On-chip camouflage, method, and system and its use for testing biological and non-biological specimens - Patent Application 20070122999

Abstract

An apparatus for detecting an analyte includes a first detectable agent having one or more detectable characteristics and a masking agent having one or more characteristics that mask the detection of one or more characteristics of the first detectable agent in the absence of the analyte, wherein at least one of the first detectable agent or the masking agent is configurable to allow detection of one or more characteristics of the first detectable agent in the presence of the analyte that are indicative of the presence of the analyte.

Description

[Technical Field]

[0001] Related Applications This application claims priority to U.S. Provisional Application No. 63 / 478,623, filed January 5, 2023, the subject matter of which is incorporated herein by reference in its entirety.

[0002] government funds This invention was made with government support under grants CS254566, DA054557, and TW012056 awarded by the National Institutes of Health. The government has certain rights in this invention.

[0003] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in XML format, the entire contents of which are incorporated herein by reference. Said XML copy, created on January 5, 2024, is named CWR-032063WO ORD st.26 and is 6,568 bytes in size. [Background technology]

[0004] Current instruments and systems for multiplex analyte testing typically require staining or multi-step labeling, which is necessarily performed using remote clinical testing. Furthermore, current analyte sensing approaches that utilize color (e.g., ELISA) and fluorescent (e.g., PCR) labels typically generate color or fluorescent detection signals that are diffused across a relatively large sample volume, resulting in low detection sensitivity and efficiency. These current approaches may also not allow for efficient integration with AI-based image analysis systems or even simple optical systems with cameras. There remains a need for novel instruments that enable simpler methods and systems for high-multiplex, rapid detection in point-of-care (POC) diagnostics that can detect target analytes in various modalities, such as color and fluorescence, without the need for staining or multi-step labeling. Summary of the Invention

[0005] The present disclosure describes an apparatus for analyte detection and methods and systems for using the apparatus in analyte detection. Advantageously, the apparatus enables biomimetic camouflage for sensing and testing biological and non-biological analytes in samples at high multiplexing, both at the target level by detecting various targets and at the modality level by detecting various modalities, such as color and / or fluorescence.

[0006] The device for detecting an analyte includes a first detectable agent having one or more detectable characteristics. The device also includes a masking agent having one or more characteristics that mask the detection of the one or more characteristics of the first detectable agent in the absence of the analyte. At least one of the one or more characteristics of the first detectable agent or the masking agent is configurable in the presence of the analyte to allow detection of the one or more characteristics of the first detectable agent that are indicative of the presence of the analyte.

[0007] In some embodiments, the first detectable agent is configured to specifically bind to the analyte, and one or more characteristics of the first detectable agent may be undetectable when the first detectable agent is not bound to the analyte and detectable upon binding to the analyte.

[0008] In some embodiments, binding of the analyte to the first detectable agent may induce the formation of a masking agent that forms an unmasked or unmasked signal area that allows detection of the first detectable agent.

[0009] In some embodiments, the masking agent may comprise a masking liquid that masks one or more characteristics of the first detectable agent. In some embodiments, binding of the analyte to the first detectable agent forms a mask-free area indicating the presence of the analyte. In some embodiments, binding of the analyte to the first detectable agent disperses the masking liquid around the first detectable agent, allowing detection of the first detectable agent indicating the presence of the analyte.

[0010] In some embodiments, the first detectable agent may include one or more first detectable particles immobilized on a surface of a substrate. The first detectable particles may be configured to specifically bind to an analyte. In some embodiments, the one or more first detectable particles immobilized on a surface of a substrate are covered by a masking liquid in the absence of the analyte.

[0011] In some embodiments, the device further comprises a detection agent that specifically binds to the analyte to form a detection agent-analyte-particle complex. The detection agent can be masked when the analyte is not bound to the detectable particle and the detection agent.

[0012] In some embodiments, the masking liquid visually masks first detectable particles that do not form a detection agent-analyte-particle complex, and the detection agent in the complex can catalyze the conversion of the masking liquid to a gas, which disperses the masking liquid around the complex to form a liquid-free zone, allowing optical detection of the complex on the substrate.

[0013] In some embodiments, the first detectable particle comprises a plurality of microbeads and has a diameter of about 10 μm to about 1 mm.

[0014] In some embodiments, the first detectable particle includes a capture agent on the outer surface of the first detectable particle that specifically binds to the analyte. The capture agent may include at least one of a small molecule, a nucleotide, a protein, an antibody, or streptavidin. In some embodiments, the capture agent is conjugated to the outer surface of the first detectable particle using a linker.

[0015] In some embodiments, the capture agent may comprise streptavidin, and the analyte may comprise a biotin-modified nucleic acid or peptide. The biotin-modified nucleic acid analyte may comprise a multi-arm amplicon nucleic acid structure. The multi-arm amplicon structure is formed using a multi-arm primer, which comprises a sense arm and an antisense arm of a single-stranded oligonucleotide linked to a core by a flexible linker. The antisense arm complements the antisense sequence of the target nucleic acid, and the sense arm complements a sense sequence of the target nucleic acid that is different from and follows the antisense sequence.

[0016] In some embodiments, the detection agent may comprise platinum nanoparticles (PtNPs), which may be conjugated to streptavidin or anti-biotin antibodies.

[0017] In some embodiments, the masking fluid can have a color that visually masks the appearance of the first detectable particles upon loading of the masking fluid onto the surface of the substrate. In some embodiments, the masking fluid can include a peroxide solution, such as about 1% to about 20% hydrogen peroxide (w / v), about 5% to about 15% hydrogen peroxide (w / v), or a peroxide solution having about 10% hydrogen peroxide (w / v).

[0018] In some embodiments, the substrate may include at least one microchannel extending along a portion of the substrate. The microchannel may contain the first detectable particle and a masking liquid. The microchannel may include a fluid inlet and an outlet for receiving and removing a liquid from the microchannel.

[0019] In some embodiments, the device may further include one or more second detectable agents. The second detectable agents may include second detectable particles immobilized on the surface of the substrate. The second detectable particles may include a second plurality of second capture agents for specifically binding the second analyte. The device may further include a plurality of second detection agents including a second targeting moiety for specifically binding the second analyte. Binding of the second analyte to both the second detectable particles and the second detection agents may form second detection agent-analyte-particle complexes that form a liquid-free zone around the second agent-analyte-particle complexes, allowing detection of the second agent-analyte-particle complexes on the substrate.

[0020] In some embodiments, the one or more second detectable particles are a substantially different color than the first detectable particles to optically distinguish between the detection of a first analyte and a second analyte in a sample using the device. For example, the one or more first detectable particles may be red and the one or more second detectable particles may be blue to easily determine the presence of one or both analytes in a liquid sample.

[0021] In some embodiments, the first analyte and / or the second analyte, or the first analyte of interest and / or the second analyte of interest, are components of a biological fluid sample. The biological fluid sample may be obtained from a subject, such as a human subject. In certain embodiments, the device is a point-of-care (POC) device.

[0022] Another embodiment described herein relates to a method for detecting an analyte. The method includes providing a device described herein. A sample containing the analyte is loaded onto a surface of a substrate to bind the analyte to the outer surface of one or more first detectable particles. The bound analyte is labeled with a plurality of first detection agents to form first detection agent-analyte-particle complexes on the surface of the substrate. A masking liquid is loaded onto the surface of the substrate to mask one or more first detectable particles of the complex. The detection agent of the complex can then catalyze the decomposition of the masking liquid to form a masking liquid-free zone around the particle of the complex. One or more first detectable particles of the complex in the masking liquid-free zone can then be detected. Detection of the first detectable particles of the complex in the masking liquid-free zone indicates the presence of the analyte in the sample.

[0023] In some embodiments, the method may further include a washing step to remove uncaptured analytes and residual sample from the surface of the substrate prior to labeling the bound analytes with the plurality of first detection agents.

[0024] In some embodiments, the step of optically detecting the one or more particles may include imaging the surface of the substrate with a camera.

[0025] In some embodiments, the camera is part of a mobile device, such as a mobile phone.

[0026] In some embodiments, the method may further include determining whether first optically detectable particles are present in the at least one image in the masking fluid-free area, wherein the number and / or size of the optically detected particles in the masking fluid-free area is indicative of the concentration of the analyte in the sample.

[0027] In some embodiments, the sample may contain two or more different analytes, and the device is configured to detect the two or more different analytes from the sample. In certain embodiments, the method may further include contacting the nucleic acid analytes in the liquid sample with a series of biotin-modified nucleic acid primers specific for the nucleic acid analytes to form biotinylated nucleic acid target analytes, wherein the biotinylated nucleic acid target analytes are bound to the outer surface of one or more first detectable particles by streptavidin conjugated to the particles.

[0028] In some embodiments, the biotin-modified nucleic acid analyte may comprise a multi-arm amplicon nucleic acid structure, and the multi-arm amplicon structure may be formed using a multi-arm primer. The multi-arm primer may comprise a sense arm and an antisense arm of a single-stranded oligonucleotide linked to a core by a flexible linker, the antisense arm being complementary to the antisense sequence of the target nucleic acid, and the sense arm being complementary to the sense sequence of the target nucleic acid, which is different from the antisense sequence and follows the antisense sequence. The sense arm is linked to the antisense arm by a multi-arm polyethylene glycol (PEG) linker, and each arm of the multi-arm PEG linker is connected to either the sense arm of the single-stranded oligonucleotide or the antisense arm of a single oligonucleotide.

[0029] In some embodiments, the method further comprises the step of amplifying the target nucleic acid analyte by providing a multi-arm primer and annealing the multi-arm primer to the target nucleic acid analyte.

[0030] In some embodiments, after annealing to the nucleic acid target sequence, the primer can be extended using a polymerase with high strand displacement activity, which can be selected from the group consisting of Bst DNA polymerase and phi29 (φ29) DNA polymerase.

[0031] In some embodiments, the multi-arm primer comprises at least two sense arms and at least two antisense arms. The antisense arms can be configured to bind to complementary sequences in nucleic acids and form a looped arm dsDNA structure mediated by the sense arms. The antisense arms can prime amplification, followed by self-priming with the sense arms, generating a stem-loop DNA hybrid structure in which the loop is partially formed by the sense arms, antisense arms, and linkers. The other free antisense arms and sense arms of the multi-arm primer can mediate self-looping chains to form a multi-arm amplicon, which are used as self-priming templates to generate a large multi-amplicon structure and form new strands and stem-loop structures. Self-looping can continue until all sense arms are extended to copy the target sequence.

[0032] Other embodiments described herein relate to a system including the apparatus described herein for performing a method for detecting an analyte. The system further includes a camera, a processor, and one or more non-transitory computer-readable media storing executable instructions and data. The processor, such as a microprocessor, can access the media and executes instructions for performing the method for detecting an analyte. The executable instructions may include a camera interface configured to instruct the camera to capture at least one image. In an exemplary embodiment, the camera may be part of a mobile device, such as a mobile phone.

[0033] Other objects and advantages and a more complete understanding of the present invention will be obtained from the following detailed description and the accompanying drawings.

[0034] The foregoing and other features of the present disclosure will become apparent to those skilled in the art to which the present disclosure pertains from a reading of the following description taken in conjunction with the accompanying drawings. [Brief explanation of the drawings]

[0035] [Figure 1A] ~ [Figure 1B] Figures 1(A-B) illustrate the concept and design of a CamoChip according to embodiments described herein. (A) is an image showing the camouflage of blue microbeads in a drop of blue peroxide solution on a glass slide. The inset image shows the drop before the formation of a liquid-free (clear) area around the bead, making it visible to the naked eye. (B) is a schematic diagram of the CamoChip design using HIV-1 RNA. The beads are modified with streptavidin to capture biotinylated viral RNA, which triggers the accumulation of streptavidin (SA)-platinum nanoparticles (PtNPs), which in turn catalyze the decomposition of the surrounding blue peroxide solution, forming a clear area around the blue bead. [Figure 2A] ~ [Figure 2B] Figures 2 (A-B) illustrate the CamoChip technology on a slide according to embodiments described herein. (A) is a digital image of a decamouflaged bead on a glass slide and the clear area formed around the bead. (B) Beads decamouflaged at various time points. The clear area around the bead begins as early as 2 seconds and continues to grow in size until a circular clear area of ​​1.5-3 mm is formed, making the masked bead visible to the naked eye. [Figure 3] FIG. 3 illustrates a digital image of a CamoChip microchip device according to an embodiment described herein for HIV-1 RNA analyte detection. [Figure 4A] ~ [Figure 4B]Figures 4(A-B) illustrate additional digital images of a CamoChip microchip device according to an embodiment described herein for HIV-1 RNA analyte detection. Biotinylated HIV-1 RNA is loaded onto a chip with streptavidin-modified blue beads. The chip is incubated for 10 minutes to capture the target RNA, followed by streptavidin-platinum nanoparticles to label the captured RNA. A blue peroxide solution is loaded onto the chip to mask the beads. After 5 minutes of incubation, the PtNPs accumulated on the beads decompose the surrounding peroxide solution, creating a clear region around the beads. (A) Microchip loaded with peroxide solution at time 0 minutes. (B) Microchip loaded with peroxide solution after 5 minutes of incubation at room temperature. [Figure 5] FIG. 5 illustrates digital images of a CamoChip microchip device according to an embodiment described herein for HIV-1 RNA analyte detection at various time points from time 0 to 15 minutes. [Figure 6] FIG. 6 is a digital image of a CamoChip microchip device according to an embodiment described herein for multiplexed detection of HIV-1 RNA on blue beads and HIV-1 core antigen (on red beads). [Figure 7A] ~ [Figure 7B] Figure 7 (A-B) are digital images showing the results of the CamoChip technology for a sample with HIV-1 RNA only (no HIV-1 core antigen). (A) Digital image of the microchip after capture of target RNA and labeling with PtNPs and before loading with a camouflaging peroxide solution. (B) Formation of a clear area on the microchip after loading with a camouflaging peroxide solution and incubating for 5 minutes. [Figure 8A] ~ [Figure 8B]Figure 8 (A-B) shows digital images showing the results of the CamoChip technology for a sample using only HIV-1 core antigen (no HIV-1 core antigen). (A) Digital image of the microchip after capture of HIV-1 core Ag and labeling with PtNPs and before loading with the camouflaging peroxide solution. (B) Formation of a clear area on the microchip after loading with the camouflaging peroxide solution and incubating for 5 minutes. [Figure 9] Figure 9 illustrates digital images of a CamoChip microchip device according to an embodiment described herein for multiplex testing of samples using HIV-1 core antigen and HIV-1 RNA at various time points from before sample loading to 10 minutes after sample loading and signal formation. [Figure 10] FIG. 10 illustrates a digital image showing the detection sensitivity of a CamoChip microchip device according to an embodiment described herein using an HIV-1 RNA sample. [Figure 11] 11 illustrates a digital image of HIV-1 / HBV coinfection detection using a CamoChip microchip device according to an embodiment described herein: HBV particles are captured and detected on red beads, and HIV-1 RNA is captured and detected on blue beads. [Figure 12] 12 is an illustration and digital image of the use of the CamoChip microchip device in combination with mobile phone technology according to embodiments described herein. Equipped with AI-based algorithms trained to detect the color, size, and diameter of clear zone formation, the mobile phone can be used for quantitative testing of multiple targets at the point of care (POC). [Figure 13]13 is a schematic diagram according to an embodiment described herein showing a pattern created by a first agent, e.g., a polymer, magnetic material, crystal, or first object covering the first agent. In response to an analyte of interest, the patterned, pattern-like, or unpatterned presence of a second agent is changed or altered to allow the first agent to become detectable, e.g., through visual or non-visual detection. [Figure 14] 14 is a schematic diagram of target analyte detection using a device according to embodiments described herein. A two- or three-phase emulsion is loaded onto a substrate surface containing a large number of optically visible beads, such that the emulsion creates a pattern that masks or camouflages the beads. Upon introduction of a sample containing the target analyte, the target triggers a reaction that converts and dissociates the emulsion into a non-emulsion form. Dissociation of the emulsion unmasks or decamouflages the beads, allowing for visual detection of the beads. [Figure 15A] ~ [Figure 15B] Figure 15 (A-B) are digital images showing a device according to an embodiment described herein. (A) Various color codes are laser printed on the surface of a plastic sheet. Each color codes for a specific target analyte and is configured to retain a specific volume of sample to maximize the testing sensitivity and overall performance of the device. (B) The fully assembled CamoChip device is completely flexible, lightweight, and low-cost. [Figure 16] FIG. 16 is a flow diagram illustrating a method for detecting an analyte. [Figure 17A] ~ [Figure 17B]Figure 17 (A-B) illustrates the design and fabrication of the CamoChip. (A) The microchip is created using polymethyl methacrylate (PMMA), double-sided adhesive (DSA), and a glass slide. First, colored beads are partially embedded into the glass surface of the microchip using a layer of liquid plastic. Then, a PMMA layer with inlets and outlets is assembled on the glass slide using a DSA layer to form a single microfluidic channel with the colored beads. (B) Digital images show the actual CamoChip with beads before (i) and after (ii) the addition of a blue camouflage fluid. [Figure 18A] ~ [Figure 18E] Figure 18 (A-E) illustrates the surface functionalization and characterization of beads. (A) Bright-field image shows solid spherical beads with two colors, blue and red, and an average size of 289.1 ± 42.33 μm. (B) Fluorescence spectroscopy analysis of beads modified with anti-hapten. Anti-hapten functionalized beads are stained with FITC-G protein, which specifically interacts with IgG on the surface of the beads. The inset bar graph shows the concentration of IgG protein on the surface of the functionalized beads, measured using UV-vis spectroscopy. (C) SDS-PAGE analysis of anti-hapten mAb released from the surface of the beads. Lane M: protein marker; Lane 1: beads functionalized with mAb; Lane 2: mAb. (D) FT-IR spectrum of surface-functionalized beads with anti-hapten mAb. (E) SDS-PAGE analysis of beads functionalized with streptavidin (SA). Lane M: protein marker; Lane 1: beads functionalized with SA; Lane 2: SA. [Figure 19A] ~ [Figure 19D]Figure 19 (A-D) illustrates the preparation and characterization of Pt-nanoprobes. (A) Schematic diagram of the preparation of Pt-nanoprobes. An anti-hapten IgG monoclonal antibody was conjugated to PtNPs via a hydrazide-reactive crosslinker, PDPH (3-(2-pyridyldithio)propionylhydrazide), which has a terminal pyridine thiol. Reduced PDPH has a free terminal thiol group that binds to the surface of PtNPs, forming hydrazide-functionalized PtNPs that can react with carbohydrate residues on oxidized antibodies. (B) Characterization of PtNPs: TEM images and particle size distribution histograms. (C) UV-vis absorption spectra of PtNPs (citric acid-coated platinum nanoparticles, black) and Pt-nanoprobes with mAb (IgG-conjugated platinum nanoparticles, blue). (D) Agarose gel electrophoresis of PtNPs (unmodified platinum nanoparticles) and Pt-nanoprobes with IgG (anti-hapten antibody-conjugated platinum nanoparticles, red). [Figure 20A] ~ [Figure 20C] Figure 20 (A-C) illustrates testing and optimization of the CamoChip design. (A) CamoChip masked (camouflaged) and unmasked (decamouflaged) with blue beads after 600 seconds of incubation with 10% peroxide blue camouflage solution. (B) CamoChip at various times of incubation (0-300 seconds). (C) Increase in the effectiveness of the decamouflaging beads (i) and the diameter of the clear zone formed (ii) at various times. [Figure 21A] ~ [Figure 21B]Figure 21 (A-B) illustrates the performance of the CamoChip in testing HIV-1 RNA in PBS-spiked samples. (A) Specificity test of the CamoChip using targeted HIV-1 RNA and non-targeted viral nucleic acids of HBV and HCV at a high concentration of 10 copies / ml. Representative images of the microchip associated with the tested non-specific targets of HIV and HBV and HCV. (B) Sensitivity test using serial dilutions of spiked HIV-1 RNA in PBS buffer at concentrations ranging from 100 to 10 copies / ml. Target HIV-1 RNA is incubated with biotinylated DNA probes and captured on the chip's bead surface, which is labeled with Pt-nanoprobes. The decamouflage efficiency is calculated from the number of unmasked beads from the total number of beads contained on the surface of each chip after a 5-minute incubation period. Representative images of the microchip associated with testing PBS samples spiked with HIV RNA. [Figure 22] Figure 22 illustrates the performance of the CamoChip in HIV-1 RNA testing in PBS and plasma spiked samples. [Figure 23A] ~ [Figure 23B] Figure 23 (A-B) illustrates the performance of the CamoChip in multiplex testing for HIV-1 RNA and HIV-1 p24 in PBS-spiked samples. (A) Bead decamouflage efficiency (bars) and diameter of the clear zone (circle) formed in the presence of HIV-1 RNA mixed with and unmixed with HIV-1 p24 antigen. (B) Representative images of the microchip associated with HIV-spiked PBS samples of various RNA concentrations. Blue beads encode HIV-1 RNA, and red beads encode p24. [Figure 24]Figure 24 illustrates the target sequence (SEQ ID NO: 6) and the design of MAPA primers. The initiation primer (IP) is 23 mer long and has a Tm of 55.3°C. The looped primer (LP) contains two sequences; each is 20 mer long, with looped sequence 1 (L1) having a Tm of 54.5°C and looped sequence 2 (L2) having a Tm of 56.5°C. The unlooped primer (ULP) is 22 mer long and has a Tm of 55.5°C. The arrow indicates the direction of DNA synthesis, and the dashed lines indicate the site and step of looping. [Figure 25A] ~ [Figure 25C] Figure 25 (A-C) illustrates the multi-arm primed amplification (MAPA) reaction of nucleic acids. (A) The initiation step of the MAPA reaction and the formation of a looped arm amplicon that serves as a template for arm extension through a cycling step, resulting in the formation of a multi-arm amplicon. (B) The cycling step involved in extending each PEG-DNA arm into a copy of the target sequence through cycles of arm looping and unlooping steps. (C) The extension step and the formation of a large multi-amplicon structure. [Figure 26A] ~ [Figure 26D]Figure 26 (A-D) illustrates the synthesis and characterization of multi-arm primers. (A) Synthesis of multi-arm polyethylene glycol (PEG)-DNA primer. A branched PEG molecule with a total of eight side chains (each as an arm) and six maleimide-modified chains was conjugated with a 1:1 mixture of thiolated looped sequences 1 and 2 (L1 and L2) to form a multi-arm loop primer (LP). (B, C) Characterization of the synthesized multi-arm DNA primer using magnetic bead separation combined with agarose gel electrophoresis. (i) Schematic diagram of the protocol used: streptavidin beads were incubated with the synthesized biotinylated multi-arm primer to form MB-SA / biotin-PEG-DNA complexes, which were subsequently loaded onto an agarose gel. (ii) Electrophoretic analysis of the formed MB-PEG / DNA complexes using 0.5% agarose gel electrophoresis. (D) UV-vis spectroscopic analysis of the formed multi-arm DNA primer. [Figure 27] Figure 27 illustrates the primer design and MAPA working protocol. The amplification products of several working protocols using the designed multi-arm loop primer (LP), its constituent sequences, looped sequence 1 (L1) and looped sequence 2 (L2), as well as other primers, including the initiation primer (IP) and unlooped primers (ULP and ULP`), were tested. The amplification reaction was carried out at 65°C for 20-35 minutes, and the formed amplification products were examined using a 2% agarose gel. [Figure 28] Figure 28 illustrates the optimization of the MAPA method. The formation of specific DNA amplicons (in the presence of target nucleic acid) using MAPA was tested at reaction temperatures ranging from 65°C to 69°C and reaction times up to 35 minutes. NC: negative control (no target nucleic acid added), M: marker DNA. [Figure 29]Figure 29 illustrates the detection sensitivity of the developed MAPA method. Electrophoretic patterns of MAPA amplification products generated from various concentrations of HIV-1 target DNA plasmid. MAPA reactions were performed using 10-fold serial dilutions of HIV-1 DNA template (10 copies / mL to 100 copies / mL) at 67°C for 30 minutes. M: 1 kb DNA ladder marker; NC: negative control (no target DNA template). [Figure 30A] ~ [Figure 30B] Figure 30 (A-B) illustrates the potential application of MAPA for target amplification and testing. (A) Amplification of MAPA on magnetic beads (MB) compared to a control (MAPA without magnetic beads). An optimized MAPA protocol was performed for HIV-1 testing in the presence of streptavidin-MB, and the formed biotinylated MAPA amplicons (due to the use of biotinylated PEG in the synthesis of MAPA LP) were spontaneously captured on the beads and could be easily separated on an agarose gel or by an external magnetic field. (B) Testing of the MAPA amplicons after magnetic separation using gel electrophoresis and fluorescence spectroscopy. [Figure 31] FIG. 31 is a schematic diagram illustrating a system using an apparatus according to an embodiment described herein. DETAILED DESCRIPTION OF THE INVENTION

[0036] Detailed Description To facilitate understanding of the present invention, a number of terms are defined below. Terms defined herein have meanings commonly understood by one of ordinary skill in the areas relevant to the present invention. Terms such as "a," "an," and "the" are intended to refer not only to a singular entity but also to plural entities and include general classes, specific examples of which may be used for illustration. While terms herein are used to describe particular aspects of the invention, their use does not limit the invention except as set forth in the claims.

[0037] Throughout the specification, when a composition is described as having, including, or comprising certain components, it is understood that the composition also consists essentially of, or consists of, the recited components. Similarly, when a method or process is described as having, including, or comprising certain process steps, the process also consists essentially of, or consists of, the recited processing steps. Furthermore, it should be understood that the order of steps or the order for performing certain actions is immaterial so long as the compositions and methods described herein remain operable. Moreover, two or more steps or actions may be performed simultaneously.

[0038] As used herein, the term "about" or "approximately" refers to an amount, level, value, number, frequency, percentage, dimension, size, total amount, weight, or length that varies by 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% of the reference amount, level, value, number, frequency, percentage, dimension, size, total amount, weight, or length. In one embodiment, the term "about" or "approximately" refers to a range of ±15%, ±10%, ±9%, ±8%, ±7%, ±6%, ±5%, ±4%, ±3%, ±2%, or ±1% of the reference amount, level, value, number, frequency, percentage, dimension, size, total amount, weight, or length.

[0039] It is further noted that the claims may be drafted to exclude any optional element. Accordingly, this statement is intended to serve as a predicate for use of exclusive terminology such as "solely," "only," etc. in connection with the recitation of claim elements or the use of a "negative" limitation. "Optional" or "optionally" means that the subsequently described circumstance may or may not occur, and so the description includes cases where the circumstance occurs and cases where it does not occur.

[0040] The term "microchannel" as used herein refers to a pathway, e.g., plastic, silicon, or glass, that allows the movement of liquids and gases through a medium. A microchannel can therefore connect to other components, i.e., maintain components "in fluid communication." While the present application is not intended to be limited by the exact dimensions of the channel, illustrative ranges for the channel are as follows: the channel can be 0.1 to 100 μm deep (e.g., 50 μm) and 50 to 10,000 μm wide (e.g., 400 μm). The length of the channel can be 1 mm to 100 mm (e.g., about 27 mm).

[0041] As used herein, the term "polymer" refers to a substance formed from two or more molecules of the same substance. A polymer can also be a linear polymer, in which the molecules are arranged primarily in parallel or nearly parallel chains. In non-linear polymers, juxtaposition of the molecules is not required.

[0042] As used herein, the term "lensless imaging" or "lensless mobile imaging system" refers to an optical configuration that collects images based on electronic signals rather than light waves. For example, a lensless image may be formed by exciting a charge-coupled device (CCD) sensor with light emitted from a light-emitting diode.

[0043] As used herein, the term "charge coupled device (CCD)" refers to a device for transferring electrical charge, typically from within the device, to an area where the charge can be manipulated, e.g., converted into a digital value. A CCD provides digital image processing when using a CCD image sensor, where pixels are represented by p-doped MOS capacitors.

[0044] As used herein, the term "patient" or "subject" refers to a human or animal, and need not be hospitalized. For example, an outpatient, a nursing home resident, or the like, is a "patient." A patient may include humans or non-human animals of any age, and thus includes both adults and minors, i.e., children. The term "patient" or "subject" is not intended to imply a need for medical treatment; thus, a patient or subject may voluntarily or involuntarily participate in an experiment, whether in clinical practice or in support of basic scientific research.

[0045] As used herein, the terms "functionalized" or "chemically functionalized" refer to the addition of functional groups to the surface of a material by chemical reaction. As one of ordinary skill in the art would readily recognize, functionalization can be used in the surface modification of a material to achieve desired surface properties, such as biocompatibility, wettability, etc. Similarly, the terms "biofunctionalization," "biofunctionalized," and the like, as used herein, refer to the modification of the surface of a material to have a desired biological function, as would be readily recognized by one of ordinary skill in the art, such as bioengineering.

[0046] The term "sample" as used herein is used in its broadest sense and includes environmental samples and biological samples. Environmental samples include materials from the environment, such as soil and water. Biological samples can be from animals, including humans; liquids, such as blood, plasma, and serum; solids, such as feces; tissues; liquid foods, such as milk; and solid foods, such as vegetables. Biological samples can include cells, tissue extracts, body fluids, chromosomal or extrachromosomal elements isolated from cells, genomic DNA (in solution or bound to a solid support, such as for Southern blot analysis), RNA (in solution or bound to a solid support, such as for Northern blot analysis), cDNA (in solution or bound to a solid support), etc.

[0047] As used herein, the terms "capture agent," "bioaffinity ligand," "binding component," "ligand," or "receptor" can refer to any of a number of different molecules, biological cells, or aggregates, and these terms are used interchangeably. Each capture agent can be immobilized on a solid substrate and binds to the analyte to be detected. Proteins, polypeptides, peptides, nucleic acids (nucleotides, oligonucleotides, and polynucleotides), antibodies, ligands, sugars, polysaccharides, microorganisms such as bacteria, fungi, and viruses, receptors, antibiotics, test compounds (especially those produced by combinatorial chemistry), plant and animal cell organelles, or portions thereof or other biological entities, can each be a capture agent. Each, in turn, can also be considered an analyte if it binds to a capture agent.

[0048] As used herein, the terms "binding" or "adhering" include any physical attachment or close association, which may be permanent or temporary. Generally, interactions such as hydrogen bonds, hydrophobic forces, van der Waals forces, covalent bonds, and ionic bonds promote physical adhesion between the capture agent and the analyte being measured. The "binding" interaction may be temporary in situations where the binding results in a chemical reaction. This is typical when the binding component is an enzyme and the analyte is a substrate for the enzyme. Reactions resulting from contact between the capture agent and the analyte are also included in the definition of binding for purposes of this application.

[0049] As used herein, the term "DNA template," or "template," refers to a nucleic acid that is used by a polymerase to synthesize a new complementary nucleic acid.

[0050] The term "oligonucleotide" as used herein is defined as a molecule composed of two or more deoxyribonucleotides or ribonucleotides. The exact size depends on many factors, which in turn depend on the ultimate function or use of the oligonucleotide. Oligonucleotides can be prepared by any suitable method, including, for example, cloning and restriction of appropriate sequences and direct chemical synthesis by methods such as phosphotriester method, diethylphosphoramidite method, and solid support method. A review of synthesis methods is given in [Goodchild J., Bioconjug. Chem. Vl (1990), P. 165-187].

[0051] The term "primer," as used herein, refers to a natural or synthetic oligonucleotide that, when duplexed with a polynucleotide template, initiates primer extension and is extended from its 3' end along the template, thereby forming an extended duplex. Primer extension is typically carried out using a nucleic acid polymerase, such as a DNA polymerase or an RNA polymerase. The sequence of nucleotides added in the extension process is determined by the sequence of the template polynucleotide. Primers typically have lengths ranging from 14 to 40 nucleotides or from 18 to 36 nucleotides. Primers are used in a variety of nucleic acid amplification reactions, such as linear amplification reactions using a single primer or polymerase chain reactions using two or more primers. In some embodiments, synthesis of primer extension products complementary to a nucleic acid strand is initiated in the presence of the requisite four different nucleoside triphosphates and a thermostable DNA polymerase in a suitable buffer at a suitable temperature. A "buffer" contains cofactors (such as divalent metal ions) and salts (to provide the appropriate ionic strength) and is adjusted to the desired pH.

[0052] Guidance for selecting primer length and sequence for a particular application is well known to those of skill in the art, as evidenced by the following reference, which is incorporated by reference: Dieffenbach, ed., PCR Primer: A Practical Manual, 2nd Edition (Cold Spring Harbor Press, New York, 2003).

[0053] "Strand displacement activity," as used herein, refers to the phenomenon by which an enzyme, such as a DNA polymerase, separates a paired nucleic acid from its complementary strand in the 5' to 3' direction, along with and near template-dependent nucleic acid synthesis. Strand displacement begins at the 5' end of the paired nucleic acid sequence, and the enzyme thus carries out nucleic acid synthesis. The newly synthesized nucleic acid and the displaced nucleic acid generally have the same nucleotide sequence, which is complementary to the template nucleic acid strand. Strand displacement activity can be located on the same molecule, imparting nucleic acid synthesis, particularly DNA synthesis, activity. As used herein, the "strong strand displacement activity" of a DNA polymerase allows the enzyme to be used to carry out isothermal polymerase reactions, such as those of Bst polymerase.

[0054] "Amplicon" refers to the product of a polynucleotide amplification reaction; i.e., a clonal population of polynucleotides, which may be single-stranded or double-stranded and are replicated from one or more starting sequences. "Amplifying" refers to generating an amplicon by performing an amplification reaction. The one or more starting sequences may be one or more copies of the same sequence, or they may be a mixture of different sequences. Preferably, an amplicon is formed by amplification of a single starting sequence. An amplicon may be generated by a variety of amplification reactions whose products contain copies of one or more starting or target nucleic acids. In some embodiments, the amplification reaction that generates the amplicon is "template-driven," meaning that base pairing of reactants, either nucleotides or oligonucleotides, with their complements in the template polynucleotide is required to generate the reaction product. In some embodiments, the template-driven reaction is primer extension using a nucleic acid polymerase or oligonucleotide ligation using a nucleic acid ligase.

[0055] As used herein, the term "amplifying" means performing an amplification reaction. "Reaction mixture" means a solution containing all of the reactants necessary to perform a reaction, which may include, but is not limited to, buffers, salts, cofactors, scavengers, etc. to maintain the pH at a selected level during the reaction.

[0056] "Bioassay reagents" or "assay reagents" are used interchangeably herein and refer to reagents used to perform analytical reactions in the cartridges of the present invention. Such reagents may include enzymes, enzyme cofactors, primers, bubble-reducing wax, salts, buffers, solvents, agents that modify the secondary structure of analytes, labels (such as fluorescent dyes or fluorescently labeled oligonucleotides), lysis buffers, etc. that make up the reaction mixture. In some embodiments, the assay reagents include reagents for performing isothermal amplification of one or more target polynucleotides.

[0057] "Isothermal amplification," in the context of assays for amplifying target nucleic acids or polynucleotides, refers to a method for replicating a target nucleic acid without the need for thermal cycling. That is, there is no need to subject the reaction mixture to cycles of different temperatures to melt the target nucleic acid strand, anneal primers, and provide extension conditions for the DNA polymerase. Isothermal amplification is typically performed at a preset temperature.

[0058] As used interchangeably herein, the terms "microfluidic" device, "microfluidics" device, or "nanofluidics" device refer to integrated systems for capturing, moving, mixing, dispensing, or analyzing small volumes of liquid, including samples (which in turn contain or may contain cellular or molecular analytes of interest), reagents, diluents, buffers, and the like. Generally, references to "microfluidics" and "nanofluidics" refer to different scales in the size of the instrument and the volumes of liquids handled. In some embodiments, features of a microfluidic device have cross-sectional dimensions of less than a few hundred square micrometers and have passages or channels with capillary dimensions, e.g., maximum cross-sectional dimensions of about 1-2 mm to about 0.1 pm. In some embodiments, a microfluidics device has a volumetric capacity in the range of 100 pL to a few nL, e.g., in the range of 10-100 nL or 100 pL to 1 pL. The dimensions of corresponding features or structures in a nanofluidics device are typically one to three orders of magnitude smaller than those of a microfluidics device. Those skilled in the art will know which dimensionality is appropriate given the circumstances of a particular application. In some embodiments, microfluidic or nanofluidic devices have one or more chambers, ports, and channels that are interconnected and fluidly connected and designed to carry out one or more analytical reactions or processes, either alone or in conjunction with instruments or means that provide supporting functions such as sample introduction, means for driving fluids and / or reagents, e.g., positive or negative pressure, acoustic energy, etc., temperature control, detection systems, data acquisition and / or integration systems. In some embodiments, microfluidic and nanofluidic devices may further include valves, pumps, filters, and specialized functional coatings on interior walls, e.g., to prevent adsorption of sample components or reactants, to facilitate reagent movement by electroosmosis, etc.Such devices may be fabricated as integrated devices in a solid substrate, which may be glass, plastic, or other solid polymeric material, and may have a planar shape that facilitates detection and monitoring of sample and reagent movement, particularly by optical or electrochemical methods. In some embodiments, such devices are disposable after a single use.

[0059] The present disclosure describes an apparatus for analyte detection, as well as methods and systems for using the apparatus in analyte detection. Advantageously, the apparatus enables biomimetic camouflage for sensing and testing biological and non-biological analytes in a sample at high multiplexing, both at the target level by detecting various targets and at the modality level by detecting various modalities, such as color and / or fluorescence.

[0060] In some embodiments, a device for detecting an analyte includes a first detectable agent having one or more detectable characteristics. The device also includes a masking agent having one or more characteristics that mask, e.g., camouflage, the detection of one or more characteristics of the first detectable agent in the absence of the analyte of interest. In the presence of the analyte of interest, the first detectable agent or masking agent can be configured to allow, e.g., decamouflage, the detection of one or more characteristic properties of the first detectable agent, thereby indicating the presence of the analyte.

[0061] In some embodiments, the first detectable agent and / or the masking agent can bind to the analyte when placed in the presence of the analyte. For example, the first detectable agent can be configured to specifically bind to the analyte of interest. One or more characteristics of the first detectable agent are undetectable in the presence of the masking agent when the first detectable agent is not bound to the analyte, and detectable when bound to the analyte.

[0062] Detection of an analyte using the devices described herein can be determined by the formation of an unmasked or unmasked signal area that allows detection of the first detectable agent. In certain embodiments, the masking agent comprises a masking liquid that masks one or more characteristics of the first detectable agent. In representative embodiments, binding of the analyte of interest to the first detectable agent triggers or initiates the formation of the masking agent to form an unmasked or unmasked signal area that indicates the presence of the analyte. The formation of the unmasked or unmasked signal area can be detectable with the naked eye or can occur at the nanoscale. The unmasked or unmasked signal can include one or more visible or invisible fluorescent, magnetic, mechanical, or physical signals.

[0063] 1-23 illustrate an example of an apparatus 10 for the detection of an analyte according to one embodiment. Advantageously, the apparatus 10 can be configured as a point-of-care (POC) diagnostic microfluidic device, allowing for immediate diagnostic feedback, as opposed to the remote laboratory testing typically required for analyte sensing approaches.

[0064] The device 10 includes a substrate to which a first detectable agent is fixed or immobilized, and a masking agent that masks the detection of one or more characteristics of the first detectable agent in the absence of an analyte. At least one of the first detectable agent or masking agent, such as masking liquid 14, can be configured in the presence of an analyte to allow detection of one or more characteristics of the first detectable agent indicative of the presence of the analyte. In some embodiments, binding of the analyte to the first detectable agent can disperse a masking agent, such as masking liquid 14, around the first detectable agent, allowing detection of the first detectable agent indicative of the presence of the analyte.

[0065] The first detectable agent can be applied to a non-porous or porous substrate by either printing or non-printing techniques. In some embodiments, the first detectable agent can have a substantially circular or speckled shape on or within the surface of the substrate 12 and be masked by a masking agent. The first detectable agent can also have a substantially star, triangle, square, rectangle, pentagon, hexagon, heptagon, octagon, or other shape. The first detectable agent can also have a substantially alphanumeric or other representative graphic or symbol shape. First detectable agents, such as speckled first agents, can be prepared from functionalized (e.g., biofunctionalized) or non-functionalized materials. Exemplary materials can include non-particulate or particulate materials, including nanoparticles, microparticles, polymeric materials, and non-polymeric materials.

[0066] In some embodiments, the first detectable agent may include one or more first detectable particles 17 fixed or immobilized on the surface of the substrate 12. For example, the one or more first detectable particles 17 may be attached, functionalized, or chemically functionalized and disposed on the surface of the substrate 12.

[0067] The first detectable particles 17 may be formed from an acrylate polymer. In a typical embodiment, the first detectable particles 17 may comprise colored poly(methyl methacrylate) (PMMA). The outer surface of each of the one or more first detectable particles 17 may also have a layer of PEGylated phospholipid. The PEGylated phospholipid may cover about 1% to about 50%, about 5% to about 30%, about 10% to about 25%, about 18% to about 22%, or preferably about 20% of the outer surface of each of the one or more first detectable particles 17. The PEGylated phospholipid may include, for example, 1,2-distearoyl-sn-glycero-3-phosphorylethanolamine (PEG-DSPE).

[0068] In some embodiments, the one or more first detectable particles may comprise a plurality of microbeads 18, such as colored PMMA microbeads. The microbeads 18 may have a diameter ranging from about 10 μm to about 1 mm. The one or more first detectable particles 17 may be configured to specifically bind to an analyte of interest.

[0069] In some embodiments, the first detectable particle 17 includes a capture agent on the outer surface of the first detectable particle that specifically binds to the analyte. The capture agent may include at least one of a small molecule, a nucleotide, a protein, an antibody, or streptavidin, or a combination thereof. In certain embodiments, the capture agent may include an antibody capable of binding to the analyte. In certain embodiments, the capture agent may include streptavidin.

[0070] In an exemplary embodiment, a capture agent in the presence of an analyte of interest can attach the analyte to the outer surface of one or more microbeads 18. For example, a capture agent located on the surface of a microbead 18 can attach the analyte to the outer surface of the microbead 18 when a liquid sample containing the analyte of interest is loaded onto the substrate of the device 10.

[0071] The capture agent can be directly conjugated to the outer surface of the first detectable particle 17. The capture agent can be covalently or non-covalently functionalized to the first detectable particle 17. In some embodiments, a linker can be used to provide covalent attachment of the capture agent to the outer surface of the detectable particle 17.

[0072] The linker used to provide the covalent bond can be a homobifunctional or heterobifunctional linker, depending on the nature of the molecule being conjugated. Homobifunctional linkers have two identical reactive groups. Heterobifunctional linkers have two different reactive groups. Various types of commercially available linkers are reactive with one or more of the following groups: primary amines, secondary amines, sulfhydryls, carboxyls, carbonyls, and carbohydrates. Examples of amine-specific linkers are bis(sulfosuccinimidyl)suberate, bis[2-(succinimidooxycarbonyloxy)ethyl]sulfone, disuccinimidyl suberate, disuccinimidyl tartrate, dimethyl adipimate 2HCl, dimethyl pimelimidate 2HCl, dimethyl suberimidate HCl, ethylene glycol bis-[succinimidyl-[succinate]], dithiol bis(succinimidyl propionate), and 3,3'-dithiobis(sulfosuccinimidyl propionate). Linkers that react with sulfhydryl groups include bismaleimidohexane, 1,4-di-[3'-(2'-pyridyldithio)-propionamido]butane, 1-[p-azidosalicylamido]-4-[iodoacetamido]butane, and N-[4-(p-azidosalicylamido)butyl]-3'-[2'-pyridyldithio]propionamide. Linkers that react preferentially with carbohydrates include azidobenzoylhydrazine. Linkers that react preferentially with carboxyl groups include 4-[p-azidosalicylamido]butylamine.

[0073] Heterobifunctional linkers reactive with amines and sulfhydryls include N-succinimidyl-3-[2-pyridyldithio]propionate, succinimidyl [4-iodoacetyl]aminobenzoate, succinimidyl 4-[N-maleimidomethyl]cyclohexane-1-carboxylate, m-maleimidobenzoyl-N-hydroxysuccinimide ester, sulfosuccinimidyl 6-[3-[2-pyridyldithio]propionamido]hexanoate, and sulfosuccinimidyl 4-[N-maleimidomethyl]cyclohexane-1-carboxylate. Heterobifunctional linkers reactive with carboxyl and amine groups include 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride. Heterobifunctional linkers reactive with carbohydrates and sulfhydryls include 4-[N-maleimidomethyl]-cyclohexane-1-carboxylhydrazide HCl, 4-(4-N-maleimidophenyl)-butyric acid hydrazide.2HCl, and 3-[2-pyridyldithio]propionylhydrazide.

[0074] In a typical embodiment, the detectable agent or particle can be biofunctionalized with streptavidin (SA) to capture biotin-modified nucleic acid target analytes (e.g., DNA and RNA) and / or with antibodies to capture protein target analytes (e.g., AMR enzymes, antigens, and viral particles). By way of example, biofunctionalization can be performed using a sequential conjugation protocol, which begins with activating the capture agent with well-known N-hydroxysuccinimide (NHS) chemistry, followed by the addition of a 3-(2-pyridyldithio)propionyl hydrazide (PDPH) or adipic acid dihydrazide (ADH) crosslinking molecule. The PDPH-activated capture agent and the ADH-activated capture agent are then available to bind to thiolated SA molecules and oxidized antibody molecules, respectively. Surface 12 or at least one microchannel 30 can be optionally rinsed with PBS before sample processing.

[0075] Alternatively, the capture agent may be non-covalently coated on the outer surface of the first detectable particle 17. Non-covalent deposition of the capture agent on the first detectable particle 17 may involve the use of a polymer matrix. The polymer may be naturally occurring or non-naturally occurring and may be of any type, including, but not limited to, nucleic acids (e.g., DNA, RNA, PNA, LNA, etc., or mimetics, derivatives, or combinations thereof), amino acids (e.g., peptides, proteins (natural or modified), etc., or mimetics, derivatives, or combinations thereof), lipids, polysaccharides, and functionalized block copolymers. The capture agent may be adsorbed onto and / or encapsulated within the polymer matrix. Alternatively, the capture agent may be covalently conjugated or crosslinked to the polymer, e.g., it may be "grafted" to the functionalized polymer.

[0076] One example of a suitable peptide polymer for non-covalent deposition of a capture agent onto the first detectable particle 17 is polylysine, e.g., poly-L-lysine. Additional representative polymers include polyethylene glycol (PEG), polyamide, polycarbonate, polyalkylene, polyalkylene glycol, polyalkylene oxide, polyalkylene terephthalate, polyvinyl alcohol, polyvinyl ether, polyvinyl ester, polyvinyl halide, polyvinylpyrrolidone, polyglycolide, polysiloxane, polyurethane, alkyl cellulose, hydroxyalkyl cellulose, cellulose ether, cellulose ester, nitrocellulose, polymers of acrylic and methacrylic acid esters, methyl cellulose, ethyl cellulose, hydroxypropyl cellulose, hydroxypropylmethyl cellulose, hydroxybutylmethyl cellulose, cellulose acetate, cellulose propionate, cellulose acetate butyrate, cellulose acetate phthalate, carboxyethyl cellulose, cellulose triacetate, sodium cellulose sulfate, poly(methyl methacrylate), poly(ethyl methacrylate), poly(butyl methacrylate), poly(isobutyl methacrylate), poly(hexyl methacrylate), acrylate), poly(isodecyl methacrylate), poly(lauryl methacrylate), poly(phenyl methacrylate), poly(methyl acrylate), poly(isopropyl acrylate), poly(isobutyl acrylate), poly(octadecyl acrylate), polyethylene, polypropylene, poly(ethylene glycol), poly(ethylene oxide), poly(ethylene terephthalate), poly(vinyl alcohol), polyvinyl acetate, polyvinyl chloride, polystyrene, polyhyaluronic acid, casein, gelatin, glutathione Polyanhydrides, polyacrylic acid, alginic acid, chitosan, poly(methyl methacrylate), poly(ethyl methacrylate), poly(butyl methacrylate), poly(isobutyl methacrylate), poly(hexyl methacrylate), poly(isodecyl methacrylate), poly(lauryl methacrylate), poly(phenyl methacrylate), poly(methyl acrylate), poly(isopropyl acrylate), poly(isobutyl acrylate), and poly(octadecyl acrylate), poly(lactide-glycolide), copolyoxalic acid,These may include block copolymers, including polycaprolactone, polyesteramides, polyorthoesters, polyhydroxybutyric acid, polyanhydrides, poly(styrene-b-isobutylene-b-styrene) (SIBS) block copolymers, ethylene vinyl acetate, poly(meth)acrylic acid, polymers of lactic and glycolic acid, polyanhydrides, poly(ortho)esters, polyurethanes, poly(butyric acid), poly(valeric acid), and poly(lactide-co-caprolactone), as well as natural polymers such as alginic acid and other polysaccharides, including dextran and cellulose, collagen, albumin and other hydrophilic proteins, zein and other prolamines and hydrophobic proteins, copolymers and mixtures thereof, and chemical derivatives thereof, including substitution and / or addition of chemical groups, e.g., alkyl, alkylene, hydroxylation, oxidation, and other modifications routinely performed by one of ordinary skill in the art.

[0077] Analytes detected using the device 10 described herein can be components of a biological fluid sample, such as biomolecules found in a biological fluid sample obtained from a subject. Typical biomolecular analytes that can be detected include deoxyribonucleic acid (DNA), ribonucleic acid (RNA), proteins, polypeptides, peptides, polysaccharides, lipids, etc. Further representative biomolecules include genes, gene fragments, messenger RNA (mRNA), hormones, vitamins, enzymes, coenzymes, immunoglobulins, etc. In some embodiments, an analyte, such as a peptide or nucleic acid of interest, can be modified prior to detection using the device 10 to enable binding of the analyte to a capture agent.

[0078] In typical embodiments in which the capture agent comprises streptavidin, an analyte, such as a peptide or nucleic acid of interest, can be biotin-modified prior to detection using device 10 to take advantage of streptavidin's high affinity for biotin, thereby enabling binding of the analyte, or a complex, such as an amplicon or multi-amplicon structure derived from the analyte, to the capture agent.

[0079] In some embodiments, the first detectable agent or particle may be masked or camouflaged using the patterned, pattern-like, or unpatterned presence of a masking agent. As shown in FIG. 13 , in some embodiments, the masking agent may comprise a polymer, magnetic material, or crystal that covers, masks, or camouflages the first detectable agent. In the presence of the analyte of interest, the patterned, pattern-like, or unpatterned properties of the masking agent are altered or modified in a manner that allows the first detectable agent to become detectable, for example, through visual or non-visual detection. Visual detection of the first detectable agent may involve the use of a microscope, an imaging system, or simply the naked eye. Non-visual detection of the first agent may involve fluorescence, ultraviolet (UV), and / or spectroscopic techniques, depending on the composition of the first detectable agent.

[0080] In some embodiments, the masking or unmasking of the first detectable agent may be assisted through the use of external or non-external forces. Exemplary forces may include magnetic, photonic, mechanical, and chemical forces.

[0081] The masking agent can be in the form of a catalyst, a magnet, a photon, a polymer, a mechanical, or a gas. In some embodiments, the masking agent that masks or camouflages the first detectable agent can comprise the biological or non-biological sample itself in which the analyte is to be detected.

[0082] In other embodiments, the masking agent can cover, mask, or camouflage the first detectable agent, which is in a coded format, and changing the characteristics of the masking agent in response to the presence of the analyte allows the code to be revealed, unmasked, or decamouflaged, which can then be decoded. As shown in Figure 15, the surface of the substrate 12 can be printed with various colored shapes or patterns, each color encoding a particular target analyte.

[0083] In some embodiments, the masking agent may comprise a masking liquid 14 that masks or camouflages one or more characteristics of the first detectable agent. In some embodiments, one or more first detectable particles 17 immobilized on the surface of the substrate 12 are covered with the masking liquid 14 in the absence of the analyte.

[0084] In some embodiments, the masking fluid 14 may include a peroxide solution. For example, the peroxide solution may include about 1% to about 20% hydrogen peroxide (w / v), about 5% to about 15% hydrogen peroxide (w / v), and more preferably about 10% hydrogen peroxide (w / v). The masking fluid 14 may also include a surfactant and / or a degassing solvent. The masking fluid 14 may also be formulated as a viscous and / or thick solution.

[0085] In some embodiments, the masking fluid 14 has a color that visually masks or camouflages the appearance of the first detectable particles upon loading of the masking fluid 14 onto the surface of the substrate.

[0086] In other embodiments, the masking agent may comprise a two- or three-phase emulsion. Two-phase emulsions (i.e., water-in-oil (W / O) or oil-in-water (O / W)) have a dispersed phase and a continuous phase. Three-phase emulsions (i.e., water-in-oil-in-water (W / O / W) or oil-in-water-in-oil (O / W / O)) have an internal phase, an external phase (continuous phase), and a dispersed phase. Emulsions can be prepared using mechanical homogenizers and ultrasonic transducers. Mechanical homogenizers use a mechanical stirrer rotating at a constant rpm to create the desired emulsion. As shown in FIG. 14, a two- or three-phase emulsion is loaded onto a substrate having a large number of optically visible microbeads 18 on its surface 12, whereby the emulsion forms a pattern that masks or camouflages the microbeads 18. Upon introduction of a sample containing the target analyte, the target triggers a reaction that converts the emulsion to a non-emulsion form, causing the emulsion to break up at the substrate surface 12. The breakup of the emulsion unmasks, or decamouflages, the microbeads, allowing visual detection of the microbeads 18 on the surface of the substrate 12.

[0087] In some embodiments, device 10 may further include a detection agent 19 that specifically binds to the analyte of interest to form a detection agent-analyte-particle complex. Binding of the analyte of interest to the first detectable agent and detection agent may occur sequentially or simultaneously. For example, the analyte may bind to the first detectable agent prior to subsequent binding to the detection agent to form a first detectable agent-analyte-detection agent complex. Alternatively, the analyte may bind to the detection agent prior to binding to the first detectable agent to form a first detectable agent-analyte-detection agent complex. In other embodiments, the analyte may bind to both the first detectable agent and the detection agent simultaneously or substantially simultaneously to form a first detectable agent-analyte-masking agent complex.

[0088] Simultaneous or sequential binding of a detectable particle, such as a detection agent 19 and a capture agent, to the analyte on the outer surface of the first detectable particle can form a detection agent-analyte-particle complex. In certain embodiments, the detection agent can be masked, e.g., camouflaged, by the masking fluid 14 if the analyte is not bound to both the detectable particle and the detection agent. For example, the masking fluid 14 can visually mask detectable particles 17 that do not form a detection agent-analyte-particle complex.

[0089] In some embodiments, the detection agent 19 of the complex catalyzes the decomposition of the masking liquid 14 into a gas that physically disperses the masking liquid 14 around the complex. This dispersion from catalytic conversion of the masking liquid 14 can form a liquid-free, unmasked signal area, or unmasked area 16, which allows optical detection of the complex on the substrate, thereby indicating the presence of the analyte. For example, the detection agent can include platinum nanoparticles (PtNPs) that target or specifically bind to the analyte or an analyte bound to a first detectable agent or particle. The PtNPs can be conjugated to a targeting moiety, such as, but not limited to, streptavidin, an aptamer, or an antibody targeting moiety. Once the PtNPs are bound to the analyte vial, the targeting moiety can catalyze the decomposition of the peroxide masking liquid into a gas that physically disperses the masking liquid.

[0090] The substrate of device 10, to which the detectable agent or particle is immobilized, may be configured to retain a specific volume of sample to maximize the test sensitivity and overall performance of device 10. As used herein, the term "substrate" refers to a surface and a solid phase. In some cases, the substrate is non-porous and may include glass, plastic, metal, or a non-porous polymeric substrate material. The substrate may also include components including, but not limited to, polydimethylsiloxane (PDMS), silicon, or quartz. The substrate may also be a non-porous substrate, such as, but not limited to, paper, wood, or a porous polymeric substrate material.

[0091] In some embodiments, the substrate may include one or more microchannels 30. The microchannels 30 may extend along at least a portion of the substrate. The microchannels 30 may further include or contain a first detectable particle and a masking fluid. The substrate may include a substantially planar, transparent wall that defines a surface of at least one microchannel 30. The substantially planar, transparent wall, which may be glass or plastic, for example, allows observation within the microchannel 30 by the naked eye or an imaging system to detect one or more characteristics of the first detectable agent or masking agent that are indicative of the presence of an analyte.

[0092] In some embodiments, the microchannel 30 may have a depth or height of 0.5 μm to 1 mm, 10 μm to 500 μm, 100 μm to 400 μm, or 325 μm to 375 μm. The microchannel 30 may have a depth or height of up to 0.5 μm, 1 μm, 10 μm, 100 μm, 200 μm, 300 μm, or greater. In a typical embodiment, the microchannel 30 has a depth or height of approximately 340 μm.

[0093] In some embodiments, the at least one microchannel 30 may have a width of 100 μm to 15 mm, 1 mm to 10 mm, or 6 mm to 8 mm. In a typical embodiment, the at least one microchannel 30 may have a width of about 7 mm. In some embodiments, the at least one microchannel 30 may have a width of 500 μm to 15 mm, 1 mm to 10 mm, or 6 mm to 8 mm. 2 , 1000 μm 2 , 10,000 μm 2 , 20,000 μm 2 , 30,000 μm 2 The sample may have a cross-sectional area, perpendicular to the flow direction of the loaded liquid sample, of or larger than 100 μm.

[0094] Microchannel 30 may include a fluid inlet 31 for receiving a liquid, such as a liquid sample that may include an analyte of interest. Microchannel 30 may further include an outlet 32 ​​for removing the liquid, e.g., the liquid sample, from microchannel 30 after the liquid has been in the presence of the first detectable agent and / or masking agent. In some embodiments, the liquid is removed via fluid outlet 32 ​​after a time sufficient to allow binding of the analyte of interest in the liquid to the first detectable agent and / or masking agent.

[0095] In some embodiments, the substrate may include a multilayer structure formed of a base layer, a microchannel 30, and a cover layer. The multilayer structure may further include an intermediate layer. In some embodiments, a first end of the microchannel 30 may be aligned with a corresponding fluid inlet 31 port, and a second end of the microchannel 30 may be aligned with a corresponding fluid outlet 32 ​​port. This forms a flow path from the fluid inlet 31 port to the corresponding fluid outlet 32 ​​port through the microchannel 30. The microchannel 30 may also extend slightly beyond its respective fluid inlet 31 port and fluid outlet 32 ​​port. The microchannel 30 is sized to accept a volume, e.g., μL or mL, of a liquid sample containing sufficient target analyte in the presence of a first detectable agent and / or a masking agent to enable analyte detection and / or maximize test sensitivity.

[0096] The base layer of the substrate can provide structural support for the microchannels and is formed of a sufficiently rigid, optically transparent, and gas-impermeable material, such as poly(methyl methacrylate) (PMMA) or glass. The base layer can have a suitable thickness, for example, from about 0.1 mm to about 2 mm, or from about 0.6 mm to about 1.6 mm, as dictated by manufacturing and assembly constraints.

[0097] The cover layer may contain fluid inlet 31 and fluid outlet 32 ​​ports used to supply and remove samples from the microchannel 30. The thickness of the cover layer may be about 1 mm to about 10 mm, e.g., about 3.175 mm, and is determined by integration and assembly requirements. The diameters of the fluid inlet 31 and fluid outlet 32 ​​ports may be about 0.3 mm to about 3 mm, e.g., about 1 mm. The lower size limit is determined by manufacturing requirements. The upper size limit is determined by the sample loading conditions into the microchannel 30. In an exemplary embodiment, a laser cutter may be used to cut larger pieces of PMMA to the desired size for the device 10 (e.g., a microfluidic device) and / or to cut holes for the fluid inlet 31 and fluid outlet 32 ​​ports.

[0098] The intermediate layer may be adhered to the base layer around the periphery of the microchannel 30 after the microchannel 30 is disposed on the base layer. A cover layer having substantially the same lateral dimensions as the base layer and any intermediate layer may be adhered to the exposed surface of the intermediate layer, thereby enclosing the microchannel 30. In an exemplary embodiment, the cover layer may be adhered to the base layer using a double-sided adhesive (DSA). In a preferred embodiment, the device 10 is oriented so that the cover layer is on top. Alternatively, the device 10 may be oriented so that the cover layer is on the bottom.

[0099] In some embodiments, the surface of the substrate 12 can be functionalized with a plurality of first detectable particles, which include capture agents on their outer surfaces that specifically bind to and capture or attach the analytes when a sample liquid containing the analytes is loaded onto the surface of the substrate 12 or passed through or perfused through at least one microchannel 30 of the substrate. If the device 10 includes multiple microchannels 30, each microchannel 30 can be functionalized with detectable particles having capture agents capable of attaching different analytes of interest thereto, or even different epitopes of individual analytes of interest thereto. In either case, each microchannel 30 is configured to receive and provide analyte detection analysis of a microvolume of liquid sample.

[0100] Optionally, the device 10 for detecting an analyte may further include one or more second detectable agents. In some embodiments, the second detectable agent may include second detectable particles immobilized on the surface of the substrate 12. The second detectable particles may include a plurality of second capture agents for specifically binding the second analyte. The device 10 may further include a plurality of second detection agents including a second targeting moiety for specifically binding the second analyte. In such cases, binding of the second analyte to both the second detectable particles and the second detection agents forms second detection agent-analyte-particle complexes that form liquid-free zones 16 around the second agent-analyte-particle complexes, allowing for detection of the second agent-analyte-particle complexes on the substrate. In some embodiments, the one or more second detectable particles are a substantially different color from the first detectable particles.

[0101] Another embodiment described herein relates to a method 100 (FIG. 16) for detecting an analyte in a sample. In one example, method 100 can be performed as described above using the apparatus 10 illustrated in FIGS. 1-23. Method 100 is utilized in a wide variety of settings and has numerous applications, for example, in point-of-care environments or for high-throughput analysis.

[0102] At step 110 of method 100, an apparatus is provided. Apparatus 10 generally includes one or more detectable particles immobilized on the surface of a substrate, as described above.

[0103] In step 120, a sample containing an analyte is loaded onto the substrate surface 12, where the analyte binds to one or more particles. The sample loaded onto the surface of the substrate 12 may contain two or more different analytes, and the device 10 may be configured to detect the two or more different analytes from the sample.

[0104] In step 130 of method 100, the bound analyte is labeled with a plurality of detection agents to form a detection agent-analyte-particle complex. In some embodiments, the particles of the detection agent-analyte-particle complex may include microbeads 18 immobilized on the surface of substrate 12, thereby forming a detection agent-analyte-microbead complex on the surface of substrate 12.

[0105] In step 140 of method 100, masking fluid 14 is then loaded onto the surface of substrate 12 to mask or camouflage the one or more first detectable particles of the complex. The first detecting agent of the first detecting agent-analyte-first detectable particle complex on the surface of substrate 12 may then catalyze the conversion of the masking fluid, for example, through catalytic decomposition, to form a masking fluid-free area around the one or more first detectable particles 17 of the complex.

[0106] In step 150 of method 100, one or more first detectable particles 17 are detected in the masking fluid-free area 16 around the particle complex. Detection of one or more first detectable particles 17 on the surface of substrate 12 indicates the presence of an analyte in the sample.

[0107] Detecting the one or more first detectable particles 17 of the complex may include optically detecting the one or more first detectable particles 17 on the surface of the substrate 12 by imaging the surface of the substrate. Optically detecting the one or more first detectable particles 17 may include using any suitable imaging device capable of obtaining an image of the substrate surface. In some embodiments, imaging the surface of the substrate 12 is performed using a camera, such as a camera included as part of a mobile device (e.g., a cell phone, see FIG. 12 ). The method 100 may then further include determining the presence of the first optically detectable particles in at least one image obtained from a masking fluid-free area on the surface of the substrate. In some embodiments, the number of optically detected first detectable particles and / or the size of the masking fluid-free area may be indicative of the total amount and / or concentration of the target analyte in the sample.

[0108] The method 100 for detecting an analyte in a sample may further include a washing step to remove uncaptured analyte and residual sample from the surface of the substrate 12 prior to labeling the bound analyte with a plurality of first detection agents. An additional washing step may be performed to remove unbound first detection agent from the surface of the substrate after allowing a suitable amount of time for binding of the first detection agent to the analyte-first detectable particle complexes.

[0109] In an exemplary embodiment, the analyte detected using method 100 is a nucleic acid, and method 100 further comprises contacting the nucleic acid analyte in the sample with one or more biotin-modified nucleic acid primers specific for the nucleic acid analyte to form a biotinylated nucleic acid target analyte, which is then bound to the outer surface of one or more first detectable particles 17 on the surface of the substrate of device 10 by streptavidin conjugated to the particle.

[0110] The biotin-modified nucleic acid primers can include a set of biotin-modified nucleic acid primers specific to a nucleic acid analyte. In an exemplary embodiment, the set of biotin-modified nucleic acid primers can target different sequences in the nucleic acid analyte. In another embodiment, the set of biotin-modified nucleic acid primers can target overlapping sequences in the nucleic acid analyte.

[0111] In some embodiments, biotin-modified nucleic acid primers can include multi-arm nucleic acid primers.The multi-arm nucleic acid primers for use in the methods or systems described herein can include a single-stranded oligonucleotide sense arm and an antisense arm linked to a core by a flexible linker.The antisense arm complements the antisense sequence of target nucleic acid (e.g., DNA or RNA), and the sense arm complements the sense sequence of target nucleic acid analyte (e.g., DNA or RNA) that is different from and follows the antisense sequence.

[0112] In some embodiments, the multi-armed nucleic acid primer can include a polyethylene glycol (PEG) linker for linking the sense arm to the antisense arm, thereby forming a multi-armed PEG-nucleic acid primer. In some embodiments, the multi-armed primer includes two, three, four, five, or more sense arms and two, three, four, five, or more antisense arms. In certain embodiments, the multi-armed primer includes at least two sense arms and at least two antisense arms. Furthermore, one or more arms are terminally modified with biotin.

[0113] The sense arm and antisense arm can be conjugated to a multi-arm PEG linker using click chemistry, such as maleimide chemistry. The sense arm and antisense arm can be configured to bind to a complementary sequence in the target nucleic acid and form a double-stranded (ds) nucleic acid (e.g., dsDNA) structure of the looped arm mediated by the sense arm. In other embodiments, the antisense arm can prime amplification, followed by self-priming with the sense arm, generating a stem-loop nucleic acid hybrid structure in which the loop is partially formed by the sense arm, the antisense arm, and the linker. The other free antisense arm and sense arm of the multi-arm primer can mediate a self-looping chain, resulting in the formation of a multi-arm amplicon. The multi-arm amplicon can then be used as a template to generate a larger multi-amplicon structure, self-priming to form a new strand and a stem-loop structure. Self-looping can continue until all sense arms are extended into copies of the target analyte sequence.

[0114] In a typical embodiment, as shown in Figure 26(A), a multi-arm nucleic acid primer may comprise a branched PEG molecule having eight side chains, each side chain functioning as an arm of the primer. Each of the individual arms of the multi-arm primer may be functionally modified to facilitate capture of the primer by a capture agent (e.g., a particle conjugated to streptavidin) or to facilitate coupling of the nucleic acid primer sequence. For example, as further shown in Figure 26(A), two of the eight side chains are terminally modified with biotin, and the remaining six are maleimide-modified strands attached to single-stranded (ss) nucleic acid copies that complement either the sense or antisense sequence of the target nucleic acid to form the multi-arm looped primer. In certain embodiments, the single-stranded nucleic acid copies in the multi-arm PEG-nucleic acid primer are 50:50% sense sequence to antisense sequence.

[0115] In some embodiments, the use of multi-arm primers prior to detection using, for example, the device 10 and / or method 100 described herein, allows for rapid amplification of analytes in a sample under isothermal conditions with high efficiency (i.e., a multi-arm primer-based amplification (MAPA) reaction).

[0116] As illustrated in Figure 25, a MAPA reaction method can involve the use of a unique set of three nucleic acid primers targeting a total of four distinct sequences in a target nucleic acid analyte. The three nucleic acid primers for use in a MAPA reaction include an initiation primer (IP) and an unlooped primer (ULP), which complement sequences at the beginning and end of the target nucleic acid analyte, respectively, in addition to a multi-armed PEG-nucleic acid looped primer. The multi-armed nucleic acid looped primer (LP) includes looped sequence 1 (LP1) and looped sequence 2 (LP2), which are designed with antisense and sense nucleic acid oligonucleotides that specifically complement two distinct but subsequent sequences in the target nucleic acid, designated L1 and L2. In a typical embodiment, LP1 and LP2 are each approximately 20-mer long and can be thiolated at their 3' and 5' ends, respectively.

[0117] As further illustrated in Figure 25, a MAPA reaction can begin with the binding or annealing of the antisense arm of a multi-arm PEG-nucleic acid primer to a complementary sequence within a target nucleic acid, followed by the formation of a looped-arm double-stranded (ds) nucleic acid structure (e.g., dsDNA or dsRNA) mediated by the arm bearing the sense sequence. This configuration serves as a template for nucleic acid synthesis through successive cycles of alternating looping and unlooping steps and the formation of multi-arm amplicons that are consumed in the extension step of the MAPA reaction, thereby forming a large multi-amplicon nucleic acid structure. Large multi-amplicon nucleic acid structures generated using a MAPA reaction can be generated in <30 minutes, enabling rapid and specific detection of nucleic acid analytes using the device 10 and / or method 100 described herein. In an exemplary embodiment, multi-arm amplicon nucleic acid structures generated using a MAPA reaction can be generated in less than ...10 minutes. 3 This allows for the specific detection of human immunodeficiency virus-1 (HIV-1) with a sensitivity of up to copies / ml. In some embodiments, the MAPA reaction can be used to amplify target nucleic acid analytes to form biotinylated MAPA amplicons that can be spontaneously captured on streptavidin-conjugated microbeads (see, e.g., FIG. 30), e.g., on the surface of substrate 12 of device 10.

[0118] In some embodiments, multi-arm PEG-nucleic acid primers can be prepared with oligonucleotides targeting different nucleic acid sequences, and such multi-arm nucleic acid primers can be used to amplify different analyte targets in a sample or different epitopes on the same target analyte simultaneously using MAPA reaction amplification.

[0119] In other embodiments, alternative nucleic acid amplification methods can be used to amplify target nucleic acid analytes in a sample prior to detection using the device 10 and / or method 100 described herein. Alternative nucleic acid amplification methods can include polymerase chain reaction (PCR) or another isothermal amplification method in addition to the MAPA reaction amplification method described herein. For example, a variety of isothermal nucleic acid amplification methods have been developed to avoid the additional components required for thermal cycling required for PCR. Alternative isothermal amplification techniques can be used in the present invention, including, but not limited to, nucleic acid sequence-based amplification (NASBA), transcription-mediated amplification (TMA), self-sustained sequence replication (3SR), signal-mediated RNA amplification technology (SMART), strand displacement amplification (SDA), rolling circle amplification (RCA), loop-mediated isothermal amplification of DNA (LAMP), isothermal multiple displacement amplification (TMDA), helicase-dependent amplification (HDA), single primer isothermal amplification (SPIA), circular helicase-dependent amplification (cHDA), and recombinase polymerase amplification (RPA).

[0120] Isothermal nucleic acid amplification methods can include the use of a nucleic acid polymerase with high strand displacement activity to enable nucleic acid amplification at a constant temperature (i.e., isothermal amplification). Additional reagents for use in isothermal amplification can include deoxynucleoside triphosphates (dNTPs) and an appropriate buffer. In a further embodiment for amplifying an RNA target biomolecule analyte, the reagents for use in isothermal amplification can include a reverse transcriptase. Typically, a method for amplifying a nucleic acid target analyte using isothermal amplification includes providing a primer, such as a multi-arm primer described herein, and annealing the primer to a target nucleic acid analyte (e.g., DNA or RNA). After annealing to the nucleic acid target sequence, the primer can be extended using a polymerase with strand displacement activity to form a nucleic acid template.

[0121] Typical high strand displacement activity nucleic acid polymerases for use in isothermal nucleic acid amplification methods include both naturally occurring and artificially synthesized nucleic acid polymerases. Typical high strand displacement activity polymerases include, but are not limited to, natural polymerases such as Bst, BSU, and Phi29, as well as artificial polymerases such as the thermostable or heat-stable DNA polymerase SD polymerase. In certain embodiments, the high strand displacement activity nucleic acid polymerase for use in the isothermal nucleic acid amplification methods described herein prior to detection is Bst. Bst DNA polymerase, or Bacillus stearothermophilus DNA polymerase I, is a typical member of polymerase family A, and its structure is similar to that of Taq DNA polymerase or other members of this family.

[0122] Still other embodiments described herein relate to a system 40 (see FIG. 31 ) that includes the device 10 described above, an imaging system 42 (e.g., a camera), a processor 44 (e.g., a microprocessor), and one or more non-transitory computer-readable media 46 that store executable instructions and data. The system 40 enables the microprocessor 44 to access the media 46 and execute instructions for performing a method for detecting an analyte, preferably according to the method 100 described herein. The executable instructions may include a camera interface configured to direct the camera to capture at least one image, e.g., an image of the surface substrate 12 of the device 10.

[0123] A system including the above-described apparatus 10 may also include an imaging system 42 that optically detects one or more characteristics of the first detectable agent or masking agent that are indicative of the presence of the analyte after the analyte-containing liquid sample is loaded onto the surface of the substrate 12.

[0124] In some embodiments, the imaging system 42 can detect unmasked or decamouflaged particles in the masking fluid-free areas 16 on the surface of the substrate 12 after an analyte-containing liquid sample has been loaded onto the surface of the substrate 12. The imaging system 42 can be a lens-based imaging system, a lensless imaging system, and / or a mobile imaging system, such as a cell phone camera. The imaging system 42 can include a controller, which can include a computer-readable storage device and a processor that analyzes images of the surface of the substrate 12 and provides real-time feedback to the subject on the results of the image acquisition / analysis. These results, in turn, can be readily transmitted to a primary care provider and / or stored in a medical record database.

[0125] In some examples, the imaging system 42 can be a lens-based imaging system or a lensless / mobile imaging system. In some embodiments, the lensless imaging system can be a CCD sensor and a light-emitting diode. In some embodiments, the lensless imaging system can include a fluorescent motorized microscope equipped with a fluorescent microscope camera and imaging and analysis software to obtain real-time microscopic images. In some embodiments, the acquired video images can be converted to single-frame images for further processing and analysis. In some embodiments, the images can then be analyzed using Adobe Photoshop software (San Jose, CA).

[0126] In some examples, a mobile imaging and quantification algorithm may be integrated into or with the device 10. The algorithm may achieve reliable and reproducible test results for data collected at all resource settings of the device 10.

[0127] In some embodiments, apparatus 10 can be configured as a microfluidic device that cooperates with a mobile device, such as a mobile phone with imaging capabilities. In such cases, the mobile phone includes image analysis algorithms / software or can acquire image analysis algorithms / software, for example, through an online application. The image is reproduced by the mobile phone's camera software and loaded into a custom mobile phone application that identifies one or more characteristic features of the first detectable agent or masking agent in the image that indicate the presence of the analyte, such as one or more first detectable particles 17 in areas 16 that are free of masking fluid, and displays the results.

[0128] In some embodiments, images obtained from the imaging system 42 may be sent to a control device that includes a computer-readable storage medium 46 for storing executable instructions and data such as images, and a microprocessor 44 for accessing the medium and executing the instructions to capture the images. The images may be correlated with the presence of an analyte using the processor 44 or another processor.

[0129] Image processing may be performed using hardware, software, or a combination thereof. When implemented in software, the software code may be executed on any suitable processor or collection of processors, whether provided on a single computer or distributed across multiple computers. Such processors may be implemented as integrated circuits, comprising one or more processors in a single integrated circuit component. However, the processor may be implemented using circuitry in any suitable form.

[0130] Furthermore, it should be appreciated that a computer may be embodied in any of a number of forms, such as a rack-mounted computer, a desktop computer, a laptop computer, or a tablet computer. Additionally, a computer may be embedded in devices not generally considered to be computers but equipped with suitable processing capabilities, including personal digital assistants (PDAs), smartphones, or any other suitable portable or fixed electronic device.

[0131] A computer may also have one or more input and output devices. These devices can be used, among other things, to display a user interface. Examples of output devices that can be used to provide a user interface include a printer or display screen for visual presentation of the output and a speaker or other sound-generating device for audible presentation of the output. Examples of input devices that can be used for a user interface include a keyboard and pointing devices, such as a mouse, touchpad, and discretization tablet. As another example, a computer may receive input information through voice recognition or other audible formats.

[0132] Such computers may be interconnected by one or more networks in any suitable form, including local or wide area networks, such as an enterprise network or the Internet. Such networks may be based on any suitable technology and operate according to any suitable protocol, and may include wireless networks, wired networks, or fiber optic networks.

[0133] Also, the various methods or processes outlined herein may be coded as software executable on one or more processors using any one of a wide variety of operating systems or platforms. Furthermore, such software may be written using any of a number of suitable programming languages ​​and / or programming or scripting tools, and may also be compiled as executable machine code or intermediate code that runs on a framework or virtual machine.

[0134] In this regard, computer-readable medium 46 (or multiple computer-readable media) (e.g., computer memory, one or more floppy disks, compact disks (CDs), optical disks, digital video disks (DVDs), magnetic tape, flash memory, circuitry in field programmable gate arrays or other semiconductor devices, or other non-transitory tangible computer storage media) may be coded with one or more programs that, when executed on one or more computers or other processors, perform methods that implement the various embodiments described herein. Computer-readable medium or medium 46 may be portable such that the program or programs stored thereon can be loaded into one or more different computers or other processors that perform various aspects described herein. As used herein, the term "non-transitory computer-readable recording medium" encompasses only computer-readable media that may be considered an article of manufacture (i.e., an article of manufacture) or machine.

[0135] The terms "program" or "software" are used herein in a general sense to refer to any type of computer code or set of computer-executable instructions that can be used to program a computer or other processor to perform various aspects as described above. Furthermore, in accordance with one aspect of this embodiment, it should be recognized that one or more computer programs, when executed to perform the methods described herein, need not reside on a single computer or processor, but may be distributed in a modular manner among a number of different computers or processors to perform various aspects herein.

[0136] Computer-executable instructions may exist in many forms, such as program modules, executed by one or more computers or other devices. Generally, program modules include routines, programs, objects, components, data structures, etc. that perform particular tasks or implement particular abstract data types. Typically, the functionality of the program modules may be combined or distributed as desired in various embodiments.

[0137] Any suitable analyte may be evaluated using the method 100, system 40, and / or device 10 described herein, generally provided that a sample containing the analyte of interest is obtained. The sample may be obtained directly or indirectly by collecting a biological sample from a subject. For example, a biological sample may be obtained by obtaining a tissue or fluid sample (e.g., blood draw, bone marrow sample, spinal tap) from a subject (e.g., at a point-of-care facility, e.g., a clinic, hospital, laboratory facility). Alternatively, a biological sample may be obtained by receiving a biological sample from one or more individuals who have obtained the sample directly from the subject (e.g., at a laboratory facility). A biological sample may be, for example, tissue (e.g., blood), saliva, cerebrospinal fluid (CSF), bile, bone marrow aspirate, breast milk, plasma, serum, sputum, stool, synovial fluid, urine, and oral, nasal, and / or vaginal fluid from one or more subjects.

[0138] In further embodiments, the presence and / or amount of analyte detected in a biological sample using the system 40, method 100, or device 10 described herein is compared to a standard or control to indicate whether the subject has a condition or disease; and, optionally, to diagnose the subject as having the condition or disease based on the results. A suitable standard or control may be the amount of analyte detected using device 10 obtained from a subject identified as not having the condition or disease.

[0139] The foregoing are examples of the present invention. Of course, for purposes of describing the present invention, it is not possible to describe every conceivable combination of components or methodologies, but one of ordinary skill in the art will recognize that many additional combinations and permutations of the present invention are possible. Accordingly, the present invention is intended to embrace all such alterations, modifications, and variations that fall within the spirit and scope of the appended claims.

[0140] Example 1 We have developed a novel type of camouflage-based microfluidic (CamoChip) device and system for point-of-care diagnostics that enables sample loading testing within minutes. The device and system integrate microfluidics, nanotechnology, surface chemistry, and AI image analysis to create biomimetic detection of target biomarkers on a chip. It uses a microchip loaded with colored beads functionalized with target-specific molecules (i.e., antibodies or oligonucleotides) that are embedded in a similarly colored peroxide liquid to mask their color. In the absence of the target biomarker, the beads remain masked by the color of the liquid (i.e., camouflaged—visually invisible). In the presence of the target biomarker, it triggers the rapid accumulation of PtNPs on the bead surface, which catalyzes the conversion of the surrounding liquid to a gas, unmasking the bead by forming a colorless region around the bead (i.e., decamouflaged—visually visible). The beads are 300 μm in size for easy visual detection with simple optical systems, such as a cell phone, and are available in one or multiple colors for easy multiplex testing. In this example, HIV-1 RNA is complexed with a set of DNA primers that target multiple conserved HIV-1 sequences (e.g., the HIV-1 pol-integrase and LTR genes) and are end-modified with biotin and digoxigenin. The formed complexes with biotin and digoxigenin are captured on the surface of dark blue beads modified with anti-biotin monoclonal antibodies (anti-biotin mAb) and labeled with PtNPs modified with anti-digoxigenin monoclonal antibodies (anti-digoxigenin mAb). The surface of the beads is further engineered using a novel interfacial chemistry that employs a PEGylated phospholipid polymer of 1,2-distearoyl-sn-glycero-3-phosphorylethanolamine (DSPE). The hydrophobic nature of DSPE promotes rapid repulsion of the blue-colored liquid from the surface of the beads, which is necessary for the effective accumulation of O2 gas around the beads as a clear zone for unmasking the beads.The CamoChip approach provides a novel system for non-amplification-based VL testing without the need for staining or multi-step labeling (a major challenge for effective testing and monitoring at the point of care). The use of bead arrays supports high sensitivity and specificity combined with the simplicity of colorimetric analysis, forming a groundbreaking test for HIV RNA at the point of care.

[0141] Our approach is fundamentally different from all existing techniques, enabling rapid visual detection of multiple targets in a fast, accurate, low-cost, and simple manner. The localized accumulation of gas signals creates transparent regions of various sizes around the beads, making optical detection of target biomarker molecules more sensitive than other sensing approaches that utilize color (e.g., ELISA) and fluorescent (e.g., PCR) labels. In current approaches, the generated color or fluorescent signal is typically diffused across a relatively large sample volume, resulting in lower detection sensitivity and sensing efficiency. Furthermore, the color-coded bead characteristics of this approach enable easy and efficient integration of the chip with AI-based image analysis systems. This supports a powerful, versatile modality that can be applied to simple camera-driven optical systems. Such advances are an important step toward true point-of-care and self-diagnosis.

[0142] Experiments and Results CamoChip design and development The CamoChip requires two main components for sample testing: (i) a microchip loaded with colored beads (i.e., bearing antibodies or DNA) whose surfaces are functionalized to capture target molecules on the chip, and (ii) Pt-nanoprobes prepared with catalytically active PtNPs whose surfaces are functionalized with target-specific molecules (i.e., antibodies or DNA) to label the targets captured on the beads and form transparent regions. The two components form a ternary PtNP-target-bead complex on the surface of the chip in the presence of the target molecules. To enable highly specific formation of this complex on the chip, a working protocol incorporating the following steps was followed: (i) loading the sample onto the chip and capturing the target on the surface of the antibody-modified colored beads, (ii) target labeling with antibody-functionalized PtNPs (i.e., Pt-nanoprobes) on the chip, and (iii) loading the chip (with the PtNP-target-bead complex) with a colored peroxide solution. In the presence of target, Pt-nanoprobes on the surface of the beads catalyze the conversion of a colored peroxide solution, which masks the beads and releases O2 gas that accumulates around the beads, displacing the liquid and unmasking the beads, allowing them to be easily visualized and detected by a portable, low-cost digital platform.

[0143] Following this design and working protocol, we developed and optimized a CamoChip with blue and red bicolor beads coded for HIV-1 RNA and HIV-1 p24 capsid protein, using human immunodeficiency virus (HIV)-1 as a model clinical target.

[0144] To prepare the microchip, 3 mm of laser-machined poly(methyl methacrylate) (PMMA) (3.175 mm; McMaster-Carr) was assembled onto a glass substrate (25 × 75 mm; Globe Scientific) using a double-layered double-sided adhesive (DSA) (170.18 μm; 300LSE, 3M) to form a single microfluidic channel measuring 7 mm in width and 340 μm in depth. The glass surface of the microchip was first assembled with the DSA layer, and the microfluidic channel was then modified with a layer of liquid plastic (200 μm thick) embedded with biofunctionalized colored microbeads, leaving 200 μm of plastic and 100 μm of free surface for target capture (Figure 17). A PMMA layer was added on top of the DSA to form the inlet and outlet of the microfluidic channel. The bead colors were used to encode specific hapten molecules, and all beads of the same color were surface-functionalized with the same target-specific ligand, enabling highly efficient target capture. The blue beads were surface-functionalized with streptavidin (SA) to capture biotin-modified HIV-1 RNA, while the red beads were surface-functionalized with an anti-HIV-1 p24 monoclonal antibody to capture p24. The carboxylated surfaces of the beads were biofunctionalized using a sequential conjugation protocol, which began with surface activation using well-known NHS chemistry, followed by the addition of a crosslinking molecule, 3-(2-pyridyldithio)propionyl hydrazide (PDPH) on the blue beads or adipic acid dihydrazide (ADH) on the red beads. The PDPH-activated and ADH-activated beads were then conjugated with thiolated SA molecules (Nanocs) and oxidized HIV-1 p24 antibody molecules (Abcam), respectively. The surface modification of the various beads was confirmed using UV-vis, fluorescence spectroscopy, FT-IR, and sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) techniques (Figure 18). UV-vis absorbance confirmed the conjugation of p24 antibody with an average concentration of 0.16 ± 0.01 mg / ml to the surface of the beads (Figure 18B).After staining the surface of the beads with FITC-modified G protein, fluorescence microscopy showed a strong green fluorescent signal (Figure 18B). FT-IR analysis showed that the p24 antibody-functionalized red beads exhibited many bands similar to those of p24 anti-IgG: 1635 cm; -1 Amide group I (CO stretching vibration of peptide bond) at 1405 cm -1 The absorption band of amide II group around 2800 cm was observed, proving the successful surface modification of the beads (Figure 18). -1 ~3000cm -1 The peaks are due to the stretching vibrations of alkyl groups, which are characteristic of lipid structures, reflecting efficient bead surface modification with DSPE (Figure 19D). The SDS-PAGE pattern of anti-p24 IgG showed the presence of major protein bands at 120 kDa for undigested IgG, and at approximately 50 kDa and 25 kDa, which are characteristic of the IgG heavy and light chains of digested IgG, respectively (Figure 19E). The results for streptavidin-beads showed only one protein band at approximately 13 kDa, representing the streptavidin subunit.

[0145] To prepare Pt-nanoprobes, citrate PtNPs were conjugated to a monoclonal anti-biotin antibody to label biotinylated HIV-1 nucleic acid captured on blue beads or HIV p24 (complexed with biotinylated anti-p24 antibody) captured on red beads. The well-known thiol-metal binding method was used to prepare both sets of Pt-nanoprobes (Figure 19). Transmission electron microscopy (TEM) and the corresponding particle size distribution histogram show that the synthesized PtNPs are spherical with an average diameter of 4.57 ± 1.8 nm (Figure 19). The color of the PtNP solution did not change after the coupling reaction, and no turbidity was visible, suggesting the stability of the PtNPs throughout the preparation reaction. This was confirmed using ultraviolet-visible (UV-vis) spectroscopy, which showed no significant changes in the absorption spectrum of the PtNPs after surface modification (Figure 19). The efficiency of the coupling reaction of streptavidin and antibody to the surface of PtNPs was evaluated by agarose gel electrophoresis and UV-vis spectroscopy. Agarose gel electrophoresis showed that the migration of PtNPs was slightly retarded after conjugation of streptavidin or monoclonal antibodies compared to unmodified PtNPs (Figure 19), suggesting that the addition of antibodies to their surface partially interferes with the electrophoretic behavior due to differences in size, mass, and charge density between PtNPs and antibody-PtNP conjugates (i.e., Pt-nanoprobes). These results provide evidence of successful conjugation of PtNPs with streptavidin and antibody molecules on the surface of the beads.

[0146] CamoChip performance testing and validation To test the proposed CamoChip, we used a microchip prepared with blue beads functionalized with SA and HIV-1 RNA as model targets (Figure 20). 7Phosphate-buffered saline (PBS) samples spiked with RNA at a concentration of 100 copies / ml were initially tested and used to optimize the CamoChip protocol. The HIV-1 RNA sample was first mixed with a set of biotin-modified DNA primers targeting various sequences in the HIV-1 RNA and thermally hybridized by heating to 80°C for 5 minutes to form highly biotinylated RNA targets. An aliquot of the resulting mixture was loaded onto the chip and incubated for 15 minutes to allow capture of nucleic acids on SA-functionalized beads, followed by a washing step to remove unbound nucleic acids. Pt-nanoprobes (SA-PtNPs) were then loaded onto the chip to label the nucleic acids captured on the beads. After washing, a camouflaging blue peroxide solution was loaded onto the chip to mask the blue beads. Clear zones began to form, and the beads became visible within 5 minutes of incubation at room temperature. We noticed that the formation of clear zones around the beads began within 30 seconds of incubation at room temperature (Figure 20). However, the incubation time was optimized to 5 minutes, at which point all beads and surrounding colorless areas were fully visualized and easily detectable. The camouflaging peroxide solution formulation was also optimized to contain 10% H2O2. Various concentrations of H2O2 were tested, with 10% being the concentration that provided the optimal kinetics for gas formation and accumulation around the beads in the form of clear areas. Various bead surface coverages with PEG-DSPE ligands were also tested to create the partial hydrophobicity required to promote liquid displacement and gas concentration around the beads. It was found that 20% coverage of the bead surface was necessary for the generated O2 gas to form colorless areas.

[0147] To test the detection specificity of the optimized CamoChip, 6The performance of the SA-functionalized blue bead-loaded chip was tested in the presence of target HIV-1 RNA at a concentration of 100 copies / ml as well as other non-target viruses, including hepatitis C virus (HCV) RNA and hepatitis B virus (HBV) DNA (Figure 21). All beads remained unmasked by the colored peroxide solution after >5 minutes of incubation with all non-target viruses, confirming the specificity of the developed CamoChip for target HIV-1 RNA testing.

[0148] To test the detection sensitivity of the optimized CamoChip, 9 ~10 1 The performance of the chip loaded with SA-functionalized blue beads was tested using serial dilutions of HIV-1 RNA in copies / ml. Each dilution was mixed with a set of biotin-modified oligonucleotides and tested using the optimized CamoChip protocol. The number of beads and the size of the clear zone formed around the beads were measured and correlated with the HIV-1 RNA concentration tested. These results suggested that the number of visible beads increased with increasing tested RNA concentration. More than 90% of the beads were visible within 10 9 Visibility was observed at the highest tested concentration of 100 copies / ml, with the limit of detection being near 100 copies / ml. Furthermore, the mean percent decamouflage efficiency increased proportionally with the tested concentration, with a minimum of 22.2 ± 4.8% of beads at 100 copies / ml (Figure 21C).

[0149] To verify the performance of CamoChip, 0 ~10 9Fifty samples of PBS and human plasma spiked with HIV-1 RNA at final concentrations ranging from 0.01 to 0.01 copies / ml were used (Figure 21). Samples were tested using the optimized CamoChip in parallel with the "gold standard" technique of RT-PCR. Receiver operating characteristic (ROC) analysis showed that an HIV-1 RNA concentration of >80 copies / ml yielded an optimal sensitivity of 92.11% with a CI of 78.6 to 98.3% for the CamoChip and a specificity of 100% with a CI of 73.5 to 100%. At this threshold, the area under the curve (AUC) was 0.987, with an exact binomial CI ranging from 0.905 to 1.0 (Figure 22).

[0150] To determine the efficiency of the developed CamoChip for multiplex testing, HIV-1 RNA and HIV-1 p24 antigen were used as model targets. CamoChips were prepared with blue beads functionalized with SA and red beads functionalized with anti-HIV p24 polyclonal antibodies loaded onto the chip and incubated for 15 min. After washing, biotinylated HIV-1 RNA (at a concentration of 10 6 A mixture of HIV-1 p24 (at a concentration of 1 ng / ml) complexed with HIV-1 mAb (at a concentration of 1 ng / ml) and biotinylated anti-p24 mAb was loaded onto the chip for target capture. The captured targets were then labeled with Pt-nanoprobes (i.e., PtNPs modified with anti-biotin mAb). The microchip was then loaded with a colored peroxide solution and incubated for 5 min. Blue and red beads and the formed clear zones could be visually detected (Figure 23).

[0151] Example 2 Multi-arm prime-looping and amplification of nucleic acids This example describes the development of a simple, easy-to-design, rapid, and specific isothermal amplification method for nucleic acids that significantly reduces the risks and challenges associated with their implementation into advanced platforms for nucleic acid analysis and testing. The novel isothermal amplification method uses a relatively simplified design using multi-arm polymer-based DNA primers to rapidly amplify target nucleic acids with high efficiency and specificity. A novel multi-arm primer-based amplification (MAPA) method for nucleic acids rapidly amplifies target nucleic acids with high efficiency under isothermal conditions. The method is based on the use of a unique set of three DNA primers that target a total of four distinct sequences in the target DNA. One multi-arm DNA primer is designed with eight polyethylene glycol (PEG) arms, each carrying a single-stranded (ss) DNA copy that complements the sense or antisense sequence of the target DNA (n=6 with 50:50% sense to antisense DNA, two with biotin groups). Two single-stranded DNA primers complement sequences at the beginning and end of the target DNA. The MAPA reaction begins with binding of the antisense arm to a complementary sequence in the target DNA, followed by the formation of a looped-arm dsDNA structure mediated by the arm bearing the sense sequence. This serves as a template for the formation of multi-arm amplicons that are consumed in the DNA synthesis and extension steps of the reaction through successive cycles of alternating looping and unlooping steps, forming large multi-amplicon DNA structures. These amplicons occur in <30 min and can be generated in 10 3 It allows for rapid and specific detection of nucleic acid targets such as human immunodeficiency virus-1 (HIV-1) with a sensitivity down to copies / ml.

[0152] material and method Target sequences and DNA oligonucleotides A nucleic acid target of the HIV-1 pol-integrase gene, a well-conserved region of the HIV-1 genome, was used as a template for MAPA development and testing. The HIV-1 target sequence was prepared and cloned into pUCIDT-AMP using gene synthesis services from Integrated DNA Technologies. A set of three primers was designed based on the sequence of the target region available in GenBank accession numbers K02013 (4720-4910). The 15-mer initiating primer (IP) targets the sequence 4720 to 4720: 5'-GGTAAGAGATCAGGCTGAACATC-3' (SEQ ID NO: 1). The multi-arm DNA looping primers (LP) consisted of the complementary sequences of L1 (4720-4720; 20-mer of 5- / 5ThioMC6-D / AGACAGCAGTACAAATGGCA-3) (SEQ ID NO: 2) and L2 (CCCCAATCCCCCCTTTTCTT / 3ThioMC3-D) (SEQ ID NO: 3), which were thiolated at the 3' and 5' ends, respectively. Two 15-mer DNA unlooping primers (ULP and ULP`) were tested in this study. ULP targets the sequence from 4720 to 4720: 5'-CTGCTGTCCCTGTAATAAACCC-3' (SEQ ID NO: 4), while ULP` targets the sequence from 4720 to 4720: 5'-AGTGCAGGGGAAAGAATAGTAGAC-3' (SEQ ID NO: 5).

[0153] Synthesis and characterization of multi-armed DNA primers Multi-armed looped DNA primers were prepared using an eight-arm heterobifunctional PEG molecule, with two arms terminating in biotin groups and six arms bearing maleimide groups that can be readily coupled to thiolated DNA oligonucleotides (i.e., L1 and L2) through well-known thiol-maleimide conjugation chemistry. The detailed protocol involves three major steps: (1) DNA activation, (2) DNA coupling to the multi-arm PEG molecule, and (3) washing and concentration of the DNA primer. Activation of thiolated L1 and L2 was performed using a tris(2-carboxyethyl)phosphine (TCEP) reduction step at room temperature for 2 h. Reduced DNA oligonucleotides (i.e., L1 and L2 with free thiol groups) were mixed with PEG solution at a 50:1 ratio and incubated for 2 h in pH 7.4 phosphate buffer. The prepared multi-armed DNA-PEG conjugates were washed and concentrated using a 10 kDa centrifugal filter unit. The prepared multi-arm PEG-DNA primer conjugates were characterized using agarose gel electrophoresis, UV-vis, and FT-IR spectroscopy techniques.

[0154] MAPA reaction and conditions MAPA reactions were performed in a 25 μl volume (total) containing the following components: 0.4 μM IP primer, 1.6 μM each LP and ULP primer, 0.4 M betaine (Sigma-Aldrich, St. Louis, MO), 10 mM MgSO, 1.4 mM dNTPs, 1× ThermoPol reaction buffer (New England BioLabs, Ipswich, MA), 8 U of Bst DNA polymerase (New England BioLabs), and 1 μl of target nucleic acid. MAPA amplification was performed using a Bio-Rad T100 thermal cycler (Bio-Rad, Foster City, CA). The reaction mixture was heated to 65°C for 30 minutes and then held at 90°C for 3 minutes to terminate the reaction. Negative controls, including technical controls to check for cross-contamination, were included in each run. The identity of the amplified DNA products was determined by gel electrophoresis on a 2% agarose gel, followed by staining with GelRed stain and visualization on a UV transilluminator.

[0155] Specificity and sensitivity of HIV-1 amplification The specificity and sensitivity of the MAPA reaction were tested using HIV-1 RNA sequences cloned into pUCIDT-AMP. The MAPA reaction was optimized by evaluating a range of amplification temperatures (65°C to 69°C). Additionally, the minimum amplification time required for maximum sensitivity was tested at various time points. Target DNA was added to the reaction in 10-fold dilutions, and amplification was carried out for 20, 25, 30, 35, or 40 minutes. Amplification specificity was tested using FABP4 and FABP3 plasmids as nonspecific targets and the optimized MAPA reaction conditions.

[0156] Results and Discussion We developed an isothermal nucleic acid amplification reaction based on the use of specially designed multi-armed DNA primers to amplify target nucleic acid sequences with high specificity and sensitivity. Together with a pair of primers (i.e., IP and ULP), these arms are extended into a multi-armed amplicon, which is ultimately extended into a multi-amplicon structure. The DNA arms of the developed primers are designed with antisense and sense DNA oligonucleotides (each 20-mer long) that specifically complement two distinct but subsequent sequences in the target DNA (Figure 24). Multiple copies (n = 3) of each DNA oligonucleotide are linked to a highly branched polymer molecule of polyethylene glycol (PEG) (n = 8, three arms with sense DNA sequences, three arms with antisense DNA sequences, and two arms terminated with biotin groups), which connects the different DNA arms and provides support for dynamic and flexible interaction with the target DNA (Figure 25). The DNA sequence is designed so that the antisense DNA arm primes amplification and subsequently self-primes with the sense DNA arm (linked to the antisense arm by PEG), generating a stem-looped PEG-DNA hybrid structure in which the loop is partially composed of ssDNA and two PEGs. The other free PEG arms (n = 4) carrying DNA mediate a chain of self-looping, resulting in the formation of a multi-arm amplicon, which is ultimately used as a template in the extension step to generate a larger multi-amplicon structure. In the self-looping step, the free DNA arm carrying the antisense sequence reverses the existing loop (benefiting from the flexibility and extensibility of PEG as a backbone polymer) and self-primes for the formation of a new strand and stem-looped structure. The self-looping cycle continues until all DNA arms carrying the sense sequence (L2) are extended into copies of the target sequence.Simultaneously, binding of the unlooping primer (ULP) stimulates unlooping of the extended arm and the formation of a sense DNA strand with the complementary sequence of the antisense arm (Lc1), which provides the amplification template for extending the sense arm (L1), and the subsequent formation of a multi-arm amplicon structure (Figure 25).

[0157] To synthesize multi-armed DNA primers, we rely on well-known maleimide-thiol coupling chemistry to guide the controlled, directional conjugation of L1 and L2 DNA oligonucleotides with PEG. The molar ratio of PEG1:DNA oligonucleotide (L1 and L2, respectively) in the coupling reaction was controlled at 50:50 to ensure the availability of excess DNA for conjugation with PEG and an equal ratio of L1 to L2. In our primer design, we used an eight-arm PEG (with six maleimides and two biotin termini) with a relatively high molecular weight of 20 kDa to provide sufficient arm length (100–200 nm) required for dynamic binding and dissociation during the amplification process of target DNA using Bst polymerase. The efficiency of the PEG-DNA coupling reaction was evaluated using magnetic separation and agarose gel electrophoresis. These results suggested that streptavidin (SA)-modified magnetic beads could bind to the free biotin groups on the PEG-DNA primers (L1 and L2), and the MB-PEG-DNA conjugates formed appeared to be large enough to migrate in the agarose gel and concentrated in the sample loading well of the agarose gel with a faint fluorescent signal from the PEG-DNA. In contrast, SA-modified magnetic beads reacted only with DNA oligonucleotides (L1 and L2, without PEG) and were able to migrate in the gel, and the DNA primers appeared as completely separated bands on the gel (Figure 26). Furthermore, UV-vis spectroscopy of the washed multi-armed DNA primers (i.e., PEG-DNA conjugates) confirmed the presence of a characteristic absorption peak for PEG around 112 nm and a characteristic absorption peak for DNA oligonucleotides around 272 nm, confirming stable coupling of PEG and DNA and the formation of the multi-armed DNA primer (Figure 26B).

[0158] To test the activity of the developed multi-arm DNA primers, a series of MAPA reaction mixtures were prepared containing (i) DNA polymerase, (ii) DNA primer pairs of IP and ULP, (iii) deoxyribonucleotide triphosphates (dNTP), and (iv) magnesium salts of MgSO4, mixed in 1× isothermal amplification buffer. To avoid non-specific binding of the primers that may occur with polymerases requiring lower optimal temperatures, Bst polymerase, which gives high processivity at relatively high reaction temperatures (60 °C to 70 °C), was used. IP and ULP primers with melting temperature (Tm) values (54 °C to 57 °C) in the same range for both the sense and antisense DNA oligonucleotides used in the preparation of the multi-arm looping primers were selected. However, it is worth mentioning that the Tm value of the L2 sequence (loop arm) used in the multi-arm primer was set slightly higher than that of IP and ULP to form a loop-out structure immediately after the single-stranded DNA was released from the template. Furthermore, both LP and ULP were used at the same concentration and at a significantly high concentration of IP (20% < LP or ULP) to ensure that the synthesis of the stem-loop-like PEG-DNA structure occurred early from the initiation primer. On the other hand, LP and ULP were equally added to the reaction to promote the simultaneous looping and loop-unloop steps in the cycling step, which are required for the effective amplification of both the sense and antisense DNA arms and the subsequent formation of the multi-arm amplicon. Following this design, the efficiency of the MAPA reaction amplifying the HIV-1 sequence as a model DNA template was tested. The results suggested that amplification occurred only in the presence of the target, while no amplification was detected in the control samples. The amplicon formed in the presence of the target appeared with a unique, unclear pattern, suggesting the formation of large amplicons along with multiple DNA bands of various lengths (<250 bp). This initial test step of MAPA was performed at 65 °C, which is the average optimal temperature of the Bst enzyme and slightly higher than the primer Tm, to ensure specific and rapid amplification of the target.The effectiveness of each primer was then tested, and the amplification products were visualized using agarose gel electrophoresis (Figure 27). These results suggest that no amplification was detected in the absence of IP or ULPs, even when the amplification reaction time was extended to 35 minutes, confirming the critical role of both primers in the amplification process. Furthermore, we tested the efficiency of MAPA to amplify target DNA using free L1 and L2 DNA oligonucleotides and without multi-arm PEG (no arms). The results showed strong nonspecific amplification (Figure 27). This confirms the important relationship between the presence of multi-arm PEG for effective looping and the amplification of specific targets. While this looping is critical for the cycling step in the MAPA reaction, the amplification process may proceed through an alternative pathway based on the formation of multi-loops rather than self-loops. This may be thermodynamically even more challenging than self-loops, and we tested this possibility by using ULPs, which complement the antisense strand in the formed amplicon and are required for the multi-looping step. The results are shown in Figure 27C and suggest specific but significantly reduced amplification when compared to MAPA, which uses ULPs that promote self-looping and unlooping-based amplification.

[0159] To further optimize the MAPA reaction conditions for sensitive HIV-1 detection, we tested the effects of different reaction temperatures (within the Bst enzyme temperature range) and time points ranging from 10 to 60 minutes. Results showed that the amplification rate increased significantly as the reaction temperature increased up to 67°C, with specific target amplification detectable 10 minutes after amplification. However, the use of relatively high reaction temperatures near 70°C increased the likelihood of nonspecific amplification, and DNA was detectable in control samples (no HIV-1 target) at 30 minutes (Figure 28). Subsequently, we used the MAPA reaction to test various concentrations of target HIV-1 sequences cloned into pUCIDT-AMP at the optimized reaction temperature of 67°C. Concentrations up to 10 copies / ml could be detected, confirming relatively sensitive target detection without additional optimization steps (Figure 29).

[0160] We developed a rapid isothermal nucleic acid amplification reaction capable of effectively amplifying target sequences within 30 minutes. The developed MAPA reaction deploys a PEG multi-arm polymer structure to facilitate rapid looping and priming of DNA synthesis of amplicons. PEG is a widely used biocompatible hydrophilic polymer with highly flexible chains that provide conformational accessibility for DNA primers to bind to target sequences. We attempted to replace the PEG function linking the L1 and L2 DNA primers with streptavidin molecules to form a multi-arm primer (Figure 29). SA molecules, as homotetramers with excellent binding affinity for biotin groups, have the potential to link biotinylated L1 and L2 sequences. MAPA reactions performed using SA-based multi-arm primers showed significantly reduced amplification compared to PEG-based primers, confirming the importance of the length and flexibility of the PEG chain for effective template-primer binding and DNA amplification. The connection to the multi-arm structure favors, at least thermodynamically, the rate of priming and DNA synthesis, allowing for the rapid formation of large amplicons in a relatively short time. Although we used a relatively challenging target, such as the HIV-1 genome, we were able to detect amplification products at 10 copies / ml on an agarose gel within 10 minutes. Compared to other isothermal methods employing DNA looping for target amplification, including LAMP, our MAPA reaction requires significantly fewer priming sequences (four for MAPA and six to eight for LAMP), shorter amplification times (≤30 minutes), and similar sensitivity limits. Furthermore, the use of PEG-based DNA primers offers a unique opportunity to design generated amplicons that enable highly sensitive and reliable applications without the need for additional or independent steps. In the current design of the MAPA reaction, we used biotinylated PEG molecules, which allows for amplicon isolation (post-reaction) without additional biotin labeling or amplicon processing steps. We were able to amplify the target HIV-1 sequence in the presence of SA-modified magnetic nanobeads (added at the beginning of the reaction). Successful amplification and capture of the amplicons formed on the surface of the beads was confirmed using agarose gel electrophoresis.The formed DNA amplicon-MB complexes were large enough to migrate freely through agarose gels (5%), and the majority of the amplification products migrated with the MBs captured in the sample loading well at the top of the gel (Figure 30). Furthermore, spontaneous biotinylation of the amplicons allowed for magnetic separation of the target-generated amplicons from any nonspecific background amplification for highly specific and reliable target detection (Figure 30B). This is one of the major drawbacks of existing isothermal amplification methods. Together, these results support the use of PEG-based and PEG-like polymers to bring additional functionality and engineering to the nucleic acid amplification step, which could ultimately facilitate its integration and implementation into advanced instruments and systems for nucleic acid analysis and testing.

[0161] Isothermal nucleic acid amplification has great potential to advance molecular testing and clinical analysis. Any reduction in amplification reaction time and the time and steps required (i.e., simpler protocols) would shorten their path to technological maturity and commercialization. Our reported technology enables rapid target amplification with a significantly simplified amplification protocol that uses a minimal number of primers and polymerase enzymes without compromising reaction sensitivity and specificity. This represents a major advance in the field of nucleic acid research and could have a significant impact on the development of point-of-care diagnostics, genome sequencing, single-cell testing, rapid pathogen testing, and clinical and environmental analysis.

[0162] From the above description of the invention, those skilled in the art will recognize improvements, changes, and modifications. Such improvements, changes, and modifications within the scope of the art are intended to be included within the scope of the appended claims. All references, publications, and patents cited in this application are hereby incorporated by reference in their entirety.

Claims

1. 1. A device for detecting an analyte, comprising: a first detectable agent having one or more detectable characteristics; and a masking agent having one or more characteristics that mask the detection of the one or more characteristics of the first detectable agent in the absence of the analyte; Including; at least one of the first detectable agent or the masking agent is configurable in the presence of the analyte to allow detection of the one or more characteristics of the first detectable agent indicative of the presence of the analyte; Device.

2. The device of claim 1 , wherein the first detectable agent is configured to specifically bind to the analyte.

3. 3. The device of claim 2, wherein the one or more characteristics of the first detectable agent are undetectable in the presence of the analyte when the first detectable agent is not bound to the analyte and are detectable upon binding to the analyte.

4. 4. The device of claim 1, wherein binding of the analyte to the first detectable agent induces configuration of the masking agent to form an unmasked or unmasked signal area that allows detection of the first detectable agent.

5. The device of claim 1 , wherein the masking agent comprises a masking liquid that masks the one or more characteristics of the first detectable agent.

6. The device of claim 5 , wherein binding of the analyte to the first detectable agent forms a mask-free zone indicative of the presence of the analyte.

7. 7. The device of claim 6, wherein binding of the analyte to the first detectable agent disperses a masking liquid around the first detectable agent to allow detection of the first detectable agent, which is indicative of the presence of the analyte.

8. 8. The device of claim 1, wherein the first detectable agent comprises one or more first detectable particles immobilized on a surface of a substrate, the first detectable particles configured to specifically bind the analyte.

9. 9. The device of claim 8, wherein the one or more first detectable particles immobilized on the surface of the substrate are covered by the masking liquid in the absence of the analyte.

10. 10. The device of claim 9, further comprising a detection agent that specifically binds to the analyte to form a detection agent-analyte-particle complex, wherein the detection agent is masked by the masking liquid when the analyte is not bound to the detectable particle and the detection agent.

11. 11. The device of claim 10, wherein the masking fluid visually masks the first detectable particles that do not form the detection agent-analyte-particle complex.

12. 12. The device of claim 11, wherein the detection agent of the complex catalyzes the conversion of the masking liquid to a gas that disperses masking liquid around the complex to form a liquid-free area and enables optical detection of the complex on the substrate.

13. 13. The device of claim 10, wherein the first detectable particles comprise a plurality of microbeads.

14. 14. The device of claim 13, wherein the microbeads have a diameter of about 10 μm to about 1 mm.

15. 15. The device of claim 10, wherein the first detectable particle comprises a capture agent on an outer surface of the first detectable particle that specifically binds to the analyte.

16. The device of claim 15 , wherein the capture agent comprises at least one of a small molecule, a nucleotide, a protein, an antibody, or streptavidin.

17. 17. The device of claim 15 or 16, wherein the capture agent is conjugated to the outer surface of the first detectable particle using a linker.

18. 18. The device of claim 16 or 17, wherein the capture agent comprises streptavidin and the analyte comprises a biotin-modified nucleic acid or peptide.

19. The biotin-modified nucleic acid analyte is a multi-arm amplicon nucleic acid structure, and the multi-arm amplicon structure is formed using a multi-arm primer, wherein the multi-arm primer comprises: Sense and antisense arms of a single-stranded oligonucleotide linked to a core by a flexible linker, wherein the antisense arm is complementary to an antisense sequence of a target nucleic acid and the sense arm is complementary to a sense sequence of the target nucleic acid that is different from the antisense sequence and follows the antisense sequence.

20. The apparatus of claim 18, comprising:

20. 20. The device of claim 10, wherein the detection agent comprises platinum nanoparticles (PtNPs).

21. 33. The device of claim 32, wherein the PtNPs are conjugated to streptavidin or anti-biotin antibodies.

22. 22. The apparatus of claim 8, wherein the masking fluid has a color that visually masks the appearance of the first detectable particles upon loading of the masking fluid onto the surface of the substrate.

23. 23. The apparatus of any one of claims 8 to 22, wherein the masking fluid comprises a peroxide solution.

24. 24. The device of claim 23, wherein the peroxide solution comprises about 1% to about 20% hydrogen peroxide (w / v), about 5% to about 15% hydrogen peroxide (w / v), or about 10% hydrogen peroxide (w / v).

25. 25. The apparatus of any one of claims 22 to 24, wherein the substrate comprises at least one microchannel extending along a portion of the substrate, the microchannel containing the first detectable particles and a masking fluid.

26. 26. The device of claim 25, wherein the microchannel comprises a fluid inlet and an outlet for receiving and removing liquid from the microchannel.

27. 27. The device of any one of claims 8 to 26, further comprising one or more second detectable agents, wherein the second detectable agents comprise second detectable particles immobilized on the surface of the substrate.

28. 28. The device of claim 27, wherein the second detectable particles comprise a second plurality of second capture agents for specifically binding a second analyte.

29. 29. The device of claim 28, further comprising a plurality of second detection agents comprising a second targeting moiety for specifically binding the second analyte, wherein binding of the second analyte to both the second detectable particle and the second detection agent forms a second detection agent-analyte-particle complex that forms a liquid-free zone around the second agent-analyte-particle complex that allows detection of the second agent-analyte-particle complex on the substrate.

30. 30. The apparatus of claim 29, wherein the one or more second detectable particles are a substantially different color than the first detectable particles.

31. 31. The device of any one of claims 1 to 30, wherein the first analyte and / or the second analyte is a component of a biological fluid sample.

32. 32. The device of claim 31, wherein the biological fluid sample is obtained from a subject.

33. 33. The device of any one of claims 1 to 32, which is a point-of-care device.

34. 1. A method for detecting an analyte, comprising: Providing an apparatus according to any one of claims 8 to 33; loading a sample containing the analyte onto the surface of the substrate to bind the analyte to an outer surface of one or more first detectable particles; labeling the bound analytes with a plurality of first detection agents to form first detection agent-analyte-particle complexes on the surface of the substrate; loading a masking fluid onto the surface of the substrate to mask the one or more first detectable particles, wherein the first detection agent of the complex catalyzes decomposition of the masking fluid to form a masking fluid-free zone around the particle of the complex; and detecting the one or more first detectable particles in the masking fluid-free area, wherein detection of the one or more first detectable particles in the masking fluid-free area indicates the presence of the analyte in the sample. A method comprising:

35. 35. The method of claim 34, further comprising a washing step to remove uncaptured analytes and the residual sample from the surface of the substrate prior to labeling the bound analytes with the plurality of first detection agents.

36. 36. The method of claim 35, wherein detecting the one or more particles comprises optically imaging the surface of the substrate with a camera.

37. 37. The method of claim 36, wherein the camera is part of a mobile device.

38. 37. The method of claim 36, further comprising determining whether the first optically detectable particle is present in the at least one image in an area that is free of masking fluid.

39. 39. The method of any one of claims 36 to 38, wherein the number and / or size of optically detected particles in the masking fluid-free area is indicative of the concentration of analyte in the sample.

40. 41. The method of any one of claims 34 to 40, wherein the sample comprises two or more different analytes and the device is configured to detect two or more different analytes from the sample.

41. 35. The method of claim 34, further comprising contacting a nucleic acid analyte in the sample with one or more biotin-modified nucleic acid primers specific for the nucleic acid analyte to form a biotinylated target nucleic acid analyte, wherein the biotinylated target nucleic acid analyte is bound to the outer surface of the one or more first detectable particles by streptavidin conjugated to the particles.

42. The biotin-modified nucleic acid analyte is a multi-arm amplicon nucleic acid structure, and the multi-arm amplicon structure is formed using a multi-arm primer, wherein the multi-arm primer comprises: Sense and antisense arms of a single-stranded oligonucleotide linked to a core by a flexible linker, wherein the antisense arm is complementary to an antisense sequence of a target nucleic acid and the sense arm is complementary to a sense sequence of the target nucleic acid that is different from the antisense sequence and follows the antisense sequence, the sense arm being linked to the antisense arm using a multi-arm polyethylene glycol (PEG) linker, and each arm of the multi-arm PEG linker being connected to either a sense arm of the single-stranded oligonucleotide or an antisense arm of a single oligonucleotide.

43. The method of claim 42, comprising:

43. 43. The method of claim 42, further comprising the step of amplifying a target nucleic acid analyte by providing a multi-armed primer and annealing the multi-armed primer to the target nucleic acid analyte.

44. 44. The method of claim 43, wherein after annealing to the nucleic acid target sequence, the primer is extended using a polymerase with high strand displacement activity to form a nucleic acid template.

45. 45. The method of claim 44, wherein the polymerase with high strand displacement activity is selected from the group consisting of Bst DNA polymerase and Phi 29 (Φ29) DNA polymerase.

46. 43. The method of claim 42, wherein the multi-armed primer comprises at least two sense arms and at least two antisense arms.

47. 47. The method of claim 46, wherein the antisense arm is configured to bind to the complementary sequence in the nucleic acid and form a looped arm dsDNA structure mediated by the sense arm.

48. 48. The method of claim 47, wherein the antisense arm primes amplification followed by self-priming with the sense arm to generate a stem-loop DNA hybrid structure in which the loop is made up in part of the sense arm and antisense arm and the linker.

49. 49. The method of claim 48, wherein the other free antisense and sense arms of the multi-arm primer mediate a self-looping chain to form a multi-arm amplicon that is used as a template in self-priming to generate a larger multi-amplicon structure and form new strands and stem-loop-like structures.

50. 50. The method of claim 49, wherein the self-looping continues until all of the sense arms are extended into copies of the target sequence.

51. 34. An apparatus according to any one of claims 1 to 33; camera; a processor; and One or more non-transitory computer readable media for storing executable instructions and data, wherein the processor accesses the media and executes the instructions to detect the analyte, preferably to perform the method of any one of claims 34 to 50. A system including:

52. 52. The system of claim 51, wherein the executable instructions include a camera interface configured to direct the camera to capture at least one image.

53. 53. The system of claim 52, wherein the camera is part of a mobile device.

Images