coronavirus vaccine

An mRNA encoding T2_17 or variants linked to a transmembrane domain enhances immune response breadth, addressing vaccine evasion by SARS-CoV-2 variants and providing improved protection.

JP2026508394APending Publication Date: 2026-03-10DIOSIMBACS LTD +1
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-03-01
Publication Date
2026-03-10

AI Technical Summary

Technical Problem

Current vaccines against SARS-CoV-2 and other coronaviruses are facing challenges due to the emergence of variants that evade neutralization by vaccine-induced immunity, necessitating the development of next-generation vaccines that provide broader protection against ACE2-binding sarbecoviruses and emerging variants of concern.

Method used

An mRNA encoding a polypeptide comprising the amino acid sequence of T2_17 or variants with high identity to T2_17, optionally linked to a transmembrane domain, is used to induce a broadly neutralizing immune response, including against SARS-CoV-2 variants.

Benefits of technology

The mRNA induces significantly higher and broader neutralizing antibody responses, including against SARS-CoV-2 variants, providing improved protection against current and emerging variants of concern.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026508394000087
    Figure 2026508394000087
  • Figure 2026508394000088
    Figure 2026508394000088
  • Figure 2026508394000089
    Figure 2026508394000089
Patent Text Reader

Abstract

Described herein are engineered messenger RNAs (mRNAs) encoding coronavirus polypeptides, as well as mRNA vaccine vectors, pharmaceutical compositions containing the mRNAs or vectors, and mRNA vaccines, and their use to induce immune responses against coronavirus family viruses. The engineered sequences include mRNA sequences encoding the engineered coronavirus receptor-binding domain (RBD) sequence CoV_S_T2_17, CoV_S_T2_17 containing the transmembrane domain sequence CoV_S_T2_20, CoV_S_T3_3 (T2_20v2), and CoV_S_T3_4 (T2_17_T2_20 dimer). Also described are polypeptides, nucleic acid molecules encoding the polypeptides, vectors, fusion proteins, pharmaceutical compositions, and their use as vaccines against coronavirus family viruses.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to messenger RNA (mRNA), mRNA vaccine vectors, pharmaceutical compositions comprising the mRNA or vectors, and mRNA vaccines, and their use to induce an immune response against viruses of the coronavirus family. [Background technology]

[0002] Coronaviruses (CoVs) cause a wide variety of animal and human diseases. Notable human diseases caused by CoVs are zoonotic diseases such as severe acute respiratory syndrome (SARS) and Middle East respiratory syndrome (MERS). Viruses within this family generally cause mild, self-limiting respiratory infections in immunocompetent humans, but can also cause severe, fatal illness characterized by the onset of fever, extreme fatigue, dyspnea, anoxia, and pneumonia. CoVs are transmitted through close contact via respiratory droplets from infected subjects, with varying degrees of infectivity within each strain.

[0003] CoVs belong to the family of coronavirus viruses, all of which are enveloped. CoVs contain a single-stranded, forward-oriented RNA genome, 25-31 kilobases in length (Siddell SG1995, The Coronaviridae), the largest genome yet found in an RNA virus. Based on phylogenetic clustering, the coronavirus family is subtyped into four genera: α, β, γ, and δ coronaviruses, with each genus further subdivided into clusters depending on the virus strain. For example, the genus β Lineage A (subgenus Envecovirus) includes HCoV-OC43 and HCoV-HKU1 (various species). Lineage B (subgenus Sarbecovirus) includes SARSr-CoV (including all strains of SARS-CoV, SARS-CoV-2, and Bat SL-CoV-WIV1). Lineage C (subgenus Merbecovirus) includes Tylonycteris bat coronavirus HKU4 (BtCoV-HKU4), Pipistrellus bat coronavirus HKU5 (BtCoV-HKU5), and MERS-CoV (various species). Lineage D (subgenus Novecovirus) includes the Rousettus bat coronavirus HKU9 (BtCoV-HKU9).

[0004] CoV virions are spherical with characteristic club-shaped spikes emanating from their surface. Virions contain four major structural proteins: spike (S); membrane (M); envelope (E); and nucleocapsid (N) proteins, all of which are encoded by the viral genome. Some subsets of β-CoVs contain a fifth structural protein, hemagglutinin esterase (HE), which enhances S protein-mediated cell entry and viral spread through mucosal membranes through its acetylesterase activity. Homotrimers of S glycoproteins constitute the unique spike structure on the viral surface. These trimers are class I fusion proteins that mediate viral binding to host receptors through the interaction of the S protein and its receptor. In most CoVs, S is cleaved by host cell proteases into two separate polypeptides—S1 and S2. S1 contains the receptor-binding domain (RBD) of the S protein (the exact positioning of the RBD varies depending on the virus strain), and S2 forms the stem of the spike molecule.

[0005] Figure 13 shows the SARS S protein architecture. Studies indicate that the N-terminal region of the S protein is much more diverse than the highly conserved C-terminal region (Dong et al., Genomic and protein structure modeling analysis depicts the origin and infectivity of 2019-nCoV, a new coronavirus which caused a pneumonia outbreak in Wuhan, China. 2020).

[0006] The SARS-CoV-2 S protein is 1,273 amino acids long and consists of an N-terminal signal peptide (amino acids 1–13), an S1 subunit (residues 14–685), and an S2 subunit (residues 686–1,273). The N-terminal sequence is responsible for relaying extracellular signals into the cell. The last two regions (S1 and S2 subunits) are responsible for receptor binding and membrane fusion, respectively. The S1 subunit contains an N-terminal domain (residues 14–305) and a receptor-binding domain (RBD, residues 319–541). The S2 subunit contains a fusion peptide (FP) (residues 788–806), a heptapeptide repeat 1 (HR1) (residues 912–984), a HR2 (residues 1,163–1,213), a transmembrane (TM) domain (residues 1213–1,237), and a cytoplasmic domain (residues 1237–1,273). The S protein trimer visually forms a characteristic bulbous coronal halo surrounding the virus particle. Based on the structure of the coronavirus S protein monomer, the S1 and S2 subunits form the bulbous head and stalk regions. The structure of the SARS-CoV-2 trimeric S protein has been determined by cryo-EM / X-ray crystallography at the atomic level, revealing different conformations of the S RBD domain in the open and closed states and their corresponding functions.

[0007] Among coronaviruses, the angiotensin-converting enzyme 2 (ACE-2)-binding viruses of the β-coronavirus genus pose the greatest pandemic risk (1, 2). Over the past two decades, two ACE2-binding sarbecoviruses (a subgenus of β-coronaviruses) have cross-species transmitted into human populations, causing the 2002 / 2003 SARS epidemic and the ongoing SARS-CoV-2 pandemic. Bats are reservoir hosts for numerous SARS-CoV-like ACE2-binding sarbecoviruses, posing a constant threat that could potentially lead to future cross-species transmission to humans and trigger new epidemics (3, 4). In addition to the emergence of new ACE2-binding viruses from zoonotic reservoir hosts, another concern is the emergence of mutations in these viruses that could evade vaccine-induced immunity, a consistent and worrying event observed in the ongoing pandemic.

[0008] As human infections increase worldwide during the current pandemic, viruses continue to undergo mutations, most significantly in the spike protein (5). Variants of concern (VOCs) are increasingly emerging, and they are associated with increased transmissibility and evasion from innate and vaccine immunity (6-9). The asparagine-to-tyrosine N501Y substitution in the receptor-binding domain (RBD) of the spike protein is a common feature of VOCs and is associated with increased affinity of the viral spike protein for the ACE-2 receptor and subsequent increased transmissibility (10). Notably, the majority of these mutations reported in VOCs are in or surrounding regions in the RBD that interact with ACE-2 and induce highly potent neutralizing antibodies (11, 12). In critical RBD epitopes, Delta VOCs (13) harbor L452R and T478K mutations, while Omicron-lineage VOCs harbor multiple mutations. The continued emergence of these VOCs in the ongoing COVID-19 pandemic and the constant threat of novel zoonotic interspecies transmission of coronaviruses from animals to humans highlights the need for next-generation vaccines that provide broader protection against ACE2-binding sarbecoviruses and emerging VOCs.

[0009] The two SARS-CoV-2 vaccines currently in use worldwide, BNT162b2 (the BioNTech vaccine manufactured by Pfizer) and mRNA-1273 (manufactured by Moderna), are based on lipid nanoparticle delivery of mRNA encoding a stabilized pre-fusion form of the spike protein from SARS-CoV-2 isolated from Wuhan, China, early in the outbreak. Both of these vaccines demonstrated greater than 94% efficacy in preventing coronavirus disease 2019 (COVID-19) in multinational Phase III clinical trials conducted in late 2020 (Polack et al., C4591001 Clinical Trial Group (2020). Safety and efficacy of the BNT162b2 mRNA COVID-19 vaccine. N. Engl. J. Med. 383, 2603-2615; Baden et al., COVE Study Group (2021). Efficacy and safety of the mRNA-1273 SARS-CoV-2 vaccine. N. Engl. J. Med. 384, 403-416). However, the emergence of new circulating variants has raised serious concerns about the efficacy of current vaccines, especially in countries where the epidemic is dominated by variants (Garcia-Beltran et al., 2021, Cell 184, 2372-2383: Multiple SARS-CoV-2 variants escape neutralization by vaccine-induced humoral immunity).

[0010] Therefore, there is a need to provide effective vaccines that induce broadly neutralizing immune responses to protect against emerging and re-emerging diseases caused by CoVs, particularly β-CoVs such as SARS-CoV and recently SARS-CoV-2. There is also a need to provide improved coronavirus vaccines that elicit broadly neutralizing antibodies against SARS-CoV-2 variants, particularly current and recent variants of concern. Furthermore, there is a need to provide vaccines that successfully counter vaccine evasion by new SARS-CoV-2 variants. WO 2021 / 198706 (Example 32, Figure 37B) describes the evaluation of the ability of a designed receptor-binding domain (RBD) sequence of the SARS-CoV-2 spike protein (known as "COV_S_T2_17" or "T2_17") to induce an immune response. DNA encoding T2_17 induced an immune response against both SAR-CoV and SARS-CoV-2 in mice. Similar immunogenic responses were observed in mice for T2_17 and T2_17 linked to the transmembrane domain (known as "COV_S_T2_17_TM," "T2_17_TM," "COV_S_T2_20," or "T2_20"). We surprisingly found that mRNA expressing T2_20 induced significantly higher SARS-CoV-2 binding antibody titers at relatively low doses compared with mRNA expressing the corresponding unlinked RBD (T2_17). Unexpectedly, compared with mRNA expressing the full-length spike antigen, mRNA expressing T2_20 also induced binding antibodies to SARS-CoV more rapidly, significantly higher antibody titers to SARS-CoV-2 more rapidly, and induced a broader neutralizing antibody response (including a neutralizing response to the SARS-CoV-2 omicron variant compared to the almost negligible neutralizing titer of this variant from mRNA expressing the full-length spike). [Prior art documents] [Patent documents]

[0011] [Patent Document 1] International Publication No. 2021 / 198706 [Non-patent literature]

[0012] [Non-Patent Document 1] Siddell SG1995,The Coronaviridae [Non-patent document 2] Dong et al,Genomic and protein structure modeling analysis depicts the origin and infectivity of 2019-nCoV,a new coronavirus which caused a pneumonia outbreak in Wuhan,China

Outdoor Tools3

Outdoor Tools 4

Direct Environment 5

Outdoor Configuration6

Direct Environment 7

Outdoor Track 8

Outdoor Content11

Outdoor Tools 12

Outdoor Content13

Fashion 14

Wood 15

Fashion 16

[0013] According to the present invention, there is provided an isolated messenger RNA (mRNA) encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 1 (T2_17), or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% amino acid identity to the amino acid sequence of SEQ ID NO: 1 over its entire length, and the amino acid sequence of a transmembrane domain.

[0014] [ka]

[0015] Optionally, the amino acid sequence of the encoded transmembrane domain is C-terminal to the amino acid sequence of SEQ ID NO:1 or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% amino acid identity to the amino acid sequence of SEQ ID NO:1 over its entire length.

[0016] Optionally, the amino acid sequence of the encoded transmembrane domain is linked to the amino acid sequence of SEQ ID NO:1 or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% amino acid identity to the amino acid sequence of SEQ ID NO:1 over its entire length by a linker amino acid sequence of up to 10 amino acid residues.

[0017] Optionally, the amino acid sequence of the encoded transmembrane domain is directly (i.e., without a linker amino acid sequence) linked to the amino acid sequence of SEQ ID NO:1 or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% amino acid identity to the amino acid sequence of SEQ ID NO:1 over its entire length.

[0018] The encoded transmembrane domain may comprise any suitable transmembrane domain amino acid sequence, including, for example, the amino acid sequence of the transmembrane domain of a coronavirus spike protein.

[0019] Optionally, the encoded transmembrane domain comprises the amino acid sequence of SEQ ID NO:2 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% amino acid identity over its entire length to the amino acid sequence of SEQ ID NO:2.

[0020] [ka]

[0021] Optionally, the mRNA of the present invention encodes the amino acid sequence of SEQ ID NO:1.

[0022] Optionally, the mRNA of the present invention comprises an RNA sequence of SEQ ID NO:8 or an RNA sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% ribonucleic acid identity over its entire length to the RNA sequence of SEQ ID NO:8 and encoding the amino acid sequence of SEQ ID NO:1.

[0023] Optionally, the mRNA of the present invention comprises the RNA sequence of SEQ ID NO:8.

[0024] [ka]

[0025] The present invention also provides an isolated RNA comprising the RNA sequence of SEQ ID NO:8, or an RNA sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% ribonucleic acid identity over its entire length to the RNA sequence of SEQ ID NO:8 and encoding the amino acid sequence of SEQ ID NO:1, or a complement thereof.

[0026] The present invention also provides an isolated RNA comprising the RNA sequence of SEQ ID NO: 8 or its complement.

[0027] The present invention also provides an isolated messenger RNA (mRNA) encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:1 (T2_17), or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% amino acid identity over its entire length to the amino acid sequence of SEQ ID NO:1.

[0028] The present invention also provides an isolated mRNA encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:1.

[0029] Optionally, the mRNA of the present invention comprises an RNA sequence of SEQ ID NO:8 or an RNA sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% ribonucleic acid identity over its entire length to the RNA sequence of SEQ ID NO:8 and encoding the amino acid sequence of SEQ ID NO:1.

[0030] Optionally, the mRNA of the present invention comprises the RNA sequence of SEQ ID NO:8.

[0031] Optionally, the mRNA of the present invention comprises the mRNA sequence of SEQ ID NO:7.

[0032] [ka]

[0033] Optionally, the mRNA of the present invention comprises an RNA sequence of SEQ ID NO: 4 or an RNA sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% ribonucleic acid identity over its entire length to the RNA sequence of SEQ ID NO: 4 and encoding the amino acid sequence of SEQ ID NO: 1.

[0034] [ka]

[0035] Optionally, the mRNA of the present invention comprises the RNA sequence of SEQ ID NO:4.

[0036] The present invention also provides an isolated RNA comprising the sequence of SEQ ID NO:4, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% ribonucleic acid identity over its entire length to the RNA sequence of SEQ ID NO:4, and encoding the amino acid sequence of SEQ ID NO:1, or a complement thereof.

[0037] Optionally, the mRNA of the present invention encodes the amino acid sequence of SEQ ID NO:2.

[0038] Optionally, the mRNA of the present invention comprises an RNA sequence of SEQ ID NO: 5 or an RNA sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% ribonucleic acid identity over its entire length to the RNA sequence of SEQ ID NO: 5 and encoding the amino acid sequence of SEQ ID NO: 2.

[0039] [ka]

[0040] Optionally, the mRNA of the present invention comprises the RNA sequence of SEQ ID NO:5.

[0041] The present invention also provides an isolated RNA comprising the sequence of SEQ ID NO:5, or an RNA sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% ribonucleic acid identity over its entire length to the RNA sequence of SEQ ID NO:5, and encoding the amino acid sequence of SEQ ID NO:2, or a complement thereof.

[0042] Optionally, the mRNA of the present invention encodes the amino acid sequence of SEQ ID NO: 3 (T2_20), or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% amino acid identity to the amino acid sequence of SEQ ID NO: 3 over its entire length.

[0043] [ka]

[0044] Optionally, the mRNA of the present invention encodes the amino acid sequence of SEQ ID NO:3.

[0045] Optionally, the mRNA of the present invention comprises an RNA sequence of SEQ ID NO: 10, or an RNA sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% ribonucleic acid identity over its entire length to the RNA sequence of SEQ ID NO: 10 and encoding the amino acid sequence of SEQ ID NO: 3.

[0046] [ka]

[0047] Optionally, the mRNA of the present invention comprises the RNA sequence of SEQ ID NO:10.

[0048] Optionally, the mRNA of the present invention comprises the mRNA sequence of SEQ ID NO:9.

[0049] [ka]

[0050] Optionally, the mRNA of the present invention comprises the mRNA sequence of SEQ ID NO:46.

[0051] [ka]

[0052] Optionally, the mRNA of the present invention comprises an RNA sequence of SEQ ID NO: 6, or an RNA sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% ribonucleic acid identity over its entire length to the RNA sequence of SEQ ID NO: 6 and encoding the amino acid sequence of SEQ ID NO: 3.

[0053] [ka]

[0054] Optionally, the mRNA of the present invention comprises the RNA sequence of SEQ ID NO:6.

[0055] The present invention also provides an isolated RNA comprising the sequence of SEQ ID NO:6, or an RNA sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% ribonucleic acid identity over its entire length to the RNA sequence of SEQ ID NO:6, and encoding the amino acid sequence of SEQ ID NO:3, or a complement thereof.

[0056] Also provided in accordance with the present invention is an isolated RNA encoding the amino acid sequence of SEQ ID NO: 1. Optionally, the RNA comprises an RNA sequence of SEQ ID NO:8, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29 or SEQ ID NO:30, or an RNA sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% ribonucleic acid identity over its entire length to the RNA sequence of SEQ ID NO:8, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29 or SEQ ID NO:30, and encoding the amino acid sequence of SEQ ID NO:1.

[0057] Also provided in accordance with the present invention is an isolated RNA encoding the amino acid sequence of SEQ ID NO: 3. Optionally, the RNA comprises an RNA sequence of SEQ ID NO: 10, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33 or SEQ ID NO: 34, or an RNA sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% ribonucleic acid identity over its entire length to an RNA sequence of SEQ ID NO: 10, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33 or SEQ ID NO: 34, and encoding the amino acid sequence of SEQ ID NO: 3.

[0058] A further aspect of the invention is an isolated RNA encoding the amino acid sequence of SEQ ID NO: 43. Optionally, the RNA comprises an RNA sequence of SEQ ID NO: 42 or an RNA sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% ribonucleic acid identity over its entire length to the RNA sequence of SEQ ID NO: 43. Optionally, the mRNA is a modified version of the mRNA comprising modified nucleosides. Optionally, one or more modified nucleosides are 5-iodouridine and 5-iodocytidine. Optionally, at least 50% of the uridines in the ORF are modified. Optionally, at least 50% of the uridines in the mRNA are modified. Optionally, at least 50% of the uridines in the ORF are modified to m1ψ. Optionally, between 5 and 50% of the uridine nucleotides are 5-iodouridine and between 5 and 50% of the cytidine nucleotides are 5-iodocytidine. Optionally, between 5 and 50% of the uridine nucleotides are 2-thiouridine and between 5 and 50% of the cytidine nucleotides are 5-methylcytidine.

[0059] The inventors recognized that advantageous immunogenic properties (e.g., increased antibody response and / or increased breadth of immune response) may also be provided by mRNA immunogens encoding other tethering coronavirus spike protein receptor-binding domains.

[0060] The present invention also provides an isolated mRNA encoding a polypeptide comprising the amino acid sequence of a coronavirus spike protein receptor binding domain (RBD) linked to the C-terminus, either directly or via a linker amino acid sequence of up to 10 amino acid residues, to the amino acid sequence of a transmembrane domain.

[0061] Optionally, the encoded RBD is a pre-fusion stabilized RBD.

[0062] Optionally, the encoded RBD is a SARS-CoV-2 RBD, e.g., a pre-fusion stabilized SARS-CoV-2 RBD.

[0063] The encoded transmembrane domain may be any suitable transmembrane domain, for example, as described above.

[0064] Optionally, the mRNA of the present invention is the product of in vitro transcription (IVT).

[0065] Optionally, the IVT mRNA of the present invention comprises a polyadenylation (poly(A)) tail downstream of the open reading frame (ORF) encoding the polypeptide.

[0066] Optionally, the mRNA of the present invention comprises one or more modified nucleosides.

[0067] Optionally, the or each modified nucleoside is selected from any of the following:

[0068] Pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-meth 2'-O-methyluridine, 5-methylcytosine, 5-methylcytidine, 5-iodo-cytidine, N1-methyladenosine, N6-methyladenosine.

[0069] Optionally, one or more modified nucleosides comprises a 1-methylpseudouridine (m1ψ) modification.

[0070] Optionally, the one or more modified nucleosides include at least one N1-methylpseudouridine (N1ψ) modification.

[0071] Optionally, the one or more modified nucleosides are 5-iodouridine and 5-iodocytidine.

[0072] Optionally, at least 50% of the uridines in the ORF are modified.

[0073] Optionally, at least 50% of the uridines in the ORF are modified to m1ψ.

[0074] Optionally, between 5 and 50% of the uridine nucleotides are 5-iodouridine and between 5 and 50% of the cytidine nucleotides are 5-iodocytidine. Optionally, between 5 and 50% of the uridine nucleotides are 2-thiouridine and between 5 and 50% of the cytidine nucleotides are 5-methylcytidine.

[0075] The present invention also provides an mRNA vaccine vector comprising the mRNA of the present invention.

[0076] The present invention also provides an mRNA vaccine comprising the mRNA of the present invention or the mRNA vaccine vector of the present invention encapsulated in a lipid nanoparticle (LNP).

[0077] The present invention further provides a pharmaceutical composition comprising the mRNA of the present invention, the mRNA vaccine vector of the present invention, or the mRNA vaccine of the present invention, and a pharmaceutically acceptable carrier, excipient, or diluent.

[0078] The present invention also provides the mRNA of the present invention, the mRNA vaccine vector of the present invention, the mRNA vaccine of the present invention, or the pharmaceutical composition of the present invention for use as a pharmaceutical.

[0079] The present invention further provides the mRNA of the present invention, the mRNA vaccine vector of the present invention, the mRNA vaccine of the present invention, or the pharmaceutical composition of the present invention for use in the prevention, treatment, or amelioration of coronavirus infection.

[0080] The present invention also provides use of the mRNA of the present invention, the mRNA vaccine vector of the present invention, the mRNA vaccine of the present invention, or the pharmaceutical composition of the present invention in the manufacture of a pharmaceutical for the prevention, treatment, or amelioration of coronavirus infection.

[0081] The present invention also provides a method for inducing an immune response against coronavirus in a subject, comprising administering to the subject an effective amount of the mRNA of the present invention, the mRNA vaccine vector of the present invention, the mRNA vaccine of the present invention, or the pharmaceutical composition of the present invention.

[0082] The present invention also provides a method for immunizing a subject against coronavirus, comprising administering to the subject an effective amount of the mRNA of the present invention, the mRNA vaccine vector of the present invention, the mRNA vaccine of the present invention, or the pharmaceutical composition of the present invention.

[0083] Optionally, the methods of the present invention comprise administering to a subject an mRNA of the present invention, an mRNA vaccine vector of the present invention, an mRNA vaccine of the present invention, or a pharmaceutical composition of the present invention as part of a prime-boost regimen.

[0084] Optionally, the coronavirus is a beta-coronavirus.

[0085] Optionally, the beta-coronavirus is a lineage B or C beta-coronavirus.

[0086] Optionally, the beta-coronavirus is a lineage B beta-coronavirus.

[0087] Optionally, the lineage B beta-coronavirus is SARS-CoV or SARS-CoV-2.

[0088] Optionally, the lineage C beta-coronavirus is MERS-CoV.

[0089] Optionally, the beta-coronavirus is a variant of concern (VOC).

[0090] Optionally, the beta-coronavirus is a SARS-CoV-2 VOC.

[0091] Optionally, the beta-coronavirus is SARS-CoV-2 beta, gamma, delta, or omicron VOC.

[0092] Optionally, the beta-coronavirus is a SARS-CoV-2 alphavirus.

[0093] Optionally, the beta-coronavirus is SARS-CoV-2 Omicron BA.2.12.1.

[0094] Optionally, the beta-coronavirus is SARS-CoV-2 Omicron BA.2.75.

[0095] Optionally, the beta-coronavirus is SARS-CoV-2 Omicron BA.2.3.20.

[0096] Optionally, the beta-coronavirus is SARS-CoV-2 Omicron BQ.1.1.

[0097] Optionally, the Omicron VOC is XBB.

[0098] Optionally, the Omicron VOC is XBB.1.5.

[0099] Optionally, the beta-coronavirus is SARS-CoV-2 Omicron XBB.1.5.

[0100] Optionally, the beta-coronavirus is SARS-CoV-2 Omicron XBB.1.19.1.

[0101] Optionally, the beta-coronavirus is SARS-CoV-2 Omicron XBC.1.

[0102] Optionally, the beta-coronavirus is SARS-CoV-2 Omicron BQ.1.12.

[0103] Optionally, the beta-coronavirus is SARS-CoV-2 Omicron XBB.1.9.1.

[0104] Optionally, the beta-coronavirus is SARS-CoV-2 Omicron CH.1.1.1.

[0105] Optionally, the beta-coronavirus is SARS-CoV-2 Omicron BA.2.

[0106] Optionally, the beta-coronavirus is SARS-CoV-2 Omicron BA.2.86.

[0107] Optionally, the SARS-CoV-2 is the Wuhan strain.

[0108] Optionally, the subject is a human subject.

[0109] Optionally, coronavirus infection causes long COVID-19 following initial infection with SARS-CoV-2. Long COVID is broadly defined as the signs, symptoms, and conditions that persist or develop after initial SARS-CoV-2 infection.

[0110] mRNA vaccines The mRNA of the present invention can be provided as part of an mRNA vaccine.

[0111] Messenger RNA (mRNA) vaccines are a new form of vaccine (reviewed recently in Pardi et al., Nature Reviews Drug Discovery Volume 17, pages 261-279 (2018) and Wang et al., Molecular Cancer (2021) 20:33: mRNA Vaccine: A Potential Therapeutic Strategy). The first mRNA vaccines approved for use were BNT162b2 (Pfizer) and mRNA-1273 (Moderna) during the COVID-19 pandemic. mRNA vaccines have the unique feature of promoting antigen expression transiently (typically for several days). Expression of exogenous antigens is controlled by the lifespan of the mRNA encoding, which is regulated by cellular degradation pathways. This transient nature of protein expression is extremely beneficial for vaccines that require repeated administration for the treatment of genetic diseases and cancer, but where prime or prime-boost vaccination is sufficient to develop highly specific adaptive immunity without exposure to infectious disease.

[0112] mRNA-based vaccines induce an immune response after synthetic mRNA encoding viral antigens is introduced into human cells. The cytosolic mRNA molecules are then translated into specific viral antigens by the host's own cellular machinery. These antigens are then presented on the cell surface where they can be recognized by immune cells, eliciting an immune response.

[0113] The structural elements of vaccine vector mRNA molecules are similar to those of natural mRNAs, including a 5' cap, a 5' untranslated region (UTR), a coding region (e.g., containing an open reading frame encoding a polypeptide of the present invention), a 3' UTR, and a poly(A) tail. The 5' UTR (also known as a leader sequence, transcript leader, or leader RNA) is a region of an mRNA immediately preceding the start codon. This region is important for regulating the translation of a transcript. In many organisms, the 5' UTR forms complex secondary structures to regulate translation. The 5' UTR begins at the transcription start site and ends one nucleotide (nt) before the start sequence of the coding region (usually AUG). In eukaryotes, the length of the 5' UTR can range from 100 nucleotides to several thousand nucleotides. These differences in length may be due to the complexity of eukaryotic regulation borne by the 5' UTR and the larger preinitiation complex that must form for translation initiation. Eukaryotic 5' UTRs contain a Kozak consensus sequence ( ) containing the start codon AUG.

[0114] [ka] (start codon underlined).

[0115] [ka] (start codon underlined) may be used.

[0116] The 5' and 3' UTR elements flanking the coding sequence strongly influence mRNA stability and translation, both of which are important considerations for vaccines. These regulatory sequences, derived from viral or eukaryotic genes, can significantly increase the half-life and expression of therapeutic mRNAs. For example, the 5' UTR of the mRNA of the present invention can contain a Kozak consensus sequence or an extended Kozak sequence along with the start codon of the mRNA. Optionally, the 5' UTR of the mRNA of the present invention contains any one of the following sequences immediately upstream of the start codon sequence: GGAGACGCCACC (SEQ ID NO: 11), GGGAGACGCCACC (SEQ ID NO: 47), or GGGAGACUGCCACC (SEQ ID NO: 14).

[0117] Optionally, the 5'UTR of the mRNA of the invention comprises a minimal UTR and a Kozak sequence immediately upstream of the start codon sequence T7, T3, SP6 or K11 polymerase binding domain, such as: GGAGACGCCACC (SEQ ID NO: 11), GGGAGACGCCACC (SEQ ID NO: 47), GGGACGCCACC (SEQ ID NO: 12), GGGACGCCACC (SEQ ID NO: 13), GGGGAGACUGCCACC (SEQ ID NO: 14), GAAGCTGCCACC (SEQ ID NO: 15) or GGGACTGCCACC (SEQ ID NO: 16).

[0118] A 5' cap structure is required for efficient protein production from mRNA. Various versions of 5' caps can be added during or after the transcription reaction using vaccinia virus-derived capping enzyme, or by incorporating synthetic caps or anti-reverse cap analogs (see Pardiet et al., supra). Anti-reverse cap analogs (ARCAs) are cap analogs used during in vitro transcription to generate capped transcripts. ARCAs are modified to ensure incorporation only in the forward orientation. Anti-reverse cap analogs (ARCAs) have a 3' OH group (m 7 G) is a modified cap analogue in which -OCH3 is substituted.

[0119] [ka] Conventional cap analogue: R = H, m 7 G(5')pppG, ARCA: R = CH3,3'-O-Me-m 7 G(5')pppG

[0120] Because of this substitution, RNA polymerase can initiate transcription only at the remaining hydroxyl group, which forces ARCA to be incorporated in the forward orientation. As a result, unlike transcripts synthesized with conventional cap analogs, 100% of transcripts synthesized with ARCA at the 5' end are translatable, resulting in a strong stimulatory effect on translation.

[0121] The 3'UTR may contain a sequence to generate a restriction site when in a vector, such as GAAUU. Also, a 3'UTR that may be used is the CYBA 3'UTR (CCUCGCCCCGGACCUGCCCUCCCGCCAGGUGCACCCACCUGCAAUAAAUGCAGCGAAGCCGGGA, SEQ ID NO: 26).

[0122] Poly(A) tails also play important regulatory roles in mRNA translation and stability. Therefore, an optimal length of poly(A) must be added to mRNA either directly from the encoding DNA template, by using poly(A) polymerase (Pardie et al., supra), or by ligation after in vitro transcription. Poly(A) is a nucleotide sequence consisting of 90 A nucleotides (A 90 ) or longer, 100 A nucleotides (A 100 ) or longer, 110 A nucleotides (A 110 ) or longer, 120 A nucleotides (A 120 ) or longer, 130 A nucleotides (A 130 ) or longer, 150 A nucleotides (A 150 ) or longer, 180 A nucleotides (A180 ) or longer, 190 A nucleotides (A 190 ) or longer. Suitable lengths of poly(A) tails include, for example, poly(A) tails of about 120 The poly(A) tail may be a segmented poly(A) tail, as disclosed in WO2020074642(A1), which is incorporated herein by reference. Optionally, the segmented poly(A) has the structure A 55~65 -SA 55~65 where S is a single nucleotide selected from C, G, T, or U. Optionally, the poly(A) may have the structure: A 55~65 -N-S4-NA 55~65 wherein N is a nucleotide that is not adenine, and S4 is four nucleotides selected from A, C, G, T, or U. 。 Optionally, the segmented poly(A) is the poly(A) of SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39 or SEQ ID NO:40.

[0123] Codon usage further influences protein translation. Substitution of rare codons in mRNA with frequently used synonymous codons for which the corresponding tRNAs are abundant in the cytoplasm is a common approach to increase protein production. Enrichment of G:C content constitutes another form of sequence optimization that has been shown to increase steady-state mRNA levels in vitro and protein expression in vivo (Pardie et al., supra).

[0124] Two major types of RNA are currently being investigated as vaccines: non-replicating mRNA and self-amplifying viral RNA. Both types of vaccines share a common structure in the mRNA construct, but self-amplifying RNA vaccines contain additional sequences in the coding region for RNA replication, including an RNA-dependent RNA polymerase.

[0125] The BNT162b2 vaccine construct contains a lipid nanoparticle (LNP)-encapsulated mRNA molecule encoding the trimerized full-length SARS2 S protein with a PP mutation (residue positions 986-987). The mRNA is encapsulated in 80 nm ionizable cationic lipid nanoparticles. The mRNA-1273 vaccine construct is also based on an LNP vector, but the synthetic mRNA encapsulated within the lipid construct encodes the full-length SARS2 S protein.

[0126] US Patent Application No. 10,702,600 (B1) (ModernaTX) describes betacoronavirus mRNA vaccines that contain LNPs suitable for use in such vaccines.

[0127] The mRNA vaccines of the present invention can be formulated in lipid nanoparticles.

[0128] mRNA vaccines have several advantages over conventional vaccines containing inactivated (or attenuated) pathogens. First, mRNA-based vaccines can be developed rapidly due to their design flexibility and the construct's ability to mimic the structure and expression of antigens during natural infection. mRNA vaccines can be developed within days to months based on target virus sequence information, whereas conventional vaccines often require years of development, requiring a deep understanding of the target virus to create an effective and safe vaccine. Second, these novel vaccines can be manufactured quickly. Due to the high yields from in vitro transcription reactions, mRNA production can be rapid, inexpensive, and scalable. Third, vaccine-associated risks are low. mRNA does not contain infectious viral components that pose a risk of infection or insertional mutagenesis. Because mRNA is a minimally immunogenic gene vector, it also circumvents anti-vector immunity and allows for repeated vaccine administration. A challenge for the effective application of mRNA vaccines lies in cytoplasmic delivery. mRNA isolates are rapidly degraded by extracellular RNases and cannot penetrate the cell membrane and be transcribed in the cytosol. However, efficient in vivo delivery can be achieved by formulating mRNA into carrier molecules, which allow rapid uptake and expression in the cytoplasm. To date, numerous delivery methods have been developed, including lipid-, polymer-, or peptide-based delivery, virus-like replicon particles, cationic nanoemulsions, naked mRNA, and dendritic cell-based delivery (each reviewed in Wang et al., supra). Delivery via divalent cationic lipid nanoparticles (LNPs) is the most promising and commonly used delivery means for mRNA vaccines.

[0129] Exogenous mRNA can be highly immunostimulatory. Single-stranded RNA (ssRNA) molecules are considered pathogen-associated molecular patterns (PAMPs) and are recognized by various Toll-like receptors (TLRs), which induce pro-inflammatory responses. While a strong cellular and humoral immune response is desirable in response to vaccination, the innate immune response elicited by exogenous mRNA can cause unwanted side effects in the subject. U-rich sequences in mRNA are important elements for activating TLRs (Wang et al., supra). Furthermore, enzymatically synthesized mRNA preparations contain double-stranded RNA (dsRNA) contaminants as aberrant products of the in vitro transcription (IVT) process. dsRNA is a potent PAMP (pathogen-associated molecular pattern) that induces downstream responses that inhibit translation and cause degradation of intracellular mRNA and ribosomal RNA (Pardie et al., supra). Therefore, mRNA may suppress antigen expression and thus reduce vaccine efficacy.

[0130] Research over the past decade has shown that the immunostimulatory effects of mRNA can be enhanced by purifying IVT mRNA, incorporating modified nucleosides, complexing mRNA with various carrier molecules (Pardie et al., supra), adding poly(A) tails, or optimizing mRNA with GC-rich sequences (Wang et al., supra). Chemical modification of uridine is a common approach to minimize the immunogenicity of exogenous mRNA. Incorporation of pseudouridine (Ψ) and N1-methylpseudouridine (m1Ψ) into IVT mRNA prevents TLR activation and other innate immune sensors, thus reducing proinflammatory signaling in response to exogenous mRNA. Such nucleoside modifications can also suppress the recognition of dsRNA species (Pardiet et al., op. cit.) and reduce innate immune sensing of exogenous mRNA translation (Houet et al. Nature Reviews Materials, 2021, https: / / doi.org / 10.1038 / s41578-021-00358-0).

[0131] Other nucleoside chemical modifications include, but are not limited to, 5-methylcytidine (m5C), 5-methyluridine (m5U), N1-methyladenosine (m1A), N6-methyladenosine (m6A), 2-thiouridine (s2U), and 5-methoxyuridine (5MoU) (Wang et al., supra).

[0132] The IVT mRNA molecules used in the mRNA-1273 and BNT162b2 COVID-19 vaccines were prepared by substituting mΨ for uridine, and their sequences were optimized to encode a stabilized prefusion spike protein with two central proline substitutions (Houet et al., supra). However, CureVac's mRNA vaccine candidate, CVnCoV, uses unmodified nucleosides and relies on a combination of mRNA sequence changes to enable immune evasion without affecting the expressed protein. First, CVnCoV has a higher GC content (63%) than rival vaccines (BNT162b2 has 56%) and the original SARS-CoV-2 virus itself (37%). Second, the vaccine contains a C-rich motif that binds to poly(C)-binding proteins, enhancing both mRNA stability and expression. Further modifications of CVnCoV include histone stem-loop sequences and poly(A) tails to enhance mRNA longevity and translation (Hubert, B., 2021). A brief overview of the CureVac vaccine and wonders of nature: URL https: / / berthub.eu / articles / posts / curevac-vaccine-and-wonders-of-biology / (accessed 15.09.21). However, the vaccine showed disappointing results in Phase III clinical trials, and experts attribute this to the decision not to incorporate chemically modified nucleosides into the mRNA sequence. Nevertheless, CureVac and Acuitas Therapeutics delivered GC-codon-rich erythropoietin (EPO)-encoding mRNA to pigs using lipid nanoparticles (LNPs). The results showed that EPO-related responses were induced without any immunogenicity (Wang et al., supra), suggesting that mRNA-based vaccines containing unmodified nucleosides still have potential.

[0133] The RNA of the present invention may include mRNA.

[0134] The mRNA of the present invention, the pharmaceutical composition or the vector of the present invention can be provided as part of an mRNA vaccine.

[0135] The vector of the present invention may comprise a DNA sequence corresponding to SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8, and optionally comprises any one of the following sequences immediately upstream of the start codon sequence: TAATACGACTCACTATA GGGAGACGCCACC (SEQ ID NO:17), AATTAACCCTCACTAAA GGGAGACGCCACC (SEQ ID NO:18), ATTTAGGGTGACACTATA GAAGCGCCACC (SEQ ID NO:19), AATTAGGGCACACTATA GGGACGCCACC (SEQ ID NO:20), TAATACGACTCACTATA GGGAGA CTGCCACC (SEQ ID NO:21), AATTAACCCTCACTAAAGGGAGA CTGCCACC (SEQ ID NO:22), ATTTAGGGTGACACTATAGAAG CTGCCACC (SEQ ID NO:23), AATTAGGGCACACTATAGGGA CTGCCACC (SEQ ID NO:24), or CGCGCCUAGCAGUGUCCCAGCCGGGUUCGUGUCGCC (SEQ ID NO:25). The above sequences may be placed upstream of the ATG of any of the mRNA sequences of the invention, including full-length spike (SEQ ID NO: 44), COV_S_T2_17 (SEQ ID NO: 4) and / or T2_20 (SEQ ID NO: 6).

[0136] The mRNA, pharmaceutical composition, vector or vaccine of the invention may include one or more modified nucleosides.

[0137] One or more modified nucleosides may be present in an RNA or mRNA of the invention, or in the mRNA of a pharmaceutical composition, vector or vaccine of the invention.

[0138] Optionally, the at least one chemical modification is selected from pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine, 5-iodo-uridine, and 2'-O-methyluridine. In some embodiments, the chemical modification is at the 5-position of the uracil. In some embodiments, the chemical modification is N1-methylpseudouridine. In some embodiments, the chemical modification is N1-ethylpseudouridine.

[0139] For example, the RNA or mRNA of the invention, or the mRNA of a pharmaceutical composition, vector or vaccine of the invention, may include one or more of the following modified nucleosides: pseudouridine (Ψ); N1-methylpseudouridine (m1Ψ) 5-methylcytidine (m5C) 5-methyluridine (m5U) N1-methyladenosine (m1A) N6-methyladenosine (m6A) 2-thiouridine (s2U) 5-Methoxyuridine (5moU) 5-iodouridine 5-iodocytidine.

[0140] In some embodiments, 100% of the uracils in the entire mRNA have a chemical modification. In some embodiments, 100% of the uracils in an open reading frame have a chemical modification. In some embodiments, the chemical modification is at the 5-position of the uracil. In some embodiments, the chemical modification is N1-methylpseudouridine. In some embodiments, 100% of the uracils in an mRNA have N1-methylpseudouridine at the 5-position of the uracil. In some embodiments, 100% of the uracils in an open reading frame have N1-methylpseudouridine at the 5-position of the uracil. In some embodiments, 5-50% of the uridine nucleotides are 5-iodouridine and 5-50% of the cytidine nucleotides are 5-iodocytidine. In some embodiments, 5-50% of the uridine nucleotides are 5-iodouridine and 5-50% of the cytidine nucleotides are 5-iodocytidine. In some embodiments, 5-50% of the uridine nucleotides are 2-thiouridine and 5-50% of the cytidine nucleotides are 5-methylcytidine.

[0141] The RNA or mRNA of the invention, or the mRNA of the pharmaceutical composition, vector, or vaccine of the invention, may contain from about 1% to about 100% modified nucleotides (or nucleosides) (with respect to the total nucleotide content, or with respect to any one or more types of nucleotides (or nucleosides), i.e., A, G, U, or C), or any intervening percentage (e.g., 1% to 20%, 1% to 25%, 1% to 50%, 1% to 60%, 1% to 70%, 1% to 80%, 1% to 90%, 1% to 95%, 10% to 20%, 10% to 25%, 10% to 25%, 10% to 30%, 10% to 35 ... %~50%, 10%~60%, 10%~70%, 10%~80%, 10%~90%, 10%~95%, 10%~100%, 20%~25%, 20%~50%, 20%~60%, 20%~70%, 20%~80%, 20%~90%, 20%~95%, 20%~100%, 50%~60%, 50 The remaining percentages may be accounted for by the presence of unmodified A, G, U, or C.

[0142] Optionally, the RNA or mRNA of the present invention, or the mRNA of the pharmaceutical composition, vector or vaccine of the present invention, comprises an RNA molecule in which the nucleic acid sequence of the molecule is the same as set forth in the respective SEQ ID NO:, but in which each "U" is replaced by mΨ.

[0143] Optionally, the RNA or mRNA of the invention, or the mRNA of the pharmaceutical composition, vector, or vaccine of the invention, comprises an RNA molecule in which the nucleic acid sequence of the molecule is the same as set forth in the respective SEQ ID NO: but in which at least 50% of the "U"s are replaced with mlΨ. The remaining "U"s may be all unmodified or may include unmodified nucleosides and one or more other modified nucleosides.

[0144] Optionally, the RNA or mRNA of the invention, or the mRNA of the pharmaceutical composition, vector, or vaccine of the invention, comprises an RNA molecule in which the nucleic acid sequence of the molecule is the same as set forth in the respective SEQ ID NO: but in which at least 70% of the "U"s are replaced with mlΨ. The remaining "U"s may be all unmodified or may include unmodified nucleosides and one or more other modified nucleosides.

[0145] Optionally, the RNA or mRNA of the invention, or the mRNA of the pharmaceutical composition, vector, or vaccine of the invention, comprises an RNA molecule in which the nucleic acid sequence of the molecule is the same as set forth in the respective SEQ ID NO: but in which at least 90% of the "U"s are replaced with mlΨ. The remaining "U"s may all be unmodified or may include unmodified nucleosides and one or more other modified nucleosides.

[0146] Optionally, the RNA or mRNA of the present invention, or the mRNA of the pharmaceutical composition, vector or vaccine of the present invention, comprises an RNA molecule in which the nucleic acid sequence of the molecule is the same as set forth in the respective SEQ ID NO:, but in which 100% of the "U"s are replaced with m1Ψ.

[0147] The mRNA vaccines of the present invention may be co-administered with immunological adjuvants such as MF59 (Novartis), TriMix, RNActive (CureVac AG), RNAdjuvant (reviewed again in Wang et al., supra).

[0148] Polynucleotides According to the present invention, there is provided an isolated polynucleotide comprising a first nucleotide sequence encoding SEQ ID NO: 53 (CoV_S_T2_20 scaffold sequence) or its complement, and a second nucleotide sequence encoding SEQ ID NO: 53 (CoV_S_T2_20 scaffold sequence) or its complement.

[0149] SEQ ID NO: 53 below shows the scaffold RBD sequences for the CoV_S_T2_20 (SEQ ID NO: 3), CoV_S_T3_3 (SEQ ID NO: 50) and CoV_S_T3_4 (SEQ ID NO: 52) designed structures (without leader sequences), and the amino acid sequences of the constant regions of the scaffolds are provided, with each variable amino acid residue (i.e., an amino acid residue that can be altered to provide an antigen that induces a neutralizing immune response against new and / or future SARS-CoV-2 variants) represented by an X (shown underlined in the sequence below).

[0150] [ka]

[0151] Examples of sequences provided herein that are covered by this scaffold sequence are SEQ ID NOs: 3 and 48 (CoV_T2_20 without and with leader sequence, respectively), SEQ ID NOs: 49 and 50 (CoV_S_T3_3 (T2_20v2) with and without leader sequence, respectively), and SEQ ID NOs: 51 and 52 (CoV_S_T3_4 (T2_17_T2_20 dimer) with and without leader sequence). Example 5 below provides details of the scaffold sequence.

[0152] According to the present invention, there is provided an isolated polynucleotide comprising a first nucleotide sequence encoding SEQ ID NO:1 (T2_17) or its complement, and a second nucleotide sequence encoding SEQ ID NO:1 (T2_17) or its complement.

[0153] Optionally, the isolated polynucleotide of the present invention further comprises a nucleotide sequence encoding SEQ ID NO:2 (the transmembrane domain amino acid sequence).

[0154] According to the present invention, there is provided an isolated polynucleotide comprising a nucleotide sequence encoding SEQ ID NO: 50 (CoV_S_T3_3) or its complement.

[0155] According to the present invention, there is provided an isolated polynucleotide comprising a nucleotide sequence encoding SEQ ID NO: 52 (CoV_S_T3_4) or its complement.

[0156] Optionally, the isolated polynucleotide according to the present invention further comprises a nucleotide sequence encoding a leader amino acid sequence, preferably SEQ ID NO: 54 (leader amino acid sequence).

[0157] According to the present invention, there is provided an isolated polynucleotide comprising a nucleotide sequence encoding SEQ ID NO: 48 (T2_20).

[0158] According to the present invention, there is provided an isolated polynucleotide comprising a nucleotide sequence encoding SEQ ID NO: 49 (CoV_S_T3_3).

[0159] According to the present invention, there is provided an isolated polynucleotide comprising a nucleotide sequence encoding SEQ ID NO: 51 (CoV_S_T3_4).

[0160] Also provided are pharmaceutical compositions comprising an isolated polynucleotide of the invention and a pharmaceutically acceptable carrier, excipient, or diluent.

[0161] Further provided by the present invention is a pharmaceutical composition comprising an isolated polynucleotide according to the present invention, further comprising an adjuvant for enhancing the immune response in a subject to the polypeptide of the composition or a polypeptide encoded by the nucleotide.

[0162] Also provided is a vector comprising an isolated polynucleotide according to the invention and separate promoters operably linked to different nucleotide sequences of the polynucleotide.

[0163] The or each vector of the pharmaceutical composition or combination formulation of the present invention may be an mRNA vector.

[0164] The present invention also provides an isolated cell comprising a vector of the present invention.

[0165] Polypeptides According to the present invention, there is provided an isolated polypeptide comprising a first amino acid sequence of SEQ ID NO: 53 (CoV_S_T2_20 scaffold sequence) and a second amino acid sequence of SEQ ID NO: 53 (CoV_S_T2_20 scaffold sequence).

[0166] According to the present invention, there is provided an isolated polypeptide comprising a first amino acid sequence (T2_17) of SEQ ID NO:1 and a second amino acid sequence (T2_17) of SEQ ID NO:1.

[0167] Optionally, the isolated polypeptide according to the invention further comprises the amino acid sequence of SEQ ID NO: 2 (transmembrane domain amino acid sequence).

[0168] According to the present invention, there is provided an isolated polypeptide comprising the amino acid sequence of SEQ ID NO: 50 (CoV_S_T3_3).

[0169] According to the present invention, there is provided an isolated polypeptide comprising the amino acid sequence of SEQ ID NO: 52 (CoV_S_T3_4).

[0170] Optionally, the isolated polypeptide according to the invention further comprises a leader amino acid sequence, preferably SEQ ID NO: 54 (leader amino acid sequence).

[0171] According to the present invention, there is provided an isolated polypeptide comprising the amino acid sequence of SEQ ID NO: 48 (T2_20).

[0172] According to the present invention, there is provided an isolated polypeptide comprising the amino acid sequence of SEQ ID NO: 49 (CoV_S_T3_3).

[0173] According to the present invention, there is provided an isolated polypeptide comprising the amino acid sequence of SEQ ID NO: 51 (CoV_S_T3_4).

[0174] Also provided is a pharmaceutical composition comprising an isolated polypeptide of the invention and a pharmaceutically acceptable carrier, excipient, or diluent.

[0175] Also provided are pharmaceutical compositions that include an adjuvant for enhancing the immune response in a subject to the polypeptide of the composition.

[0176] The present invention further provides a fusion protein comprising an isolated polypeptide of the present invention.

[0177] The present invention also provides pseudotyped virus particles comprising an isolated polypeptide of the present invention.

[0178] Also provided according to the present invention is an isolated polynucleotide of the present invention, an isolated polypeptide of the present invention, a pharmaceutical composition of the present invention or a vector of the present invention for use as a medicament.

[0179] The present invention also provides the isolated polypeptide of the present invention, the pharmaceutical composition of the present invention, or the vector of the present invention for use in the prevention, treatment, or amelioration of coronavirus infection.

[0180] The present invention also provides use of the isolated polypeptide of the present invention, the pharmaceutical composition of the present invention, or the vector of the present invention in the manufacture of a medicament for the prevention, treatment, or amelioration of coronavirus infection.

[0181] The present invention also provides an isolated polynucleotide of the present invention, an isolated polypeptide of the present invention, a pharmaceutical composition of the present invention, or a vector of the present invention for use in inducing an immune response to coronavirus in a subject.

[0182] The present invention also provides use of the isolated polynucleotide of the present invention, the isolated polypeptide of the present invention, the pharmaceutical composition of the present invention, or the vector of the present invention in the manufacture of a medicament for inducing an immune response against coronavirus in a subject.

[0183] Also provided according to the present invention is an isolated polynucleotide of the present invention, an isolated polypeptide of the present invention, a pharmaceutical composition of the present invention, or a vector of the present invention for use in immunizing a subject against coronavirus.

[0184] The present invention also provides the use of an isolated polynucleotide of the invention, an isolated polypeptide of the invention, a pharmaceutical composition of the invention, or a vector of the invention in the manufacture of a medicament for immunizing a subject against coronavirus.

[0185] The present invention also provides a method of inducing an immune response to coronavirus in a subject, the method comprising administering to the subject an effective amount of: the isolated polynucleotide of the present invention; an isolated polypeptide of the present invention; a pharmaceutical composition of the present invention; or Vectors of the present invention.

[0186] The present invention also provides a method of immunizing a subject against coronavirus, the method comprising administering to the subject an effective amount of: the isolated polynucleotide of the present invention; an isolated polypeptide of the present invention; a pharmaceutical composition of the present invention; or Vectors of the present invention.

[0187] Treatment and Use The present invention also provides a method for inducing an immune response against coronavirus in a subject, comprising administering to the subject an effective amount of the mRNA of the present invention, the vector of the present invention, the pharmaceutical composition of the present invention, or the vaccine of the present invention.

[0188] The present invention also provides a method for immunizing a subject against coronavirus, comprising administering to the subject an effective amount of the mRNA of the present invention, the vector of the present invention, the pharmaceutical composition of the present invention, or the vaccine of the present invention.

[0189] An effective amount is an amount that generates an antigen-specific immune response in a subject.

[0190] Optionally, the method comprises administering an effective amount of the mRNA of the present invention, the vector of the present invention, the pharmaceutical composition of the present invention, or the vaccine of the present invention to a subject previously seroconverted with an mRNA, vector, pharmaceutical composition, or vaccine encoding or comprising a full-length coronavirus spike protein. Optionally, the coronavirus is a sarbecovirus. Optionally, the mRNA of the present invention, the vector of the present invention, the pharmaceutical composition of the present invention, or the vaccine of the present invention comprises or consists of SEQ ID NO:4 or SEQ ID NO:7. Optionally, the mRNA, vector, pharmaceutical composition, or vaccine encoding or comprising a full-length coronavirus spike protein is an mRNA comprising or consisting of any one of SEQ ID NOs:41-43.

[0191] Further provided is the mRNA of the present invention, the vector of the present invention, the pharmaceutical composition of the present invention or the vaccine of the present invention for use as a medicament.

[0192] The present invention further provides the mRNA of the present invention, the vector of the present invention, the pharmaceutical composition of the present invention, or the vaccine of the present invention for use in the prevention, treatment, or amelioration of coronavirus infection.

[0193] The present invention also provides use of the mRNA of the present invention, the vector of the present invention, the pharmaceutical composition of the present invention, or the vaccine of the present invention in the manufacture of a pharmaceutical for the prevention, treatment, or amelioration of coronavirus infection.

[0194] Optionally, the coronavirus is a β-coronavirus.

[0195] Optionally, the β-coronavirus is a lineage B or C β-coronavirus.

[0196] Optionally, the β-coronavirus is a lineage B β-coronavirus.

[0197] Optionally, the lineage Bβ-coronavirus is SARS-CoV or SARS-CoV-2.

[0198] Optionally, the lineage Cβ-coronavirus is MERS-CoV.

[0199] Optionally, the immune response is induced against two or more lineage B beta-coronaviruses.

[0200] Optionally, the immune response is directed against SARS-1 and SARS-2 beta-coronaviruses.

[0201] Optionally, an immune response is induced against SARS-1 and MERS beta-coronaviruses.

[0202] Optionally, the immune response is induced against SARS-2 and MERS beta-coronaviruses.

[0203] Optionally, the immune response is induced against SARS-1, SARS-2 and MERS beta-coronaviruses.

[0204] Optionally, the beta-coronavirus is a variant of concern (VOC).

[0205] Optionally, the beta-coronavirus is a SARS-CoV-2 VOC.

[0206] Optionally, the beta-coronavirus is SARS-CoV-2 strain B1.248 (Brazil P1 strain) VOC.

[0207] Optionally, the beta-coronavirus is SARS-CoV-2 lineage B1.351 (South Africa) VOC.

[0208] Optionally, the beta-coronavirus is a SARS-CoV-2 beta, gamma, or delta coronavirus.

[0209] Optionally, the beta-coronavirus is a SARS-CoV-2 alphavirus.

[0210] Optionally, the beta-coronavirus is a SARS-CoV-2 beta-coronavirus.

[0211] Optionally, the beta-coronavirus is a SARS-CoV-2 gamma coronavirus.

[0212] Optionally, the beta-coronavirus is a SARS-CoV-2 delta VOC.

[0213] Optionally, the beta-coronavirus is a SARS-CoV-2 alpha-coronavirus.

[0214] Optionally, the beta-coronavirus is SARS-CoV-2 Omicron VOC.

[0215] Optionally, the beta-coronavirus is SARS-CoV-2 Omicron BA.1.

[0216] Optionally, the beta-coronavirus is SARS-CoV-2 Omicron BA.2.

[0217] Optionally, the beta-coronavirus is SARS-CoV-2 Omicron BA.2.12.1.

[0218] Optionally, the beta-coronavirus is SARS-CoV-2 Omicron BA.2.75.

[0219] Optionally, the beta-coronavirus is SARS-CoV-2 Omicron BA.2.3.20.

[0220] Optionally, the beta-coronavirus is SARS-CoV-2 Omicron BQ.1.1.

[0221] Optionally, the beta-coronavirus is SARS-CoV-2 Omicron XBB.

[0222] Optionally, the beta-coronavirus is SARS-CoV-2 Omicron XBB.1.5.

[0223] Optionally, the beta-coronavirus is SARS-CoV-2 Omicron XBB.1.19.1.

[0224] Optionally, the beta-coronavirus is SARS-CoV-2 Omicron XBC.1.

[0225] Optionally, the beta-coronavirus is SARS-CoV-2 Omicron BQ.1.12.

[0226] Optionally, the beta-coronavirus is SARS-CoV-2 Omicron XBB.1.9.1.

[0227] Optionally, the beta-coronavirus is SARS-CoV-2 Omicron CH.1.1.1.

[0228] Optionally, the beta-coronavirus is SARS-CoV-2 Omicron BA.2.

[0229] Optionally, the beta-coronavirus is SARS-CoV-2 Omicron BA.2.86.

[0230] Whether an immune response has been induced against a beta-coronavirus can be readily determined using methods well known to those skilled in the art, for example, a pseudotype neutralization assay as described in the Examples below.

[0231] Optionally, coronavirus infection causes long COVID-19 following initial infection with SARS-CoV-2. Long COVID is broadly defined as the signs, symptoms, and conditions that persist or develop after initial SARS-CoV-2 infection.

[0232] Optionally, the subject is a human subject.

[0233] Administration Any suitable route of administration can be used. Administration methods include, but are not limited to, intradermal, intramuscular, intraperitoneal, parenteral, intravenous, subcutaneous, vaginal, rectal, intranasal, inhalation, or oral. Parenteral administration, such as subcutaneous, intravenous, or intramuscular administration, is generally achieved by injection. Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution or suspension in liquid prior to injection, or as emulsions. Injectable solutions and suspensions can be prepared from sterile powders, granules, and tablets of the type described above. Administration can be systemic or local. Routes for systemic administration generally include transdermal, oral, and parenteral routes, including, for example, subcutaneous, intravenous, intramuscular, intraarterial, intradermal, and intraperitoneal injections and / or intranasal routes. Common local administration routes include, for example, topical routes as well as intradermal, transdermal, subcutaneous, or intramuscular injections, or intralesional, intracranial, intrapulmonary, intracardiac, and sublingual injections.

[0234] For lipid nanoparticles, the route of administration is often determined by the nanoparticle's properties and therapeutic indication. Following intravenous (iv) administration, many lipid nanoparticles can accumulate in the liver. The liver is inherently capable of producing secretory proteins, and therefore, iv administration of lipid nanoparticle-mRNA formulations can be used to produce proteins deficient in inherited metabolic and hematological disorders or to generate antibodies that neutralize pathogens or target cancer cells. These applications require protein translation without stimulating an immune response, which may limit the efficiency of repeated administration. However, iv administration can also result in the accumulation of lipid nanoparticles in multiple lymph nodes throughout the body, potentially increasing the immune response to mRNA vaccines. For example, iv administration of mRNA vaccines has been shown to induce stronger antigen-specific cytotoxic T cell responses compared to local injection. Wide distribution of mRNA vaccines in the body can lead to systemic adverse effects; therefore, it may be necessary to develop lipid nanoparticles that enable targeted delivery of mRNA vaccines to tissues with abundant immune cells.

[0235] Local administration routes are also being considered for mRNA therapeutics. Local administration aims to achieve a local therapeutic effect. For example, local injection of lipid nanoparticle-mRNA formulations allows for the recruitment of therapeutic proteins to specific tissues such as the heart, eye, and brain. Furthermore, lipid nanoparticle-mRNA formulations can be administered to the lungs by inhalation.

[0236] Local administration of mRNA vaccines can also prime systemic responses. For example, intradermal (id), intramuscular (im), and subcutaneous (sc) injections are commonly used for vaccination because resident and recruited antigen-presenting cells (APCs) reside in the skin and muscles and can internalize and process mRNA-encoded antigens. Furthermore, the blood and lymphatic systems in these tissues help APCs and mRNA vaccines to stimulate T cell immunity, centering them in draining lymph nodes. In fact, both intramuscular and intradermal administration of lipid nanoparticle-mRNA vaccines has produced robust immune responses at well-tolerated doses in human trials. Because APCs in peripheral lymph nodes can readily endocytose administered lipid nanoparticle-mRNA formulations, vaccination can also be achieved via intranasal administration.

[0237] mRNA vaccines delivered by lipid nanoparticles may contain cationic lipids and / or ionizable lipids (see review: Lipid Nanoparticles for mRNA Delivery, Nature Reviews Materials, 6, 1078-1094, 2021). In addition to cationic or ionizable lipids, lipid nanoparticle-mRNA formulations typically contain other lipid components, such as phospholipids (e.g., phosphatidylcholine and phosphatidylethanolamine), cholesterol, or polyethylene glycol (PEG)-functionalized lipids (PEG-lipids). These lipids can improve nanoparticle properties such as particle stability, delivery efficacy, tolerability, and biodistribution.

[0238] The composition can be administered in any suitable manner, such as a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers are determined in part by the particular composition being administered and by the particular method used to administer the composition. Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose, and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present, such as antibacterial agents, antioxidants, chelating agents, and inert gases.

[0239] Some of the compositions may be administered as pharmaceutically acceptable acid or base addition salts formed by reaction with inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid, and organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid, malonic acid, succinic acid, maleic acid, and fumaric acid, or by reaction with inorganic bases such as sodium hydroxide, ammonium hydroxide, potassium hydroxide, and organic bases such as mono-, di-, trialkyl and aryl amines and substituted ethanol amines.

[0240] Administration can be achieved by single or multiple doses. In the context of the present disclosure, the dose administered to a subject should be sufficient to induce a beneficial therapeutic response in the subject over time, or to inhibit or prevent infection. The required dose will vary from subject to subject, depending on the species, age, weight, and general condition of the subject, the severity of the infection being treated, the specific composition being used, and its mode of administration. The appropriate dose can be determined by one skilled in the art using only routine experimentation.

[0241] The present disclosure includes methods comprising administering an mRNA vaccine to a subject in need thereof. The exact amount required will vary from subject to subject, depending on the species, age and general condition of the subject, the severity of the disease, the particular composition, its mode of administration, its mode of activity, etc.

[0242] mRNA vaccines are typically formulated in dosage unit form for ease of administration and uniformity of dosage. However, it will be understood that the total daily usage amount of mRNA vaccine can be determined by the attending physician within the scope of sound medical judgment. The specific therapeutically effective, prophylactically effective, or appropriate imaging dose level for any particular patient will depend on various factors, including: the disorder to be treated and the severity of the disorder; the activity of the specific compound used; the specific composition used; the patient's age, weight, general health, sex, and diet; the administration time, administration route, and excretion rate of the specific compound used; the duration of treatment; drugs used in combination with or simultaneously with the specific compound used; and similar factors well known in the medical field.

[0243] Effective amounts of mRNA provided herein can be as low as 20 pg, for example, administered as a single dose or two 10 pg doses. In some embodiments, the effective amount is 20 μg to 300 μg or 25 μg to 300 μg total dose. For example, an effective amount can be 20 μg, 25 μg, 30 μg, 35 μg, 40 μg, 45 μg, 50 μg, 55 μg, 60 μg, 65 μg, 70 μg, 75 μg, 80 μg, 85 μg, 90 μg, 95 μg, 100 μg, 110 μg, 120 μg, 130 μg, 140 μg, 150 μg, 160 μg, 170 μg, 180 μg, 190 μg, 200 μg, 250 μg, or 300 μg total dose. In some embodiments, the effective amount is a 20 μg total dose. In some embodiments, the effective amount is a 25 pg total dose. In some embodiments, the effective amount is a 50 μg total dose. In some embodiments, the effective amount is a 75 μg total dose. In some embodiments, the effective amount is a 100 μg total dose. In some embodiments, the effective amount is a 150 μg total dose. In some embodiments, the effective amount is a 200 μg total dose. In some embodiments, the effective amount is a 250 pg total dose. In some embodiments, the effective amount is a 300 μg total dose.

[0244] The mRNA vaccines described herein can be formulated into dosage forms described herein, such as intranasal, intratracheal, or injectable (e.g., intravenous, intraocular, intravitreal, intramuscular, intradermal, intracardiac, intraperitoneal, and subcutaneous).

[0245] Optionally, the mRNA vaccine is formulated in an amount effective to generate an antigen-specific immune response in the subject.

[0246] In some embodiments, the effective amount is a total dose of 1 μg to 1000 μg, 25 μg to 1000 μg, or 50 μg to 1000 μg. In some embodiments, the effective amount is a total dose of 100 μg. In some embodiments, the effective amount is a 25 μg dose administered to the subject a total of two times. In some embodiments, the effective amount is a 100 μg dose administered to the subject a total of two times. In some embodiments, the effective amount is a 400 μg dose administered to the subject a total of two times. In some embodiments, the effective amount is a 500 μg dose administered to the subject a total of two times.

[0247] Optionally, the subject is administered a dose of 10 μg / kg to 400 μg / kg of mRNA vaccine. In some embodiments, the mRNA dose is 1-5 μg, 5-10 μg, 10-15 μg, 15-20 μg, 10-25 μg, 20-25 μg, 20-50 μg, 30-50 μg, 40-50 μg, 40-60 μg, 60-80 μg, 60-100 μg, 50-100 μg, 80-120 μg, 40-120 μg, 40-150 μg, 50-150 μg, 50-200 μg, 80-200 μg, 10 ... 0μg, 120-250μg, 150-250μg, 180-280μg, 200-300μg, 50-300μg, 80-300μg, 100-300μg, 40-300μg, 50-350μg, 100-350μg, 200-350μg, 300-350μg, 320-400μg, 40-380μg, 40-100μg, 100-400μg, 200-400μg or 300-400μg / dose.

[0248] In some embodiments, the mRNA vaccine is administered to the subject by intradermal or intramuscular injection. In some embodiments, the mRNA vaccine is administered to the subject on day 0. In some embodiments, a second dose of the mRNA vaccine is administered to the subject on day 21.

[0249] In a strategy called "prime-boost," a first dose of an mRNA vaccine is administered as a priming step, followed by a second dose as a booster. The prime-boost strategy aims to provide a stronger overall immune response. The boost can be administered at least one day, at least one week, or at least 2, 3, 4, 5, 6, or 7 weeks, or at least 2, 3, 4, 5, or 6 months after the primer. For example, the boost can be administered at least three weeks after the primer.

[0250] Pharmaceutically acceptable vehicles and / or carriers Pharmaceutical compositions may contain a vehicle solution and / or a pharmaceutically acceptable carrier. The vehicle solution and / or pharmaceutically acceptable carrier may include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The carrier and composition may be sterile, and the formulation is suitable for the mode of administration. The composition may also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. The composition may be a liquid solution, suspension, emulsion, tablet, pill, capsule, sustained-release formulation, or powder. The composition may be formulated as a suppository using traditional binders and carriers such as triglycerides. Oral formulations may contain standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, and magnesium carbonate. Any common pharmaceutical carrier, such as sterile saline solution or sesame oil, may be used. The vehicle may also contain conventional pharmaceutical auxiliary materials, such as pharmaceutically acceptable salts for adjusting osmotic pressure, buffers, preservatives, etc. Other vehicles that can be used in the compositions and methods provided herein are normal saline and sesame oil.

[0251] The vehicle solution and / or carrier may comprise a triblock copolymer comprising one poly(propylene oxide) block and two poly(ethylene oxide) blocks. Preferably, the triblock copolymer is an ABA triblock copolymer containing one poly(propylene oxide) block B of formula (p-1):

[0252] [ka] (In the formula, s is an integer of 15 to 67, preferably 20 to 40.

[0253] Two poly(ethylene oxide) blocks A of formula (p-2):

[0254] [ka] (wherein r is independently for each block an integer of 2 to 130, preferably 50 to 100, more preferably 60 to 90). More preferably, the triblock copolymer has the following structure:

[0255] [ka] (wherein r and t are each independently an integer of 2 to 130, preferably 50 to 100, more preferably 60 to 90, and s is an integer of 15 to 67, preferably 20 to 40.) Most preferably, poloxamer P188 is used as the triblock copolymer.

[0256] The vehicle solution and / or carrier may contain a triblock copolymer dissolved therein. However, as will be understood by those skilled in the art, this does not exclude the possibility that a certain amount of copolymer molecules may be contained in the composition and adsorbed to the lipid or lipidoid nanoparticles considered as component (p) of LNP / LiNP. Preferably, compositions for intramuscular administration or aerosol formation contain the triblock copolymer at a concentration of 0.05 to 5% w / v (i.e., grams per 100 mL), preferably 0.1 to 2%, based on the total volume of the composition. In addition to the triblock copolymer, other excipients may be present in the vehicle solution. Preferably, the vehicle solution further contains at least one of sucrose and NaCl, more preferably sucrose and NaCl.

[0257] Pharmaceutical formulations according to the invention can be conveniently prepared, for example, by a method comprising adding the triblock copolymer to a suspension comprising a vehicle solution and lipid or lipidoid nanoparticles, or adding lipid or lipidoid nanoparticles to a vehicle solution comprising the triblock copolymer.

[0258] Pharmaceutical compositions for RNA delivery An aspect of the present invention relates to a pharmaceutical composition comprising an mRNA of the present invention, an mRNA vaccine vector of the present invention, or an mRNA vaccine of the present invention, and a pharmaceutically acceptable carrier, excipient, or diluent.

[0259] The mRNA or mRNA vaccines of the present invention can be advantageously combined in pharmaceutical compositions with additional components and / or compounds that facilitate delivery of the mRNA to target cells or tissues and / or enhance its stability. One possibility in this regard is the formation of the RNA into liposomes or nanoparticles using suitable materials, such as those described herein and, for example, in EP 3013964 B1, the entire contents of which are incorporated herein. In particular, the mRNA or mRNA vaccines of the present invention can be formulated with liposomes to generate lipoplexes, or with subsequent generation lipid nanocarriers, such as lipid nanoparticles (LNPs), lipidoid nanoparticles (LiNPs), nanostructured lipid carriers, and / or cationic lipid-nucleic acid complexes.

[0260] In some embodiments, nucleic acids of the present invention can be delivered to target cells and / or tissues in vivo, ex vivo, and / or in vitro using LNPs or LiNPs. LNPs and LiNPs can be distinguished from other carriers due to their small size, uniform size distribution, and structure, making them particularly suitable for immunization of subjects. Those skilled in the art are aware of methods for producing LNPs and LiNPs. LNP or LiNP production involves a combination of lipids or lipidoids, such as phospholipids, cholesterol, and other specialized lipids, mixed together in a solvent such as alcohol. This mixture is then subjected to a process called nanoprecipitation, which involves rapidly mixing the lipid solution with a non-solvent, such as nucleic acid dissolved in water, under controlled conditions of temperature, pressure, and stirring rate. During this process, the lipids self-assemble into complex nanoscale structures, which entrap and protect the therapeutic nucleic acids of the present invention. Nanoparticles may also be further modified with various surface coatings, such as polyethylene glycol (PEG), to improve stability and reduce their tendency to be eliminated by the immune system.

[0261] The LiNPs may comprise mRNA as component (a), an ionizable lipid or ionizable lipidoid as component (b), and optionally a helper lipid as defined below as component (c). Optionally, the LiNPs may comprise a triblock copolymer comprising one poly(propylene oxide) block and two poly(ethylene oxide) blocks, as described above, as component (p).

[0262] As component (a), nanoparticles included in the pharmaceutical composition of the invention, e.g., in a formulation for intramuscular or aerosol delivery, may contain mRNA encoding T2_17 and / or T2_20, which provide the pharmaceutically active components of the nanoparticles. In some embodiments, the pharmaceutical composition may (further) comprise a full-length spike protein as described herein. In some embodiments, component (a) consists of mRNA encoding COV_S_T2_17 or consists of mRNA encoding COV_S_T2_20. Optionally, the nanoparticles in the pharmaceutical composition comprise as component (a) mRNA encoding COV_S_T2_10 or COV_S_T2_27, respectively, selected from SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:17, SEQ ID NO:20, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, and / or SEQ ID NO:46.

[0263] As component (b), the nanoparticles in the pharmaceutical composition may further comprise an ionizable lipid or an ionizable lipidoid. It will be understood that this includes the possibility that the nanoparticles comprise a combination of different ionizable lipids, a combination of different ionizable lipidoids, or a combination of one or more ionizable lipids and one or more ionizable lipids. The nanoparticles used in the context of the present invention typically comprise mRNA (a) and, as the ionizable lipid or as the ionizable lipid (b), a cationic lipid or a cationic lipidoid, in the form of a mixture of these components.

[0264] Optionally, the pharmaceutical composition or mRNA vaccine according to the invention comprises as component (b) a LiNP comprising an ionizable lipidoid of formula (b-1):

[0265] [ka] where the variables a, b, p, m, n and R 1A ~R 6A is defined as follows: a is 1 and b is an integer from 2 to 4, or a is an integer from 2 to 4 and b is 1; p is 1 or 2; m is 1 or 2, n is 0 or 1, and m+n is ≧2; and R 1A ~R 6A are independently selected from the following: hydrogen, —CH—CH(OH)—R 7A , -CH(R 7A )-CH2-OH, -CH2-CH2-(C=O)-OR 7A or -CH2-R 7A , (R 7A is selected from C3-C18 alkyl or C3-C18 alkenyl having one C-C double bond), a protecting group for an amino group, -C(NH)-NH2, a poly(ethylene glycol) chain, and a receptor ligand) (wherein R 1A ~R 6A At least two residues of the group -CH2-CH(OH)-R 7A , -CH(R 7A )-CH2OH, -CH2CH2(C=O)-OR 7 , -CH2CH2(C=O)-NH-R 7A or -CH2R 7 where R 7 is selected from C3-C18 alkyl or C3-C18 alkenyl having one C-C double bond. One or more of the nitrogen atoms contained in the compound of formula (b-1) are protonated to provide a compound having a positive charge).

[0266] Optionally, the cationic lipidoid formula (b-1) is R1A ~R 6A and optionally, R 1A ~R 6A or R 1A ~R 6A At least four of the residues are -CH2-CH(OH)-R 7A ,-CH(R 7A )-CH2-OH,-CH2-CH2-(C=O)-OR 7A ,-CH2-CH2-(C=O)-NH-R 7A and -CH2-R 7A , is a group selected from (R 7A is selected from C3-C18 alkyl or C3-C18 alkenyl having one CC double bond).

[0267] According to an optional embodiment, the compound of formula (b-1) is a compound of formula (b-1b), and component (b) comprises or consists of a lipidoid compound of formula (b-1b):

[0268] [ka] (In the formula, R 1A ~R 6A is defined similarly to formula (b-1), including preferred embodiments thereof, or protonated forms thereof in which one or more of the nitrogen atoms shown in formula (b-1b) are protonated to provide a compound having a positive charge.

[0269] Thus, according to a particularly preferred embodiment, component (b) comprises or consists of a lipidoid of formula (b-1b) above or a protonated form thereof, and R 1A ~R 6A is hydrogen and -CH2-CH(OH)-R 7A wherein R is independently selected from 7A is selected from C8-C18 alkyl and C8-C18 alkenyl having one C-C double bond, provided that R 1A ~R6A At least two of the residues are -CH2-CH(OH)-R 7A and more preferably R 1A ~R 6A and even more preferably at least three residues of R 1A ~R 6A At least four of the residues are -CH2-CH(OH)-R 7A where R 7A is selected from C8-C18 alkyl and C8-C18 alkenyl having one CC double bond.

[0270] In certain embodiments, the mRNA vaccine or pharmaceutical composition according to the invention comprises LiNP nanoparticles comprising a cationic lipidoid of formula (bV) and / or formula (b-VII):

[0271] [ka]

[0272] As component (c), the LiNPs of the pharmaceutical composition may include an ionizable lipidoid helper lipid, as described below. In particular, the agents and reagents described herein for delivering and / or introducing mRNA into target cells or tissues, as well as the lipids and lipidoids described herein, may be combined with one or more (e.g., two, three, or four) additional lipids (e.g., cholesterol, DPPC, DOPE, and / or PEG-lipids (e.g., DMPE-PEG, DMG-PEG2000)). These additional lipids may support the desired functions of the therapeutic agent and lipidoid (supporting and / or increasing the delivery and / or introduction of RNA into cells or tissues, and improving transfection efficiency, respectively) and function as their respective "helper lipids." Specific examples of such "helper lipids" include cholesterol, DPPC, DOPE, and / or PEG-lipids (e.g., DMG-PEG2000). Additional lipids (e.g., "helper lipids") may also be part of the complexes / particles disclosed herein. Those skilled in the art can easily prepare complexes / particles according to the present invention. Examples of additional lipids (e.g., "helper lipids") are also known in the art. Those skilled in the art can easily select appropriate additional lipids (e.g., "helper lipids") and the ratio of cationic lipidoid to additional lipids (e.g., "helper lipids"). Such ratios can be cationic lipidoid:additional lipid molar ratios of [1-4:1-5], [3-4:4-6], [about 4:about 5], or [about 4:about 5.3] (narrower ranges are preferred). For example, cationic lipidoid can be combined with three additional lipids, such as DPPC, cholesterol, and DMG-PEG2000, preferably in the molar ratios of about 8.0:about 5.3:about 4.4:about 0.9, respectively, or more specifically, 8.00:5.29:4.41:0.88, respectively. Preferably, lipidoids according to formula (b-1), (b-1b), (bV), (b-VI) and (b-VII) are as described above and are used together with helper lipids DPPC and cholesterol and PEG-lipid DMG-PEG2000 in a molar ratio of 8.00:5.29:4.41:0.88 to formulate lipidoid nanoparticles.

[0273] In some embodiments, an mRNA vaccine or pharmaceutical composition according to the invention comprises the following components: a) mRNA according to the present invention; b) a cationic lipidoid of formula (b-1), (b-1b), (bV), (b-VI) or (b-VIII), c) one or more helper lipids, optionally c1) DPPC, and / or c2) cholesterol, and / or c3) PEG-lipid DMG-PEG2000 and one or more helper lipids selected from LiNPs comprising optionally, components b) and c1)-c3) are present, and optionally components b) and c1)-c3) are in a molar ratio of about 8.0:about 5.3:about 4.4:about 0.9, respectively; Optionally, the NLP comprises a triblock copolymer comprising one poly(propylene oxide) block and two poly(ethylene oxide) blocks as component (p) defined above in the vehicle.

[0274] A composition in which the R-isomer of formula (bV), i.e., formula (b-VI), is formulated with the lipids DPPC and cholesterol and the PEG-lipid DMG-PEG2000 in a molar ratio of 8.00:5.29:4.41:0.88 is also referred to herein as "Formulation I." A composition in which the lipidoid of formula (b-VII) is formulated with the lipids DPPC and cholesterol and the PEG-lipid DMG-PEG2000 in a molar ratio of 8.00:5.29:4.41:0.88 is also referred to herein as "Formulation II." In some embodiments, the LiNPs in the pharmaceutical composition of the invention comprise Formulation I and / or Formulation II. In some embodiments, the LiNPs comprise Formulation I and / or Formulation II.

[0275] The cationic lipidoid to mRNA ratio in LiNPs is controlled by the molar ratio of nitrogen atoms in the cationic lipidoid (N) to phosphate groups in the mRNA (P) (N / P ratio). The other lipid components are calculated according to the target molar lipid ratios to the cationic lipidoid described above, which can be, for example, 8.00:5.29:4.41:0.88 for the cationic lipidoid, DPPC, cholesterol, and PEG-lipid DMG-PEG2000, respectively. In some embodiments, the final N / P ratio of cationic lipidoid having formula (b-1), (b-1a), (bV), (b-VI) and / or (b-VII) to one phosphate group of the mRNA molecule is preferably 4 to 44, preferably 4 to 16, more preferably 8 nitrogen atoms of cationic lipidoid having formula (b-1), (b-1a), (bV), (b-VI) and / or (b-VII) per one phosphate group of the mRNA molecule.

[0276] The lipid or lipidoid nanoparticles contained in the suspensions and aerosols according to the invention preferably have a Z-average diameter in the range of 10 to 500 nm, more preferably in the range of 10 to 250 nm, and even more preferably in the range of 20 to 200 nm. The particle sizes indicated are the hydrodynamic diameters of the particles as determined by dynamic light scattering (DLS). Measurements are generally carried out at 25°C.

[0277] The polydispersity index of the nanoparticles contained in the suspension formulation and aerosol according to the present invention is preferably in the range of 0.05 to 0.4, more preferably in the range of 0.05 to 0.2. The polydispersity index can be determined by dynamic light scattering (DLS). Measurements are generally carried out at 25°C.

[0278] In some embodiments, the composition comprises a pharmaceutically acceptable carrier and / or an adjuvant. For example, the adjuvant can be alum, Freund's complete adjuvant, a biological adjuvant, or an immunostimulatory oligonucleotide (such as a CpG oligonucleotide).

[0279] Pharmaceutically acceptable carriers (vehicles) useful in this disclosure are conventional. Remington's Pharmaceutical Sciences by E. W. Martin, Mack Publishing Co., Easton, PA, 15th Edition (1975) describes compositions and formulations suitable for pharmaceutical delivery of one or more therapeutic compositions and additional pharmaceutical agents.

[0280] The nature of the carrier will generally depend on the particular mode of administration being employed. For example, parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solution, aqueous dextrose, glycerol, or the like as a vehicle. For solid compositions (e.g., powder, pill, tablet, or capsule forms), conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. In addition to biologically neutral carriers, pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances such as wetting or emulsifying agents, preservatives, and pH buffering agents, for example, sodium acetate or sodium monolaurate.

[0281] Optionally, the mRNA vaccines of the present invention are administered intramuscularly.

[0282] Optionally, the mRNA vaccines of the present invention are administered intramuscularly, intradermally, subcutaneously with a needle or gene gun, or by electroporation.

[0283] Optionally, the mRNA of the present invention, the vector of the present invention, the pharmaceutical composition of the present invention, or the vaccine of the present invention is administered via the respiratory system, in some embodiments, the administration is in a form that allows administration to the respiratory system by inhalation, nebulization, spray, or drops, such as nasal spray or nasal drops.

[0284] Sequence identity The similarity between amino acid sequences or nucleic acid sequences is expressed in terms of the similarity between the sequences, otherwise referred to as sequence identity. Sequence identity is often measured in terms of the percentage of identity (or similarity or homology), and the higher the percentage, the more similar the two sequences are. Homologs or variants of a given gene or protein have a relatively high degree of sequence identity when aligned using standard methods. Methods for aligning sequences for comparison are well known in the art. Various programs and alignment algorithms are described in Smith and Waterman, Adv. Appl. Math. 2:482, 1981; Needleman and Wunsch, J. Mol. Biol. 48:443, 1970; Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988; Higgins and Sharp, Gene 73:237-244, 1988; Higgins and Sharp, CABIOS 5:151-153, 1989; Corpet et al., Nucleic Acids' Research 16:10881-10890, 1988; and Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988. Altschul et al., Nature Genet. 6:119-129, 1994. The NCBI Basic Local Alignment Search Tool (BLAST™) (Altschul et al., J. Mol. Biol. 215:403-410, 1990) is available from several sources, including the National Center for Biotechnology Information (NCBI, Bethesda, MD) and the Internet, for use in conjunction with the sequence analysis programs blastp, blastn, blastx, tblastn, and tblastx.

[0285] Sequence identity between nucleic acid or amino acid sequences can be determined by comparing the alignment of sequences. If an equivalent position in the compared sequences is occupied by the same nucleotide or amino acid, the molecules are identical at that position. Scoring an alignment as a percentage of identity is a function of the number of identical nucleotides or amino acids at the position shared by the compared sequences. When comparing sequences, optimal alignment may require the introduction of gaps in one or more sequences to account for possible insertions and deletions in the sequences. Sequence comparison methods may use gap penalties for the same number of identical molecules in the compared sequences; sequence alignments with as few gaps as possible reflect a higher relatedness between the two compared sequences and achieve a higher score than those with many gaps. Calculating the maximum percent identity involves generating an optimal alignment that takes gap penalties into account.

[0286] Suitable computer programs for performing sequence comparisons are widely available in the commercial and public sector, including, for example, MatGat (Campanella et al., 2003, BMC Bioinformatics 4:29; program available at http: / / bitincka.com / ledion / matgat), Gap (Needleman and Wunsch, 1970, J. Mol. Biol. 48:443-453), FASTA (Altschul et al., 1990, J. Mol. Biol. 215:403-410; program available at http: / / www.ebi.ac.uk / fasta), Clustal W 2.0 and X 2.0 (Larkin et al., 2007, Bioinformatics 23:2947-2948; program available at http: / / www.ebi.ac.uk / tools / clustalw2) and EMBOSS Pairwise Alignment. Algorithms (Needleman and Wunsch, 1970, supra; Kruskal, 1983, Time warps, string edits and macromolecules: the theory and practice of sequence comparison, Sankoff and Kruskal (eds.), pp. 1-44, Addison Wesley; programs available at http: / / www.ebi.ac.uk / tools / emboss / align). All programs can be run using default parameters.

[0287] For example, sequence comparison can be performed using the "needle" method of the EMBOSS Pairwise Alignment Algorithms, which determines the optimal alignment (including gaps) when considering two sequences over their entire length and provides a percentage identity score. The default parameters for amino acid sequence comparison (option "Protein molecule") can be: Gap Extend penalty: 0.5, Gap Open penalty: 10.0, Matrix: Blosum 62.

[0288] Sequence comparison may be performed over the entire length of the reference sequence.

[0289] Conservative amino acid substitutions The polypeptide encoded by the mRNA of the present invention may contain one or more conservative amino acid substitutions. Conservative amino acid substitutions are substitutions that, when made, do not significantly disrupt the properties of the original polypeptide, i.e., the structure and, in particular, function of the protein are conserved and do not change significantly due to such substitutions. Examples of conservative substitutions are shown below. Original residue Conservative substitution Ala Ser Arg Lys Asn Gln,His Asp Glu Cys Ser Gln Asn Glu Asp His Asn;Gln Ile Leu,Val Leu Ile;Val Lys Arg;Gln; Met Leu;Ile Phe Met;Leu;Tyr Ser Thr Thr Ser Trp Tyr Tyr;Trp;Phe Val Ile;Leu

[0290] Conservative substitutions generally maintain (a) the structure of the polypeptide backbone, e.g., sheet or helix conformation, in the area of ​​the substitution, (b) the charge or hydrophobicity of the target site molecule, or (c) the bulk of the side chains.

[0291] Generally, substitutions expected to produce the greatest changes in protein properties are non-conservative, such as (a) a hydrophilic residue, e.g., serine or threonine, is substituted for (or is substituted by) a hydrophobic residue, e.g., leucine, isoleucine, phenylalanine, valine, or alanine; (b) a cysteine ​​or proline is substituted for (or is substituted by) any other residue; (c) a residue having an electrically positive side chain, e.g., lysine, arginine, or histidine, is substituted for (or is substituted by) an electrically negative residue, e.g., glutamate or aspartate; or (d) a residue having a bulky side chain, e.g., phenylalanine, is substituted for (or is substituted by) one having no side chain, e.g., glycine.

[0292] Broadly neutralizing immune response The term "broadly neutralizing immune response" is used herein to mean an immune response elicited in a subject sufficient to inhibit (i.e., reduce), neutralize, or prevent infection and / or progression of an infection with a virus within the coronavirus family. Optionally, the broadly neutralizing immune response is sufficient to inhibit, neutralize, or prevent infection and / or progression of two or more β-coronaviruses (e.g., SARS-CoV and SARS-CoV-2). Optionally, the broadly neutralizing immune response is sufficient to inhibit, neutralize, or prevent infection and / or progression of two or more types of β-coronaviruses within the same β-coronavirus lineage (e.g., two or more β-coronaviruses within the Sarbecovirus subgenus, such as SARS-CoV, SARS-CoV-2, and Bat SL-CoV-WIV1). Optionally, the broadly neutralizing immune response is sufficient to inhibit, neutralize, or prevent infection and / or progression of infection with coronaviruses of different β-coronavirus lineages, such as coronaviruses of lineage B (e.g., SARS-CoV and SARS-CoV-2) and lineage C (e.g., MERS-CoV). Optionally, the broadly neutralizing immune response is sufficient to inhibit, neutralize, or prevent infection and / or progression of infection with most or all different β-coronaviruses. Optionally, the broadly neutralizing immune response is sufficient to inhibit, neutralize, or prevent infection and / or progression of infection with most or all different viruses of the coronavirus family. Optionally, the broadly neutralizing immune response is sufficient to inhibit, neutralize, or prevent infection and / or progression of infection with most or all Variants of Concern (VOC) of SARS-CoV-2, including beta, gamma, delta, and omicron (BA.1). Optionally, the broadly neutralizing immune response is sufficient to inhibit, neutralize or prevent infection and / or progression of infection with SAR-CoV, WIV16, RaTG13, SARS-CoV-2, SARS-CoV-2 beta, SARS-CoV-2 gamma, SARS-CoV-2 delta, SARS-CoV-2 omicron (BA.1, BA.2, BA.2.12.1, BA.4, BA.5, XBB 1.5).

[0293] An immune response can be a humoral and / or cellular immune response. A cellular immune response is the response of cells of the immune system, such as B cells, T cells, macrophages, or polymorphonuclear cells, to a stimulus, such as an antigen or a vaccine. An immune response can include any cell of the body that is involved in a host defense response, including, for example, epithelial cells that secrete interferons or cytokines. An immune response includes, but is not limited to, an innate immune response or inflammation.

[0294] Optionally, the polypeptide encoded by the mRNA of the present invention induces a protective immune response. A protective immune response refers to an immune response that protects a subject from infection or disease (i.e., prevents infection or prevents the onset of a disease associated with infection). Methods for measuring immune responses are well known in the art and include, for example, measuring lymphocyte (such as B or T cell) proliferation and / or activity, cytokine or chemokine secretion, inflammation, or antibody production.

[0295] Optionally, the polypeptides encoded by the mRNA of the present invention can induce antibody production and / or T cell responses in a human or non-human animal to which the mRNA is administered (e.g., expressed from an administered mRNA vaccine).

[0296] Embodiments of the present invention will now be described, by way of example only, with reference to the accompanying drawings, in which: [Brief explanation of the drawings]

[0297] [Figure 1A] Figure 1. In silico design of antigen candidates. (A) Phylogenetic tree generated for sarbecoviruses using protein sequences of the receptor-binding domain (RBD) of the spike protein. The tree was generated using IQ-Tree (24). Human viruses are represented in green, palm civet viruses in pink, and bat viruses in dark gray. Two distinct clades are colored red (non-ACE-2 binding) and blue (ACE-2 binding). [Figure 1B]Figure 1 shows the in silico design of antigen candidates. (B) Structural model of the RBD with the epitope region highlighted as a sphere. The RBD backbone is colored according to the CONSURF (25) score calculated using the alignment used to construct the phylogenetic tree. The figure was generated and rendered using PyMol (24) using the PDB (27) ids 6wps (14), 6w41 (15), and 7bz5 (11). [Figure 1C] Figure 1 shows the in silico design of antigen candidates. (C) Structural representation of the various antigen designs used in the study. Epitopes engineered to match wild-type SARS-CoV (orange) and wild-type SARS-CoV-2 (gray) are represented by spheres. Additional glycosylation site modifications are represented by green spheres. [Figure 2A] In vitro selection and in vivo immunogenicity of antigens are shown. (A) Immunization and bleeding schedule for BALB / c mice. Mice were immunized at 30-day intervals and bled every 15 days. [Figure 2B] (B) Antigen FACS binding data. Sera from mice immunized with the antigens were screened for binding to SARS-CoV, SARS-CoV-2, WIV16, and RaTG13 spike proteins. The X-axis represents mean fluorescence intensity (MFI), and the Y-axis represents all vaccine designs considered for screening. Duplicate MFIs are reported for each mouse serum. [Figure 2C] The in vitro selection and in vivo immunogenicity of the antigen are shown. (C) Using the SARS-CoV-2 RBD as a control vaccine design, ELISA was used to confirm the induction of binding antibodies against SARS-CoV and SARS-CoV-2 by T2_17. T2_17 produced cross-binding antibodies. The X-axis represents blood collection, and the Y-axis represents the area under the curve (AUC) of the ELISA binding curve. The Mann-Whitney U indicated statistical significance (p-values: * ≤ 0.05, ** < 0.01, *** ≤ 0.001, **** ≤ 0.0001). [Figure 3A]Immunogenicity studies in guinea pigs and rabbits are shown. (A) Guinea pig immunization and bleeding schedule. Guinea pigs were immunized at 28-day intervals with DNA delivered intradermally by the Tropis ParmaJet device and bled every 14 days. [Figure 3B] Immunogenicity studies in guinea pigs and rabbits are shown. (B) Structural model of the vaccine design used for the guinea pig studies. Glycosylation sites and modified epitopes are represented as green and orange spheres, respectively. [Figure 3C] Immunogenicity studies in guinea pigs and rabbits are shown. (C) Neutralization by sera from guinea pigs immunized with T2_17 and SARS2_RBD_P521N. The X-axis represents the number of bleeds, and the Y-axis represents the log10IC50 value of the neutralization curve. [Figure 3D] Immunogenicity studies in guinea pigs and rabbits are shown. (D) Broad neutralization of SARS-CoV, WIV16, RaTG13, and SARS-CoV-2 by T2_17 compared to SARS2_RBD_P521N. Serum 28 days after the third immunization (bleed 6) was used for comparison. [Figure 3E] Immunogenicity studies in guinea pigs and rabbits are shown. (E) ACE-2 competitive ELISA. Sera from guinea pigs immunized with T2_17 and SARS2_RBD_P521N. NIBSC standard (20 / 162) was used as a control. [Figure 3F] Immunogenicity studies in guinea pigs and rabbits are shown. (F) Rabbit immunization and bleeding schedule. Rabbits were immunized at 14-day intervals and bled every 14 days. [Figure 3G] Immunogenicity studies in guinea pigs and rabbits are shown. (G) Neutralization by serum from rabbits immunized with T2_17. The X-axis represents the number of bleeds, and the Y-axis represents the llog10 IC50 value of the neutralization curve. [Figure 3H]Immunogenicity studies in guinea pigs and rabbits are shown. (H) Broad neutralization of SARS-CoV, WIV16, RaTG13, SARS-CoV-2, SARS-CoV-2 beta, SARS-CoV-2 gamma, SARS-CoV-2 delta, and SARS-CoV-2 omicron by T2_17. Serum 14 days after the fourth immunization (bleed 4) was used for comparison. NISBSC standard for SARS-CoV-2 and SARS-CoV antiserum were used as references. Mann-Whitney U indicated statistical significance (p-values: *≤0.05, **<0.01, ***≤0.001, ****≤0.0001). [Figure 4A] Immunogenicity and challenge studies in K18-hACE2 mice are shown. (A) Immunization, blood collection, and challenge schedule for K18-hACE2 mice. K18-hACE2 mice were primed with the AZD1222 vaccine and then boosted 4 weeks later with either AZD1222 or T2_17. Eight weeks later, mice were challenged with either the Victoria or Delta variant of SARS-CoV-2. [Figure 4B] Immunogenicity and challenge studies in K18-hACE2 mice are shown. (B) Neutralization of SARS-CoV, SARS-CoV-2, and SARS-CoV-2 delta variants by serum from K18-hACE2 mice. Sera from mice boosted with T2_17(DNA) and T2_17(MVA) significantly neutralized the delta variant (B.1.617.2) compared to those boosted with AZD1222 at bleed 4. The X-axis represents the number of bleeds, and the Y-axis represents the log10IC50 value of the neutralization curve. [Figure 4C] Immunogenicity and challenge studies in K18-hACE2 mice. (C) Weight loss profile of K18-hACE2 mice after challenge with Victoria and Delta variants. All mice were protected except for naive mice. [Figure 4D] Immunogenicity and challenge studies in K18-hACE2 mice. (D) Immunization and blood collection schedule for K18-hACE2 mice for long-term analysis. [Figure 4E]Immunogenicity and challenge studies in K18-hACE2 mice are shown. (E) Neutralization of SARS-CoV-2 K18-hACE2 mouse sera. Neutralization by sera from mice boosted with T2_17(MVA) is statistically higher than that of mice boosted with AZD1222 at bleed 2. The X-axis represents bleed number, and the Y-axis represents the log10IC50 value of the neutralization curve. [Figure 4F] Immunogenicity and challenge studies in K18-hACE2 mice are shown. (F) Peptide microarray analysis of longitudinal analysis. The X axis represents mouse serum, and the Y axis represents different linear peptides. The last column represents the conservation of the corresponding peptides in SARS-CoV, SARS-CoV-2, and T2_17. The Mann-Whitney U test is used as a statistical significance test in all plots (p values: * ≤ 0.05, ** < 0.01, *** ≤ 0.001). [Figure 5A] Immunogenicity of mRNA in guinea pigs. (A) Guinea pig immunization and blood collection schedule. Guinea pigs were immunized with mRNA at 3-week intervals. [Figure 5B] Immunogenicity of mRNA in guinea pigs. (B) Neutralization of SAR-CoV and SARS-CoV-2 by guinea pig serum. The X-axis represents the number of blood draws, and the Y-axis represents the log10IC50 value of the neutralization curve. [Figure 5C] Immunogenicity of mRNA in guinea pigs is shown. (C) Broad neutralization of SAR-CoV, WIV16, RaTG13, SARS-CoV-2, and SARS-CoV-2 omicron by T2_17. Serum 6 weeks after the boost (bleed 3) was used for comparison. The Mann-Whitney U test was used to test statistical significance in all plots (p values: * ≤ 0.05, ** < 0.01, *** ≤ 0.001). [Figure 6-1]Figure 1 shows a multiple sequence alignment of known sarbecoviruses. Sarbecoviruses are divided into two distinct phylogenetic clades—clade 1 (boxed in blue) and clade 2. Members of clade 1 have been reported to have deletions around the ACE-2 binding motif and do not bind to the human ACE-2 receptor. Regions corresponding to the epitope regions of the S309, CR3022, and B38 antibodies are colored gray, purple, and orange, respectively. [Figure 6-2] Figure 1 shows a multiple sequence alignment of known sarbecoviruses. Sarbecoviruses are divided into two distinct phylogenetic clades—clade 1 (boxed in blue) and clade 2. Members of clade 1 have been reported to have deletions around the ACE-2 binding motif and do not bind to the human ACE-2 receptor. Regions corresponding to the epitope regions of the S309, CR3022, and B38 antibodies are colored gray, purple, and orange, respectively. [Figure 7] Neutralization data for SARS2_RBD_P521N and SARS2_RBD in BALB / c mice are shown. Sera from BALB / c mice immunized with SARS2_RBD_P521N and SARS-COV-2 RBD produced similar neutralizing antibody responses 14 days after four immunizations. The X-axis represents the antigen, and the Y-axis represents the log10IC50 value of the neutralization curve. The difference is not statistically significant (Mann-Whitney U test, p-value = 0.4681). [Figure 8] Figure 1 shows binding antibody data for T2_17 in guinea pigs. ELISA was used to confirm the induction of binding antibodies against SARS-CoV and SARS-CoV-2 by T2_17 and SARS2_RBD_P521N. The pre-bleed (bleed 0) was considered a control for nonspecific binding. The X-axis represents the number of blood draws, and the Y-axis represents the area under the curve (AUC) of the ELISA binding curve. The Mann-Whitney U test was used as a statistical significance test in all plots (p-values: * ≤ 0.05, ** < 0.01, *** ≤ 0.001). [Figure 9]Figure 1 shows the binding antibody data for T2_17 in rabbits. The induction of binding antibodies against SARS-CoV and SARS-CoV-2 by T2_17 was confirmed using ELISA. The X-axis represents the number of blood samples collected, and the Y-axis represents the area under the curve (AUC) of the ELISA binding curve. The Mann-Whitney U test was used to test statistical significance in all plots (p-values: *≦0.05, **<0.01, ***≦0.001). [Figure 10] ELISA binding data for K18-hACE2 sera are shown. Binding antibodies were observed 4 weeks after immunization with AZD1222 and 4 weeks after boosting with different AZD1222 / T2_17 antibodies. The X-axis represents the number of bleeds, and the Y-axis represents the area under the curve (AUC) of the ELISA binding curve. The Mann-Whitney U test is used as a statistical significance test in all plots (p-values: *≦0.05, **<0.01, ***≦0.001). [Figure 11A] Figure 1 shows the immunogenicity of mRNA vaccines in BALB / c mice. (A) Immunization and bleeding schedule for BALB / c mice. Mice were immunized with mRNA at 4-week intervals. [Figure 11B] (B) Immunogenicity of mRNA vaccines in BALB / c mice. (C) Elicitation of binding antibodies against SARS-CoV-2 was confirmed using ELISA on serum collected 2 weeks after the boost (bleed 3). The X-axis represents the antigen, and the Y-axis represents the area under the curve (AUC) of the ELISA binding curve. [Figure 12] Immunogenicity of mRNA vaccines in guinea pigs is shown. Elicitation of binding antibodies against SARS-CoV and SARS-CoV-2 was confirmed in guinea pigs using ELISA. The X-axis represents the antigen, and the Y-axis represents the area under the curve (AUC) of the ELISA binding curve. The Mann-Whitney U test is used as a statistical significance test in all plots (p-values: *≦0.05, **<0.01, ***≦0.001). [Figure 13]The structure of the SARS S protein is shown. The N-terminal sequence is involved in relaying extracellular signals into the cell. Research has shown that the N-terminal region of the S protein is much more diverse than the highly conserved C-terminal region (Dong et al., Genomic and protein structure modeling analysis depicts the origin and infectivity of 2019-nCoV, a new coronavirus which caused a pneumonia outbreak in Wuhan, China. 2020). The diagram shows the S domain, which includes the S1 and S2 domains responsible for receptor binding and cell membrane fusion, respectively. [Figure 14] Immunogenicity of mRNA vaccines in guinea pigs is shown. Guinea pigs were immunized with 15 μg of T2_17_TM mRNA at 3-week intervals according to the immunization schedule in Figure 5a. This figure shows neutralization of SARS-CoV-2 Wuhan and SARS-CoV-2 XBB 1.5 by guinea pig sera at bleed 3 (6 weeks after the booster immunization). Boxes represent the quartiles (25th, 50th, and 75th percentiles) of the distribution, whiskers represent the minimum and maximum values ​​of the distribution (excluding outliers), and flyers represented as black circles represent outliers. Two-tailed Mann-Whitney U demonstrated statistical significance (p-values: * ≤ 0.05, ** < 0.01, *** ≤ 0.001, **** ≤ 0.0001). [Figure 15A] The gating strategy used to analyze flow cytometry data is shown. (A) A preliminary FSC / SSC gate was set on the starting cell population. [Figure 15B] The gating strategy used to analyze flow cytometry data is shown. (B) Singlets were gated by plotting FSC-H vs. FSC-A, followed by gating live cells as 7-AAD negative (C). [Figure 15C]The gating strategy used to analyze flow cytometry data is shown. (B) Singlets were gated by plotting FSC-H vs. FSC-A, followed by gating live cells as 7-AAD negative (C). [Figure 15D] (D) The gating strategy used to analyze flow cytometry data is shown. Live cells were visualized as a histogram in the RL-1 channel, with the PMT for the negative cell population set between 10 and 10. [Figure 15E] (E) The gating strategy used to analyze flow cytometry data is shown. (F) The MFI values ​​of the positive control are shown. Representative flow cytometry plots are shown. [Figure 16] Figure 5 shows the immunogenicity of mRNA vaccines in guinea pigs. Guinea pigs were immunized with 15 μg of T2_17_TM mRNA at 3-week intervals according to the immunization schedule in Figure 5a. This figure shows the neutralization of SARS-CoV-2 omicron VOCs by guinea pig sera at bleed 3 (6 weeks post-boost). Boxes represent quartiles (25th, 50th, and 75th percentiles) of the distribution, whiskers represent the minimum and maximum of the distribution (excluding outliers), and flyers represented as black circles represent outliers. [Figure 17a-1] Figure 17a shows neutralization of sarbecovirus lentiviral pseudotypes containing Omicron VOC by antisera generated in guinea pigs after immunization with next-generation optimized coronavirus T2_20 constructs, CoV_S_T3_3 (T2_20_v2) (SEQ ID NO: 49) and CoV_S_T3_4 (T2_17_T2_20_dimer) (SEQ ID NO: 51), and first-generation CoV_S_T2_20 (SEQ ID NO: 48). Data shown include results from study COV038 in guinea pigs. Guinea pigs were immunized twice, at weeks 0 and 3, and bled four times at three-week intervals. Data shown is for serum at SB2 (three weeks post-boost) (Figure 17b). [Figure 17a-2]Figure 17a shows neutralization of sarbecovirus lentiviral pseudotypes containing Omicron VOC by antisera generated in guinea pigs after immunization with next-generation optimized coronavirus T2_20 constructs, CoV_S_T3_3 (T2_20_v2) (SEQ ID NO: 49) and CoV_S_T3_4 (T2_17_T2_20_dimer) (SEQ ID NO: 51), and first-generation CoV_S_T2_20 (SEQ ID NO: 48). Data shown include results from study COV038 in guinea pigs. Guinea pigs were immunized twice, at weeks 0 and 3, and bled four times at three-week intervals. Data shown is for serum at SB2 (three weeks post-boost) (Figure 17b). [Figure 17a-3] Figure 17a shows neutralization of sarbecovirus lentiviral pseudotypes containing Omicron VOC by antisera generated in guinea pigs after immunization with next-generation optimized coronavirus T2_20 constructs, CoV_S_T3_3 (T2_20_v2) (SEQ ID NO: 49) and CoV_S_T3_4 (T2_17_T2_20_dimer) (SEQ ID NO: 51), and first-generation CoV_S_T2_20 (SEQ ID NO: 48). Data shown include results from study COV038 in guinea pigs. Guinea pigs were immunized twice, at weeks 0 and 3, and bled four times at three-week intervals. Data shown is for serum at SB2 (three weeks post-boost) (Figure 17b). [Figure 17a-4] Figure 17a shows neutralization of sarbecovirus lentiviral pseudotypes containing Omicron VOC by antisera generated in guinea pigs after immunization with next-generation optimized coronavirus T2_20 constructs, CoV_S_T3_3 (T2_20_v2) (SEQ ID NO: 49) and CoV_S_T3_4 (T2_17_T2_20_dimer) (SEQ ID NO: 51), and first-generation CoV_S_T2_20 (SEQ ID NO: 48). Data shown include results from study COV038 in guinea pigs. Guinea pigs were immunized twice, at weeks 0 and 3, and bled four times at three-week intervals. Data shown is for serum at SB2 (three weeks post-boost) (Figure 17b). [Figure 17b]Figure 17a shows neutralization of sarbecovirus lentiviral pseudotypes containing Omicron VOC by antisera generated in guinea pigs after immunization with next-generation optimized coronavirus T2_20 constructs, CoV_S_T3_3 (T2_20_v2) (SEQ ID NO: 49) and CoV_S_T3_4 (T2_17_T2_20_dimer) (SEQ ID NO: 51), and first-generation CoV_S_T2_20 (SEQ ID NO: 48). Data shown include results from study COV038 in guinea pigs. Guinea pigs were immunized twice, at weeks 0 and 3, and bled four times at three-week intervals. Data shown is for serum at SB2 (three weeks post-boost) (Figure 17b). [Figure 18-1] Figure 1 shows an amino acid sequence alignment of CoV_T2_20 (SEQ ID NO: 48), CoV_S_T3_3 (SEQ ID NO: 49), and COV_S_T3_4 (SEQ ID NO: 51) (with leader sequences). Differences between the sequences are shown as boxed residues. In this alignment, CoV_S_T3_4 (a T2_17_T2_20 dimer) is shown with the amino acid sequence of T2_20 preceding the amino acid sequence of T2_17. [Figure 18-2] Figure 1 shows an amino acid sequence alignment of CoV_T2_20 (SEQ ID NO: 48), CoV_S_T3_3 (SEQ ID NO: 49), and COV_S_T3_4 (SEQ ID NO: 51) (with leader sequences). Differences between the sequences are shown as boxed residues. In this alignment, CoV_S_T3_4 (a T2_17_T2_20 dimer) is shown with the amino acid sequence of T2_20 preceding the amino acid sequence of T2_17. [Figure 19] Figure 1 shows an amino acid sequence alignment of CoV_T2_20 (SEQ ID NO: 48), CoV_S_T3_3 (SEQ ID NO: 49), and COV_S_T3_4 (SEQ ID NO: 51) (with leader sequences). Differences between the sequences are shown as boxed residues. In this alignment, CoV_S_T3_4 (a T2_17_T2_20 dimer) is shown with the amino acid sequence of T2_17 preceding the amino acid sequence of T2_20. [Figure 20a]Figure 20a shows an immunogenicity study of optimized coronavirus CoV_S_T2_20 (SEQ ID NO: 48) in guinea pigs. Guinea pigs were immunized twice with mRNA at weeks 0 and 3 and bled at 3-week intervals starting on day 0 (Figure 20b). Data shown uses serum from bleed SB2 (3 weeks post-boost). The x-axis represents pseudoviruses tested for neutralization and the y-axis represents log(IC50) values. [Figure 20b] Figure 20a shows an immunogenicity study of optimized coronavirus CoV_S_T2_20 (SEQ ID NO: 48) in guinea pigs. Guinea pigs were immunized twice with mRNA at weeks 0 and 3 and bled at 3-week intervals starting on day 0 (Figure 20b). Data shown uses serum from bleed SB2 (3 weeks post-boost). The x-axis represents pseudoviruses tested for neutralization and the y-axis represents log(IC50) values. [Figure 21a] This is a continuation of the study shown in Figure 20. Figure 21a shows neutralization data for the optimized coronavirus CoV_S_T2_20 (SEQ ID NO: 48) antigen in guinea pigs against a more diverse group of coronavirus pseudoviruses. Guinea pigs were immunized twice with mRNA at weeks 0 and 3 and bled at 3-week intervals starting on day 0 (Figure 21b). Data shown uses serum from bleed SB2 (3 weeks post-boost). [Figure 21b] This is a continuation of the study shown in Figure 20. Figure 21a shows neutralization data for the optimized coronavirus CoV_S_T2_20 (SEQ ID NO: 48) antigen in guinea pigs against a more diverse group of coronavirus pseudoviruses. Guinea pigs were immunized twice with mRNA at weeks 0 and 3 and bled at 3-week intervals starting on day 0 (Figure 21b). Data shown uses serum from bleed SB2 (3 weeks post-boost). DETAILED DESCRIPTION OF THE INVENTION

[0298] Sequence Number Table

[0299] [Table 4-1]

[0300] [Table 4-2]

[0301] array

[0302] [ka]

[0303] [ka]

[0304] [ka]

[0305] The amino acid sequence of the transmembrane domain is shown in bold.

[0306] [ka]

[0307] [ka]

[0308] [ka]

[0309] [ka]

[0310] [ka]

[0311] [ka]

[0312] [ka]

[0313] [ka]

[0314] [ka] Cursive: T7 promoter Underline: Kozak

[0315] [ka] Cursive: SP6 Promoter Underline: Kozak

[0316] [ka] Cursive: SP6 Promoter Underline: Kozak

[0317] [ka] Cursive: T3 promoter Underline: Kozak

[0318] [ka] Cursive: T7 promoter Underline: Kozak

[0319] [ka] Cursive: T3 promoter Underline: Kozak

[0320] [ka] Cursive: SP6 Promoter Underline: Kozak

[0321] [ka] Cursive: T3 promoter Underline: Kozak

[0322] [ka]

[0323] [ka]

[0324] [ka]

[0325] [ka]

[0326] [ka]

[0327] [ka]

[0328] [ka]

[0329] [ka]

[0330] [ka]

[0331] [ka]

[0332] [ka]

[0333] [ka]

[0334] [ka]

[0335] [ka]

[0336] [ka]

[0337] [ka]

[0338] [ka] 5'UTR: HindIII-30nt random sequence-T7 promoter-5'MinUTR-Kozak-start codon 3'UTR: stop codon - EcoRI - SapI - 30 nt random sequence - HindIII

[0339] [ka] ARCA Cap=m27,3'-oGP3 G- 5'UTR(min)=GGAGACGCCACC ATG: Bold Stop codon: bold

[0340] [ka] ARCA Cap=m27,3'-oGP3 G- 5'UTR(min)=GGAGACGCCACC ATG: Bold 3'UTR (non-specific)=GAATT Poly(A) tail = -poly(approx. A120) Stop codon: bold

[0341] [ka] ATG: Bold Stop codon: bold

[0342] [ka]

[0343] [ka]

[0344] [ka]

[0345] Possible general forms of poly(A) Segmented polyA DNA / mRNA sequence (8) A55~65 -SA 55~65 wherein S is a single nucleotide selected from C, G, T, or U.

[0346] Segmented polyA DNA / mRNA sequence (9) A 55~65 -NS 3~4- NA 55~65 where N is a nucleotide that is not adenine. wherein the S nucleotide is any nucleotide A, C, G, T, or U.

[0347] >CoV_T2_20 (with leader sequence) (SEQ ID NO: 48) Amino acid sequence:

[0348] [ka] The amino acid sequence of the leader sequence (SEQ ID NO: 54) is underlined. The amino acid sequence of the transmembrane domain (SEQ ID NO: 2) is shown in bold.

[0349] >CoV_S_T3_3(T2_20v2)(with leader sequence)(SEQ ID NO:49) Amino acid sequence:

[0350] [ka] The amino acid sequence of the leader sequence (SEQ ID NO: 54) is underlined. The amino acid sequence of the transmembrane domain (SEQ ID NO: 2) is shown in bold.

[0351] >CoV_S_T3_3(T2_20v2)(leader sequence not included)(SEQ ID NO:50) Amino acid sequence:

[0352] [ka] The amino acid sequence of the transmembrane domain (SEQ ID NO: 2) is shown in bold.

[0353] >CoV_S_T3_4 (T2_17_T2_20 dimer) (including leader sequence) (SEQ ID NO: 51) Amino acid sequence:

[0354] [ka] The amino acid sequence of the leader sequence (SEQ ID NO: 54) is underlined. The amino acid sequence of the transmembrane domain (SEQ ID NO: 2) is shown in bold.

[0355] >CoV_S_T3_4 (T2_17_T2_20 dimer) (without leader sequence) (SEQ ID NO: 52) Amino acid sequence:

[0356] [ka] The amino acid sequence of the transmembrane domain (SEQ ID NO: 2) is shown in bold.

[0357] >CoV_S_T2_20 scaffold sequence (SEQ ID NO: 53) Amino acid sequence:

[0358] [ka] In this sequence, X can be any amino acid residue.

[0359] >Leader amino acid sequence (SEQ ID NO: 54): MDAMKRGLCCVLLLCGAVFVSPSAA [Example]

[0360] Example 1 A single receptor-binding domain-based antigen elicits broad humoral responses against SARS-CoV-2 and related sarbecoviruses across different vaccine platforms.

[0361] This example describes a novel receptor-binding domain-based single antigen that elicits a pan-sarbecovirus humoral response.

[0362] summary Among the coronaviruses causing zoonotic disease outbreaks over the past two decades, the diverse group of betacoronaviruses (β-CoVs) poses the greatest threat. To achieve broad vaccine protection against these viruses, vaccines capable of eliciting broad immune responses across one or multiple subgroups are needed. Leveraging a novel platform (DIOSynVax®) for selecting immunooptimized, structurally engineered antigens capable of eliciting immune responses across a range of related viruses, we demonstrate proof-of-concept for a single antigen against the Sarbecovirus subgenus. From a phylogenetically informed array of epitope-modified antigens, we selected an antigen (T2_17) based on its broad immune response in BALB / c mice. The immunogenicity and neutralization spectrum of T2_17 as a DNA immunogen against SARS-CoV-2 and related viruses were confirmed in guinea pigs and rabbits using a needleless intradermal immunization method. In particular, given the increasing number of mutations induced by SARS-CoV-2 variants of concern (VOCs), we tested rabbit sera for their ability to neutralize VOCs beta, gamma, delta, and omicron (BA.1). Vaccine sera consistently showed neutralizing ability against emerging VOCs, demonstrating the broad specificity of the vaccine design. Furthermore, protection against Delta in K18-hACE2 mice primed with AZD1222 vaccine was observed upon boosting with T2_17 in both DNA and modified vaccinia virus Ankara (MVA) vaccine platforms. We further validated the immunogenicity of T2_17 in mice in an mRNA vaccine platform. Here, we demonstrate proof-of-concept of the DIOSynVax® antigen pipeline for in vivo selection of single immunogens capable of eliciting broadly neutralizing immune responses.

[0363] Introduction In this study, we utilized a novel platform of digitally immunooptimized synthetic vaccine antigens (DIOSynVax©) to expand coverage to all β-coronaviruses of the Sarbecovirus subgenus. These computationally immunooptimized and structurally engineered antigens were selected in vivo to induce immune responses across a group of related viruses. First, we generated phylogenetically informed RBD subunit-based antigens that compared all known human and animal reservoir sarbecovirus sequences. This antigen design was further used as a backbone to engineer both epitope-optimized and immune-refocused designs using available structural data of spike proteins in complex with RBD-binding monoclonal antibodies, specifically those that bind to both SARS-CoV and SARS-CoV-2, such as S309 (14) and CR3022 (15). The nucleic acid sequences of these in silico-designed antigens were optimized for human expression, and synthetic genes expressing each unique antigen structure were shuttled into expression cassettes for sequential in vitro and in vivo screening in BALB / c mice. The best-in-class immunologically optimal antigen, designated T2_17, was further confirmed by DNA immunoscreening in mice, followed by guinea pigs and rabbits. To further validate the utility of this antigen for boosting specific responses in the context of the existing spike-specific immune response of the early Wuhan isolate (used by most licensed vaccines), the T2_17 antigen was administered as a heterologous boost to K18-hACE2 transgenic mice pre-primed with the AZD1222 vaccine, using either DNA or MVA immunogens. RBD-specific immune responses were observed in the T2_17 antigen-immunized group. Further immunogenicity of the T2_17 antigen was confirmed in mice and guinea pigs as an mRNA-delivered immunogen based on chemically modified mRNA (16) in lipidoid nanoparticle formulations (LNP) (17).These studies confirmed that these computational structural antigen designs can elicit broad immunogenicity using a single RBD-based antigen that generates a broadly neutralizing humoral response covering SARS-CoV, SARS-CoV-2 including VOCs, and related bat sarbecoviruses.

[0364] result In silico antigen design: Spike protein sequences from viruses belonging to the sarbecovirus lineage were compiled from the NCBI Virus Database (18) and further pruned. The SARS-CoV-2 strain hCoV-19 / Wuhan / IVDC-HB-01 / 2019 was used for the analysis. A phylogenetic tree of these sequences is shown in Figure 1A. Two distinct clades were observed in the tree, separating clade 1, which does not interact with the ACE-2 receptor (1, 19), from clade 2, which does. Clade 1 viruses share many of the sequence features of clade 2 members but possess a deletion around the ACE-2 binding region (Figure 6). An optimized core sequence (T2_13) was designed to ensure that the novel antibody was phylogenetically closer to all sarbecoviruses represented in the phylogenetic tree shown in Figure 1A. To further understand the importance of the amino acid composition of epitopes in generating antibody responses, we modified T2_13 to display the exact amino acid sequence of the SARS-CoV epitope for monoclonal antibodies S309 (14) (T2_14) and CR3022 (15) (T2_15), and the exact amino acid sequence of the SARS-CoV-2 epitope for monoclonal antibody B38 (11) (T2_16). The sequences of the epitopes for monoclonal antibodies S309 (14) and CR3022 (15) are highly conserved across the sequences considered in this study, whereas the sequence of the epitope for monoclonal antibody B38 (11) is highly divergent (Figure 1B). We further modified the epitope region of monoclonal antibody B38 (11) by introducing glycosylation sites onto the backbone of T2_14 (T2_17) and T2_15 (T2_16). This was done to mask the divergent epitope region and enhance the presentation of conserved epitopes to the immune system. Epitope masking by introducing glycans has been exploited by many viruses, such as hepatitis C virus (20), Lassa virus (21), and influenza (22), to evade innate immunity, and we used this strategy to train the immune system against conserved epitopes.To compare the immunogenicity of soluble and membrane-anchored RBD subunit-based vaccines, membrane-anchored versions of T2_13 and T2_17 (T2_13_TM and T2_17_TM, respectively) were constructed. The structural stability of these designs was assessed in silico using the BUILD module of the FOLDX (23) algorithm, using T2_13 as the reference model. Structural models of these vaccine antigens are shown in Figure 1C.

[0365] Antigen selection and immunogenicity confirmation in BALB / c mice. In vivo screening was performed in BALB / c mice by immunizing them with the in silico-designed antigen and SARS-CoV-2 RBD (hCoV-19 / Wuhan / IVDC-HB-01 / 2019) as DNA immunogens (Figure 2A). Serum from immunized mice was assayed for cross-reactive antibodies against spike proteins in a flow cytometry-based cell surface display assay. Binding to four spike proteins, namely SARS-CoV (SARS-Tor2), SARS-CoV-2 (hCoV-19 / Wuhan / IVDC-HB-01 / 2019), WIV16, and RaTG13, was tested. Serum collected two weeks after the second immunization with the antigen design demonstrated the binding profile of the vaccine candidate against various spike proteins (Figure 2B). Serum from all antigen-immunized mice showed higher binding across the four spike proteins than mice immunized with PBS, suggesting seroconversion of the antigen-immunized mice.

[0366] No significant differences in binding were observed between sera from mice immunized with T2_13 and those from mice immunized with the SARS-CoV-2 RBD across the four spike proteins (all p>0.05, MWU test), suggesting that the epitopes in this design are biased toward the SARS-CoV-2 RBD. For the T2_16 design, in which the epitope region of mAb B38 was mutated to an epitope region on SARS-CoV-2, binding to SARS-CoV, WIV16, and RaTG13 was reduced compared to T2_13 (p<0.05, MWU test) without significant changes in binding to SARS-CoV-2. Matching the S309 and CR3022 epitopes to SARS-CoV (T2_14 and T2_15) enhanced binding to SARS-CoV (p<0.05, MWU test), but not to other spike proteins. Introduction of glycosylation sites in design T2_17 significantly enhanced the binding of elicited antibodies to SARS-CoV and RaTG13 compared to T2_14 (p<0.01, MWU test), whereas no difference was observed for T2_18 compared to T2_15. When delivered as a DNA immunogen, there was no statistical difference between the transmembrane-anchored and soluble designs. Because T2_17 had the best (or either second-best) median binding to the four spike proteins, we select T2_17 as a lead candidate for further immunological assays.

[0367] The induction of cross-binding antibodies by T2_17 was further confirmed by ELISA using SARS-CoV RBD and SARS-CoV-2 RBD (Figure 2C), which revealed strong binding antibody responses to both SARS-CoV and SARS-CoV-2 within 2 weeks of the second immunization. T2_17 induced a stronger response to SARS-CoV compared with SARS-CoV-2 RBD. Against SARS-CoV-2, the two antigens—SARS-CoV-2 RBD and T2_17—produced similar binding antibody responses.

[0368] Immunogenicity of T2_17 was confirmed in outbred animals. To determine the breadth of antibody responses and neutralizing potency of T2_17 as a DNA immunogen in outbred animals, guinea pigs were immunized using the CE-approved and clinically validated Pharmajet Tropis (©) needleless intradermal delivery device to ensure standardized intradermal delivery (Figure 3A). As a control, we used a C-terminal glycosylation-modified SARS-CoV-2 RBD (SARS2_RBD_P521N) (Figure 3B), previously evaluated in BALB / c mice (Figure 7). The generation of neutralizing antibodies against both SARS-CoV and SARS-CoV-2 was confirmed using pseudoviruses expressing the full-length spike proteins of SARS-CoV and SARS-CoV-2. Both T2_17 and SARS2_RBD_P521N produced binding antibodies to both SARS-CoV and SARS-CoV-2 (Figure 8) after one immunization, but T2_17 induced significantly higher antibodies than SARS2_RBD_P521N against SARS-CoV and comparable antibodies against SARS-CoV-2. After two immunizations, higher binding antibodies were detected for T2_17 against SARS-CoV compared to SARS2_RBD_P521N, but the responses were comparable for SARS-CoV-2. After three immunizations, SARS2_RBD_P521N induced a higher response against SARS-CoV-2, while T2_17 had a higher response against SARS-CoV (Figure 8). Neutralizing antibodies were detected for SARS-CoV-2 after the first immunization, whereas significant neutralizing responses against SARS-CoV occurred after two immunizations and were more potent for T2_17 than for SARS2_RBD_P521N (Figure 3C). Because SARS2_RBD_P521N differs from SARS-CoV-2 by only one amino acid, better binding and neutralizing responses by SARS2_RBD_P521N against SARS-CoV-2 were expected.To further confirm whether the T2_17 vaccine design generates broader responses, we compared sera induced by SARS2_RBD_P521N 28 days after the third immunization for neutralization against SARS-CoV (SARS-Tor2), SARS-CoV-2 (hCoV-19 / Wuhan / IVDC-HB-01 / 2019), WIV16, and RaTG13. Statistically significantly higher neutralizing antibody titers were generated by T2_17 against SARS-CoV, WIV16, and RaTG13 (Figure 3D). To further confirm that antisera against T2_17 can abolish hACE2 receptor binding, we performed an ELISA-based competition assay demonstrating that T2_17 and SARS2_RBD_P521N antisera abolished binding to the hACE-2 receptor and were comparable to the WHO standard (NIBSC standard-20 / 162) of pooled convalescent COVID-19 patient sera (Figure 3E). These results demonstrated an important proof-of-concept that T2_17, a single-gene-delivered, structurally engineered antigen, can elicit broad-spectrum pan-sarbecocoronavirus neutralizing antibodies. Prior to human clinical trials, a GMP lot of pEVAC T2_17 was manufactured and evaluated for safety and immunogenicity in rabbits using the same gene delivery device to ensure uniform intradermal administration (Figure 3F). After one immunization, binding antibodies against SARS-CoV and SARS-CoV-2 were elicited (Figure 9), which increased with subsequent immunizations until reaching a plateau by the fourth immunization. Strong neutralizing antibodies were observed 2 weeks after the third immunization (Figure 3G), and serum 14 days after the fourth immunization (bleed 4) demonstrated broad neutralizing antibody responses against SARS-CoV, SARS-CoV-2, beta, gamma, delta, omicron (BA.1) Viruses and bat sarbecoviruses-WIV16, and RaTG13 elicited by gene delivery of the engineered T2-17 pan-sarbeco vaccine candidate (Figure 3H).

[0369] Challenge studies in mice expressing human ACE2-K18-hACE2. Since nearly the entire human population seroconverts, either by natural infection, vaccination, or both, we tested the efficacy of the T2_17 antigen when administered as a booster after AZD1222 (ChAdOx1 nCoV-19) as a prime vaccine. To address this, homozygous K18-hACE2 transgenic mice were inoculated with 1.4 × 10 9 Mice were immunized with vp AZD1222 and boosted 4 weeks later with either T2_17 or the licensed AZD1222 vaccine (Figure 4A), while the control group received only PBS at each immunization. Because no significant neutralizing responses were observed in mice using T2_17 as a DNA vaccine in the prime-boost regimen, we administered T2_17 as either a DNA immunogen or a modified vaccinia virus Ankara (MVA) immunogen. The ChadOx-MVA prime-boost regimen has been shown to be effective in Ebola (28, 29). Eight weeks after the booster immunization, mice in all groups were challenged with either the January 2020 isolate of SARS-CoV-2 (Victoria) or the delta strain of SARS-CoV-2 (Table 1).

[0370] [Table 1]

[0371] Increased binding antibody titers against both SARS-CoV and SARS-CoV-2 were observed after boosting with either AZD1222 or T2_17 (Figure 10). A statistically significant difference in antibody titers against SARS-CoV-2 was observed 4 weeks after boosting with T2_17 as the DNA or MVA immunogen compared to boosting with AZD1222, but a statistically significant increase in binding antibody titers against SARS-CoV was observed after boosting with T2_17 as the MVA immunogen (Figure 10). The generation of neutralizing antibodies against SARS-CoV, SARS-CoV-2, and DeltaVOC was confirmed using pseudoviruses expressing the full-length spike proteins of SARS-CoV, SARS-CoV-2, and DeltaVOC. Neutralizing antibodies against SARS-CoV-2 and Delta VOC were detected in all groups except the control group before challenge, whereas neutralizing antibodies against SARS-CoV were detected only in the T2_17 MVA boosted group (Figure 4B). Two weeks after the boost, both T2_17 as DNA and MVA immunogens neutralized the Delta strain significantly better than sera from mice boosted with AZD1222 (Figure 4B). Mice in all groups except the control survived and continued to gain weight after challenge with either the Victoria or Delta strain (Figure 4C).

[0372] Long-term serological studies in K18-hACE2 mice Because all groups were protected in the challenge study and similar levels of neutralizing antibodies were observed for SARS-CoV and SARS-CoV-2 before and after the boost, we investigated whether this could be due to the short interval between the prime and boost. To this end, we primed another group of K18-hACE2 mice with the AZD1222 vaccine and boosted them 20 weeks later (Figure 4D). Groups of mice were boosted with either AZD1222, T2_17(DNA), T2_17(MVA), or PBS (Table 2). One group of mice was primed with T2_17(MVA) alone as a control. The AZD1222 / PBS group was included to monitor antibody titers over time in the absence of a boost.

[0373] [Table 2]

[0374] Blood was collected from immunized mice 12 weeks after priming to check antibody titers. Only neutralizing antibody titers against SARS-CoV-2 were measured for this longitudinal analysis. In this study, significantly higher titers were observed in the T2_17(MVA) boost group (Figure 4E). No antibody titers were observed in the T2_17(MVA)-primed group, suggesting that MVA is a weaker platform when delivered as a prime. Antibody levels were maintained up to 44 weeks after priming. Because T2_17 is an RBD-based antigen, we further investigated whether boosting with T2_17 would generate higher RBD-specific antibodies compared to boosting with AZD1222. Final bleed sera from the four mice with the highest neutralizing antibodies for vaccine groups—PBS / PBS, PBS / T2_17(MVA), AZD1222 / AZD1222, and AZD1222 / T2_17(MVA)—were tested against 14 overlapping 15-mer peptides from the SARS-CoV RBD, SARS-CoV-2 RBD, and T2_17 using PEPperPRINT® microarray technology. The PBS / PBS mouse group was used for intensity normalization for the remaining test groups. Microarray data are shown in Figure 4F. Compared to the AZD1222-boosted group, a greater number of peptide hits were observed in the T2_17(MVA)-boosted group, suggesting that the T2_17-boosted group induced a greater number of RBD-specific antibodies.

[0375] Immunogenicity of vaccine candidates in the mRNA platform. To further validate the immunogenicity of T2_17 in the mRNA platform, we immunized BALB / c mice with T2_17 as an mRNA immunogen. Previous reports on mRNA vaccines have shown that membrane-anchored, prefusion-stabilized, full-length MERS spike antigens elicited stronger pseudovirus-neutralizing antibody responses than soluble forms (30). In this study, T2_17 was also delivered to mice as a transmembrane-anchored (T2_17_TM) mRNA immunogen (SEQ ID NO: 46). The mRNA immunogen was delivered at different doses, i.e., 5 μg and 10 μg, in a prime-boost regimen at 4-week intervals in BALB / c mice (Figure 11A). A full-length spike protein with a double proline mutation in a lipid formulation, like that used for T2_17 and T2_17_TM, was used as a control (SEQ ID NO: 43). Additionally, the BNT162b2 vaccine was used as a control. All mice immunized with the antigen produced binding antibodies against SARS-CoV-2. Transmembrane-anchored T2_17 produced significantly higher binding antibodies at the 5 μg dose compared to soluble T2_17 (Figure 11B). No significant differences were observed for T2_17_TM at the two test doses. A higher dose of 10 μg of T2_17 produced comparable binding antibody titers to T2_17_TM (Figure 11B). No significant differences were observed between full-length spike SCoV2 (PP) mRNA and Biontech's BNT162b2 mRNA, i.e., mRNA modified with 25% 2-thiouridine and 25% 5-methylcytidine or 100% N1-methylpseudouridine (Figure 11B). Because higher antibody titers were observed for T2_17_TM at lower doses, we further evaluated the immunogenicity of T2_17_TM in guinea pigs. Guinea pigs were immunized with mRNA encoding T2_17_TM (SEQ ID NO: 46) and the full-length spike with a double proline mutation (SEQ ID NO: 43) at 3-week intervals (Figure 5A). Three weeks after the prime, T2_17_TM induced binding antibodies to SARS-CoV and SARS-CoV-2, whereas the full-length spike antigen induced binding antibodies to SARS-CoV but not SARS-CoV-2 (Figure 12).T2_17_TM induced significantly higher binding antibody titers against SARS-CoV-2 compared to the full-length spike three weeks after the boost (Figure 12). Three weeks after the boost, higher neutralizing antibody titers against SARS-CoV were observed for T2_17_TM. A small number of guinea pigs immunized with the full-length spike (SEQ ID NO: 43) induced neutralizing titers against SARS-CoV three weeks after the boost, but the titers subsequently declined to low levels. Meanwhile, the neutralizing titers remained high for T2_17_TM. Neutralizing antibody titers were observed for both T2_17_TM and the full-length spike against SARS-CoV-2, and titers were lower for T2_17_TM compared to the full-length spike. However, it should be noted that the full-length spike presents other epitopes in the three RBD subunits and the S1 and S2 subunits. We further confirmed the breadth of T2_17_TM by measuring neutralization titers against RaTG13, WIV16, and the SARS-CoV-2 Omicron (BA.1) variant. Significantly higher neutralization titers were observed for T2_17_TM against WIV16, SARS-CoV, and the SARS-CoV-2 Omicron (BA.1) strain 6 weeks after booster immunization. The neutralization titer of the full-length spike was nearly negligible against the SARS-CoV-2 Omicron strain (Figure 5C).

[0376] Consideration The occurrence of two human epidemics driven by ACE-2 receptors using sarbecoviruses over the past two decades highlights the urgent need for vaccines that can provide broad protection from SARS-CoV-2 and the closely related ACE-2 receptor using sarbecoviruses, which can be transmitted between species from zoonotic reservoir hosts. To achieve pan-sarbeco / pan-betacoronavirus protection, various vaccine strategies have been used, including mRNAs expressing chimeric versions of spike proteins from various coronaviruses (31) and mosaic and cocktail nanoparticles expressing the RBDs of various coronaviruses (32). While these strategies have been reported to be effective in generating pan-sarbeco / pan-betacoronavirus immune responses, they require the synthesis, manufacture, and formulation of multiple gene constructs, which can pose a significant bottleneck for large-scale manufacturing. In addition to the possibility of zoonotic transmission between species from related bat or other mammalian sarbecoviruses, another cause for concern is the rapid accumulation of immune escape mutations in circulating SARS-CoV-2. Since late 2020, numerous mutations that result in immune evasion, increased transmissibility, or both have been reported, with the most recent circulating Omicron lineage reporting the largest number of mutations in the SARS-CoV-2 viral genome. Effective vaccines targeting these circulating variants of concern are currently needed. An ideal candidate would be a single antigen that provides protection against a diverse group of sarbecoviruses as well as VOCs.

[0377] Here, we present preclinical data on a single-antigen RBD subunit-based vaccine design that induces immune responses against SARS-CoV, SARS-CoV-2, RaTG13, WIV16, and BA.1 lineage Viruses. The antibody core scaffold was designed using the novel DIOSynVax platform. The platform integrates phylogenetic relationships between input sequences and structural bioinformatics to generate core antigen sequences that ideally should generate immune responses against a diverse group of phylogenetically related viruses. We further modified the core antigen sequences by mutating several known epitopes on the RBD, introducing glycosylation sites, or both, to enhance the immunogenicity of the antigens. This resulted in a panel of antigens designated T2_13 to T2_17. The immunogenicity and breadth of these antigens were confirmed in BALB / c mice. From the binding profiles of sera from mice immunized with these antigens, we down-selected one of the antigens, T2_17, for further preclinical studies. Mice immunized with T2_17 as a DNA immunogen induced significant binding titers against both SARS-CoV and SARS-CoV-2. Furthermore, neutralizing antibodies against both SARS-CoV and SARS-CoV-2 were detected in outbred guinea pigs and outbred rabbits. Notably, rabbit sera neutralized a broad panel of SARS-CoV-2 VOCVs, namely alpha, beta, gamma, delta, and omicron. These broad humoral responses validate the DIOSynVax® platform used to generate pan-Sarbeco RBD subunit-based antibodies. The breadth of the antigen (T2_17) against VOCs up to BA.1 is particularly promising as the antigen was designed using the hCoV-19 / Wuhan / IVDC-HB-01 / 2019 strain of SARS-CoV-2, suggesting the applicability of the platform to capture some future variants to some extent.

[0378] To further demonstrate the utility of T2_17 as a booster in a non-naive population, K18-hACE2 mice were primed with AZD1222 vaccine, boosted at 4-week intervals with AZD1222 or T2_17 as a DNA or MVA immunogen, and challenged with either the Victoria or Delta strains of SARS-CoV-2. All mice immunized with the antigen were protected from challenge, with increased neutralizing antibody titers against Delta in the T2_17 boosted group 4 weeks after the boost. Neutralizing antibodies against SARS-CoV were observed in the T2_17(MVA) group. T2_17(DNA) did not induce neutralizing antibodies against SARS-CoV-2. We believe this is due to differences in the properties of the vaccine vectors between AZD1222 and DNA, which was not addressed in this study. Further longitudinal serological studies were conducted to understand the impact of boosting K18-hACE2 mice at 20-week intervals. Antibody titers remained high for 12 weeks after priming, with only the T2_17(MVA) boost group showing a significant increase in antibody titers 4 weeks after the boost. Equivalent titers were observed across all antigen-immunized mouse groups at 44 weeks after the prime. Furthermore, to confirm the differential immune response in the T2_17(MVA) boost group, peptide microarrays were performed on terminal sera from K18-hACE2 mice from the long-term study. A higher number of peptide hits against the RBD region were observed in the T2_17(MVA) boost group, suggesting a greater induction of RBD-specific humoral responses in the T2_17 boost group.

[0379] mRNA vaccine technology offers a competitive edge over many established vaccine technologies, with superior immunogenicity, tolerability, and faster production (33). T2_17 was tested as an mRNA immunogen in mice and guinea pigs using chemically modified mRNA in lipidoid nanoparticle formulations (LNPs) (16) (17). Previous studies on MERS-based vaccines have shown that membrane-anchored, prefusion-stabilized, full-length MERS spike antigens elicited stronger pseudovirus-neutralizing antibody responses than soluble forms as mRNA immunogens (30). In this study, BALB / c mice were immunized with different doses of T2_17 and transmembrane-anchored T2_17 (T2_17_TM) at 5 μg and 10 μg, respectively. T2_17_TM demonstrated significantly higher binding antibody titers compared to T2_17 at the lower dose of 5 μg, but comparable binding antibody titers at the 10 μg dose. Based on these observations, we further validated T2_17_TM as an mRNA immunogen in guinea pigs. Both binding and neutralizing antibodies were observed for T2_17_TM. Six weeks after the booster immunization, only guinea pigs immunized with T2_17_TM demonstrated neutralizing antibodies against SARS-CoV and the SARS-CoV-2 Omicron (BA.1) variant. The group immunized with the full-length SARS-CoV-2 spike did not demonstrate strong neutralizing immune responses against SARS-CoV and the SARS-CoV-2 Omicron strain. While higher antibody titers against SARS-CoV-2 and RaTG13 were observed with the full-length spike, it should be noted that the full-length spike, which presents three RBD subunits homologous to the SARS-CoV-2 spike tested here, consistently has higher titers compared to other heterologous antigens. Furthermore, the high similarity between the S2 region of SARS-CoV-2 and RaTG13 also induces higher cross-neutralizing antibodies between RaTG13 and SARS-CoV-2, resulting in higher antibody titers for the full-length spike compared to T2_17. Overall, all combined studies support T2_17 as an attractive single antibody for targeting multiple sarbecoviruses and its applicability across different vaccine platforms.

[0380] In conclusion, T2_17 generates strong humoral immune responses against SARS-CoV, SARS-CoV-2, RaTG13, WIV16, and SARS-CoV-2 variants—alpha, beta, gamma, delta, and omicron (BA.1). This demonstrates the robustness of the platform, as its design predated the emergence of these variants and their sequences were not included in the initial design. Given the ongoing emergence of new variants, it is essential that new vaccine antigens be substantially different from the Wuhan strain or other variants to go beyond boosting conserved immunodominant epitopes in these strains (34, 35). As a novel antigen with moderate similarity to SARS-CoV-2, T2_17 may be an ideal booster vaccine candidate to overcome immune imprinting by Wuhan-strain-based spike vaccines.

[0381] Materials and Methods Study design The primary objective of this study was to investigate the broad-based immune response and protective efficacy of the T2_17 vaccine against SARS-CoV, SARS-CoV-2, and related bat sarbecoviruses. Sample size was estimated empirically by considering the variability of results and the required statistical power while minimizing the number of animals. Animals in the study were randomly assigned for immunological readout. The study was unblinded. No data points were omitted from the analysis. The animal studies were approved by the AWERB University of Cambridge (Animal Welfare and Ethical Review Body), and the experiments were conducted under an approved UK Home Office license.

[0382] Phylogenetic analysis Protein sequences of spike proteins were downloaded from the NCBI virus database for all known sarbecoviruses. A multiple sequence alignment (MSA) was generated using MUSCLE (36). The resulting MSA was pruned to the RBD region, filtered at 95% sequence identity, and used as input for phylogenetic tree reconstruction. The protein model with the best BIC score was used to generate a phylogenetic tree using IQTREE (24). The resulting tree was used to generate a phylogenetically optimized design using HyPhy (37).

[0383] Epitope identification Available structural data (June 2020) for spike protein-antibody complexes for SARS-CoV and SARS-CoV-2 were downloaded from the Protein Databank (PDB) (27). These structural data were further truncated for antigen-antibody complexes in which the epitope region is located in the RBD. An amino acid residue in the antigen with at least one atom within a 5 Å radius of at least one atom of an amino acid in the antibody was defined as an epitope residue, and an epitope region was defined as a continuous stretch of at least five amino acids.

[0384] Glycosylation site modification The location of glycosylation sites was determined by in silico mutation of triplets of amino acids in the epitope to the glycosylation sequon-NXT (38) using the FoldX algorithm (23). Briefly, the residue following the NX motif (where X can be any amino acid except Pro) was mutated to either threonine or serine, or the residue preceding the XT (where X can be any amino acid except Pro) was mutated to Asn to create a novel NXT / S motif. The mutation with the lowest energy cost, as calculated by the Build module of FoldX (23), was selected.

[0385] Molecular Modeling A structural model was generated for T2_13 using MODELLER (39, 40) using both the SARS-CoV and SARS-CoV-2 structures as templates. The structural model with the highest DOPE score (41) was selected as the working model for further molecular modeling. The side chains of the model were further optimized using SCWRL (42), and energy was minimized using GROMACS (43). For T2_14–T2_18, mutations were introduced using the BUILD module of the FOLDX algorithm with T2_13 as the reference structure (23), and structural stability was confirmed using the FOLDX force field (23).

[0386] Plasmid production and transformation The antigen sequences were gene-optimized and adapted to human codon usage via the GeneOptimizer algorithm (44). These genes were cloned into pEVAC (GeneArt, Germany) via restriction digestion. Plasmids were transformed into chemically induced competent E. coli DH5α cells (Invitrogen 18265-017) via heat shock. Plasmid DNA was extracted from the transformed bacterial cultures using a Plasmid Mini Kit (Qiagen 12125). All plasmids were then quantified using UV spectrophotometry (NanoDrop® - Thermo Scientific).

[0387] Vaccination experiments in mice Eleven groups of six 8-10 week old female BALB / c mice were purchased from Charles River Laboratories (Kent, UK). Mice were immunized a total of four times at 30 day intervals. A total volume of 50 μg of plasmid DNA in 50 μl of PBS was administered subcutaneously in the posterior flank. Blood was sampled from the saphenous vein at 15 day intervals, and animals were terminally bled by cardiac puncture under non-recoverable anesthesia on day 150.

[0388] Fluorescence-assisted cell sorting (FACS) assay HEK293T cells were transfected with expression plasmids expressing wild-type spike glycoproteins from four ACE-2-binding sarbecoviruses, including SARS-CoV (SARS-Tor2), SARS-CoV-2 (hCoV-19 / Wuhan / IVDC-HB-01 / 2019), WIV16 (accession ID: ALK02457), and RaTG13 (accession ID: QHR63300). Forty-eight hours after transfection, cells were transferred to V-bottom 96-well plates (50,000 cells / well). Cells were incubated with serum (diluted 1:50 in PBS) or anti-mouse IgG isotype negative control (Invitrogen 10400C, diluted at 20 μg / mL in PBS) for 30 minutes, washed with FACS buffer (PBS, 1% FBS, 0.02% Tween® 20), and incubated with goat anti-mouse IgG (H+L) Alexa Fluor 647 secondary antibody (Invitrogen A32728, diluted at 20 μg / mL in FACS buffer) for 30 minutes in the dark. Cells were washed with FACS buffer, and samples were processed on an Attune NxT Flow Cytometer (Invitrogen) equipped with a high-throughput autosampler. Dead cells were excluded from analysis by staining cells with 7-aminoactinomycin D (7-AAD) and gating on 7-AAD-negative live cells.

[0389] Enzyme-linked immunosorbent assay (ELISA) The assay was adapted from that originally described by Amanat and coworkers. (45) Briefly, Nunc MaxiSorp® flat-bottom plates were filled with 50 μl / well of SARS-1 or SARS-2 DPBS (-Ca 2+ / -Mg 2+Plates were coated with 1 μg / mL RBD from (Sigma) and incubated overnight at 4°C. The next day, the plates were blocked with 3% milk in PBST (0.1% w / v Tween® 20 in PBS) for 1 hour. After removing the blocking buffer, 50 μl / well of serum samples diluted in PBST-NFM (1% w / w nonfat milk in PBST) were added to the plates and incubated on a plate shaker at 20°C for 2 hours. The plates were washed three times with 200 μl of PBST, and then 50 μl of HRP-conjugated goat anti-Ig (heavy and light chains) (Jackson ImmunoResearch) was added to each well and incubated on a plate shaker for 1 hour. The plates were washed three times with 200 μl of PBST, and 50 μl / well of 1-Step Ultra TMB chromogenic substrate (Sigma) was added to the plates. The chemical reaction was stopped after 3 minutes with 50 μl of 2N H2SO4. The optical density at a wavelength of 450 nm (OD450) was measured using a BioRad microplate reader. Values ​​from the dilution curve were used to determine the area under the curve.

[0390] Intradermal nucleic acid immunization with Tropis PharmaJet (copyright) delivery in guinea pigs Two groups of eight 7-week-old female Dunkin Hartley guinea pigs (Envigo RMS, Blackthorn, United Kingdom) were immunized three times, 28 days apart. A total volume of 200 μl of PBS containing 400 μg of plasmid DNA was administered via a PharmaJet Tropis intradermal device, divided into each hind limb. Blood was sampled from the saphenous vein at 14-day intervals.

[0391] Intradermal nucleic acid immunization with Tropis PharmaJet © delivery in rabbits.

[0392] Ten adult (5 male, 5 female) rabbits were immunized intradermally in the upper left and upper right hind limbs with GMP lot pEVAC_T2_17 (clinical pEVAC_PS) (300 μl at 2 mg / mL) via a PharmaJet Tropis needleless delivery device. For the control group, 10 adult (5 male, 5 female) rabbits were injected with PBS. Arterial blood was sampled at 14-day intervals.

[0393] Production of lentiviral pseudotypes Lentiviral pseudotypes were produced by transient transfection of HEK293T / 17 cells with the packaging plasmids p8.91 (46, 47) and pCSFLW (48) and different SARS-CoV-2 VOC spike-carrying expression plasmids using Fugene-HD transfection agent (49, 50). Supernatants were collected 48 h later, passed through a 0.45 μm cellulose acetate filter, and titrated on HEK293T / 17 cells transiently expressing human ACE-2 and TMPRSS2. Target HEK293T / 17 cells were transfected 24 h prior with 2 μg of pCAGGS-huACE-2 and 75 ng of pCAGGS-TMPRSS2 (51, 52).

[0394] Pseudotype-based microneutralization assay Pseudotype-based microneutralization assays were performed as previously described (53). Briefly, serial dilutions of serum were incubated with lentiviral pseudotyped SARS-CoV-2 / RaTG13 / SARS-CoV / WIV16 / SARS-CoV-2 variant spikes in 96-well white cell culture plates at 37°C and 5% CO for 1 h. Then, 1.5 x 10 cells transiently expressing human ACE-2 and TMPRSS2 were incubated in a 96-well white cell culture plate. 4of HEK293T / 17 was added per well and the plate was incubated for 48 hours at 37°C and 5% CO in a humidified incubator. Bright-Glo (Promega) was then added to each well and luminescence was read after a 5-minute incubation period. Experimental data points were normalized to 100% and 0% neutralization controls and nonlinear regression analysis was performed in GraphPad Prism 9 to generate neutralization curves and IC 50 got the value.

[0395] ACE-2 competition assay The SARS-CoV-2 surrogate virus neutralization test (SVNT, GenScript, Piscataway, NJ, USA) was performed according to the manufacturer's instructions. Briefly, serum from six bled guinea pigs was diluted in PBS over an eight-point 1:2 dilution series starting at a starting concentration of 1:50. The samples were further diluted 1:9 in the provided sample buffer and then mixed with HRP conjugated to SARS-CoV-2 RBD protein, incubated at 37°C for 30 minutes, and added to human ACE-2 protein-coated wells in a 96-well plate format. The reactions were incubated at 37°C for 15 minutes and then washed four times with the provided wash buffer. TMB solution was then added and incubated at room temperature in the dark for 15 minutes to allow the reaction to proceed. The reactions were then quenched using the provided stop solution, and the absorbance was then read at 450 nm.

[0396] MVA production The MVA strain used in this study was MVA-CR19. Recombinant MVA expressing the SARS-CoV-2 RBD T2-17 was generated as previously described. Briefly, for in vivo recombination, adherent AGE1.CR.pIX was infected with the parental MVA-CR19 TK-GFP at different MOIs ranging from 0.5 PFU to 0.006 PFU. After 2 h, cells were transfected with 0.4 μg of the shuttle vector pMVA_RBD T2_17 using Effectene (Qiagen, Hilden, Germany) according to the manufacturer's instructions. After 48 h, cells were harvested, lysed by three freeze / thaw cycles, and sonicated. Pure recombinant virus was obtained by successive plaque purification under agarose overlay, and the absence of parental MVA-CR19 TK-GFP contamination was confirmed by PCR screening. This recombinant MVA encoding the SARS-CoV-2 RBD T2-17 was plaque-purified for three additional rounds. The resulting recombinant MVA-CR19 RBD-T2_17 (MVA T2_17) virus stock was produced in suspension AGE1.CR.pIX cells, purified through two rounds of ultracentrifugation on a 35% sucrose cushion, and titered on DF-1 cells using crystal violet staining. The sequence of rMVA and the absence of revertant MVA were confirmed by PCR amplification and Sanger sequencing. Expression of RBD T2_17 was confirmed by Western blot analysis with monoclonal antibody CR3022 using cell lysates from HEK293 cells harvested 24 hours after infection with MVA T2_17 (MOI 2).

[0397] Vaccine boost efficacy study in K18-hACE2 mice Eight groups of six female 8-15 week-old homozygous K18-hACE2 mice (Jax) were divided into two hind limbs and injected with 1.4 × 10 9Mice were primed intramuscularly with viral particles of AZD1222 or PBS in a total volume of 100 μl. Twenty-eight days later, two groups of six mice were boosted with PBS, AZD1222, T2_17 DNA, or T2_17 MVA. Mice were bled at 2-week intervals and challenged on day 84 with either Victoria / 1 / 2020 (type B) or delta SARS-CoV-2 via the intranasal route in a total volume of 40 μl across both nostrils. Mice were weighed daily, observed for clinical signs, and monitored for 14 days before being euthanized by terminal bleeding.

[0398] Long-term serological studies in K18-hACE2 mice Six groups of six female 8-15 week-old homozygous K18-hACE2 mice (Jax) were divided into two hind limbs and injected with 1.4 × 10 9 Mice were primed intramuscularly with viral particles of AZD1222 or PBS in a total volume of 100 μl. Twenty weeks later, groups of six mice were boosted with PBS, AZD1222, T2_17(DNA), or T2_17(MVA). Mice were bled 12 weeks post-priming, 24 weeks post-priming, and terminally bled 44 weeks post-priming.

[0399] Peptide microarray Four samples were selected from the final blood draw of a longitudinal study of a K18-hACE2 mouse AZD1222 vaccine prime, T2_17 boost vaccine efficacy study. Samples were selected based on serum quality and pMN assay performance against SARS-CoV-2 Wuhan. Sample aliquots (30 μL) were sent to PEPperPRINT GmbH for peptide microarray analysis. Briefly, 15-mer peptides spanning the SARS-CoV RBD (213 AA) / SARS-CoV-2 RBD (214 AA) / T2_17 RBD (214 AA) with a 14 AA overlap were printed in duplicate per array copy for a total of five array copies. HA and c-Myc control peptides were included in each array copy. The protein sequence was extended with a neutral GSGSGSGSG linker to avoid cleaved peptides and remove identical peptides. A total of 1,310 peptide sequences were synthesized and spotted in duplicate on the PEPperCHIP® microarray platform. For all serum samples, the corrected raw data intensities were logarithmically transformed. For each vaccine group, i.e., PBS / T2_17 MVA, AZD1222 / AZD1222, and AZD1222 / T2_17MVA, peptides with raw data intensities two-fold higher than the maximum intensity observed in the PBS / PBS group were considered antibody epitope hits. This allowed us to eliminate any peptides that showed nonspecific binding to other biomolecules in the serum.

[0400] mRNA vaccine production An mRNA sequence encoding the SARS-CoV-2 S protein with two proline mutations, T2_17 and T2_17_TM, was synthesized by in vitro transcription (IVT) from a linearized plasmid DNA template using modified nucleotides to generate partially modified mRNA. After IVT, the mRNA was dephosphorylated and enzymatically polyadenylated. Purification was performed by precipitation, followed by formulation in water for injection at a concentration of 1 mg / mL. The mRNA was stored at -80°C until LNP encapsulation. Each mRNA was encapsulated in LNPs by nanoprecipitation, using microfluidic mixing of mRNA in citrate buffer (pH 4.5) with ionizable lipids, structural lipids, helper lipids, and polyethylene glycol (PEG) lipids in ethanol, followed by buffer exchange and concentration by tangential flow filtration. The mRNA / LNPs were filtered through a 0.2 μm membrane and stored at -20°C until use. The formulations were analytically characterized and deemed acceptable for in vivo use.

[0401] Immunization of BALB / c mice with mRNA Seven groups of six female 8-10 week-old BALB / c mice were purchased from Charles River Laboratories (Kent, UK). Mice were immunized twice, 21 days apart. A total volume of 50 μl of vehicle containing various amounts of mRNA was administered intramuscularly into each hind paw. Blood was sampled from the saphenous vein at 21-day intervals, and animals were terminally bled by cardiac puncture under non-recoverable anesthesia on day 63.

[0402] Immunization of guinea pigs with mRNA Three groups of six female Hartley guinea pigs, 8-10 weeks old, were purchased from Envigo (The Netherlands). The guinea pigs were immunized twice, 21 days apart. A total volume of 100 μl of vehicle containing various amounts of mRNA was administered intramuscularly into each hind paw. Blood was sampled from the saphenous vein at 21-day intervals, and the animals were humanely euthanized after terminal bleeding on day 63.

[0403] statistical analysis Using the Python sklearn package (54), a two-sided Mann-Whitney U test was performed for all comparisons. All plots were generated using the Python Matplotlib package and the statannotat package (55).

[0404] References and Notes 1. K. Liu, S. Tan, S. Niu, J. Wang, L. Wu, H. Sun, Y. Zhang, X. Pan, X. Qu, P. Du, Y. Meng, Y. Jia, Q. Chen, C. Deng, J. Yan, H.-W. Wang, Q. Wang, J. Qi, G. F. Gao, Cross-species recognition of SARS-CoV-2 to bat ACE2. Proc Natl Acad Sci U S A 118(2021), doi:10.1073 / pnas.2020216118. 2. K. J. Olival, P. M. Cryan, B. R. Amman, R. S. Baric, D. S. Blehert, C. E. Brook, C. H. Calisher, K. T. Castle, J. T. H. Coleman, P. Daszak, J. H. Epstein, H. Field, W. F. Frick, A. T. Gilbert, D. T. S. Hayman, H. S. Ip, W. B. Karesh, C. K. Johnson, R. C. Kading, T. Kingston, J. M. Lorch, I. H. Mendenhall, A. J. Peel, K. L. Phelps, R. K. Plowright, D. M. Reeder, J. D. Reichard, J. M. Sleeman, D. G. Streicker, J. S. Towner, L.-F. Wang, Possibility for reverse zoonotic transmission of SARS-CoV-2 to free-ranging wildlife: A case study of bats. PLOS Pathogens 16, e1008758(2020). 3.B.Hu,L.-P.Zeng,X.-L.Yang,X.-Y.Ge,W.Zhang,B.Li,J.-Z.Xie,X.-R.Shen,Y.-Z.Zhang,N.Wang,D.-S.Luo,X.-S.Zheng,M.-N.Wang,P.Daszak,L.-F.Wang,J.Cui,Z.-L.Shi,Discovery of a rich gene pool of bat SARS-related coronaviruses provides new insights into the origin of SARS coronavirus.PLOS Pathogens 13,e1006698(2017). 4.V.D.Menachery,B.L.Yount,K.Debbink,S.Agnihothram,L.E.Gralinski,J.A.Plante,R.L.Graham,T.Scobey,X.-Y.Ge,E.F.Donaldson,S.H.Randell,A.Lanzavecchia,W.A.Marasco,Z.-L.Shi,R.S.Baric,A SARS-like cluster of circulating bat coronaviruses shows potential for human emergence.Nat Med 21,1508-1513(2015). 5.S.Vilar,D.G.Isom,One Year of SARS-CoV-2:How Much Has the Virus Changed?Biology(Basel)10(2021),doi:10.3390 / biology10020091. 6.AMHorspool,C.Ye,TYWong,BPRuss,KSLee,MTWinters,JRBevere,T.Kieffer,I.Martinez,J.Sourimant,A.Greninger,RKPlemper,J.Denvir,HACyphert,J.Torrelles,L.Martinez-Sobrido,FHDamron,SARS-CoV-2 B.1.1.7 and B.1.351 variants of concern induces lethal disease in K18-hACE2 transgenic mice despite convalescent plasma therapy.bioRxiv(2021),doi:10.1101 / 2021.05.05.442784. 7.D.Planas,T.Bruel,L.Grzelak,F.Guivel-Benhassine,I.Staropoli,F.Porrot,C.Planchais,J.Buchrieser,MMRajah,E.Bishop,M. Albert,F.Donati,M.Prot,S.Behillil,V.Enouf,M.Maquart,M.Smati-Lafarge,E.Varon,F.Schortgen,L.Yahyaoui,M.Gonzalez,J.De Seze, H. Pere, D. Veyer, A. Seve, E. Simon-Loriere, S. Fafi-Kremer, K. Stefic, H. Mouquet, L. Hocqueloux, S. van der Werf, T. Prazuck, O. Schwartz, Sensitivity of infectious SARS-CoV-2 B.1.1.7 and B.1.351 variants to neutralizing antibodies.Nat Med 27,917-924(2021). 8.P.Wang,R.G.Casner,M.S.Nair,M.Wang,J.Yu,G.Cerutti,L.Liu,P.D.Kwong,Y.Huang,L.Shapiro,D.D.Ho,Increased resistance of SARS-CoV-2 variant P.1 to antibody neutralization.Cell Host Microbe 29,747-751.e4(2021). 9.K.Leung,M.H.Shum,G.M.Leung,T.T.Lam,J.T.Wu,Early transmissibility assessment of the N501Y mutant strains of SARS-CoV-2 in the United Kingdom,October to November 2020.Euro Surveill 26(2021),doi:10.2807 / 1560-7917.ES.2020.26.1.2002106. 10.F.Tian,B.Tong,L.Sun,S.Shi,B.Zheng,Z.Wang,X.Dong,P.Zheng,Mutation N501Y in RBD of Spike Protein Strengthens the Interaction between COVID-19 and its Receptor ACE2.bioRxiv,2021.02.14.431117(2021). 11.Y.Wu,F.Wang,C.Shen,W.Peng,D.Li,C.Zhao,Z.Li,S.Li,Y.Bi,Y.Yang,Y.Gong,H.Xiao,Z.Fan,S.Tan,G.Wu,W.Tan,X.Lu,C.Fan,Q.Wang,Y.Liu,C.Zhang,J.Qi,G.F.Gao,F.Gao,L.Liu,A noncompeting pair of human neutralizing antibodies block COVID-19 virus binding to its receptor ACE2.Science 368,1274-1278(2020). 12.W.C.Hwang,Y.Lin,E.Santelli,J.Sui,L.Jaroszewski,B.Stec,M.Farzan,W.A.Marasco,R.C.Liddington,Structural Basis of Neutralization by a Human Anti-severe Acute Respiratory Syndrome Spike Protein Antibody,80R.Journal of Biological Chemistry 281,34610-34616(2006). 13.F.Campbell,B.Archer,H.Laurenson-Schafer,Y.Jinnai,F.Konings,N.Batra,B.Pavlin,K.Vandemaele,M.D.Van Kerkhove,T.Jombart,O.Morgan,O.le Polain de Waroux,Increased transmissibility and global spread of SARS-CoV-2 variants of concern as at June 2021.Euro Surveill 26,2100509(2021). 14.D.Pinto,Y.-J.Park,M.Beltramello,A.C.Walls,M.A.Tortorici,S.Bianchi,S.Jaconi,K.Culap,F.Zatta,A.De Marco,A.Peter,B.Guarino,R.Spreafico,E.Cameroni,J.B.Case,R.E.Chen,C.Havenar-Daughton,G.Snell,A.Telenti,H.W.Virgin,A.Lanzavecchia,M.S.Diamond,K.Fink,D.Veesler,D.Corti,Cross-neutralization of SARS-CoV-2 by a human monoclonal SARS-CoV antibody.Nature 583,290-295(2020). 15.M.Yuan,N.C.Wu,X.Zhu,C.D.Lee,R.T.Y.So,H.Lv,C.K.P.Mok,I.A.Wilson,A highly conserved cryptic epitope in the receptor binding domains of SARS-CoV-2 and SARS-CoV.Science 368,630-633(2020). 16.M.S.D.Kormann,G.Hasenpusch,M.K.Aneja,G.Nica,A.W.Flemmer,S.Herber-Jonat,M.Huppmann,L.E.Mays,M.Illenyi,A.Schams,M.Griese,I.Bittmann,R.Handgretinger,D.Hartl,J.Rosenecker,C.Rudolph,Expression of therapeutic proteins after delivery of chemically modified mRNA in mice.Nat Biotechnol 29,154-157(2011). 17.A.Jarzebinska,T.Pasewald,J.Lambrecht,O.Mykhaylyk,L.Kummerling,P.Beck,G.Hasenpusch,C.Rudolph,C.Plank,C.Dohmen,A Single Methylene Group in Oligoalkylamine-Based Cationic Polymers and Lipids Promotes Enhanced mRNA Delivery.Angewandte Chemie International Edition 55,9591-9595(2016). 18.E.L.Hatcher,S.A.Zhdanov,Y.Bao,O.Blinkova,E.P.Nawrocki,Y.Ostapchuck,A.A.Schaffer,J.R.Brister,Virus Variation Resource-improved response to emergent viral outbreaks.Nucleic Acids Res 45,D482-D490(2017). 19.W.Li,S.-K.Wong,F.Li,J.H.Kuhn,I.-C.Huang,H.Choe,M.Farzan,Animal Origins of the Severe Acute Respiratory Syndrome Coronavirus:Insight from ACE2-S-Protein Interactions.J Virol 80,4211-4219(2006). 20.M.Lavie,X.Hanoulle,J.Dubuisson,Glycan Shielding and Modulation of Hepatitis C Virus Neutralizing Antibodies.Front Immunol 9,910(2018). 21.Y.Watanabe,J.Raghwani,J.D.Allen,G.E.Seabright,S.Li,F.Moser,J.T.Huiskonen,T.Strecker,T.A.Bowden,M.Crispin,Structure of the Lassa virus glycan shield provides a model for immunological resistance.Proc Natl Acad Sci U S A 115,7320-7325(2018). 22.D.Eggink,P.H.Goff,P.Palese,Guiding the immune response against influenza virus hemagglutinin toward the conserved stalk domain by hyperglycosylation of the globular head domain.J Virol 88,699-704(2014). 23.J.Schymkowitz,J.Borg,F.Stricher,R.Nys,F.Rousseau,L.Serrano,The FoldX web server:an online force field.Nucleic Acids Research 33,W382-W388(2005). 24.L.-T.Nguyen,H.A.Schmidt,A.von Haeseler,B.Q.Minh,IQ-TREE:A Fast and Effective Stochastic Algorithm for Estimating Maximum-Likelihood Phylogenies.Molecular Biology and Evolution 32,268-274(2015). 25.H.Ashkenazy,S.Abadi,E.Martz,O.Chay,I.Mayrose,T.Pupko,N.Ben-Tal,ConSurf 2016:an improved methodology to estimate and visualize evolutionary conservation in macromolecules.Nucleic Acids Res 44,W344-W350(2016). 26.L.Schrodinger,W.DeLano,PyMOL(2020)(available at http: / / www.pymol.org / pymol). 27.HMBerman,J.Westbrook,Z.Feng,G.Gilliland,TNBhat,H.Weissig,INShindyalov,PEBourne,The Protein Data Bank.Nucleic Acids Research 28,235-242(2000). 28.K.Ewer,T.Rampling,N.Venkatraman,G.Bowyer,D.Wright,T.Lambe,EBImoukhuede,R.Payne,SKFehling,T.Strecker,N.Biedenkopf,V.Krahling,CMTully,NJEdwards,EMBentley,D. Samuel,G.Labbe,J.Jin,M.Gibani,A.Minhinnick,M.Wilkie,I.Poulton,N.Lella,R.Roberts,F.Hartnell,J.Bliss,K.Sierra-Davidson,J.Powlson,E.Berrie,R.Tedder,F.Roman,I.DeRoman,I. Ryck,A.Nicosia,NJSullivan,DAStanley,OTMbaya,JELedgerwood,RMSchwartz,L.Siani,S.Colloca,A.Folgori,S.Di Marco,R.Cortese,E.Wright,S.Becker,BSGraham,RAKoup,MMLevine,A.Volkmann,P.Chaplin,AJPollard,SJDraper,WRBallou,A.Lawrie,SCGilbert,AVSHill,A Monovalent Chimpanzee Adenovirus Ebola Vaccine with JVA Bono Med. 374,1635-1646(2016). Curr Opin Immunol 35,131-136(2015) 29.Y.Zhou,NJSullivan,Adenovirus prime,MVA boost Ebola virus vaccine. 30. KSCorbett, DKEdwards, SRLeist, OMAbiona, S.Boyoglu-Barnum,RAGillespie,S.Himansu,A.Schafer,CTZiwawo,ATDiPiazza,KHDinnon,SMElbashir,CAShaw,AWoods,EJFri tch, DRMartinez, KW Bock, M. Minai, BM Nagata, GBHutchinson, K. Wu, C. Henry, K. Bahi, D. Garcia-Dominguez, L. Ma, I. Renzi, W.-P. Kong, SDSchmidt, L. Wang, Y. Zhang, E. Phung, LA Chang, RJ Loomis, NEAltars, E. Narayanan, M. Metkar, V. Presnyak, C. Liu, MK Louder, W. Shi, K. Leung, ES Yang, A. West, KL Gully, LJ Stevens, N. Wang, D. Wrapp, NADoria-Rose, G.S tewart-Jones, H.Bennett,GSAlvarado,MCNason,TJRuckwardt,JSMcLellan,MRDenison,JDChappell,INMoore,KMMorabito,JRMascola,RSBaric,ACarfi,BSGraham,SARS-CoV-2 mRNA Vaccine Design Enabled by Prototype Pathogen Preparedness.Nature 586,567-571(2020). 31.D.R.Martinez,A.Schafer,S.R.Leist,G.De la Cruz,A.West,E.N.Atochina-Vasserman,L.C.Lindesmith,N.Pardi,R.Parks,M.Barr,D.Li,B.Yount,K.O.Saunders,D.Weissman,B.F.Haynes,S.A.Montgomery,R.S.Baric,Chimeric spike mRNA vaccines protect against Sarbecovirus challenge in mice.bioRxiv,2021.03.11.434872(2021). 32.A.C.Walls,M.C.Miranda,A.Schafer,M.N.Pham,A.Greaney,P.S.Arunachalam,M.-J.Navarro,M.A.Tortorici,K.Rogers,M.A.O’Connor,L.Shirreff,D.E.Ferrell,J.Bowen,N.Brunette,E.Kepl,S.K.Zepeda,T.Starr,C.-L.Hsieh,B.Fiala,S.Wrenn,D.Pettie,C.Sydeman,K.R.Sprouse,M.Johnson,A.Blackstone,R.Ravichandran,C.Ogohara,L.Carter,S.W.Tilles,R.Rappuoli,S.R.Leist,D.R.Martinez,M.Clark,R.Tisch,D.T.O’Hagan,R.Van Der Most,W.C.Van Voorhis,D.Corti,J.S.McLellan,H.Kleanthous,T.P.Sheahan,K.D.Smith,D.H.Fuller,F.Villinger,J.Bloom,B.Pulendran,R.Baric,N.P.King,D.Veesler,Elicitation of broadly protective sarbecovirus immunity by receptor-binding domain nanoparticle vaccines.Cell(2021),doi:10.1016 / j.cell.2021.09.015. 33.T.Schlake,A.Thess,M.Fotin-Mleczek,K.-J.Kallen,Developing mRNA-vaccine technologies.RNA Biol 9,1319-1330(2012). 34.M.Aguilar-Bretones,R.A.Fouchier,M.P.Koopmans,G.P.van Nierop,Impact of antigenic evolution and original antigenic sin on SARS-CoV-2 immunity.J Clin Invest 133,e162192(2023). 35.B.Ju,Q.Fan,M.Wang,X.Liao,H.Guo,H.Wang,X.Ge,L.Liu,Z.Zhang,Antigenic sin of wild-type SARS-CoV-2 vaccine shapes poor cross-neutralization of BA.4 / 5 / 2.75 subvariants in BA.2 breakthrough infections.Nat Commun 13,7120(2022). 36.R.C.Edgar,MUSCLE:a multiple sequence alignment method with reduced time and space complexity.BMC Bioinformatics 5,113(2004). 37.S.L.K.Pond,S.D.W.Frost,S.V.Muse,HyPhy:hypothesis testing using phylogenies.Bioinformatics 21,676-679(2005). 38.R.Kornfeld,S.Kornfeld,Assembly of Asparagine-Linked Oligosaccharides.Annual Review of Biochemistry 54,631-664(1985). 39.N.Eswar,B.Webb,M.A.Marti-Renom,M.S.Madhusudhan,D.Eramian,M.-Y.Shen,U.Pieper,A.Sali,Comparative protein structure modeling using MODELLER.Curr Protoc Protein Sci Chapter 2,Unit 2.9(2007). 40.A.Sali,T.L.Blundell,Comparative protein modelling by satisfaction of spatial restraints.J Mol Biol 234,779-815(1993). 41.M.Shen,A.Sali,Statistical potential for assessment and prediction of protein structures.Protein Sci 15,2507-2524(2006). 42.G.G.Krivov,M.V.Shapovalov,R.L.Dunbrack,Improved prediction of protein side-chain conformations with SCWRL4:Side-Chain Prediction with SCWRL4.Proteins 77,778-795(2009). 43.D.Van Der Spoel,E.Lindahl,B.Hess,G.Groenhof,A.E.Mark,H.J.C.Berendsen,GROMACS:fast,flexible,and free.J Comput Chem 26,1701-1718(2005). 44.D.Raab,M.Graf,F.Notka,T.Schodl,R.Wagner,The GeneOptimizer Algorithm:using a sliding window approach to cope with the vast sequence space in multiparameter DNA sequence optimization.Syst Synth Biol 4,215-225(2010). 45. F. Amanat, D. Stadlbauer, S. Strohmeier, THONguyen, V. Chromikova, M. McMahon, K. Jiang, GAArunkumar, D. Jurczyszak, J. Polanco, M. Bermudez-Gonzalez, G. Kleiner, T. Aydillo, L. Miorin, DSFi erer,LALugo,EMKojic,J.Stoever,STHLiu,C.Cunningham-Rundles,PLFelgner,T.Moran,A.Garcia-Tailor,D.Caplivski,ACCheng,K.Kedzierska,O.Vapalahti,JMHepojoki,V.Simon,F.Krammer,A Serological assay for detecting SARS-CoV-2 seroconversion in humans.Nat Med 26,1033-1036(2020). 46.R.Zufferey,D.Nagy,RJMandel,L.Naldini,D.Trono,Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo.Nat Biotechnol 15,871-875(1997). 47.L.Naldini,U.Blomer,P.Gallay,D.Ory,R.Mulligan,F.H.Gage,I.M.Verma,D.Trono,In Vivo Gene Delivery and Stable Transduction of Nondividing Cells by a Lentiviral Vector(;http: / / science.sciencemag.org / ). 48.C.Demaison,K.Parsley,G.Brouns,M.Scherr,K.Battmer,C.Kinnon,M.Grez,A.J.Thrasher,High-level transduction and gene expression in hematopoietic repopulating cells using a human immunodeficiency[correction of imunodeficiency]virus type 1-based lentiviral vector containing an internal spleen focus forming virus promoter.Human gene therapy 13,803-813(2002). 49.A.T.Sampson,J.Heeney,D.Cantoni,M.Ferrari,M.S.Sans,C.George,C.Di Genova,M.Mayora Neto,S.Einhauser,B.Asbach,R.Wagner,H.Baxendale,N.Temperton,G.Carnell,Coronavirus Pseudotypes for All Circulating Human Coronaviruses for Quantification of Cross-Neutralizing Antibody Responses.Viruses 13,1579(2021). 50.C.Di Genova,A.Sampson,S.Scott,D.Cantoni,M.Mayora-Neto,E.Bentley,G.Mattiuzzo,E.Wright,M.Derveni,B.Auld,B.T.Ferrara,D.Harrison,M.Said,A.Selim,E.Thompson,C.Thompson,G.Carnell,N.Temperton,Production,Titration,Neutralisation,Storage and Lyophilisation of Severe Acute Respiratory Syndrome Coronavirus 2(SARS-CoV-2)Lentiviral Pseudotypes.Bio Protoc 11,e4236(2021). 51.M.Hoffmann,H.Kleine-Weber,S.Schroeder,N.Kruger,T.Herrler,S.Erichsen,T.S.Schiergens,G.Herrler,N.H.Wu,A.Nitsche,M.A.Muller,C.Drosten,S.Pohlmann,SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor.Cell 181,271-280.e8(2020). 52.S.Bertram,A.Heurich,H.Lavender,S.Gierer,S.Danisch,P.Perin,J.M.Lucas,P.S.Nelson,S.Pohlmann,E.J.Soilleux,Influenza and SARS-coronavirus activating proteases TMPRSS2 and HAT are expressed at multiple sites in human respiratory and gastrointestinal tracts.PLoS ONE 7,1-8(2012). 53. G. Carnell, K. Grehan, F. Ferrara, E. Molesti, N. J. Temperton, An Optimised Method for the Production using PEI, Titration and Neutralization of SARS-CoV Spike Luciferase Pseudotypes. Bio-Protocol 7 (2017) (available at http: / / dx.doi.org / 10.21769 / BioProtoc.2514). 54. F. Pedregosa, G. Varoquaux, A. Gramfort, V. Michel, B. Thirion, O. Grisel, M. Blondel, P. Prettenhofer, R. Weiss, V. Dubourg, J. Vanderplas, A. Passos, D. Cournapeau, M. Brucher, M. Perrot, E. Duchesnay, Scikit-learn: Machine Learning in Python. Journal of Machine Learning Research 12, 2825 - 2830 (2011). 55. J. D. Hunter, Matplotlib: A 2D Graphics Environment. Computing in Science Engineering 9, 90 - 95 (2007).

[0405] Example 2 mRNA sequences encoding COV_S_T2_17 and COV_S_T2_20 This example provides mRNA sequences encoding the COV_S_T2_17 and COV_S_T2_20 polypeptide sequences.

[0406] [Chemical formula]

[0407] [Chemical formula]

[0408] [ka]

[0409] [ka]

[0410] [ka]

[0411] Example 3 A single RBD-based antigen elicits broad humoral responses against SARS-CoV-2 and related sarbecoviruses across different vaccine technologies This example is a continuation of Example 1. In this example, T2_17_TM and the full-length spike (S) protein vaccine were further tested for neutralizing potency against XBB.1.5 and SARS2_Wuhan viruses in guinea pigs. T2_17_TM was also tested for neutralizing potency against additional Omicron VOCs in guinea pigs. The contents of the Introduction, Discussion, and related sections of Materials and Methods in Example 1 apply to this example.

[0412] Immunogenicity of vaccine candidates as mRNA Guinea pigs were immunized with either a 3.15 μg dose of T2_17_TM or a 15 μg dose of the full-length spike with the double proline mutation at 3-week intervals (Figure 5A). We further tested the neutralization titers against one of the recent prominent mutant strains, XBB.1.5. No neutralization titers were observed for either T2_17_TM or the full-length spike vaccine. To confirm whether the low neutralization titer of T2_17_TM was due to the low dose of 3.15 μg, we tested the serum from guinea pigs immunized with 15 μg of T2_17_TM and compared it with the serum from guinea pigs immunized with 15 μg of the full-length spike. Serum from guinea pigs immunized with 15 μg of T2_17_TM neutralized pseudoviruses expressing the XBB.1.5 mutant strain (Figure 14). FIG. 16 shows serum from guinea pigs immunized with 15 μg of T2_17_TM neutralizing pseudovirus expressing additional α micron VOCs.

[0413] Consideration Six weeks after the booster immunization, only guinea pigs immunized with T2_17_TM demonstrated neutralizing antibodies against the SARS-CoV-2 omicron (BA.1) variant at the lower dose of 3.15 μg and against XBB.1.5 at the higher dose of 15 μg. The group immunized with full-length SARS-CoV-2 spike did not demonstrate strong neutralizing immune responses against SARS-CoV or SARS-CoV-2 omicron XBB.1.5 at the 15 μg dose. At the time of T2_17's design, no SARS-CoV-2 mutant strains had yet been observed. The TM version of T2_17 still generated neutralizing antibodies against VOCs, including the recent XBB.1.5, although titers were lower than those observed against the Wuhan strain. Due to the extraordinary variability of SARS-CoV-2 in animals and humans due to its global distribution, future updates to T2_17 may be required, including not only the inclusion of VOC sequence information but also combinations with other conserved structural and non-structural antigens. Furthermore, a phase 1 clinical trial is currently being initiated to understand the immunogenicity of T2_17 in the context of the current combined immunity observed in the human population.

[0414] In conclusion, all studies combined support T2_17 as an effective single antibody for targeting multiple sarbecoviruses and its applicability across different vaccine technologies. Immunization with T2_17 generated strong humoral immune responses against SARS-CoV, SARS-CoV-2, RaTG13, WIV16, and SARS-CoV-2 variants—alpha, beta, gamma, delta, and omicron (BA.1, XBB1.5). The fact that the design of T2_17 predated the emergence of these Viruses and that none of their sequences were included in the initial design is a strong indication of DIOSynVax technology. Furthermore, immunization with T2_17_TM generated strong humoral immune responses against SARS-CoV, SARS-CoV-2, RaTG13, WIV16, and SARS-CoV-2 omicron BA.1 and XBB. XBB.1.5; BA.2.12.1; BA.2.75; BA.2.3.20; and BQ.1.1. Given the ongoing emergence of new variants, new vaccine antigens should be substantially different from the Wuhan strain or other variants to exceed the boosting of conserved immunodominant epitopes in these strains. All current vaccines use the full-length spike as the antigen, and only 16% of the antibodies generated against the spike antigen are RBD-directed. T2_17 is a novel RBD-based antigen with a significant difference of 14.5% from the Wuhan-Hu-1 strain of SARS-CoV-2, making it an ideal booster vaccine candidate to overcome immune imprinting caused by full-length spike vaccines.

[0415] Example 4 Next-generation engineered T2_20 (optimized coronavirus RBD) family antigen sequences The present inventors have developed the next generation T2_20 (optimized coronavirus RBD) family of antigens, the amino acid sequence of which is shown below.

[0416] >CoV_S_T3_3(T2_20v2)(with leader sequence)(SEQ ID NO:49) Amino acid sequence:

[0417] [ka] The amino acid sequence of the leader sequence is underlined. The amino acid sequence of the transmembrane domain is shown in bold.

[0418] >CoV_S_T3_3(T2_20v2)(leader sequence not included)(SEQ ID NO:50) Amino acid sequence:

[0419] [ka] The amino acid sequence of the transmembrane domain is shown in bold.

[0420] >CoV_S_T3_4 (T2_17_T2_20 dimer) (including leader sequence) (SEQ ID NO: 51) Amino acid sequence:

[0421] [ka] The amino acid sequence of the leader sequence is underlined. The amino acid sequence of the transmembrane domain is shown in bold.

[0422] >CoV_S_T3_4 (T2_17_T2_20 dimer) (without leader sequence) (SEQ ID NO: 52) Amino acid sequence:

[0423] [ka] The amino acid sequence of the transmembrane domain is shown in bold.

[0424] Example 5 CoV_S_T2_20 scaffold sequence (SEQ ID NO: 53) SEQ ID NO: 53 below shows the scaffold RBD sequences for the CoV_S_T2_20 (SEQ ID NO: 3), CoV_S_T3_3 (SEQ ID NO: 50), and CoV_S_T3_4 (SEQ ID NO: 52) optimized coronavirus RBD design structures (without leader sequences), where the amino acid sequences of the constant regions of the scaffolds are provided and each variable amino acid residue (i.e., an amino acid residue that can be altered to provide an antigen that induces a neutralizing immune response against new and / or future SARS-CoV-2 variants) is represented by an X (shown underlined in the sequence below).

[0425] [ka]

[0426] Examples of sequences provided herein that are covered by this scaffold sequence are SEQ ID NOs: 3 and 48 (CoV_T2_20 without and with leader sequence, respectively), SEQ ID NOs: 49 and 50 (CoV_S_T3_3 (T2_20v2) with and without leader sequence, respectively), and SEQ ID NOs: 51 and 52 (CoV_S_T3_4 (T2_17_T2_20 dimer) with and without leader sequence).

[0427] Figures 18 and 19 show the amino acid sequence alignment of CoV_T2_20 (SEQ ID NO: 48), CoV_S_T3_3 (SEQ ID NO: 49) and CoV_S_T3_4 (SEQ ID NO: 51) (including leader sequences). Differences between the sequences are shown as boxed residues.

[0428] The amino acid residues at variable positions in the designed sequences of CoV_S_T2_20, CoV_S_T3_3 and CoV_S_T3_4 are listed in the table below. The variable amino acid residue positions in SEQ ID NO: 53 correspond to the amino acid residue positions in SEQ ID NO: 53 without the leader sequence.

[0429] [Table 3]

[0430] Example 6 Neutralization of a panel of coronavirus pseudoviruses with sera from animals immunized with the T2_20 family of optimized coronavirus RBD constructs Figure 17 shows neutralization of SARS-CoV-1, SARS-CoV-2 Omicron VOC, and Wuhan spike-bearing lentiviral pseudotypes (PV) by antisera generated with the vaccine constructs and the control optimized coronavirus T2_20 family in guinea pigs (study COV038) using the mRNA platform. Figure 17b shows the immunization and bleeding schedule for guinea pigs in the study, where the guinea pigs were immunized twice at weeks 0 and 3 and bled four times at 3-week intervals. Data shown is for serum from SB2 (3 weeks after the booster immunization).

[0431] This figure shows neutralization of PV using antisera from animals immunized with the next-generation optimized coronavirus T2_20 antigen CoV_S_T3_3 (T2_20v2) (SEQ ID NO: 49), which retains neutralizing activity against SAR-CoV-1 while expanding the range to XBB.1.5, XBB.1.19.1, XBC.1, BQ.1.12, and XBB.1.9.1 at the expense of the ancestral (and extinct) Wuhan-Hu-1. Immunization with the dimeric CoV_S_T3_4 (T2_17_T2_20 dimer) (SEQ ID NO: 51) antigen is comparable to immunization with the monomeric T2_20 (CoV_S_T2_20) (SEQ ID NO: 48) antigen on the first tier panel of PV.

[0432] Figure 20a shows neutralization of SARS-CoV-1, SARS-CoV-2 omicron VOC, and Wuhan spike-harboring lentivirus PV by antisera generated with the optimized coronavirus CoV_S_T2_20 (SEQ ID NO: 48) using the mRNA platform (Study COV038). The immunization and blood collection schedule was the same as described above for Figure 17 and is illustrated in Figure 20b. Figure 21a shows additional neutralization data for guinea pigs immunized with the optimized coronavirus CoV_S_T2_20 (SEQ ID NO: 48) in Study COV038, where the guinea pigs were challenged with a more diverse panel of PVs bearing SARS-CoV-1 and SARS-CoV-2 S proteins. The immunization and blood collection schedule was the same as described above for Figure 17 and is also shown in Figure 21b. Figure 21a shows that immunization with CoV_S_T2_20 elicits broadly neutralizing immune responses against a broader panel of PVs containing SARS-CoV-1 and SARS-CoV-2 S proteins. In particular, broadly neutralizing immune responses are elicited against PVs of SARS-CoV-1, the related SARS1 virus WIV-16, and SARS-CoV-2 Wuhan, alpha, beta, gamma, delta, and several omicron subvariants, including BA.2 and BA.2.86.

Claims

1. An isolated messenger RNA (mRNA) encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 1 (T2_17), or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% amino acid identity to the amino acid sequence of SEQ ID NO: 1 over its entire length, and the amino acid sequence of a transmembrane domain.

2. 2. The mRNA of claim 1, wherein the encoded transmembrane domain is directly linked to the C-terminus of an amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% amino acid identity to the amino acid sequence of SEQ ID NO: 1 over its entire length.

3. 2. The mRNA of claim 1, wherein the encoded transmembrane domain comprises the amino acid sequence of SEQ ID NO:2 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% amino acid identity thereto over its entire length.

4. 10. An mRNA according to any preceding claim, encoding the amino acid sequence of SEQ ID NO:

1.

5. 5. The mRNA of claim 4, comprising an RNA sequence of SEQ ID NO:8, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29 or SEQ ID NO:30, or an RNA sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% ribonucleic acid identity over its entire length to the RNA sequence of SEQ ID NO:8, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29 or SEQ ID NO:30, and encoding the amino acid sequence of SEQ ID NO:

1.

6. The mRNA of claim 4, comprising the RNA sequence of SEQ ID NO: 8 or SEQ ID NO:

27.

7. 5. The mRNA of claim 4, comprising an RNA sequence of SEQ ID NO: 4 or an RNA sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% ribonucleic acid identity thereto over its entire length with the RNA sequence of SEQ ID NO: 4 and encoding the amino acid sequence of SEQ ID NO:

1.

8. The mRNA of claim 4, comprising the RNA sequence of SEQ ID NO:

4.

9. 10. An mRNA according to any preceding claim, encoding the amino acid sequence of SEQ ID NO:

2.

10. 10. The mRNA of claim 9, comprising an RNA sequence of SEQ ID NO: 5 or an RNA sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% ribonucleic acid identity thereto over its entire length with the RNA sequence of SEQ ID NO: 5 and encoding the amino acid sequence of SEQ ID NO:

2.

11. The mRNA of claim 9, comprising the RNA sequence of SEQ ID NO:

5.

12. 3. The mRNA of any preceding claim, encoding the amino acid sequence of SEQ ID NO: 3 (T2_20), or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% amino acid identity to the amino acid sequence of SEQ ID NO: 3 over its entire length.

13. 10. An mRNA according to any preceding claim, encoding the amino acid sequence of SEQ ID NO:

3.

14. 14. The mRNA of claim 13, comprising an RNA sequence of SEQ ID NO: 10, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33 or SEQ ID NO: 34, or an RNA sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% ribonucleic acid identity over its entire length to the RNA sequence of SEQ ID NO: 10, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33 or SEQ ID NO: 34, and encoding the amino acid sequence of SEQ ID NO:

3.

15. The mRNA of claim 13, comprising the RNA sequence of SEQ ID NO: 10 or SEQ ID NO:

31.

16. The mRNA of claim 13, comprising the mRNA sequence of SEQ ID NO: 9, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34 or SEQ ID NO:

46.

17. 14. The mRNA of claim 13, comprising an RNA sequence of SEQ ID NO: 6 or an RNA sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% ribonucleic acid identity thereto over its entire length with the RNA sequence of SEQ ID NO: 6 and encoding the amino acid sequence of SEQ ID NO:

3.

18. The mRNA of claim 13, comprising the RNA sequence of SEQ ID NO:

6.

19. An mRNA encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 1 (T2_17), or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% amino acid identity to the amino acid sequence of SEQ ID NO: 1 over its entire length.

20. An mRNA encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:

1.

21. 21. The mRNA of claim 20, comprising an RNA sequence of SEQ ID NO:8, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29 or SEQ ID NO:30, or an RNA sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% ribonucleic acid identity over its entire length to the RNA sequence of SEQ ID NO:8, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29 or SEQ ID NO:30, and encoding the amino acid sequence of SEQ ID NO:

1.

22. The mRNA of claim 20, comprising the RNA sequence of SEQ ID NO:

8.

23. 21. The mRNA of claim 20, comprising the mRNA sequence of SEQ ID NO: 7, SEQ ID NO: 27, SEQ ID NO: 28 or SEQ ID NO: 29 or SEQ ID NO:

30.

24. 10. The mRNA of any preceding claim, comprising an anti-reverse cap analog (ARCA) at the 5' end of the mRNA.

25. 10. The mRNA of any preceding claim, comprising a 5'-untranslated region (5'-UTR) upstream of the coding sequence encoding said polypeptide.

26. The mRNA of claim 25, wherein the 5'-UTR comprises an extended Kozak sequence: GCCACCAUG together with the start codon sequence of the mRNA.

27. The 5'-UTR contains the following sequence immediately upstream of the start codon sequence of the mRNA: a) GGAGACGCCACC (SEQ ID NO: 11); b) GGGAGACGCCACC (SEQ ID NO: 47); c) GAAGCGCCACC (SEQ ID NO: 12); d) GGGACGCCACC (SEQ ID NO: 13); e) GGGAGACTGCCACC (SEQ ID NO: 14); f) GAAGCTGCCACC (SEQ ID NO: 15), or g) GGGACTGCCACC (SEQ ID NO: 16) The mRNA of claim 25, comprising any one of:

28. 10. The mRNA of any preceding claim, comprising a 3'-untranslated region (3'-UTR) downstream of the coding sequence encoding said polypeptide.

29. the 3'-UTR a) GAAUU, or b) CCTCGCCCCGGACCTGCCCTCCCGCCAGGTGCACCCACCTGCAATAAATGCAGCGAAGCCGGGA (SEQ ID NO: 26) 29. The mRNA of claim 28, comprising a sequence selected from:

30. 10. The mRNA of any preceding claim, which is the product of in vitro transcription (IVT).

31. 10. The mRNA of any preceding claim, comprising a polyadenylation (poly(A)) tail downstream of the open reading frame (ORF) encoding said polypeptide.

32. 10. The mRNA of any preceding claim, comprising one or more modified nucleosides.

33. The or each modified nucleoside is selected from the group consisting of: Pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine The mRNA of claim 31, wherein the uridine is selected from the group consisting of lysine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-iodo-uridine, 5-methoxyuridine, 2'-O-methyluridine, 5-iodocytidine, 5-methylcytosine, 5-methylcytidine, N1-methyladenosine, and N6-methyladenosine.

34. 33. The mRNA of claim 32, wherein the one or more modified nucleosides comprise a 1-methylpseudouridine (m1ψ) modification.

35. An mRNA according to any one of claims 32 to 34, wherein at least 50% of the uridines in the ORF are modified.

36. 35. The mRNA of any one of claims 32 to 34, wherein at least 50% of the uridines in the mRNA are modified.

37. 35. The mRNA of claim 34, wherein at least 50% of the uridines in the ORF are modified to m1ψ.

38. The mRNA of claim 34, wherein at least 50% of the uridines in the mRNA are modified to m1ψ.

39. The mRNA of claim 32, wherein 5 to 50% of the uridine nucleotides are 5-iodouridine and 5 to 50% of the cytidine nucleotides are 5-iodocytidine.

40. The mRNA of claim 32, wherein 5 to 50% of the uridine nucleotides are 2-thiouridine and 5 to 50% of the cytidine nucleotides are 5-methylcytidine.

41. An mRNA vaccine vector comprising the mRNA of any preceding claim.

42. An mRNA vaccine comprising the mRNA of any one of claims 1 to 40 or the mRNA vaccine vector of claim 41 encapsulated in a lipid nanoparticle (LNP) or a lipidoid nanoparticle (LiNP).

43. A pharmaceutical composition comprising the mRNA described in any one of claims 1 to 40, the mRNA vaccine vector described in claim 41, or the mRNA vaccine described in claim 42, and a pharmaceutically acceptable carrier, excipient, or diluent.

44. 44. The pharmaceutical composition of claim 43, wherein the pharmaceutically acceptable vehicle solution, carrier, excipient, or diluent comprises a triblock copolymer containing one poly(propylene oxide) block and two poly(ethylene oxide) blocks.

45. The mRNA has the formula (b-1): 【Chemistry 81】 where the variables a, b, p, m, n and R 1A ~R 6A is defined as follows: a is 1 and b is an integer from 2 to 4, or a is an integer from 2 to 4 and b is 1; p is 1 or 2; m is 1 or 2, n is 0 or 1, and m+n is ≧2; and R 1A ~R 6A are, independently of one another, the following: hydrogen, —CH 2 —CH(OH)—R 7A , —CH(R 7A )-CH 2 —OH, —CH 2 -CH 2 -(C=O)-OR 7A , or -CH 2 -R 7A (R 7A is selected from C3 to C18 alkyl, or C3 to C18 alkenyl having one C-C double bond), a protecting group for an amino group, —C(NH)—NH 2 , a poly(ethylene glycol) chain, and a receptor ligand, 1A ~R 6A At least two residues of 2 —CH(OH)—R 7A , —CH(R 7A )-CH 2 OH, -CH 2 CH 2 (C═O)—O—R 7 , -CH 2 CH 2 (C=O)-NH-R 7A or -CH 2 R 7 wherein R 7 is selected from C3 to C18 alkyl or C3 to C18 alkenyl having one C-C double bond, and one or more of the nitrogen atoms contained in the compound of formula (b-1) are protonated to provide a compound having a positive charge.

45. The pharmaceutical composition of claim 43 or 44, or the mRNA vaccine of claim 42, wherein the composition is complexed in the form of LiNP nanoparticles comprising a cationic lipidoid of the formula:

46. The cationic lipidoid formula (b-1) is R 1A ~R 6A and optionally at least two residues of R 1A ~R 6A or R 1A ~R 6A At least four residues of 2 —CH(OH)—R 7A , —CH(R 7A )-CH 2 —OH, —CH 2 -CH 2 -(C=O)-OR 7A , -CH 2 -CH 2 -(C=O)-NH-R 7A and -CH 2 -R 7A and R 7A is selected from C3 to C18 alkyl or C3 to C18 alkenyl having one C-C double bond.

47. The LiNP nanoparticles have the formula (b-V) and / or the formula (b-VII): 【Chemistry 82】 45. The mRNA vaccine of claim 42, or the pharmaceutical composition of claim 43 or 44, comprising a cationic lipidoid of the formula:

48. The LiNP comprises: a) the mRNA according to any one of claims 1 to 40, or the mRNA vaccine vector according to claim 41; b) a cationic lipidoid of formula (b-V), c) one or more helper lipids, optionally i) DPPC, and / or ii) cholesterol, and / or iii) PEG-lipid DMG-PEG2000; and one or more helper lipids selected from Including, Optionally, components b) and c(i)-c(iii) are present, more preferably in a molar ratio of about 8.0: about 5.3: about 4.4: about 0.9, respectively; Optionally, the NLP comprises a triblock copolymer containing one poly(propylene oxide) block and two poly(ethylene oxide) blocks as component (p) defined above in a vehicle, the mRNA vaccine of claim 42, or the pharmaceutical composition of claim 43 or 44.

49. An mRNA according to any one of claims 1 to 40, an mRNA vaccine vector according to claim 41, an mRNA vaccine according to claim 42, or a pharmaceutical composition according to any one of claims 43 to 48, for use as a pharmaceutical.

50. An mRNA according to any one of claims 1 to 40, an mRNA vaccine vector according to claim 41, an mRNA vaccine according to claim 42, or a pharmaceutical composition according to any one of claims 43 to 48, for use in the prevention, treatment, or amelioration of coronavirus infection.

51. Use of the mRNA of any one of claims 1 to 40, the mRNA vaccine vector of claim 41, the mRNA vaccine of claim 42, or the pharmaceutical composition of any one of claims 43 to 48 in the manufacture of a medicament for the prevention, treatment, or amelioration of coronavirus infection.

52. A method for inducing an immune response against coronavirus in a subject, the method comprising administering to the subject an effective amount of the mRNA of any one of claims 1 to 40, the mRNA vaccine vector of claim 41, the mRNA vaccine of claim 42, or the pharmaceutical composition of any one of claims 43 to 48.

53. 49. A method of immunizing a subject against coronavirus, comprising administering to the subject an effective amount of the mRNA of any one of claims 1 to 40, the mRNA vaccine vector of claim 41, the mRNA vaccine of claim 42, or the pharmaceutical composition of any one of claims 43 to 48.

54. The method of claim 52 or 53, comprising administering the mRNA of any of claims 1 to 40, the mRNA vaccine vector of claim 41, the mRNA vaccine of claim 42, or the pharmaceutical composition of any of claims 43 to 48 as part of a prime-boost regimen.

55. 55. The mRNA, mRNA vaccine vector, mRNA vaccine, or pharmaceutical composition for use according to claim 50, the use according to claim 51, or the method according to any of claims 52 to 54, wherein the coronavirus is a beta-coronavirus.

56. 56. The mRNA, mRNA vaccine vector, mRNA vaccine or pharmaceutical composition, use, or method for use according to claim 55, wherein the beta-coronavirus is a lineage B or lineage C beta-coronavirus.

57. 56. The mRNA, mRNA vaccine vector, mRNA vaccine or pharmaceutical composition, use, or method for use according to claim 55, wherein the beta-coronavirus is a lineage B beta-coronavirus.

58. 58. The mRNA, mRNA vaccine vector, mRNA vaccine or pharmaceutical composition, use, or method for use according to claim 56 or claim 57, wherein the lineage B beta-coronavirus is SARS-CoV or SARS-CoV-2.

59. 57. The mRNA, mRNA vaccine vector, mRNA vaccine or pharmaceutical composition, use, or method for use according to claim 56, wherein the lineage C beta-coronavirus is MERS-CoV.

60. 56. The mRNA, mRNA vaccine vector, mRNA vaccine or pharmaceutical composition, use, or method for use according to claim 55, wherein the beta-coronavirus is a variant of concern (VOC).

61. 56. The mRNA, mRNA vaccine vector, mRNA vaccine or pharmaceutical composition, use or method for use according to claim 55, wherein the beta-coronavirus is SARS-CoV-2 VOC.

62. 56. The mRNA, mRNA vaccine vector, mRNA vaccine or pharmaceutical composition, use, or method for use according to claim 55, wherein said beta-coronavirus is SARS-CoV-2 beta, gamma, delta, or omicron VOC.

63. 56. The mRNA, mRNA vaccine vector, mRNA vaccine or pharmaceutical composition, use, or method for use according to claim 55, wherein said beta-coronavirus is SARS-CoV-2 Omicron XBB.1.5 virus.

64. 56. The mRNA, mRNA vaccine vector, mRNA vaccine or pharmaceutical composition, use, or method for use according to claim 55, wherein the beta-coronavirus is SARS-CoV-2 Omicron BA.2.12.

1.

65. 56. The mRNA, mRNA vaccine vector, mRNA vaccine or pharmaceutical composition, use, or method for use according to claim 55, wherein the beta-coronavirus is SARS-CoV-2 Omicron BA.2.

75.

66. 56. The mRNA, mRNA vaccine vector, mRNA vaccine or pharmaceutical composition, use or method for use according to claim 55, wherein said beta-coronavirus is SARS-CoV-2 Omicron BA.2.3.

20.

67. 56. The mRNA, mRNA vaccine vector, mRNA vaccine or pharmaceutical composition, use, or method for use according to claim 55, wherein the beta-coronavirus is SARS-CoV-2 Omicron BQ.1.

1.

68. 56. The mRNA, mRNA vaccine vector, mRNA vaccine or pharmaceutical composition, use, or method for use according to claim 55, wherein said beta-coronavirus is SARS-CoV-2 Omicron XBB.

69. 56. The mRNA, mRNA vaccine vector, mRNA vaccine or pharmaceutical composition, use, or method for use according to claim 55, wherein the beta-coronavirus is SARS-CoV-2 Omicron XBB.1.

5.

70. An isolated polynucleotide comprising a first nucleotide sequence encoding SEQ ID NO:53 (CoV_S_T2_20 scaffold sequence) or its complement, and a second nucleotide sequence encoding SEQ ID NO:53 (CoV_S_T2_20 scaffold sequence) or its complement.

71. An isolated polynucleotide comprising a first nucleotide sequence encoding SEQ ID NO:1 (T2_17) or its complement, and a second nucleotide sequence encoding SEQ ID NO:1 (T2_17) or its complement.

72. 72. The isolated polynucleotide of claim 70 or 71, further comprising a nucleotide sequence encoding SEQ ID NO:2 (transmembrane domain amino acid sequence).

73. An isolated polynucleotide comprising a nucleotide sequence encoding SEQ ID NO: 50 (CoV_S_T3_3) or its complement.

74. An isolated polynucleotide comprising a nucleotide sequence encoding SEQ ID NO: 52 (CoV_S_T3_4) or its complement.

75. 75. The isolated polynucleotide of any of claims 70 to 74, further comprising a nucleotide sequence encoding a leader amino acid sequence, preferably SEQ ID NO: 54 (leader amino acid sequence), or a complement thereof.

76. An isolated polynucleotide comprising a nucleotide sequence encoding SEQ ID NO: 48 (T2_20) or its complement.

77. An isolated polynucleotide comprising a nucleotide sequence encoding SEQ ID NO: 49 (CoV_S_T3_3) or its complement.

78. An isolated polynucleotide comprising a nucleotide sequence encoding SEQ ID NO: 51 (CoV_S_T3_4) or its complement.

79. An isolated polypeptide comprising a first amino acid sequence of SEQ ID NO: 53 (CoV_S_T2_20 scaffold sequence) and a second amino acid sequence of SEQ ID NO: 53 (CoV_S_T2_20 scaffold sequence).

80. An isolated polypeptide comprising a first amino acid sequence of SEQ ID NO:1 (T2_17) and a second amino acid sequence of SEQ ID NO:1 (T2_17).

81. 81. The isolated polypeptide of claim 79 or 80, further comprising the amino acid sequence of SEQ ID NO: 2 (transmembrane domain amino acid sequence).

82. An isolated polypeptide comprising the amino acid sequence of SEQ ID NO: 50 (CoV_S_T3_3).

83. An isolated polypeptide comprising the amino acid sequence of SEQ ID NO: 52 (CoV_S_T3_4).

84. 84. The isolated polypeptide of any one of claims 79 to 83, further comprising a leader amino acid sequence, preferably SEQ ID NO: 54 (leader amino acid sequence).

85. An isolated polypeptide comprising the amino acid sequence of SEQ ID NO: 48 (T2_20).

86. An isolated polypeptide comprising the amino acid sequence of SEQ ID NO: 49 (CoV_S_T3_3).

87. An isolated polypeptide comprising the amino acid sequence of SEQ ID NO: 51 (CoV_S_T3_4).

88. A pharmaceutical composition comprising an isolated polynucleotide according to any one of claims 70 to 78 or an isolated polypeptide according to any one of claims 79 to 87, and a pharmaceutically acceptable carrier, excipient or diluent.

89. 79. A vector comprising the isolated polynucleotide of any one of claims 70 to 78 and separate promoters operably linked to each different nucleotide sequence of said polynucleotide.

90. A fusion protein comprising the polypeptide of any one of claims 79 to 87.

91. A pseudotyped virus particle comprising a polypeptide according to any one of claims 79 to 87.

92. 90. An isolated polynucleotide according to any one of claims 70 to 78, an isolated polypeptide according to any one of claims 79 to 87, a pharmaceutical composition according to claim 88, or a vector according to claim 89 for use as a medicament.

93. 90. The isolated polynucleotide of any of claims 70 to 78, the isolated polypeptide of any of claims 79 to 87, the pharmaceutical composition of claim 88, or the vector of claim 89 for use in the prevention, treatment, or amelioration of coronavirus infection.

94. 90. The isolated polynucleotide of any one of claims 70 to 78, the isolated polypeptide of any one of claims 79 to 87, the pharmaceutical composition of claim 88, or the vector of claim 89 for use in inducing an immune response against coronavirus infection.

95. 90. The isolated polynucleotide of any of claims 70 to 78, the isolated polypeptide of any of claims 79 to 87, the pharmaceutical composition of claim 88, or the vector of claim 89 for use in immunizing a subject against coronavirus infection.

96. 1. A method of inducing an immune response to influenza virus in a subject, comprising administering to said subject an effective amount of: An isolated polynucleotide according to any one of claims 70 to 78. An isolated polypeptide according to any one of claims 79 to 87.

89. A pharmaceutical composition according to claim 88, or The vector of claim 89 Administering

97. 1. A method of immunizing a subject against influenza virus, comprising administering to said subject an effective amount of: An isolated polynucleotide according to any one of claims 70 to 78. An isolated polypeptide according to any one of claims 79 to 87.

89. A pharmaceutical composition according to claim 88, or The vector of claim 89 Administering

Citation Information

Patent Citations

  • Coronavirus vaccines

    WO2021198706A2