Nucleic acids, recombinant vectors, target integration cells, gene expression methods, and uses
Targeted integration of exogenous nucleic acid fragments into specific sites using recombinase systems in host cells addresses the instability and cost issues of traditional random integration, achieving stable and high-yield expression for recombinant protein production.
Patent Information
- Application Number
- JP2025550184
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-11-09
- Filing Date
- 2024-03-25
- Publication Date
- 2026-02-24
AI Technical Summary
Traditional methods for developing host cells for recombinant protein production, such as Chinese hamster ovary cells, involve random integration of genes, leading to unstable expression, high costs, and resource waste due to extensive screening and unknown integration site effects, resulting in unpredictable expression stability and reduced target gene levels.
A nucleic acid fragment (SEQ ID No. 1) is used for targeted integration of exogenous nucleic acid fragments into specific sites within a range of bases, utilizing recombinase systems like Bxb1 integrase, ΦC31 integrase, or Cre recombinase, with selectable marker genes and promoters, to achieve stable and high-yield expression.
This method reduces construction time, costs, and uncertainty, providing high-yield and stable expression with predictable performance, simplifying the process and reducing the need for extensive screening.
Smart Images

Figure 2026506403000001_ABST
Abstract
Description
[Technical Field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application simultaneously claims priority to a Chinese patent application bearing application number 2023103474969, entitled "Nucleic acid, recombinant vector, targeted integration cell, gene expression method, and use," filed with the Patent Office of the People's Republic of China on March 28, 2023, and application number 2023114934398, entitled "Nucleic acid, recombinant vector, targeted integration cell, gene expression method, and use," filed with the Patent Office of the People's Republic of China on November 9, 2023, the entire contents of which are incorporated herein by reference.
[0002] This application relates to the field of biotechnology, and in particular to nucleic acids and recombinant vectors containing same, targeted integrated cells, and methods and uses for producing target gene expression products. [Background technology]
[0003] Host cells (e.g., Chinese hamster ovary cells) are the primary standard expression platform for recombinant protein production. The traditional approach to developing suitable host cells involves randomly inserting a gene of interest into the genome and then selectively culturing cells carrying the transgene. However, in the upstream cell line generation process, non-targeted transgene integration methods are used to generate a stably transfected cell pool. Multiple clones are then obtained using monoclonal techniques, and these clones are then subjected to tedious screening to identify clones with suitable production characteristics. Subsequent steps require process development and medium optimization for each cell line, which requires extensive repetitive work, resulting in high costs and resource waste. Regarding the quality of the produced cell lines, the expression stability of cell lines obtained using this method is difficult to predict during cultivation. Furthermore, information about the random integration site is unknown, and site effects resulting from the integration of exogenous target genes can also lead to significantly reduced expression levels of the target gene.
[0004] Overall, constructing a cell line using traditional random integration methods typically takes more than six months to obtain a stable cell line. Random integration has drawbacks, including a significant labor-intensive process, high costs, and instability in copy number and site, as well as uncertainty about the effect of the site on cellular physiology. These drawbacks can lead to the loss of the target gene during growth, resulting in a loss of value for the resulting cell line. Summary of the Invention
[0005] One objective of the present embodiment includes providing a nucleic acid, wherein the host cell containing the nucleic acid is capable of stable and high-yield expression of an exogenous nucleic acid fragment incorporated into SEQ ID No. 1.
[0006] In a first aspect of the present application, a nucleic acid is provided, said nucleic acid comprising a nucleic acid fragment set forth in SEQ ID No. 1, said nucleic acid fragment being used to integrate an exogenous nucleic acid fragment.
[0007] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within a nucleotide range from base 11 to base 430 of the nucleic acid fragment.
[0008] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 21st to 414th base section of the nucleic acid fragment.
[0009] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 38th to 402nd base section of the nucleic acid fragment.
[0010] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within a nucleotide range from base 53 to base 389 of the nucleic acid fragment.
[0011] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within a nucleotide range from base 73 to base 373 of the nucleic acid fragment.
[0012] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within a nucleotide range from base 91 to base 360 of the nucleic acid fragment.
[0013] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 108th to 342nd base section of the nucleic acid fragment.
[0014] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 126th to 326th base section of the nucleic acid fragment.
[0015] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 143rd to 310th base section of the nucleic acid fragment.
[0016] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within a nucleotide range from base 160 to base 295 of the nucleic acid fragment.
[0017] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within a nucleotide range from base 178 to base 274 of the nucleic acid fragment.
[0018] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 194th to 263rd base section of the nucleic acid fragment.
[0019] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 209th to 253rd base section of the nucleic acid fragment.
[0020] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 221st to 242nd base section of the nucleic acid fragment.
[0021] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 231st to 240th base section of the nucleic acid fragment.
[0022] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to site NW_003616785.1:83044 within the nucleic acid fragment.
[0023] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to site NW_003616785.1:83044 within the nucleic acid fragment in the CHO cell.
[0024] In some embodiments of the present application, the exogenous nucleic acid fragment comprises a first recombination recognition sequence, a second recombination recognition sequence, a selectable marker gene and / or a target gene located between the first recombination recognition sequence and the second recombination recognition sequence, and a promoter that regulates and controls expression of the selectable marker gene and / or the target gene.
[0025] In some embodiments of the present application, the exogenous nucleic acid fragment comprises a selectable marker gene located between the first recombination recognition sequence and the second recombination recognition sequence, and a promoter that regulates and controls expression of the selectable marker gene.
[0026] In some embodiments of the present application, the exogenous nucleic acid fragment comprises a target gene located between the first recombination recognition sequence and the second recombination recognition sequence, and a promoter that regulates and controls expression of the target gene.
[0027] In some embodiments of the present application, the exogenous nucleic acid fragment comprises a selectable marker gene and a target gene located between the first recombination recognition sequence and the second recombination recognition sequence, and a promoter that regulates and controls expression of the selectable marker gene and the target gene.
[0028] In some embodiments of the present application, the first recombination recognition sequence and the second recombination recognition sequence are generated by a recombinase, and optionally, the recombinase is Bxb1 integrase, ΦC31 integrase, Cre recombinase, or FLP recombinase, and optionally, the recombinase is Bxb1 integrase; or / and, The first recombination recognition sequence and the second recombination recognition sequence are each independently one or more selected from a LoxP sequence, a LoxPL3 sequence, a LoxP2L sequence, a LoxFas sequence, a Lox511 sequence, a Lox2272 sequence, a Lox2372 sequence, a Lox5171 sequence, a Loxm2 sequence, a Lox71 sequence, a Lox66 sequence, an FRT sequence, a Bxb1 attP sequence, a Bxb1 attB sequence, an attP sequence, an attB, an attL, and an attR sequence; optionally, the first recombination recognition sequence and the second recombination recognition sequence are each independently selected from an attR sequence and an attL sequence; optionally, the first recombination recognition sequence is attR and the second recombination recognition sequence is attL. In some embodiments of the present application, the selectable marker gene is one or more selected from a neomycin resistance gene, a thymidine kinase gene, a hygromycin phosphotransferase gene, a dihydrofolate reductase gene, a thymidine kinase gene, a glutamine synthetase gene, an asparagine synthetase gene, a tryptophan synthetase gene, a histidinol dehydrogenase gene, an aminoglycoside phosphotransferase gene, a tryptophan synthetase gene, and a fluorescent protein gene, and optionally, the selectable marker gene is a fluorescent protein gene.
[0029] In some embodiments of the present application, the promoter is a CMV promoter, an SV40 promoter, an RSV promoter, a β-globin promoter, a UBC promoter, an EF1a promoter, a ubiquitin promoter, a β-actin promoter, a PGK1 promoter, a Rosa26 promoter, an HSP70 promoter, a GAPDH promoter, an Eif4A1 promoter, an Egr1 promoter, a FerH promoter, an SM22α promoter, or an Endothelin-1 promoter.
[0030] In some embodiments of the present application, the target gene encodes one or more of an antibody, a recombinant protein, a polypeptide, an enzyme, a hormone, a growth factor, and a receptor, optionally, the target gene encodes an antibody, and optionally, the nucleotide sequence of the target gene is set forth in SEQ ID No. 2.
[0031] In some embodiments of the present application, the nucleotide sequence of the nucleic acid comprises the nucleotide sequence set forth in SEQ ID No. 3.
[0032] In some embodiments of the present application, the nucleotide sequence of the nucleic acid comprises the nucleotide sequence set forth in SEQ ID No.7.
[0033] In some embodiments of the present application, the nucleotide sequence of the nucleic acid comprises the nucleotide sequence set forth in SEQ ID No.9.
[0034] In a second aspect of the present application, there is provided a recombinant vector, the recombinant vector comprising the nucleic acid of the first aspect, the nucleic acid further comprising the first recombination recognition sequence and the second recombination recognition sequence, and the exogenous nucleic acid fragment comprising a target gene and / or a selectable marker gene.
[0035] In some embodiments of the present application, the exogenous nucleic acid fragment is a target gene, the first recombination recognition sequence is a 5' homologous arm homologous to the sequence fragment in which the nucleic acid fragment set forth in SEQ ID No. 1 is located, and the second recombination recognition sequence is a 3' homologous arm homologous to the sequence fragment in which the nucleic acid fragment set forth in SEQ ID No. 1 is located, and optionally, the 5' homologous arm is attR and the 3' homologous arm is attL.
[0036] In some embodiments of the present application, the exogenous nucleic acid fragment is a selectable marker gene, the first recombination recognition sequence is a 5' homologous arm homologous to the sequence fragment in which the nucleic acid fragment set forth in SEQ ID No. 1 is located, and the second recombination recognition sequence is a 3' homologous arm homologous to the sequence fragment in which the nucleic acid fragment set forth in SEQ ID No. 1 is located, and optionally, the 5' homologous arm is attP and the 3' homologous arm is attP-GA.
[0037] In some embodiments of the present application, the recombinant vector is a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, a herpes viral vector, a poxviral vector, a baculoviral vector, a papillomaviral vector, a papovaviral vector, an integrating phage vector, a non-viral vector, a transposon and / or transposase, an integrase substrate, or a plasmid.
[0038] In a third aspect of the present application there is provided a targeted integration cell, said targeted integration cell comprising a nucleic acid according to the first aspect.
[0039] In some embodiments of the present application, the target integration cell is a eukaryotic cell.
[0040] In some embodiments of the present application, the eukaryotic cell is a mammalian cell.
[0041] In some embodiments of the present application, the mammalian cells include Chinese hamster ovary CHO cells, human embryonic kidney HEK293 cells, and optionally, the target integration cells are Chinese hamster ovary CHO cells.
[0042] In a fourth aspect of the present application, there is provided a method for producing a targeted integration cell according to the third aspect, said method comprising: The method includes the step of introducing a nucleic acid according to the first aspect into a cell, or providing a cell containing the nucleic acid fragment set forth in SEQ ID No. 1, and integrating the exogenous nucleic acid fragment into the nucleic acid fragment to produce a targeted integrated cell.
[0043] In a fifth aspect of the present application, there is provided a method for producing a target gene expression product, said method comprising the step of culturing a targeted integration cell according to the third aspect and collecting an expression product of the target gene in the exogenous nucleic acid fragment.
[0044] In a sixth aspect of the present application there is provided the use of a nucleic acid according to the first aspect in the manufacture of a protein or polypeptide, said protein or said polypeptide being expressed by said exogenous nucleic acid fragment. [Effects of the Invention]
[0045] Compared with the prior art, the present application has the following beneficial effects: During the early stages of this application, a large number of cell lines were screened and it was found that integration of an exogenous nucleotide sequence (e.g., a fusion protein or a monoclonal antibody) into the nucleic acid fragment set forth in SEQ ID No. 1 or a homologous fragment thereof that maintains at least 90% identity thereto can result in targeted integration cells that are characterized by high identity, stability, and high yield. These advantages significantly reduce the requirements for the subsequent culture process (e.g., culture conditions and medium composition). The present application also provides targeted integration cells, in which the insertion site of the exogenous nucleotide fragment is determined. Therefore, compared with the conventional random integration cell construction method, the construction process required for the targeted integration cells of the present application is simpler, takes less time, is more efficient, and is less costly, and furthermore, has less uncertainty, is more reproducible, and is more controllable. [Brief explanation of the drawings]
[0046] In order to more clearly describe the technical solutions in the embodiments of the present application and to more fully understand the present application and its beneficial effects, the following will briefly describe the drawings necessary for describing the embodiments. Obviously, the drawings in the following description are only some embodiments of the present application, and those skilled in the art can obtain other drawings from these drawings without any creative efforts. [Figure 1] 1 is a flowchart of a process in an embodiment of the present application. [Figure 2] 1 shows a map of a plasmid used to screen for integration sites in an example of the present application. [Figure 3] 1 is a map of the transfection plasmids produced in the examples of the present application. [Figure 4] FIG. 1 is a statistical diagram showing the protein expression levels in cells into which target gene 1 has been introduced in an example of the present application. [Figure 5] FIG. 1 is a diagram verifying the stability of cells into which target gene 1 has been introduced during serial passage in an example of the present application. [Figure 6] FIG. 1 is an electrophoresis image of cells into which target gene 1 has been introduced in an example of the present application. [Figure 7] 1 shows an electrophoresis image of cells into which target genes 2 and 3 have been introduced in an example of the present application. DETAILED DESCRIPTION OF THE INVENTION
[0047] The present application will be described in more detail below with reference to drawings, embodiments, and examples. It should be understood that these embodiments and examples are provided to explain the present application and not to limit the scope of the present application, but to provide a more thorough and comprehensive understanding of the disclosure of the present application. In addition, the present application can be implemented in many different forms and is not limited to the embodiments and examples described herein. It should be understood that those skilled in the art can make various changes or modifications without violating the content of the present application, and the resulting equivalent forms are also included in the scope of protection of the present application. Furthermore, in the following description, many specific details are given to provide a fuller understanding of the present application, but it should be understood that the present application can be implemented without one or more of these details.
[0048] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. In this specification, the terms used in the specification of this application are for describing embodiments and examples, and are not intended to limit the present application. term
[0049] Unless otherwise stated or contradictory, the terms or phrases used herein have the following meanings:
[0050] As used herein, the term "and / or," "or / and," and "and / or" includes any one of two or more related listed items, and also includes any and all combinations of the related listed items, and said any and all combinations include any two of the related listed items, any two or more of the related listed items, or all combinations of the related listed items. It should be noted that when at least three items are connected by a combination of at least two conjunctions selected from "and / or," "or / and," and "and / or," it is understood that in this application, the technical solutions in question definitely include technical solutions connected by "logical AND," and also definitely include technical solutions connected by "logical OR." For example, "A and / or B" includes the three parallel forms of A, B, and A+B. For example, a technical solution of "A, and / or, B, and / or, C, and / or D" includes any of A, B, C, and D (i.e., all technical solutions connected by a "logical OR"), any and all combinations of A, B, C, and D, i.e., any combination of two or three of A, B, C, and D, and further includes four combinations of A, B, C, and D (i.e., all technical solutions connected by a "logical AND").
[0051] In this application, unless otherwise specified, terms such as "plurality," "multiple kinds," "multiple times," and "multiple elements" mean that the quantity is two or more. For example, "one or more kinds" means one or more kinds.
[0052] As used herein, the terms "combinations of these," "any combination of these," "any combination of these," and the like include all appropriate combinations of any two or more of the listed items.
[0053] In this specification, the term "appropriate" in "appropriate combination form," "appropriate form," "any appropriate form," etc., is based on whether the technical solution of the present application can be implemented, the technical problem of the present application can be solved, and the expected technical effect of the present application can be achieved.
[0054] In this specification, the terms "preferred," "more preferred," "more suitably," and "desirable" are intended to describe more effective embodiments or examples, and should not be understood to limit the scope of protection of the present application.
[0055] In this application, the terms "furthermore", "even more", "particularly" etc. are used for descriptive purposes and indicate differences in content, but should not be understood as limiting the scope of protection of this application.
[0056] In this application, "optionally", "optional" and "optional" mean that there may be or may not be, that is, it means either one selected from the two parallel modes of "present" or "absent". When multiple "optional" appear in one technical solution, each "optional" is independent unless otherwise specified and there is no contradiction or mutual constraint.
[0057] In this application, the terms "first," "second," "third," "fourth," etc., in "first embodiment," "second embodiment," "third embodiment," "fourth embodiment," etc., are for descriptive purposes only and cannot be understood as indicating or implying relative importance or number, or as implicitly indicating the importance or number of the indicated technical features. Furthermore, it should be understood that "first," "second," "third," "fourth," etc., serve the purpose of a non-exhaustive enumeration description only and do not constitute a closed-form limitation on number.
[0058] In this application, technical features described openly include closed technical solutions consisting of the listed features, and also open technical solutions including the listed features.
[0059] In this application, with respect to numerical intervals (i.e., numerical ranges), unless otherwise specified, any numerical distribution is considered continuous within the numerical interval and includes the two numerical endpoints (i.e., the minimum and maximum values) of the numerical range and every value between those two endpoints. Unless otherwise specified, when a numerical interval indicates only integers within that numerical interval, the two endpoint integers of the numerical range and every integer between those two endpoints are included, and all integers are equivalent to being directly recited herein. For example, when t is an integer selected from 1 to 10, it means that t is any integer selected from the group of integers consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. Furthermore, when multiple ranges are provided describing a characteristic or property, these ranges may be combined. In other words, unless otherwise specified, ranges disclosed herein should be understood to include any and all subranges therein.
[0060] Unless otherwise specified, the temperature parameters in this application may be constant temperature treatments or may vary within a certain temperature range. It should be understood that the constant temperature treatment may vary the temperature within the precision range of the equipment control. For example, the temperature may vary within the ranges of ±5°C, ±4°C, ±3°C, ±2°C, and ±1°C.
[0061] In this application, %(w / w) and wt% both represent weight %, %(v / v) represents volume %, and %(w / v) represents mass volume %.
[0062] In this application, "about" or "approximately" means within an acceptable error range for a particular value, as determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, depending on the practice in the art, "about" can mean within 3 or more standard deviations. Alternatively, "about" can mean within 20% or less, preferably 10% or less, more preferably 5% or less, and even more preferably 1% or less of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5-fold, and even more preferably within 2-fold of a value.
[0063] In this application, a "selection marker gene" may be a gene that allows target integrant cells carrying the gene to be specifically selected for or about the gene in the presence of a corresponding selection agent. For example, but not by way of limitation, a selection marker can allow for positive selection of target integrant cells transformed with the selection marker gene in the presence of the gene. Untransformed target integrant cells cannot grow or survive under selected conditions. A selection marker may be positive, negative, or dual-function. A positive selection marker allows for the selection of cells carrying the marker, while a negative selection marker allows for the selective elimination of cells carrying the marker. A selection marker can confer drug resistance or complement a metabolic or catabolic defect in the target integrant cells.
[0064] In this application, the term "antibody" is used in the broadest sense and encompasses a variety of antibody structures, including, but not limited to, monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), half antibodies, and antibody fragments, as long as the fragment exhibits the desired antigen-binding activity. As used herein, the term "antibody fragment" refers to a molecule other than an intact antibody, which contains a portion of an intact antibody that binds to the antigen bound by the intact antibody. Examples of antibody fragments include, but are not limited to, Fv, Fab, Fab', Fab'-SH, F(ab'), diabodies, linear antibodies, single-chain antibody molecules (e.g., scFv), and multispecific antibodies formed from antibody fragments. For a review of specific antibody fragments, see Holliger and Hudson, Nature Biotechnology 23:1126-1136 (2005).
[0065] As used herein, the term "targeted integration cells" refers to cells into which exogenous nucleic acid has been introduced, including the progeny of such cells. Targeted integration cells include "transformants" and "transformed cells," and include the primary transformed cell and its progeny, regardless of the number of passages. The nucleic acid content of the progeny may not be entirely identical to that of the parent cell and may contain mutations. Mutant progeny that have the same function or biological activity as screened or selected for in the originally transformed cell are included herein.
[0066] As used herein, the term "vector" refers to a nucleic acid molecule capable of delivering another nucleic acid linked thereto. The term also includes vectors that are self-replicating nucleic acid structures and vectors that integrate into the genome of a target integrating cell into which they are introduced. In certain embodiments, a vector induces expression of a nucleic acid to which it is operably linked. Such vectors are referred to herein as "expression vectors."
[0067] In this application, the term "homologous fragment" refers to a sequence fragment that has significant sequence similarity as determined by sequence alignment. For example, two sequence fragments may have approximately 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 99.9% homology. Alignment is performed using algorithms and computer programs (including, but not limited to, BLAST, FASTA, and HMME) that compare sequence fragments and calculate the statistical significance of the match based on factors such as sequence length, sequence identity and similarity, and the presence and length of sequence mismatches or gaps. For example, the ratio of the length of the similar sequence fragment to the length of the aligned region may be used. Homologous sequence fragments can refer to both DNA sequences and protein sequences.
[0068] The presently disclosed means provide a target integration cell suitable for an exogenous nucleotide sequence. In certain embodiments, the target integration cell comprises an exogenous nucleotide sequence integrated into an integration site on the genome of a host cell. An "integration site" comprises a nucleic acid sequence in the genome of the target integration cell, into which the exogenous nucleotide sequence is inserted. In certain embodiments, the integration site is located between two adjacent nucleotides on the genome of the target integration cell. In certain embodiments, the integration site comprises an extended segment of nucleotides, and the exogenous nucleotide sequence may be inserted between any of the nucleotides.
[0069] Site-specific integration (SSI) integrates a recombinant gene encoding a recombinant protein of interest into a predetermined genomic site, providing a means to generate more consistent clones and reducing cell line development time. Thus, SSI has become a promising strategy for teams developing host cells for exogenous expression (e.g., CHO cell lines) to reproducibly target preferred genomic sites that may be characterized by high activity and stable expression.
[0070] Various technologies have been used to achieve site-specific integration in CHO cell lines, including the Cre / Lox recombinase system, the Flp / FRT recombinase system, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR / Cas9. These technologies have improved integration efficiency and precision compared to random knock-in approaches. To utilize precise recombinase-mediated recombination, a target site must be introduced into the cellular genome. This can be achieved by simple random integration or targeted mutagenesis.
[0071] Site-specific integration methods require lengthy and laborious procedures to obtain final single-cell clones. Furthermore, the construct backbone may remain integrated into the genome during the integration process, potentially leading to side effects such as gene silencing. Recombinase systems also pose challenges in constructing vector cells and subsequent product cell development because they require two recombination sites to construct RMCE. Zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR / Cas9 all utilize the cell's intrinsic DNA repair machinery to integrate payload DNA. However, as the size of the insertion cassette increases, the frequency of homologous recombination repair decreases, limiting the amount of heterologous DNA that can be inserted in a single integration.
[0072] Cell lines generated by site-specific integration of target genes, such as fusion proteins, monoclonal antibodies, and dual antibodies, exhibit predictable performance in terms of growth, production, and stability compared to cell lines generated by random integration. This method improves the controllability and reproducibility of the integration process, promotes stable and high-yield expression of target genes, and simplifies subsequent screening and process development steps. Therefore, the development of cells that can efficiently and stably express target proteins is of great importance. First aspect of the present application
[0073] An embodiment of the present application provides a nucleic acid, the nucleic acid comprising the nucleic acid fragment set forth in SEQ ID No. 1, the nucleic acid fragment being used to integrate an exogenous nucleic acid fragment. SEQ ID No.1: TAATTCTGGCAACTATCAAAGGTTCACCAAGGAAGGAATTCTTTATTTGGTATCTGCAAGCGCCTGGGTGTTCCAATTTCTATCTGCAAATGTTTGTTCCTGCAGACATGTCTAACTATGGTGGAAACAGAGACCAGCCTCAGATGTCACACTGTGACCTGACCTATAAAAGCTGAACTTTACAAAGCATAAGCTTGGGTTCATGCCTGAGTGAAACCAGAC TGAGTTTCTCTTGTCTCTCCGACTGCTTGCTTGGTCCTGTGCTGGCTAAAATTTCCATGACAGTAGGGGTGTAAATTATTCAGTTTTAGTTTCCCAGAAAACTAAAAGTAAGACTGTCATATGACCTAATGATTTGACTTCTGGGTCCTTTCAATTAGCTGTTGAAAGGACAATAGATTACTCATGGCCATTTAAACAAATTCACAGTAGCAAAAAGGTGAG
[0074] In one example of the present application, the sequence fragment into which the exogenous nucleic acid fragment is incorporated maintains 90% or greater identity with the nucleic acid fragment set forth in SEQ ID No. 1, for example, 90%, 90.5%, 91%, 91.5%, 92%, 92.5%, 93%, 93.5%, 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% identity.
[0075] In the present application, the integration site of the exogenous nucleic acid fragment may correspond to positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, ... 444 of the nucleic acid fragment.
[0076] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within a base range of 11 to 430 of the nucleic acid fragment. Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within a base range of 21 to 414 of the nucleic acid fragment. Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within a base range of 38 to 402 of the nucleic acid fragment. Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within a base range of 53 to 389 of the nucleic acid fragment. Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within a base range of 73 to 373 of the nucleic acid fragment. Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within a base range of 91 to 360 of the nucleic acid fragment. Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within a base range of 108 to 342 of the nucleic acid fragment. Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within a nucleotide section from 126 to 326 of the nucleic acid fragment. Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within a nucleotide section from 143 to 310 of the nucleic acid fragment. Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within a nucleotide section from 160 to 295 of the nucleic acid fragment. Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within a nucleotide section from 178 to 274 of the nucleic acid fragment. Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within a nucleotide section from 194 to 263 of the nucleic acid fragment. Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within a nucleotide section from 209 to 253 of the nucleic acid fragment. Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within a nucleotide section from 221 to 242 of the nucleic acid fragment. Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within a nucleotide section from base 231 to base 240 of the nucleic acid fragment. Optionally, the integration site of the exogenous nucleic acid fragment corresponds to site NW_003616785.1:83044 within the nucleic acid fragment. Optionally, the integration site of the exogenous nucleic acid fragment corresponds to site NW_003616785.1:83044 within the nucleic acid fragment in a CHO cell.
[0077] In one example of the present application, the exogenous nucleic acid fragment comprises a first recombination recognition sequence, a second recombination recognition sequence, a selectable marker gene and / or a target gene located between the first recombination recognition sequence and the second recombination recognition sequence, and a promoter that regulates and controls the expression of the selectable marker gene and / or the target gene.
[0078] In one example of the present application, the exogenous nucleic acid fragment comprises a selectable marker gene located between the first recombination recognition sequence and the second recombination recognition sequence, and a promoter that regulates and controls the expression of the selectable marker gene.
[0079] In one example of the present application, the exogenous nucleic acid fragment comprises a target gene located between the first recombination recognition sequence and the second recombination recognition sequence, and a promoter that regulates and controls expression of the target gene.
[0080] In one example of the present application, the exogenous nucleic acid fragment comprises a selectable marker gene and a target gene located between the first recombination recognition sequence and the second recombination recognition sequence, and a promoter that regulates and controls the expression of the selectable marker gene and the target gene.
[0081] In one example of the present application, the first recombination recognition sequence and the second recombination recognition sequence are generated by a recombinase, and the recombinase is Bxb1 integrase, ΦC31 integrase, Cre recombinase, or FLP recombinase.
[0082] In one example of the present application, the recombinase is Bxb1 integrase.
[0083] In one example of the present application, the first recombination recognition sequence and the second recombination recognition sequence are each independently one or more selected from a LoxP sequence, a LoxPL3 sequence, a LoxP2L sequence, a LoxFas sequence, a Lox511 sequence, a Lox2272 sequence, a Lox2372 sequence, a Lox5171 sequence, a Loxm2 sequence, a Lox71 sequence, a Lox66 sequence, an FRT sequence, a Bxb1 attP sequence, a Bxb1 attB sequence, an attP sequence, an attB sequence, an attL sequence, and an attR sequence.
[0084] In one example of the present application, the first recombination recognition sequence and the second recombination recognition sequence are both independently selected from attR and attL sequences.
[0085] Optionally, the first recombination recognition sequence is attR and the second recombination recognition sequence is attL.
[0086] In one example of the present application, the selectable marker gene is one or more selected from a neomycin resistance gene, a thymidine kinase gene, a hygromycin phosphotransferase gene, a dihydrofolate reductase gene, a thymidine kinase gene, a glutamine synthetase gene, an asparagine synthetase gene, a tryptophan synthetase gene, a histidinol dehydrogenase gene, an aminoglycoside phosphotransferase gene, a tryptophan synthetase gene, and a fluorescent protein gene.
[0087] In one example of the present application, the selectable marker gene is a fluorescent protein gene.
[0088] In one example of the present application, the promoter is a CMV promoter, an SV40 promoter, an RSV promoter, a β-globin promoter, a UBC promoter, an EF1a promoter, a ubiquitin promoter, a β-actin promoter, a PGK1 promoter, a Rosa26 promoter, an HSP70 promoter, a GAPDH promoter, an Eif4A1 promoter, an Egr1 promoter, a FerH promoter, an SM22α promoter, or an Endothelin-1 promoter.
[0089] In one example of the present application, the target gene encodes one or more of an antibody, a recombinant protein, a polypeptide, an enzyme, a hormone, a growth factor, and a receptor.
[0090] In one example of the present application, the target gene encodes an antibody.
[0091] In one example of the present application, the nucleotide sequence of the target gene is shown in SEQ ID No. 2.
[0092] In one example of the present application, the nucleotide sequence of the nucleic acid comprises the nucleotide sequence shown in SEQ ID No. 3.
[0093] In one example of the present application, the nucleotide sequence of the nucleic acid comprises the nucleotide sequence shown in SEQ ID No.7.
[0094] In one example of the present application, the nucleotide sequence of the nucleic acid comprises the nucleotide sequence shown in SEQ ID No.9. Second aspect of the present application
[0095] An embodiment of the present application provides a recombinant vector, the recombinant vector comprising the nucleic acid of the first aspect, the nucleic acid further comprising the first recombination recognition sequence and the second recombination recognition sequence, and the exogenous nucleic acid fragment comprises a target gene and / or a selectable marker gene.
[0096] In one example of the present application, the exogenous nucleic acid fragment is a target gene, the first recombination recognition sequence is a 5' homologous arm homologous to the sequence fragment in which the nucleic acid fragment set forth in SEQ ID No. 1 is located, and the second recombination recognition sequence is a 3' homologous arm homologous to the sequence fragment in which the nucleic acid fragment set forth in SEQ ID No. 1 is located.
[0097] In one example of the present application, the 5' homologous arm is attR and the 3' homologous arm is attL.
[0098] In one example of the present application, the exogenous nucleic acid fragment is a selectable marker gene, the first recombination recognition sequence is a 5' homologous arm homologous to the sequence fragment in which the nucleic acid fragment set forth in SEQ ID No. 1 is located, and the second recombination recognition sequence is a 3' homologous arm homologous to the sequence fragment in which the nucleic acid fragment set forth in SEQ ID No. 1 is located.
[0099] In one example of the present application, the 5' homologous arm is AttP and the 3' homologous arm is AttP-GA.
[0100] In one example of the present application, the recombinant vector is a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, a herpes viral vector, a poxviral vector, a baculoviral vector, a papillomaviral vector, a papovaviral vector, an integrating phage vector, a non-viral vector, a transposon and / or transposase, an integrase substrate, or a plasmid.
[0101] In one example of the present application, the recombinant vector is a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, a herpes viral vector, a pox viral vector, a baculoviral vector, a papilloma viral vector, a papova viral vector, an integrating phage vector, or a non-viral vector. Third aspect of the present application
[0102] An embodiment of the present application provides a targeted integration cell, said targeted integration cell comprising a nucleic acid according to the first aspect. In one example of the present application, the target integration cell is a eukaryotic cell, Optionally, the eukaryotic cell is a mammalian cell; Optionally, the mammalian cells include Chinese hamster ovary CHO cells, human embryonic kidney HEK293 cells.
[0103] In one example of the present application, the target integration cells are Chinese Hamster Ovary CHO cells.
[0104] Optionally, the CHO cell comprises a CHO host cell, a CHO K1 host cell, a CHO K1SV host cell, a DG44 host cell, a DUKXB-11 host cell, a CHOK1S host cell, or a CHO K1M host cell. Fourth aspect of the present application
[0105] The present examples provide a method for producing a targeted integration cell according to the third aspect, the method comprising: The method includes the step of introducing a nucleic acid according to the first aspect into a cell, or providing a cell containing the nucleic acid fragment set forth in SEQ ID No. 1, and integrating the exogenous nucleic acid fragment into the nucleic acid fragment to produce a targeted integrated cell.
[0106] Optionally, the integration method includes, but is not limited to, a site-specific recombination technique derived from homologous recombination technology, which utilizes integrase for specific recognition sites to achieve genetic engineering such as gene replacement, gene knockout, and knock-in between the genome and exogenous DNA, such as recombinase-mediated cassette exchange and CRISPR / Cas9-mediated gene targeting integration. Fifth aspect of the present application
[0107] An embodiment of the present application provides a method of producing a target gene expression product, said method comprising culturing a targeted integration cell according to the third aspect and collecting an expression product of the target gene in said exogenous nucleic acid fragment. Sixth aspect of the present application
[0108] An example of the present application provides the use of a nucleic acid according to the first aspect in the production of a protein or polypeptide, said protein or said polypeptide being expressed by said exogenous nucleic acid fragment.
[0109] The targeted integrated cells in this application are characterized by stability and high yield.
[0110] In the present application, the integration site and / or nucleotide sequences adjacent to the integration site can be experimentally identified. In some embodiments of the present application, the integration site and / or nucleotide sequences adjacent to the integration site can be identified by genome-wide screening methods to isolate host cells. In some embodiments of the present application, the integration site and / or nucleotide sequences adjacent to the integration site can be identified by genome-wide screening methods after a transposase-based cassette integration event. In some embodiments of the present application, the integration site and / or nucleotide sequences adjacent to the integration site can be identified by brute force random integration screening. In some embodiments of the present application, the integration site and / or nucleotide sequences adjacent to the integration site can be determined by conventional sequencing methods (e.g., targeted locus amplification) followed by next-generation sequencing and genome-wide sequencing. In some embodiments of the present application, the location of the integration site on the chromosome can be determined by conventional cell biological methods (e.g., fluorescence in situ hybridization analysis).
[0111] Hereinafter, the embodiments of the present application will be described in detail with reference to examples. It should be understood that these examples are for the purpose of illustrating the present application and do not limit the scope of the present application. In the following examples, for experimental methods for which specific conditions are not specified, reference will be made to the guidance set forth in this application, and the experimental methods may be based on experimental manuals in the relevant field, conventional conditions, conditions recommended by manufacturers, or may refer to experimental methods known in the relevant technical field.
[0112] In the following specific examples, unless otherwise specified, the measured parameters of the raw material ingredients may have some deviation within the range of measuring accuracy. Regarding the parameters of temperature and time, allowable deviations are possible due to the measuring accuracy and operating accuracy of the equipment.
[0113] Consumables used in the following specific examples include Neon Resuspension Buffer R (ThermoFisher), a resuspension buffer exclusively for the cell electroporation device, and E1 Buffer (ThermoFisher), an electroshock solution. The recovery medium was 80% (v / v) EX-CELL CHO cloning medium (Sigma-Aldrich) and 20% (v / v) EX-CELLAdvanced CHO Fed-batch medium (Sigma-Aldrich) supplemented with 1% GlutaMAX (ThermoFisher). The growth medium and passaging medium were both EX-CELLAdvanced CHO Fed-batch medium supplemented with 1% GlutaMAX (ThermoFisher). Pressure medium 1 was a passaging medium supplemented with G418 to a final concentration of 200 μg / ml. Pressure medium 2 was a passaging medium supplemented with hygromycin to a final concentration of 200 μg / ml. The conditioned medium was the supernatant obtained by inoculating CHO-K1 cells into a subculture medium and sterile filtering the supernatant after one day of culture. The cloning medium was 75% (v / v) EX-CELL CHO Cloning Medium, 20% (v / v) conditioned medium, and 5% (v / v) ClonaCell-CHO ACF Supplement supplemented with 1% GlutaMAX. The basal medium for the fed-batch medium was EX-CELL Advanced CHO Fed-batch Medium supplemented with 1% GlutaMAX (ThermoFisher), and the feed medium was Cell Boost 7a / 7b (HyClone). Example 1
[0114] The operation process of this embodiment is shown in FIG. 1 and mainly includes the following steps:
[0115] (1) A recombinant plasmid containing RMCE was constructed using the green fluorescent protein gene (EGFP) as a screening marker gene and the attp sequence as a homologous arm (see Figure 2). (2) The constructed plasmid was linearized, and the linear DNA was purified and recovered. (3) 3 × 10 6The CHO cells were transferred to a 50 mL centrifuge tube and centrifuged at room temperature at 1000 rpm for 5 minutes, and the supernatant was discarded. (4) The cells were resuspended in 100 μL of R buffer, a resuspension buffer exclusively used in the cell electroporation device. (5) 15 μg of the linearized plasmid obtained in step (2) was added to the cells resuspended in step (4) and mixed gently by pipetting 50 times to avoid introducing bubbles. (6) The cell electroporation device was turned on and the parameters were adjusted, the motor slot was attached to the electroporation device, and 3 mL of electroshock solution E1 buffer solution was added to the slot. (7) The cell-plasmid suspension from step (5) was aspirated into an electroporation pipette tip and placed in an electric shock tank to administer an electric shock. (8) The electroporated cells were immediately transferred to a 6-well plate containing 2 mL of recovery medium and cultured overnight in a 37°C, 5% CO2 incubator. (9) 24 hours after electroporation, the cells were pressurized with pressurized medium 1, diluted, and seeded into 480 wells. (10) After approximately two weeks of culture, a stable fluorescent pool was obtained, and the pool with the highest fluorescence intensity was expanded and cultured until the cell doubling time was less than 24 hours and the viability exceeded 95%. (11) The recovered cells were cultured by limiting dilution and cultured in cloning medium to complete the monoclonalization. (12) After 14 days, the fluorescent monoclonal cells were expanded in growth medium to generate cell lines. Growth curves were monitored and fluorescence was detected using the fed-batch and feed medium in shake flask cultures. The cell line that showed a good growth curve and high fluorescence was designated GBB003 cells. (13) A passage stability study was conducted for the above-mentioned highly fluorescent cell line using passage medium for approximately 90 days. The GBB003 cells showed little change in fluorescence value and stable growth, confirming that they were stable highly fluorescent cells. (14) Referring to step (1), the target gene 1 fragment, the target gene 2 fragment, and the target gene 3 fragment were cloned into different plasmids to construct three recombinant plasmids containing RMCE, as shown in Figure 3 . Target gene fragment 1 has the sequence shown in SEQ ID No. 2. SEQ ID No. 2: (15) The stable, highly fluorescent cells GBB003 obtained in step (13) were selected for transfection and integration verification. The recombinant plasmid obtained in step (14) above was amplified and linearized, and then co-transfected with Bxb-1 integrase into the stable, highly fluorescent cells GBB003. The transfection steps were the same as above. (16) One day after transfection, a minipool was constructed from the cell pool and pressure screening was performed using pressure medium 2. (17) After 7–10 days, the nonfluorescent cells in the minipool were expanded and monocloned by limiting dilution. (18) Non-fluorescent monoclonal cells were cultured in a constant-temperature incubator (37°C, 80% humidity) and continued to grow until the shake flask stage. After approximately one month, the cell line was subjected to feed culture. A fed-batch culture (Advance + 1% Glutamax for the first three days) was performed. On days 3 and 5, 3% (v / v) Cell Boost 7a and 0.3% (v / v) Cell Boost 7b (Cytiva) were simultaneously added. On days 7, 9, 11, and 13, 5% (v / v) Cell Boost 7a and 0.5% (v / v) Cell Boost 7b (Cytiva) were simultaneously added. Sugar was replenished on days 3, 5, 7, 9, 11, and 13 depending on the cell's sugar consumption, and expression levels were evaluated. Figure 4 shows the results of comparing the expression levels of site-specifically integrated product minipool cell pool (GBB003-minipool), single-copy cell line (GBB003-2D8), and randomly integrated minipool cell pool (random minipool) and single-copy cell line (random monoclone) cultured under the same conditions.
[0116] To investigate the stability of cell clones with targeted integration of target gene 1, clonal cells were serially subcultured for approximately 90 days and evaluated for stability. P1, P13, and P26 were batch cultured for 7 days, with sugar supplementation on days 3, 5, and 7 depending on the intracellular sugar consumption. Expression levels (Figure 5) indicated that the monoclonal cells were stable and had high yields. Second-generation whole-genome sequencing was performed using cell line GBB003, which highly expresses both the fluorescent group and the target gene. The annotation information for the integration site in CHO is NW_003616785.1:83044. When a fluorescent group was inserted into cell line GBB003 at NW_003616785.1:83044, cell line GBB003 highly expressed the fluorescent group. When a gene of interest is inserted into the NW_003616785.1:83044 position of the cell line GBB003, the cell line GBB003 highly expresses the gene of interest. The sequence fragment incorporating target gene 1 is shown in SEQ ID No. 3.
[0117] The genome of the monoclonal cell line was amplified using the breakpoint upstream primer F1 (SEQ ID No. 4): AGACCAGCCTCAGATGTCACAC and the target gene downstream primer R1 (SEQ ID No. 5): AGGCACACAACGGAGGCGGT in the integration plasmid, and a fragment consistent with the theoretical size of 3403 bp was obtained (the band corresponding to lane GBB003-2D8) as shown in Figure 6.
[0118] The sequence fragment incorporating target gene 1 contains attL, the nucleotide sequence of which is shown in SEQ ID No. 6. SEQ ID No. 6: ATGATCCTGACGACGGAGACCGCGGTGGTTGACCAGACAAACC. In the sequence fragment incorporating target gene 1, the portion before attL is an exogenous sequence, and the portion after attL is an endogenous sequence. The exogenous sequence includes target gene 1. Target gene 1 can encode a monoclonal antibody.
[0119] The amplified band was excised from the gel, collected, and purified. Several primer pairs were designed and DNA sequencing was performed. The spliced sequence was shown as SEQ ID No. 3, which was consistent with the theoretical sequence (SEQ ID No. 3), confirming that the target gene was correctly integrated into the target site.
[0120] Similarly, the sequence fragment that integrates target gene 2 into a cell line that highly expresses the target gene is shown in SEQ ID No. 7.
[0121] The genome of the product cell line was amplified using the breakpoint upstream primer F1 (SEQ ID No. 4): AGACCAGCCTCAGATGTCACAC and the product gene downstream primer R2 (SEQ ID No. 8): CCTTAGAATCCTGCTCGGTGA in the plasmid used for production, yielding a fragment consistent with the theoretical size (3486 bp), as shown in Figure 7 (corresponding band in lane GBB003-1G2).
[0122] The amplified band was excised from the gel, recovered, and purified. Several primer pairs were designed and DNA sequencing was performed. The spliced sequence, shown in SEQ ID No. 7, matched the theoretical sequence (SEQ ID No. 7), confirming that the target gene was correctly integrated into the target site. The sequence fragment containing target gene 2 includes attL. In the sequence fragment containing target gene 2, the portion before attL is the exogenous sequence, and the portion after attL is the endogenous sequence. The exogenous sequence includes target gene 2. After integration of target gene 2 into a cell line that highly expresses the target gene, the marker gene EGFP was replaced with the fragment containing target gene 2.
[0123] Similarly, the sequence fragment that integrated target gene 3 into a cell line that highly expresses the target gene is shown in SEQ ID No. 9.
[0124] The genome of the product cell line was amplified using the breakpoint upstream primer F1 (SEQ ID No. 4): AGACCAGCCTCAGATGTCACAC and the product gene downstream primer R2 (SEQ ID No. 10): TACAAATGTGGTATGGCTGATTAGC in the plasmid used for the product, and a fragment consistent with the theoretical size (3665 bp) was obtained, as shown in Figure 7 (corresponding band in lane GBB003-1D1).
[0125] The amplified band was excised from the gel, collected, and purified. Several primer pairs were designed and DNA sequencing was performed. The spliced sequence, shown in SEQ ID No. 9, matched the theoretical sequence (SEQ ID No. 9), confirming that the target gene was correctly integrated into the target site. The sequence fragment containing target gene 3 contains attL. After integration of target gene 3 into a cell line that highly expresses target gene 3, the marker gene EGFP was replaced with a fragment containing target gene 3. References:
[0126] [1]Takeshi Omasa et al,. Cell engineering and cultivation of chinese hamster ovary (CHO) cells. Curr Pharm Biotechnol. 2010 Apr;11(3):233-40.
[0127] The technical features of the above embodiments and examples may be combined in any suitable manner, and for the sake of brevity, not all possible combinations of the technical features in the above embodiments and examples are described, but all combinations of these technical features should be considered within the scope of the present specification unless there is a contradiction.
[0128] The above examples merely illustrate some embodiments of the present application and are useful for specifically and in detail understanding the technical solutions of the present application, but should not be understood as limiting the scope of protection of the patent application. It should be noted that those skilled in the art can make several modifications and improvements without departing from the concept of the present application, and all of these fall within the scope of protection of the present application. Furthermore, after reading the above description of the present application, those skilled in the art should understand that various changes or modifications can be made to the present application, and the resulting equivalents are also within the scope of protection of the present application. It should also be understood that any technical solutions obtained by those skilled in the art through logical analysis, reasoning, or limited testing based on the technical solutions provided in the present application are all within the scope of protection of the patent claims attached hereto. Therefore, the scope of protection of the present patent application should be determined based on the content of the appended claims, and the description and drawings can be used to interpret the content of the claims.
Claims
1. A nucleic acid, The nucleic acid comprises a nucleic acid fragment set forth in SEQ ID No. 1, and the nucleic acid fragment is used to integrate an exogenous nucleic acid fragment.
2. the site into which the exogenous nucleic acid fragment is integrated corresponds to any site within a nucleotide section from 11 to 430 of the nucleic acid fragment; Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within a range of bases 21 to 414 of the nucleic acid fragment; Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within a range of bases 38 to 402 of the nucleic acid fragment; Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within a range of bases 53 to 389 of the nucleic acid fragment; Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within a range of bases 73 to 373 of the nucleic acid fragment; Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within a range of bases 91 to 360 of the nucleic acid fragment; Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within a range of bases 108 to 342 of the nucleic acid fragment; Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within a range of bases 126 to 326 of the nucleic acid fragment; Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within a range of bases 143 to 310 of the nucleic acid fragment; Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within a range of bases 160 to 295 of the nucleic acid fragment; Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within a range of bases 178 to 274 of the nucleic acid fragment; Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within a range of bases 194 to 263 of the nucleic acid fragment; Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within a range of bases 209 to 253 of the nucleic acid fragment; Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within a range of bases 221 to 242 of the nucleic acid fragment; 2. The nucleic acid of claim 1, wherein the integration site of the exogenous nucleic acid fragment corresponds to any site within the 231st to 240th base range of the nucleic acid fragment.
3. The exogenous nucleic acid fragment a first recombination recognition sequence, a second recombination recognition sequence, a selectable marker gene and / or a target gene located between the first recombination recognition sequence and the second recombination recognition sequence, and a promoter that regulates and controls the expression of the selectable marker gene and / or the target gene; Optionally, the exogenous nucleic acid fragment comprises a selectable marker gene located between the first recombination recognition sequence and the second recombination recognition sequence, and a promoter that regulates and controls expression of the selectable marker gene; Optionally, the exogenous nucleic acid fragment comprises a target gene located between the first recombination recognition sequence and the second recombination recognition sequence, and a promoter that regulates and controls expression of the target gene; 3. The nucleic acid of claim 2, wherein the exogenous nucleic acid fragment optionally comprises a selectable marker gene and a target gene located between the first recombination recognition sequence and the second recombination recognition sequence, and a promoter that regulates and controls the expression of the selectable marker gene and the target gene.
4. the first recombination recognition sequence and the second recombination recognition sequence are generated by a recombinase, and the recombinase is Bxb1 integrase, ΦC31 integrase, Cre recombinase, or FLP recombinase; or / and The nucleic acid of claim 3, wherein the first recombination recognition sequence and the second recombination recognition sequence are each independently one or more selected from the group consisting of a LoxP sequence, a LoxPL3 sequence, a LoxP 2L sequence, a LoxFas sequence, a Lox511 sequence, a Lox2272 sequence, a Lox2372 sequence, a Lox5171 sequence, a Loxm2 sequence, a Lox71 sequence, a Lox66 sequence, an FRT sequence, a Bxb1 attP sequence, a Bxb1 attB sequence, an attP sequence, an attB, an attL, and an attR sequence.
5. the selectable marker gene is one or more selected from a neomycin resistance gene, a thymidine kinase gene, a hygromycin phosphotransferase gene, a dihydrofolate reductase gene, a thymidine kinase gene, a glutamine synthetase gene, an asparagine synthetase gene, a tryptophan synthetase gene, a histidinol dehydrogenase gene, an aminoglycoside phosphotransferase gene, a tryptophan synthetase gene, and a fluorescent protein gene; 4. The nucleic acid of claim 3, wherein optionally, the selectable marker gene is a fluorescent protein gene.
6. 4. The nucleic acid according to claim 3, wherein the promoter is a CMV promoter, an SV40 promoter, an RSV promoter, a β-globin promoter, a UBC promoter, an EF1a promoter, a ubiquitin promoter, a β-actin promoter, a PGK1 promoter, a Rosa26 promoter, an HSP70 promoter, a GAPDH promoter, an Eif4A1 promoter, an Egr1 promoter, a FerH promoter, an SM22α promoter, or an Endothelin-1 promoter.
7. 4. The nucleic acid of claim 3, wherein the target gene encodes one or more of an antibody, a recombinant protein, a polypeptide, an enzyme, a hormone, a growth factor, and a receptor.
8. The nucleic acid according to any one of claims 1 to 7, wherein the nucleotide sequence of the nucleic acid comprises the nucleotide sequence set forth in SEQ ID No. 3, SEQ ID No. 7 or SEQ ID No.
9.
9. A recombinant vector comprising: The recombinant vector comprises the nucleic acid of claim 1 or 2, A recombinant vector, characterized in that the nucleic acid further comprises the first recombination recognition sequence and the second recombination recognition sequence, and the exogenous nucleic acid fragment comprises a target gene and / or a selectable marker gene.
10. The exogenous nucleic acid fragment is a target gene, the first recombination recognition sequence is a 5' homologous arm homologous to the sequence fragment in which the nucleic acid fragment shown in SEQ ID No. 1 is located, and the second recombination recognition sequence is a 3' homologous arm homologous to the sequence fragment in which the nucleic acid fragment shown in SEQ ID No. 1 is located, or 10. The recombinant vector of claim 9, wherein the exogenous nucleic acid fragment is a selectable marker gene, the first recombination recognition sequence is a 5′ homologous arm homologous to a sequence fragment in which the nucleic acid fragment represented by SEQ ID No. 1 is present, and the second recombination recognition sequence is a 3′ homologous arm homologous to a sequence fragment in which the nucleic acid fragment represented by SEQ ID No. 1 is present.
11. The recombinant vector of claim 10, wherein the recombinant vector is a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, a herpes viral vector, a pox viral vector, a baculoviral vector, a papilloma viral vector, a papovaviral vector, an integrating phage vector, a non-viral vector, a transposon and / or transposase, an integrase substrate, or a plasmid.
12. A target integration cell, comprising: A target integration cell, characterized in that the target integration cell contains the nucleic acid according to any one of claims 1 to 8.
13. the target integration cell is a eukaryotic cell; Optionally, the eukaryotic cell is a mammalian cell; 13. The target integration cell of claim 12, wherein the mammalian cell optionally comprises a Chinese hamster ovary CHO cell, a human embryonic kidney HEK293 cell.
14. A method for producing a targeted integration cell according to claim 12 or 13, comprising: The manufacturing method includes: A method for producing a targeted integrated cell, comprising the steps of: introducing the nucleic acid according to any one of claims 1 to 8 into a cell, or providing a cell containing the nucleic acid fragment set forth in SEQ ID No. 1; and integrating the exogenous nucleic acid fragment into the nucleic acid fragment.
15. 1. A method for producing a target gene expression product, comprising: The method comprises culturing the targeted integration cell of claim 12 or 13 and collecting the expression product of the target gene in the exogenous nucleic acid fragment.
16. 10. Use of a nucleic acid according to any one of claims 1 to 8 in the production of a protein or polypeptide, wherein said protein or said polypeptide is expressed by said exogenous nucleic acid fragment.
Citation Information
Patent Citations
Targeted integration of nucleic acids
JP2022070949A