Application of Fusarium brachygibosum in the production of mycelial protein
Fusarium brachygibosum strain FXFB001 enhances mycelial protein production by achieving high protein content and low fat, addressing yield limitations in existing Fusarium venenatum strains, offering a safe and efficient alternative protein source.
Patent Information
- Application Number
- JP2024553866
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-01-11
- Filing Date
- 2024-03-11
- Publication Date
- 2026-02-16
- Estimated Expiration
- 2044-03-11
AI Technical Summary
Current methods for producing mycelial proteins using Fusarium venenatum strains have limitations in yield and require improvement, and there is a need for naturally occurring high-protein-producing filamentous fungal strains to enhance industrial production of alternative proteins.
The application of Fusarium brachygibosum strain FXFB001, with specific gene sequences, is used in the production of mycelial proteins, involving a fermentation process with controlled conditions to produce protein-rich mycelium with high protein content and low fat, and the use of a microbial inoculant with auxiliary materials.
Fusarium brachygibosum strain FXFB001 achieves a mycelial protein content of over 55.39%, with low fat and high dietary fiber, providing a safe and efficient alternative protein source for industrial use, reducing environmental impact.
Smart Images

Figure 2026505564000020 
Figure 2026505564000021 
Figure 2026505564000022
Abstract
Description
[Technical Field]
[0001] The present invention belongs to the technical field of functional microorganisms, and specifically relates to the application of Fusarium brachygibosum in the production of mycelial proteins. [Background technology]
[0002] Alternative proteins are proteins produced from plant or animal cells or by microbial fermentation. These innovative foods are designed to taste as good or better than conventional animal-based foods and offer health benefits such as zero cholesterol, low fat, and low fiber at the same or lower cost. Alternative proteins require fewer inputs, such as land, fertilizer, and water, than conventionally produced animal products, and generate fewer negative externalities, such as greenhouse gas emissions and air pollution. At the same time, alternative proteins also reduce the contribution of food production to pandemic risk and antimicrobial resistance.
[0003] Microbial fermentation protein, one of the alternative protein production methods, uses the fermentation of microorganisms or algae to produce proteins. These proteins contain cellulose, abundant enzymes, and biologically active substances, but are cholesterol-free, making them gentler for patients with cardiovascular and cerebrovascular diseases. Industrially, the main strains used for fermentation to produce microbial protein meat include algae, yeast, and filamentous fungi. Algae have issues such as slow growth rate and low density, so they have mainly been used for small-scale protein production. Yeast has fast growth, high cell density, and requires simple production equipment, but its low cell wall digestibility and high nucleic acid content limit the further development of yeast-fermented protein. Protein-producing filamentous fungi are primarily concentrated in the Fusarium fungus. The mycelium produced by Fusarium is tastier than single-cell proteins such as yeast and bacteria, has a tissue structure similar to meat, and its abundant edible crude fiber aids gastrointestinal digestion, making it a meat substitute that can meet the nutritional needs of modern people. Currently, a strain of Fusarium venenatum has been developed, and mycelia with higher protein content have been used in the production of meat products (Patent Document 1). However, the yield of mycelial protein produced by this Fusarium venenatum needs to be improved. Patent Document 2 also discloses that mycelial protein production in Fusarium venenatum can be effectively promoted by deleting the intracellular pyruvate decarboxylase gene FvPDC6. Currently, there are very few naturally occurring high-protein-producing mycelial species. The search for more potential, naturally highly productive filamentous fungal protein strains would be a development of great commercial value. [Prior art documents] [Patent documents]
[0004] [Patent Document 1] Chinese Patent Application Publication No. 115851458 [Patent Document 2] Chinese Patent Application Publication No. 116640753 Summary of the Invention [Problem to be solved by the invention]
[0005] In view of this, the present invention aims to provide an application of a novel Fusarium fungus in the production of mycelial proteins. [Means for solving the problem]
[0006] The present invention provides the application of Fusarium brachygibbosum or its microbial inoculant in the production of mycelial protein.
[0007] Preferably, the Fusarium brachygibosum is a Fusarium brachygibosum strain having a TEF1 gene sequence having at least 95% homology to SEQ ID NO:5 and / or an ITS1 gene sequence having at least 97% homology to SEQ ID NO:6, or a composition formed by the Fusarium brachygibosum strain.
[0008] Preferably, the Fusarium brachygibosum comprises Fusarium brachygibosum strain FXFB001; The Fusarium brachygibosum strain FXFB001 has the accession number CGMCC No: 41066.
[0009] Preferably, the Fusarium brachygibosum comprises a spore form and / or a mycelium form.
[0010] The present invention provides an edible mycelium, wherein the edible mycelium has a protein content of 40% or more, a dietary fiber content of 20% or more, and a fat content of 8% or less, based on the dry mass of the edible mycelium, and the edible mycelium is derived from Fusarium brachygibbosum; The Fusarium brachygibosum is the Fusarium brachygibosum in the application.
[0011] Preferably, the edible mycelium is elastic and / or tough.
[0012] The present invention provides Fusarium brachygibbosum strain FXFB001, which has the accession number CGMCC No: 41066.
[0013] The present invention provides a microbial inoculant for producing protein or protein-rich mycelium, comprising the Fusarium brachygibosum strain FXFB001 and an acceptable adjuvant for the inoculant.
[0014] Preferably, the mass ratio of the Fusarium brachygibosum strain FXFB001 to the auxiliary materials is 1-10:1-100.
[0015] Preferably, the supplementary materials include one or more of a medium, an additive, and a carrier.
[0016] The present invention provides the use of the Fusarium brachygibosum strain FXFB001 or the microbial inoculant in the production of protein or mycelium.
[0017] The present invention provides a method for producing edible mycelium using Fusarium brachygibbosum, Inoculating the seed culture solution prepared from Fusarium brachygibosum or a microbial inoculant thereof into a fermentation medium and culturing it to obtain a fermentation liquid; and separating the fermentation product after sterilizing the fermentation liquid to obtain edible mycelium; The Fusarium brachygibosum is the Fusarium brachygibosum in the application.
[0018] Preferably, the fermentation medium comprises a first fermentation medium and / or a second fermentation medium; the first fermentation medium contains the following components in the amounts listed: starch 23 to 27 g / L, citric acid 0.8 to 1.2 g / L, potassium dihydrogen phosphate 0.8 to 1.2 g / L, ammonium sulfate 4.5 to 5.5 g / L, magnesium salt 17 to 21 mg / L, the concentration of which is calculated as Mg, calcium salt 2.8 to 43 mg / L, the concentration of which is calculated as Ca, manganese salt 0.48 to 0.62 mg / L, iron salt or ferrous salt 0.96 to 1.05 mg / L, the concentration of which is calculated as Fe, zinc salt 0.72 to 0.91 mg / L, the concentration of which is calculated as Zn, cobalt salt 0.44 to 0.54 mg / L, the concentration of which is calculated as Co, and multivitamins 0.08 to 0.12 mg / L; The second fermentation medium contains 15 to 60 kg / m of glucose 3 , K2SO4 0.5~1.5kg / m 3 , H3PO4 0.4~0.8kg / m 3 Calculate the concentration in Mg equivalent: Magnesium salt 9.75 to 58.5 g / m 3 Calculate the concentration in terms of Zn. Zinc salt: 2.2 to 22.5 g / m 3 Calculate the concentration of manganese salt in Mn equivalent: 2.46 to 9.85 g / m 3 , calcium acetate 0.1-0.3 kg / m 3 and antifoaming agent 0.08 to 0.12 kg / m 3 It contains the following ingredients:
[0019] Preferably, the fermentation culture conditions when fermenting using the first fermentation medium are: During the first 15 hours of fermentation, the aeration rate was controlled at 900-1100 L / h and the pressure at 0.04-0.06 MPa. After 15 hours of fermentation, the material supply rate was 0.5-2.0 mL / L / h, the aeration rate was 1400-1600 L / h, the pressure was 0.08-0.12 MPa, and the pH value of the fermentation liquid was 4.0-6.0. The fermentation temperature is 27 to 29°C, the rotation speed is 100 to 450 rpm, the dissolved oxygen content is 20 to 50%, and the fermentation time is 68 to 76 hours. the raw material supply components at the time of supplying the raw material include 280 to 320 g / L of glucose and 0.08 to 0.12 mg / L of multivitamins; The multivitamin contains 0.08 to 0.12 parts of vitamin B1 and 0.12 parts of vitamin B 12 The ingredients include 0.08 to 0.12 parts by mass of vitamin B1, 0.08 to 0.12 parts by mass of vitamin B2, 0.08 to 0.12 parts by mass of vitamin B3, 0.08 to 0.12 parts by mass of vitamin B5, 0.08 to 0.12 parts by mass of vitamin B6, 0.08 to 0.12 parts by mass of vitamin B9, 0.08 to 0.12 parts by mass of vitamin C, and 0.08 to 0.12 parts by mass of vitamin H.
[0020] Preferably, when the fermentation culture is carried out using the second fermentation medium, the fermentation culture conditions are an aeration rate of 900 to 1600 L / h, a pressure controlled to 0.04 to 0.12 MPa, and a pH value of the fermentation liquid of 4.0 to 6.0; The fermentation temperature is 27°C to 29°C, the rotation speed is 100 to 450 rpm, the dissolved oxygen content is 20% to 50%, and the fermentation time is 72 to 480 hours. When the reducing sugar content in the fermentation system is less than 2-5 g / L, the fermentation liquid with a volume fraction of 20%-90% is discharged, and the second fermentation medium is added to the original volume.
[0021] Preferably, the method for preparing an inoculum of Fusarium brachygibosum comprises: The Fusarium brachygibosum is inoculated into a first seed medium, and primary seed culture and secondary seed culture are sequentially performed to obtain a secondary seed liquid. The method also includes a method of inoculating the secondary seed culture medium with the secondary seed culture solution, carrying out tertiary seed culture, and obtaining a tertiary seed culture solution.
[0022] Preferably, the first seed culture medium contains 28 to 32 g / L of glucose, 23 to 27 g / L of yeast extract powder, 0.8 to 1.2 g / L of potassium dihydrogen phosphate, 17 to 21 mg / L of magnesium salt (concentration calculated as Mg), and 3 to 4 mg / L of calcium salt (concentration calculated as Ca), and the second seed culture medium contains 23 to 27 g / L of starch, 0.8 to 1.2 g / L of citric acid, 0.8 to 1.2 g / L of potassium dihydrogen phosphate, and ammonium sulfate. It contains the following components with concentrations of 4.8 to 5.2 g / L, 17 to 21 mg / L of magnesium salt, the concentration of which is calculated in Mg equivalent, 0.003 to 0.004 g / L of calcium salt, the concentration of which is calculated in Ca equivalent, 0.48 to 0.62 mg / L of manganese salt, the concentration of which is calculated in Mn equivalent, 0.96 to 1.05 mg / L of iron salt or ferrous salt, the concentration of which is calculated in Fe equivalent, 0.72 to 0.91 mg / L of zinc salt, the concentration of which is calculated in Zn equivalent, and 0.44 to 0.54 mg / L of cobalt salt, the concentration of which is calculated in Co equivalent.
[0023] Preferably, the culture temperature of the primary seed culture, the secondary seed culture, or the tertiary seed culture is 25°C to 30°C; The culture time of the primary seed culture, secondary seed culture, or tertiary seed culture is 22 to 26 hours; The rotation speed of the primary seed culture, secondary seed culture, or tertiary seed culture is 100 to 200 rpm; The aeration rate of the tertiary seed culture is 8 to 12 L / min; The pressure of the tertiary seed culture is 0.04 to 0.06 MPa; The pH value of the tertiary seed culture system is 4.0 to 6.0.
[0024] Preferably, the sterilization method for the fermentation liquid is heat sterilization, The heat sterilization procedure involves maintaining a temperature of 60°C to 70°C for 18 to 22 minutes, then raising the temperature to 88°C to 92°C and maintaining the temperature for 8 to 15 minutes.
[0025] Preferably, the method for separating the fermentation product comprises separating the solid and liquid phases of the fermentation broth, washing the solid phase, and then drying it to obtain edible mycelium.
[0026] The present invention provides the application of said edible mycelium or edible mycelium prepared by said method in the preparation of meat substitutes.
[0027] Preferably, the preparation method does not involve structural processing. [Effects of the Invention]
[0028] This invention provides the application of Fusarium brachygibbosum in the production of mycelial protein, and marks the first time that Fusarium brachygibbosum has been used in the fermentation production of mycelial protein. Experiments have demonstrated that Fusarium brachygibbosum is superior to other Fusarium fungi (such as Fusarium venenatum) in terms of fermentative production of mycelial protein content. Using the Kjeldahl method, the mycelial protein content was detected to be over 55.39%. It also has low fat and high dietary fiber content, with a total fat content of 7.97% and dietary fiber content of 26.01%, respectively. The mycelial protein produced is toxin-free, making it an ideal alternative protein. The mycelium produced by Fufusarium brachygibosum in this invention was found to have a high mycelial protein content, good morphology, and no toxic side effects. Therefore, this invention provides a new means for the industrial production of alternative proteins and also provides a basis for the development of safe food. At the same time, production based on fermentation methods can greatly improve protein production efficiency, reduce carbon emissions, and protect the environment.
[0029] The present invention also provides Fusarium brachygibbosum strain FXFB001, with accession number CGMCC No. 41066. The present invention isolated strain FXFB001 from a forest humus soil sample in the Tibet Autonomous Region. Morphological and molecular identification showed that strain FXFB001 was Fusarium brachygibbosum. Initial screening revealed that the strain produced pale yellow, filamentous, and elastic mycelium, with a protein content of over 55.39% as measured by the Kjeldahl method. The protein-rich mycelium produced by strain FXFB001 exhibited good filamentous properties during fermentation, and the fermentation broth exhibited a natural flesh color without heating and had no unpleasant odor. The Fusarium brachygibosum strain FXFB001 provided by the present invention has a significantly higher protein yield than other currently reported Fusarium strains, and the proteins it produces are toxin-free, safe, and without side effects. Therefore, the present invention provides a new means for the industrial production of alternative proteins and at the same time provides a foundation for the development of safe foods. [Brief explanation of the drawings]
[0030] [Figure 1] 1 shows the colony morphology of the strain FXFB001 isolated and purified in Example 1 of the present invention. [Figure 2] 1 shows a phylogenetic tree of the strain FXFB001 constructed based on multiple genes in Example 1 of the present invention. [Figure 3] 1 is a bacterial cake obtained by initial screening and culturing of the bacterial strain FXFB001 in Example 2 of the present invention. [Figure 4] 1 shows the fermentation product obtained by fermentation culture of the strain FXFB001 in Example 3 of the present invention. [Figure 5] 1 shows the results of microscopic observation of protein-rich mycelia obtained by fermentation culture of the strain FXFB001 in Example 3 of the present invention. DETAILED DESCRIPTION OF THE INVENTION
[0031] [CROSS-REFERENCE TO RELATED APPLICATIONS] This application claims priority from a Chinese patent application filed with the China Patent Office on January 11, 2024, application number 202410044012.8, entitled "Application of Fusarium brachygibosum in the production of mycelial protein," the entire contents of which are incorporated herein by reference.
[0032] Biological material deposit information The Fusarium brachygibbosum strain FXFB001 provided by the present invention was deposited at the China General Microbiological Culture Collection Center (CGMCC) (CN) on December 13, 2023. The abbreviation of the depository is CGMCC, the address of the depository is Institute of Microbiology, Chinese Academy of Sciences, No. 1 Beichen West Road, Chaoyang District, Beijing, China, and the deposit number is CGMCC No: 41066.
[0033] The present invention provides the application of Fusarium brachygibbosum or its microbial inoculant in the production of mycelial protein.
[0034] In the present invention, the Fusarium brachygibosum includes a single Fusarium brachygibosum strain or a combination of multiple Fusarium brachygibosum strains. The present invention does not impose any particular limitation on the Fusarium brachygibosum strain, and all strains taxonomically identified as Fusarium brachygibosum are included within the scope of protection of the present invention. For example, the Fusarium brachygibosum may be any strain having a TEF1 gene sequence that is 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:5 and an ITS1 gene sequence that is 97%, 98%, 99%, or 100% identical to SEQ ID NO:6, such as the Fusarium brachygibosum strain FXFB001. The Fusarium brachygibosum strain FXFB001 has the accession number CGMCC No: 41066 and has excellent ability to produce protein-rich mycelium.
[0035] In the present invention, the production is preferably fermentation production. Fermentation production is a process for preparing microbial cells, direct metabolites, or secondary metabolites by utilizing the biological activity of microorganisms under aerobic or anaerobic conditions. In one embodiment of the present invention, the fermentation production is a process for growing Fusarium brachygibosum in large quantities under conditions containing nutrients provided by a fermentation medium to obtain protein-rich mycelium. The present invention is not particularly limited to the form of Fusarium brachygibosum, and any living form of Fusarium brachygibosum known in the art, including, for example, spores and / or mycelia, may be used.
[0036] The present invention provides Fusarium brachygibbosum strain FXFB001, which has the accession number CGMCC No: 41066.
[0037] In the present invention, the Fusarium brachygibosum strain FXFB001 was isolated and purified from a forest humus sample in Shannan City, Tibet Autonomous Region. Morphological identification revealed that the aerial mycelia growing on PSA medium were felt-like, initially white, gradually turning pink, and the underside of the plate was orange-red to deep red. Conidial morphology revealed that the macroconidia were sickle-shaped with slightly pointed ends, 3-5 septa, and measured 10.8-25.1 μm x 2.0-3.6 μm. The microconidia were spindle-shaped, slightly curved, slightly flattened, and 0-2 septa. The chlamydospores were spherical and present singly within the hyphae, measuring 5.2-7.5 μm. Molecular identification was also performed based on the TEF1 and ITS sequences. The results showed that the TEF1 sequence of strain FXFB001 shared 99.84% identity with Fusarium brachygibbosum (NCBI: MK752485.1), and the ITS1 sequence of strain FXFB001 shared 100% identity with Fusarium brachygibbosum (NCBI: GQ505450.1). A multigene phylogenetic tree was simultaneously constructed, showing that strain FXFB001 and Fusarium brachygibbosum were clustered on one branch. Based on the results of morphological and molecular identification, strain FXFB001 was classified as Fusarium brachygibbosum.
[0038] In one embodiment of the present invention, initial screening of the protein production characteristics of the FXFB001 strain was performed. The initial screening method preferably involves inoculating the FXFB001 strain into a first seed medium, culturing the FXFB001 strain with constant temperature shaking, isolating the solid-phase culture product, drying it, and measuring the crude protein content. The first seed medium preferably contains 28-32 g / L of glucose, 23-27 g / L of yeast extract powder, 0.8-1.2 g / L of potassium dihydrogen phosphate, 0.18-0.22 g / L of magnesium sulfate heptahydrate, and 0.009-0.011 g / L of calcium chloride, more preferably 30 g / L of glucose, 27 g / L of yeast extract powder, 1.0 g / L of potassium dihydrogen phosphate, 0.2 g / L of magnesium sulfate heptahydrate, and 0.01 g / L of calcium chloride. The temperature for the constant temperature shaking culture is preferably 25-30°C, more preferably 28°C. The duration of the constant temperature shaking culture is preferably 45 to 50 hours, more preferably 48 hours. The rotation speed of the constant temperature shaking culture is preferably 180 to 220 rpm, more preferably 200 rpm. The method for separating the solid-state culture is preferably suction filtration using a vacuum suction filtration device, and the filter cake is thoroughly washed. The drying is preferably oven drying. The oven drying temperature is preferably 55°C to 65°C, more preferably 60°C. The protein-rich mycelium prepared by fermentation using strain FXFB001 has a filamentous mycelial morphology and a pale yellow filter cake color. The filter cake is elastic and has a dry weight biomass percentage of 0.63%. The protein content measured by the Kjeldahl method is 55.39% or more.
[0039] The present invention provides a microbial inoculant for producing mycelial protein, which comprises the Fusarium brachygibosum strain FXFB001 and auxiliary materials.
[0040] In the present invention, the mass ratio of the Fusarium brachygibosum strain FXFB001 to the auxiliary material is preferably 1-10:1-100, more preferably 1-10:5-80, and even more preferably 1:10-50. The type of the auxiliary material varies depending on the formulation of the microbial inoculant.
[0041] In the present invention, the microbial inoculant preferably comprises a freeze-dried powder or a liquid. The method for preparing the liquid microbial inoculant preferably comprises preparing an inoculum of Fusarium brachygibosum strain FXFB001 and preparing the liquid. The method for preparing the freeze-dried powder microbial inoculant preferably comprises preparing an inoculum of Fusarium brachygibosum strain FXFB001 and freeze-drying it.
[0042] In one embodiment of the present invention, the method for preparing the seed liquid of the microbial inoculant of Fusarium brachygibosum strain FXFB001 preferably includes the steps of inoculating the activated strain FXFB001 into a first medium to perform primary seed culture and obtain a primary seed liquid, inoculating the first medium with the primary seed liquid again to perform secondary seed culture and obtain a secondary seed liquid, and inoculating a second medium with the secondary seed liquid to perform tertiary seed culture and obtain a tertiary seed liquid.
[0043] In the present invention, an artificially prepared medium and artificially created culture conditions (e.g., culture temperature) are used in the culture to enable rapid growth and reproduction of a certain (species) of microorganism. The first seed medium contains components in the following amounts: glucose 28-32 g / L, yeast extract powder 23-27 g / L, potassium dihydrogen phosphate 0.8-1.2 g / L, magnesium salt (concentration calculated as Mg) 17-21 mg / L, and calcium salt (concentration calculated as Ca) 3-4 mg / L, more preferably glucose 30 g / L, yeast extract powder 25 g / L, potassium dihydrogen phosphate 1.0 g / L, magnesium salt (concentration calculated as Mg) 19 mg / L, and calcium salt (concentration calculated as Ca) 3.5 mg / L. The second seed culture medium contains components in the following amounts: starch 23 to 27 g / L, citric acid 0.8 to 1.2 g / L, potassium dihydrogen phosphate 0.8 to 1.2 g / L, ammonium sulfate 4.8 to 5.2 g / L, magnesium salt 17 to 21 mg / L, the concentration of which is calculated as Mg, calcium salt 3 to 4 mg / L, the concentration of which is calculated as Ca, manganese salt 0.48 to 0.62 mg / L, iron salt or ferrous salt 0.96 to 1.05 mg / L, the concentration of which is calculated as Fe, zinc salt 0.72 to 0.91 mg / L, the concentration of which is calculated as Zn, and cobalt salt 0.44 to 0.54 mg / L, the concentration of which is calculated as Co, and more preferably starch 25 g / L, citric acid 1 g / L, potassium dihydrogen phosphate 1 g / L, ammonium sulfate 5 g / L, magnesium salt 0.48 to 0.62 mg / L, the concentration of which is calculated as Mg, The starch contains 19 mg / L of calcium salt, the concentration of which is calculated as Ca, 3.5 mg / L of manganese salt, the concentration of which is calculated as Mn, 1 mg / L of iron salt or ferrous salt, the concentration of which is calculated as Fe, 0.81 mg / L of zinc salt, the concentration of which is calculated as Zn, and 0.49 mg / L of cobalt salt, the concentration of which is calculated as Co. The present invention is not particularly limited to the type of starch, and any type of starch known in the art, such as sweet potato starch, corn starch, cassava starch, or potato starch, may be used.In the present invention, the forms of calcium salts, cobalt salts, and zinc salts are not particularly limited, and any form known in the art may be used for each metal salt. For example, calcium salts exist in one or more forms of calcium chloride, calcium sulfate, calcium bicarbonate, etc.; cobalt salts preferably exist in the form of cobalt chloride; and zinc salts exist in one or two forms of zinc chloride, zinc sulfate, etc. The magnesium salt preferably includes one or more of magnesium sulfate, magnesium chloride, magnesium nitrate, etc. The manganese salt preferably includes one or more of manganese sulfate, manganese chloride, potassium permanganate, potassium manganate, etc. In the present invention, the source of the components of the fermentation medium is not particularly limited, and any commercially available source of components known in the art may be used. In the present invention, the methods for preparing the first and second seed culture media are not particularly limited, and any method for preparing a microbial culture medium well known in the art may be used. After preparation, the medium is preferably sterilized. The sterilization method is preferably high-pressure steam sterilization. In an embodiment of the present invention, the first seed culture medium preferably contains components in the following amounts: glucose 28 to 32 g / L, yeast extract powder 23 to 27 g / L, potassium dihydrogen phosphate 0.8 to 1.2 g / L, magnesium sulfate heptahydrate 0.18 to 0.22 g / L, and calcium chloride 0.003 to 0.004 g / L, and more preferably contains components in the following amounts: glucose 30 g / L, yeast extract powder 25 g / L, potassium dihydrogen phosphate 1.0 g / L, magnesium sulfate heptahydrate 0.2 g / L, and calcium chloride 0.005 g / L.The second seed medium contains components in the following amounts: starch 23 to 27 g / L, citric acid 0.8 to 1.2 g / L, potassium dihydrogen phosphate 0.8 to 1.2 g / L, ammonium sulfate 4.8 to 5.2 g / L, magnesium sulfate heptahydrate 0.18 to 0.22 g / L, calcium salt 0.003 to 0.004 g / L, manganese sulfate monohydrate 1.5 to 1.9 mg / L, ferrous sulfate heptahydrate 4.8 to 5.2 mg / L, zinc chloride 0.72 to 0.91 mg / L, and cobalt chloride 0.44 to 0.54 mg / L, more preferably starch 25 g / L, citric acid 1.0 g / L, potassium dihydrogen phosphate 1.0 g / L, ammonium sulfate 5.0 g / L, magnesium sulfate heptahydrate 0.017 to 0.021 g / L, calcium chloride The medium contains the following components: 0.01 g / L of ammonium sulfate, 1.5 mg / L of manganese sulfate monohydrate, 5.0 mg / L of ferrous sulfate heptahydrate, 1.9-2.0 mg / L of zinc sulfate, and 1.8-2.2 mg / L of cobalt chloride. In the examples of the present invention, the dosage error of each drug and reagent when preparing each medium should not exceed 10%. The incubation temperature for the primary seed culture, secondary seed culture, or tertiary seed culture is preferably 25°C-30°C, more preferably 28°C. The incubation time for the primary and secondary seed cultures or tertiary seed cultures is preferably 22-26 hours, more preferably 24 hours. The primary and secondary seed cultures or tertiary seed cultures are preferably completed in culture bottles. The rotation speed for the primary and secondary seed cultures is preferably 180-220 rpm, more preferably 200 rpm. The inoculum volume for the secondary seed culture is preferably 4%-6%, more preferably 5%. The rotation speed of the tertiary seed culture is preferably 100 to 220 rpm, more preferably 150 rpm. During the culture period, the culture bottle is preferably placed on a shaking table and cultured with shaking. In the tertiary seed culture, the inoculum volume is preferably 5% to 10%, more preferably 8%. In the present invention, there are no particular limitations on the method for inoculating the seed liquid. For example, any inoculation method known in the art, such as transferring a small amount of culture liquid to a corresponding medium using a sterile pipette under sterile conditions, may be used. The aeration rate of the tertiary seed culture is preferably 8 to 12 L / min, more preferably 10 L / min.The pressure of the tertiary seed culture is preferably 0.04 to 0.06 MPa, more preferably 0.05 MPa. The pH value of the tertiary seed culture system is preferably 4.0 to 6.0, more preferably 5.0. The tertiary seed culture is preferably carried out in a culture tank equipped with a pressure valve. The present invention does not place any particular restrictions on the specifications or brand of the culture tank, and any culture tank known in the art may be used.
[0044] In the present invention, when preparing a microbial inoculant, spores are separated from the tertiary seed solution and mixed with a solution solvent or a freeze-dried protective agent to prepare a solution or freeze-dried powder. The molecular spore method is preferably centrifugation. In the present invention, the type of auxiliary material for the solution is not particularly limited, and any auxiliary material for a solution well known in the art, such as a culture medium, may be used. In the solution serving as a microbial inoculant, the effective spore count of the strain FXFB001 is (1 to 100) x 10 7 / mL, more preferably 5 × 10 7 In the liquid preparation that is the microbial inoculant, the effective spore count of the strain FXFB001 is (1 to 100) × 10 7 / g, more preferably (1 to 100) × 10 7 / g.
[0045] The present invention provides a method for producing edible mycelium using Fusarium brachygibosum, Inoculating the seed culture solution prepared from Fusarium brachygibosum or a microbial inoculant thereof into a fermentation medium and culturing it to obtain a fermentation liquid; and separating the fermentation product after sterilizing the fermentation liquid to obtain edible mycelium; The Fusarium brachygibosum is the Fusarium brachygibosum in the application described in the above technical solution.
[0046] In the present invention, the method for preparing the seed culture solution prepared by Fusarium brachygibosum is the same as that described above, and therefore detailed description thereof will be omitted here.
[0047] In the present invention, fermentation refers to a process of preparing microbial cells or direct metabolic products or secondary metabolic products by utilizing the biological activity of microorganisms under aerobic or anaerobic conditions. Fermentation generally refers to a specific decomposition process of organic matter by living organisms. Fusarium brachygibosum fermentation is a process in which Fusarium brachygibosum decomposes and utilizes the nutrients in a fermentation medium, continuously growing and forming a large amount of mycelium. The fermentation medium contains a nitrogen source, a carbon source, inorganic salts, and water. The fermentation medium includes a first fermentation medium and / or a second fermentation medium. The first fermentation medium preferably contains components in the following amounts: starch 23 to 27 g / L, citric acid 0.8 to 1.2 g / L, potassium dihydrogen phosphate 0.8 to 1.2 g / L, ammonium sulfate 4.5 to 5.5 g / L, magnesium salt 17 to 21 mg / L (concentration calculated as Mg), calcium salt 2.8 to 43 mg / L (concentration calculated as Ca), manganese salt 0.48 to 0.62 mg / L (concentration calculated as Mn), iron salt or ferrous salt 0.96 to 1.05 mg / L (concentration calculated as Fe), zinc salt 0.72 to 0.91 mg / L (concentration calculated as Zn), cobalt salt 0.44 to 0.54 mg / L (concentration calculated as Co), and multivitamin 0.08 to 0.12 mg / L, and more preferably starch 25 g / L, citric acid 1 g / L, potassium dihydrogen phosphate 1 g / L, ammonium sulfate The second fermentation medium preferably contains 15 to 60 kg / m glucose, 19 mg / L magnesium salt (concentration calculated as Mg), 25 mg / L calcium salt (concentration calculated as Ca), 0.54 mg / L manganese salt (concentration calculated as Mn), 1 mg / L iron salt or ferrous salt (concentration calculated as Fe), 0.81 mg / L zinc salt (concentration calculated as Zn), 0.49 mg / L cobalt salt (concentration calculated as Co), and 0.1 mg / L multivitamin. 3 , K2SO4 0.5~1.5kg / m 3 , H3PO4 0.4~0.8kg / m 3 Calculate the concentration in Mg equivalent: Magnesium salt 9.75~58.5g / m 3 Calculate the concentration in terms of Zn. Zinc salt: 2.2 to 22.5 g / m 3Calculate the concentration of manganese salt in Mn equivalent: 2.46 to 9.85 g / m 3 , calcium acetate 0.1-0.3 kg / m 3 and antifoaming agent 0.08-0.12 kg / m 3 More preferably, glucose is 25 to 55 kg / m 3 , K2SO4 0.8~1.3kg / m 3 , H3PO4 0.5~0.7kg / m 3 Calculate the concentration in Mg equivalent: Magnesium salt 12.5 to 50.5 g / m 3 Calculate the concentration in terms of Zn. Zinc salt: 4.5 to 20.5 g / m 3 Calculate the concentration in Mn equivalent: Manganese salt 5.2 to 7.5 g / m 3 , calcium acetate 0.15-0.25kg / m 3 and antifoaming agent 0.1 kg / m 3 It contains the following ingredients:
[0048] The present invention does not limit the type of starch; starch types well known in the art, such as sweet potato starch, corn starch, cassava starch, and potato starch, may be used. The forms of calcium salts, cobalt salts, and zinc salts are not particularly limited in the present invention; the forms of each metal salt may be those well known in the art. For example, calcium salts may exist in one or more forms of calcium chloride, calcium sulfate, calcium bicarbonate, etc.; cobalt salts are preferably present in the form of cobalt chloride; and zinc salts may exist in one or two forms of zinc chloride, zinc sulfate, etc. The magnesium salt preferably includes one or more of magnesium sulfate, magnesium chloride, magnesium nitrate, etc. The iron salt or ferrous salt, the concentration of which is calculated in terms of Fe, preferably includes one or more of ferrous sulfate heptahydrate, ferric chloride, ferrous chloride, etc. The manganese salt preferably includes one or more of magnesium sulfate, manganese chloride, potassium permanganate, potassium manganate, etc. In the present invention, there is no particular limitation on the source of the components of the fermentation medium, and commercially available sources of the components well known in the art may be used.
[0049] In an embodiment of the present invention, the first fermentation medium preferably contains starch 23-27 g / L, citric acid 0.8-1.2 g / L, potassium dihydrogen phosphate 0.8-1.2 g / L, ammonium sulfate 4.5-5.5 g / L, magnesium sulfate heptahydrate 0.18-0.22 g / L, calcium chloride 0.008-0.012 g / L, manganese sulfate monohydrate 1.5-1.9 mg / L, ferrous sulfate heptahydrate 4.5-5.5 mg / L, zinc chloride 1.8-2.2 mg / L, cobalt chloride 1.8-2.2 mg / L, and multivitamins 0.08-0.12 mg / L, and more preferably contains starch 25 g / L, citric acid 1.0 g / L, potassium dihydrogen phosphate 1.0 g / L, ammonium sulfate 5.0 g / L, magnesium sulfate heptahydrate 0.18-0.22 g / L, calcium chloride 0.008-0.012 g / L, manganese sulfate monohydrate 1.5 mg / L, ferrous sulfate heptahydrate 4.5 mg / L, zinc chloride 1.8 mg / L, cobalt chloride 1.8 mg / L, and multivitamins 0.08-0.12 mg / L. In one embodiment of the present invention, the second fermentation medium preferably contains 0.2 g / L of glucose, 0.0034 g / L of calcium salts, 1.7 mg / L of manganese sulfate monohydrate, 5.0 mg / L of ferrous sulfate heptahydrate, 0.8 mg / L of zinc salts, 0.5 mg / L of cobalt chloride, and 0.1 mg / L of multivitamins. 3 , K2SO4 1.0 kg / m 3 , H3PO4 0.6 kg / m 3 , magnesium sulfate heptahydrate 0.25 kg / m 3 , zinc sulfate heptahydrate 0.05g / m 3 , manganese sulfate tetrahydrate 0.03g / m 3 , calcium acetate 0.1-0.3 kg / m 3 and antifoaming agent 0.1 kg / m 3 It contains the following ingredients:
[0050] In the present invention, there is no particular limitation on the method for preparing the fermentation medium, and any preparation method known in the art may be used. After preparation is complete, the fermentation medium is preferably sterilized. In the present invention, there is no particular limitation on the method for sterilizing the fermentation medium, and any sterilization method known in the art, such as high-pressure steam sterilization, may be used. After sterilization is complete, the fermentation medium is placed at room temperature and inoculated under aseptic conditions. In the present invention, there is no particular limitation on the inoculation method, and any inoculation method known in the art may be used, such as accurately measuring a certain amount of seed culture liquid using a sterile container in a sterile environment, transferring it to the fermentation medium, and mixing it uniformly. The fermentation is preferably completed in a fermentation tank equipped with a pressure valve. In the present invention, there is no particular limitation on the specifications or brand of the fermentation tank, and any fermentation tank known in the art may be used.
[0051] In the present invention, in addition to the fermentation medium that influences the fermentation process and results, the fermentation conditions are also an important factor that influences the fermentation results. For example, temperature, fermentation time, system pH, dissolved oxygen, rotation speed, pressure, timing and amount of material supply, etc. all affect the fermentation results. When fermentation is performed using the first fermentation medium, the fermentation culture conditions are preferably as follows: during the first 15 hours of fermentation culture, the aeration rate is 900-1100 L / h and the pressure is 0.04-0.06 MPa; after 15 hours of fermentation culture, material supply is started at a rate of 0.5-2.0 mL / L / h; the aeration rate is 1400-1600 L / h; the pressure is 0.08-0.12 MPa; the pH of the fermentation liquid is 4.0-6.0; the fermentation culture temperature is 27°C-29°C; the rotation speed is 100-450 rpm; the dissolved oxygen is 0.04-0.06 MPa; and the fermentation culture temperature is 27°C-29°C. The preferred conditions are: aeration rate of 1000 L / h, pressure of 0.05 MPa, and fermentation time of 68 to 76 hours; aeration rate of 1500 L / h, pressure of 0.1 MPa, pH of the fermentation broth of 5.0, fermentation temperature of 28°C, rotation speed of 280 rpm, dissolved oxygen content of 35%, and fermentation time of 72 hours. The preferred conditions are: glucose 280 to 320 g / L and multivitamin 0.08 to 0.12 mg / L; glucose 300 g / L and multivitamin 0.1 mg / L; and fermentation time of 72 hours. The preferred conditions are: aeration rate of 1000 L / h, pressure of 0.05 MPa, pH of the fermentation broth of 5.0, fermentation temperature of 28°C, rotation speed of 280 rpm, dissolved oxygen content of 35%, and fermentation time of 72 hours. The preferred conditions are: glucose 280 to 320 g / L and multivitamin 0.08 to 0.12 mg / L; glucose 300 g / L and multivitamin 0.1 mg / L. The multivitamin contains 0.08 to 0.12 parts of vitamin B1 and 0.12 parts of vitamin B 12 The fermentation medium contains the following components in parts by mass: 0.08-0.12 parts of vitamin B2, 0.08-0.12 parts of vitamin B3, 0.08-0.12 parts of vitamin B5, 0.08-0.12 parts of vitamin B6, 0.08-0.12 parts of vitamin B9, 0.08-0.12 parts of vitamin C, and 0.08-0.12 parts of vitamin H. Addition of these multivitamins during the fermentation process improves the elasticity and toughness of the mycelium. The present invention does not limit the source of vitamins in the fermentation medium, and commercially available vitamin sources known in the art may be used.
[0052] In the present invention, when the fermentation culture is carried out using the second fermentation medium, the fermentation culture conditions are as follows: aeration rate 900 to 1600 L / h, pressure controlled to 0.04 to 0.12 MPa, pH of the fermentation broth 4.0 to 6.0, fermentation culture temperature 27 to 29°C, rotation speed 100 to 450 rpm, dissolved oxygen content 20% to 50%, and fermentation culture time 72 to 480 hours, more preferably aeration rate 1000 to 1400 L / h, pressure controlled to 0.05 to 0.1 MPa, pH of the fermentation broth 5.0, fermentation culture temperature 28°C, rotation speed 280 rpm, and dissolved oxygen content 35%. During the fermentation culture period, if the reducing sugar content in the fermentation system is 2 to 5 g / L or less than 3 to 4 g / L, 20% to 90% by volume of the fermentation broth is discharged and the second fermentation medium is added to the original volume. The volume of the discharged fermentation liquid is preferably 30% to 80% of the original volume of the fermentation liquid, more preferably 40% to 70%, and most preferably 50%. Addition of the second fermentation medium to the original volume is preferably completed within 10 to 30 minutes, and the material supply is preferably completed within 20 minutes. During the fermentation culture period, the material supply is started when the reducing sugar concentration falls to 2 to 5 g / L or less, and the material supply operation can be repeated multiple times.
[0053] In the present invention, the fermentation broth is preferably sterilized after fermentation is completed. Sterilization of the fermentation broth is beneficial for inactivating viable bacteria in the fermentation broth and, at the same time, further decomposing nucleic acid molecules produced during the fermentation process, reducing the nucleic acid content of the mycelium obtained by fermentation, which is convenient for subsequent processing and application. The sterilization method for the fermentation broth is preferably heat sterilization. The heat sterilization procedure preferably involves holding at a temperature of 60°C to 70°C for 18 to 22 minutes, and then at 88°C to 92°C for 8 to 15 minutes, and more preferably holding at 65°C for 20 minutes and then at 90°C for 12 minutes.
[0054] In the present invention, the fermentation product is separated after sterilization. The method for separating the fermentation product preferably involves separating the solid and liquid phases of the fermentation broth, washing the solid phase, and then drying it. The solid-liquid separation method includes filtration or centrifugation. In one embodiment of the present invention, the method for separating the fermentation product preferably involves suction filtration using a vacuum suction filter and thoroughly washing the filter cake. After solid-liquid separation, the solid phase is recovered and washed with purified water. The washing is preferably performed one to three times, more preferably two times. The drying is preferably performed by oven drying. The oven drying temperature is preferably 55°C to 65°C, more preferably 60°C. Observation of the filter cake revealed that the mycelium morphology was in good condition and filamentous, the color of the filter cake was pale yellow, the filter cake was elastic, and the dry weight biomass percentage was 0.63% or more. The protein content measured by the Kjeldahl method was 55.39% or more. After toxin testing, the filter cake was found to be toxin-free. At the same time, the mycelium produced by Fusarium brachygibosum strain FXFB001 has excellent mycelial properties, being toxin-free and rich in protein, so the present invention provides the application of the Fusarium brachygibosum strain FXFB001 or the microbial inoculant in the production of mycelial protein.
[0055] The present invention provides an edible mycelium, wherein the edible mycelium has a protein content of 40% or more, a dietary fiber content of 20% or more, and / or a fat content of 8% or less, based on the dry mass of the edible mycelium, and the edible mycelium is derived from Fusarium brachygibbosum, for example, obtained by fermenting Fusarium brachygibbosum.
[0056] In the present invention, the protein content of the edible mycelia is preferably 45%, 50%, 55%, 60%, or 65% or more, the dietary fiber content of the edible mycelia is preferably 25%, 30%, 35%, 40%, or 45% or more, and the fat content of the edible mycelia is preferably 7%, 6%, 5%, 4%, or 3% or less.
[0057] In the present invention, the edible mycelium is preferably derived from the Fusarium brachygibbosum strain having the accession number CGMCC No. 41066. The addition of the multivitamin during the fermentation and cultivation of the edible mycelium improves the elasticity and toughness of the mycelium.
[0058] In the present invention, the fermentation method is the same as the method for producing edible mycelia using Fusarium brachygibosum described in the technical solution above. The edible mycelia prepared by fermentation preferably have a filamentous appearance, a flesh-colored color, and elasticity. Physical and chemical tests have shown that the protein-rich mycelia do not contain toxins and have good edible safety characteristics.
[0059] The edible mycelium is rich in protein and can be used as a raw material for industrial production of alternative proteins. The present invention provides the application of the edible mycelium or the edible mycelium prepared by the above method in the preparation of meat substitutes.
[0060] In the present invention, the meat substitute is a type of edible mycelium processed product, and refers to a meat substitute such as a nutritional food or health food produced from the edible mycelium without structural processing, and the structural processing preferably includes shearing.
[0061] In the present invention, the method for producing meat substitutes uses edible protein-rich mycelia as a raw material for processing or deep-processing various products. The method for producing nutritional foods from the protein-rich mycelia preferably involves using the protein-rich mycelia as is or extracting higher-purity proteins and using other supplementary materials to produce nutritional foods. The mycelia are highly elastic and tough, and their abundant proteins contain various essential amino acids, which can significantly increase the nutritional value of the resulting foods. The foods are preferably provided in the form of nutritional supplements. Similarly, foods can be formulated to enhance flavor or be combined with common foods to make them more appealing to consumers. In certain embodiments, the compositions of the present invention are produced as milk-based or meat-based products. In one embodiment of the present invention, the edible mycelia obtained by fermentation are used to produce ham or sausages in place of meat ingredients (such as pork, beef, chicken, fish, mutton, rabbit, or donkey). The term "dairy-based product" refers to any liquid or semi-solid milk- or whey-based product with various fat contents. Milk-based products include, for example, cow's milk, goat's milk, sheep's milk, skimmed milk, whole milk, milk powder and whey reconstituted without any processing or processed products such as sour milk, curd, curd, yogurt, acidified whole milk, buttermilk and other yogurt products. Another important group includes milk beverages such as whey drinks, fermented milk, condensed milk, infant or toddler milk powder, milk-containing foods such as flavored milk, ice cream, sugar, etc.
[0062] In the present invention, the method for producing a health food from the protein-rich mycelium preferably involves using the protein-rich mycelium as is, extracting a more highly purified protein, or using other active ingredients and auxiliary materials to produce a health food. The health food contains an acceptable excipient or carrier. Carriers or diluents acceptable for health use are well known in the health food field. For example, the carrier preferably includes one or more of lactose, starch, glucose, methylcellulose, magnesium stearate, mannitol, sorbitol, etc., or analogs thereof. The diluent preferably includes ethanol, glycerol, and water or other solvents. The pharmaceutical carrier, excipient, or diluent can be selected taking into consideration the intended route of administration and standard pharmaceutical / health food practices. In addition to the carrier, excipient, or diluent, the health food may also include any suitable adhesive, lubricant, suspending agent, coating agent, or solubilizer. Adhesives include starch, gelatin, and natural sugars such as glucose, anhydrous lactose, free-flowing lactose, and beta-lactose; natural and synthetic gums such as corn syrup, gum arabic, gum tragacanth, or sodium alginate, methylcellulose carbonate, and polyethylene glycol. Lubricants include sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, and sodium chloride. Preservatives, stabilizers, dyes, and even flavorings may be included in the health food. Preservatives include sodium benzoate, sorbic acid, cysteine, and esters of parabens. Antioxidants and suspending agents may also be used. Another example of a suitable carrier is sucrose. Another example of a preservative is cysteine.
[0063] When used in conjunction with the term "comprising" in the claims and / or specification, the terms "a" or "an" can refer to "one," but can also refer to "one or more," "at least one," and "one or more."
[0064] The terms "comprise," "have," "include," or "contain" as used in the claims and the specification are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.
[0065] Although the disclosed subject matter supports the definition of the term "or" as alternatives only and "and / or," the term "or" in the claims means "and / or" unless expressly stated as alternatives only or the alternatives are mutually exclusive.
[0066] When used in the claims or specification, any selected / optional / preferred "numerical range" includes not only the numerical endpoints at either end of the range, but also all whole numbers covered by said numerical endpoints relative to the stated numerical endpoints.
[0067] "Edible mycelium" refers to a fungal fermentation culture or concentrate, or an edible mycelium concentrate obtained by further dehydrating and de-nucleating a fungal fermentation culture, and depending on the moisture content of the dehydrated concentrate, the edible mycelium may be in a solid state or a mixture of solid and liquid.
[0068] "Mycelium" refers to the vegetative growth portion of a fungus consisting of hyphae and is an important source of fungal protein production. The mycelium in this disclosure is a fungus from the genus Fusarium, and edible mycelium is obtained after fermentation of the fungus. In some embodiments, the edible mycelium is derived from a fermentation culture of a single fungus. In some embodiments, the edible mycelium is derived from a fermentation culture of multiple fungi.
[0069] The application of Fusarium brachygibosum in the production of mycelial proteins provided by the present invention will be described in detail below with reference to examples, which should not be construed as limiting the scope of protection of the present invention.
[0070] Example 1 Isolation and screening method for Fusarium brachygibosum strain FXFB001 1. Source of strains 1.1 Sample collection: Strain FXFB001 was collected in June 2018 from a forest humus soil sample in Shannan City, Tibet Autonomous Region.
[0071] 1.2 Separation process: The forest humus sample was mixed uniformly, and 5 g was weighed out and placed in an Erlenmeyer flask containing 45 mL of sterile 0.7% sodium carboxymethylcellulose solution and 15 glass beads, and shaken at 30°C and 150 rpm for 30 minutes. 1 mL of the soil suspension was taken and diluted with sterile water for 10 minutes. -1 , 10 -2 , 10 -3 and then diluted in a 10 -2 and 10 -3 The two dilutions were spread evenly on MGA 2.5 plates (containing chloramphenicol and tetracycline hydrochloride) at a drop rate of 100 μL per dish. After the plate surface dried, the plates were incubated upside down at 28°C for 2 to 7 days. MGA 2.5 medium contained 15 g / L peptone, 1.0 g KH2PO4, 0.5 g MgSO4·7H2O, 0.0025 g malachite green oxalate, 20 g agar, and 1 L distilled water.
[0072] 1.3 Purification process: The strain was purified using the stepwise mycelial end transplantation method. After colonies formed on the plates, the mycelium from the end of a single colony was harvested and placed on malt extract agar / wort agar medium (MEA, purchased from Beijing Aobo Xing Biotechnology Co., Ltd.). The strain was incubated at 28°C until pure colonies were obtained. The resulting colonies were stored at -80°C and designated strain FXFB001.
[0073] 2. Strain Identification 2.1 Morphological characteristics of strain FXFB001 The FXFB001 strain was inoculated into MEA medium and cultured for 4 days at 28°C. Depending on the growth rate, the morphology of mycelia, colony color, number and shape of microconidia and macroconidia, sporulating cells, shape and presence of chlamydospores, and type of fruiting body were recorded to identify the strain. Cultural characteristics: The colony diameter was 3.8 cm in 4 days. The aerial mycelium growing on PSA medium was felt-like and initially white, gradually turning pink, and the underside of the plate turned orange-red to deep red (see Figure 1). Morphological characteristics: Conidia: The macroconidia were sickle-shaped, slightly pointed at both ends, had 3-5 septa, and measured 10.8-25.1 μm x 2.0-3.6 μm. The microconidia were spindle-shaped, slightly curved, slightly flattened at both ends, and had 0-2 septa. The chlamydospores were spherical, occurring singly within the hyphae, and measured 5.2-7.5 μm.
[0074] 2.2 Molecular identification of strain FXFB001 2.2.1 TEF1 and ITS sequence analysis 1. DNA Template Preparation An appropriate amount of mycelium from each strain was collected in a PCR tube containing 50 μL of lysis solution, placed in a PCR instrument (Dongsheng ETC811), heated at 95°C for 30 minutes, transferred to -20°C, and frozen for 15 minutes. After removal, the tube was centrifuged at 3000 rpm (SIGMA 3K15) for 2 minutes to allow the cell debris and lysis solution to settle to the bottom of the PCR tube. At the same time, the supernatant was essentially clear, indicating that the fungal genetic material had dissolved in the supernatant.
[0075] 2. Preparation of PCR System A 25 μL PCR system was constructed: 2 μL of supernatant, 8.8 μL of ultrapure sterile water, 12 μL of 2x PCR mix, 1 μL of DMSO, 0.6 μL of 10 μmol / L upstream primer, and 0.6 μL of 10 μmol / L downstream primer. The primer sequences are listed in Table 1.
[0076] Table 1. Amplification primer sequences for the two genes [Table 1]
[0077] 3. PCR Amplification 2 μL of the supernatant and the prepared PCR system were added to a PCR tube and placed in a PCR machine (Dongsheng ETC811) for PCR amplification. The PCR reaction conditions are listed in the table below. After amplification was completed, the PCR product was sent to Beijing Jingke Biotechnology Co., Ltd. for sequencing using a sequencer (abi3730XL).
[0078] The PCR reaction conditions are as follows. TEF1: Pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 s, annealing at 55°C for 30 s, amplification at 72°C for 1 min for 34 cycles, hold at 72°C for 5 min. ITS1: pre-denaturation at 94°C for 2.5 min, denaturation at 95°C for 30 s, annealing at 52°C for 30 s, amplification at 72°C for 1 min for 30 cycles, hold at 72°C for 5 min.
[0079] 4. The PCR product was sequenced, and the sequence of the PCR product obtained was as follows: TEF1 sequence: GACTCTGGCAAGTCGACCACTGTAAGTACCACCAAGCCTCGACCCCGCCTAGATTTGGTGGGGTAGTCTCAAGATTCATCCATACTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTCTCATTTCCCTCGATCGCGCGCCCTTTTACCCATCGATCCATCATTCGACTCGCTCTCTCACGACGACTCGATCCGCGCCCGTTACCCCGCTCGAGCTCAAAAATTTTGCGAATCAATCGTAATTTTTTTCTTGATGGGGCTCATACCCCGCCACTCGAGTGACGGGCGCGCTTGCCCTCTTCCCACAGTCATATTCATATGGGCGCGCATCATCACGTGTCTACCAGTCACTAACCACTTGACAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTATGCTGTCACCGTTGCCTTCATCACATCCTCATACTAACACGTCCACCAGAC(SEQ ID NO:5).
[0080] ITS1 sequence: The NBCI online comparison system (Blast) was used to compare the two gene sequences, respectively. The comparison database was the Nucleotide collection (nr / nt). The most similar comparison results for the two genes are shown in Table 2.
[0081] Table 2 Comparison of the two gene sequences of the above strains [Table 2]
[0082] The TEF1 gene and ITS1 gene sequences of all FSAMSC strains were collected from the FUSARIOID-ID database ( www.fusarium.org ), and the evolutionary positions of the current strains were analyzed by constructing a multigene phylogenetic tree.
[0083] The analysis procedure for the multi-gene phylogenetic tree was as follows: first, multiple sequence comparison of each gene was performed individually using MAFFT (version v7.310), then the multiple sequence comparison result file was trimmed using GBLOCKS (version 0.91b), and then manually trimmed using AliView. After trimming, the sequences of the two genes were consecutively spliced, and a multi-gene phylogenetic tree of the spliced sequences was constructed using IQ-TREE (version 2.2.5), as shown in Figure 2 .
[0084] Based on morphological characteristics and ITS1 and TEF1 sequences, the strain FXFB001 was identified as Fusarium brachygibbosum. The strain was deposited at the China General Microbiological Culture Collection Center on December 13, 2023, with the accession number CGMCC No: 41066.
[0085] Example 2 Initial screening experiments of mycelial protein-producing strains 1 Preparation method of mycelial protein by primary screening The strain FXFB001 isolated and identified in Example 1 and other microbial strains isolated in the same batch as the strain FXFB001 were each inoculated into a 250 mL Erlenmeyer flask containing 50 mL of the primary screening medium, and cultured with shaking at 200 rpm at a constant temperature for 48 hours. The composition of the primary screening medium was 30 g / L glucose, 30 g / L yeast extract powder, 1 g / L KH2PO4, 0.5 g / L MgSO4·7H2O, and 0.2 g / L CaCl2, and it was sterilized by high-pressure steam at 121 °C for 20 minutes. The filter cake was suction-filtered using a vacuum suction filtration device, washed thoroughly, placed in an electric blast drying oven, and oven-dried at 60 °C. The mass of the dried filter cake was accurately measured, the biomass concentration was calculated, and then, referring to the <<National Food Safety Standard for the Determination of Protein in Foods GB 5009.5-2016>>, the Kjeldahl method was used to measure the crude protein of the mycelium.
[0086] 2 The results of preparing mycelium by primary screening are shown in Table 3.
[0087] Table 3 List of the states of mycelium produced by strains by primary screening
Table 3
[0088] The strain number 41 is strain FXFB001. The mycelium prepared by fermentation of strain FXFB001 has a filamentous mycelial morphology, a pale yellow filter cake color, and an elastic filter cake texture (Figure 3). The dry weight biomass reached 0.63%. Furthermore, the protein content of the mycelium was measured to be 55.39% by the Kjeldahl method. In other words, the protein-rich mycelium prepared by strain FXFB001 showed no spores under a microscope, had a good filamentous shape, a pale yellow and elastic filter cake, and no unpleasant odor.
[0089] Example 3 Mycelial amplification and fermentative production of strain FXFB001 and several microbial strains derived from its initial screening cultures
[0090] 1 Culture method 1.1 The shake flask seed culture media used are as shown in Table 4 (primary seed culture medium and secondary seed culture medium) and Table 5 (tertiary seed culture medium).
[0091] Table 4. Culture medium for primary and secondary seed culture [Table 4]
[0092] Table 5. Tertiary seed culture medium [Table 5]
[0093] 1.2 Seed Culture Conditions: The primary seed culture medium shown in Table 4 was used to prepare the inoculum. The activated strain of the present invention (strains with good mycelial morphology in the seed culture medium and fermentation broth and excellent indicators, see Table 7) was inoculated into a 250 mL three-concave Erlenmeyer flask containing 50 mL of initial screening medium and cultured at 200 rpm for 24 hours with shaking at a constant temperature. The secondary seed culture medium shown in Table 4 was used to prepare the inoculum. 5% of the inoculum volume was transferred to a 3 L three-concave Erlenmeyer flask containing 1 L of seed culture medium and cultured at 200 rpm for 24 hours. The secondary seed culture was then inoculated into a 10 L fermentation tank containing the seed culture medium shown in Table 5 at an inoculum volume of 8%. The aeration rate was 10 L / min, the tank pressure was 0.05 MPa, the stirring rate was 150 rpm, the temperature was 28°C, and the pH was adjusted online to 5.0 with aqueous ammonia. The fermentation time was approximately 24 hours.
[0094] 1.3 Fermentation culture produced protein-rich mycelium: 1.3.1 The primary fermentation medium for producing protein-rich mycelium is shown in Table 6.
[0095] Table 6. First fermentation medium [Table 6]
[0096] The multivitamin used in this example is Vitamin B1 / thiamine, Vitamin B 12 Contains the following ingredients in equal mass ratios: cobalamin, vitamin B2 / riboflavin, vitamin B3 / niacin, vitamin B5 / D-calcium pantothenate, vitamin B6 / pyridoxine, vitamin B9 / folic acid, vitamin C, and vitamin H / D-biotin.
[0097] 1.4 The fermentation culture method is as follows: The three-stage inoculum cultured for 24 hours was inoculated at an inoculation amount of 5% and pumped from the bottom valve through a sterilized hose into a 50 L fermentation tank containing 30 L of the first fermentation medium. The aeration volume for the first 15 hours was 1000 L / h, and the tank pressure was 0.05 mpa. After 15 hours, the material supply was started at a rate of 0.5 mL / L / h. The components of the material supply included 320 g / L of glucose and 0.1 mg / L of multivitamins. Then, the aeration volume was adjusted to 1500 L / h, the tank pressure was adjusted to 0.1 mpa, the pH was controlled at 6.0 with ammonia water, and the culture was carried out at 28 °C for 72 hours with a rotation speed of 100 rpm and a dissolved oxygen of 50%.
[0098] 1.5 Post-treatment process after fermentation culture (1) Heat treatment: After fermentation, the fermentation broth was heated to 65 °C and held for about 20 minutes, then heated to 90 °C and held for about 10 minutes, and then cooled to room temperature. (2) Pressurized filtration and refrigeration: After heat treatment, the fermentation broth was pressurized filtered using a plate and frame filter press. After sufficient washing and ventilation, the filter cake was taken out and stored at 4 °C. (3) Detection: The sample for crude protein measurement was pretreated, the dried sample was pulverized and passed through a 60-mesh sieve, and then the measurement was carried out according to the <<National Food Safety Standard for the Determination of Protein in Foods GB5009.5-2016>>. For the detection of common mycotoxins in foods, the detection was entrusted to a third-party SGS.
[0099] The fermentation results of each strain are shown in Table 7.
[0100] Table 7 Rescreening results of Fusarium sp. in a 50 L fermentation tank
Table 7
[0101] Comparison of the mycelium results obtained by fermenting and culturing the Fusarium brachygibbosum strain FXFB001 in the first fermentation medium supplemented with multivitamins with the results of preparing protein-rich mycelium by the initial screening in Example 2 1. The mycelium prepared by initial screening showed no spores under the microscope, and the filter cake was grayish-white with good elasticity, good toughness, and no bad odor. 2. The mycelium protein obtained by continuous fermentation culture has a good filamentous shape when observed under a microscope (Figures 4 and 5). The fermented liquid naturally has a flesh color without heating, and the protein content is approximately 55%.
[0102] The toxin detection results showed that under the above fermentation and culture conditions, no fungal toxins were detected in strain FXFB001 (below the limit, see Table 8; for detection methods, refer to the SN / T3136-2012 standard), and the total fat content was 7.97%, crude protein content was 60.51%, and dietary fiber content was 26.01%.
[0103] Table 8. Physical and chemical detection results [Table 8]
[0104] Example 4 Method for producing protein-rich mycelium by fermentation of Fusarium brachygibosum 1 Culture method 1.1 The components of the shake flask seed medium used are as shown in Table 9 (primary seed culture medium and secondary seed culture medium) and Table 10 (tertiary seed culture medium).
[0105] Table 9. Media for primary and secondary seed culture [Table 9]
[0106] Table 10. Tertiary seed culture medium [Table 10]
[0107] 1.2 Seed culture conditions: The primary seed solution was prepared using the seed medium shown in Table 9. The activated strain FXFB001 was harvested and inoculated into a 250 mL three-concave Erlenmeyer flask containing 50 mL of the medium and incubated at 180 rpm for 26 hours. The secondary seed solution was prepared using the seed medium shown in Table 9. A 6% inoculum was transferred to a 3 L three-concave Erlenmeyer flask containing 1 L of seed medium and incubated at 200 rpm for 22 hours. The secondary seed solution was then inoculated into a 10 L fermentation tank containing the medium shown in Table 10 at a 10% inoculum. The aeration rate was 11 L / min, the tank pressure was 0.06 MPa, the stirring rate was 220 rpm, the temperature was 26 °C, and the pH was adjusted online to 6.0 with aqueous ammonia. The fermentation time was 36 hours.
[0108] 1.3 Fermentation culture produced protein-rich mycelium: 1.3.1 Fermentation media for producing protein-rich mycelium are shown in Table 11.
[0109] Table 11 Second fermentation medium [Table 11]
[0110] 1.4 The fermentation culture method is as follows: The tertiary seed solution cultured for 22 hours was pumped through a sterilized hose at a 7% inoculation rate into a 50L fermentation tank containing the second fermentation medium shown in Table 11 at a volume of 30L via a bottom valve. The fermentation conditions were an aeration rate of 1100L / h, a tank pressure of 0.05MPa, and when the reducing sugar content in the fermentation medium was less than 2g / L, 80% of the medium was released and the original volume was restored within 20 minutes. The second fermentation medium was used as the feed medium. The aeration rate was 1400L / h, the tank pressure was adjusted to 0.1MPa, and the pH value of the system was controlled at 5.2 with ammonia water. The culture was carried out at 28°C, a rotation speed of 350rpm, and a dissolved oxygen concentration of 40% for 480 hours.
[0111] 1.5 Treatment process after fermentation (1) Heat treatment: After fermentation ended, the fermentation broth was heated to 65°C and held for about 20 minutes, then heated to 90°C and held for about 10 minutes, and then cooled to room temperature. (2) Pressurized filtration and refrigeration: After heat treatment, the fermentation broth was pressurized and filtered using a plate and frame filter press. After sufficient washing and ventilation, the filter cake was taken out and stored at 4°C. (3) Detection: The crude protein measurement sample was pretreated, the dried sample was pulverized, passed through a 60-mesh sieve, and then the measurement was carried out in accordance with <<National Food Safety Standard for the Determination of Protein in Foods GB5009.5-2016>>. For the detection of common mycotoxins in foods, the detection was entrusted to the third-party SGS.
[0112] Under the above fermentation culture conditions, no toxin was detected in the mycelium produced by the fermentation of strain FXFB001. In the case of the mycelium dry basis, the total fat was 5.8%, the crude protein content was 54.2%, and the dietary fiber content was 20.4%.
[0113] Example 5 1 Culture method 1.1 The components of the shaking flask seed culture medium used are as shown in Table 12 (primary seed culture medium and secondary seed culture medium) and Table 13 (tertiary seed culture medium).
[0114] Table 12 Primary and secondary seed culture media
Table 12
[0115] Table 13 Tertiary seed culture medium
Table 13
[0116] 1.2 Culture conditions of the seed solution: The primary seed solution was prepared using the medium shown in Table 12. The activated strain FXFB001 was harvested and inoculated into a 250 mL three-concave Erlenmeyer flask containing 50 mL of the medium, followed by 24 hours of constant temperature shaking at 200 rpm. The secondary seed solution was prepared using the seed medium shown in Table 12. A 5% inoculum was transferred to a 3 L three-concave Erlenmeyer flask containing 1 L of seed medium, and cultured for 24 hours at 200 rpm on a shaking table. The secondary seed solution was then inoculated into a 10 L fermentation tank containing the medium shown in Table 13 at an 8% inoculum. The aeration rate was 10 L / min, the tank pressure was 0.05 MPa, the stirring rate was 150 rpm, the temperature was 27 °C, and the pH was adjusted online to 5.5 with aqueous ammonia. The fermentation time was approximately 24 hours.
[0117] 1.3 Fermentation culture produced protein-rich mycelium: 1.3.1 The components of the fermentation medium for producing protein-rich mycelium are listed in Table 14.
[0118] Table 14. First fermentation medium [Table 14]
[0119] The vitamin complex contains Vitamin B1 / Thiamine 0.1mg, Vitamin B 12 The vitamins were in the following mass ratios: Calcium pantothenate / cobalamin 0.1mg, Vitamin B2 / riboflavin 0.1mg, Vitamin B3 / niacin 0.1mg, Vitamin B5 / D-calcium pantothenate 0.1mg, Vitamin B6 / pyridoxine 0.1mg, Vitamin B9 / folic acid 0.1mg, Vitamin C 0.1mg, and Vitamin H / D-biotin 0.1mg.
[0120] 1.4 The fermentation culture method is as follows: The three-stage inoculum solution cultured for 24 hours was inoculated at an inoculation amount of 10% and pumped through a sterilized hose from the bottom valve into a 50 L fermentation tank containing the first fermentation medium shown in Table 14 with a liquid volume of 25 L. The aeration volume for the first 15 hours was 900 L / h, and the tank pressure was 0.04 mpa. After 15 hours, the material supply was started at 2 ml / L / h. The material supply medium was 300 g / L glucose and 0.1 mg / L multivitamins. Then, the aeration volume was adjusted to 1600 L / h, the tank pressure was adjusted to 0.1 mpa, the pH was controlled at 4.5 with ammonia water, and the culture was carried out at 28°C with a rotation speed of 100 rpm and a dissolved oxygen of 30% for 70 hours.
[0121] 1. Process for treatment after fermentation culture (1) Heat treatment: After fermentation, the fermentation broth was heated to 65°C and held for about 20 minutes, then heated to 90°C and held for about 10 minutes, and then cooled to room temperature. (2) Pressurized filtration and refrigeration: After heat treatment, the fermentation broth was pressurized filtered using a plate and frame filter press. After sufficient washing and ventilation, the filter cake was taken out and stored at 4°C. (3) Detection: The sample for crude protein measurement was pretreated, the dried sample was pulverized and passed through a 60-mesh sieve, and then the measurement was carried out according to <<National Food Safety Standard for the Determination of Protein in Foods GB5009.5-2016>>. For the detection of common mycotoxins in foods, the detection was entrusted to a third-party SGS.
[0122] Under the above fermentation culture conditions, no toxin was detected in the mycelia produced by the fermentation of strain FXFB001. In the case of the dry basis of mycelia, the total fat was 8%, the crude protein content was 60.5%, and the dietary fiber content was 26.0%.
[0123] Example 6 Method for producing protein-rich mycelia by fermentation of Fusarium brachygibbosum 1. Culture method 1.1 The components of the shaking flask inoculum medium used are as shown in Table 15 (primary inoculum culture medium and secondary inoculum culture medium) and Table 16 (tertiary inoculum medium).
[0124] Table 15. Media for primary and secondary seed culture [Table 15]
[0125] Table 16. Tertiary seed culture medium [Table 16]
[0126] 1.2 Seed culture conditions: The primary seed solution was prepared using the seed medium shown in Table 15. The activated strain FXFB001 of the present invention was harvested and inoculated into a 250 mL three-concave Erlenmeyer flask containing 50 mL of the medium, followed by 22 hours of constant temperature shaking at 200 rpm. The secondary seed solution was prepared using the seed medium shown in Table 15. A 6% inoculum was transferred to a 3 L three-concave Erlenmeyer flask containing 1 L of seed medium, and cultured for 22 hours at a shaking table speed of 220 rpm. The secondary seed solution was then inoculated into a 10 L fermentation tank containing the medium shown in Table 16 at a 10% inoculum. The aeration rate was 11 L / min, the tank pressure was 0.06 MPa, the stirring rate was 220 rpm, the temperature was 28 °C, and the pH was adjusted online to 5.0 with aqueous ammonia. The fermentation time was 42 hours.
[0127] 1.3 Fermentation culture produced protein-rich mycelium: 1.3.1 Fermentation media for producing protein-rich mycelium are shown in Table 17.
[0128] Table 17 Second fermentation medium [Table 17]
[0129] 1.4 The fermentation culture method is as follows: The three-stage inoculum solution cultured for 22 hours was inoculated at an inoculation amount of 7% and pumped through a sterilized hose from the bottom valve into a 50 L fermentation tank containing the second fermentation medium shown in Table 17 with a liquid volume of 30 L. The fermentation conditions were an aeration rate of 1100 L / h and a tank pressure of 0.05 mpa. When the reducing sugar in the fermentation system was less than 5 g / L, 50% of the medium was discharged, and then the material was supplied to the original volume within 20 minutes. The material supply medium was the second fermentation medium. The aeration rate was adjusted to 1400 L / h and the tank pressure to 0.1 mpa. The pH value of the system was controlled at 5.0 with ammonia water, cultured at 28 °C, the rotation speed was 350 rpm, the dissolved oxygen was 40%, and cultured for 120 hours.
[0130] 1.5 Post-treatment process after fermentation culture (1) Heat treatment: After fermentation, the fermentation broth was heated to 65 °C and held for about 20 minutes, then heated to 90 °C and held for about 10 minutes, and then cooled to room temperature. (2) Pressurized filtration and refrigeration: After heat treatment, the fermentation broth was pressurized filtered using a plate and frame filter press. After sufficient washing and ventilation, the filter cake was taken out and stored at 4 °C. (3) Detection: The sample for crude protein measurement was pretreated, the dried sample was pulverized and passed through a 60-mesh sieve, and then the measurement was carried out according to <<National Food Safety Standard for the Determination of Protein in Foods GB5009.5-2016>>. For the detection of common mycotoxins in foods, the detection was entrusted to a third-party SGS.
[0131] Under the above fermentation culture conditions, no toxin was detected in the mycelium produced by the fermentation of strain FXFB 01. In the case of the mycelium dry basis, the total fat was 8.0%, the crude protein content was 60.5%, and the dietary fiber content was 26.0%.
[0132] Example 7 Microbial inoculant containing strain FXFB 01 The Fusarium brachygibbosum strain FXFB 01 was subcultured according to the method described in Example 3, 50% glycerin was added to the obtained three-stage inoculum solution, and it could be stored frozen at -80 °C.
[0133] Example 8 Method for producing meat substitute (edible fungal protein-based sausage) using mycelium of Example 5 The following weights of raw materials were accurately measured: 40 kg of edible mycelium, 58 kg of ice water, 0.1 kg of chemical seasoning, 0.7 kg of yeast extract, 1 kg of edible sugar, 0.5 kg of meat flavoring, 3 kg of sunflower oil, 0.6 kg of edible salt, 0.6 kg of spices, 2 kg of starch, 2.5 kg of carrageenan, and 0.106 kg of paprika.
[0134] The manufacturing method is Step 1: Mixing carrageenan, starch and some ice water, chopping evenly, adding fungal protein, chemical seasoning, sugar, food essence, vegetable oil, edible salt, spices, coloring and the remaining ice water, and mixing evenly; Step 2: Fill the nylon casing with the meat filling using a filling machine, hang the sausage on a stick and put it in a smoker, dry it at 60°C for 20 minutes, steam it at 95°C for 20 minutes, and then boil it. Step 3: Remove the product, blow cold air on it to below 25°C, and then package it. Step 4: flash-freezing and storing.
[0135] It should be pointed out that the above are only preferred embodiments of the present invention, but those skilled in the art may make some improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be regarded as within the protection scope of the present invention.
Claims
1. Application of Fusarium brachygibbosum or its microbial inoculant in the production of mycelial protein.
2. The application described in claim 1, characterized in that the Fusarium brachygibosum is a Fusarium brachygibosum strain having a TEF1 gene sequence having at least 95% homology to SEQ ID NO: 5 and / or an ITS1 gene sequence having at least 97% homology to SEQ ID NO: 6, or a composition formed by the Fusarium brachygibosum strain.
3. the Fusarium brachygibosum comprises the Fusarium brachygibosum strain FXFB001; The application of claim 1, characterized in that the Fusarium brachygibosum strain FXFB001 has the deposit number CGMCC No: 41066.
4. The application according to any one of claims 1 to 3, characterized in that the Fusarium brachygibosum comprises spore and / or mycelium forms.
5. An edible mycelium, wherein the mass percent content of protein in the edible mycelium is 40% or more, and / or the mass percent content of dietary fiber is 20% or more, and / or the mass percent content of fat is 8% or less, based on the dry mass of the edible mycelium; The edible mycelium is derived from Fusarium brachygibbosum; The edible mycelium is characterized in that the Fusarium brachygibosum is Fusarium brachygibosum in the application according to any one of claims 2 to 4.
6. 6. The edible mycelium according to claim 5, characterized in that the edible mycelium is highly elastic and / or tough.
7. 1. Fusarium brachygibbosum strain FXFB001, characterized in that it is Fusarium brachygibbosum strain FXFB001, and has deposit number CGMCC No: 41066.
8. A microbial inoculant for producing protein or protein-rich mycelia, comprising the Fusarium brachygibosum strain FXFB001 of claim 7 and an inoculant-acceptable auxiliary material.
9. The microbial inoculant for producing protein or protein-rich mycelium according to claim 8, wherein the mass ratio of the Fusarium brachygibosum strain FXFB001 to auxiliary materials is 1-10:1-100.
10. 10. A microbial inoculant for producing proteins or protein-enriched mycelia according to claim 8 or 9, characterized in that the auxiliary materials comprise one or more of a culture medium, an additive and a carrier.
11. 11. Use of the Fusarium brachygibosum strain FXFB001 according to claim 7 or the microbial inoculant according to any one of claims 8 to 10 in the production of proteins or protein-rich mycelium.
12. A method for producing edible mycelium using Fusarium brachygibbosum, comprising: A step of inoculating a seed liquid prepared from Fusarium brachygibosum or a microbial inoculant thereof into a fermentation medium and culturing it to obtain a fermentation liquid; and separating the fermentation product after sterilizing the fermentation liquid to obtain edible mycelium; The method according to any one of claims 2 to 4, wherein the Fusarium brachygibosum is Fusarium brachygibosum.
13. the fermentation medium comprises a first fermentation medium and / or a second fermentation medium; The first fermentation medium contains the following components in the amounts listed below: starch 23 to 27 g / L, citric acid 0.8 to 1.2 g / L, potassium dihydrogen phosphate 0.8 to 1.2 g / L, ammonium sulfate 4.5 to 5.5 g / L, magnesium salt 17 to 21 mg / L, the concentration of which is calculated as Mg, calcium salt 2.8 to 43 mg / L, the concentration of which is calculated as Ca, manganese salt 0.48 to 0.62 mg / L, the concentration of which is calculated as Mn, iron salt or ferrous salt 0.96 to 1.05 mg / L, the concentration of which is calculated as Fe, zinc salt 0.72 to 0.91 mg / L, the concentration of which is calculated as Zn, cobalt salt 0.44 to 0.54 mg / L, the concentration of which is calculated as Co, and multivitamins 0.08 to 0.12 mg / L; The second fermentation medium contains 15 to 60 kg / m of glucose 3 , K. 2 SO 4 0.5~1.5kg / m 3 , H 3 P.O. 4 0.4~0.8kg / m 3 , Magnesium salts: 9.75 to 58.5 g / m 3 , Zinc salts whose concentration is calculated in terms of Zn: 2.2 to 22.5 g / m 3 , manganese salts whose concentration is calculated in Mn equivalent: 2.46 to 9.85 g / m 3 , calcium acetate 0.1-0.3 kg / m 3 and antifoaming agent 0.08 to 0.12 kg / m 3 The method according to claim 12, characterized in that the component is contained in an amount of:
14. The fermentation culture conditions when fermenting using the first fermentation medium are: During the first 15 hours of fermentation, the aeration rate is controlled at 900-1100 L / h and the pressure is controlled at 0.04-0.06 MPa. After 15 hours of fermentation, start supplying the material at a rate of 0.5-2.0 mL / L / h, the aeration rate is 1400-1600 L / h, the pressure is 0.08-0.12 MPa, and the pH value of the fermentation liquid is 4.0-6.0; The fermentation culture temperature is 27°C to 29°C, the rotation speed is 100 to 450 rpm, the dissolved oxygen content is 20% to 50%, and the fermentation culture time is 68 to 76 hours, the raw material supply components at the time of supplying the raw material include 280 to 320 g / L of glucose and 0.08 to 0.12 mg / L of multivitamins; The multivitamin is vitamin B 1 0.08 to 0.12 parts of vitamin B 12 0.08 to 0.12 parts of vitamin B 2 0.08 to 0.12 parts of vitamin B 3 0.08 to 0.12 parts of vitamin B 5 0.08 to 0.12 parts of vitamin B 6 0.08 to 0.12 parts of vitamin B 9 The method according to claim 13, characterized in that the ingredients are 0.08 to 0.12 parts by weight of the soluble fiber, 0.08 to 0.12 parts by weight of vitamin C, and 0.08 to 0.12 parts by weight of vitamin H.
15. When the fermentation culture is carried out using the second fermentation medium, the fermentation culture conditions are as follows: the aeration rate is controlled to 900 to 1600 L / h, the pressure is controlled to 0.04 to 0.12 MPa, and the pH value of the fermentation liquid is controlled to 4.0 to 6.0; The fermentation culture temperature is 27°C to 29°C, the rotation speed is 100 to 450 rpm, the dissolved oxygen content is 20% to 50%, and the fermentation culture time is 72 to 480 hours, The method according to claim 13, wherein when the reducing sugar content in the fermentation system is less than 2-5 g / L, a volume fraction of 20%-90% of the fermentation liquid is discharged, and a second fermentation medium is added to the original volume.
16. The method for preparing the seed culture solution of Fusarium brachygibosum comprises: The Fusarium brachygibosum is inoculated into a first seed medium, and primary seed culture and secondary seed culture are sequentially performed to obtain a secondary seed liquid. The method according to claim 12, further comprising inoculating a second seed medium with the secondary seed liquid, followed by tertiary seed culture to obtain a tertiary seed liquid.
17. the first seed culture medium contains components in the following amounts: glucose 28 to 32 g / L, yeast extract powder 23 to 27 g / L, potassium dihydrogen phosphate 0.8 to 1.2 g / L, magnesium salt whose concentration is calculated as Mg 17 to 21 mg / L, and calcium salt whose concentration is calculated as Ca 3 to 4 mg / L; 17. The method of claim 16, wherein the second seed culture medium contains the following components in amounts: 23 to 27 g / L of starch, 0.8 to 1.2 g / L of citric acid, 0.8 to 1.2 g / L of potassium dihydrogen phosphate, 4.8 to 5.2 g / L of ammonium sulfate, 17 to 21 mg / L of magnesium salt (concentration calculated as Mg), 0.003 to 0.004 g / L of calcium salt (concentration calculated as Ca), 0.48 to 0.62 mg / L of manganese salt (concentration calculated as Mn), 0.96 to 1.05 mg / L of iron salt or ferrous salt (concentration calculated as Fe), 0.72 to 0.91 mg / L of zinc salt (concentration calculated as Zn), and 0.44 to 0.54 mg / L of cobalt salt (concentration calculated as Co).
18. the culture temperature of the primary seed culture, secondary seed culture, or tertiary seed culture is 25°C to 30°C; The culture time of the primary seed culture, secondary seed culture, or tertiary seed culture is 22 to 26 hours; The rotation speed of the primary seed culture, secondary seed culture, or tertiary seed culture is 100 to 200 rpm; The aeration rate of the tertiary seed culture is 8 to 12 L / min; The pressure of the tertiary seed culture is 0.04 to 0.06 MPa; The method according to claim 16 or 17, wherein the pH value of the tertiary seed culture system is 4.0 to 6.
0.
19. The sterilization method of the fermentation liquid is heat sterilization, The method according to claim 12, wherein the heat sterilization procedure is to maintain the temperature at 60°C to 70°C for 18 to 22 minutes, and then raise the temperature to 88°C to 92°C and maintain the temperature for 8 to 15 minutes.
20. The method according to claim 12, wherein the method for separating the fermentation product comprises separating the solid and liquid phases of the fermentation broth, washing the solid phase, and then drying it to obtain edible mycelium.
21. Use of the edible mycelium according to claim 5 or 6 or prepared by the method according to any one of claims 12 to 20 in the preparation of meat substitutes.
22. A meat substitute, characterized in that it is produced using the edible mycelium according to claim 5 or 6, or the edible mycelium prepared by the method according to any one of claims 12 to 20, as a meat raw material.
23. 23. The meat substitute of claim 22, comprising ham or sausage.
Citation Information
Patent Citations
Pyruvate decarboxylase gene FvPDC6 and application of pyruvate decarboxylase gene FvPDC6 in improving yield of fusarium venanii hypha protein
CN116640753A
Edible foodstuffs and bio reactor design
US20230248039A1
Food Materials Comprising Filamentous Fungal Particles and Membrane Bioreactor Design
US20240023588A1
Food products comprising fungal mycelium, process for their preparation and uses thereof
WO2022091089A1
Fusarium angulatum with high yield of hypha protein and application of fusarium angulatum
CN115851458A