RNAi formulations for the prevention or treatment of obesity and combination therapy using the same
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-03-08
- Publication Date
- 2026-04-02
AI Technical Summary
Existing anti-obesity treatments, such as semaglutide-based therapies, lead to significant weight regain and increased cardiometabolic risk factors after discontinuation, highlighting the need for more effective and sustainable weight management solutions.
A pharmaceutical composition comprising an RNAi formulation that specifically suppresses MARC1 expression, potentially combined with a GLP-1 receptor agonist or GLP-1/GIP receptor dual agonist, to enhance weight loss and maintain efficacy post-treatment.
The RNAi formulation increases basal metabolic rate, promotes fat oxidation, and when combined with GLP-1 receptor agonists, sustains weight loss effects and reduces side effects, providing a more effective and long-lasting obesity treatment.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical Field]
[0001] The present invention relates to an RNAi formulation for preventing or treating obesity and a combination therapy using the same, and more particularly to a pharmaceutical composition for preventing or treating obesity containing an RNAi formulation targeting MARC1 as an active ingredient. [Background technology]
[0002] The number of obese people is increasing every year due to living conditions, excessive nutritional intake due to an increase in processed foods and eating out, and a decrease in physical activity. The World Health Organization (WHO) classifies obesity as a disease rather than a physiological phenomenon or symptom, and diagnoses obesity when the body mass index (BMI) is 30 or higher. In most cases, this refers to weight above the normal standard, but obesity can also be defined as a high proportion of fat in the body composition, even if the weight is below the standard.
[0003] Obesity is a condition characterized by an imbalance between energy intake and expenditure, resulting in the excessive accumulation of body fat and an increase in the number and size of fat cells. Energy in the body is stored in the form of triglycerides in fat cells. When energy sources are depleted, stored fat is broken down into free fatty acids and glycerol for use as an energy source. However, excessive energy intake directly contributes to obesity by promoting the differentiation of adipocytes and increasing the amount of stored fat in the body. Obesity not only results in changes in body shape due to the accumulation of visceral and abdominal fat, but also acts as a risk factor for increasing the incidence of various diseases. Excessive accumulation of visceral fat causes problems with glucose metabolism, resulting in symptoms such as abnormal hormone and cytokine secretion. Increases in triglycerides and LDL cholesterol and decreases in HDL cholesterol due to obesity lead to abnormalities in body fat metabolism, a decrease in insulin receptors in tissues, and reduced insulin sensitivity. This inhibits the transport of glucose into cells, leading to hyperglycemia and diabetes. Obesity is also known to be closely related to the occurrence of metabolic diseases such as hyperlipidemia, cardiovascular disease, cancer, respiratory disorders, stroke, and osteoarthritis.
[0004] Antiobesity drugs can be broadly classified into appetite suppressants, fat absorption inhibitors, and glucagon-like peptide-1 (GLP-1) analogs. Among these, semagultide, a GLP-1 analog, has been approved by the U.S. Food and Drug Administration (FDA) as an anti-obesity drug for long-term weight management in adults. However, according to a study by the National Institutes of Health (NIH) on changes in weight and cardiometabolic risk factors in patients one year after discontinuing treatment with a semaglutide-based product (product name: Wegovy®), the study found that patients regained an average of two-thirds of their lost weight one year later, and cardiometabolic risk factors also increased to a similar level as weight.
[0005] Meanwhile, disease treatment using the phenomenon of RNA interference is gaining attention as a safer therapeutic agent for treating diseases because it uses small interfering RNA (siRNA) that targets mRNA and regulates gene expression at the translational level.
[0006] As a result of intensive research and efforts to develop drugs to treat obesity or improve the efficacy of conventional obesity treatments, the inventors developed an RNA formulation using RNA interference technology and completed the present invention based on this. Summary of the Invention [Problem to be solved by the invention]
[0007] An object of the present invention is to provide a pharmaceutical composition for preventing or treating obesity, which comprises, as an active ingredient, an RNAi preparation that specifically suppresses the expression of MARC1.
[0008] Another object of the present invention is to provide a combined preparation for preventing or treating obesity, which contains the RNAi preparation as an active ingredient, together with a GLP-1 receptor agonist or a GLP-1 / GIP receptor dual agonist.
[0009] Another object of the present invention is to provide a method for preventing or treating obesity, which comprises the step of administering the RNAi formulation to an individual. [Means for solving the problem]
[0010] To achieve the above object, one embodiment provides an RNAi preparation that specifically suppresses the expression of MARC1, comprising EVP-mU * fG * mAmGmUmAfAmGfCmAmAmUmCfUmG * fG * mU * mC * mC * mU * mU, P-mA * fG* mAmUmCfCmAfGfAmGmCmUmGfCmG * fC * mC * mA * mC, or EVP-mU * fG * mAmUmCfCmAfGfAmGmCmUmGfCmG * fC * mC * mA * antisense strand consisting of mC, and mC * mC * mAfGmAfUmUmGmCmUmUmAmCmUmCmA-GalNAc, mG * fC * mGfCfAfGmCfUmCfUmGfGmAfUmCfU-GalNAc, or mG * fC * A pharmaceutical composition for preventing or treating obesity is provided, which comprises a sense strand consisting of mGfCfAfGmCfUmCfUmGfGmAfUmCfA-GalNAc.
[0011] Another embodiment provides a combined preparation for preventing or treating obesity, which contains a GLP-1 receptor agonist or a GLP-1 / GIP receptor dual agonist and the RNAi preparation as active ingredients.
[0012] Yet another embodiment provides a method for preventing or treating obesity, comprising administering the RNAi formulation to an individual.
[0013] Yet another embodiment provides the use of the RNAi formulation for the manufacture of a medicament for preventing or treating obesity.
[0014] Other objects and advantages of the present invention will become more apparent from the following detailed description taken in conjunction with the accompanying claims and drawings. Contents not described in this specification will be fully understood and can be inferred by those skilled in the art of this application or a similar art, so the description thereof will be omitted. [Effects of the Invention]
[0015] The RNAi formulation according to one embodiment reduces the body weight of an individual by increasing the basal metabolic rate and promoting fat oxidation in the individual, and can therefore be used as an active ingredient in an agent for treating obesity.
[0016] When administered in combination with a drug based on a GLP-1 receptor agonist or a GLP-1 / GIP dual agonist, the RNAi formulation according to one embodiment not only exhibited improved weight loss effects, but also maintained the weight loss effect for a long period of time even after the administration of the drug was discontinued. Therefore, the RNAi formulation can be used as an active ingredient in a combination formulation to improve the efficacy or reduce side effects of existing obesity treatments. [Brief explanation of the drawings]
[0017] [Figure 1] 1 shows the results of administering OLX702A-031-1 according to one embodiment to an obese animal model, and then monitoring the relative weight change (%) over time compared to the day of initial administration of the test substance. [Figure 2] In one embodiment, OLX702A-031-1 was administered to an obese animal model, and the weight change was observed with the naked eye approximately 4 weeks after the date of administration of the test substance. Figure 2A shows the results for a group provided with a normal diet, Figure 2B shows the results for a group administered 1X PBS to an obese animal model, Figure 2C shows the results for a group administered OLX700A-001-8 to an obese animal model, and Figure 2D shows the results for a group administered OLX702A-031-1 to an obese animal model. [Figure 3] 1 shows the results of administering OLX702A-031-2 according to one embodiment to an obese animal model, and then monitoring the relative weight change (%) over time compared to a control group. [Figure 4] OLX702A-031-2 according to one embodiment was administered to an obese animal model, and the change in food intake was then observed. Figure 4A shows the results of monitoring cumulative food intake over time, and Figure 4B shows the results of calculating and comparing average daily food intake. [Figure 5]In one embodiment, OLX702A-031-2 was administered to an obese animal model, and changes in activity levels were observed over a 48-hour period. Figure 5A shows the results of monitoring activity levels over time, and Figure 5B shows the results of calculating and comparing average activity levels per hour. [Figure 6] OLX702A-031-2 according to one embodiment was administered to an obese animal model, and the change in energy consumption was observed over a 48-hour period. Figure 6A shows the results of monitoring energy consumption levels over time, and Figure 6B shows the results of calculating and comparing average energy consumption levels. [Figure 7] In one embodiment, OLX702A-031-2 was administered to an obese animal model, and changes in the respiratory quotient were observed over a period of 48 hours. Figure 7A shows the results of measuring the respiratory exchange rate (RER) over time, and Figure 7B shows the results of calculating and comparing the average respiratory quotient values over the experimental period. [Figure 8] In one embodiment, OLX702A-031-2 was administered to an obese animal model, and the respiratory quotient was then measured under light or dark conditions for 48 hours. Figure 8A shows the results of calculating and comparing the respiratory quotient under light conditions, and Figure 8B shows the results of calculating and comparing the respiratory quotient under dark conditions. [Figure 9] OLX702A-031-2 according to one embodiment was administered to an obese animal model, and the FGF21 levels were examined. Figure 9A shows the FGF21 mRNA expression levels in liver tissue, and Figure 9B shows the results of comparing the FGF21 levels in serum. [Figure 10] OLX702A-031-2 according to one embodiment was administered to an obese animal model, and the FGF 21 levels were compared with those in a semaglutide-administered group. Figure 10A shows the FGF 21 mRNA expression levels in liver tissue, and Figure 10B shows the results of comparing the FGF 21 levels in serum. [Figure 11]1 shows the results of administering OLX702A-031-2 and semaglutide in accordance with one embodiment to an obese animal model, and then observing the relative change in body weight (%) over time compared to a control group. [Figure 12] In one embodiment, OLX702A-031-2 and semaglutide were administered in combination to an obese animal model, and changes in food intake were observed. Figure 12A shows the results of observing cumulative food intake over time, Figure 12B shows the results of calculating and comparing average daily food intake in the period before semaglutide administration was discontinued, and Figure 12C shows the results of calculating and comparing average daily food intake over the entire experimental period. [Figure 13] The results show that OLX702A-031-2 according to one embodiment and semaglutide were co-administered to an obese animal model under the condition that semaglutide was administered at weekly intervals, and the relative change in body weight (%) compared to the control group (vehicle-administered group) was observed over time. [Figure 14] This shows the results of observing cumulative food intake over time after co-administration of OLX702A-031-2 according to one embodiment and semaglutide to an obese animal model, with semaglutide administered at weekly intervals. [Figure 15] This shows the results of administering OLX702A-031-2 according to one embodiment and semaglutide in combination to an obese animal model, with semaglutide administered every day, and then observing the relative change in body weight (%) over time compared to the control group. [Figure 16] This shows the results of co-administration of OLX702A-031-2 according to one embodiment and semaglutide to an obese animal model, with semaglutide administered every other day, and then monitoring cumulative food intake over time. [Figure 17] 1 shows the results of administering OLX702A-031-2 and tirzepatide in combination to an obese animal model, and then monitoring the relative weight change (%) over time compared to a control group (Normal Chow VC group). [Figure 18A] 1 shows the results of examining the change in food intake after co-administration of OLX702A-031-2 and tirzepatide according to one embodiment to an obese animal model, and examining the cumulative food intake over time. [Figure 18B] OLX702A-031-2 and tirzepatide according to one embodiment were administered in combination to an obese animal model, and changes in food intake were observed. The average daily food intake before tirzepatide administration was discontinued was calculated and compared. [Figure 18C] OLX702A-031-2 and tirzepatide according to one embodiment were co-administered to an obese animal model, and changes in food intake were observed. The average daily food intake over the entire experiment period was calculated and compared. [Figure 19] OLX702A-075-16 and semaglutide according to one embodiment were co-administered to an obese primate animal model, and the relative change in body weight (%) compared to the day of initial administration of the test substance was observed over time. [Figure 20] According to one embodiment, OLX702A-075-16 and semaglutide were co-administered to an obese primate animal model, and the relative change (%) in average daily food intake compared to the day of initial administration of the test substance was then determined. [Figure 21] 1 shows the results of comparing the percentage of body fat measured over time after co-administration of OLX702A-075-16 and semaglutide according to one embodiment to an obese primate animal model. [Figure 22] 1 shows the results of comparing abdominal circumference measured over time after co-administration of OLX702A-075-16 and semaglutide according to one embodiment to an obese primate animal model. DETAILED DESCRIPTION OF THE INVENTION
[0018] Each description and embodiment disclosed in the present invention applies to each other description and embodiment. In other words, all combinations of the various elements disclosed in the present invention fall within the scope of the present invention. In addition, the specific description below should not be construed as limiting the scope of the present invention.
[0019] One embodiment is a pharmaceutical composition for preventing or treating obesity, which comprises as an active ingredient a double-stranded RNAi formulation comprising a sense strand and an antisense strand, wherein the antisense strand is an EVP-mU having complementarity to the MARC1 (Mitochondrial amidoxime reducing component 1) mRNA sequence. * fG * mAmGmUmAfAmGfCmAmAmUmCfUmG * fG * mU * mC * mC * mU * mU, P-mA * fG * mAmUmCfCmAfGfAmGmCmUmGfCmG * fC * mC * mA * mC, or EVP-mU * fG * mAmUmCfCmAfGfAmGmCmUmGfCmG * fC * mC * mA * mC, and the sense strand consists of mC * mC * mAfGmAfUmUmGmCmUmUmAmCmUmCmA-GalNAc, mG * fC * mGfCfAfGmCfUmCfUmGfGmAfUmCfU-GalNAc, or mG * fC * A pharmaceutical composition is provided which comprises mGfCfAfGmCfUmCfUmGfGmAfUmCfA-GalNAc.
[0020] Other aspects provide pharmaceutical uses of said RNAi formulations for the prevention or treatment of obesity, and uses of said RNAi formulations for the manufacture of a medicament for the prevention or treatment of obesity.
[0021] RNAi preparations As used herein, the term "RNAi (RNA interference)" refers to a mechanism in which double-stranded RNA (dsRNA) consisting of a strand with a sequence homologous to the mRNA of a target gene and a strand with a sequence complementary to the strand is introduced into a cell or the like to induce degradation of the mRNA of the target gene, thereby suppressing the expression of the target gene.
[0022] As used herein, the term "RNAi agents" or "nucleic acid molecules inducing RNAi" refers to any agent or nucleic acid molecule that suppresses or down-regulates gene expression or viral replication by mediating RNA interference in a sequence-specific manner. The term refers to an individual nucleic acid molecule, a plurality of such nucleic acid molecules, or a pool of such nucleic acid molecules. In one embodiment, the RNAi agent is an siRNA.
[0023] As used herein, the term "small interfering RNA (siRNA)" refers to a short double-stranded RNA (dsRNA) that mediates efficient gene silencing in a sequence-specific manner.
[0024] As used herein, the term "gene" should be considered in its broadest sense and may encode a structural protein or a regulatory protein. Regulatory proteins include transcription factors, heat shock proteins, and proteins involved in DNA / RNA replication, transcription, and / or translation. In the present invention, the target gene whose expression is to be suppressed is endogenous to the viral genome and may be integrated into an animal genome or may exist as a component other than a chromosome.
[0025] As used herein, the term "antisense strand" refers to a polynucleotide that is substantially or 100% complementary to a target nucleic acid of interest, such as, in whole or in part, to messenger RNA (mRNA), a non-mRNA RNA sequence (e.g., microRNA, piwiRNA, tRNA, rRNA, and hnRNA), or a coding or non-coding DNA sequence.
[0026] As used herein, the term "sense strand" refers to a polynucleotide having the same nucleic acid sequence as a nucleic acid of interest, which is identical in whole or in part to an mRNA (messenger RNA), a non-mRNA RNA sequence (e.g., microRNA, piwiRNA, tRNA, rRNA, and hmRNA), or a coding or non-coding DNA sequence.
[0027] As used herein, the terms "complementarity" or "complementary" refer to the meaning generally accepted in the art. The terms generally refer to the formation or presence of hydrogen bond(s) between one nucleic acid sequence and another nucleic acid sequence, either by traditional Watson-Crick or other non-traditional types of bonding described herein. Perfect complementarity means that every contiguous residue in a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence. Partial complementarity can include various mismatches or non-based paired nucleotides (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more mismatches, e.g., 1 to 3 mismatches, non-nucleotide linkers, or non-base paired nucleotides) within a nucleic acid molecule. The partial complementarity results in bulges, loops, overhangs, or blunt ends between the sense and antisense strands of a nucleic acid molecule, or between the antisense strand of a nucleic acid molecule and its corresponding target nucleic acid molecule.
[0028] As used herein, the term "blunt end" refers to the meaning generally accepted in the art. In the context of the RNAi formulations or nucleic acid molecules herein, the term refers to the ends of a double-stranded siRNA molecule that have no overhanging nucleotides. In the siRNA molecules described herein, the 5'-end of the antisense strand and the 3'-end of the sense strand form blunt ends.
[0029] RNAi formulations to suppress MARC1 expression "MARC1 (Mitochondri alamidoxime reducing component 1)" is a mammalian molybdenum-containing enzyme, also referred to as MTARC1 or MOSC1. Deficiency of the MARC1 enzyme is associated with low blood cholesterol levels and regulation of fat metabolism, making it a potential therapeutic target for obesity. The MARC1 protein is understood to include naturally occurring wild-type MARC1 and its functional variants. The sequence of the MARC1 protein or its encoding gene can be obtained from publicly known databases, such as GenBank of the National Institutes of Health.
[0030] As used herein, the term "expression" refers to the meaning generally accepted in the art. The term generally refers to the process by which a gene ultimately produces a protein. Expression includes, but is not limited to, transcription, splicing, post-transcriptional modification, or translation. As used herein, expression levels are determined or monitored by detecting mRNA levels or protein levels.
[0031] The terms "suppression" or "reduction" when used in connection with expression of the MARC1 gene in an individual refer to a statistically significant decrease compared to an untreated or normal control group, e.g., a decrease of at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 60%, 65%, 70%, 70%, 80%, 85%, 90%, or 95% or more, although this may be below the level of detection depending on the detection or measurement method.
[0032] In one embodiment, an RNAi formulation increases the expression or plasma levels of fibroblast growth factor 21 (FGF 21). Mitochondrial amidoxime-reducing component 1 (FGF 21) regulates various metabolic pathways, including glucose metabolism and energy homeostasis. Administration of FGF 21 to obese animal models has been reported to improve insulin sensitivity and lipoprotein profiles. The increase may be, for example, at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 60%, 65%, 70%, 70%, 80%, 85%, 90%, or 95% or greater compared to a control group, although this may be above the detectable level depending on the detection or measurement method.
[0033] siRNA (small interfering RNA) is involved in RNAi (RNA interference) activity. RNAi is an intracellular gene regulation mechanism first discovered in Caenorhabditis elegans in 1998. Its mechanism of action is known to be that the antisense strand of an RNA duplex introduced into a cell binds complementary to the mRNA of the target gene, thereby inducing degradation of the target gene. RNAi has recently attracted the most attention as a potential technology for new drug development.
[0034] However, despite this potential, side effects and drawbacks of siRNA have been reported one after another. To develop RNAi-based therapeutics, it is necessary to overcome obstacles such as 1) the lack of an effective delivery system, 2) off-target effects, 3) induction of immune responses, and 4) saturation of the intracellular RNAi machinery. Although siRNA is an effective method for directly regulating target gene expression, these issues have hindered the development of therapeutic agents. In this regard, asymmetric siRNA (asymmetric shorter duplex siRNA: asiRNA) is an asymmetric RNAi-inducing structure with a shorter double helix length than the 19+2 structure of conventional siRNA. This technology overcomes issues associated with existing siRNA structure technologies, such as off-target effects, saturation of the RNAi mechanism, and TLR3-mediated immune responses, making it possible to develop new RNAi drugs with fewer side effects.
[0035] Based on this, in this embodiment, an asymmetric siRNA comprising a sense strand and an antisense strand complementary to the sense strand is presented. The siRNA according to one embodiment does not cause problems such as off-target effects or saturation of the RNAi mechanism, and can effectively suppress expression of the MARC1 gene as desired while maintaining stable and high transduction efficiency.
[0036] In one embodiment, the RNAi formulation comprises one or more chemical modifications to the sense or antisense strand.
[0037] Conventional siRNAs do not pass through cell membranes due to their high negative charge caused by their phosphate backbone structure and high molecular weight, and are quickly degraded and removed from the blood, making it difficult to deliver sufficient amounts to the target site for RNAi induction. Currently, for in vitro delivery, many highly efficient delivery methods using cationic lipids and cationic polymers have been developed, but in vivo, it is difficult to deliver siRNA with the same efficiency as in vitro, and there is a problem that siRNA delivery efficiency decreases due to interactions with various proteins present in the body.
[0038] Therefore, in this example, we present an RNAi formulation that is effective and can be delivered into target cells without a separate carrier by introducing chemical modifications to asymmetric siRNA (antisense strand of SEQ ID NO: 1 (UGAGUAAGCAAUCUGGUCCUU), SEQ ID NO: 2 (AGAUCCAGAGCUGCGCCAC), or SEQ ID NO: 3 (UGAUCCAGAGCUGCGCCAC) and sense strand of SEQ ID NO: 4 (CCAGAUUGCUUACUCA), SEQ ID NO: 5 (GCGCAGCUCUGGAUCU), or SEQ ID NO: 6 (GCGCAGCUCUGGAUCA)) that has excellent knockdown efficiency after transfection into cells or animal models expressing MARC1.
[0039] In the present invention, the chemical modification of the sense strand or antisense strand may include one or more selected from the group consisting of: binding with an N-acetylgalactosamine (GalNAc) derivative; modification of the nucleotide bond to phosphorothioate, boranophosphate, or methyl phosphonate; substitution of the -OH group at the 2' carbon position of the sugar structure in the nucleotide with -CH3 (methyl), -OCH3 (methoxy), -NH2, -F, -O-2-methoxyethyl-O-propyl, -O-2-methylthioethyl, -O-3-aminopropyl, or -O-3-dimethylaminopropyl; binding of a phosphate group, E-vinylphosphonate, or cell-penetrating peptide.
[0040] In one embodiment, the N-acetylgalactosamine (GalNAc) derivative has the following structure: Formula 1. RNAi formulations having the N-acetylgalactosamine (GalNAc) derivative attached to their termini can have improved delivery to target cells (e.g., hepatocytes) and provide effective therapeutic effects. [Formula 1] [ka]
[0041] In one embodiment, the sense strand may contain one or more chemical modifications selected from the following: two to four nucleotide bonds adjacent to the 5' end are modified to phosphorothioate, boranophosphate, or methyl phosphonate; the -OH group at the 2' carbon position of one or more intranucleotide sugar structures is replaced with -CH3 (methyl), -OCH3 (methoxy), -NH2, -F, -O-2-methoxyethyl-O-propyl, -O-2-methylthioethyl, -O-3-aminopropyl, or -O-3-dimethylaminopropyl; and a linkage to an N-acetylgalactosamine (GalNAc) derivative or a cell-penetrating peptide at the 3' end.
[0042] In one embodiment, the antisense strand may contain any one or more chemical modifications selected from the following: two to seven nucleotide bonds adjacent to the 3' or 5' end are modified to phosphorothioate, boranophosphate, or methyl phosphonate; the -OH group at the 2' carbon position of one or more intranucleotide sugar structures is replaced with -CH3 (methyl), -OCH3 (methoxy), -NH2, -F, -O-2-methoxyethyl-O-propyl, -O-2-methylthioethyl, -O-3-aminopropyl, or -O-3-dimethylaminopropyl; and a phosphate group, E-vinylphosphonate, or a cell-penetrating peptide at the 5' end.
[0043] In another embodiment, the RNAi formulation may include one or more modifications selected from the group consisting of: modification of 2 to 7 nucleotide bonds adjacent to the 3' or 5' end of the sense or antisense strand to phosphorothioate; modification in which the -OH group at the 2' carbon position of the sugar structure in one or more nucleotides in the sense or antisense strand is replaced with -OCH3 (methoxy) or -F; and modification in which an N-acetylgalactosamine (GalNAc) derivative is bonded to the 3' end of the sense strand; and modification in which a phosphate group or an E-vinylphosphonate bond is bonded to the 5' end of the antisense strand.
[0044] In one embodiment, the antisense strand is EVP-mU * fG * mAmGmUmAfAmGfCmAmAmUmCfUmG * fG * mU * mC * mC * mU * mU, P-mA * fG * mAmUmCfCmAfGfAmGmCmUmGfCmG * fC * mC * mA * mC, or EVP-mU * fG * mAmUmCfCmAfGfAmGmCmUmGfCmG * fC * mC * mA * mC, and the sense strand consists of mC * mC * mAfGmAfUmUmGmCmUmUmAmCmUmCmA-GalNAc, mG * fC * mGfCfAfGmCfUmCfUmGfGmAfUmCfU-GalNAc, or mG * fC *mGfCfAfGmCfUmCfUmGfGmAfUmCfA-GalNAc, * denotes a phosphorothioated bond, m denotes 2'-O-methyl, P denotes a 5'-phosphate bond, f denotes 2'-fluoro, EVP denotes a 5'-E-vinylphosphonate bond, and GalNAc denotes a trivalent GalNAc derivative of formula 1.
[0045] obesity The pharmaceutical composition can be used to prevent or treat obesity by suppressing the expression of the MARC1 gene.
[0046] Obesity is a disease caused by an energy imbalance that occurs when nutrients are consumed in excess relative to energy expenditure over a long period of time, and according to the World Health Organization (WHO), it is defined as a state in which abnormal or excessive fat accumulates in adipose tissue to an extent that is detrimental to health. Obesity is a typical disease of metabolic syndrome, and obesity itself is known to be a disease that increases the risk of developing diseases caused by metabolic disorders such as type 2 diabetes, high blood pressure, hyperlipidemia, and coronary artery disease.
[0047] Antiobesity drugs can be broadly classified into appetite suppressants, fat absorption inhibitors, and glucagon-like peptide-1 (GLP-1) analogs. The first approach, which involves suppressing appetite, stimulates the brain's nerves to induce a feeling of fullness. Drugs such as diethylproprion, phendimetrazine, and phentermine have been approved by the U.S. FDA and are commercially available. The second approach, which involves inhibiting the absorption of ingested fat, acts on the digestive tract to prevent fat absorption. A representative example is orlistat. Finally, glucagon-like peptide-1 analogs (GLP-1 analogs) are drugs used in conventional diabetes treatment and possess important physiological activities such as promoting insulin secretion and suppressing glucagon secretion. Semaglulotide (trade name: Wegovy®), a GLP-1 analog, has been approved by the U.S. Food and Drug Administration as an anti-obesity drug for long-term weight management in adults. However, according to the National Institutes of Health (NIH), an analysis of changes in patients' weight and cardiometabolic risk factors one year after discontinuing the treatment revealed that, on average, patients gained back about two-thirds of their lost weight one year later, and cardiometabolic risk factors also increased to a similar level as their weight. Under these technical circumstances, there is a need to develop new drugs that improve the efficacy or reduce the side effects of existing obesity treatments.
[0048] Pharmaceutical Compositions As used herein, the term "effective ingredient" refers to an ingredient in an amount that is adequate to affect a beneficial or desired clinical or biochemical result. Specifically, it refers to an effective amount of a pharmaceutical formulation, active agent, or RNAi formulation. The effective amount is an amount administered one or more times that is adequate to prevent a disease or to improve a disease state, including, but not limited to, alleviating symptoms, reducing the extent of the disease, stabilizing (i.e., not worsening) the disease state, slowing or reducing the rate of disease progression, or improving or palliating and relieving (partially or in whole) the disease state.
[0049] As used herein, the term "prevention" refers to any action that blocks the onset of a disease, suppresses a disease, or delays its progression, such as preventing or hindering the onset of obesity or its characteristic features, or guarding or protecting against the onset of obesity or its characteristic features.
[0050] As used herein, the term "treatment" refers to both therapeutic treatment and prophylactic or preventative measures. It also refers to any action that improves or beneficially alters the symptoms of a disease, such as preventing, reducing, or ameliorating obesity or its characteristic features, or slowing (attenuating) the progression of the disease or its characteristic features in an individual.
[0051] As used herein, the term "effective amount" refers to the meaning generally accepted in the art. The term generally refers to the amount of a molecule, compound, or construct that elicits the intended biological response (e.g., a beneficial response) in a cell, tissue, system, animal, or human desired by a researcher, veterinarian, physician, or other clinician. Specifically, a "therapeutically effective amount" refers to the amount of a molecule, compound, or construct that elicits a desired medical response, e.g., a therapeutically relevant change in a measurable parameter associated with a disease or disorder, sufficient to render a particular clinical treatment effective. A therapeutically effective amount of a drug for treating a disease or disorder is the amount required to produce a therapeutically relevant change in the parameter.
[0052] The method of administration of the pharmaceutical composition can be determined by a person skilled in the art based on the symptoms and severity of the disease of the patient. The pharmaceutical composition may be formulated into various forms, such as powder, tablets, capsules, liquids, injections, ointments, and syrups, and may be provided in unit-dose or multi-dose containers, such as sealed ampoules and bottles. The pharmaceutical composition may also be formulated with one or more other active agents currently used for the prevention or treatment of disease. The effective amount of the other active agent depends on the amount present in the formulation, the severity of the disease, and other factors.
[0053] The pharmaceutical composition of the present invention can be administered orally or parenterally. The administration route of the composition of the present invention can be, but is not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intestinal, sublingual, or topical. The dosage of the composition of the present invention varies depending on the patient's weight, age, sex, health condition, diet, administration time, method, excretion rate, or disease severity, and can be easily determined by one of ordinary skill in the art. Furthermore, the composition of the present invention can be formulated into an appropriate dosage form for clinical administration using known techniques.
[0054] The pharmaceutical composition of the present invention can be administered in combination with an existing antiobesity agent, such as a GLP-1 receptor agonist or a GLP-1 / GIP receptor dual agonist, and can be administered separately, simultaneously, or sequentially with the GLP-1 receptor agonist or GLP-1 / GIP receptor dual agonist.
[0055] One embodiment is a combination formulation for the prevention or treatment of obesity, comprising a first active ingredient comprising a GLP-1 receptor agonist (Glucagon-like peptide-1 receptor agonist) or a GLP-1 / GIP receptor dual agonist (Glucagon-like peptide-1 / Glucose-dependent insulinotropic polypeptide receptor dual agonist), and a second active ingredient comprising a double-stranded RNAi formulation comprising a sense strand and an antisense strand, wherein the antisense strand is an EVP-mU RNA that is complementary to the MARC1 (Mitochondrial amidoxime reducing component 1) mRNA sequence. * fG * mAmGmUmAfAmGfCmAmAmUmCfUmG * fG * mU * mC * mC * mU * mU, P-mA * fG * mAmUmCfCmAfGfAmGmCmUmGfCmG * fC * mC * mA * mC, or EVP-mU * fG * mAmUmCfCmAfGfAmGmCmUmGfCmG * fC * mC * mA * mC, and the sense strand consists of mC * mC * mAfGmAfUmUmGmCmUmUmAmCmUmCmA-GalNAc, mG * fC * mGfCfAfGmCfUmCfUmGfGmAfUmCfU-GalNAc, or mG * fC * A combination formulation is provided consisting of mGfCfAfGmCfUmCfUmGfGmAfUmCfA-GalNAc.
[0056] Other aspects provide pharmaceutical uses of the RNAi formulations for the prevention or treatment of obesity in combination with a GLP-1 receptor agonist or a GLP-1 / GIP receptor dual agonist, and uses of the RNAi formulations for the manufacture of combination formulations with a GLP-1 receptor agonist or a GLP-1 / GIP receptor dual agonist for the prevention or treatment of obesity.
[0057] Another embodiment provides a kit for preventing or treating obesity, which comprises the above-mentioned combination formulation, characterized in that the first active ingredient is contained in a first compartment and the second active ingredient is contained in a second compartment and provided to an individual in this form.
[0058] The combination formulation for preventing or treating obesity and the kit for preventing or treating obesity contain or utilize the above-mentioned RNAi formulation or pharmaceutical composition, and therefore, the description of the common content between them will be omitted to avoid overcomplicating this specification.
[0059] Combination preparations and kits containing the combination preparations As used herein, the term "combination preparation" refers to two or more drugs / preparations used simultaneously or nearly simultaneously (e.g., administered one after the other or on the same day) for the purpose of achieving a therapeutic synergistic effect. The combination preparation collectively refers to pharmaceutical compositions for achieving a combined therapeutic effect by administering two or more drugs individually, simultaneously, or sequentially, or by alternating administration at regular or irregular intervals. The combined therapeutic effect can be defined as a therapeutically superior effect measured, for example, through the degree of response, response rate, time to disease progression, or survival time, compared to the effect achieved by administering one or the other of the combination treatment components at a standard dose, and as providing a synergistic effect.
[0060] As used herein, the terms "synergism," "therapeutic synergy," and "synergistic effect" refer to the phenomenon in which treating a patient with a combination of therapeutic agents (e.g., a GLP-1 receptor agonist or a GLP-1 / GIP receptor dual agonist combined with an RNAi formulation according to one embodiment) results in a therapeutically superior outcome compared to the outcome achieved by each individual component of the combination when used alone. In this regard, a therapeutically superior outcome can include one or more of the following: (a) an increase in therapeutic response greater than any one or two of the individual effects of each agent alone at the same dose as in the combination; (b) a reduction in the dose of one or more agents in the combination without a decrease in therapeutic efficacy; (c) a reduction in the incidence of side effects while achieving the same or greater therapeutic benefit as monotherapy with each agent at the same dose as in the combination; (d) a reduction in dose-limiting toxicity while achieving greater therapeutic benefit than monotherapy with each agent; or (e) a delay or minimization of the induction of drug resistance.
[0061] In one embodiment, the combination formulation may comprise a first active ingredient comprising a GLP-1 receptor agonist or a GLP-1 / GIP receptor dual agonist and a second active ingredient comprising the RNAi formulation for the prevention or treatment of obesity. The first and second active ingredients may be administered separately, simultaneously, or sequentially. Such combination therapy may 1) exhibit superior therapeutic efficacy compared to the individual effects of the GLP-1 receptor agonist or GLP-1 / GIP receptor dual agonist administered alone, 2) reduce the dose of the GLP-1 receptor agonist or GLP-1 / GIP receptor dual agonist without reducing therapeutic efficacy, or 3) eliminate side effects or problems (e.g., rapid weight gain after discontinuation) caused by the GLP-1 receptor agonist or GLP-1 / GIP receptor dual agonist.
[0062] In one embodiment, the combination formulation or a kit containing the combination formulation may be provided to an individual in such a manner that the first active ingredient is contained in a first compartment and the second active ingredient is contained in a second compartment.
[0063] Glucagon-like eptide-1 receptor agonist (GLP-1 receptor agonist) Glucagon-like peptide-1 (GLP-1) is a 30-amino acid long incretin hormone secreted by intestinal L-cells in response to food ingestion. In healthy individuals, GLP-1 promotes glucose-dependent insulin secretion by the pancreas and plays an important role in regulating postprandial blood glucose. GLP-1 also inhibits glucagon secretion and induces a decrease in hepatic glucose production. GLP-1 also delays gastric emptying and slows small intestinal motility, delaying food absorption.
[0064] GLP-1 receptor agonists or GLP-1 analogs function by promoting insulin synthesis and secretion, inhibiting glucagon secretion, suppressing gastric emptying, enhancing glucose utilization, and inhibiting food intake. GLP-1 receptor agonists have been developed as drugs for the treatment of type 2 diabetes, but have recently attracted attention as effective ingredients for the treatment of obesity. However, it has been reported that GLP-1 receptor agonists as anti-obesity drugs can cause vomiting and nausea when taken, and may lead to weight gain after discontinuation of administration. The GLP-1 receptor agonist may be selected from the group consisting of semaglutide, liraglutide, exenatide, taspoglutide, albiglutide, lixisenatide, and dulaglutide.
[0065] GLP-1 / GIP receptor dual agonist (Glucagon-like peptide-1 / Glucose-dependent insulinotropic polypeptide receptor dual agonist) Glucose-dependent insulinotropic polypeptide (GIP) is a 42-amino acid long incretin hormone secreted by K cells in the small intestine after ingestion of glucose or fat. In healthy individuals, GIP is dependent on blood glucose concentration, promotes insulin secretion from the pancreas, and helps lower blood glucose levels. It has also been reported to increase GLP-1 activity, have anti-inflammatory effects, and improve lipid metabolism.
[0066] GIP receptor agonists or GIP analogs are substances that complement the effects of GLP-1 receptor agonists, and have been reported to have a greater effect on glucose and body weight when combined with GLP-1 receptor agonists. Therefore, GLP-1 / GIP receptor dual agonists are being used as active ingredients for the treatment of obesity. The GLP-1 / GIP receptor dual agonist may be selected from the group consisting of tirzepatide, NN9709, SAR-438335, and ZP-DI-70.
[0067] One embodiment provides a method for preventing or treating obesity, comprising administering the RNAi formulation to an individual.
[0068] Another aspect provides a combination therapy for preventing or treating obesity, comprising administering to an individual the RNAi formulation separately, simultaneously, or sequentially with the GLP-1 receptor agonist or GLP-1 / GIP receptor dual agonist.
[0069] The obesity prevention or treatment method or combination therapy may directly include or utilize the above-mentioned RNAi preparation, pharmaceutical composition, or combination preparation, and therefore, the description of the common content between them will be omitted to avoid overcomplicating this specification.
[0070] As used herein, the term "individual" refers to a subject in need of treatment for a disease, specifically a liver disease, and more specifically may include any mammal, such as a human or non-human primate, mouse, dog, cat, horse, cow, sheep, pig, goat, camel, or antelope.
[0071] The present invention will be described in more detail below through examples, but these examples are for illustrative purposes only and the scope of the present invention is not limited to these examples.
[0072] [Example] Example 1. Synthesis of RNAi formulations In this example, a nucleic acid molecule for inducing RNAi targeting MARC1 was synthesized. Specifically, various chemical modifications (2'OMe, P, Fluoro, EVP) were introduced, and a derivative designated "trivalent GalNAc" was attached to the 3' end of the sense strand to synthesize an RNAi formulation according to one example. The synthesis method used in this example was a method known in the art, and the sequence information of the synthesized RNAi formulation is shown in Table 1 below.
[0073] [Table 1]
[0074] Specifically, in Table 1 above, " * The chemical variations designated "," "m," "f," "P," and "GalNAc" are as shown in Table 2 above.
[0075] [Table 2]
[0076] Specifically, in Table 2, " * " means a form in which the existing phosphodiester bond is replaced with a phosphorothioate bond, "m" means a form in which the existing 2'-OH is replaced with 2'-O-methyl, "f" means a form in which the 2'-OH of the existing G (guanine) is replaced with fluoro, for example, in the case of fG, "P" means a form in which a phosphate group is attached to the 5'-end (a phosphate group is attached to the oxygen attached to the 5th carbon in the 5'-end base), "EVP" means a form in which E-vinylphosphonate is attached to the 5'-end of the antisense strand, and "GalNAc" means a form in which a trivalent GalNAc derivative of the following formula 1 is attached to the 3'-end of the sense strand.
[0077] Meanwhile, the structure of the trivalent GalNAc derivative is as shown in the following formula 1. [Formula 1] [ka]
[0078] [Experimental Example] I. Confirmation of the anti-obesity effect of administering an RNAi formulation in one example Experimental Example 1. Anti-obesity effect of administration of OLX702A-031-1 or OLX702A-031-2 In this experiment, the anti-obesity effect was evaluated by measuring changes in body weight following administration of OLX702A-031-1 or OLX702A-031-2 in an animal model in which obesity was induced with a high-fat diet (diet-induced obesity: DIO).
[0079] 1-1. Confirmation of the weight loss effect of OLX702A-031-1 administration C57BL / 6 mice (8 weeks old, male, Koatech) were used as animal model groups. Animals were divided into a normal diet group (NCD) and a high-fat diet group (HFD) for 32 weeks. The high-fat diet (60% fat content, 60% HFD) animal model group was further divided into a 1X PBS group (HFD-VC), a Factor IX-targeting OLX700A-001-8 group (HFD-NC), and an example OLX702A-031-1 group (HFD-031-1) based on the administered substance. Specific experimental conditions for the animal model groups are shown in Table 3 below.
[0080] [Table 3]
[0081] Starting from the 28th week after the high-fat diet was introduced, OLX702A-031-1 according to one embodiment was administered subcutaneously at a dose of 10 mpk every week for a total of four times. This experiment was conducted for four weeks, and body weight was measured three times a week along with the administration of the test substance. In addition, approximately four weeks after the administration of the test substance, weight changes in each animal model group were evaluated visually. The control group was a group administered 1X PBS (HFD-VC), and the negative control group was a group administered OLX700A-001-8 subcutaneously at a dose of 10 mpk every week (HFD-NC).
[0082] As a result, as shown in Figure 1, the group administered with OLX702A-031-1 according to one embodiment (HFD-031-1) showed significant weight loss from about 10 days after the administration of the test substance, and the weight loss of about 15% was maintained throughout the experiment. Furthermore, as shown in Figure 2, the HFD-031-1 group according to one embodiment showed a significant weight loss effect that was visible to the naked eye.
[0083] 1-2. Confirmation of the weight loss effect of OLX702A-031-2 administration C57BL / 6 mice (8-week-old, male, Koatech) were fed a high-fat diet (60% fat content, 60% HFD) for 8 weeks and were divided into a 1X PBS group (Vehicle), a semaglutide group (Semaglutide), and an OLX702A-031-2 group (OLX702A-031-2) according to the substance administered to the animal model groups. Specific experimental conditions for the animal model groups are shown in Table 4 below.
[0084] [Table 4]
[0085] Eight weeks after the high-fat diet was introduced, OLX702A-031-2 according to one embodiment was administered subcutaneously at 10 mpk doses every two weeks for a total of four times. This experiment was conducted for eight weeks, and body weight (FX-2000i, A&D Company, 0.01-2200 g) and food intake (CSG201F, OHAUS, 0.1 g-200 g) were measured twice weekly along with the administration of the test substance. The food intake was calculated by measuring the difference between the amount supplied and the amount remaining per individual. The control group was a group administered 1X PBS (Vehicle), and the positive control group was a group administered semaglutide subcutaneously at 0.42 mpk doses every one week for a total of eight times. Here, mpk means mg (drug) / kg (control animal).
[0086] As a result, as shown in FIG. 3 and Table 5, a significant weight loss effect was observed in the group administered with OLX702A-031-2 according to one embodiment (OLX702A-031-2).
[0087] [Table 5]
[0088] Furthermore, as shown in Figure 4 and Table 6, the OLX702A-031-2 group showed a slight decrease in food intake compared to the positive control group, indicating that the weight loss effect was not simply due to a decrease in food intake.
[0089] [Table 6]
[0090] Experimental Example 2: Confirmation of increase in basal metabolic rate and fat oxidation effect In this experiment, we used an animal model in which obesity was induced with a high-fat diet (diet-induced obesity: DIO) to measure changes in basal metabolic rate and fat oxidation levels following administration of OLX702A-031-2, in an attempt to identify the main factors behind the anti-obesity effect.
[0091] The food intake, energy expenditure, and locomotive activity of the animal model groups in Experimental Examples 1-2 were measured using a comprehensive animal metabolic monitoring system (CLAMS; Columbus Instruments, Columbus, OH, USA). Specifically, on the afternoon of the 12th day after the initial administration of the test substance, the animal model groups were placed in the CLAMS to adapt to the changed environment. Starting at 9:00 AM the next day (i.e., the 13th day after the initial administration of the test substance), oxygen uptake (VO), carbon dioxide consumption (VCO), activity (measured using infrared beams), food intake, and water intake were measured every 10 minutes for a total of 48 hours. Thereafter, the respiratory quotient (RER) was calculated as the ratio of carbon dioxide consumption to oxygen uptake (VCO / VO), and energy expenditure was calculated using the following equation: [Formula 1]
number
[0092] As a result, as shown in Figures 5, 6, Tables 7 and 8, there was no difference in activity levels between the animal model groups, and the energy expenditure of the semaglutide-administered group (Semaglutide) was confirmed to be at a similar level to the control group. On the other hand, the energy expenditure of the OLX702A-031-2-administered group (OLX702A-031-2) according to one embodiment was found to increase significantly regardless of changes in activity levels.
[0093] [Table 7]
[0094] [Table 8]
[0095] Furthermore, as shown in Figures 7, 8, and Table 9, the respiratory quotient of the OLX702A-031-2 group was closer to 0.7 than that of the semaglutide group (generally, the respiratory quotient is approximately 0.7 when fat is broken down, and approximately 1.0 when carbohydrates are broken down). The value of approximately 0.7 indicates that fat oxidation, i.e., fat burning, was actively promoted. Furthermore, this tendency was observed under both light and dark conditions, and was even more pronounced under dark conditions.
[0096] [Table 9]
[0097] From the above results, it was found that the weight loss effect of the RNAi formulation according to one embodiment begins with an increase in energy consumption, i.e., an increase in basal metabolic rate, and also exhibits an excellent fat oxidation effect.
[0098] Experimental Example 3: Confirmation of the mechanism of anti-obesity effect In this experimental example, the levels of FGF 21 (Fibroblast Growth Factor 21) were evaluated in an animal model in which obesity was induced with a high-fat diet, and the FGF 21-related effects were compared with those of a group administered semaglutide.
[0099] 3-1.FGF 21 expression enhancement effect C57BL / 6 mice (8-week-old, male, Koatech) were fed a high-fat diet for 10 weeks and the animal model groups were divided into two groups based on the administered substance: a 1X PBS group (Vehicle) and an OLX702A-031-2 group (OLX702A-031-2). Specific experimental conditions for the animal model groups are shown in Table 10 below.
[0100] [Table 10]
[0101] Ten weeks after the high-fat diet was introduced, OLX702A-031-2 according to one embodiment was administered subcutaneously once at a dose of 10 mpk. Then, 12 days after the subcutaneous administration, each animal model group was sacrificed, and FGF21 mRNA expression levels in liver tissue and serum FGF21 levels were measured. A group administered 1X PBS (vehicle) served as a control group.
[0102] As a result, as shown in Figure 9, it was found that the FGF21 mRNA expression level in liver tissue and the FGF21 level in serum of the group administered OLX702A-031-2 according to one embodiment (OLX702A-031-2) were both significantly increased compared to the control group.
[0103] 3-2. Comparison with semaglutide group C57BL / 6 mice were fed a high-fat diet for 8 weeks and the animal model groups were divided into 1X PBS-administered group (Vehicle), semaglutide-administered group (Semaglutide), and OLX702A-031-2-administered group (OLX702A-031-2) according to one embodiment of the present invention. The specific experimental conditions for the animal model groups are shown in Table 11 below.
[0104] [Table 11]
[0105] Eight weeks after the high-fat diet was introduced, OLX702A-031-2 according to one embodiment was administered subcutaneously at 10 mpk doses every two weeks for a total of four times. Eight weeks after the subcutaneous administration, each animal model group was sacrificed and FGF21 mRNA expression levels in liver tissue and serum FGF21 levels were measured. Meanwhile, a group administered 1X PBS (VC) served as the control group, and a group administered semaglutide subcutaneously at 0.42 mpk doses every one week for a total of eight times served as the positive control group.
[0106] As a result, as shown in Figure 10, the FGF21 mRNA expression levels in liver tissue and serum FGF21 levels in the semaglutide group (Semaglutide) were similar to or tended to decrease compared to the control group, whereas the FGF21 expression levels in the group administered OLX702A-031-2 according to one embodiment (OLX702A-031-2) were significantly increased, as in the above-mentioned experimental results. These results confirm that, unlike semaglutide, OLX702A-031-2 according to one embodiment has an effect of increasing FGF21 expression as an additional mechanism of action for weight loss.
[0107] Taking the above experimental results into consideration, the weight loss effect of the RNAi formulation targeting MARC1 according to one embodiment, unlike existing GLP-1 receptor agonist-based therapeutics, is based on an increase in basal metabolic rate / energy expenditure, and in terms of its mechanism of action, it can be classified as additionally enhancing the expression of FGF 21. Therefore, as confirmed in this experimental example, the RNAi formulation according to one embodiment not only exhibits an anti-obesity effect when administered alone, but is also expected to exhibit an improved anti-obesity effect when administered in combination with a GLP-1 receptor agonist-based therapeutic.
[0108] II. Confirmation of improved anti-obesity effects by combined administration with GLP-1 receptor agonists or GLP-1 / GIP dual agonists In order to confirm the efficacy of a combined preparation containing an RNAi preparation targeting MARC1 according to one embodiment, we attempted to confirm the anti-obesity effects of its combination with semaglutide, a GLP-1 receptor agonist, and with tirzepatide, a GLP-1 / GIP receptor dual agonist.
[0109] Experimental Example 1: Confirmation of weight loss by combined administration of OLX702A-031-2 and semaglutide In this experimental example, an animal model in which obesity was induced with a high-fat diet was used, and the changes in body weight and food intake following co-administration of OLX702A-031-2 and semaglutide, a GLP-1 (glucagon-like peptide-1) receptor agonist, were measured to evaluate the anti-obesity effect.
[0110] 1-1.Comparison of weight changes C57BL / 6 mice (6-week-old, male, Koatech) were fed a high-fat diet for 8 weeks and the animal model groups were divided into a normal diet group (NCD) and a high-fat diet group (HFD) for 8 weeks. The high-fat diet animal model groups were further divided into 1X PBS group (HFD VC), semaglutide alone group (Semaglutide), and a combination of OLX702A-031-2 and semaglutide according to one embodiment (OLX702A-031-2+Sema) groups. Specific experimental conditions for the animal model groups are shown in Table 12 below.
[0111] [Table 12]
[0112] Eight weeks after the high-fat diet was introduced, OLX702A-031-2 and semaglutide were co-administered according to one embodiment. Specifically, semaglutide was subcutaneously administered twice a week at a dose of 0.42 mpk for a total of 16 doses, after which administration was discontinued for the remainder of the experiment. OLX702A-031-2 was subcutaneously administered at a dose of 10 mpk for a total of 8 doses every two weeks for a total of 16 weeks. The experiment was conducted for 16 weeks, and along with the administration of the test substances, each individual's body weight was measured five times a week from the start of the experiment (D0) to day 66, and then three times a week until the end of the experiment. The control group was an obese animal model administered 1X PBS (VC), and the comparison group was a group administered semaglutide alone subcutaneously at a dose of 0.42 mpk twice a week for a total of 16 doses (Semaglutide) for a total of 8 weeks.
[0113] As a result, as shown in Figure 11 and Table 13, the group administered semaglutide alone (Semaglutide) showed effective weight loss effects throughout the administration period, but showed a rapid increase in weight after semaglutide administration was discontinued (8 weeks after administration of the test substance).On the other hand, the OLX702A-031-2+sema group according to one embodiment showed a weight loss effect that was approximately 1.5 times greater than the Semaglutide group, and it was confirmed that this weight loss effect was maintained not only during the period in which semaglutide administration was administered, but also during the period in which semaglutide administration was discontinued.
[0114] [Table 13]
[0115] 1-2. Comparison of dietary intake The food intake of the animal model group in Experimental Example 1-1 was measured for 16 weeks, and along with the administration of the test substance, the food intake of each individual was measured twice a week from the start of the experiment (D0) until week 9, and then five times a week until the end of the experiment. The food intake was calculated by measuring the difference between the amount supplied and the amount remaining for each individual, and the cumulative food intake over the entire experimental period and the average daily food intake over the period before semaglutide administration was discontinued and over the entire experimental period were evaluated.
[0116] As a result, as shown in Figure 12 and Table 14, in terms of cumulative food intake, there was no difference between the group administered OLX702A-031-2 and semaglutide in accordance with one embodiment (OLX702A-031-2+sema) and the control group or the group administered semaglutide alone (Semaglutide).In addition, in terms of average daily food intake, both the Semaglutide group and the OLX702A-031-2+sema group had reduced food intake compared to the control group until semaglutide administration was discontinued, and the food intake of the OLX702A-031-2+sema group was at a similar level regardless of the discontinuation of semaglutide administration.
[0117] [Table 14]
[0118] The experimental results showed that the improved weight loss effect of combined administration with the GLP-1 receptor agonist semaglutide was initiated by an increase in energy expenditure, not a decrease in food intake.
[0119] Experimental Example 2: Confirmation of the combined effect of semaglutide and OLX702A-031-2 by changing the number of times semaglutide is administered In this experimental example, an animal model in which obesity was induced with a high-fat diet was used as the subject, and the effects of the number of semaglutide administrations on the anti-obesity effects of the combined administration of OLX702A-031-2 and semaglutide were examined.
[0120] 2-1. Comparison of weight change in once-weekly administration groups C57BL / 6 mice (8-week-old, male, Koatech) were fed a high-fat diet for 8 weeks and the animal model groups were divided into three groups according to the administered substance: a group administered 1X PBS every week (Vehicle), a group administered semaglutide alone every week (Sema QW), a group administered OLX702A-031-2 according to an embodiment every two weeks (OLX702A-031-2Q2W), and a group administered OLX702A-031-2 according to an embodiment in combination with semaglutide (OLX702A-031-2Q2W+Sema QW). Specific experimental conditions for the animal model groups are shown in Table 15 below.
[0121] [Table 15]
[0122] The test substances were administered 8 weeks after the high-fat diet was introduced. Specifically, semaglutide was administered subcutaneously at 0.42 mpk doses every week for a total of six times, and OLX702A-031-2 was administered subcutaneously at 10 mpk doses every two weeks for a total of three times. This experiment was conducted for six weeks, and body weight and food intake were measured daily along with the administration of the test substances. The food intake was calculated by measuring the difference between the amount supplied and the amount remaining per individual. The control group was an obese animal model administered 1X PBS (Vehicle), and the positive control groups were a group administered semaglutide subcutaneously at 0.42 mpk doses every week for a total of six times (Sema QW) and a group administered OLX702A-031-2 subcutaneously at 10 mpk doses every two weeks for a total of three times (OLX702A-031-2Q2W).
[0123] As a result, as shown in Figure 13 and Table 16, under the condition that semaglutide was administered once a week, the group administered OLX702A-031-2 according to one embodiment in combination with semaglutide (OLX702A-031-2+semga QW) showed significantly improved weight loss effects compared to the group administered either alone.
[0124] [Table 16]
[0125] Furthermore, as shown in Figure 14 and Table 17, the OLX702A-031-2 + semaglutide QW group did not differ from the other groups in terms of cumulative food intake, indicating that the weight loss effect began with an increase in energy expenditure.
[0126] [Table 17]
[0127] 2-2. Comparison of weight change in once-daily administration groups C57BL / 6 mice (8-week-old, male, Koatech) were fed a high-fat diet for 8 weeks and the animal model groups were divided into three groups according to the administered substance: a group administered 1X PBS every week (Vehicle), a group administered semaglutide alone every day (Sema QD), a group administered OLX702A-031-2 according to an embodiment every two weeks (OLX702A-031-2Q2W), and a group administered OLX702A-031-2 according to an embodiment in combination with semaglutide (OLX702A-031-2 Q2W+Sema QD). The specific experimental conditions for the animal model groups are shown in Table 18 below.
[0128] [Table 18]
[0129] Eight weeks after the high-fat diet was introduced, OLX702A-031-2 and semaglutide were co-administered according to one embodiment. Specifically, semaglutide was subcutaneously administered at 0.15 mpk doses every day for a total of 14 times, and then administration was discontinued for the remainder of the experiment. OLX702A-031-2 was subcutaneously administered at 10 mpk doses every two weeks for a total of three times. The experiment was conducted for six weeks, and body weight and food intake were measured daily along with the administration of the test substances. Food intake was calculated by measuring the difference between the amount supplied and the amount remaining per individual. The control group was an obese animal model administered 1X PBS (Vehicle), and the positive control groups were a group in which semaglutide was administered subcutaneously at 0.15 mpk doses every day for a total of 14 times and then discontinued (Sema QD), and a group in which OLX702A-031-2 was administered subcutaneously at 10 mpk doses every two weeks for a total of three times (OLX702A-031-2+sema QD).
[0130] As a result, as shown in Figure 15 and Table 19, under conditions where semaglutide was administered daily, the group administered OLX702A-031-2 according to one embodiment in combination with semaglutide (OLX702A-031-2+sema QD) showed improved weight loss effects compared to the group administered alone. In particular, the group administered semaglutide every other day (sema QD) showed a rapid increase in weight after semaglutide administration was discontinued, whereas the weight loss effect was sustained in the OLX702A-031-2+sema QD group.
[0131] [Table 19]
[0132] Furthermore, as shown in Figure 16 and Table 20, the OLX702A-031-2+sema QD group did not differ significantly from the other groups in terms of cumulative food intake, indicating that the weight loss effect began with an increase in energy expenditure.
[0133] [Table 20]
[0134] The experimental results showed that the improved weight loss effect achieved by combined administration confirmed in Experimental Example 1 was consistently achieved regardless of the number of semaglutide administrations.
[0135] Experimental Example 3: Confirmation of weight loss by combined administration of OLX702A-031-2 and tirzepatide In this experimental example, an animal model in which obesity was induced with a high-fat diet was used, and the changes in body weight and food intake following co-administration of OLX702A-031-2 and tirzepatide, a GLP-1 / GIP receptor dual agonist, were measured to evaluate the anti-obesity effect.
[0136] 3-1.Comparison of weight changes C57BL / 6 mice (7-week-old, male, Koatech) were fed a high-fat diet for 9 weeks. Animal model groups were divided into a normal diet group (NCD) and a high-fat diet group (HFD) for 9 weeks. The high-fat diet group was further divided into 1X PBS-treated groups (HFD VC), tirzepatide alone at 10 nmol / kg (tirzepatide 10 nmol), tirzepatide alone at 100 nmol / kg (tirzepatide 100 nmol), and a combination group of OLX702A-031-2 (5 mpk) and tirzepatide (10 nmol / kg) (OLX702A-031-2 + TZP 10 nmol) according to one embodiment. Specific experimental conditions for the animal model groups are shown in Table 21 below.
[0137] [Table 21]
[0138] Nine weeks after the high-fat diet was introduced, OLX702A-031-2 and tirzepatide according to one embodiment were co-administered. Specifically, tirzepatide was subcutaneously administered twice a week at a dose of 10 nmol / kg for a total of eight doses, and then discontinued for the remainder of the experiment. OLX702A-031-2 was subcutaneously administered every two weeks at a dose of 5 nmol / kg for a total of four doses. The experiment was conducted for nine weeks, and each individual's body weight was measured five times a week along with the administration of the test substances. The control group was an obese animal model administered 1X PBS (HFD VC), and the comparison groups were a group administered tirzepatide subcutaneously at a dose of 10 nmol / kg twice a week for a total of eight times (tirzepatide 10 nmol) and a group administered tirzepatide subcutaneously at a dose of 100 nmol / kg twice a week for a total of eight times (tirzepatide 100 nmol).
[0139] As a result, as shown in Figure 17 and Table 22, the groups administered tirzepatide alone (tirzepatide 10 nmol, tirzepatide 100 nmol) showed effective weight loss during the administration period, but showed a rapid increase in weight after tirzepatide administration was discontinued. On the other hand, the group administered OLX702A-031-2 and tirzepatide in combination (OLX702A-031-2 + TZP 10 nmol) according to one embodiment not only showed a weight loss effect at a level similar to that of the high-dose tirzepatide group (tirzepatide 100 mol), but also maintained this weight loss effect during and after tirzepatide administration.
[0140] [Table 22]
[0141] 3-2. Comparison of dietary intake The food intake of the animal model group in Experimental Example 3-1 was measured for 9 weeks. The food intake of each individual was measured 5 times a week along with the administration of the test substance. The food intake was calculated by measuring the difference between the amount of food supplied and the amount of food remaining for each individual. The cumulative food intake throughout the entire experiment and the average daily food intake during the period before the discontinuation of tirzepatide administration and during the entire experiment were evaluated.
[0142] As a result, as shown in Figures 18A to 18C and Table 23, the group administered OLX702A-031-2 and tirzepatide in combination (OLX702A-031-2 + TZP 10 nmol) according to one embodiment showed no difference in cumulative food intake compared to the control group or the groups administered tirzepatide alone (tirzepatide 10 nmol, tirzepatide 100 nmol). Furthermore, the OLX702A-031-2 + TZP 10 nmol group showed a higher level than the other groups before tirzepatide administration was discontinued, but showed a similar level to the other groups throughout the entire experiment.
[0143] [Table 23]
[0144] The experimental results showed that the improved weight loss effect of combined use with tirzepatide, a GLP-1 / GIP receptor dual agonist, was initiated by an increase in energy expenditure, not a decrease in food intake.
[0145] III. Confirmation of weight loss by combined administration of OLX702A-075-16 and semaglutide using a primate animal model Experimental Example 1: Comparison of weight change after combined administration of OLX702A-075-16 In this experimental example, a primate model in which obesity was induced with a high-fat diet was used as the subject, and the changes in body weight and food intake following co-administration of OLX702A-075-16 and semaglutide, a GLP-1 receptor agonist, were measured to evaluate the anti-obesity effect.
[0146] 1-1.Comparison of weight changes Obese monkey models (12-23 years, male) that had been fed a high-fat diet for more than two years were used as subjects. The animal model groups were divided into three groups based on the substance administered: a group administered 1X PBS (Vehicle), a group administered semaglutide alone (Semaglutide), a group administered OLX702A-075-16 according to one embodiment alone (OLX702A-075-16), and a group administered OLX702A-075-16 according to one embodiment in combination with semaglutide (OLX702A-075-16+sema). Specific experimental conditions for the animal model groups are shown in Table 24 below.
[0147] [Table 24]
[0148] An obese monkey model that had been fed a high-fat diet for over two years was co-administered with OLX702A-075-16 according to one embodiment and semaglutide. Specifically, semaglutide was subcutaneously administered at 30 μg / kg doses every week for a total of four times, and then discontinued for the remainder of the experiment. OLX702A-075-16 was subcutaneously administered at 10 mpk doses every two weeks for a total of three times. The experiment was carried out for 12 weeks, and each individual's body weight was measured twice a week along with the administration of the test substances. The control group was an obese animal model administered 1X PBS (Vehicle), and the comparison groups were a group administered semaglutide subcutaneously at a dose of 30 μg / kg four times at weekly intervals (Semaglutide) and a group administered OLX702A-075-16 subcutaneously at a dose of 10 mpk two times at two-week intervals (OLX702A-075-16).
[0149] Table 25 shows the results of checking the relative body weight change (%) over time for each animal model group compared to the day on which the test substance was administered (Base).
[0150] [Table 25]
[0151] As a result, as shown in Figure 19 and Table 25, the group administered semaglutide alone (Semaglutide) showed effective weight loss effects during the administration period, but showed signs of weight gain again after semaglutide administration was discontinued.On the other hand, the group administered OLX702A-075-16 and semaglutide in combination (OLX702A-075-16+sema) according to one embodiment not only showed a superior weight loss effect compared to the Semaglutide group, but also maintained this weight loss effect during the period when semaglutide administration was administered and when semaglutide administration was discontinued.
[0152] 1-2. Comparison of dietary intake The food intake of the animal model group in Experimental Example 1-1 was measured for 12 weeks, and the food intake of each individual was measured daily starting from 7 days before the administration of the test substance. The food intake was calculated by measuring the difference between the amount of food supplied and the amount remaining for each individual, and the cumulative food intake and the average daily food intake during the experimental period were evaluated.
[0153] Table 26 shows the results of confirming the relative change (%) in the average daily food intake for each animal model group compared to the day of administration of the test substance (Base).
[0154] [Table 26]
[0155] As shown in Figure 20 and Table 26, the results also showed that in terms of average daily food intake, the group administered OLX702A-075-16 in accordance with one embodiment in combination with semaglutide (OLX702A-075-16+sema) showed similar levels to the group administered semaglutide alone (Semaglutide).
[0156] From the above experimental results, it is inferred that the improved weight loss effect due to the combined administration of Experimental Example 1-1 is not initiated by a decrease in food intake, but by an increase in energy expenditure.
[0157] Experimental Example 2: Comparison of changes in body fat percentage with combined administration of OLX702A-075-16 The body fat percentage of the animal model group in Experimental Example 1-1 was measured for 12 weeks, and the body fat percentage of each individual was measured every 4 weeks from the day of test substance administration. The animal models were anesthetized with propofol injection and then transferred to a GE Lunar Prodigy Primo Bone Densitometer. Body fat percentage was then quantified and evaluated using a GE Lunar Prodigy Dual Energy X-ray Absorptiometry (DEXA) scan.
[0158] Table 27 shows the results of the change in body fat percentage (%) over time for each animal model group.
[0159] [Table 27]
[0160] As a result, as shown in Figure 21 and Table 27, the group administered OLX702A-075-16 in combination with semaglutide (OLX702A-075-16+sema) showed an effective reduction in body fat percentage, and this effect was superior to that of the group administered semaglutide alone (Semaglutide).
[0161] Experimental Example 3: Comparison of changes in abdominal circumference with combined administration of OLX702A-075-16 The abdominal circumference measurement for the animal model group of Experimental Example 1-1 was carried out for 12 weeks, and the abdominal circumference of each individual was measured every 4 weeks from the day of administration of the test substance. The animal models were anesthetized by injecting propofol, and the anesthetized animal models were laid on their sides, and the abdominal circumference was measured around the navel for evaluation.
[0162] Table 28 shows the results of changes in abdominal circumference (cm) over time for each animal model group.
[0163] [Table 28]
[0164] As a result, as shown in Figure 22 and Table 28, the group administered OLX702A-075-16 in combination with semaglutide (OLX702A-075-16+sema) showed an effective reduction in waist circumference, and this effect was superior to that of the group administered semaglutide alone (Semaglutide).
[0165] While the present invention has been described in detail above, it will be apparent to those skilled in the art that the specific details are merely preferred embodiments and should not be construed as limiting the scope of the present invention. Therefore, the true scope of the present invention will be defined by the appended claims and their equivalents.
Claims
1. A pharmaceutical composition for the prevention or treatment of obesity, comprising a double-stranded RNAi preparation containing a sense strand and an antisense strand as an active ingredient, The antisense strand is EVP-mU having complementarity to the MARC1 (Mitochondrial amidoxime reducing component 1) mRNA sequence * fG * mAmGmUmAfAmGfCmAmAmUmCfUmG * fG * mU * mC * mC * mU * mU, P-mA * fG * mAmUmCfCmAfGfAmGmCmUmGfCmG * fC * mC * mA * mC, or EVP-mU * fG * mAmUmCfCmAfGfAmGmCmUmGfCmG * fC * mC * mA * consisting of mC, and the sense strand is mC * mC * mAfGmAfUmUmGmCmUmUmAmCmUmCmA-GalNAc, mG * fC * mGfCfAfGmCfUmCfUmGfGmAfUmCfU-GalNAc, or mG * fC * consisting of mGfCfAfGmCfUmCfUmGfGmAfUmCfA-GalNAc As mentioned above, * A pharmaceutical composition in which is a modification to a phosphorothioate bond, m is a substitution to 2'-O-methyl, P is a bond to a 5'-phosphate group, f is a substitution to 2'-fluoro, EVP is a bond to 5'-E-vinylphosphonate, and GalNAc is a bond to an N-acetyl-galactosamine derivative.
2. The N-acetyl-galactosamine derivative has the structure of the following formula 1, wherein it is part of the pharmaceutical composition according to claim 1: [Formula 1] 【Chemistry 1】
3. The pharmaceutical composition according to claim 1, wherein the 5' end of the antisense chain and the 3' end of the sense chain form a blunt end.
4. The composition is the pharmaceutical composition according to claim 1, which suppresses the expression of MARC1.
5. The pharmaceutical composition according to claim 1, wherein the composition increases the expression or plasma level of FGF21 (fibroblast growth factor 21).
6. The pharmaceutical composition according to claim 1, wherein the composition is administered in combination with a GLP-1 receptor agonist or a GLP-1 / GIP receptor dual agonist.
7. The pharmaceutical composition according to claim 6, wherein the GLP-1 receptor agonist is selected from the group consisting of semaglutide, liraglutide, exenatide, taspoglutide, albiglutide, lixisenatide, and dulaglutide.
8. The pharmaceutical composition according to claim 6, wherein the GLP-1 / GIP receptor dual agonist is selected from the group consisting of tirzepatide, NN9709, SAR-438335, and ZP-DI-70.
9. The pharmaceutically acceptable composition according to claim 6, wherein the composition is prepared to be administered individually, simultaneously, or sequentially with the GLP-1 receptor agonist or the GLP-1 / GIP receptor dual agonist.
10. A combination formulation for the prevention or treatment of obesity comprising: a first active ingredient containing a GLP-1 receptor agonist or a GLP-1 / GIP receptor dual agonist; and a second active ingredient containing a double-stranded RNAi preparation including a sense strand and an antisense strand; The antisense strand is EVP-mU, which is complementary to the MARC1 (Mitochondrial amidoxime reducing component 1) mRNA sequence. * fG * mAmGmUmAfAmGfCmAmAmUmCfUmG * fG * mU * mC * mC * mU * mU, P-mA * fG * mAmUmCfCmAfGfAmGmCmUmGfCmG * fc * mC * mA * mC, or EVP-mU * fG * mAmUmCfCmAfGfAmGmCmUmGfCmG * fc * mC * mA * It consists of mC, and the sense chain is mC * mC * mAfGmAfUmUmGmCmUmUmAmCmUmCmA-GalNAc, mG * fc * mGfCfAfGmCfUmCfUmGfGmAfUmCfU-GalNAc, or mG * fc * It consists of mGfCfAfGmCfUmCfUmGfGmAfUmCfA-GalNAc, As mentioned above, * A combination formulation in which is a modification to a phosphorothioate bond, m is substitution to 2'-O-methyl, P is the attachment of a 5'-phosphate group, f is substitution to 2'-fluoro, EVP is the attachment of 5'-E-vinylphosphonate, and GalNAc is the attachment of an N-acetyl-galactosamine derivative.
11. The combination formulation according to claim 10, wherein the GLP-1 receptor agonist is selected from the group consisting of semaglutide, liraglutide, exenatide, taspoglutide, albiglutide, lixisenatide, and dulaglutide.
12. The combination formulation according to claim 10, wherein the GLP-1 / GIP receptor dual agonist is selected from the group consisting of tirzepatide, NN9709, SAR-438335, and ZP-DI-70.
13. The combination formulation according to claim 10, wherein the N-acetyl-galactosamine derivative is a compound of the following formula 1: [Formula 1] 【Chemistry 2】
14. The combination formulation according to claim 10, wherein the 5' end of the antisense chain and the 3' end of the sense chain form a blunt end.
15. The combination formulation according to claim 10, wherein the first active ingredient and the second active ingredient are manufactured to be administered individually, simultaneously, or sequentially.
16. A kit for the prevention or treatment of obesity, comprising a combination formulation according to any one of claims 10 to 15, wherein the first active ingredient is provided to an individual in a form in which it is contained in a first compartment and the second active ingredient is contained in a second compartment.