Common light chain antibody library, method for preparing same, and use thereof

A common light chain antibody library with diverse heavy chains addresses chain misassociation in bispecific antibody preparation, facilitating efficient screening and development of multispecific antibodies with improved pharmacokinetics and reduced immunogenicity.

JP2026508171APending Publication Date: 2026-03-10SANYOU BIOPHARMACEUTICALS CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-02-08
Publication Date
2026-03-10

AI Technical Summary

Technical Problem

The preparation of bispecific antibodies is hindered by chain misassociation, and there is a need for antibody libraries with a common light chain while maintaining heavy chain diversity to overcome this issue and enable efficient screening for multispecific antibodies.

Method used

A common light chain antibody library is constructed by combining a common light chain sequence with highly diverse human antibody heavy chain sequences, encoded by IGKV3 or IGKV1 light chain germline genes, to create a consensus antibody library that allows for the development of bispecific antibodies with high efficiency.

Benefits of technology

The library provides a platform for screening bispecific antibodies with a common light chain structure, enhancing pharmacokinetics and reducing immunogenicity, and enables the continuous selection of candidate molecules based on various target combinations.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026508171000033
    Figure 2026508171000033
  • Figure 2026508171000034
    Figure 2026508171000034
  • Figure 2026508171000035
    Figure 2026508171000035
Patent Text Reader

Abstract

The present invention relates to an antibody library comprising a common light chain with heavy chain diversity, and a method for preparing the antibody library. The present invention further relates to the use of the antibody library comprising a common light chain with heavy chain diversity for preparing bispecific antibodies comprising a common light chain, and the prepared bispecific antibodies comprising the common light chain.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates generally to the field of antibody engineering. More specifically, the present invention relates to a consensus antibody library with heavy chain diversity, a method for its preparation, and its use in obtaining bispecific antibodies with a consensus light chain. [Background technology]

[0002] The concept of bispecific antibodies was first proposed 60 years ago. However, with the advancement of monoclonal antibody technology and the maturation of clinical applications of monoclonal antibody drugs, the pace of bispecific antibody technology and drug development has increased dramatically. Because bispecific antibodies can solve problems that monoclonal antibodies cannot address mechanistically, many drug discovery companies and research and development institutions are working to develop antibody drugs with superior therapeutic effects. While there are currently only five bispecific antibody drugs on the market, sales were $460 million in 2018 and are expected to reach $5.43 billion by 2024 (Jijie GuB et al. (2020). "Biology drives the discovery of bispecific antibodies as innovative therapeutics." Antibody. Therapeutics v13(1):18-62). This clearly demonstrates the enormous market potential for the development of bispecific antibody drugs with superior efficacy compared to monoclonal antibodies.

[0003] Bispecific antibodies are antibodies that can simultaneously bind to two different antigen epitopes. Some bispecific antibodies bind to two different target proteins, while others bind to different epitopes on a single target. Due to their unique mechanism of action, bispecific antibodies achieve effects not achievable with monoclonal antibodies. For example, a bispecific antibody combining an anti-CD3 antibody and an anti-tumor-associated antigen antibody can bring effector cells closer to the target cells. Bispecific antibodies can simultaneously bind to two targets on the cell surface, achieving coactivation or coinhibition. Other bispecific antibodies cross the blood-brain barrier through one arm and exert their therapeutic effect through the other arm. Other bispecific antibodies bind to different epitopes on the same antigen, providing superior efficacy compared to single-epitope antibodies. All of these mechanisms of action are not possible with conventional monoclonal antibodies (Labrijn, AF, et al. (2019). "Bispecific antibodies: ^ a mechanistic review of the pipeline." Nat Rev Drug Discov 18(8): 585-608.).

[0004] Bispecific antibodies are highly desirable because their two arms act cooperatively. However, a major challenge in the preparation of bispecific antibodies is "chain misassociation." To address this issue, various bispecific structural platforms have been developed, including miniaturized bispecific antibodies, various asymmetric bispecific antibodies, and bispecific antibodies utilizing a common light chain. Bispecific antibody structural types are extremely diverse (Suurs, FV, et al. (2019). "A review of bispecific antibodies and antibody constructs in oncology and clinical challenges," Pharmacol Ther 201: 103-119). Currently, there are only five bispecific antibodies on the market: a miniaturized scFv-linked antibody (CD3 × CD19, blinatumomab), a bispecific antibody using a common light chain (Factor IX × Factor X, emicizumab), two duobody-type bispecific antibodies (CD20 × CD3, mosunetuzumab), and one ANG2 × VEGF-α bispecific antibody (faricimab) using crossmab and knob-in-hole technology. Most bispecific antibodies with other structures are currently in preclinical or Phase I clinical trials. Therefore, it will likely take some time before the safety and efficacy of various bispecific antibody configurations are demonstrated in clinical studies.

[0005] Common light chain bispecific antibodies are primarily differentiated from conventional IgG antibodies by the use of identical light chains, which differ in the variable region sequences of the two heavy chains. However, the use of identical light chains prevents light chain misassociation. Furthermore, multiple mutations in the Fc segments of the two heavy chains (e.g., knob-into-hole mutations) prevent the same heavy chains from dimerizing, avoiding the issue of inter-heavy chain homodimerization. Therefore, common light chain bispecific antibodies successfully resolve the issue of antibody chain misassociation and are structurally very similar to natural IgG antibodies, which account for approximately 70% of the total human antibody population. Compared to other bispecific antibody platforms, common light chain bispecific antibodies are expected to have advantages in terms of pharmacokinetics and immunogenicity.

[0006] Therefore, in this field, there is a need for antibody libraries that have a common light chain while maintaining heavy chain diversity, and screening using multiple antigens can make it possible to obtain common light chain-type multispecific antibodies with high efficiency. Summary of the Invention

[0007] The present invention relates to the design of a common light chain in a multispecific antibody (e.g., a bispecific antibody) and the construction of an antibody library containing the common light chain. In this invention, a common light chain antibody library was constructed by combining a common light chain sequence with highly diverse human antibody heavy chain sequences based on the common light chain sequence with excellent druggability.

[0008] Thus, in a first aspect, the present invention provides an antibody library having heavy chain diversity and comprising a common light chain, wherein the common light chain in said antibody library is encoded by an IGKV3 or IGKV1 light chain germline gene.

[0009] In some embodiments, the common light chain in the antibody libraries of the invention is encoded by an IGKV3-20, IGKV3-11, IGKV1-39, IGKV1-5, or IGKV1-33 light chain germline gene.

[0010] In a preferred embodiment, the common light chain in the antibody library of the invention is encoded by the IGKV3-20 or IGKV1-39 light chain germline gene.

[0011] In some specific embodiments, the common light chains in the antibody libraries of the invention include, respectively:

[0012] (a) LCDR1 shown in SEQ ID NO:1 or variants thereof having no more than two amino acid changes in LCDR1 shown in SEQ ID NO:1, LCDR2 shown in SEQ ID NO:2 or variants thereof having no more than two amino acid changes in LCDR2 shown in SEQ ID NO:2, and LCDR3 shown in SEQ ID NO:3 or variants thereof having no more than two amino acid changes in LCDR3 shown in SEQ ID NO:3.

[0013] (b) LCDR1 shown in SEQ ID NO:4 or a variant of LCDR1 shown in SEQ ID NO:4 having a change of not more than two amino acids, LCDR2 shown in SEQ ID NO:5 or a variant of LCDR2 shown in SEQ ID NO:5 having a change of not more than two amino acids, and LCDR3 shown in SEQ ID NO:6 or a variant of LCDR3 shown in SEQ ID NO:6 having a change of not more than two amino acids.

[0014] (c) LCDR1 shown in SEQ ID NO:7 or a variant of LCDR1 shown in SEQ ID NO:7 having a change of not more than two amino acids, LCDR2 shown in SEQ ID NO:8 or a variant of LCDR2 shown in SEQ ID NO:8 having a change of not more than two amino acids, and LCDR3 shown in SEQ ID NO:9 or a variant of LCDR3 shown in SEQ ID NO:9 having a change of not more than two amino acids.

[0015] (d) LCDR1 set forth in SEQ ID NO:10 or variants thereof having no more than two amino acid changes in LCDR1 set forth in SEQ ID NO:10, LCDR2 set forth in SEQ ID NO:11 or variants thereof having no more than two amino acid changes in LCDR2 set forth in SEQ ID NO:11, and LCDR3 set forth in SEQ ID NO:12 or variants thereof having no more than two amino acid changes in LCDR3 set forth in SEQ ID NO:12.

[0016] (e) LCDR1 set forth in SEQ ID NO:13 or a variant thereof having no more than two amino acid changes in LCDR1 set forth in SEQ ID NO:13, LCDR2 set forth in SEQ ID NO:14 or a variant thereof having no more than two amino acid changes in LCDR2 set forth in SEQ ID NO:14, and LCDR3 set forth in SEQ ID NO:15 or a variant thereof having no more than two amino acid changes in LCDR3 set forth in SEQ ID NO:15.

[0017] (f) LCDR1 set forth in SEQ ID NO:16 or variants of LCDR1 set forth in SEQ ID NO:16 having changes of not more than two amino acids, LCDR2 set forth in SEQ ID NO:17 or variants of LCDR2 set forth in SEQ ID NO:17 having changes of not more than two amino acids, and LCDR3 set forth in SEQ ID NO:18 or variants of LCDR3 set forth in SEQ ID NO:18 having changes of not more than two amino acids.

[0018] (g) LCDR1 set forth in SEQ ID NO:19 or variants thereof having no more than two amino acid changes in LCDR1 set forth in SEQ ID NO:19, LCDR2 set forth in SEQ ID NO:20 or variants thereof having no more than two amino acid changes in LCDR2 set forth in SEQ ID NO:20, and LCDR3 set forth in SEQ ID NO:21 or variants thereof having no more than two amino acid changes in LCDR3 set forth in SEQ ID NO:21.

[0019] (h) LCDR1 set forth in SEQ ID NO:22 or variants of LCDR1 set forth in SEQ ID NO:22 having changes of not more than two amino acids, LCDR2 set forth in SEQ ID NO:23 or variants of LCDR2 set forth in SEQ ID NO:23 having changes of not more than two amino acids, and LCDR3 set forth in SEQ ID NO:24 or variants of LCDR3 set forth in SEQ ID NO:24 having changes of not more than two amino acids.

[0020] (i) LCDR1 set forth in SEQ ID NO:25 or variants thereof having no more than two amino acid changes in LCDR1 set forth in SEQ ID NO:25, LCDR2 set forth in SEQ ID NO:26 or variants thereof having no more than two amino acid changes in LCDR2 set forth in SEQ ID NO:26, and LCDR3 set forth in SEQ ID NO:27 or variants thereof having no more than two amino acid changes in LCDR3 set forth in SEQ ID NO:27.

[0021] (j) LCDR1 set forth in SEQ ID NO:28 or variants of LCDR1 set forth in SEQ ID NO:28 having changes of not more than two amino acids, LCDR2 set forth in SEQ ID NO:29 or variants of LCDR2 set forth in SEQ ID NO:29 having changes of not more than two amino acids, and LCDR3 set forth in SEQ ID NO:30 or variants of LCDR3 set forth in SEQ ID NO:30 having changes of not more than two amino acids.

[0022] (k) LCDR1 set forth in SEQ ID NO:31 or variants thereof having no more than two amino acid changes in LCDR1 set forth in SEQ ID NO:31, LCDR2 set forth in SEQ ID NO:32 or variants thereof having no more than two amino acid changes in LCDR2 set forth in SEQ ID NO:32, and LCDR3 set forth in SEQ ID NO:33 or variants thereof having no more than two amino acid changes in LCDR3 set forth in SEQ ID NO:33.

[0023] (l) LCDR1 set forth in SEQ ID NO:34 or variants of LCDR1 set forth in SEQ ID NO:34 having changes of not more than two amino acids, LCDR2 set forth in SEQ ID NO:35 or variants of LCDR2 set forth in SEQ ID NO:35 having changes of not more than two amino acids, and LCDR3 set forth in SEQ ID NO:36 or variants of LCDR3 set forth in SEQ ID NO:36 having changes of not more than two amino acids.

[0024] (m) LCDR1 shown in SEQ ID NO:37 or a variant of LCDR1 shown in SEQ ID NO:37 with a change of not more than two amino acids, LCDR2 shown in SEQ ID NO:38 or a variant of LCDR2 shown in SEQ ID NO:38 with a change of not more than two amino acids, and LCDR3 shown in SEQ ID NO:39 or a variant of LCDR3 shown in SEQ ID NO:39 with a change of not more than two amino acids.

[0025] (n) LCDR1 set forth in SEQ ID NO:40 or variants of LCDR1 set forth in SEQ ID NO:40 having not more than two amino acid changes, LCDR2 set forth in SEQ ID NO:41 or variants of LCDR2 set forth in SEQ ID NO:41 having not more than two amino acid changes, and LCDR3 set forth in SEQ ID NO:42 or variants of LCDR3 set forth in SEQ ID NO:42 having not more than two amino acid changes.

[0026] (o) LCDR1 set forth in SEQ ID NO:43 or variants thereof having no more than two amino acid changes in LCDR1 set forth in SEQ ID NO:43, LCDR2 set forth in SEQ ID NO:44 or variants thereof having no more than two amino acid changes in LCDR2 set forth in SEQ ID NO:44, and LCDR3 set forth in SEQ ID NO:45 or variants thereof having no more than two amino acid changes in LCDR3 set forth in SEQ ID NO:45.

[0027] (p) LCDR1 shown in SEQ ID NO:46 or a variant of LCDR1 shown in SEQ ID NO:46 having a change of not more than two amino acids, LCDR2 shown in SEQ ID NO:47 or a variant of LCDR2 shown in SEQ ID NO:47 having a change of not more than two amino acids, and LCDR3 shown in SEQ ID NO:48 or a variant of LCDR3 shown in SEQ ID NO:48 having a change of not more than two amino acids.

[0028] (q) LCDR1 set forth in SEQ ID NO:49 or variants thereof having no more than two amino acid changes in LCDR1 set forth in SEQ ID NO:49, LCDR2 set forth in SEQ ID NO:50 or variants thereof having no more than two amino acid changes in LCDR2 set forth in SEQ ID NO:50, and LCDR3 set forth in SEQ ID NO:51 or variants thereof having no more than two amino acid changes in LCDR3 set forth in SEQ ID NO:51.

[0029] (r) LCDR1 set forth in SEQ ID NO:49 or variants of LCDR1 set forth in SEQ ID NO:49 having not more than two amino acid changes, LCDR2 set forth in SEQ ID NO:52 or variants of LCDR2 set forth in SEQ ID NO:52 having not more than two amino acid changes, and LCDR3 set forth in SEQ ID NO:53 or variants of LCDR3 set forth in SEQ ID NO:53 having not more than two amino acid changes.

[0030] (s) LCDR1 set forth in SEQ ID NO:54 or variants of LCDR1 set forth in SEQ ID NO:54 having changes of not more than two amino acids, LCDR2 set forth in SEQ ID NO:35 or variants of LCDR2 set forth in SEQ ID NO:35 having changes of not more than two amino acids, and LCDR3 set forth in SEQ ID NO:55 or variants of LCDR3 set forth in SEQ ID NO:55 having changes of not more than two amino acids.

[0031] In some embodiments, the consensus light chain in the antibody library of the present invention comprises a light chain variable region sequence set forth in any of SEQ ID NOs: 56-74, or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the light chain variable region sequence.

[0032] In some embodiments, the heavy chain variable regions in the antibody libraries of the invention are encoded by naturally occurring heavy chain species genes in the human immunoglobulin locus, preferably by naturally occurring heavy chain genes IGHV1, IGHV3, and / or IGHV4 heavy chain genes in the human immunoglobulin locus.

[0033] In some embodiments, the heavy chain variable region in the antibody library of the present invention is encoded by a nucleotide sequence rearranged by an engineered technique, for example, the heavy chain variable region is encoded by a nucleotide sequence rearranged with any naturally occurring HCDR3 and any naturally occurring HCDR1 and HCDR2, thereby increasing the capacity and diversity of the antibody library.

[0034] In some embodiments, an antibody library of the invention comprises at least 1 x 10 10 -1×10 12 The antibody library contains 100,000 antibodies, preferably 90% of which are functional, and more preferably the antibodies in the antibody library bind to the target antigen with a Kd value of 100 nM or less.

[0035] In some embodiments, the antibody library of the invention is a Fab antibody library, an scFv antibody library, an scFab antibody library, or a full-length antibody library.

[0036] In a second aspect, the present invention provides a method for preparing an antibody library according to the first aspect of the invention.

[0037] In some embodiments, the method for preparing an antibody library according to the first aspect of the present invention comprises the steps of:

[0038] (a) Construct a gene library of human natural antibodies.

[0039] (b) Amplifying and recovering heavy chain nucleotide sequences from the human antibody gene library constructed in step (a).

[0040] (c) obtaining a nucleotide sequence encoding the common light chain according to the first aspect of the invention;

[0041] (d) Ligating the heavy chain nucleotide sequence obtained in step (b) and the common light chain nucleotide sequence obtained in step (c) into an expression vector (e.g., a phage vector, a yeast vector, a mammalian cell vector) and expressing them.

[0042] For example, they can be expressed in prokaryotic cells such as E. coli or eukaryotic cells such as yeast or mammalian cells.

[0043] In some embodiments, the method for preparing an antibody library according to the first aspect of the present invention comprises the steps of: 12 Contains various types of antibodies.

[0044] (a) Construct a gene library of human natural antibodies.

[0045] (b) Amplifying "CDR1+CDR2" and "CDR3" of the heavy chain gene sequence in the human antibody gene library constructed in step (a). For example, amplifying "CDR1+CDR2" of the heavy chain gene sequence using primers SEQ ID NO:79-SEQ ID NO:81, and amplifying "CDR3" of the heavy chain gene sequence using primers SEQ ID NO:82-SEQ ID NO:84.

[0046] (c) The "CDR1+CDR2" and "CDR3" amplified in step (b) are combined using fusion PCR to obtain a PCR product.

[0047] (d) The artificial heavy chain nucleotide sequence obtained in step (c) is amplified and recovered.

[0048] (e) obtaining a nucleotide sequence encoding the common light chain according to the first aspect of the present invention.

[0049] (f) The artificial heavy chain nucleotide sequence obtained in step (d) and the common light chain nucleotide sequence obtained in step (e) are ligated into an expression vector (e.g., a phage vector, a yeast vector, or a mammalian cell vector) and expressed.

[0050] For example, they can be expressed in prokaryotic cells such as E. coli or eukaryotic cells such as yeast or mammalian cells.

[0051] In a third aspect, the present invention provides the use of an antibody library of the present invention having heavy chain diversity and comprising a common light chain for the preparation of bispecific antibodies having a common light chain.

[0052] In a fourth aspect, the present invention provides bispecific antibodies obtained from an antibody library containing a common light chain with heavy chain diversity of the present invention. For example, using phage display technology, the Fab antibody library of the present invention is displayed as antibodies on the surface of phage, and this Fab antibody library with a common light chain is screened using any two target antigens. The resulting candidate antibodies have a common light chain sequence but different heavy chain sequences. The resulting candidate molecules can be used for internal and external drug screening and evaluation of formulation suitability, and then directly used to construct bispecific antibodies with a common light chain structure. Therefore, the common light chain designed in the present invention and the library constructed based on it can function as a screening platform for bispecific antibodies with a common light chain structure, enabling continuous selection of bispecific antibody candidate molecules based on various target combinations.

[0053] In some embodiments, a bispecific antibody of the invention comprises a first antigen-binding site and a second antigen-binding site, wherein the first antigen-binding site and the second antigen-binding site share a common light chain, and the common light chain is encoded by an IGKV3 or IGKV1 light chain gene, preferably an IGKV3-20, IGKV3-11, IGKV1-39, IGKV1-5, or IGKV1-33 light chain gene, and more preferably an IGKV3-20 or IGKV1-39 light chain gene.

[0054] For example, the common light chain in said bispecific antibody comprises a CDR selected from:

[0055] (a) LCDR1 shown in SEQ ID NO:1 or variants thereof having no more than two amino acid changes in LCDR1 shown in SEQ ID NO:1, LCDR2 shown in SEQ ID NO:2 or variants thereof having no more than two amino acid changes in LCDR2 shown in SEQ ID NO:2, and LCDR3 shown in SEQ ID NO:3 or variants thereof having no more than two amino acid changes in LCDR3 shown in SEQ ID NO:3.

[0056] (b) LCDR1 shown in SEQ ID NO:4 or variants thereof having not more than two amino acid changes in LCDR1 shown in SEQ ID NO:4, LCDR2 shown in SEQ ID NO:5 or variants thereof having not more than two amino acid changes in LCDR2 shown in SEQ ID NO:5, and LCDR shown in SEQ ID NO:6 or variants thereof having not more than two amino acid changes in LCDR3 shown in SEQ ID NO:6.

[0057] (c) LCDR1 shown in SEQ ID NO:7 or a variant of LCDR1 shown in SEQ ID NO:7 having a change of not more than two amino acids, LCDR2 shown in SEQ ID NO:8 or a variant of LCDR2 shown in SEQ ID NO:8 having a change of not more than two amino acids, and LCDR3 shown in SEQ ID NO:9 or a variant of LCDR3 shown in SEQ ID NO:9 having a change of not more than two amino acids.

[0058] (d) LCDR1 set forth in SEQ ID NO:10 or variants thereof having no more than two amino acid changes in LCDR1 set forth in SEQ ID NO:10, LCDR2 set forth in SEQ ID NO:11 or variants thereof having no more than two amino acid changes in LCDR2 set forth in SEQ ID NO:11, and LCDR3 set forth in SEQ ID NO:12 or variants thereof having no more than two amino acid changes in LCDR3 set forth in SEQ ID NO:12.

[0059] (e) LCDR1 set forth in SEQ ID NO:13 or variants of LCDR1 set forth in SEQ ID NO:13 having changes of not more than two amino acids, LCDR2 set forth in SEQ ID NO:14 or variants of LCDR2 set forth in SEQ ID NO:14 having changes of not more than two amino acids, and LCDR3 set forth in SEQ ID NO:15 or variants of LCDR3 set forth in SEQ ID NO:15 having changes of not more than two amino acids.

[0060] (f) LCDR1 set forth in SEQ ID NO:16 or variants of LCDR1 set forth in SEQ ID NO:16 having changes of not more than two amino acids, LCDR2 set forth in SEQ ID NO:17 or variants of LCDR2 set forth in SEQ ID NO:17 having changes of not more than two amino acids, and LCDR3 set forth in SEQ ID NO:18 or variants of LCDR3 set forth in SEQ ID NO:18 having changes of not more than two amino acids.

[0061] (g) LCDR1 set forth in SEQ ID NO:19 or variants thereof having no more than two amino acid changes in LCDR1 set forth in SEQ ID NO:19, LCDR2 set forth in SEQ ID NO:20 or variants thereof having no more than two amino acid changes in LCDR2 set forth in SEQ ID NO:20, and LCDR3 set forth in SEQ ID NO:21 or variants thereof having no more than two amino acid changes in LCDR3 set forth in SEQ ID NO:21.

[0062] (h) LCDR1 set forth in SEQ ID NO:22 or variants of LCDR1 set forth in SEQ ID NO:22 having changes of not more than two amino acids, LCDR2 set forth in SEQ ID NO:23 or variants of LCDR2 set forth in SEQ ID NO:23 having changes of not more than two amino acids, and LCDR3 set forth in SEQ ID NO:24 or variants of LCDR3 set forth in SEQ ID NO:24 having changes of not more than two amino acids.

[0063] (i) LCDR1 set forth in SEQ ID NO:25 or variants thereof having no more than two amino acid changes in LCDR1 set forth in SEQ ID NO:25, LCDR2 set forth in SEQ ID NO:26 or variants thereof having no more than two amino acid changes in LCDR2 set forth in SEQ ID NO:26, and LCDR3 set forth in SEQ ID NO:27 or variants thereof having no more than two amino acid changes in LCDR3 set forth in SEQ ID NO:27.

[0064] (j) LCDR1 set forth in SEQ ID NO:28 or variants of LCDR1 set forth in SEQ ID NO:28 having changes of not more than two amino acids, LCDR2 set forth in SEQ ID NO:29 or variants of LCDR2 set forth in SEQ ID NO:29 having changes of not more than two amino acids, and LCDR3 set forth in SEQ ID NO:30 or variants of LCDR3 set forth in SEQ ID NO:30 having changes of not more than two amino acids.

[0065] (k) LCDR1 set forth in SEQ ID NO:31 or variants thereof having no more than two amino acid changes in LCDR1 set forth in SEQ ID NO:31, LCDR2 set forth in SEQ ID NO:32 or variants thereof having no more than two amino acid changes in LCDR2 set forth in SEQ ID NO:32, and LCDR3 set forth in SEQ ID NO:33 or variants thereof having no more than two amino acid changes in LCDR3 set forth in SEQ ID NO:33.

[0066] (l) LCDR1 set forth in SEQ ID NO:34 or variants of LCDR1 set forth in SEQ ID NO:34 having changes of not more than two amino acids, LCDR2 set forth in SEQ ID NO:35 or variants of LCDR2 set forth in SEQ ID NO:35 having changes of not more than two amino acids, and LCDR3 set forth in SEQ ID NO:36 or variants of LCDR3 set forth in SEQ ID NO:36 having changes of not more than two amino acids.

[0067] (m) LCDR1 set forth in SEQ ID NO:37 or variants of LCDR1 set forth in SEQ ID NO:37 having not more than two amino acid changes, LCDR2 set forth in SEQ ID NO:38 or variants of LCDR2 set forth in SEQ ID NO:38 having not more than two amino acid changes, and LCDR3 set forth in SEQ ID NO:39 or variants of LCDR3 set forth in SEQ ID NO:39 having not more than two amino acid changes.

[0068] (n) LCDR1 set forth in SEQ ID NO:40 or variants of LCDR1 set forth in SEQ ID NO:40 having not more than two amino acid changes, LCDR2 set forth in SEQ ID NO:41 or variants of LCDR2 set forth in SEQ ID NO:41 having not more than two amino acid changes, and LCDR3 set forth in SEQ ID NO:42 or variants of LCDR3 set forth in SEQ ID NO:42 having not more than two amino acid changes.

[0069] (o) LCDR1 set forth in SEQ ID NO:43 or variants thereof having no more than two amino acid changes in LCDR1 set forth in SEQ ID NO:43, LCDR2 set forth in SEQ ID NO:44 or variants thereof having no more than two amino acid changes in LCDR2 set forth in SEQ ID NO:44, and LCDR3 set forth in SEQ ID NO:45 or variants thereof having no more than two amino acid changes in LCDR3 set forth in SEQ ID NO:45.

[0070] (p) LCDR1 shown in SEQ ID NO:46 or a variant of LCDR1 shown in SEQ ID NO:46 having a change of not more than two amino acids, LCDR2 shown in SEQ ID NO:47 or a variant of LCDR2 shown in SEQ ID NO:47 having a change of not more than two amino acids, and LCDR3 shown in SEQ ID NO:48 or a variant of LCDR3 shown in SEQ ID NO:48 having a change of not more than two amino acids.

[0071] (q) LCDR1 set forth in SEQ ID NO:49 or variants thereof having no more than two amino acid changes in LCDR1 set forth in SEQ ID NO:49, LCDR2 set forth in SEQ ID NO:50 or variants thereof having no more than two amino acid changes in LCDR2 set forth in SEQ ID NO:50, and LCDR3 set forth in SEQ ID NO:51 or variants thereof having no more than two amino acid changes in LCDR3 set forth in SEQ ID NO:51.

[0072] (r) LCDR1 set forth in SEQ ID NO:49 or variants of LCDR1 set forth in SEQ ID NO:49 having not more than two amino acid changes, LCDR2 set forth in SEQ ID NO:52 or variants of LCDR2 set forth in SEQ ID NO:52 having not more than two amino acid changes, and LCDR3 set forth in SEQ ID NO:53 or variants of LCDR3 set forth in SEQ ID NO:53 having not more than two amino acid changes.

[0073] (s) LCDR1 set forth in SEQ ID NO:54 or variants of LCDR1 set forth in SEQ ID NO:54 having changes of not more than two amino acids, LCDR2 set forth in SEQ ID NO:35 or variants of LCDR2 set forth in SEQ ID NO:35 having changes of not more than two amino acids, and LCDR3 set forth in SEQ ID NO:55 or variants of LCDR3 set forth in SEQ ID NO:55 having changes of not more than two amino acids.

[0074] In some embodiments, the consensus light chain in the antibody library of the present invention comprises a light chain variable region sequence set forth in any of SEQ ID NOs: 56-74, or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the light chain variable region sequence.

[0075] In some embodiments, the bispecific antibody of the present invention further comprises an Fc region consisting of a first and a second subunit, wherein the first antigen-binding portion is formed by fusing the N-terminus of the first Fc subunit to the C-terminus of the Fab heavy chain, and the second antigen-binding portion is formed by fusing the N-terminus of the second Fc subunit to the C-terminus of the Fab heavy chain. For example, the Fc region is an Fc region of an immunoglobulin molecule, and in particular, an Fc region of an IgG-based immunoglobulin is preferably an IgG1 or IgG4 Fc region, more preferably human IgG1 or IgG4. The Fc region.

[0076] In some embodiments, in the bispecific antibody of the present invention, amino acid residues in the CH3 domain of a first subunit of the Fc region are replaced with amino acid residues with larger side chain volumes, thereby forming a protrusion in the CH3 domain of the first subunit, which is positioned in a cavity in the CH3 domain of the second subunit. Furthermore, amino acid residues in the CH3 domain of a second subunit of the Fc region are replaced with amino acid residues with smaller side chain volumes, thereby forming a cavity in the CH3 domain of the second subunit. The protrusion in the CH3 domain of the first subunit is positioned in the cavity in the CH3 domain of the second subunit, thereby forming a stable "knob-in-hole" association between the heavy chains of the bispecific antibody.

[0077] The present invention also relates to isolated polynucleotides encoding the bispecific antibodies of the present invention, vectors (particularly expression vectors) comprising the isolated polynucleotides, host cells comprising the isolated polynucleotides or the vectors, and methods for producing the bispecific antibodies.

[0078] BRIEF DESCRIPTION OF THE DRAWINGS The following detailed description will become more clearly understood when taken in conjunction with the accompanying drawings, in which: Figure 1 is a block diagram of a semiconductor device according to an embodiment of the present invention; Figure 2 is a block diagram of a semiconductor device according to an embodiment of the present invention; Figure 3 is a block diagram of a semiconductor device according to an embodiment of the present invention; [Brief explanation of the drawings]

[0079] [Figure 1]Figure 1A shows the amino acid length distribution of the light chain species IGKV3-20, with the vertical axis representing the number of amino acids and the horizontal axis representing the number of amino acids. Figure 1B shows the amino acid length distribution of the light chain species IGKV3-11. Figure 1C shows the amino acid length distribution of the light chain species IGKV1-39. Figure 1D shows the amino acid length distribution of the light chain species IGKV1-5. Figure 1E shows the amino acid length distribution of the light chain species IGKV1-33. Figure 1F shows the amino acid length distribution of the light chain species IGKV3-16. [Figure 2] Figure 2 shows the expression level of the library in prokaryotic cells for phage Fabs with 19 common light chains in embodiment 2.1. The horizontal axis shows the names of antibodies derived from the common light chains, and the vertical axis shows the expression level of phage Fabs with the common light chains in prokaryotic cells. [Figure 3] Figure 3A shows the expression level in prokaryotic cells of a phage Fab display library with three common light chains, the light chain species IGKV3-20. The horizontal axis shows the name of the antibody from which the common light chains were derived, and the vertical axis shows the expression level in prokaryotic cells of the phage Fab display library with the common light chains. Figure 3B shows the number of clones expressed in prokaryotic cells at different expression levels for a phage Fab display library with three common light chains, the light chain species IGKV3-20. The horizontal axis shows the range of expression level, and the vertical axis shows the number of clones. [Figure 4] Figure 4A shows the expression level in prokaryotic cells of a phage Fab display library with two common light chains, the light chain species IGKV3-11. The horizontal axis shows the name of the antibody from which the common light chains were derived, and the vertical axis shows the expression level in prokaryotic cells of the phage Fab display library with the common light chains. Figure 4B shows the number of clones expressed in prokaryotic cells at different expression levels for a phage Fab display library with two common light chains, the light chain species IGKV3-11. The horizontal axis shows the range of expression level, and the vertical axis shows the number of clones. [Figure 5]Figure 5A shows the expression levels in prokaryotic cells of a phage Fab display library with four common light chains belonging to the light chain species IGKV1-39. The horizontal axis shows the names of the antibodies from which the common light chains are derived, and the vertical axis shows the expression levels in prokaryotic cells of the phage Fab display library with the common light chains. Figure 5B shows the number of clones expressed in prokaryotic cells at different expression levels for a phage Fab display library with four common light chains belonging to the light chain species IGKV1-39. The horizontal axis shows the range of expression levels, and the vertical axis shows the number of clones. [Figure 6] Figure 6A shows the expression level in prokaryotic cells of a phage Fab display library with one common light chain, the light chain species IGKV1-5. The horizontal axis shows the name of the antibody from which the common light chain was derived, and the vertical axis shows the expression level in prokaryotic cells of the phage Fab display library with the common light chain. Figure 6B shows the number of clones expressed in prokaryotic cells at different expression levels for a phage Fab display library with one common light chain, the light chain species IGKV1-5. The horizontal axis shows the expression level range, and the vertical axis shows the number of clones. [Figure 7] Figure 7A shows the expression level in prokaryotic cells of a phage Fab display library with four common light chains, light chain species IGKV1-33. The horizontal axis shows the name of the antibody from which the common light chains are derived, and the vertical axis shows the expression level in prokaryotic cells of the phage Fab display library with the common light chains. Figure 7B shows the number of clones expressed in prokaryotic cells at different expression levels for a phage Fab display library with four common light chains, light chain species IGKV1-33. The horizontal axis shows the range of expression level, and the vertical axis shows the number of clones. [Figure 8] Figure 8A shows the expression levels in prokaryotic cells of a phage Fab display library with five common light chains of other light chain species. The horizontal axis shows the names of the antibodies from which the common light chains are derived, and the vertical axis shows the expression levels in prokaryotic cells of the phage Fab display library with the common light chains. Figure 8B shows the number of clones expressed in prokaryotic cells at different expression levels for a phage Fab display library with five common light chains of other light chain species. The horizontal axis shows the range of expression levels, and the vertical axis shows the number of clones. [Figure 9]Figure 9A shows the expression levels in prokaryotic cells of a phage Fab display library with five common light chains from different light chain species. The horizontal axis shows the names of the antibodies from which the common light chains were derived, and the vertical axis shows the expression levels in prokaryotic cells of the phage Fab display library with the common light chains. Figure 9B shows the number of clones expressed in prokaryotic cells at different expression levels for a phage Fab display library with five common light chains from different light chain species. The horizontal axis shows the range of expression levels, and the vertical axis shows the number of clones. [Figure 10] Figures 10A-10B show the expression levels in eukaryotic cells of antibodies obtained by combining heavy chains with the heavy chain variable regions of the clone numbers listed in Table 4 and a common light chain. In Figure 10A, the horizontal axis shows the name of the antibody from which the common light chain is derived, and the vertical axis shows the expression level of each antibody in eukaryotic cells. [Figure 11A] Figure 11A shows the expression levels in eukaryotic cells of antibodies that combine a light chain derived from Eculizumab with a heavy chain of the heavy chain variable region subtype of the clone number shown in Table 4. The horizontal axis shows the gene lineage of the heavy chain variable region corresponding to the clone number in Table 44, and the vertical axis shows the expression levels in eukaryotic cells of each antibody that shares the common light chain derived from Eculizumab. [Figure 11B] Figure 11B shows the expression levels in eukaryotic cells of antibodies combined with the light chain derived from sacituzumab and the heavy chain variable region subtypes of the clone numbers shown in Table 4. The horizontal axis shows the gene lineage of the heavy chain variable region corresponding to the clone number in Table 4, and the vertical axis shows the expression levels in eukaryotic cells of each antibody that shares the common light chain derived from sacituzumab. [Figure 11C] Figure 11C shows the expression levels in eukaryotic cells of antibodies combining the light chain derived from HNF-018 with the heavy chain variable region subtypes of the clone numbers shown in Table 4. The horizontal axis shows the gene lineage of the heavy chain variable region corresponding to the clone number in Table 4, and the vertical axis shows the expression levels in eukaryotic cells of each antibody with the common light chain derived from HNF-018. [Figure 11D]Figure 11D shows the expression levels in eukaryotic cells of antibodies combining the light chain derived from robatumumab with the heavy chain variable region subtypes of the clone numbers shown in Table 4. The horizontal axis shows the gene lineage of the heavy chain variable region corresponding to the clone number in Table 4, and the vertical axis shows the expression levels in eukaryotic cells of each antibody that shares the common light chain derived from robatumumab. [Figure 11E] Figure 11E shows the expression levels in eukaryotic cells of antibodies combined with the light chain derived from olokizumab and the heavy chain variable region subtypes of the clone numbers shown in Table 4. The horizontal axis shows the gene lineage of the heavy chain variable region corresponding to the clone number in Table 4, and the vertical axis shows the expression level in eukaryotic cells of each antibody that shares the common light chain derived from olokizumab. [Figure 11F] Figure 11F shows the expression levels in eukaryotic cells of antibodies combining the light chain derived from Fasinumab with the heavy chain variable region subtypes of the clone numbers shown in Table 4. The horizontal axis shows the gene lineage of the heavy chain variable region corresponding to the clone number in Table 4, and the vertical axis shows the expression level in eukaryotic cells of each antibody that shares the common light chain derived from Fasinumab. [Figure 11G] Figure 11G shows the expression levels in eukaryotic cells of antibodies combining the light chain derived from Matuzumab with the heavy chain variable region subtypes of the clone numbers shown in Table 4. The horizontal axis shows the gene lineage of the heavy chain variable region corresponding to the clone number in Table 4, and the vertical axis shows the expression level in eukaryotic cells of each antibody that shares the common light chain derived from Matuzumab. [Figure 11H] Figure 11H shows the expression levels in eukaryotic cells of antibodies combining VK1-278-derived light chains with heavy chain variable region subtypes of the clone numbers shown in Table 4. The horizontal axis shows the gene lineage of the heavy chain variable region corresponding to the clone number in Table 4, and the vertical axis shows the expression levels in eukaryotic cells of each antibody with the common light chain derived from VK1-278. [Figure 11I]Figure 11I shows the expression levels in eukaryotic cells of antibodies combining light chains derived from VK1-203 with heavy chain variable region subtypes of the clone numbers shown in Table 4. The horizontal axis shows the gene lineage of the heavy chain variable region corresponding to the clone number in Table 4, and the vertical axis shows the expression levels in eukaryotic cells of each antibody with the common light chain derived from VK1-203. [Figure 11J] Figure 11J shows the expression levels in eukaryotic cells of antibodies combining Zalutumumab-derived light chains with the heavy chain variable region subtypes of the clone numbers shown in Table 4. The horizontal axis shows the gene lineage of the heavy chain variable region corresponding to the clone number in Table 4, and the vertical axis shows the expression levels in eukaryotic cells of each antibody that shares the Zalutumumab-derived common light chain. [Figure 11K] Figure 11K shows the expression levels in eukaryotic cells of antibodies that combine the light chain derived from Fremanezumab with the heavy chain variable region subtypes of the clone numbers shown in Table 4. The horizontal axis shows the gene lineage of the heavy chain variable region corresponding to the clone number in Table 4, and the vertical axis shows the expression level in eukaryotic cells of each antibody that shares the common light chain derived from Fremanezumab. [Figure 12] Based on the results of Figures 11A to 11K, Figure 12 shows the expression levels in eukaryotic cells of antibodies that combine a heavy chain with a common light chain and a heavy chain variable region corresponding to the clone numbers listed in part of Table 4. The horizontal axis shows the name of the antibody derived from the common light chain, and the vertical axis shows the expression level in eukaryotic cells of each antibody with that common light chain. [Figure 13A] Figure 13A is a pie chart showing the distribution of heavy chain gene lineages in a phage display Fab library (CLC-09) prepared by combining the common light chain derived from HNF-018 with the HCDR3 heavy chain library obtained in embodiment 3.1. [Figure 13B] Figure 13B is a bar graph showing the distribution of heavy chain gene lineages in a phage display Fab library (CLC-09) prepared by combining the common light chain derived from HNF-018 with the HCDR3 heavy chain library obtained in embodiment 3.1. [Figure 13C]Figure 13C is a pie chart showing the distribution of heavy chain gene families in a phage display Fab library (CLC-24) prepared by combining the common light chain derived from Eculizumab with the HCDR3 heavy chain library obtained in embodiment 3.1. [Figure 13D] Figure 13D is a bar graph showing the distribution of heavy chain gene lineages in a phage display Fab library (CLC-24) prepared by combining the common light chain derived from Eculizumab with the HCDR3 heavy chain library obtained in embodiment 3.1. [Figure 14A-C] Figures 14A to 14C show the distribution of amino acid lengths of the heavy chain CDR regions in a phage display Fab library (CLC-09) constructed by combining the common light chain derived from HNF-018 with the recombinant HCDR3 heavy chain library obtained in embodiment 3.1. The vertical axis indicates the percentage of amino acid length of each CDR in the total, and Figures 14A, 14B, and 14C correspond to HCDR1, HCDR2, and HCDR3, respectively. [Figure 14D-F] Figures 14D to 14F show the distribution of amino acid lengths of the heavy chain CDR regions in a phage display Fab library (CLC-24) constructed by combining the common light chain derived from Eculizumab with the HCDR3 heavy chain library obtained in embodiment 3.1. The horizontal axis shows the amino acid length, and the vertical axis shows the proportion of the amino acid length of each CDR in the total. Figures 14D, 14E, and 14F correspond to HCDR1, HCDR2, and HCDR3, respectively. [Figure 15] Figure 15A shows the prokaryotic expression efficiency of antibodies from two common light chain antibody libraries. Figure 15B shows the phage display efficiency of antibodies from two common light chain antibody libraries. [Figure 16] Figure 16 shows the isoelectric point (pI) distribution of anti-TROP2 antibody molecules derived from the recombinant phage display library (hRAL) and the common light chain phage display library (CLC). [Figure 17]Figure 17 shows the EC50 distribution of antigen protein binding for anti-TROP2 antibody molecules derived from the hRAL and CLC libraries based on ELISA testing. [Figure 18] Figure 18 shows the expression levels of 770 common light chain antibodies and 65 commercially available or developmental monoclonal antibodies. [Figure 19] Figure 19 shows 30 common light chain antibodies and 24 commercially available or developmental monoclonal antibodies, Tm1.

[0080] Detailed Description of the Invention Before describing the present invention in detail, it should be understood that the present invention is not limited to the particular methods and experimental conditions described herein, as these methods and conditions may vary, and the terminology used herein is used only to illustrate particular embodiments and is not intended to be limiting.

[0081] I. Definition Unless otherwise defined, all technical and scientific terms used herein have the meaning commonly understood by one of ordinary skill in the art. For purposes of the present invention, the following terms are defined below.

[0082] The term "about," when used in conjunction with a numerical value, is meant to encompass a range up to a lower limit of 10% less than the specified numerical value and up to an upper limit of 10% greater than the specified numerical value.

[0083] The term "and / or," when used in conjunction with two or more alternatives, should be understood to mean any one of the alternatives, or any two or more of the alternatives.

[0084] As used herein, the term "comprise" or "comprises" means including the recited elements, integers, or steps, but does not exclude any other elements, integers, or steps. When the term "comprise" or "comprises" is used herein, unless otherwise specified, it also encompasses embodiments consisting of the recited elements, integers, or steps. For example, when referring to an antibody variable region "comprising" a particular sequence, it also covers an antibody variable region consisting of that particular sequence.

[0085] The terms "antibody library" or "antibody library" are used interchangeably herein and refer to a collection of a large number of antibodies.

[0086] The term "antibody display library" refers to a platform that expresses a large number of antibodies on a cell surface or a cell-free surface. The antibody expression platform is applied to screening for antibodies against target antigens. Antibody display libraries include, but are not limited to, phage display libraries and yeast display libraries.

[0087] The terms "synthetic antibody library," "synthetic antibody library," or "synthetic library" are used interchangeably herein to refer to a collection of synthetically designed VH and / or VL antibody sequences.

[0088] The terms "variable region domain", "variable region", "variable domain", "VH / VL pairing", "VH / VL", "Fab section", "Fab arm", "Fab" or "arm" are used interchangeably herein.

[0089] In a bispecific antibody, the two arms contain a "common light chain" meaning that the light chains of the two arms of the antibody are homologous or have some amino acid sequence differences but retain the antigen-binding specificity. For example, one skilled in the art can prepare or discover a light chain that is not homologous in sequence but is still functionally equivalent by introducing conservative amino acid changes within the definition of a common light chain described herein. Such conservative amino acid changes refer to amino acid changes in a region that does not affect, or only partially affects, the antigen-antibody binding specificity when paired with a heavy chain.

[0090] The term "antibody" is used herein in the broadest sense and includes, but is not limited to, monoclonal antibodies, polyclonal antibodies, and multispecific antibodies (e.g., bispecific antibodies), as long as they exhibit the desired antigen-binding activity. Antibodies can be complete antibodies (e.g., having two full-length light chains and two full-length heavy chains) of any type and subtype (e.g., IgM, IgD, IgG1, IgG2, IgG3, IgG4, IgE, IgA1, and IgA2). A complete antibody monomer is a four-chain molecule formed by disulfide-linking two full-length light chains and two full-length heavy chains, also known as an Ig molecule monomer. The antibody monomer is the basic structure that makes up an antibody.

[0091] "Epitope" or "antigenic determinant" refers to the region on an antigen that interacts with a specific antigen-binding site, called a complementarity-determining region (paratope), located within the variable region of an antibody molecule. A single antigen can have more than one epitope. Therefore, different antibodies can bind to different regions on the antigen and have different biological effects. Epitopes can be formed by contiguous amino acids or non-contiguous amino acids that are spatially close due to the three-dimensional structure of a protein. Epitopes consisting of contiguous amino acids are generally retained after treatment with denaturing solvents, while epitopes that depend on three-dimensional structure are generally lost by treatment with denaturing solvents. Epitopes typically contain at least three, more commonly at least five, about nine, or about eight to ten amino acids in a unique spatial arrangement.

[0092] The term "antigen-binding fragment" refers to a portion or fragment of an intact antibody, containing fewer amino acid residues than the intact antibody, that retains the ability to bind to antigen or compete for antigen binding with the intact antibody (the intact antibody from which the antigen-binding fragment is derived). Antigen-binding fragments can be prepared by recombinant DNA techniques or by enzymatic or chemical cleavage of intact antibodies. Antigen-binding fragments include, but are not limited to, Fab, Fab', F(ab'), Fv, single-chain Fv (scFv), single-chain Fab, diabody, single-domain antibody (sdAb, nanobody), camelid Ig, Ig NAR, F(ab)' fragment, bi-scFv, (scFv)2, microbody, bifunctional antibody, trifunctional antibody, tetrafunctional antibody, and disulfide-stabilized Fv protein ("dsFv"). The term also includes genetically engineered variants, such as chimeric antibodies (e.g., humanized murine antibodies) and heteroconjugate antibodies (e.g., bispecific antibodies), as well as antigen-binding fragments thereof. For a more detailed description, see Pierce Catalog and Handbook, (1994-1995) (Pierce Chemical Co., Rockford, IL, and Kuby, Journal of Immunology, 3rd ed., W.H. Freeman & Co., New York, 1997).

[0093] The term "antigen-binding site" refers to the site, i.e., one or more amino acid residues, of an antibody that interacts with an antigen. For example, the antigen-binding site of an antibody contains amino acid residues from the "complementarity-determining regions" (CDRs). Native immunoglobulin molecules typically have two antigen-binding sites, while Fab molecules typically have a single antigen-binding site.

[0094] The terms "whole antibody," "full-length antibody," "complete antibody," and "intact antibody" are used interchangeably herein and refer to a glycoprotein composed of at least two heavy chains (HC) and two light chains (LC) interconnected by disulfide bonds. Each heavy chain consists of a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region. The heavy chain constant region consists of three domains: CH1, CH2, and CH3. Each light chain consists of a light chain variable region (abbreviated herein as VL) and a light chain constant region. The light chain constant region consists of a single CL domain. Mammalian heavy chains are classified as α, δ, ε, γ, or μ. Mammalian light chains are classified as λ or κ. Immunoglobulins containing α, δ, ε, γ, or μ heavy chains are classified as immunoglobulin (Ig) A, IgD, IgE, IgG, and IgM. Intact antibodies form a "Y"-shaped structure. The stem of the Y connects the second and third constant regions of two heavy chains (and the fourth constant region for IgE and IgM) with a disulfide bond (interchain) formed at the hinge. Heavy chains γ, α, and δ each have a constant region with three Ig domains (rows) arranged in tandem and a hinge region that provides flexibility. Heavy chains μ and ε each have a constant region consisting of four immunoglobulin domains. The second and third constant regions are called the "CH2 domain" and "CH3 domain," respectively. Each arm of the Y consists of the variable region and first constant region of a single heavy chain bound to the variable and constant region of a single light chain. Antigen binding is achieved by the variable regions of the light and heavy chains.

[0095] The light chain variable region and heavy chain variable region each contain a "framework" region interspersed with three highly variable regions (also called "complementarity-determining regions" or "CDRs"). "Complementarity-determining regions" or "CDR regions" or "CDRs" or "hypervariable regions" (used interchangeably herein with hypervariable region, "HVR") are regions within antibody variable domains that exhibit high sequence diversity, form structurally defined loops ("hypervariable loops"), and / or contain antigen contact residues ("antigen contact points"). CDRs are primarily responsible for binding to antigen epitopes. The CDRs of the heavy and light chains are typically referred to as CDR1, CDR2, and CDR3, starting from the N-terminus. The CDRs in the heavy chain variable domain are referred to as HCDR1, HCDR2, and HCDR3, while the CDRs in the light chain variable domain are referred to as LCDR1, LCDR2, and LCDR3. For a particular light or heavy chain variable region amino acid sequence, the precise amino acid sequence boundaries of each CDR can be determined using any one or a combination of a number of known CDR definition systems. (These include, for example, Chothia's (1989) Nature 342: 877-883; Al-Lazikani et al., "Standard conformations for the canonical structures of immunoglobulins", Journal of Molecular Biology, 273, 927-948 (1997)), which is based on the three-dimensional structure of antibodies and the topology of the CDR loops; Kabat's (1987) AbM (University of Bath), Contact (University College London), the international ImMunoGeneTics database (IMGT) (http: / / www.imgt.org / ), which is based on antibody sequence variability; and the North CDR definition, which is based on neighborhood-propagation clustering using multiple crystal structures.

[0096] However, it should be noted that the CDR boundaries of the same antibody variable region obtained based on different definition systems may differ. That is, the CDR sequences of the same antibody variable region will differ under different definition systems. For example, the residue ranges of the CDR regions using Kabat and Chothia numbering under different definition systems are as shown in Table A below.

[0097] [Table 1] Therefore, in the present invention, when an antibody is defined by a specific CDR sequence, the scope of the antibody is one in which the variable region sequence contains the specific CDR sequence described above, but where the claimed CDR boundaries differ from the specific CDR boundaries defined herein as a result of application of a different aspect (e.g., the rules or combination of a different designation system).

[0098] The boundaries of the CDRs of the antibodies of the present invention can be determined artificially based on any scheme known in the art or a combination thereof. Unless otherwise specified, the term "CDR" or "CD sequence" as used herein encompasses CDR sequences determined in any of the above ways.

[0099] The sequences of the framework (FR) of different light or heavy chains are aligned and conserved within a species (e.g., humans). The antibody framework (the combined framework of the component light and heavy chains) identifies and aligns the CDRs in three-dimensional space. CDRs are primarily responsible for binding to antigen epitopes. Antibodies with different specificities (i.e., combinations of binding sites for different antigens) have different CDRs. Although CDRs differ between antibodies, only a limited number of amino acid positions are directly involved in antigen binding. These positions within the CDRs are called specificity-determining residues (SDRs).

[0100] A "monoclonal antibody" is an antibody produced by a single clone of B lymphocytes or a cell into which the light and heavy chain genes of a single antibody have been transfected. Monoclonal antibodies are produced by methods known to those skilled in the art, for example, by hybridoma production by fusing myeloma cells with immune spleen cells. Monoclonal antibodies also include humanized monoclonal antibodies.

[0101] An "Fv" is the minimum antibody fragment containing a complete antigen-binding site. In one embodiment, a two-chain Fv consists of a heavy-chain variable domain and a light-chain variable domain that form a tight, non-covalent dimer. In a single-chain Fv (scFv) structure, the heavy-chain variable domain and the light-chain variable domain are covalently linked by a flexible polypeptide linker, and the light and heavy chains form a "dimeric" structure similar to that of a two-chain Fv. In this configuration, three hypervariable regions (HVRs) in each variable domain interact to form the antigen-binding site on the surface of the VH-VL dimer. The six HVRs together determine the antigen-binding specificity of the antibody. However, a single variable domain (or half of an Fv containing only three HVRs with antigen specificity) can still recognize and bind antigen, although with lower affinity than the complete binding site.

[0102] Fab fragments contain a heavy chain variable domain and a light chain variable variable domain, as well as the light chain constant domain and the first heavy chain constant domain (CH1). Fab' fragments differ from Fab fragments by the addition of a few residues to the carboxyl terminus of the heavy chain CH1 domain, including one or more cysteines from the antibody hinge region. Fab'-SH, as used herein, refers to Fab' in which the cysteine ​​residues in the constant domains bear free thiol groups. F(ab')2 antibody fragments were originally produced as dimers of Fab' fragments linked through the hinge cysteines. Other chemical linkages of antibody fragments are also known.

[0103] As used herein, the term "Fc region" or "Fc region" refers to the C-terminal region of an immunoglobulin heavy chain comprising at least a portion of the constant region. This term includes native-sequence Fc regions and variant Fc regions. While the limits of the Fc region of an IgG heavy chain may vary somewhat, the Fc region of a human IgG heavy chain is generally defined as extending from Cys226 or Pro230 to the carboxy terminus of the heavy chain, regardless of the presence or absence of the C-terminal lysine (Lys447) of the Fc region. Unless otherwise specified herein, the numbering of amino acid residues in the Fc region or constant region follows the EU numbering system described in Kabat et al., Sequences of Proteins of Immunological Interest, 5th ed., Public Health Service, National Institutes of Health, Bethesda, MD, 1991, also known as the EU index. As used herein, a "subunit" of an Fc region refers to either of the two polypeptides that form the dimeric Fc region, i.e., a polypeptide that contains an immunoglobulin heavy chain C-terminal constant region and is capable of stable self-association. For example, a subunit of an IgG Fc region contains the IgG CH2 and IgG CH3 constant domains.

[0104] The terms "specific binding" or "binding" as used with respect to an antigen and an antibody mean that the antibody forms a stable complex with the antigen under physiological conditions. Methods for determining whether an antibody specifically binds to an antigen are well known in the art, and include, for example, surface plasmon resonance assays, MSD assays (Estep, P. et al., High throughput solution-based measurement of antibody-antigen affinity and epitope binning, MAbs, 2013. 5(2): pp. 270-278), and ForteBio affinity assays (Estep, P. et al., High throughput solution-based measurement of antibody-antigen affinity and epitope binning. MAbs, 2013. 5(2): pp. 270-278).

[0105] "Affinity" refers to the strength of the sum total of all noncovalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen). Unless otherwise specified herein, "binding affinity" refers to the intrinsic binding affinity, which reflects a 1:1 interaction between members of a binding pair (e.g., an antibody and an antigen). The affinity of a molecule X for its partner Y is typically expressed in terms of the binding dissociation equilibrium constant (KD). Affinity can be measured by common methods known in the art, methods known in the art, and methods described herein.

[0106] As used herein, the term "variant" refers to a heavy or light chain variable region in which at least one, e.g., one, two, or three, amino acid(s) have been substituted, deleted, or added. Modified antigen-binding proteins comprising heavy or light chain variants substantially retain the biological properties of the antigen-binding protein prior to modification. In one embodiment, antigen-binding proteins comprising variant heavy or light chain variable region sequences retain 60%, 70%, 80%, 90%, or 100% of the biological properties of the antigen-binding protein prior to modification. It should be understood that modifications may be made alone or in combination with another heavy or light chain variable region. The antigen-binding proteins of the present disclosure comprise heavy chain variable region amino acid sequences that are 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homologous to the heavy chain variable region amino acid sequences described herein. The antigen binding proteins of the present disclosure comprise light chain variable region amino acid sequences that are 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homologous to the light chain variable region amino acid sequences described herein. The percentage of homology can apply to the entire heavy and / or light chain variable regions, or the percentage homology can be limited to the frame regions, where the sequences corresponding to the CDRs have 100% identity to the CDRs disclosed herein within the heavy and / or light chain variable regions. As used herein, the term "CDR variant" refers to a CDR in which at least one, e.g., one, two, or three, amino acid(s) have been substituted, deleted, or added, and the modified antigen binding protein containing the CDR variant substantially retains the biological characteristics of the antigen binding protein prior to modification. In one embodiment, the antigen binding protein comprising the variant CDR retains 60%, 70%, 80%, 90%, or 100% of the biological properties of the antigen binding protein prior to modification. It should be understood that each modifiable CDR may be modified alone or in combination with another CDR. In one embodiment, the modification is a substitution, particularly a conservative substitution.

[0107] As known in the art, "polynucleotide" or "nucleic acid," as used interchangeably herein, refer to a chain of nucleotides of any length, including DNA and RNA. The nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and / or their analogs, or any substrate that can be incorporated into a chain by DNA or RNA polymerase.

[0108] The sequence identity between sequences is calculated as follows:

[0109] To determine the percent identity of two amino acid sequences or two nucleic acid sequences, the sequences are aligned for optimal alignment purposes (e.g., gaps may be introduced into one or both of the first and second amino acid or nucleic acid sequences for optimal alignment, or non-homologous sequences may be removed for alignment purposes). In a preferred embodiment, the length of the reference sequence to be aligned for alignment purposes is at least 30%, preferably at least 40%, more preferably at least 50%, 60%, and even more preferably at least 70%, 80%, 90%, or 100%. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then aligned. If a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, the molecules are homologous at that position.

[0110] Sequence alignment and calculation of percent identity between two sequences can be accomplished using a mathematical algorithm. In a preferred embodiment, the Needlema and Wunsch ((1970) J. Mol. Biol. 48:444-453) algorithm in the GAP program integrated into the GCG software package (available at http: / / www.gcg.com) is used to determine percent identity between two amino acid sequences using a Blossum 62 matrix or a PAM250 matrix, a gap penalty of 16, 14, 12, 10, 8, 6, or 4, and a length penalty of 1, 2, 3, 4, 5, or 6. In yet another preferred embodiment, the percent identity between two nucleotide sequences is determined using a NWSgapdna.CMP matrix, a gap penalty of 40, 50, 60, 70, or 80, and a length penalty of 1, 2, 3, 4, 5, or 6. A particularly preferred parameter set (and the one that should be used unless otherwise specified) is one that uses a Blossum 62 scoring matrix, a gap open penalty of 12, a gap extension penalty of 4, and a frameshift gap penalty of 5.

[0111] The percent identity between two amino acid or nucleotide sequences can also be determined using the algorithm of E. Meyers and W. Miller ((1989) CABIOS, 4:11-17) as incorporated into the ALIGN program (version 2.0), using a PAM120 residue weight table, a gap length penalty of 12, and a gap penalty of 4.

[0112] Additionally, or alternatively, the nucleic acid and protein sequences described herein can be used as "query sequences" to perform searches against public databases, for example, to identify other family member sequences or related sequences.

[0113] As used herein, the terms "first and second" are used for convenience to distinguish when there are multiple moieties of each type, e.g., antigen-binding sites. These terms are not meant to confer a particular order or orientation to the bispecific antibody unless the context clearly dictates otherwise.

[0114] As used herein, "vector" refers to a construct capable of delivering one or more genes or sequences of interest to a host cell and, preferably, expressing said genes or sequences in the host cell. Examples of vectors include, but are not limited to, viral vectors, naked DNA or RNA expression vectors, plasmids, cosmids, phage vectors (for phage display systems), yeast vectors (for yeast display systems), DNA or RNA expression vectors associated with cationic condensing agents, DNA or RNA expression vectors encapsulated in liposomes, and certain eukaryotic cells (e.g., production cells).

[0115] The term "phagemid" refers to a DNA expression system that can replicate as a plasmid or be packaged as single-stranded DNA in phage virus particles. Bacteriophages (phagemids) are used to carry entire libraries of antibody genes. Phagemids require helper phage to provide additional proteins, which, after infection of bacteria, result in the production of phage virus particles displaying the recombinant protein encoded by the phagemid.

[0116] The term "phage" refers to a virus particle that infects and replicates in bacteria.

[0117] The term "helper phage" refers to a specific phage particle that provides all the proteins / materials necessary for the production of functional phage virus particles.

[0118] The term "panning" refers to an affinity selection technique that selects binders for a specific target antigen.

[0119] As used herein, the terms "host cell," "host cell line," and "host cell culture" are used interchangeably and refer to cells into which exogenous nucleic acid has been introduced, including the progeny of those cells. Host cells include "transformants" and "transformed cells," which include the primary transformed cell and its progeny, regardless of the number of passages. The progeny may not be completely identical in nucleic acid content to the parent cell and may contain mutations. Included herein are mutant progeny that have the same function or biological activity as the cells screened or selected for in the originally transformed cell.

[0120] II. Design of a common light chain in a multispecific antibody The production of multispecific antibodies (e.g., bispecific antibodies) faces the challenge that mismatches between heavy and light chains result in non-negligible numbers and quantities of unpaired and mispaired by-products.

[0121] To reduce light chain mismatches, the present invention designs a common light chain that can be used in multispecific antibodies (e.g., bispecific antibodies), whereby the same antibody light chain variable domain is used for multiple antigen-binding sites formed from antibody heavy chain variable domains and antibody light chain variable domains.

[0122] In this invention, we selected κ light chains with good pharmaceutical suitability from the antibodies in our human antibody gene library (also known as a recombinant phage display library) and the light chain gene lines of 161 types of antibody drugs that are already on the market or have completed phase III clinical trials.

[0123] For reference, a human antibody gene library was constructed according to the method described in embodiment 2.1 of Chinese Patent CN112250763B. The constructed library bacterial solution was applied to a medium and cultured. After that, several single colonies were collected and sequenced.

[0124] The light chains obtained by single colony sequencing were analyzed, and 1,590 light chain sequences were obtained. 83 duplicated sequences were removed and grouped by gene line. Six gene lines with relatively high abundance in nature (IGKV1-33, IGKV1-5, IGKV1-39, IGKV3-11, IGKV3-20, and IGKV3-15) were selected and their amino acid lengths were analyzed. As a result, it was found that light chains with an amino acid sequence length of 107 had the highest occupancy rate among light chains with gene lines IGKV1-33, IGKV1-5, IGKV1-39, and IGKV3-11, and light chains with an amino acid sequence length of 108 had the highest occupancy rate among light chains with gene lines IGKV3-20 and IGKV3-15 (Thomas Tiller et al., "A fully synthetic human Fab antibody library based on fixed VH / VL framework pairings with favorable biophysical properties", mAbs, 2013, 5(3): 1-26).

[0125] The light chains of IGKV1-33, IGKV1-5, IGKV1-39, and IGKV3-11 with 107 amino acid residues were compared separately with the light chains of IGKV3-20 and IGKV3-15 with 108 amino acid residues. Sequence conservation was compared without considering the CDR3 sequence, and 2-3 highly conserved sequences were selected for each gene line, resulting in a total of 12 light chain sequences.

[0126] Next, these 12 light chain sequences were aligned with 161 light chain sequences that were already commercially available or were being studied for antibody sequences. After removing duplicate sequences, the LCDR3s were compared and selected based on sequence diversity. Ultimately, light chain sequences belonging to 25 different gene lines were selected.

[0127] The light chain sequences of the selected 25 different gene lines were searched, and sequences already used as common light chains and sequences with high homology to existing common light chains were eliminated, ultimately yielding sequences belonging to 19 different gene lines.

[0128] The CDR regions of the light chain sequences of the 19 different gene lines obtained are shown in Table 1.

[0129] [Table 2] TIFF2026508171000003.tif237169 TIFF2026508171000004.tif120169 III. Generation of antibody libraries containing common light chains with heavy chain diversity In the present invention, two synthetic antibody libraries were constructed. The antibody libraries of the present invention contain at least 1 x 10 8 -1×10 12 It has different types of antibodies.

[0130] In some embodiments, the antibody library of the present invention comprises diversified heavy chain variable regions (VH) and common light chain variable regions (VL), wherein the heavy chain variable regions are encoded by natural heavy chain gene lines in the human immunoglobulin locus (e.g., IGHV1, IGHV3, and / or IGHV4 heavy chain gene lines), and the common light chain variable regions (VL) are derived from the light chain variable regions (VL) of antibodies selected from Table 1. This allows the antibody library to reflect the natural diversity of human antibody heavy chains, and the antibodies in the antibody library comprise natural antibody heavy chain variable regions (VH) and common light chain variable regions (VL). The antibody library comprises at least 1 x 10 8 -1×10 10 Preferably, at least 90% of the antibodies contained in the antibody library are functional, preferably binding to the target antigen with a Kd of 100 nM or less.

[0131] Exemplary steps for constructing the antibody library include:

[0132] (a) Construct a gene library of human natural antibodies.

[0133] (b) Amplifying and recovering heavy chain nucleotide sequences from the human antibody gene library constructed in step (a).

[0134] (c) Obtain a nucleotide sequence encoding the light chain of any of the antibodies listed in Table 1.

[0135] (d) Ligating the heavy chain nucleotide sequence obtained in step (b) and the light chain nucleotide sequence obtained in step (c) into an expression vector (e.g., a phage vector, a yeast vector, or a mammalian cell vector) and expressing them.

[0136] For example, they can be expressed in prokaryotic cells (such as E. coli) or eukaryotic cells (such as yeast and mammalian cells).

[0137] In some embodiments, the antibody library of the present invention comprises diversified heavy chain variable regions (VH) and a common light chain variable region (VL), wherein the heavy chain variable region is encoded by a nucleotide sequence recombined by an engineered technique, and the common light chain variable region is derived from the light chain variable region (VL) of an antibody selected from Table 1. For example, the heavy chain variable region is encoded by a nucleotide sequence recombining any natural HCDR3 with any natural HCDR1 and HCDR2. This makes the combinations of any natural HCDR3 with any natural HCDR1 and HCDR2 far more numerous than the combinations of HCDR1, HCDR2, and HCDR3 in natural antibodies, thereby improving the heavy chain diversity and library size in the antibody library. The antibody library contains at least 1 x 10 10 -1×10 12 Preferably, at least 90% of the antibodies in the antibody library are functional, preferably binding to the target antigen with a Kd of 100 nM or less.

[0138] Exemplary steps for constructing the antibody library include: (a) Construct a gene library of human natural antibodies.

[0139] (b) Amplify the "CDR1+CDR2" and "CDR3" heavy chain gene sequences in the human antibody gene library constructed in step (a). For example, use primers SEQ ID NO:79-SEQ ID NO:81 to amplify the "CDR1+CDR2" heavy chain gene sequence, and use primers SEQ ID NO:82-SEQ ID NO:84 to amplify the "CDR3" heavy chain gene sequence.

[0140] (c) The amplified "CDR1+CDR2" and "CDR3" from (b) are combined using fusion PCR to obtain a PCR product.

[0141] (d) Amplifying and recovering the artificial heavy chain nucleotide sequence from step (c).

[0142] (e) Obtain a nucleotide sequence encoding the consensus sequence of any of the antibodies listed in Table 1.

[0143] (f) The artificial heavy chain nucleotide sequence obtained in step (d) and the common light chain nucleotide sequence obtained in step (e) are ligated into an expression vector (e.g., a phage vector, a yeast vector, or a mammalian cell vector) and expressed.

[0144] For example, they can be expressed in prokaryotic cells (such as E. coli) or eukaryotic cells (such as yeast).

[0145] IV. Antibody Library Screening Any of the antibody libraries of the present invention can be used to screen for antibodies with binding specificity to an antigen of interest. Antibodies encoded by nucleic acids in the antibody libraries of the present invention can be expressed and displayed using, for example, a cell-free display system (e.g., a ribosome display system), a phage display system, a prokaryotic cell-based display system (e.g., a bacterial display system), or a eukaryotic cell-based display system (e.g., a yeast display system or a mammalian cell display system). In some embodiments, the antibody library is expressed and displayed on yeast cells. In another embodiment, the antibody library is expressed and displayed in phage particles (phage display).

[0146] In yet other embodiments, two or more display systems are used, for example, phage display followed by yeast display.

[0147] The antibody library of the present invention can be expressed / displayed in a suitable display system in any antibody form, such as complete antibodies (full-length antibodies), antigen-binding fragments thereof (such as Fab), or single-chain antibodies (scFv).

[0148] Phage display is a protein display technology using phages (e.g., phages f1, fd, and M13). In this display system, at least one antibody chain (e.g., heavy and / or light chain) is typically covalently linked to a phage coat protein (e.g., gene III protein, gene VIII protein, or major coat protein). Phage display is described, for example, in U.S. Patent No. 5,223,409.

[0149] In other embodiments, the antibody libraries of the present invention are expressed / displayed using eukaryotic expression / display systems (e.g., yeast or mammalian cell expression / display systems). Yeast display systems directly or indirectly link protein components (e.g., antibodies) to yeast cell wall proteins (e.g., Aga1p or Aga2p). In some cases, one chain of the antibody is covalently fused to the yeast cell wall protein and displayed directly. In other cases, the antibody and the yeast cell wall component are linked via an intermediate reagent. Yeast display is described, for example, in Boder et al., Arch Biochem Biophys 526(2):99-106, 2012.

[0150] To screen the antibody library of the present invention to isolate antibodies capable of binding to a target antigen, the antibody library can be contacted with the target antigen under suitable conditions that allow antibody-antigen binding.

[0151] Phage particles or host cells displaying antibodies that bind to the target antigen can be isolated, for example, using a support to which the target antigen has been immobilized. If desired, the nucleic acid encoding the displayed antibody can be amplified and identified. This screening process can be repeated multiple times, and multiple display systems can be used.

[0152] Screening of antibodies from the libraries described herein can be done by any suitable method. For example, binding activity can be assessed by standard immunoassays and / or affinity chromatography. The ability of candidate antibodies to bind to therapeutic targets can be assessed by, for example, BIACORE™, which uses surface plasmon resonance to measure the binding kinetics of antibodies to specific target antigens. TM These can be analyzed in vitro using instruments, or the antibody can be analyzed in vivo using one of a variety of animal models, and then tested in humans if necessary.

[0153] V. Bispecific Antibodies with a Common Light Chain By screening the antibody library of the present invention, bispecific antibodies having a common light chain can be prepared.

[0154] In some embodiments, the bispecific antibody comprises a first antigen-binding portion and a second antigen-binding portion, wherein the first antigen-binding portion and the second antigen-binding portion comprise a common light chain, and the common light chain is encoded by an IGKV3 or IGKV1 light chain gene. Preferably, the common light chain is encoded by an IGKV3-20, IGKV3-11, IGKV1-39, IGKV1-5, or IGKV1-33 light chain gene. More preferably, the common light chain is encoded by an IGKV3-20 or IGKV1-39 light chain gene. For example, the common light chain in the bispecific antibody is derived from the light chain of an antibody selected from Table 1.

[0155] In some embodiments, the bispecific antibody further comprises an Fc region consisting of a first and a second subunit, and the first antigen-binding site is formed by fusing the N-terminus of the first Fc subunit to the C-terminus of the Fab heavy chain, and the second antigen-binding site is formed by fusing the N-terminus of the second Fc subunit to the C-terminus of the Fab heavy chain. For example, the Fc region is an Fc region of an immunoglobulin molecule, particularly an Fc region of an IgG class immunoglobulin, preferably an IgG1 or IgG4 Fc region, and more preferably a human IgG1 or IgG4 Fc region.

[0156] In some preferred embodiments, the bispecific antibody has an Fc region in which amino acid residues in the CH3 domain of a first subunit are substituted with amino acid residues having a larger side chain volume, creating a protrusion in the CH3 domain of the first subunit and positioning it in the cavity of the CH3 domain of the second subunit, and an Fc region in which amino acid residues in the CH3 domain of a second subunit are substituted with amino acid residues having a smaller side chain volume, creating a cavity in the CH3 amino acid residue of the second subunit and positioning the protrusion of the CH3 of the first subunit in the cavity of the CH3 of the second subunit, thereby forming a stable "knob-into-hole" association between the heavy chains of the bispecific antibody.

[0157] To aid in understanding the present invention, the following embodiments are set forth, which should not be construed as, and are not intended to, limit the scope of the present invention in any way.

[0158] Embodiment The invention, as generally described herein, may be more readily understood by reference to the following embodiments. These embodiments are provided for illustrative purposes and are not intended to limit the scope of the invention. These embodiments are not intended to represent that the following experiments are all or the only experiments performed.

[0159] Embodiment 1: 1590 Light Chain Sequence Analysis Screening In this embodiment, we describe the specific process chosen to construct a trillion-unit consensus light chain phage display library.

[0160] First, a human antibody gene library (also known as a recombinant phage display library) was constructed. The specific construction method referred to embodiment 2.1 of Chinese Patent CN112250763B. The constructed library bacterial liquid was spread on a medium and cultured, after which several single colonies were collected and sequenced.

[0161] The light chains obtained by single-colony sequencing of the above library were analyzed, yielding 1,590 light chain sequences. After removing 83 duplicated sequences, the sequences were grouped by gene line. Six gene lines (IGKV1-33, IGKV1-5, IGKV1-39, IGKV3-11, IGKV3-20, and IGKV3-15) with relatively high natural abundance were selected and analyzed for amino acid length. The results are shown in Figures 1A-1F. Light chains with a length of 107 amino acids were most prevalent among light chains from gene lines IGKV1-33, IGKV1-5, IGKV1-39, and IGKV3-11. Light chains with a length of 108 amino acids were most prevalent among light chains from gene lines IGKV3-20 and IGKV3-15. Therefore, we performed alignment analysis on the light chains of IGKV1-33, IGKV1-5, IGKV1-39, and IGKV3-11 with 107 amino acid residues, and the light chains of IGKV3-20 and IGKV3-15 with 108 amino acid residues, and compared the sequence conservation without considering the CDR3 sequence. We then selected 2-3 highly conserved sequences for each gene line, resulting in a total of 12 light chain sequences.

[0162] Next, the 12 light chain sequences were aligned with those of commercially available or research antibody sequences, and after removing duplicate sequences, they were aligned with LCDR3 and selected based on sequence diversity, ultimately selecting light chain sequences belonging to 25 different gene lines.The light chain sequences of the selected 25 different gene lines were then searched, and sequences already used as common light chains and sequences with high homology to existing common light chains were eliminated, ultimately obtaining sequences belonging to 19 different gene lines.

[0163] The CDR regions of the light chain sequences of the 19 different gene lines obtained are shown in Table 1.

[0164] Embodiment 2: Construction and validation of a prototype common light chain library In this embodiment, the library size is approximately 1 × 10 based on the 19 light chain sequences selected in embodiment 1 and combined with heavy chain sequences from different gene lines. 8 A phage display Fab library of approximately cfu will be constructed, and the constructed phage display Fab library will be subjected to prokaryotic expression detection, phage display status analysis, eukaryotic expression detection, and preliminary drug suitability analysis.

[0165] 2.1 Construction of a consensus light chain phage display library The 19 light chain nucleotide sequences selected in Example 1 were gene-synthesized at Suzhou King Weizhi Biotechnology Co., Ltd. They were double-digested with Hind III restriction enzyme (Thermo Fisher, FD0505) and sgsI restriction enzyme (Thermo Fisher, FD1894) and ligated into a phage display vector. The constructed vectors containing the light chain target genes were transformed into competent E. coli SS320 (Lucigen, MC1061 F). After plating, single colonies were picked and sequenced. Correctly sequenced clones were inoculated into ampicillin-containing medium and cultured overnight at 37°C. Plasmids were then extracted using an endotoxin-free plasmid extraction kit (OMEGA, D6950-01).

[0166] At the same time, a human antibody gene library was constructed according to the method described in Example 2.1 of Chinese Patent CN112250763B. The heavy chain gene sequence from the constructed human antibody gene library was amplified using the plasmid from the human antibody gene library as a template with the upstream primer Middle-F: TAAGGCGCGCCTAACCATCTATTTC (SEQ ID NO: 77) and the downstream primer HC-CDR3-R: GAGGTGCTCTTGGAGGAGGGTGCCAGCG GGAAGACCGATGGGCCCTTGGTGCTAGCTGCTGAGACGGTGACCATTGTCCCTTGGCCCCAG (SEQ ID NO: 78). The amplified heavy chain gene sequence was recovered by double digestion with Eco91I restriction enzyme (Thermo Fisher, FD0394) and SfiI restriction enzyme (Thermo Fisher, FD1824).

[0167] The phage display plasmid containing the extracted light chain sequence was double digested with Eco91I restriction enzyme and SfiI restriction enzyme, and then recovered.

[0168] The recovered phage display plasmids containing the heavy and light chain gene sequences were double digested with Eco91I and SfiI restriction enzymes, and the resulting products were ligated. The ligated products were recovered using a recovery kit (Omega, catalog number: D6492-02).

[0169] Finally, the phage display plasmids carrying one human antibody heavy chain gene and one of the 19 light chain genes were transformed into competent E. coli SS320 (Lucigen, MC1061 F) using an electroporator (Bio-Rad, MicroPulser). The transformed E. coli SS320 cells were spread onto ampicillin-resistant 2-YT solid medium (1.5% tryptone, 1% yeast extract, 0.5% NaCl, and 1.5% agar, prepared at a weight / volume ratio of g / mL). After overnight incubation, 2YT medium was added to the 2-YT solid medium plate filled with the culture medium. The cultures grown on the ampicillin-resistant 2-YT solid medium were then scraped off with a spreader rod. An appropriate amount of 80% sterilized glycerol (final concentration 10-20%) was then added to construct a phage Fab display library carrying the 19 common light chains.

[0170] The resulting phage Fab display library, which contained 19 common light chains, was plated using serial dilution and the library size was determined (see Example 2.2 of Chinese Patent CN112250763B for library size calculation methods). At the same time, 26 to 32 single colonies from each library were picked and sequenced.

[0171] The library sizes, unique rates, and effective antibody rates of the phage Fab display libraries with 19 common light chains are shown in Table 2. Except for the phage Fab display library numbered CLC-2, the library sizes of the other phage Fab display libraries with 18 common light chains were all 10 8 That was all.

[0172] [Table 3] 2.2 Detection of Fab prokaryotic expression of consensus light chain phage display library In this embodiment, the prokaryotic expression and phage display of the phage Fab display library having 19 common light chains constructed in embodiment 2.1 are detected using an ELISA technique.

[0173] The bacterial suspension of the phage Fab display library containing 19 common light chains in Example 2.1 was diluted and spread onto medium to obtain single colonies. 42 or 32 bacterial clones were selected from each phage Fab display library and inoculated into ampicillin-resistant 2-YT medium for overnight culture (approximately 16 hours). A 96-well ELISA plate was coated with Anti-Fd (1 μg / mL, 30 μL / well, Bio-Rad, Part Number: STAR161) and incubated overnight at 4°C. The following day, the overnight cultured monoclonal bacterial suspension was centrifuged at 5000 rpm for 10 minutes, and the supernatant was collected. Simultaneously, the 96-well ELISA plate was washed three times with PBST and then blocked with 5% nonfat dry milk for 2 hours. After washing three times with PBST, the cells were incubated for 1 hour with either 3-fold serially diluted bacterial supernatant or a standard IgG full-length antibody protein (ipilimumab, abbreviated as IPI, prepared by Sanyu Biomedical (Shanghai) Co., Ltd.) (initial concentration: 2 μg / mL). After washing three times with PBST, the secondary antibody, Anti-human Fab-HRP (Sigma, A0293), was added and incubated for 1 hour. After incubation, the cells were washed six times with PBST and TMB (SurModics, TMBS-1000-01) was added for color development. Based on the color development results, the reaction was stopped by adding 2 M HCl, and the OD450 was measured using a microplate reader (Molecular Devices, SpecterMax 190).

[0174] A standard curve was created using Softmax Pro 7.1 software, and the concentration of the measured monoclonal bacterial solution was calculated. After statistical analysis, graphs were created using Graphpad Prism 7 software.

[0175] As shown in Figure 2, among the phage Fab display libraries with one common light chain, 12 libraries (the light chains of which correspond to Zalutumumab, Robatumumab, Eculizumab, VK1-203, Sacituzumab, Bococizumab, Fremanezumab, Olokizumab, Matuzumab, Fasinumab, VK1-278, and HNF-018, respectively) showed relatively high prokaryotic expression levels, whereas the other 7 libraries (the light chains of which correspond to Glembatumumab, Ligelizumab, HNE-083, Sirukumab, Tanezumab, HNE-008, and VK3-181, respectively) showed relatively low prokaryotic expression levels.

[0176] The phage Fab display library containing 19 common light chains was analyzed for the prokaryotic expression levels of each light chain gene line to which the common light chains belong. The results are shown in Figures 3A-3B, 4A-4B, 5A-5B, 6A-6B, 7A-7B, and 8A-8B, respectively.

[0177] As a result, for the three libraries with the IGKV3-20 light chain gene line (with light chains corresponding to VK3-181, HNF-018, and Robatumumab, respectively), the prokaryotic expression levels of the libraries corresponding to the light chains of HNF-018 and Robatumumab, excluding VK3-181, were relatively high. For the two libraries with the IGKV3-11 light chain gene line (with light chains corresponding to Fremanezumab and Sirukumab, respectively), the prokaryotic expression levels of the library corresponding to the light chain of Fremanezumab were relatively high, but the expression levels of the library corresponding to the light chain of Sirukumab were relatively low. Among the four libraries with the IGKV1-39 light chain gene line (the light chains correspond to Eculizumab, Sacituzumab, Bococizumab, and HNE-083, respectively), the expression level of the library corresponding to the Eculizumab light chain was highest, while the expression levels of the libraries corresponding to the Sacituzumab and Bococizumab light chains were relatively high, and the expression level of the library corresponding to the HNE-083 light chain was low. Among the libraries with the IGKV1-5 light chain gene line, the prokaryotic expression level of the library corresponding to the HNE-008 light chain was low. Among the four libraries in the IGKV1-33 light chain gene line (the light chains correspond to VK1-203, VK1-278, Matuzumab, and Tanezumab, respectively), the libraries corresponding to the light chains of VK1-203, VK1-278, and Matuzumab had the highest prokaryotic Fab expression levels, while the library corresponding to the light chain of Tanezumab had a relatively low expression level.Of the five libraries belonging to other light chain gene lines, the library corresponding to the light chain of Zalutumumab had a relatively high expression level, followed by the libraries corresponding to the light chains of Olokizumab and Fasinumab, and the libraries corresponding to the light chains of Glembatumumab and Ligelizumab had a relatively low expression level.

[0178] Furthermore, libraries corresponding to the light chains of Robatumumab (IGKV3-20), Fremanezumab (IGKV3-11), Eculizumab (IGKV1-39), VK1-203 (IGKV1-33), and Zalutumumab (IGKV1-13), which showed high expression levels in each light chain gene line, were selected. 48 clones were isolated from each library and their expression levels were analyzed again. The results are shown in Figures 9A and 9B. The libraries corresponding to the light chains of Robatumumab (IGKV3-20), Fremanezumab (IGKV3-11), Eculizumab (IGKV1-39), VK1-203 (IGKV1-33), and Zalutumumab (IGKV1-13) all showed high overall expression levels, which is consistent with the results in Figures 3 and 8.

[0179] 2.3 Phage display status analysis of phage Fab display libraries with common light chains The bacterial suspension of the phage Fab display library containing 19 common light chains of Example 2.1 was diluted and applied to a medium. Several clones were selected and inoculated into carbenicillin- and tetracycline-resistant 2-YT medium. The medium was cultured at 37°C and 220 rpm for 1.5-2 hours. After the OD600 reached 0.5-0.6, VSCM13 helper phage (purchased from Stratagene, titer: 5e+12) was added at a 1:1000 ratio and the medium was cultured in a constant-temperature incubator at 37°C for 30 minutes. The medium was then transferred to a shaker and cultured at 37°C and 220 rpm for 1 hour. The medium was then centrifuged at 5000 rpm and the supernatant was removed. Fresh carbenicillin- and kanamycin-resistant 2-YT medium was added and the medium was cultured overnight (approximately 16 hours). A 96-well ELISA plate was coated with Anti-Fd (1 μg / mL, 30 μL / well, Bio-Rad, product number: STAR161) and incubated overnight at 4°C. The following day, the overnight phage culture was centrifuged at 5000 rpm for 10 minutes, and the supernatant was collected. Simultaneously, the plate was washed three times with PBST and blocked with 5% nonfat dry milk for 2 hours. After washing three times with PBST, the phage culture supernatant was added and incubated for 1 hour. After washing three times with PBST, the secondary antibody, Anti-M13-HRP (Sino biological, product number 11973-MM05T-H), was added and incubated for 1 hour. After incubation, the plate was washed six times with PBST and TMB (SurModics, product number TMBS-1000-01) was added for color development. Based on the color development results, the reaction was stopped by adding 2 M HCl, and the OD450 was measured using a microplate reader (Molecular Devices, SpecterMax 190). The data were compiled in Excel and plotted as a graph.

[0180] The results are shown in Table 3. With a threshold of 2.1 times the negative value, the phage Fab display rates of the other 16 phage libraries with common light chains were all 80% or higher, except for the libraries corresponding to the light chains of VK3-181, Ligelizumab, and Sacituzumab.

[0181] [Table 4] 2.4 Eukaryotic expression and pharmaceutical suitability analysis of an antibody library with 11 common light chains 2.4.1 Selection of Light and Heavy Chain Sequences for Eukaryotic Expression Light chain sequence selection: Based on the prokaryotic expression levels and phage display expression results of embodiments 2.2 and 2.3, 11 light chains with relatively high expression levels when combining the conditions of each light chain gene line (light chains of VK1-278, VK1-203, HNF-018, Olokizumab, Robatumumab, Sacituzumab, Zalutumumab, Matuzumab, Fremanezumab, Fasinumab, and Eculizumab, respectively) will be subjected to eukaryotic expression testing.

[0182] 2.4.2 Heavy Chain Sequence Selection: The sequencing results for the clones selected in Example 2.1 were compiled, and the heavy chain CDR3 amino acid lengths of the heavy chain sequences belonging to the heavy chain gene lines IGHV1, IGHV3, and IGHV4 were analyzed. The results showed that the heavy chain CDR3 amino acid lengths of IGHV1 and IGHV3 showed a normal distribution. IGHV4 had only 42 sequences, which showed a weak tendency toward a normal distribution.

[0183] Based on the analysis of heavy chain CDR3, 12 heavy chain sequences with different CDR3 lengths were selected for each subtype (heavy chain gene lines IGHV1, IGHV3, and IGHV4). The gene line information of the 36 specifically selected heavy chain sequences is shown in Table 4.

[0184] [Table 5] TIFF2026508171000008.tif152170 2.5 Construction, eukaryotic expression, and purification of full-length antibodies combining a common light chain and heavy chains of different subtypes In this embodiment, the 36 heavy chains and 11 light chains selected from embodiment 2.4 are combined to construct, express, and purify a full-length antibody to obtain a full-length antibody protein.

[0185] First, a heavy chain coding sequence of an antibody of fully human origin was constructed by combining the heavy chain variable region amino acid sequence shown in Table 4 with the coding sequence of the human IgG1 constant region (SEQ ID NO:75).The 11 light chain variable region nucleotide sequences selected in Example 2.3.1 (SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:68, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74) and the coding sequence of the human light chain constant region (CL) kappa type (SEQ ID NO:76) were linked to construct a light chain coding sequence of an fully human origin antibody. The coding sequences for the antibody heavy and light chains were inserted into the eukaryotic expression vector pcDNA3.4-TOPO (Invitrogen), transformed into Escherichia coli DH5α, and cultured overnight at 37°C. Plasmids were extracted using an endotoxin-free plasmid extraction kit (OMEGA, D6950-01) to obtain endotoxin-free antibody plasmids, which were then expressed using the ExpiCHO transient transfection expression system (Thermo Fisher, A29133).

[0186] The specific method for transient transfection of ExpiCHO is as follows: On the day of transfection, the cell density was approximately 7 x 10 6 to 1×10 7 Cells were cultured at a final concentration of 6 x 10 viable cells / mL, confirming cell viability >98% using fresh ExpiCHO expression medium pre-warmed at 37°C. 6 Adjust the concentration to 100 cells / mL. TM Dilute the target plasmid in SFM (1 μg of plasmid per 1 mL of medium) and simultaneously incubate with OptiPRO TM ExpiFectamine in SFM TMEqual volumes of both were mixed and gently pipetted to mix well. TM The CHO / plasmid DNA mixture was prepared and incubated at room temperature for 1-5 minutes. The mixture was added to the prepared cell suspension and gently shaken. Finally, the cells were cultured in a cell culture shaker at 37°C under 8% CO2 conditions.

[0187] 18-22 hours after transfection, the culture medium was added with ExpiCHO TM Enhancer and ExpiCHO TM Feed was added, and the flask was continuously cultured at 32°C in a shaker under 5% CO2 conditions. TM Feed is added and ExpiCHO TM The cell suspension was gently mixed while slowly adding the feed. Seven days after transfection, the cell culture supernatant expressing the target protein was centrifuged at 15,000 g for 10 minutes, and the antibody protein expression level was measured using a GATOR (ProbeLife) device.

[0188] The results of full-length antibody protein expression levels in CHO cells are shown in Figures 10A-10B. Except for Fasinumab and VK1-203, all antibodies that combined a different heavy chain with a light chain showed high expression levels.

[0189] Figures 11A-11K show the results of measuring the expression levels of antibodies combining 11 light chains (VK1-278, VK1-203, HNF-018, Olokizumab, Robatumumab, Sacituzumab, Zalutumumab, Matuzumab, Fremanezumab, Fasinumab, and Eculizumab) with different heavy chain subtypes. The results demonstrate high expression levels of antibodies combining the heavy chain gene line IGHV3 with 11 light chains.

[0190] Based on these results, antibodies with some combinations of heavy and light chains were further selected and expressed in eukaryotes to confirm the expression levels of antibodies after combining the antibodies with the common light chain. The results are shown in Figure 12.

[0191] As shown in Figure 12, in eukaryotic cells, the antibodies with the highest expression levels are Eculizumab and Sacituzumab, whose light chain gene line is IGKV1-39, and HNF-018, whose light chain gene line is IGKV3-20.

[0192] 2.6 Physicochemical characterization of full-length antibodies combining common light chains and heavy chains of different subtypes In this example, antibody purity was measured using SDS-PAGE and SEC-HPLC.

[0193] 2.6.1 Construction, Expression, and Purification of Antibody Molecules Based on the results of CHO expression in Example 2.5 and the diversity of CDR3 amino acid lengths, five heavy chain sequences with different CDR3 lengths were randomly selected from each heavy chain subtype (IGHV1, IGHV3, and IGHV4). The gene line information for the selected heavy chain sequences is shown in Table 5. The selected 15 heavy chain sequences and 11 light chain sequences were combined, and the resulting 165 antibody molecules were expressed using the method described in Example 2.5. The resulting supernatant was affinity purified using MabSelect SuRe LX (GE, 17547403), and the target protein was eluted with 100 mM sodium acetate (pH 3.0). The mixture was then neutralized with 1 M Tris-HCl, and the resulting protein was finally exchanged into PBS buffer using an ultrafiltration tube (Millipore, UFC901096).

[0194] The purification results were as follows: IGHV3-43*02 (16-16 HC) combined with HNF-018 did not produce antibodies; IGHV3-33*01 and IGHV3-33*06 (13-32 HC) combined with Sacituzumab did not produce antibodies; IGHV3-43*02 (16-16 HC) and IGHV4-61*02 (24-13 HC) combined with Matuzumab did not produce antibodies; IGHV3-33*01 and IGHV3-33*06 (13-32 HC) combined with VK1-278 did not produce antibodies; and IGHV1-3*01 (17-19 HC) and IGHV1-46*01 (10-40 HC) combined with Fasinumab did not produce antibodies. HC), IGHV3-11*04 (2-27 HC), IGHV3-23*01, IGHV3-23D*01 (12-24 HC), IGHV3-33*01, IGHV3-33*06 (13-32 HC), IGHV3-43*02 (16-16 HC), IGHV4-34*01 (2-18 HC), and IGHV4-61*02 (24-13 HC) were not purified with antibodies, while IGHV1-3*01 (17-19 HC), IGHV1-46*01 (10-40 HC), IGHV1-69*01, IGHV1-69*12, IGHV1-69D*01 (13-23 HC) were not purified with antibodies. Antibodies for IGHV3-23*01, IGHV3-23D*01 (12-24 HC), IGHV3-33*01, IGHV3-33*06 (13-32 HC), and IGHV3-43*02 (16-16 HC) could not be purified, and SDS-PAGE evaluation could not be performed on a total of 19 antibodies. A total of 146 antibodies were available for SDS-PAGE evaluation.

[0195] [Table 6] 2.6.2 SDS-PAGE detection of antibody molecules Preparation of non-reducing SDS-PAGE solution: 1 μg of each antibody and the control IPI (ipilimumab) was added to 5x SDS loading buffer and 40 mM iodoacetamide. The mixture was heated in a dry bath at 75°C for 10 minutes. After cooling to room temperature, the mixture was centrifuged at 12,000 rpm for 5 minutes and the supernatant was collected.

[0196] Preparation of reducing solution: 2 μg of each antibody and the control IPI was added to 5x SDS loading buffer and 5 mM DTT. The mixture was heated in a dry bath at 100°C for 10 minutes. After cooling to room temperature, the mixture was centrifuged at 12,000 rpm for 5 minutes and the supernatant was collected. The supernatant was loaded onto a Bis-Tris 4-15% gradient gel (GenScript) and subjected to gel electrophoresis. Protein bands were visualized by Coomassie Brilliant Blue staining.

[0197] Scan the stained protein gel (decolorized with decolorizing solution until the background becomes transparent) using an EPSON V550 color scanner and calculate the purity of the reduced and non-reduced bands using the peak area method using ImageJ.

[0198] SDS-PAGE experiments showed that each antibody had a band of approximately 150 kD in the non-reducing gel and bands of approximately 55 kD and 25 kD in the reducing gel, consistent with the expected sizes. Detection by reducing gel revealed that the purity of all 146 expressed antibodies was 95% or higher.

[0199] 2.6.3 SEC-HPLC detection of antibody molecules Sample preparation: Mobile phase: 150 mmol / L phosphate buffer (pH 7.4). Dilute each antibody and control IPI to 0.5 mg / mL in the mobile phase.

[0200] Experimental method: An Agilent HPLC 1100 or Shimadzu LC2030C PLUS liquid chromatography system was used, with an XBridge BEH column (SEC 3.5 μm, 7.8 mm ID x 30 cm, Waters). The flow rate was 0.8 mL / min, the injection volume was 20 μL, and the VWD detector wavelengths were set at 280 nm and 214 nm. A blank solution, IPI control solution, and antibody sample solution were injected sequentially. The proportions of high molecular weight polymer, antibody monomer, and low molecular weight substances in the sample were calculated using the area-squared method.

[0201] The results are shown in Table 6. All full-length antibodies obtained from 15 heavy chains combined with HNF-018 were detectable, and all had monomer purity of 94% or higher, 11 of which had 100% (73% occupancy). Of the 13 detectable full-length antibodies obtained from 15 heavy chains combined with eculizumab, all but one had monomer purity of 98% or higher, 7 of which had 100% (54% occupancy). Of the 7 detectable full-length antibodies obtained from 15 heavy chains combined with olokizumab, all had monomer purity of 97% or higher, 1 of which had 100%. Of the 8 detectable full-length antibodies obtained from 15 heavy chains combined with robatumumab, all had monomer purity of 94% or higher, 1 of which had 100%. Of the six detectable full-length antibodies obtained from 15 heavy chains combined with sacituzumab, all had monomer purity of 96% or greater, but none had 100% purity. Of the five detectable full-length antibodies obtained from 15 heavy chains combined with zalutumumab, all had monomer purity of 93% or greater, but none had 100% purity. Of the six detectable full-length antibodies obtained from 15 heavy chains combined with matuzumab, all had monomer purity of 90% or greater, except for one with 86.95%, but none had 100% purity. Of the five detectable full-length antibodies obtained from 15 heavy chains combined with VK1-278, all had monomer purity of 96% or greater, one of which had 100% purity. Of the five detectable full-length antibodies obtained from 15 heavy chains combined with fremanezumab, all had monomer purity of 90% or greater, two of which had 100% purity. The one detectable full-length antibody obtained from 15 heavy chains combined with Fasinumab had a monomer purity of 85.4%. The two detectable full-length antibodies obtained from 15 heavy chains combined with VK1-203 had monomer purities of 87.2% and 95.76%.

[0202] The SEC-HPLC results showed that the full-length antibody combining the heavy chain of HNF-018 and Eculizumab had high monomer purity and demonstrated superior pharmaceutical suitability.

[0203] [Table 7] Embodiment 3: Construction of a phage Fab display library with trillions of common light chains Based on the results of the eukaryotic cell CHO expression level and the physicochemical property evaluation in this embodiment 2, two light chains, HNF-018 and Eculizumab, were selected as common light chains, and a common light chain phage library of trillions of genes was constructed.

[0204] 3.1 Construction of a recombinant heavy chain library containing human HCDR3 Peripheral blood mononuclear cells (PBMCs) were isolated from normal human blood using Ficoll-Paque density gradient centrifugation medium (purchased from GE, catalog number 17144003S). Total RNA was extracted from the isolated PBMCs using conventional methods and reverse-transcribed to cDNA using a reverse transcription kit (TaKaRa, catalog number 6210A). Based on the sequence similarity between the heavy and light chain genes, degenerate primers were designed for the leading ends of the heavy and light chain variable regions and the trailing ends of the first constant region, respectively, based on the sequence homology between the heavy and light chain gene sequences (Li Lin, Construction and Preliminary Screening of a Large-Scale Non-Immunovirus Human Fab Phage Antibody Library, Master's Thesis, China Union Medical University, June 2007). Antibody heavy and light chain variable region gene fragments were obtained by PCR. Fragments containing the antibody light and heavy chain variable regions were amplified by fusion PCR. The PCR product was then digested, recovered, and ligated with a phage display vector. The ligated product was recovered using a recovery kit (Omega, catalog number: D6492-02). Finally, the ligated product was transformed into competent E. coli SS320 (Lucigen, MC1061 F) using an electroporator (Bio-Rad, MicroPulser). The transformed E. coli SS320 was then plated on ampicillin-resistant 2-YT solid medium. The library size was confirmed by serial dilution plating to be 3 x 10^11 cfu, i.e., a recombinant phage display library (hRAL) containing 3 x 10^11 antibody genes (see Example 2.2 of Chinese Patent CN112250763B for library size calculation methods).

[0205] Plasmids were extracted from the library bacteria obtained above using a plasmid extraction kit (OMEGA, D6950-01) to obtain antibody gene library plasmids. Using this antibody gene library plasmid as a template, the heavy chain "CDR1 + CDR2" was amplified and purified using the following primers: CDR1+CDR2 forward primer HindIII-572-F:CATGTATCCGGTAAGCGGCAGGGTCGG((SEQ ID NO:79); CDR1+CDR2 reverse primer LC-R1:CACAGTAATACACGGCCGTGTC((SEQ ID NO:80); CDR1+CDR2 reverse primer LC-R2:CACAGTAATACACAGCCGTGTC((SEQ ID NO:81); Additionally, the heavy chain "CDR3" was amplified and purified using the following primers: CDR3 forward primer HC-F1:GACACGGCCGTGTATTACTGTG((SEQ ID NO:82); CDR3 forward primer HC-F2:GACACGGCTGTGTATTACTGTG((SEQ ID NO:83); HC-CDR3-R:GAGGTGCTCTTGGAGGAGGGTGCCAGCGGGAAGACCGATGGGCCCTTGGTGCTAGCTGCTGAGACGGTGACCRKKGTYCCYTGGCCCCAG((SEQ ID NO:84) The "CDR1+CDR2" and "CDR3" amplified by fusion PCR were combined, and the fusion product was enzymatically treated, recovered, and ligated with the phage display vector. The ligation product was recovered using a recovery kit (Omega, catalog number: D6492-02). Finally, the product was transformed into competent E. coli SS320 (Lucigen, MC1061 F) using an electroporator (Bio-Rad, MicroPulser). The transformed E. coli SS320 cells were plated on ampicillin-resistant 2-YT solid medium. The size of this heavy chain library was determined to be 1 x 1 x 10 by serial dilution. 12 cfu, i.e., 1 × 10 12 It was confirmed that this was a heavy chain gene library.

[0206] Construction of a phage display library containing 3.2 trillion common light chains The recombinant HCDR3 heavy chain library obtained in Example 3.1 was used to extract plasmids using a plasmid extraction kit (OMEGA, D6950-01) to obtain recombinant HCDR3 gene library plasmids. Using this library plasmid as a template, heavy chain variable region fragments were amplified using the upstream primer Middle-F (TAAGGCGCGCCTAACCATCTATTTC) (SEQ ID NO: 77) and the downstream primer HC-CDR3-R (GAGGTGCTCTTGGAGGAGGGTGCCAGCGGGAAGACCGATGGGCCCTTGGTGCTAGCTGCTGAGACGGTGACCATTGTCCCTTGGCCCCAG) (SEQ ID NO: 78). After agarose gel electrophoresis, the gel slices were recovered, and the recovered products and the phage display vectors containing the two common light chains (Eculizumab and HNF018) obtained in Example 2.1 were transformed into Eco91I (Thermo The resulting product was double-digested with SgsI (Thermofisher, FD0394) and SgsI (Thermofisher, FD1894), gel recovered, and ligated. The ligation product was recovered using a recovery kit (Omega, catalog number: D6492-02). The transformed E. coli SS320 cells were plated onto ampicillin-resistant 2-YT solid medium. Serial dilution plating confirmed that the library size was 1 x 10^12 cfu, i.e., a phage Fab display library with 1 x 10^12 common light chains. At the same time, serial dilutions were plated onto medium to obtain single colonies, and 3675 clones were selected for sequencing.

[0207] The composition ratios of heavy chain gene lines obtained after sequencing are shown in Figures 13A-13D. The results showed that in the phage Fab display libraries with two common light chains, IGHV3 had the highest composition ratio of heavy chain gene lines, at 57% and 53%, respectively. Among the IGHV3 subtypes, IGHV3-30 was found to have the highest composition ratio.

[0208] The results of amino acid length analysis of the heavy chain CDR regions are shown in Figures 14A-14F. The results showed that the heavy chain CDR1 amino acids were mostly 5, and the CDR2 amino acids were generally 17 or 16. The number of CDR3 amino acids, which correlates highly with antibody diversity, ranged from 6 to 25 and showed a normal distribution, with 14 amino acids accounting for the highest proportion. This indicates that the heavy chain diversity of the resulting phage Fab display library, which has two common light chains, is very high.

[0209] Quality control analysis of a 3.3 trillion consensus light chain phage display library In this embodiment, the clone sequencing results of embodiment 3.2 were analyzed to determine the heavy chain gene line composition ratio, heavy chain CDR3 amino acid length, and amino acid composition ratio at each position in the heavy chain CDR3 in the phage Fab display library with a common light chain. At the same time, some clones were selected and the prokaryotic expression and phage display status of the common light chain antibody library were analyzed using ELISA.

[0210] Prokaryotic expression was detected as follows. Phage Fab display library suspensions containing a common light chain were diluted and plated onto culture media to obtain single colonies. 1,468 clones were selected from each library, inoculated into ampicillin-resistant 2-YT medium, and cultured overnight (approximately 16 hours). Anti-Fd (1 μg / mL, 30 μL / well, Bio-Rad, Part Number: STAR161) was coated onto a 96-well ELISA plate and incubated overnight at 4°C. The following day, the overnight cultured monoclonal suspension was centrifuged at 5000 rpm for 10 minutes, and the supernatant was collected. Simultaneously, the plate was washed three times with PBST, blocked with 5% nonfat dry milk for two hours, and then washed three times with PBST. Serially diluted bacterial supernatants and a standard IgG full-length antibody protein (standard, initial concentration 2 μg / mL) were added and incubated for one hour. The plate was then washed three times with PBST and incubated for 1 hour with the secondary antibody Anti-human Kappa-HRP (Novus, NB7466). After incubation, the plate was washed six times with PBST and TMB (SurModics, TMBS-1000-01) was added for color development. Based on the color development results, the reaction was stopped by adding 2 M HCl, and the OD450 was measured using a microplate reader (Molecular Devices, SpecterMax 190).

[0211] The phage display status was detected as follows. A phage Fab display library containing a common light chain was diluted and plated on medium to obtain single colonies. 1305 clones were selected and inoculated into ampicillin-resistant 2-YT medium. After overnight incubation, they were inoculated into new ampicillin-resistant 2-YT medium containing 2% glucose and cultured at 37°C and 220 rpm until the OD600 reached 0.5. Helper phage was added, and the medium was left to stand for 30 minutes, followed by incubation at 37°C and 220 rpm for 1 hour. After centrifugation at 5000 rpm and removal of the supernatant, new ampicillin- and kanamycin-resistant 2-YT medium was added and cultured overnight (approximately 16 hours) at 30°C and 220 rpm. The medium was then centrifuged at 5000 rpm and the supernatant was collected and used as the monoclonal phage supernatant. A 96-well ELISA plate was coated with Anti-Fd (1 μg / mL, 30 μL / well, Bio-Rad, product code: STAR161) and incubated overnight at 4°C. The next day, the plate was washed three times with PBST and blocked with 5% nonfat dry milk for 2 hours. The monoclonal phage supernatant and a 5-fold serially diluted phage positive control (initial concentration: 1e+10 cfu) were added and incubated for 1 hour. The plate was then washed three times with PBST and incubated with the secondary antibody Anti-M13-HRP (Sino biological, product code: 11973-MM05T-H) for 1 hour. After incubation, the plate was washed six times with PBST and developed with TMB (SurModics, product code: TMBS-1000-01). Based on the color development, the reaction was stopped by adding 2 M HCl, and the OD450 was measured using a microplate reader (Molecular Devices, SpecterMax 190). The data will be compiled in EXCEL and plotted as a graph.

[0212] The prokaryotic expression results for the common light chain antibody libraries are shown in Figure 15A. Using a threshold of 1.65-fold the negative control (PBS) measurement value, the prokaryotic (Fab) expression efficiencies for the two common light chain antibody libraries were 74.68% and 78.58%, respectively. The phage display results for the common light chain antibody libraries are shown in Figure 15B. Using a threshold of 2-fold the negative control (helper phage used as a negative control), the phage expression efficiencies for the two common light chain antibody libraries were 69.77% and 76.34%, respectively. The results demonstrated that both common light chain antibody phage libraries had high prokaryotic expression and phage display efficiencies.

[0213] Example 4: Screening and validation of consensus light chain phage display libraries 4.1 Preparation of raw materials for phage display library screening 4.1.1 Preparation of antigen protein for screening Genetic manipulation at the coding gene level added a His tag or a human Fc tag to the C-terminus of the human ROR1 ECD (Uniprot ID: Q01973, AA30-406) or human TROP2 ECD (Uniprot ID: P09758, AA31-274) sequences, respectively. The resulting nucleic acid sequences were constructed in the pcDNA3.4 vector, then transformed into E. coli DH5α strain and cultured overnight at 37°C. The plasmids were then extracted using an endotoxin-free plasmid extraction kit (OMEGA, D6950-01). The resulting plasmids were purified with ExpiFectamine. TM 293 Transfection Reagent Kit (Gibco TM HEK293 cells (ATCC® CRL-1573) were cultured in vitro. TM) for transient expression, and the cell culture supernatant was collected after 7 days of expression. Proteins containing His tags were affinity purified using Ni Smart Beads 6FF (Changzhou Tiandi Renhe Biotechnology Co., Ltd., SA036050), and the target proteins were eluted using an imidazole gradient. The eluted proteins were exchanged and concentrated into PBS buffer using ultracentrifugal concentration tubes (Millipore, UFC901096), and the final antigen proteins (huROR1-His and huTROP2-His) were obtained. Proteins containing Fc tags were purified by affinity chromatography using a Protein A / G affinity chromatography column. After purification, the target proteins were eluted with 100 mM glycine (pH 3.0), concentrated, and buffer exchanged to obtain the final antigen proteins (huROR1-hFc and huTROP2-hFc).

[0214] 4.1.2 Generation of overexpressing cells and assay by flow cytometry analysis Construction of human ROR1 and TROP2 HEK293 cell lines (hereafter referred to as huROR1-HEK293 and huTROP1-HEK293): The nucleic acid sequences of full-length human ROR1 (Uniprot ID: Q01973) and human TROP2 (Uniprot ID: P09758) were constructed in the pLVX-puro plasmid (Clontech, Cat#632164). The resulting plasmids were then electroporated (Invitrogen, Neon TM Transfection System, MP922947) was used to transfect HEK293 cells (ATCC® CRL-1573 TM) were electroporated. After electroporation, the resulting cells were transferred to antibiotic-free DMEM medium (Gibco, 11995065) supplemented with 10% FBS (Gibco, 15140-141) and seeded onto ten 10 cm cell culture dishes for 48 hours. They were then aliquoted into 96-well cell culture plates at an average density of 0.5 cells / well, and puromycin (Gibco, A111138-03) was added at a final concentration of 2 μg / mL as a selective pressure. After approximately two weeks, the growth of cell line clones was monitored, and cloned cell lines were selected and assayed.

[0215] Flow cytometry analysis of huROR1-HEK293 cells: Logarithmically growing cells were digested and seeded into a 96-well plate. After washing with FACS buffer (1x PBS buffer containing 2% FBS), a pre-prepared fluorescently labeled secondary antibody (anti-human IgG Fc antibody, Abcam, 98596) was added and incubated at 4°C for 30 minutes. Finally, detection was performed using a flow cytometer (Beckman, CytoFLEX A00-1-1102). The detection results confirmed high expression of human ROR1 on the surface of hROR1-HEK293 cells.

[0216] Flow cytometry analysis of huTROP2-HEK293 cells: The above cell lines in logarithmic growth phase were digested and seeded into 96-well plates. After washing with FACS buffer (1x PBS buffer supplemented with 2% FBS), a serial dilution of primary antibody (sacituzumab) in PBS was added and incubated at 4°C for 30 minutes. After washing, a prepared fluorescently labeled secondary antibody (anti-human IgG Fc antibody, Abcam, 98596) was added and incubated at 4°C for 30 minutes. Finally, detection was performed using a flow cytometer (Beckman, CytoFLEX A00-1-1102). The results confirmed the establishment of hTROP2-HEK293 cell lines expressing high levels of human TROP2 on the cell surface.

[0217] 4.2 Screening of phage display libraries In this embodiment, screening verification is performed using the magnetic bead method and the immunotube method for the common light chain phage display library (CLC) constructed in Embodiment 3 and the human HCDR3-containing recombinant phage library (hRAL) constructed in Embodiment 3. The differences in physicochemical properties and affinity of antibody molecules screened from both libraries were aligned.

[0218] 4.2.1 Screening of antibody gene phage display libraries using magnetic beads Screening using magnetic beads involves biotin-labeling antigen proteins (huROR1-His and huTROP2-His) and then binding them to streptavidin-conjugated magnetic beads. The antigen-bound beads are then incubated with the antibody gene phage display library, washed, and eluted through a biopanning process. Typically, three to four rounds of biopanning are required to highly enrich for antigen-specific monoclonal antibodies. In this embodiment, biotin-labeled antigen proteins were used to screen the phage display library, and after three rounds of biopanning, primary screening of monoclonal antibodies against the antigen proteins was performed. The specific method is described in Example 2.4.1 of Chinese Patent CN112250763B.

[0219] 4.2.2 Screening of antibody gene phage display libraries by immunotube method The immunotube method and magnetic bead method are complementary and validated experimental methods aimed at enriching antigen-specific antibodies. The immunotube method involves coating antigen proteins (huROR1-His, huTROP2-His, huROR1-hFc, huTROP2-hFc) on the surface of a highly adhesive immunotube. A phage-displayed antibody library is then added to the immunotube. After a biopanning process involving incubation, washing, and elution with the antigen proteins adsorbed to the immunotube surface, two to four rounds of selection are performed to ultimately enrich for antigen-specific monoclonal antibodies. In this embodiment, after three rounds of biopanning, primary screening of monoclonal antibodies against the aforementioned antigen proteins is performed. The specific method is described in Example 2.4.2 of Chinese Patent CN112250763B.

[0220] 4.3 Construction, Expression, and Purification of Full-Length Antibody Proteins The construction, expression and purification of the full-length antibody protein was carried out with reference to embodiment 2.5.

[0221] 4.4 Physicochemical properties and affinity assays of anti-TROP2 antibodies In this embodiment, physicochemical analysis and affinity activity testing are performed on the anti-TROP2 monoclonal antibodies derived from the CLC library and hRAL library, which were expressed and purified in Example 4.3.

[0222] 4.4.1 SDS-PAGE assay See Example 2.6.2 for SDS-PAGE assay methods. Thirty-six candidate antibodies were detected in the hRAL library, and 38 in the CLC library. The experimental results are shown in Table 7.

[0223] As a result, of the 36 candidate antibodies in the hRAL library, 34 had protein purity of 95% or more by SDS-PAGE, one candidate antibody (C34) had protein purity of 57.5% by SDS-PAGE, and one candidate antibody (E35) had unknown protein purity by SDS-PAGE. All 38 candidate antibodies in the CLC library had protein purity of 95% or more by SDS-PAGE.

[0224] 4.4.2 Isoelectric point (pI) assay In this embodiment, the isoelectric points of the candidate antibodies in the hRAL library and the CLC library were determined using capillary isoelectric focusing (cIEF). The specific flow of capillary isoelectric focusing is as follows:

[0225] Sample preparation: 40 μL of each of the test sample, reference sample, iCIEF system compatibility control sample (China Food and Drug Testing Institute, 330002), and blank solution, each with a target concentration of 1 mg / mL and a volume of 50 μL, was added to a centrifuge tube containing 160 μL of premix and vortexed three times (5 s each). The tube was placed in a benchtop microcentrifuge and centrifuged at 13,000 rpm for 3 minutes at room temperature. After centrifugation, 160 μL of the supernatant was removed and transferred to a 96-well plate in the order of sampling, with sealing film attached. After centrifugation at 1,000 rpm for 10 minutes at room temperature, analysis was performed immediately.

[0226] Analysis measurement: Start the dual-function capillary electrophoresis device (ProteinSimple, Maurice) and perform a system self-test after 15 minutes. After all self-tests have passed, proceed with the subsequent experiment. After the reagents and cartridges on the reagent disk are ready, set the measurement method parameters. The parameters for the iCIEF system suitability test method are as follows: Time and Voltage: Focus Period 1: 1500 V, 1.0 min. Focus Period 2: 3000 V, 7.5 min. Test: Absorbance: 0.005 s. Fluorescence: 3, 5, 10, 20 s. Injection time: 55 s. Standard: pI 4.05: 250 pixels. pI 9.99: 1800 pixels. The parameters for the sample test method are as follows: Time and Voltage: Focus Period 1: 1500 V, 1.0 min. Focus Period 2: 3000 V, 8.0 min. Test: Absorbance: 0.005 s. Fluorescence: 3, 5, 10, 20 s. Injection time: 55 s. Standard - pI 4.05: 250 pixels. pI 9.99: 1800 pixels. Sampling and injection order were: 2 x iCIEF system suitability control solution, 1 x blank solution, 1 x reference solution, 1 x each test solution, and 1 x iCIEF system suitability control solution.

[0227] End of measurement and data analysis: After saving the data, the cartridge was washed and the instrument was shut down. The collected data was analyzed using iCE software to obtain the isoelectric point of each peak.

[0228] The results are shown in Table 7 and Figure 16. The isoelectric points of the 36 candidate antibodies from the hRAL library ranged from 6.73 to 8.51 (average value 7.73), while the isoelectric points of the 38 candidate antibodies from the CLC library ranged from 7.27 to 8.60 (average value 8.08). The isoelectric points of the antibodies derived from the CLC library were more deviated from neutral (pI 7.0), indicating that the CLC library antibodies have good formulation suitability (druglikeness / developability).

[0229] [Table 8] TIFF2026508171000012.tif224170 4.4.3 Binding activity assay between anti-TROP2 antibodies and huTROP2-His A 96-well ELISA plate was coated with huTROP2-His (2 μg / mL, 30 μL / well) and incubated overnight at 4°C. The next day, the plate was washed three times with PBST and blocked with 5% nonfat dry milk for 2 hours. After washing the plate three times with PBST, serially diluted candidate antibodies and a positive control antibody (sacituzumab) were added and incubated for 1 hour. After washing the plate three times with PBST, a dual anti-human IgG-Fc-HRP antibody (Abcam, ab98596) was added and incubated for 1 hour. After incubation, the plate was washed six times with PBST and TMB substrate (SurModics, TMBS-1000-01) was added for color development. Based on the color development results, the reaction was stopped by adding 2 M HCl, and the absorbance was measured at OD450 using a microplate reader (Molecular Devices, SpectraMax 190).

[0230] The results are shown in Figure 17. The binding activity was classified into three levels: high, medium, and low, based on the magnitude of the EC50 value. EC 50A value between 0.001 and 0.01 is defined as high binding activity, 0.01 and 0.1 as moderate binding activity, and 0.1 and 1 as low binding activity. For the hRAL library, there were no high-binding activity candidates, 94% (34 / 36) of moderate-binding activity candidates, and 6% (2 / 36) of low-binding activity candidates. For the CLC library, there were 79% (30 / 38) of high-binding activity candidates, 21% (8 / 38) of moderate-binding activity candidates, and no low-binding activity candidates. These results clearly demonstrate that the ELISA binding activity of candidate antibodies screened from the CLC library is superior to that of candidate antibodies obtained from the hRAL library.

[0231] 4.5 Physicochemical properties and affinity assay of anti-ROR1 antibodies In this embodiment, physicochemical analysis and affinity activity testing are performed on the anti-ROR1 monoclonal antibodies derived from the CLC library and hRAL library expressed and purified in Embodiment 4.3.

[0232] 4.5.1 SDS-PAGE assay See Example 2.6.2 for SDS-PAGE assay methods. Eleven candidate antibodies were detected from the hRAL library and 12 from the CLC library. The experimental results are shown in Table 8.

[0233] The results showed that all candidate antibodies showed bands at approximately 150 kD on the non-reducing gel and bands at approximately 55 kD (heavy chain) and 25 kD (light chain) on the reducing gel, consistent with their predicted sizes. Furthermore, the purity of all candidate antibodies was 95% or higher. Consequently, the antibodies obtained from both the common light chain antibody library and the human-derived antibody library were confirmed to have good SDS-PAGE purity.

[0234] 4.5.2 SEC-HPLC assay The SEC-HPLC assay method is as per embodiment 2.6.3, and the experimental results are shown in Table 8.

[0235] As a result, the SEC monomer purity of all antibodies obtained from the hRAL library was 90% or higher, but only one antibody had a 100% monomer purity (occupancy rate: 0.09%). The SEC monomer purity of all antibodies obtained from the CLC library was also 90% or higher, and of these, seven antibodies had a 100% monomer purity (occupancy rate: 66.67%). Therefore, it was found that antibodies screened from the CLC library exhibited superior performance in terms of purity.

[0236] 4.5.3 DSF thermal stability evaluation In this experiment, differential scanning fluorescence (DSF) was used to examine the denaturation temperature (Tm) of full-length antibodies derived from the hRAL library and the CLC library.

[0237] Preparation of 100X Sypro Orange dye solution: 6 μL of 5000X Sypro Orange was added to 294 μL of 1X PBS to prepare 100X Sypro Orange dye solution. Preparation of Hercerptin reference solution: A fixed amount of trastuzumab stock solution was taken and diluted to 0.2 mg / mL with 1X PBS. Preparation of test product solution: A fixed amount of test product stock solution was taken and diluted to 0.2 mg / mL with 1X PBS. If the stock solution concentration was less than 0.2 mg / mL, the stock solution was directly used in the test. Sampling: 19 μL of 0.2 mg / mL trastuzumab reference solution or 0.2 mg / mL test product solution was dispensed into eight tubes, to which 1 μL of 100X Sypro Orange dye solution was added and mixed. Three parallel tests were performed for each test product or reference product. Parameter settings: The test type was selected as melting curve, and continuous mode was used. The temperature scan range was 25°C to 95°C, the heating rate was 1% / min (approximately 1°C / min), and after equilibration at 25°C for 5 minutes, data was collected during the heating process. The reporter dye was ROX, the quencher dye was none, and the reaction volume was 20 μL. The 8-tube array was placed in the predetermined position and the experiment began. Determining the Tm value: The Tm value of the protein is expressed as the temperature corresponding to the valley of the first peak in the first derivative curve.

[0238] Three full-length antibodies were detected in the hRAL library and 12 in the CLC library. The results are shown in Table 8. The maximum Tm value of the antibodies obtained from the human antibody library was 74.01°C, with an average of 70.76°C. The maximum Tm value of the antibodies obtained from the common light chain antibody library was 74.27°C, with an average of 70.86°C. The percentage of antibodies with a Tm value of 70°C or higher was 58.3%. This indicates that the CLC library, like the hRAL library, can produce antibodies with good thermal stability.

[0239] [Table 9] 4.5.4 Affinity Kinetics Assay of Anti-ROR1 Antibodies In this embodiment, the affinity activity of full-length antibodies derived from the human antibody library and the consensus light chain antibody library for the recombinant human protein huROR1-His was assayed using a GATOR (ProbeLife) device.

[0240] The specific method is as follows: 2 g of BSA and 2 mL of 10% Tween 20 were added to 1000 mL of 1x PBS, mixed, and the pH was adjusted to 7.40 to produce Q Buffer. This was filtered, aliquoted, and stored. The sensor regeneration buffer was prepared by dissolving 0.38 g of glycine and 4.38 g of sodium chloride in 500 mL of purified water and adjusting the pH to 2.0. This was filtered, aliquoted, and stored. The candidate or control antibody was diluted to 30 nM in Q Buffer. The antigen, human recombinant protein huROR1-His, was serially diluted two-fold in Q Buffer to concentrations of 600, 300, 150, 75, 37.5, 18.8, 9.38, and 0 nM. Prewet the sensor (Protein A Probes, ProbeLife, CA) with Q Buffer for at least 10 minutes under light-protected conditions, then begin measurement on the sample plate (Greiner, 655209). After an error-free test, measurements were performed according to the preset program. First, binding was performed with the candidate or control antibody for 120 seconds, followed by equilibration in Q Buffer for 30 seconds until binding was complete. The antibody-bound sensor was then transferred to various concentrations of diluted huROR1-His antigen, allowed to bind for 120 seconds, and then transferred to Q Buffer for 180 seconds for dissociation. Finally, the binding and dissociation data for different concentrations of antigen and antibody were fitted to obtain KD, Kon, and Koff values. Eleven full-length antibodies were detected in the human-derived antibody library, and 12 full-length antibodies were detected in the consensus light chain antibody library.

[0241] The results are shown in Table 9. Among the antibodies obtained from the CLC library, the highest affinity was 3.82E-09 M. Meanwhile, among the antibodies obtained from the hRAL library, the highest affinity was 6.6E-09 M. This indicates that the antibodies obtained from the common light chain antibody library exhibited superior affinity activity. Regarding Koff, three antibodies obtained from the hRAL library had Koff values ​​less than 5.0E-03 / s (25% occupancy), compared with five antibodies obtained from the CLC library (45.5% occupancy). Overall, this indicates that the common light chain phage display library offers a greater possibility of obtaining antibodies with higher affinity.

[0242] [Table 10] TIFF2026508171000015.tif53169 Embodiment 5: Characterization of common light chain antibodies To further evaluate the formulation suitability of the common light chain antibodies screened from the constructed common light chain phage display antibody library (CLC), in this embodiment, the magnetic bead method and immunotube method are used to screen and verify the CLC library against multiple targets (ROR1, AXL, GPC1, CD228a, PTK7, FGFR2B, TROP2, and 5T4).

[0243] 5.1 Preparation of screening materials and screening of libraries For preparation of screening raw materials and screening of the library, please refer to Examples 4.1-4.2.

[0244] 5.2 Screening of positive clones that specifically bind to antigenic proteins by ELISA The output pool obtained by screening using the magnetic bead method and the immunotube method in Example 5.1 is diluted to prepare single clones, and positive clones are screened by ELISA using plates coated with antigen proteins (huROR1-His, huAXL-His, huGPC1-His, huCD228a-His, huPTK7-His, huFGFR2B-His, huTROP2-His, hu5T4-His). For specific methods, see Example 3.3.

[0245] Positive clones screened by ELISA were sequenced to obtain unique antibody sequences that bound to the antigen protein. The results are shown in Table 10. A total of 5,352 unique antibody sequences were obtained from the eight target screening validation, with an average of 706 unique binding clones per target (TROP2 was not included in the statistics because only the CLC-24 library was screened). The number of antibodies targeting ROR1, AXL, and GPC1 was particularly high, with over 900 unique binding clones obtained for each.

[0246] [Table 11] 5.3 Performance testing of common light chain antibodies and antibodies under development In this embodiment, 70 common light chain antibodies were selected from the antibody molecules selected for each of the aforementioned targets, and the expression levels, SDS-PAGE, SEC, and thermal stability of the selected 70 antibodies and 65 monoclonal antibody drugs that are on the market or under research and development were analyzed.

[0247] 5.3.1 Construction, Expression, and Purification of Full-Length Proteins For construction, expression and purification of full-length proteins, please see Example 2.5.

[0248] 5.3.2 Comparison of expression levels between common light chain antibodies and antibodies under development In this embodiment, the expression levels of the culture supernatants on day 7 of expression of 70 common light chain antibodies and 65 commercially available or research and development antibodies expressed as described above were assayed. The specific method is as follows: Q Buffer Preparation: Prepare a kinetic buffer containing 0.02% Tween 20 and 0.2% BSA in 1x PBS.

[0249] Preparation of R Buffer: Q Buffer containing 10 mM Gly and 150 mM NaCl was prepared, and the pH was adjusted to 2.0.

[0250] Standard curve preparation: Sanyu Biomedical (Shanghai) Co., Ltd.'s in-house standard (VHH) was first diluted to a concentration of 234.50 μg / mL, and then serially diluted to 0.46 μg / mL. 200 μL of each concentration was placed in a 96-well plate.

[0251] Quality control point: An arbitrary point in the standard curve was used as a quality control point.

[0252] Treatment of unmeasured culture supernatant: Dilute the culture supernatant 10-fold with Q Buffer to a volume of 200 μL and place in a 96-well plate.

[0253] Start the Gator instrument and associated software, select the Quantitation experiment mode, run the Loading program for 120 seconds and the Regeneration program for 50 seconds, create a standard curve using a 4-parameter logistic curve, and then use the readings from the culture supernatant samples to calculate the expression levels.

[0254] The results are shown in Figure 18 and Tables 11-12. The average expression level of the 70 common light chain antibodies was 123.87 μg / mL, while the average expression level of the 65 marketed or R&D monoclonal antibodies was 74.23 μg / mL (P value < 0.0001). This shows that the expression levels of the common light chain antibodies are statistically significantly higher than those of the marketed or R&D monoclonal antibodies, indicating that the common light chain antibodies screened from the constructed common light chain phage display library have higher expression levels.

[0255] 5.3.3 SDS-PAGE Analysis of Common Light Chain Antibodies and Marketed or Research Antibodies In this example, the purity of the 70 common light chain antibodies and 65 marketed or R&D monoclonal antibody proteins mentioned above will be confirmed by SDS-PAGE. For specific methods, please refer to Example 2.6.2.

[0256] The results are shown in Tables 11-12. Of the 70 common light chain antibodies, 10 had low expression levels, making it impossible to purify the proteins or to perform testing due to low purified protein concentrations. The purity of the remaining 59 antibody proteins was 95% or higher. Of the 65 monoclonal antibodies already on the market or in research and development, 27 had low expression levels and had not been tested, while 37 had antibody protein purity of 95% or higher.

[0257] 5.3.4 SEC-HPLC Assay of Common Light Chain Antibodies and Marketed and Research Antibodies In this example, the purity of 70 common light chain antibodies and 65 marketed or R&D monoclonal antibody proteins expressed as described above is tested by SEC-HPLC. For specific methods, see Example 2.6.3.

[0258] The results are shown in Tables 11-12. Of the 70 common light chain antibody proteins, 30 reached a concentration of 0.5 mg / mL and underwent SEC-HPLC analysis. Of these, 28 had a monomer purity of 95% or higher, representing 93.3% of proteins with a monomer purity of 95% or higher. Of the 65 monoclonal antibody proteins under development, 15 reached a concentration of 0.5 mg / mL and underwent SEC-HPLC analysis, representing 11 having a monomer purity of 95% or higher (73.3% of proteins had a monomer purity of 95% or higher). The results showed that the purity of the common light chain antibodies screened from the constructed common light chain phage display library was statistically significantly higher than that of the monoclonal antibodies under development, demonstrating that common light chain antibodies have superior purity characteristics.

[0259] 5.3.5 DSF Thermostability Analysis of Consensus Light Chain Antibodies and Research Antibodies In this embodiment, 30 common light chain antibodies and 24 marketed or research and development monoclonal antibodies with high expression levels were selected from the 70 common light chain antibodies and 65 marketed or research and development monoclonal antibody proteins expressed as described above, and thermal stability analysis was performed using DSF. For specific methods, see embodiment 4.6.3.

[0260] The results are shown in Figure 19 and Tables 11-12. The average Tm1 of the 30 common light chain antibodies was 70.88°C, while the average Tm1 of the 24 marketed or research and development monoclonal antibodies was 61.06°C (P value < 0.0001). This result indicates that the thermal stability of the common light chain antibodies is statistically significantly better than that of the research and development monoclonal antibodies, indicating that the common light chain antibodies screened from the constructed common light chain phage display library have superior thermal stability.

[0261] [Table 12] TIFF2026508171000018.tif232169 TIFF2026508171000019.tif23169

Table 13

Table 14

Claims

1. The antibody library containing a common light chain with heavy chain diversity is encoded by an IGKV3 or IGKV1 light chain germline gene. Preferably, the common light chain is encoded by an IGKV3-20, IGKV3-11, IGKV1-39, IGKV1-5, or IGKV1-33 light chain germline gene. More preferably, the common light chain is encoded by an IGKV3-20 or IGKV1-39 light chain germline gene. For example, the common light chains in the antibody library each include: (a) LCDR1 shown in SEQ ID NO:1 or variants thereof having no more than two amino acid changes in LCDR1 shown in SEQ ID NO:1, LCDR2 shown in SEQ ID NO:2 or variants thereof having no more than two amino acid changes in LCDR2 shown in SEQ ID NO:2, and LCDR3 shown in SEQ ID NO:3 or variants thereof having no more than two amino acid changes in LCDR3 shown in SEQ ID NO:

3. (b) LCDR1 shown in SEQ ID NO:4 or a variant of LCDR1 shown in SEQ ID NO:4 having a change of not more than two amino acids, LCDR2 shown in SEQ ID NO:5 or a variant of LCDR2 shown in SEQ ID NO:5 having a change of not more than two amino acids, and LCDR3 shown in SEQ ID NO:6 or a variant of LCDR3 shown in SEQ ID NO:6 having a change of not more than two amino acids. (c) LCDR1 shown in SEQ ID NO:7 or a variant of LCDR1 shown in SEQ ID NO:7 with no more than two amino acid changes, LCDR2 shown in SEQ ID NO:8 or a variant of LCDR2 shown in SEQ ID NO:8 with no more than two amino acid changes, and LCDR3 shown in SEQ ID NO:9 or a variant of LCDR3 shown in SEQ ID NO:9 with no more than two amino acid changes. (d) LCDR1 set forth in SEQ ID NO:10 or variants thereof having no more than two amino acid changes in LCDR1 set forth in SEQ ID NO:10, LCDR2 set forth in SEQ ID NO:11 or variants thereof having no more than two amino acid changes in LCDR2 set forth in SEQ ID NO:11, and LCDR3 set forth in SEQ ID NO:12 or variants thereof having no more than two amino acid changes in LCDR3 set forth in SEQ ID NO:

12. (e) LCDR1 set forth in SEQ ID NO: 13 or variants of LCDR1 set forth in SEQ ID NO: 13 having not more than two amino acid changes, LCDR2 set forth in SEQ ID NO: 14 or variants of LCDR2 set forth in SEQ ID NO: 14 having not more than two amino acid changes, and LCDR3 set forth in SEQ ID NO: 15 or variants of LCDR3 set forth in SEQ ID NO: 15 having not more than two amino acid changes. (f) LCDR1 set forth in SEQ ID NO: 16 or variants thereof having no more than two amino acid changes in LCDR1 set forth in SEQ ID NO: 16, LCDR2 set forth in SEQ ID NO: 17 or variants thereof having no more than two amino acid changes in LCDR2 set forth in SEQ ID NO: 17, and LCDR3 set forth in SEQ ID NO: 18 or variants thereof having no more than two amino acid changes in LCDR3 set forth in SEQ ID NO:

18. (g) LCDR1 set forth in SEQ ID NO: 19 or variants of LCDR1 set forth in SEQ ID NO: 19 having not more than two amino acid changes, LCDR2 set forth in SEQ ID NO: 20 or variants of LCDR2 set forth in SEQ ID NO: 20 having not more than two amino acid changes, and LCDR3 set forth in SEQ ID NO: 21 or variants of LCDR3 set forth in SEQ ID NO: 21 having not more than two amino acid changes. (h) LCDR1 set forth in SEQ ID NO:22 or variants thereof having no more than two amino acid changes in LCDR1 set forth in SEQ ID NO:22, LCDR2 set forth in SEQ ID NO:23 or variants thereof having no more than two amino acid changes in LCDR2 set forth in SEQ ID NO:23, and LCDR3 set forth in SEQ ID NO:24 or variants thereof having no more than two amino acid changes in LCDR3 set forth in SEQ ID NO:

24. (i) LCDR1 set forth in SEQ ID NO:25 or variants thereof having no more than two amino acid changes in LCDR1 set forth in SEQ ID NO:25, LCDR2 set forth in SEQ ID NO:26 or variants thereof having no more than two amino acid changes in LCDR2 set forth in SEQ ID NO:26, and LCDR3 set forth in SEQ ID NO:27 or variants thereof having no more than two amino acid changes in LCDR3 set forth in SEQ ID NO:

27. (j) LCDR1 set forth in SEQ ID NO:28 or variants of LCDR1 set forth in SEQ ID NO:28 having not more than two amino acid changes, LCDR2 set forth in SEQ ID NO:29 or variants of LCDR2 set forth in SEQ ID NO:29 having not more than two amino acid changes, and LCDR3 set forth in SEQ ID NO:30 or variants of LCDR3 set forth in SEQ ID NO:30 having not more than two amino acid changes. (k) LCDR1 set forth in SEQ ID NO:31 or variants of LCDR1 set forth in SEQ ID NO:31 having changes of not more than two amino acids, LCDR2 set forth in SEQ ID NO:32 or variants of LCDR2 set forth in SEQ ID NO:32 having changes of not more than two amino acids, and LCDR3 set forth in SEQ ID NO:33 or variants of LCDR3 set forth in SEQ ID NO:33 having changes of not more than two amino acids. (l) LCDR1 set forth in SEQ ID NO:34 or variants of LCDR1 set forth in SEQ ID NO:34 having not more than two amino acid changes, LCDR2 set forth in SEQ ID NO:35 or variants of LCDR2 set forth in SEQ ID NO:35 having not more than two amino acid changes, and LCDR3 set forth in SEQ ID NO:36 or variants of LCDR3 set forth in SEQ ID NO:36 having not more than two amino acid changes. (m) LCDR1 set forth in SEQ ID NO:37 or variants of LCDR1 set forth in SEQ ID NO:37 having not more than two amino acid changes, LCDR2 set forth in SEQ ID NO:38 or variants of LCDR2 set forth in SEQ ID NO:38 having not more than two amino acid changes, and LCDR3 set forth in SEQ ID NO:39 or variants of LCDR3 set forth in SEQ ID NO:39 having not more than two amino acid changes. (n) LCDR1 set forth in SEQ ID NO: 40 or variants of LCDR1 set forth in SEQ ID NO: 40 having not more than two amino acid changes, LCDR2 set forth in SEQ ID NO: 41 or variants of LCDR2 set forth in SEQ ID NO: 41 having not more than two amino acid changes, and LCDR3 set forth in SEQ ID NO: 42 or variants of LCDR3 set forth in SEQ ID NO: 42 having not more than two amino acid changes. (o) LCDR1 set forth in SEQ ID NO:43 or variants of LCDR1 set forth in SEQ ID NO:43 having not more than two amino acid changes, LCDR2 set forth in SEQ ID NO:44 or variants of LCDR2 set forth in SEQ ID NO:44 having not more than two amino acid changes, and LCDR3 set forth in SEQ ID NO:45 or variants of LCDR3 set forth in SEQ ID NO:45 having not more than two amino acid changes. (p) LCDR1 shown in SEQ ID NO: 46 or a variant of LCDR1 shown in SEQ ID NO: 46 having a change of not more than two amino acids, LCDR2 shown in SEQ ID NO: 47 or a variant of LCDR2 shown in SEQ ID NO: 47 having a change of not more than two amino acids, and LCDR3 shown in SEQ ID NO: 48 or a variant of LCDR3 shown in SEQ ID NO: 48 having a change of not more than two amino acids. (q) LCDR1 set forth in SEQ ID NO:49 or variants of LCDR1 set forth in SEQ ID NO:49 having not more than two amino acid changes, LCDR2 set forth in SEQ ID NO:50 or variants of LCDR2 set forth in SEQ ID NO:50 having not more than two amino acid changes, and LCDR3 set forth in SEQ ID NO:51 or variants of LCDR3 set forth in SEQ ID NO:51 having not more than two amino acid changes. (r) LCDR1 set forth in SEQ ID NO:49 or variants of LCDR1 set forth in SEQ ID NO:49 having not more than two amino acid changes, LCDR2 set forth in SEQ ID NO:52 or variants of LCDR2 set forth in SEQ ID NO:52 having not more than two amino acid changes, and LCDR3 set forth in SEQ ID NO:53 or variants of LCDR3 set forth in SEQ ID NO:53 having not more than two amino acid changes. (s) LCDR1 set forth in SEQ ID NO:54 or variants of LCDR1 set forth in SEQ ID NO:54 with no more than two amino acid changes, LCDR2 set forth in SEQ ID NO:35 or variants of LCDR2 set forth in SEQ ID NO:35 with no more than two amino acid changes, and LCDR3 set forth in SEQ ID NO:55 or variants of LCDR3 set forth in SEQ ID NO:55 with no more than two amino acid changes. For example, the antibody library is a Fab antibody library, an scFv antibody library, an scFab antibody library, or a full-length antibody library.

2. In the antibody library having heavy chain diversity and comprising a common light chain according to claim 1, the common light chain in the antibody library comprises a light chain variable region sequence set forth in any of SEQ ID NOs: 56-74, or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity with the light chain variable region sequence.

3. The antibody library of claim 1, which has heavy chain diversity and includes a common light chain, wherein the variable regions of the heavy chains in the antibody library are encoded by natural heavy chain germline genes in the human immunoglobulin locus (e.g., IGHV1, IGHV3 and / or IGHV4 heavy chain germline genes).

4. 2. The antibody library of claim 1, having heavy chain diversity and containing a common light chain, The heavy chain variable region is encoded by a nucleotide sequence recombined by an engineered technique. For example, the heavy chain variable region is encoded by a nucleotide sequence recombining any natural HCDR3 with any natural HCDR1 and HCDR2. For example, the antibody library contains at least 1 x 10^10 to 1 x 10^12 different antibodies. Preferably, at least 90% of the antibodies contained in the antibody library are functional. Preferably, the antibodies bind to the target antigen with a Kd value of 100 nM or less.

5. A method for preparing an antibody library according to any one of claims 1 to 3, comprising: (a) Construct a gene library of human natural antibodies. (b) Amplifying and recovering heavy chain nucleotide sequences from the human antibody gene library constructed in step (a). (c) obtaining a nucleotide sequence encoding the common light chain of claim 1 or 2; (d) The heavy chain nucleotide sequence obtained in step (b) and the common light chain nucleotide sequence obtained in step (c) are ligated into an expression vector (e.g., a phage vector, a yeast vector, or a mammalian cell vector) and expressed. For example, they can be expressed in prokaryotic cells (e.g., E. coli) or eukaryotic cells (e.g., yeast, mammalian cells).

6. 5. A method for preparing the antibody library of claim 4, comprising: (a) Construct a gene library of human natural antibodies. (b) Amplifying "CDR1+CDR2" and "CDR3" of the heavy chain gene sequence in the human antibody gene library constructed in step (a). For example, amplifying "CDR1+CDR2" of the heavy chain gene sequence using primers set forth in SEQ ID NO: 79-SEQ ID NO: 81, and amplifying "CDR3" of the heavy chain gene sequence using primers set forth in SEQ ID NO: 82-SEQ ID NO:

84. (c) The "CDR1+CDR2" and "CDR3" amplified in step (b) are combined using fusion PCR to obtain a PCR product. (d) The artificial heavy chain nucleotide sequence obtained in step (c) is amplified and recovered. (e) Obtaining a nucleotide sequence encoding the common light chain of claim 1 or 2. (f) The artificial heavy chain nucleotide sequence obtained in step (d) and the common light chain nucleotide sequence obtained in step (e) are ligated into an expression vector (e.g., a phage vector, a yeast vector, or a mammalian cell vector) and expressed. For example, they can be expressed in prokaryotic cells (e.g., E. coli) or eukaryotic cells (e.g., yeast, mammalian cells).

7. Use of an antibody library having heavy chain diversity and containing a common light chain according to any one of claims 1 to 4 for preparing bispecific antibodies having a common light chain.

8. A bispecific antibody comprising a first antigen-binding portion and a second antigen-binding portion, wherein the first antigen-binding portion and the second antigen-binding portion comprise a common light chain, and the common light chain is encoded by an IGKV3 or IGKV1 light chain germline gene. Preferably, the common light chain is encoded by an IGKV3-20, IGKV3-11, IGKV1-39, IGKV1-5, or IGKV1-33 light chain germline gene. More preferably, the common light chain is encoded by an IGKV3-20 or IGKV1-39 light chain germline gene. For example, the common light chain in the bispecific antibody comprises a CDR selected from: (a) LCDR1 set forth in SEQ ID NO:1 or variants thereof having no more than two amino acid changes in LCDR1 set forth in SEQ ID NO:1, LCDR2 set forth in SEQ ID NO:2 or variants thereof having no more than two amino acid changes in LCDR2 set forth in SEQ ID NO:2, and LCDR3 set forth in SEQ ID NO:3 or variants thereof having no more than two amino acid changes in LCDR3 set forth in SEQ ID NO:

3. (b) LCDR1 set forth in SEQ ID NO:4 or variants thereof having no more than two amino acid changes in LCDR1 set forth in SEQ ID NO:4, LCDR2 set forth in SEQ ID NO:5 or variants thereof having no more than two amino acid changes in LCDR2 set forth in SEQ ID NO:5, and LCDR3 set forth in SEQ ID NO:6 or variants thereof having no more than two amino acid changes in LCDR3 set forth in SEQ ID NO:

6. (c) LCDR1 set forth in SEQ ID NO:7 or variants of LCDR1 set forth in SEQ ID NO:7 having no more than two amino acid changes, LCDR2 set forth in SEQ ID NO:8 or variants of LCDR2 set forth in SEQ ID NO:8 having no more than two amino acid changes, and LCDR3 set forth in SEQ ID NO:9 or variants of LCDR3 set forth in SEQ ID NO:9 having no more than two amino acid changes. (d) LCDR1 set forth in SEQ ID NO:10 or variants thereof having no more than two amino acid changes in LCDR1 set forth in SEQ ID NO:10, LCDR2 set forth in SEQ ID NO:11 or variants thereof having no more than two amino acid changes in LCDR2 set forth in SEQ ID NO:11, and LCDR3 set forth in SEQ ID NO:12 or variants thereof having no more than two amino acid changes in LCDR3 set forth in SEQ ID NO:

12. (e) LCDR1 set forth in SEQ ID NO: 13 or variants of LCDR1 set forth in SEQ ID NO: 13 having not more than two amino acid changes, LCDR2 set forth in SEQ ID NO: 14 or variants of LCDR2 set forth in SEQ ID NO: 14 having not more than two amino acid changes, and LCDR3 set forth in SEQ ID NO: 15 or variants of LCDR3 set forth in SEQ ID NO: 15 having not more than two amino acid changes. (f) LCDR1 set forth in SEQ ID NO: 16 or variants of LCDR1 set forth in SEQ ID NO: 16 having not more than two amino acid changes, LCDR2 set forth in SEQ ID NO: 17 or variants of LCDR2 set forth in SEQ ID NO: 17 having not more than two amino acid changes, and LCDR3 set forth in SEQ ID NO: 18 or variants of LCDR3 set forth in SEQ ID NO: 18 having not more than two amino acid changes. (g) LCDR1 set forth in SEQ ID NO: 19 or variants of LCDR1 set forth in SEQ ID NO: 19 having not more than two amino acid changes, LCDR2 set forth in SEQ ID NO: 20 or variants of LCDR2 set forth in SEQ ID NO: 20 having not more than two amino acid changes, and LCDR3 set forth in SEQ ID NO: 21 or variants of LCDR3 set forth in SEQ ID NO: 21 having not more than two amino acid changes. (h) LCDR1 set forth in SEQ ID NO:22 or variants of LCDR1 set forth in SEQ ID NO:22 having not more than two amino acid changes, LCDR2 set forth in SEQ ID NO:23 or variants of LCDR2 set forth in SEQ ID NO:23 having not more than two amino acid changes, and LCDR3 set forth in SEQ ID NO:24 or variants of LCDR3 set forth in SEQ ID NO:24 having not more than two amino acid changes. (i) LCDR1 set forth in SEQ ID NO:25 or variants thereof having no more than two amino acid changes in LCDR1 set forth in SEQ ID NO:25, LCDR2 set forth in SEQ ID NO:26 or variants thereof having no more than two amino acid changes in LCDR2 set forth in SEQ ID NO:26, and LCDR3 set forth in SEQ ID NO:27 or variants thereof having no more than two amino acid changes in LCDR3 set forth in SEQ ID NO:

27. (j) LCDR1 set forth in SEQ ID NO:28 or variants of LCDR1 set forth in SEQ ID NO:28 having not more than two amino acid changes, LCDR2 set forth in SEQ ID NO:29 or variants of LCDR2 set forth in SEQ ID NO:29 having not more than two amino acid changes, and LCDR3 set forth in SEQ ID NO:30 or variants of LCDR3 set forth in SEQ ID NO:30 having not more than two amino acid changes. (k) LCDR1 set forth in SEQ ID NO:31 or variants of LCDR1 set forth in SEQ ID NO:31 having changes of not more than two amino acids, LCDR2 set forth in SEQ ID NO:32 or variants of LCDR2 set forth in SEQ ID NO:32 having changes of not more than two amino acids, and LCDR3 set forth in SEQ ID NO:33 or variants of LCDR3 set forth in SEQ ID NO:33 having changes of not more than two amino acids. (l) LCDR1 set forth in SEQ ID NO:34 or variants of LCDR1 set forth in SEQ ID NO:34 having not more than two amino acid changes, LCDR2 set forth in SEQ ID NO:35 or variants of LCDR2 set forth in SEQ ID NO:35 having not more than two amino acid changes, and LCDR3 set forth in SEQ ID NO:36 or variants of LCDR3 set forth in SEQ ID NO:36 having not more than two amino acid changes. (m) LCDR1 set forth in SEQ ID NO:37 or variants of LCDR1 set forth in SEQ ID NO:37 having not more than two amino acid changes, LCDR2 set forth in SEQ ID NO:38 or variants of LCDR2 set forth in SEQ ID NO:38 having not more than two amino acid changes, and LCDR3 set forth in SEQ ID NO:39 or variants of LCDR3 set forth in SEQ ID NO:39 having not more than two amino acid changes. (n) LCDR1 set forth in SEQ ID NO: 40 or variants of LCDR1 set forth in SEQ ID NO: 40 having not more than two amino acid changes, LCDR2 set forth in SEQ ID NO: 41 or variants of LCDR2 set forth in SEQ ID NO: 41 having not more than two amino acid changes, and LCDR3 set forth in SEQ ID NO: 42 or variants of LCDR3 set forth in SEQ ID NO: 42 having not more than two amino acid changes. (o) LCDR1 set forth in SEQ ID NO:43 or variants of LCDR1 set forth in SEQ ID NO:43 having not more than two amino acid changes, LCDR2 set forth in SEQ ID NO:44 or variants of LCDR2 set forth in SEQ ID NO:44 having not more than two amino acid changes, and LCDR3 set forth in SEQ ID NO:45 or variants of LCDR3 set forth in SEQ ID NO:45 having not more than two amino acid changes. (p) LCDR1 shown in SEQ ID NO: 46 or a variant of LCDR1 shown in SEQ ID NO: 46 having a change of not more than two amino acids, LCDR2 shown in SEQ ID NO: 47 or a variant of LCDR2 shown in SEQ ID NO: 47 having a change of not more than two amino acids, and LCDR3 shown in SEQ ID NO: 48 or a variant of LCDR3 shown in SEQ ID NO: 48 having a change of not more than two amino acids. (q) LCDR1 set forth in SEQ ID NO:49 or variants of LCDR1 set forth in SEQ ID NO:49 having not more than two amino acid changes, LCDR2 set forth in SEQ ID NO:50 or variants of LCDR2 set forth in SEQ ID NO:50 having not more than two amino acid changes, and LCDR3 set forth in SEQ ID NO:51 or variants of LCDR3 set forth in SEQ ID NO:51 having not more than two amino acid changes. (r) LCDR1 set forth in SEQ ID NO:49 or variants of LCDR1 set forth in SEQ ID NO:49 having not more than two amino acid changes, LCDR2 set forth in SEQ ID NO:52 or variants of LCDR2 set forth in SEQ ID NO:52 having not more than two amino acid changes, and LCDR3 set forth in SEQ ID NO:53 or variants of LCDR3 set forth in SEQ ID NO:53 having not more than two amino acid changes. (s) LCDR1 set forth in SEQ ID NO:54 or variants of LCDR1 set forth in SEQ ID NO:54 with no more than two amino acid changes, LCDR2 set forth in SEQ ID NO:35 or variants of LCDR2 set forth in SEQ ID NO:35 with no more than two amino acid changes, and LCDR3 set forth in SEQ ID NO:55 or variants of LCDR3 set forth in SEQ ID NO:55 with no more than two amino acid changes. Preferably, the common light chain in the bispecific antibody comprises a light chain variable region sequence set forth in any of SEQ ID NOs: 56-74, or a sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to said light chain variable region sequence.

9. 9. The bispecific antibody of claim 8, further comprising an Fc domain consisting of first and second subunits, wherein the first antigen-binding portion is fused to the C-terminus of the Fab heavy chain at the N-terminus of the first subunit of the Fc domain; The second antigen-binding portion is fused to the C-terminus of the Fab heavy chain by the N-terminus of the second Fc domain subunit. For example, the Fc domain is an Fc domain of an immunoglobulin molecule, particularly an Fc domain of an IgG class immunoglobulin. Preferably, it is an IgG1 or IgG4 Fc domain, more preferably a human IgG1 or IgG4 Fc domain.

10. 10. The bispecific antibody of claim 9, In the CH3 domain of the first subunit of the Fc domain, amino acid residues are substituted with amino acid residues having a larger side chain volume, thereby creating a knob in the CH3 domain of the first subunit that can be positioned within a hole in the CH3 domain of the second subunit, and in the CH3 domain of the second subunit of the Fc domain, amino acid residues are substituted with amino acid residues having a smaller side chain volume, thereby creating a cavity in the CH3 domain of the second subunit, and the knob in the CH3 domain of the first subunit can be positioned within the cavity in the CH3 domain of the second subunit, thereby allowing the heavy chains of the bispecific antibody to form a stable "knob-into-hole" association with each other.

11. An isolated polynucleotide encoding the bispecific antibody of any one of claims 8-10.

12. A vector, particularly an expression vector, comprising the isolated polynucleotide of claim 11.

13. 13. A host cell comprising the isolated polynucleotide of claim 11 or the vector of claim 12.

14. A method for producing a bispecific antibody according to any one of claims 8 to 10, comprising the steps of: a) culturing the host cell of claim 13 under conditions suitable for expression of the bispecific antibody, and b) Recover the bispecific antibody.