carbon double bond, R 5 and R 6 are each independently H or methyl; R 7 is C4-C 20 is alkyl, R 8 and R 9 are independently C1-C 12 alkyl or R 8 and R 9 together with the nitrogen atom to which they are attached form a 5-, 6- or 7-membered heterocyclic ring; a, b, c, and d each independently represent an integer of 1 to 24; x is 0, 1, or 2.

[0351] Formula (AXVI) In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt, tautomer, prodrug, or stereoisomer thereof, wherein: L 1 and L 2 are each independently —O(C═O)—, —(C═O)O—, or a carbon-carbon double bond; R 1a and R 1bis, independently for each occurrence, (a) H or C1-C 12 alkyl, or (b) R 1a is H or C1-C 12 alkyl, and R 1b together with the carbon atom attached to it, the adjacent R 1b and together with the carbon atom attached thereto form a carbon-carbon double bond, R 2a and R 2b is, independently for each occurrence, (a) H or C1-C 12 alkyl, or (b) R 2a is H or C1-C 12 alkyl, and R 2b together with the carbon atom attached to it, the adjacent R 2b and together with the carbon atom attached thereto form a carbon-carbon double bond, R 3a and R 3b is, independently for each occurrence, (a) H or C1-C 12 alkyl, or (b) R 3a is H or C1-C 12 alkyl, and R 3b together with the carbon atom attached to it, the adjacent R 3b and together with the carbon atom attached thereto form a carbon-carbon double bond, R 4a and R 4b is, independently for each occurrence, (a) H or C1-C 12 alkyl, or (b) R 4a is H or C1-C 12 alkyl, and R 4b together with the carbon atom attached to it, the adjacent R 4b and together with the carbon atom attached thereto form a carbon-carbon double bond, R 5 and R 6 are each independently methyl or cycloalkyl; R 7 is independently H or C1-C for each occurrence 12 alkyl, and R 8 and R 9 are each independently unsubstituted C-C 12 alkyl or R 8 and R 9 together with the nitrogen atom to which they are attached form a 5-, 6- or 7-membered heterocyclic ring containing one nitrogen atom; a and d each independently represent an integer of 0 to 24, b and c each independently represent an integer of 1 to 24, and e is 1 or 2; however, R 1a , R 2a , R 3a Or R 4a At least one of the following is C1-C 12 alkyl or L 1 Or L 2 at least one of is -O(C=O)- or -(C=O)O-; R 1a and R 1b is not isopropyl when a is 6 or n-butyl when a is 8.

[0352] Formula (AXVII) In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt thereof, wherein: R1 and R2 are the same or different and each represents a linear or branched alkyl having 1 to 9 carbon atoms, or an alkenyl or alkynyl having 2 to 11 carbon atoms; L1 and L2 are the same or different and each is a linear alkyl group having 5 to 18 carbon atoms or forms a heterocycle together with N; X1 is a bond or -CG-G- to form L2-CO-O-R2; X2 is S or O; L3 is a bond or lower alkyl, or forms a heterocycle together with N; R3 is lower alkyl, R4 and R5 are the same or different and are each lower alkyl.

[0353] Compounds (A1)~(A11) In some embodiments, the lipid nanoparticles comprise an ionizable lipid having the following structure: [ka] or a pharmaceutically acceptable salt thereof.

[0354] In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt thereof.

[0355] In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt thereof.

[0356] In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt thereof.

[0357] In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt thereof.

[0358] In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt thereof.

[0359] In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt thereof.

[0360] In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt thereof.

[0361] In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt thereof.

[0362] In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt thereof.

[0363] In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt thereof.

[0364] Non-cationic lipids In certain embodiments, the lipid nanoparticles described herein comprise one or more non-cationic lipids. The non-cationic lipids may be phospholipids.

[0365] In some embodiments, the lipid nanoparticles comprise 5-25 mol% non-cationic lipids. For example, the lipid nanoparticles may comprise 5-20 mol%, 5-15 mol%, 5-10 mol%, 10-25 mol%, 10-20 mol%, 10-25 mol%, 15-25 mol%, 15-20 mol%, or 20-25 mol% non-cationic lipids. In some embodiments, the lipid nanoparticles comprise 5 mol%, 10 mol%, 15 mol%, 20 mol%, or 25 mol% non-cationic lipids.

[0366] In some embodiments, the non-cationic lipids of the present disclosure are 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dilinoleo ... 1-Oleoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME16.0PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3 -phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), sphingomyelin, or a mixture thereof.

[0367] In some embodiments, the lipid nanoparticles contain 5-15 mol%, 5-10 mol%, or 10-15 mol% DSPC. For example, the lipid nanoparticles may contain 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mol% DSPC.

[0368] In certain embodiments, the lipid composition of the lipid nanoparticle compositions disclosed herein may comprise one or more phospholipids, such as one or more saturated or (poly)unsaturated phospholipids, or a combination thereof. Generally, a phospholipid comprises a phospholipid moiety and one or more fatty acid moieties.

[0369] The phospholipid moiety can be selected, for example, from the non-limiting group consisting of phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylserine, phosphatidic acid, 2-lysophosphatidylcholine, and sphingomyelin.

[0370] The fatty acid moiety may be selected from the non-limiting group consisting of, for example, lauric acid, myristic acid, myristoleic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, erucic acid, phytanic acid, arachidic acid, arachidonic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid, and docosahexaenoic acid.

[0371] Certain phospholipids can promote fusion with membranes.For example, cationic phospholipids can interact with one or more negatively charged phospholipids in membranes (for example, cell membranes or intracellular membranes).By fusion of phospholipids with membranes, one or more components (for example, therapeutic agents) of lipid-containing compositions (for example, LNPs) can pass through the membrane, and for example, one or more components can be delivered to target tissues.

[0372] Non-natural phospholipid species are also contemplated, including natural species with modifications and substitutions, including branching, oxidation, cyclization, and alkynes. For example, phospholipids can be functionalized or crosslinked with one or more alkynes (e.g., alkenyl groups in which one or more double bonds are replaced with triple bonds). Under appropriate reaction conditions, alkyne groups can undergo copper-catalyzed cycloaddition when exposed to azides. Such reactions can be useful for functionalizing the lipid bilayer of nanoparticle compositions to promote membrane penetration or cell recognition, or for conjugating nanoparticle compositions to useful components such as targeting or imaging moieties (e.g., dyes).

[0373] Phospholipids include, but are not limited to, glycerophospholipids such as phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidylglycerol, and phosphatidic acid. Phospholipids also include phosphosphingolipids, such as sphingomyelin.

[0374] In some embodiments, the phospholipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1 , 2-Dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-Diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-Palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-Di-O-Octadecenyl-sn-glycero-3-phosphocholine (18:0 diether PC), 1-Oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-Hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME16.0PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3 -phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), sphingomyelin, or a mixture thereof.

[0375] Expression (HI) In certain embodiments, the phospholipid is an analog or variant of DSPC. In certain embodiments, the phospholipid has the formula (HI): [ka] or a salt thereof, wherein Each R 1 are independently optionally substituted alkyl, or optionally, two R 1 are joined together with the intervening atoms to form an optionally substituted monocyclic carbocyclyl or an optionally substituted monocyclic heterocyclyl, or optionally, three R 1 are joined together with the intervening atoms to form an optionally substituted bicyclic carbocyclyl or an optionally substituted bicyclic heterocyclyl; n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; A is a group having the formula: [ka] It is of L 2 Each instance of is independently a bond or an optionally substituted C 1-6 alkylene, wherein optionally substituted C 1-6 One methylene unit of the alkylene is optionally O, N(R N ), S, C(O), C(O)N(R N ), NR N C(O), C(O)O, OC(O), OC(O)O, OC(O)N(R N ), NR N C(O)O, or NR N C(O)N(R N ) and R 2 Each instance of is independently an optionally substituted C 1-30 Alkyl, optionally substituted C 1-30 alkenyl, or optionally substituted C 1-30 alkynyl, and optionally R 2one or more methylene units of are independently an optionally substituted carbocyclylene, an optionally substituted heterocyclylene, an optionally substituted arylene, an optionally substituted heteroarylene, N(R N ), O, S, C(O), C(O)N(R N ), NR N C(O), NR N C(O)N(R N ), C(O)O, OC(O), OC(O)O, OC(O)N(R N ), NR N C(O)O, C(O)S, SC(O), C(=NR N ), C(=NR N )N(R N ), NR N C(=NR N ), NR N C(=NR N )N(R N ), C(S), C(S)N(R N ), NR N C(S), NR N C(S)N(R N ), S(O), OS(O), S(O)O, OS(O)O, OS(O)2, S(O)2O, OS(O)2O, N(R N )S(O), S(O)N(R N ), N(R N )S(O)N(R N ), OS(O)N(R N ), N(R N )S(O)O, S(O)2, N(R N )S(O)2, S(O)2N(R N ), N(R N )S(O)2N(R N ), OS(O)2N(R N ), or N(R N )S(O)2O, R N each instance of is independently hydrogen, optionally substituted alkyl, or a nitrogen protecting group; Ring B is an optionally substituted carbocyclyl, an optionally substituted heterocyclyl, an optionally substituted aryl, or an optionally substituted heteroaryl; p is 1 or 2.

[0376] In certain embodiments, the compound has the formula: [ka] (In the formula, R 2 and each instance of is independently an unsubstituted alkyl, an unsubstituted alkenyl, or an unsubstituted alkynyl.

[0377] In some embodiments, the phospholipid can be one or more of the phospholipids described in PCT Application No. PCT / US2018 / 037922.

[0378] In some embodiments, lipid nanoparticles comprise 5-25% non-cationic lipids by molar ratio relative to other lipid components. For example, lipid nanoparticles may comprise 5-30%, 5-15%, 5-10%, 10-25%, 10-20%, 10-25%, 15-25%, 15-20%, 20-25%, or 25-30% non-cationic lipids by molar ratio. In some embodiments, lipid nanoparticles comprise 5%, 10%, 15%, 20%, 25%, or 30% non-cationic lipids by molar ratio.

[0379] In some embodiments, lipid nanoparticles contain 5-25% phospholipids by molar ratio relative to other lipid components. For example, lipid nanoparticles may contain 5-30%, 5-15%, 5-10%, 10-25%, 10-20%, 10-25%, 15-25%, 15-20%, 20-25%, or 25-30% phospholipids by molar ratio. In some embodiments, lipid nanoparticles contain 5%, 10%, 15%, 20%, 25%, or 30% phospholipids by molar ratio.

[0380] structural lipids The lipid composition of the pharmaceutical composition disclosed herein can comprise one or more structured lipids. As used herein, the term "structured lipid" includes sterols and also includes lipids that contain sterol moieties.

[0381] Incorporating structured lipids into lipid nanoparticles may help reduce aggregation of other lipids within the particles. The structured lipids can be selected from the group including, but not limited to, cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, alpha-tocopherol, hopanoids, phytosterols, steroids, and mixtures thereof. In some embodiments, the structured lipid is a sterol. As defined herein, "sterol" is a subgroup of steroids consisting of steroid alcohols. In certain embodiments, the structured lipid is a steroid. In certain embodiments, the structured lipid is cholesterol. In certain embodiments, the structured lipid is a cholesterol analog. In certain embodiments, the structured lipid is alpha-tocopherol.

[0382] In some embodiments, the structured lipid can be one or more of the structured lipids described in US Application No. 16 / 493,814.

[0383] In some embodiments, lipid nanoparticles contain 25-55% structural lipids in a molar ratio relative to other lipid components. For example, the lipid nanoparticles may contain 10-55%, 25-50%, 25-45%, 25-40%, 25-35%, 25-30%, 30-55%, 30-50%, 30-45%, 30-40%, 30-35%, 35-55%, 35-50%, 35-45%, 35-40%, 40-55%, 40-50%, 40-45%, 45-55%, 45-50%, or 50-55% structural lipids. In some embodiments, lipid nanoparticles contain 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, or 55% structural lipids.

[0384] In some embodiments, the lipid nanoparticles comprise 30-45 mol% sterol, optionally 35-40 mol%, e.g., 30-31 mol%, 31-32 mol%, 32-33 mol%, 33-34 mol%, 34-35 mol%, 35-36 mol%, 36-37 mol%, 37-38 mol%, 38-39 mol%, or 39-40 mol% sterol. In some embodiments, the lipid nanoparticles comprise 25-55 mol% sterol. For example, the lipid nanoparticles may contain 25-50 mol%, 25-45 mol%, 25-40 mol%, 25-35 mol%, 25-30 mol%, 30-55 mol%, 30-50 mol%, 30-45 mol%, 30-40 mol%, 30-35 mol%, 35-55 mol%, 35-50 mol%, 35-45 mol%, 35-40 mol%, 40-55 mol%, 40-50 mol%, 40-45 mol%, 45-55 mol%, 45-50 mol%, or 50-55 mol% sterol. In some embodiments, the lipid nanoparticles contain 25 mol%, 30 mol%, 35 mol%, 40 mol%, 45 mol%, 50 mol%, or 55 mol% sterol.

[0385] In some embodiments, the lipid nanoparticles comprise 35-40 mol% cholesterol, for example, the lipid nanoparticles may comprise 35, 35.5, 36, 36.5, 37, 37.5, 38, 38.5, 39, 39.5, or 40 mol% cholesterol.

[0386] Polyethylene glycol (PEG)-lipids The lipid composition of the pharmaceutical compositions disclosed herein may include one or more polyethylene glycol (PEG) lipids.

[0387] As used herein, the term "PEG-lipid" or "PEG-modified lipid" refers to a polyethylene glycol (PEG)-modified lipid. Non-limiting examples of PEG-lipids include PEG-modified phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugates (e.g., PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamine, and PEG-modified 1,2-diacyloxypropan-3-amine. Such lipids are also called PEGylated lipids. For example, the PEG lipid can be a lipid called PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or PEG-DSPE.

[0388] In some embodiments, PEG lipids include, but are not limited to, 1,2-dimyristoyl-sn-glycerol methoxypolyethylene glycol (PEG-DMG), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)] (PEG-DSPE), PEG-disterylglycerol (PEG-DSG), PEG-dipalmetoleyl, PEG-dioleyl, PEG-distearyl, PEG-diacylglycamide (PEG-DAG), PEG-dipalmitoylphosphatidylethanolamine (PEG-DPPE), or PEG-1,2-dimyristyloxypropyl-3-amine (PEG-c-DMA).

[0389] In some embodiments, the PEG-lipid is selected from the group consisting of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and mixtures thereof. In some embodiments, the PEG-modified lipid is PEG-DMG, PEG-c-DOMG (also referred to as PEG-DOMG), PEG-DSG, and / or PEG-DPG.

[0390] In some embodiments, the lipid portion of the PEG-lipid comprises a PEG-lipid having a molecular weight of about C 14 ~About C22 , preferably about C 14 ~About C 16 In some embodiments, the PEG moiety, e.g., mPEG-NH2, has a size of about 1000, 2000, 5000, 10,000, 15,000, or 20,000 daltons. In some embodiments, the PEG lipid is PEG 2k -DMG.

[0391] In some embodiments, the lipid nanoparticles described herein can include a PEG-lipid that is a non-diffusible PEG. Non-limiting examples of non-diffusible PEGs include PEG-DSG and PEG-DSPE.

[0392] PEG lipids are known in the art, for example, those described in U.S. Pat. No. 8,158,601 and International Publication No. WO2015 / 130584A2.

[0393] Generally, some of the other lipid components (e.g., PEG lipids) of the various formulas described herein can be synthesized as described in International Patent Application No. PCT / US2016 / 000129, filed December 10, 2016, entitled "Compositions and Methods for Delivery of Therapeutic Agents," which is incorporated by reference in its entirety.

[0394] The lipid component of the lipid nanoparticle composition may include one or more molecules containing polyethylene glycol, such as PEG, or a PEG-modified lipid. Such species may alternatively be referred to as PEGylated lipids. The PEG lipid is a lipid modified with polyethylene glycol. The PEG lipid may be selected from the non-limiting group including PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and mixtures thereof. For example, the PEG lipid may be a lipid called PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or PEG-DSPE.

[0395] In some embodiments, the PEG-modified lipid is a modified PEG DMG. PEG-DMG has the following structure: [ka]

[0396] In some embodiments, the PEG lipid may be a PEGylated lipid described in International Publication No. WO2012099755 (the contents of which are incorporated herein by reference in their entirety). Any of these exemplary PEG lipids described herein may be modified to include a hydroxyl group on the PEG chain. In certain embodiments, the PEG lipid is a PEG-OH lipid. As generally defined herein, a "PEG-OH lipid" (also referred to herein as a "hydroxy-PEGylated lipid") is a PEGylated lipid having one or more hydroxyl (-OH) groups on the lipid. In certain embodiments, the PEG-OH lipid includes one or more hydroxyl groups on the PEG chain. In certain embodiments, the PEG-OH lipid, i.e., the hydroxy-PEGylated lipid, includes an -OH group at the end of its PEG chain. Each possibility represents a separate embodiment.

[0397] Formula (PI) In certain embodiments, the PEG lipid has the formula (PI): [ka] or a salt thereof, wherein R 3 -OR O and R O is hydrogen, an optionally substituted alkyl, or an oxygen protecting group; r is an integer between 1 and 100, inclusive; L 1 is an optionally substituted C 1-10 alkylene and optionally substituted C 1-10 At least one methylene of the alkylene is independently selected from optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, O, N(R N ), S, C(O), C(O)N(R N ), NR N C(O), C(O)O, OC(O), OC(O)O, OC(O)N(R N ), NR N C(O)O, or NR N C(O)N(R N ) and D is a moiety obtained by click chemistry or a moiety that is cleavable under physiological conditions; m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; A is a group having the formula: [ka] It is of L 2 Each instance of is independently a bond or an optionally substituted C 1-6 alkylene, wherein optionally substituted C 1-6 One methylene unit of the alkylene is optionally O, N(R N ), S, C(O), C(O)N(R N ), NR N C(O), C(O)O, OC(O), OC(O)O, OC(O)N(RN ), NR N C(O)O, or NR N C(O)N(R N ) and R 2 Each instance of is independently an optionally substituted C 1-30 Alkyl, optionally substituted C 1-30 alkenyl, or optionally substituted C 1-30 alkynyl, and optionally R 2 one or more methylene units of are independently an optionally substituted carbocyclylene, an optionally substituted heterocyclylene, an optionally substituted arylene, an optionally substituted heteroarylene, N(R N ), O, S, C(O), C(O)N(R N ), NR N C(O), NR N C(O)N(R N ), C(O)O, OC(O), OC(O)O, OC(O)N(R N ), NR N C(O)O, C(O)S, SC(O), C(=NR N ), C(=NR N )N(R N ), NR N C(=NR N ), NR N C(=NR N )N(R N ), C(S), C(S)N(R N ), NR N C(S), NR N C(S)N(R N ), S(O), OS(O), S(O)O, OS(O)O, OS(O)2, S(O)2O, OS(O)2O, N(R N )S(O), S(O)N(R N ), N(R N )S(O)N(R N ), OS(O)N(R N ), N(R N )S(O)O, S(O)2, N(R N )S(O)2, S(O)2N(R N ), N(R N )S(O)2N(RN ), OS(O)2N(R N ), or N(R N )S(O)2O, R N each instance of is independently hydrogen, optionally substituted alkyl, or a nitrogen protecting group; Ring B is an optionally substituted carbocyclyl, an optionally substituted heterocyclyl, an optionally substituted aryl, or an optionally substituted heteroaryl; p is 1 or 2.

[0398] In certain embodiments, the compound of formula (PI) is a PEG-OH lipid (i.e., R 3 HA-OR O and RO is hydrogen). In certain embodiments, the compound of formula (PI) has the formula (PI-OH): [ka] or a salt thereof.

[0399] Formula (PII) In certain embodiments, the PEG lipid is a PEGylated fatty acid. In certain embodiments, the PEG lipid is a compound of formula (PII). In some embodiments, the compound of formula (PII) is the following formula: [ka] or a salt thereof, wherein R 3 -OR O and R O is hydrogen, an optionally substituted alkyl, or an oxygen protecting group; r is an integer between 1 and 100, inclusive; R 5 is an arbitrarily substituted C 10-40 Alkyl, optionally substituted C 10-40 alkenyl, or optionally substituted C 10-40 alkynyl, and optionally R5 One or more methylene groups in the formula (I) are optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(R N ), O, S, C(O), C(O)N(R N ), NR N C(O), NR N C(O)N(R N ), C(O)O, OC(O), OC(O)O, OC(O)N(R N ), NR N C(O)O, C(O)S, SC(O), C(=NR N ), C(=NR N )N(R N ), NR N C(=NR N ), NR N C(=NR N )N(R N ), C(S), C(S)N(R N ), NR N C(S), NR N C(S)N(R N ), S(O), OS(O), S(O)O, OS(O)O, OS(O)2, S(O)2O, OS(O)2O, N(R N )S(O), S(O)N(R N ), N(R N )S(O)N(R N ), OS(O)N(R N ), N(R N )S(O)O, S(O)2, N(R N )S(O)2, S(O)2N(R N ), N(R N )S(O)2N(R N ), OS(O)2N(R N ), or N(R N )S(O)2O, R N Each instance of is independently hydrogen, optionally substituted alkyl, or a nitrogen protecting group.

[0400] In certain embodiments, the compound of formula (PII) has the formula (PII-OH): [ka] or a salt thereof. In some embodiments, r is 40-50.

[0401] In yet another embodiment, the compound of formula (PII) is [ka] or a salt thereof.

[0402] In some embodiments, the compound of formula (PII) is [ka] is.

[0403] In some embodiments, the lipid composition of the pharmaceutical compositions disclosed herein does not comprise a PEG-lipid.

[0404] In some embodiments, the PEG-lipid can be one or more of the PEG-lipids described in US Application No. US 15 / 674,872.

[0405] In some embodiments, the lipid nanoparticles comprise 0.5-15% PEG-lipid molar ratio relative to other lipid components. For example, the lipid nanoparticles may comprise 0.5-10%, 0.5-5%, 1-15%, 1-10%, 1-5%, 2-15%, 2-10%, 2-5%, 5-15%, 5-10%, or 10-15% PEG-lipid molar ratio. In some embodiments, the lipid nanoparticles comprise 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, or 15% PEG-lipid molar ratio.

[0406] In some embodiments, the lipid nanoparticles contain 1-5%, optionally 1-3 mol%, e.g., 1.5-2.5 mol%, 1-2 mol%, 2-3 mol%, 3-4 mol%, or 4-5 mol%, of PEG-modified lipids. In some embodiments, the lipid nanoparticles contain 0.5-15 mol% of PEG-modified lipids. For example, the lipid nanoparticles contain 5-10 mol%, 0.5-5 mol%, 1-15 mol%, 1-10 mol%, 1-5 mol%, 2-15 mol%, 2-10 mol%, 2-5 mol%, 5-15 mol%, 5-10 mol%, or 10-15 mol%. In some embodiments, the lipid nanoparticles comprise 0.5 mol%, 1 mol%, 2 mol%, 3 mol%, 4 mol%, 5 mol%, 6 mol%, 7 mol%, 8 mol%, 9 mol%, 10 mol%, 11 mol%, 12 mol%, 13 mol%, 14 mol%, or 15 mol% PEG-modified lipids.

[0407] Some embodiments include adding PEG to a composition comprising LNPs encapsulating nucleic acids (e.g., one that already contains PEG in the amounts listed above). In embodiments, this includes adding about 0.5 mol% or more of PEG, e.g., about 1 mol%, about 1.5 mol%, about 2 mol%, about 2.5 mol%, about 3 mol%, about 3.5 mol%, about 4 mol%, about 5 mol%, or more, to the LNP composition after formation (e.g., one that already contains PEG in the amounts listed elsewhere herein).

[0408] In some embodiments, the lipid nanoparticles comprise 20-60 mol % ionizable amino lipid, 5-25 mol % non-cationic lipid, 25-55 mol % sterol, and 0.5-15 mol % PEG-modified lipid.

[0409] In some embodiments, the LNPs of the present disclosure comprise an ionizable amino lipid of Compound 1, where the non-cationic lipid is DSPC, the structural lipid is cholesterol, and the PEG lipid is DMG-PEG.

[0410] In some embodiments, the LNPs of the present disclosure comprise an ionizable amino lipid of Compound 2, where the non-cationic lipid is DSPC, the structural lipid is cholesterol, and the PEG lipid is DMG-PEG.

[0411] In some embodiments, the LNP comprises an ionizable amino lipid of any of formula (AIII), (AIV), or (AV), a phospholipid comprising DSPC, a structural lipid, and a PEG lipid comprising PEG-DMG.

[0412] In some embodiments, the LNP comprises an ionizable amino lipid of any of formula (AIII), (AIV), or (AV), a phospholipid comprising DSPC, a structural lipid, and a PEG lipid comprising a compound having formula (PII).

[0413] In some embodiments, the LNP comprises an ionizable amino lipid of formula (AIII), (AIV), or (AV), a phospholipid comprising a compound having formula (HI), a structural lipid, and a PEG lipid comprising a compound having formula (PI) or (PII).

[0414] In some embodiments, the LNP comprises an ionizable amino lipid of formula (AIII), (AIV), or (AV), a phospholipid comprising a compound having formula (HI), a structural lipid, and a PEG lipid comprising a compound having formula (PI) or (PII).

[0415] In some embodiments, the LNP comprises an ionizable amino lipid of formula (AIII), (AIV), or (AV), a phospholipid having formula (HI), a structural lipid, and a PEG-lipid comprising a compound having formula (PII).

[0416] In some embodiments, the lipid nanoparticles comprise 49 mol% ionizable amino lipid, 10 mol% DSPC, 38.5 mol% cholesterol, and 2.5 mol% DMG-PEG.

[0417] In some embodiments, the lipid nanoparticles comprise 49 mol% ionizable amino lipid, 11 mol% DSPC, 38.5 mol% cholesterol, and 1.5 mol% DMG-PEG.

[0418] In some embodiments, the lipid nanoparticles comprise 48 mol% ionizable amino lipid, 11 mol% DSPC, 38.5 mol% cholesterol, and 2.5 mol% DMG-PEG.

[0419] In some embodiments, the LNPs are comprised of an N:P ratio of about 2:1 to about 30:1.

[0420] In some embodiments, the LNPs are composed of an N:P ratio of about 6:1.

[0421] In some embodiments, the LNPs are composed of an N:P ratio of about 3:1, 4:1, or 5:1.

[0422] In some embodiments, the LNPs are comprised of a weight / weight ratio of ionizable amino lipid components to mRNA of about 10:1 to about 100:1.

[0423] In some embodiments, the LNPs are composed of a weight / weight ratio of ionizable amino lipid components to RNA of about 20:1.

[0424] In some embodiments, the LNPs are composed of about a 10:1 weight / weight ratio of ionizable amino lipid components to RNA.

[0425] Some embodiments include compositions having one or more LNPs with a diameter of about 150 nm or less, e.g., about 140 nm, 130 nm, 120 nm, 110 nm, 100 nm, 90 nm, 80 nm, 70 nm, 60 nm, 50 nm, 40 nm, 30 nm, or 20 nm or less. Some embodiments include compositions having an average LNP diameter of about 150 nm or less, e.g., about 140 nm, 130 nm, 120 nm, 110 nm, 100 nm, 90 nm, 80 nm, 70 nm, 60 nm, 50 nm, 40 nm, 30 nm, or 20 nm or less. In some embodiments, the compositions have an average LNP diameter of about 30 nm to about 150 nm, or an average diameter of about 60 nm to about 120 nm.

[0426] LNPs may comprise one or more types of lipids, including but not limited to, amino lipids (e.g., ionizable amino lipids), neutral lipids, non-cationic lipids, charged lipids, PEG-modified lipids, phospholipids, structured lipids, and sterols. In some embodiments, LNPs may further comprise one or more cargo molecules, including but not limited to, nucleic acids, plasmid DNA, DNA or RNA oligonucleotides, siRNA, shRNA, snRNA, snoRNA, lncRNA, etc., small molecules, proteins, and peptides.

[0427] In some embodiments, the composition comprises a liposome. A liposome is a lipid particle comprising lipids arranged in one or more concentric lipid bilayers around a central region. The central region of the liposome may comprise an aqueous solution, suspension, or other aqueous composition.

[0428] In some embodiments, lipid nanoparticles can comprise two or more components (e.g., amino lipids and nucleic acids, PEG-lipids, phospholipids, structured lipids). For example, lipid nanoparticles can comprise amino lipids and nucleic acids. Compositions comprising lipid nanoparticles, such as those described herein, can be used in a wide variety of applications, including stealth delivery of therapeutic payloads with minimal adverse innate immune responses.

[0429] Effective in vivo delivery of nucleic acids represents an ongoing medical challenge. Exogenous nucleic acids (i.e., nucleic acids originating from outside a cell or organism) are easily degraded in the body, for example, by the immune system. Therefore, effective delivery of nucleic acids to cells often requires the use of particulate carriers (e.g., lipid nanoparticles). Particulate carriers must be formulated to minimize particle aggregation, be relatively stable prior to intracellular delivery, effectively deliver nucleic acids into cells, and not induce or minimize an immune response. To achieve minimal particle aggregation and stability prior to delivery, many conventional particulate carriers have relied on the presence and / or concentration of certain components (e.g., PEG-lipids). However, it has been found that certain components can reduce the stability of encapsulated nucleic acids (e.g., mRNA). Reduced stability can limit the broad applicability of particulate carriers. Therefore, there remains a need for methods to improve the stability of nucleic acids (e.g., mRNA) encapsulated in lipid nanoparticles.

[0430] In some embodiments, the lipid nanoparticles comprise one or more ionizable molecules, polynucleotides, and optional components such as structural lipids, sterols, neutral lipids, phospholipids, and molecules that can reduce particle aggregation (e.g., polyethylene glycol (PEG), PEG-modified lipids), such as those described above.

[0431] In some embodiments, the LNPs described herein can include one or more ionizable molecules (e.g., amino lipids or ionizable lipids). The ionizable molecules can include charged groups and have a certain pKa. In certain embodiments, the pKa of the ionizable molecules can be about 6 or greater, about 6.2 or greater, about 6.5 or greater, about 6.8 or greater, about 7 or greater, about 7.2 or greater, about 7.5 or greater, about 7.8 or greater, or about 8 or greater. In some embodiments, the pKa of the ionizable molecules can be about 10 or less, about 9.8 or less, about 9.5 or less, about 9.2 or less, about 9.0 or less, about 8.8 or less, or about 8.5 or less. Combinations of the above-referenced ranges are also possible (e.g., 6 or greater and about 8.5 or less). Other ranges are also possible. In embodiments in which two or more types of ionizable molecules are present in the particle, each type of ionizable molecule can independently have a pKa in one or more of the above ranges.

[0432] Generally, ionizable molecules contain one or more charged groups. In some embodiments, ionizable molecules can be positively or negatively charged. For example, ionizable molecules can be positively charged. For example, ionizable molecules can contain amine groups. As used herein, the term "ionizable lipid" has its ordinary meaning in the art and may refer to a molecule or matrix containing one or more charged moieties. As used herein, a "charged moiety" is a chemical moiety that has a formal charge, such as a monovalent (+1 or -1), divalent (+2 or -2), trivalent (+3 or -3), etc. charge. The charged moiety can be anionic (i.e., negatively charged) or cationic (i.e., positively charged). Examples of positively charged moieties include amine groups (e.g., primary amines, secondary amines, and / or tertiary amines), ammonium groups, pyridinium groups, guanidine groups, and imidazolium groups. In certain embodiments, the charged moiety comprises an amine group. Examples of negatively charged groups or precursors thereof include carboxylate groups, sulfonate groups, sulfate groups, phosphonate groups, phosphate groups, hydroxyl groups, etc. The charge of the charged moiety may in some cases be altered by environmental conditions; for example, a change in pH may change the charge of the moiety and / or cause the moiety to become charged or uncharged. In general, the charge density of the molecule and / or matrix may be selected as desired.

[0433] In some cases, an ionizable molecule (e.g., an amino lipid or an ionizable lipid) may contain one or more precursor moieties that can be converted into a charged moiety. For example, an ionizable molecule may contain a neutral moiety, such as those described above, that can be hydrolyzed to form a charged moiety. As a non-limiting specific example, a molecule or matrix may each contain an amide that can be hydrolyzed to form an amine. Those skilled in the art can determine whether a given chemical moiety possesses a formal electronic charge (e.g., by inspection, pH titration, ionic conductivity measurement, etc.) and / or whether a given chemical moiety reacts (e.g., is hydrolyzed) to form a chemical moiety with a formal electronic charge.

[0434] Ionizable molecule (for example, aminolipid or ionizable lipid) can have any suitable molecular weight.In certain embodiments, the molecular weight of ionizable molecule is about 2,500g / mol or less, about 2,000g / mol or less, about 1,500g / mol or less, about 1,250g / mol or less, about 1,000g / mol or less, about 900g / mol or less, about 800g / mol or less, about 700g / mol or less, about 600g / mol or less, about 500g / mol or less, about 400g / mol or less, about 300g / mol or less, about 200g / mol or less or about 100g / mol or less. In some cases, the molecular weight of the ionizable molecule is about 100 g / mol or more, about 200 g / mol or more, about 300 g / mol or more, about 400 g / mol or more, about 500 g / mol or more, about 600 g / mol or more, about 700 g / mol or more, about 1000 g / mol or more, about 1,250 g / mol or more, about 1,500 g / mol or more, about 1,750 g / mol or more, about 2,000 g / mol or more, or about 2,250 g / mol or more. Combinations of the above ranges are also possible (e.g., at least about 200 g / mol and up to about 2,500 g / mol). In embodiments in which more than one type of ionizable molecule is present in the particle, each type of ionizable molecule can independently have a molecular weight in one or more of the above ranges.

[0435] In some embodiments, the percentage (e.g., by weight or by molar basis) of a single type of ionizable molecule (e.g., amino lipid or ionizable lipid) and / or all ionizable molecules within the particle can be about 15% or more, about 16% or more, about 17% or more, about 18% or more, about 19% or more, about 20% or more, about 21% or more, about 22% or more, about 23% or more, about 24% or more, about 25% or more, about 30% or more, about 35% or more, about 40% or more, about 42% or more, about 45% or more, about 48% or more, about 50% or more, about 52% or more, about 55% or more, about 58% or more, about 60% or more, about 62% or more, about 65% or more, or about 68% or more. In some cases, this percentage (e.g., by weight or by molar basis) can be about 70% or less, about 68% or less, about 65% or less, about 62% or less, about 60% or less, about 58% or less, about 55% or less, about 52% or less, about 50% or less, or about 48% or less. Combinations of the above-referenced ranges are also possible (e.g., 20% or more and about 60% or less, 40% or more and about 55% or less, etc.). In embodiments in which two or more types of ionizable molecules are present in the particles, each type of ionizable molecule can independently have one or more percentages (e.g., by weight or by molar basis) in the above ranges. This percentage (e.g., by weight or by molar basis) can be determined by extracting the ionizable molecule(s) from the dried particles using, for example, an organic solvent and measuring the amount of the material using high-pressure liquid chromatography (i.e., HPLC), liquid chromatography-mass spectrometry (LC-MS), nuclear magnetic resonance (NMR), or mass spectrometry (MS). Those skilled in the art will be familiar with techniques for determining the amount of a component using the techniques referenced above. For example, HPLC can be used to quantify the amount of a component, for example, by comparing the area under the curve of the HPLC chromatogram to a standard curve.

[0436] It should be understood that the terms "charged" or "charged moiety" do not refer to a "partial negative charge" or a "partial positive charge" on a molecule. "Partial negative charge" and "partial positive charge" are given their ordinary meaning in the art. A "partial negative charge" can arise when a functional group contains a polar bond such that electron density is attracted to one of the atoms of that bond, creating a partial negative charge on that atom. Those skilled in the art will generally recognize bonds that can be polarized in this way.

[0437] According to the disclosure herein, the lipid composition can include one or more lipids described herein, including those described above or known in the art as useful in preparing lipid nanoparticle formulations.

[0438] stabilizing compounds Some embodiments of the compositions described herein are stabilized pharmaceutical compositions. Various non-viral delivery systems, including nanoparticle formulations, offer attractive opportunities to overcome many of the challenges associated with mRNA delivery. Lipid nanoparticles (LNPs) have attracted particular attention in recent years, as various LNP formulations have shown promise in a variety of pharmaceutical applications. However, lipids have been shown to degrade nucleic acids, including mRNA, and lipid nanoparticle formulations rapidly lose purity when stored as refrigerated liquids. Furthermore, the storage stability of mRNA encapsulated within LNPs is lower than that of unencapsulated mRNA.

[0439] A class of compounds has been found to stabilize nucleic acids within lipid carriers such as LNPs, an unexpected and unprecedented discovery that enables applications including extended refrigerated liquid shelf life, extended use periods at room temperature, and extended in-use stability at physiological temperatures up to elevated temperatures such as 40° C. Such stabilizing compounds solve a significant problem, as current manufacturing processes and formulations experience a 5-10% loss of purity during LNP formation and processing that is typical of current large-scale LNP production.

[0440] In some embodiments, the stabilized pharmaceutical composition comprises a nucleic acid formulation comprising a nucleic acid and a stabilizing compound (e.g., a compound of Formula (I), a compound of Formula (II), or a tautomer or solvate thereof). In some embodiments, the stabilized pharmaceutical composition comprises a nucleic acid formulation comprising a nucleic acid, a lipid, and a stabilizing compound represented by Formula (I): [ka] or a tautomer or solvate thereof, wherein: [ka] is a single or double bond, R 1 is H and R 2 is OCH3 or R 3 Together with OCH2O, R 3 is OCH3 or R 2 Together with OCH2O, R 4 is H and R 5 is H or OCH3, and R 6 is OCH3 and R 7 is H or OCH3, and R 8 is H and R 9 is H or CH3, and X is a pharmaceutically acceptable anion, for example, a halide such as chloride.

[0441] In some embodiments, the compound of formula (I) is [ka] or a tautomer or solvate thereof.

[0442] In some embodiments, the stabilized pharmaceutical composition comprises a nucleic acid, a lipid, and a compound of Formula (II): [ka] or a tautomer or solvate thereof, wherein: R10 is H and R 11 is H and R 12 is R 13 Together with OCH2O, R 14 is H and R 15 is R 16 Together with OCH2O, R 17 is H and X is a pharmaceutically acceptable anion, for example a halide such as chloride.

[0443] In some embodiments, the compound of formula (II) is [ka] or a tautomer or solvate thereof.

[0444] The stabilizing compounds of formula (I), (Ia), (Ib), (Ic), (II), and (IIa) are described in International Application No. PCT / US2022 / 025967, which is incorporated herein by reference in its entirety.

[0445] In some embodiments, the nucleic acid formulation comprises a lipid nanoparticle. In some embodiments, the nucleic acid is mRNA.

[0446] In some embodiments, the stabilized compound ("compound") has a purity of at least 70%, 80%, 90%, 95%, or 99%. In some embodiments, the compound contains less than 100 ppm of elemental metal. In some embodiments, the stabilized pharmaceutical composition ("composition") includes a pharmaceutically acceptable metal chelator, such as EDTA (ethylenediaminetetraacetic acid) or DTPA (diethylenetriaminepentaacetic acid).

[0447] In some embodiments, the composition is an aqueous solution. In some embodiments, the compound is present in the aqueous solution at a concentration of about 0.1 mM to about 10 mM. In some embodiments, the aqueous solution has a pH of about 5 to 8, including about pH 5, 5.5, 6, 6.5, 7, 7.5, or 8. In some embodiments, the aqueous solution does not contain NaCl. In some embodiments, the aqueous solution contains NaCl at a concentration of about 150 mM. In some embodiments, the aqueous solution contains a phosphate buffer, a Tris buffer, an acetate buffer, a histidine buffer, or a citrate buffer.

[0448] In some embodiments, the growth of microorganisms in the composition is inhibited by the compound.

[0449] In some embodiments, the composition is characterized by an mRNA purity level of greater than 60%, greater than 70%, greater than 80%, or greater than 90% main peak mRNA purity after at least 30 days of storage. In some embodiments, the composition comprises an mRNA purity level of greater than 50% main peak mRNA purity after at least 6 months of storage. In some embodiments, storage is at room temperature.

[0450] In some embodiments, the composition comprises lipid nanoparticles encapsulating mRNA, and the composition comprises less than 50%, less than 60%, less than 70%, less than 80%, less than 90%, or less than 95% RNA fragments after at least 30 days of storage. In some embodiments, the storage temperature is higher than room temperature. In some embodiments, the storage temperature is about 4°C.

[0451] In some embodiments, the compound interacts with nucleic acids contained within lipid nanostructures (e.g., lipid nanoparticles, liposomes, or lipoplexes), e.g., via pi-pi stacking and / or by altering the helicity of the nucleic acid backbone. In some embodiments, the compound intercalates with nucleic acids. In some embodiments, the compound binds to nucleic acids (e.g., reversibly binds and / or binds to strand regions of nucleic acids). In some embodiments, the compound self-associates and binds to nucleic acid ribose contacts and / or nucleobase contacts. In some embodiments, the compound does not substantially bind to phosphate contacts of nucleic acids. In some embodiments, the positive charge of the compound contributes to nucleic acid binding. In some embodiments, 10 -3 Less than M (e.g., 10 -4 Under M, 10 -5 Under M, 10 -5 Under M, 10 -7 Under M, 10 -8 Less than M or 10 -9 They interact with nucleic acids with a binding affinity defined by an equilibrium dissociation constant of less than M.

[0452] In some embodiments, the compound interacts with the nucleic acid, providing shielding from solvent, e.g., water. In some embodiments, the compound shields the ribose from solvent more than the compound shields the phosphate groups of the nucleic acid. In some embodiments, solvent exposure is measured by solvent accessible surface area (SASA). In some embodiments, the stabilizing compound reduces the solvent accessible surface area of ​​the ribose by about 5-10 nm 2 In some embodiments, the stabilizing compound reduces the solvent accessible surface area of ​​ribose to about 6-8 nm 2 In some embodiments, the stabilizing compound reduces the solvent accessible surface area of ​​phosphoric acid to about 9-12 nm 2 In some embodiments, the stabilizing compound reduces the solvent accessible surface area of ​​phosphoric acid to about 10-11 nm 2 Reduce to.

[0453] In some embodiments, a nucleic acid conformationally stabilized by a compound exhibits a higher thermal denaturation temperature (e.g., as measured by circular dichroism or DSC) than in the absence of the compound. In some embodiments, the compound confers increased stability, e.g., thermal stability, to the nucleic acid in its folded structure, e.g., compared to its unfolded, less folded, or more linear form. In some embodiments, the compound causes compaction of the nucleic acid when interacting with the nucleic acid. In some embodiments, the compound causes a decrease in the hydrodynamic radius of the nucleic acid molecule when interacting with the nucleic acid. In some embodiments, the stabilizing compound causes a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60% or more decrease in compaction or hydrodynamic radius of the nucleic acid molecule. In some embodiments, the stabilizing compound causes compaction or a decrease in hydrodynamic radius of a nucleic acid molecule when the compound is at a concentration of 1 μM, 2 μM, 3 μM, 4 μM, 5 μM, 6 μM, 7 μM, 8 μM, 9 μM, 10 μM, 15 μM, 20 μM, 25 μM, 30 μM, 35 μM, 40 μM, 45 μM, 50 μM, 60 μM, 70 μM, 80 μM, 90 μM, or 100 μM.

[0454] mRNA-lipid adducts It has been found that certain ionizable lipids are prone to form lipid-polynucleotide adducts.In particular, ionizable lipids containing tertiary amine groups can decompose into one or both of secondary amines and reactive aldehyde species that can interact with polynucleotides (such as mRNA), forming ionizable lipid-polynucleotide adduct impurities, which can be detected by reversed-phase ion-pair chromatography (RP-IP HPLC).For example, oxidation of tertiary amines can form N-oxides, which can undergo acid / base catalyzed hydrolysis at the amine to produce aldehydes and secondary amines that can form adducts with mRNA.Therefore, in some embodiments, the ionizable lipid-polynucleotide adduct impurities are aldehyde-mRNA adduct impurities.

[0455] It has also been found that such adducts can interfere with mRNA translation and affect the activity of mRNA products formulated in lipid nanoparticles (LNPs). Therefore, it may be advantageous to prepare and use LNP compositions with reduced levels of ionizable lipid-polynucleotide adduct impurities, for example, less than about 20%, less than about 10%, less than about 5%, or less than about 1% of the mRNA in the form of ionizable lipid-polynucleotide adduct impurities that can be measured by RP-IP HPLC. Thus, in some embodiments, LNP compositions are provided with less than about 10%, less than about 5%, or less than about 1% of the mRNA in the form of ionizable lipid-polynucleotide adduct impurities that can be measured by RP-IP HPLC, including less than 10%, less than 5%, or less than 1%.

[0456] In some embodiments, the amount of lipid aldehyde in the composition is less than about 50 ppm, including less than 50 ppm.In addition, or alternatively, in some embodiments, the amount of N-oxide compound in the composition is less than about 50 ppm, including less than 50 ppm.In addition, or alternatively, in some embodiments, the amount of transition metal, such as Fe, in the composition is less than about 50 ppm, including less than 50 ppm.In addition, or alternatively, in some embodiments, the amount of alkyl halide compound in the composition is less than about 50 ppm, including less than 50 ppm.In addition, or alternatively, in some embodiments, the amount of aldehyde compound in the composition is less than about 50 ppm, including less than 50 ppm.In addition, or alternatively, in some embodiments, the amount of ketone compound in the composition is less than about 50 ppm, including less than 50 ppm.In addition, or alternatively, in some embodiments, the amount of conjugated diene compound in the composition is less than about 50 ppm, including less than 50 ppm.

[0457] In some embodiments, the composition is stable against the formation of ionizable lipid-polynucleotide adduct impurities. In some embodiments, the amount of ionizable lipid-polynucleotide adduct impurities in the composition increases at an average rate of less than about 2% per day when stored at a temperature of about 25° C. or less, including an average rate of less than 2% per day. In some embodiments, the amount of ionizable lipid-polynucleotide adduct impurities in the composition increases at an average rate of less than about 0.5% per day when stored at a temperature of about 5° C. or less, including an average rate of less than 0.5% per day. In some embodiments, the amount of ionizable lipid-polynucleotide adduct impurities in the composition increases at an average rate of less than about 0.5% per day when stored at refrigerated temperatures, optionally about 5° C.

[0458] Lipid vehicle (e.g., LNP) compositions with reduced content of ionizable lipid-polynucleotide adduct impurities can be prepared by methods that inhibit the formation of either or both of N-oxides and aldehydes. Such methods can include treating a composition containing an ionizable lipid containing a tertiary amine group to inhibit the formation of either or both of N-oxides and aldehydes, for example, by treating the composition with a reducing agent, treating the composition with a chelating agent, adjusting the pH of the composition, adjusting the temperature of the composition, and adjusting a buffer in the composition. Such methods can include one or more of treating the ionizable lipid with a scavenger, treating the ionizable lipid with a reducing agent, treating the ionizable lipid with a chelating agent, treating the polynucleotide with a reducing agent, and treating the polynucleotide with a chelating agent prior to combining the ionizable lipid with the polynucleotide.

[0459] According to any of the above, the scavenger, reducing agent, and / or reducing agent may be an agent that reacts with an aldehyde, a ketone, an anhydride, and / or a diene compound. The scavenger may include one or more selected from (O-(2,3,4,5,6-pentafluorobenzyl)hydroxylamine hydrochloride) (PFBHA), methoxyamine (e.g., methoxyamine hydrochloride), benzyloxyamine (e.g., benzyloxyamine hydrochloride), ethoxyamine (e.g., ethoxyamine hydrochloride), 4-[2-(aminooxy)ethyl]morpholine dihydrochloride, butoxyamine (e.g., tert-butoxyamine hydrochloride), 4-dimethylaminopyridine (DMAP), 1,4-diazabicyclo[2.2.2]octane (DABCO), triethylamine (TEA), piperidine 4-carboxylate (BPPC), and combinations thereof. The reducing agent may include a boron compound (e.g., sodium borohydride and / or bis(pinacolato)diboron). The reducing agent may include a boron compound, such as one or both of sodium borohydride and bis(pinacolato)diboron. The chelating agent may include immobilized iminodiacetic acid. The reducing agent may include an immobilized reducing agent, such as silica-immobilized diphenylphosphine (Si-DPP), agarose-immobilized thiol (Ag-thiol), silica-immobilized cysteine ​​(Si-cysteine), silica-immobilized thiol (Si-thiol), or a combination thereof. The reducing agent may include a free reducing agent, such as potassium metabisulfite, sodium thioglycolate, tris(2-carboxyethyl)phosphine (TCEP), sodium thiosulfate, N-acetylcysteine, glutathione, dithiothreitol (DTT), cystamine, dithioerythritol (DTE), dichlorodiphenyltrichloroethane (DDT), homocysteine, lipoic acid, or a combination thereof.

[0460] According to any of the above, the pH may be or may be adjusted to a pH of about 7 to about 9.

[0461] According to any of the above, the buffer may be selected from sodium phosphate, sodium citrate, sodium succinate, histidine, histidine-HCl, sodium malate, sodium carbonate, and TRIS (tris(hydroxymethyl)aminomethane). According to any of the above, the buffer may be TRIS, or may be about 20 mM to about 150 mM TRIS or may be adjusted thereto.

[0462] According to any of the above, the temperature of the composition may be or may be adjusted to 25°C or below.

[0463] The composition may also include a free reducing agent or antioxidant.

[0464] Pharmaceutical preparations Provided herein are compositions (e.g., pharmaceutical compositions such as vaccines), methods, kits, and reagents for the prevention and / or treatment of EBV in, for example, humans and other mammals. In some embodiments, an EBV mRNA vaccine is administered to a subject to prevent EBV infection or a disease associated with EBV infection (e.g., infectious mononucleosis, nasopharyngeal carcinoma, Burkitt lymphoma, Hodgkin lymphoma, gastric cancer, post-transplant lymphoproliferative disease (PTLD), systemic lupus erythematosus, and / or multiple sclerosis). In some embodiments, an EBV mRNA vaccine is administered to a subject to treat EBV infection or a disease associated with EBV infection (e.g., infectious mononucleosis, nasopharyngeal carcinoma, Burkitt lymphoma, Hodgkin lymphoma, gastric cancer, post-transplant lymphoproliferative disease (PTLD), systemic lupus erythematosus, and / or multiple sclerosis). The vaccine compositions provided herein can be used as therapeutic or prophylactic agents. They may be used in medicine for the prevention and / or treatment of EBV infection or diseases associated with EBV infection.

[0465] In some embodiments, a vaccine composition containing the mRNA described herein can be administered to a subject (e.g., a mammalian subject, such as a human subject), and the mRNA is translated in vivo to produce an antigenic polypeptide (antigen).

[0466] An "effective amount" of a composition, such as an mRNA vaccine, is based, at least in part, on the target tissue, target cell type, means of administration, physical characteristics of the mRNA (e.g., length, nucleotide composition, and / or degree of nucleoside modification), other components of the vaccine, and other determinants, such as the subject's age, weight, height, sex, and overall health. Typically, an effective amount of a composition will result in an induced or enhanced immune response in response to antigen production in the subject's cells. In some embodiments, an effective amount of a composition comprising an mRNA with at least one chemical modification is more efficient than a composition comprising a corresponding unmodified polynucleotide encoding the same antigen or peptide antigen. Increased antigen production may be demonstrated by increased cell transfection (percentage of cells transfected with the mRNA vaccine), increased protein translation and / or expression from the polynucleotide, decreased nucleic acid degradation (e.g., as indicated by an increased duration of protein translation from the modified polynucleotide), or an altered antigen-specific immune response of the host cell.

[0467] The term "pharmaceutical composition" refers to a combination of an active agent (e.g., mRNA) and an inert or active carrier (e.g., a lipid composition, e.g., LNP), making the composition particularly suitable for in vivo or ex vivo diagnostic or therapeutic applications. A "pharmaceutically acceptable carrier" is one that does not cause undesirable physiological effects after or upon administration to a subject. A carrier in a pharmaceutical composition must also be "acceptable" in the sense that it may be compatible with and capable of stabilizing the active ingredient. One or more solubilizing agents may be utilized as pharmaceutical carriers for delivery of the active agent. Examples of pharmaceutically acceptable carriers include, but are not limited to, biocompatible vehicles, adjuvants, additives, and diluents to achieve a usable composition in dosage form. Other examples of carriers include colloidal silicon oxide, magnesium stearate, cellulose, and sodium lauryl sulfate. Additional suitable pharmaceutical carriers and diluents, as well as pharmaceutical requirements for their use, are described in Remington's Pharmaceutical Sciences.

[0468] In some embodiments, compositions according to the present disclosure (including polynucleotides and their encoded polypeptides) can be used to treat or prevent EBV infection. The compositions can be administered prophylactically as part of an active immunization scheme, or therapeutically, to healthy individuals or early in infection during the latency period or during active infection after symptom onset. In some embodiments, the amount of mRNA provided to a cell, tissue, or subject can be an amount effective for immunoprophylaxis.

[0469] The composition may be administered together with other prophylactic or therapeutic compounds. As a non-limiting example, the prophylactic or therapeutic compound may be an adjuvant or a booster. As used herein, the term "booster," when referring to a prophylactic composition such as a vaccine, refers to an additional administration of the prophylactic (vaccine) composition. A booster (or booster vaccine) may be administered after the initial administration of the prophylactic composition. The administration time between the initial administration of the prophylactic composition and the booster may be, but is not limited to, 12 hours, 1 day, 36 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 10 days, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 18 months, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, or more. In exemplary embodiments, the administration time between the initial administration of the prophylactic composition and the booster may be, but is not limited to, 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, or 6 months. As described herein, the booster may contain the same or a different mRNA compared to the initial administration of the prophylactic composition. In some embodiments, the booster is monovalent (e.g., the mRNA encodes a single antigen). In some embodiments, the booster is multivalent (e.g., the mRNA encodes multiple antigens).

[0470] In some embodiments, "administering" or "administration" refers to providing a substance to a subject in a pharmacologically useful manner. In some embodiments, the mRNA vaccines disclosed herein are administered enterally to a subject. In some embodiments, enteral administration of the composition is oral. In some embodiments, the mRNA vaccines disclosed herein are administered parenterally to a subject. In some embodiments, the mRNA vaccines disclosed herein are administered to a subject subcutaneously, intraocularly, intravitreally, subretinal, intravenously (IV), intracerebroventricularly, intramuscularly, intranasally, intrathecally (IT), intracisternally, intraperitoneally, via inhalation, topically, or by direct injection into one or more cells, tissues, or organs.

[0471] The compositions can be utilized in a variety of settings, depending on the prevalence of infection or the extent or level of unmet medical need. As a non-limiting example, mRNA vaccines can be utilized to treat and / or prevent EBV. mRNA vaccines have superior properties over commercially available vaccines in that they produce much greater antibody titers, better neutralizing immunity, generate a more durable immune response, and / or provide a faster response.

[0472] Provided herein are pharmaceutical compositions comprising mRNA and / or complexes, optionally in combination with one or more pharmaceutically acceptable excipients.

[0473] The mRNA may be formulated or administered alone or in combination with one or more other components, for example, a vaccine may include other components, including but not limited to, an adjuvant.

[0474] In some embodiments, the vaccine does not include an adjuvant (is adjuvant-free).

[0475] The mRNA may be formulated or administered in combination with one or more pharmaceutically acceptable excipients. In some embodiments, the vaccine composition comprises at least one additional active agent, such as, for example, a therapeutically active agent, a prophylactically active agent, or a combination of both. The vaccine composition may be sterile, pyrogen-free, or both sterile and pyrogen-free. General considerations in the formulation and / or manufacture of pharmaceutical agents, e.g., vaccine compositions, can be found, for example, in Remington: The Science and Practice of Pharmacy 21st ed., Lippincott Williams & Wilkins, 2005 (incorporated herein by reference in its entirety).

[0476] In some embodiments, the vaccine is administered to a human, human patient, or subject. For purposes of this disclosure, the phrase "active ingredient" generally refers to the mRNA contained therein, e.g., the mRNA encoding an EBV protein antigen.

[0477] Formulations of the vaccine compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing into association the active ingredient (e.g., mRNA) with an excipient and / or one or more accessory ingredients, and then dividing, shaping, and / or packaging the product into desired single or multi-dose units, as necessary and / or desired.

[0478] The relative amounts of active ingredient, pharmaceutically acceptable excipient, and / or any additional ingredients in a pharmaceutical composition according to the present disclosure will vary depending on the identity, size, and / or condition of the subject being treated, as well as the route by which the composition is administered. By way of example, the composition may contain from 0.1% to 100%, e.g., 0.5 to 50%, 1 to 30%, 5 to 80%, at least 80% (w / w) active ingredient.

[0479] In some embodiments, mRNA is formulated with one or more excipients to (1) enhance stability, (2) increase cell transfection, (3) enable sustained or delayed release (e.g., from a depot), (4) alter biodistribution (e.g., target specific tissues or cell types), (5) increase in vivo translation of the encoded protein, and / or (6) alter the release profile of the encoded protein (antigen) in vivo. In addition to conventional excipients such as any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersing or suspending aids, surfactants, isotonic agents, thickening or emulsifying agents, preservatives, excipients include, but are not limited to, lipidoids, liposomes, lipid nanoparticles, polymers, lipoplexes, core-shell nanoparticles, peptides, proteins, cells transfected with mRNA (e.g., for transplantation into a subject), hyaluronidase, nanoparticle mimics, and combinations thereof.

[0480] Prevention / Usage Epstein-Barr virus (EBV) is a complex, large, double-stranded DNA gammaherpesvirus with a high seroprevalence (>90%) in adults worldwide. It is responsible for 90% of infectious mononucleosis (IM) cases worldwide, most commonly seen in adolescents and young adults with primary infection. IM is a clinical syndrome characterized by fever, fatigue, sore throat, and lymphadenopathy, which can lead to prolonged symptoms, hospitalization, and splenic rupture. EBV has also been associated with other serious diseases, including infectious mononucleosis, nasopharyngeal carcinoma, Burkitt lymphoma, Hodgkin lymphoma, gastric cancer, post-transplant lymphoproliferative disorder (PTLD), and more recently, systemic lupus erythematosus and multiple sclerosis. The mRNA vaccines provided herein can be used to treat and / or prevent such diseases associated with EBV infection.

[0481] Provided herein are mRNA vaccines, methods, kits, and reagents for the prevention and / or treatment of EBV infection in humans and other mammals. The mRNA vaccines can be used as therapeutic or prophylactic agents. In some embodiments, the mRNA vaccines are used to provide preventative protection from EBV infection. In some embodiments, the mRNA vaccines are used to treat EBV infection. In some embodiments, the mRNA vaccines are used in priming immune effector cells, for example, to activate peripheral blood mononuclear cells (PBMCs) ex vivo, which are then infused (reinfused) into a subject.

[0482] The subject can be any mammal, including non-human primates and human subjects. Typically, the subject is a human subject.

[0483] In some embodiments, the mRNA vaccine is administered to a subject (e.g., a mammalian subject, such as a human subject) in an amount effective to induce an antigen-specific immune response. The RNA ...

Claims

1. 1. An Epstein-Barr virus (EBV) messenger ribonucleic acid (mRNA) vaccine comprising: (a) one or more mRNAs, each of which contains an open reading frame (ORF) encoding an EBV lytic antigen; (b) one or more mRNAs, each of which contains an ORF encoding an EBV latent antigen; and (c) lipid nanoparticles, The EBV mRNA vaccine, wherein at least 50% by mass of the mRNA in the vaccine is mRNA encoding the EBV lytic antigen.

2. The EBV mRNA vaccine, wherein about 50% to about 80% of the mass of the mRNA in the vaccine is mRNA encoding the EBV lytic antigen, and about 20% to about 50% of the mass of the mRNA in the vaccine is mRNA encoding the EBV latent antigen.

3. 3. The EBV mRNA vaccine of claim 1, wherein the EBV lytic antigen is an EBV glycoprotein optionally selected from EBV glycoprotein 350 (gp330), EBV glycoprotein 220 (gp220), EBV glycoprotein H (gH), EBV glycoprotein L (gL), EBV glycoprotein 42 (gp42), and EBV glycoprotein B (gB).

4. 4. The EBV mRNA vaccine according to claim 1, wherein the EBV latent antigen is selected from EBV nuclear antigen 1 (EBNA1), EBV nuclear antigen 2 (EBNA2), EBV nuclear antigen 3A (EBNA3A), EBV nuclear antigen 3B (EBNA3B), EBV nuclear antigen 3C (EBNA3C), EBV latent membrane protein 1 (LMP1), EBV latent membrane protein 2A (LMP2A), and EBV latent membrane protein 2B (LMP2B).

5. about 25% to about 45%, or optionally about 40% to about 45%, or about 42% of the mass of the mRNA in the vaccine is mRNA encoding EBV gp220; about 10% to about 20%, or optionally about 15% to about 20%, or about 16% of the mass of the mRNA in the vaccine is mRNA encoding EBV gH; about 5% to about 15%, or optionally about 10% to about 15%, or about 10.5%, of the mass of the mRNA in the vaccine is mRNA encoding EBV gL; about 5% to about 15%, or optionally about 10% to about 15%, or about 10.5%, of the mass of the mRNA in the vaccine is mRNA encoding EBV gp42; about 10% to about 25%, or optionally about 10% to about 15%, or about 10.5%, of the mass of the mRNA in the vaccine is mRNA encoding EBBA3A; 5. The EBV mRNA vaccine of any one of claims 1 to 4, wherein about 10% to about 25%, or optionally about 10% to about 15%, or about 10.5%, of the mass of the mRNA in the vaccine is mRNA encoding EBV LMP2B.

6. about 25% to about 30%, or optionally about 27%, of the mass of the mRNA in the vaccine is mRNA encoding EBV gp220; about 10% to about 15%, or optionally about 10%, of the mass of the mRNA in the vaccine is mRNA encoding EBV gH; about 5% to about 10%, or optionally about 6.5%, of the mass of the mRNA in the vaccine is mRNA encoding EBV gL; about 5% to about 10%, or optionally about 6.5%, of the mass of the mRNA in the vaccine is mRNA encoding EBV gp42; about 20% to about 25%, or optionally about 25%, of the mass of the mRNA in the vaccine is mRNA encoding EBBA3A; 5. The EBV mRNA vaccine of any one of claims 1 to 4, wherein about 20% to about 25%, or optionally about 25%, of the mass of the mRNA in the vaccine is mRNA encoding EBV LMP2B.

7. EBV mRNA vaccine according to any one of the preceding claims, wherein said EBNA3A has one or more of the following characteristics: a. lacking the C-terminal transcription factor domain; b. has a length of about 523 amino acids; c. comprising amino acid residues corresponding to amino acid residues 1-523 of naturally occurring EBNA3A; d. does not contain amino acid residues corresponding to amino acid residues 524-944 of naturally occurring EBNA3A; e. The N-terminus of the EBNA3A is truncated compared to naturally occurring EBNA3A, and the C-terminus of the EBNA3A is truncated compared to naturally occurring EBNA3A. f. having a length of about 455 amino acids; g. comprising amino acid residues corresponding to amino acid residues 68-523 of naturally occurring EBNA3A; h. does not contain amino acid residues corresponding to amino acid residues 1-67 and 524-944 of naturally occurring EBNA3A; i. one or more nuclear localization signals (NLS) in the EBNA3A are mutated compared to naturally occurring EBNA3A; j. 1 to 4, 2 to 4, 3 to 4, or 4 of the NLSs in the EBNA3A are mutated compared to naturally occurring EBNA3A, and optionally the mutated NLSs are at amino acid positions selected from 63 to 66, 146 to 155, 375 to 381, and 394 to 398 compared to naturally occurring EBNA3A; and / or k. has a C-terminus truncated at amino acid residue 68, the N-terminus of the EBNA3A is truncated at amino acid residue 523, and the EBNA3 contains NLS mutations at amino acid residues 146-155, 375-378, and 394-398 compared to naturally occurring EBNA3A.

8. 8. The EBV mRNA vaccine of any one of claims 1 to 7, wherein the mRNA vaccine comprises an mRNA encoding an antigen selected from gp220, gH, gL, gp42, EBBA3A and LMP2B and having the following characteristics: a. EBV gp220 comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO: 1, and / or the mRNA encoding said EBV gp220 comprises an open reading frame comprising a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 7, and / or the mRNA encoding said EBV gp220 comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 13; b. the EBV gH comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO:2, and / or the mRNA encoding the EBV gH comprises an open reading frame comprising a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the nucleic acid sequence of SEQ ID NO:8, and / or the mRNA encoding the EBV gH comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the nucleic acid sequence of SEQ ID NO:14; c) the EBV gL comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO:2, and / or the mRNA encoding the EBV gL comprises an open reading frame comprising a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the nucleic acid sequence of SEQ ID NO:9, and / or the mRNA encoding the EBV gL comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the nucleic acid sequence of SEQ ID NO:15; d. The EBV gp42 is soluble, and / or the EBV gp42 comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO:4, and / or the mRNA encoding the EBV gp42 comprises an open reading frame comprising a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the nucleic acid sequence of SEQ ID NO:10, and / or the mRNA encoding the EBV gp42 comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the nucleic acid sequence of SEQ ID NO:16; e. The EBNA3A comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO:5, or at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of any one of SEQ ID NOs:28-31, and / or the mRNA encoding the EBNA3A has at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the nucleic acid sequence of SEQ ID NO:11, or at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the nucleic acid sequence of SEQ ID NOs:24-27. and / or the mRNA encoding said EBNA3A comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 17, or at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the nucleic acid sequence of any one of SEQ ID NOs: 32-35; and / or f. The EBV LMP2B comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO:6, and / or the mRNA encoding the EBV LMP2B comprises an open reading frame comprising a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the nucleic acid sequence of SEQ ID NO:12, and / or the mRNA encoding the EBV LMP2B comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the nucleic acid sequence of SEQ ID NO:

18.

9. The EBV mRNA vaccine of any one of claims 1 to 8, wherein one or more of the mRNAs comprises a chemical modification.

10. 1. A therapeutic Epstein-Barr virus (EBV) messenger ribonucleic acid (mRNA) vaccine comprising: The therapeutic EBV mRNA vaccine comprises one or more mRNAs encoding at least two EBV latent antigens and lipid nanoparticles, wherein the EBV latent antigens are selected from EBV nuclear antigen 1 (EBNA1), EBV nuclear antigen 2 (EBNA2), EBV nuclear antigen 3A (EBNA3A), EBV nuclear antigen 3B (EBNA3B), EBV nuclear antigen 3C (EBNA3C), EBV latent membrane protein 1 (LMP1), EBV latent membrane protein 2A (LMP2A), and EBV latent membrane protein 2B (LMP2B).

11. 11. The therapeutic EBV mRNA vaccine of claim 10, wherein no more than 50% of the mass of the mRNA in the vaccine is mRNA encoding the EBV latent antigen.

12. 12. The therapeutic EBV mRNA vaccine of claim 10 or 11, further comprising one or more mRNAs encoding at least one EBV lytic antigen, wherein about 50% to about 80% of the mass of the mRNA in the vaccine is mRNA encoding the EBV lytic antigen, and about 20% to about 50% of the mass of the mRNA in the vaccine is mRNA encoding the EBV latent antigen.

13. 13. The therapeutic EBV mRNA vaccine of claim 12, wherein the EBV lytic antigen is an EBV glycoprotein optionally selected from EBV glycoprotein 350 (gp330), EBV glycoprotein 220 (gp220), EBV glycoprotein H (gH), EBV glycoprotein L (gL), EBV glycoprotein 42 (gp42), and EBV glycoprotein B (gB).

14. about 25% to about 45%, or optionally about 40% to about 45%, or about 42% of the mass of the mRNA in the vaccine is mRNA encoding EBV gp220; about 10% to about 20%, or optionally about 15% to about 20%, or about 16% of the mass of the mRNA in the vaccine is mRNA encoding EBV gH; about 5% to about 15%, or optionally about 10% to about 15%, or about 10.5%, of the mass of the mRNA in the vaccine is mRNA encoding EBV gL; about 5% to about 15%, or optionally about 10% to about 15%, or about 10.5%, of the mass of the mRNA in the vaccine is mRNA encoding EBV gp42; about 10% to about 25%, or optionally about 10% to about 15%, or about 10.5%, of the mass of the mRNA in the vaccine is mRNA encoding EBBA3A; 14. The therapeutic EBV mRNA vaccine of any one of claims 12-13, wherein about 10% to about 25%, or optionally about 10% to about 15%, or about 10.5%, of the mass of the mRNA in the vaccine is mRNA encoding EBV LMP2B.

15. The therapeutic EBV mRNA vaccine of any one of claims 10 to 14, wherein the EBNA3A has one or more of the following characteristics: a. lacking the C-terminal transcription factor domain; b. has a length of about 523 amino acids; c. comprising amino acid residues corresponding to amino acid residues 1-523 of naturally occurring EBNA3A; d. does not contain amino acid residues corresponding to amino acid residues 524-944 of naturally occurring EBNA3A; e. The N-terminus of the EBNA3A is truncated compared to naturally occurring EBNA3A, and the C-terminus of the EBNA3A is truncated compared to naturally occurring EBNA3A. f. having a length of about 455 amino acids; g. comprising amino acid residues corresponding to amino acid residues 68-523 of naturally occurring EBNA3A; h. does not contain amino acid residues corresponding to amino acid residues 1-67 and 524-944 of naturally occurring EBNA3A; i. one or more nuclear localization signals (NLS) in the EBNA3A are mutated compared to naturally occurring EBNA3A; j. 1 to 4, 2 to 4, 3 to 4, or 4 of the NLSs in the EBNA3A are mutated compared to naturally occurring EBNA3A, and optionally the mutated NLSs are at amino acid positions selected from 63 to 66, 146 to 155, 375 to 381, and 394 to 398 compared to naturally occurring EBNA3A; and / or k. has a C-terminus truncated at amino acid residue 68, the N-terminus of the EBNA3A is truncated at amino acid residue 523, and the EBNA3 contains NLS mutations at amino acid residues 146-155, 375-378, and 394-398 compared to naturally occurring EBNA3A.

16. 1. A therapeutic Epstein-Barr virus (EBV) messenger ribonucleic acid (mRNA) vaccine comprising: The therapeutic EBV mRNA vaccine comprises one or more mRNAs encoding an EBNA3A antigen and lipid nanoparticles, wherein the EBNA3A antigen has one or more of the following characteristics: a. lacking the C-terminal transcription factor domain; b. has a length of about 523 amino acids; c. comprising amino acid residues corresponding to amino acid residues 1-523 of naturally occurring EBNA3A; d. does not contain amino acid residues corresponding to amino acid residues 524-944 of naturally occurring EBNA3A; e. The N-terminus of the EBNA3A is truncated compared to naturally occurring EBNA3A, and the C-terminus of the EBNA3A is truncated compared to naturally occurring EBNA3A. f. having a length of about 455 amino acids; g. comprising amino acid residues corresponding to amino acid residues 68-523 of naturally occurring EBNA3A; h. does not contain amino acid residues corresponding to amino acid residues 1-67 and 524-944 of naturally occurring EBNA3A; i. one or more nuclear localization signals (NLS) in the EBNA3A are mutated compared to naturally occurring EBNA3A; j. 1 to 4, 2 to 4, 3 to 4, or 4 of the NLSs in the EBNA3A are mutated compared to naturally occurring EBNA3A, and optionally the mutated NLSs are at amino acid positions selected from 63 to 66, 146 to 155, 375 to 381, and 394 to 398 compared to naturally occurring EBNA3A; and / or k. has a C-terminus truncated at amino acid residue 68, the N-terminus of the EBNA3A is truncated at amino acid residue 523, and the EBNA3 contains NLS mutations at amino acid residues 146-155, 375-378, and 394-398 compared to naturally occurring EBNA3A.

17. A method comprising administering to a subject a therapeutically effective amount of the EBV mRNA vaccine of any one of the preceding claims.

18. A method for treating EBV infection, comprising administering to a subject an EBV mRNA vaccine comprising one or more mRNAs encoding at least two latent EBV antigens to induce a therapeutically effective cytotoxic CD8 T cell response against EBV-infected cells.

19. 19. The method of claim 17 or 18, wherein the therapeutically effective amount is one or more doses of 25-150 μg, 25-100 μg, 25-50 μg, 50-150 μg, 50-100 μg, 5-25 μg, 25 μg, 30 μg, 40 μg, 50 μg, 75 μg, or 100 μg of the EBV mRNA vaccine.

20. The method of any one of claims 17 to 19, wherein the subject is infected with EBV.

21. The method according to any one of claims 17 to 19, wherein the subject is a patient who has undergone or is scheduled to undergo a solid organ transplant or a hematopoietic stem cell transplant.

22. The method of any one of claims 17 to 19, wherein the subject has or is at risk of having post-transplant lymphoproliferative disorder.

23. 20. The method of any one of claims 17 to 19, wherein the subject has or is at risk of having infectious mononucleosis.

24. The method of any one of claims 17 to 19, wherein the subject has or is at risk of having multiple sclerosis.

25. The method of any one of claims 17 to 19, wherein the subject has or is at risk of having systemic lupus erythematosus.

26. The method of any one of claims 17 to 19, wherein the subject has or is at risk of having cancer.

27. 27. The method of claim 26, wherein the cancer is selected from Burkitt's lymphoma, Hodgkin's lymphoma, nasopharyngeal carcinoma, and gastric cancer.

28. The method of any one of claims 17 to 27, wherein the subject is EBV seropositive.

29. The method of any one of claims 17 to 27, wherein the subject is EBV seronegative.

30. The method of any one of claims 17 to 19, wherein the effective amount induces a CD8+ T cell response.

Images