Codon optimization and its uses

Abstract

This disclosure addresses methods and applications of codon optimization of gene products. In particular, this disclosure features codon optimization methods by reducing the frequency of m6A modifications to promote increased half-life and stability of mRNA for the purpose of enhancing protein production. Additional methods for delivering codon-optimized gene products are disclosed. The methods disclosed are clinically relevant for gene therapy, cell therapy, and vaccine development.

Description

[Technical Field]

[0001] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in XML format and is incorporated herein by reference in its entirety. The XML copy, created on March 1, 2024, is titled "51772-004WO4_Sequence_Listing_3_1_24" and is 18,345 bytes in size.

[0002] The present disclosure relates to the field of nucleic acid engineering. Specifically, the present disclosure provides compositions and methods for modifying the codon sequence of a nucleic acid encoding a polypeptide to improve expression of the desired polypeptide in an organism of interest, such as a human. [Background technology]

[0003] N(6)-methyladenosine (m6A), the most common mRNA modification in mammals, influences broad aspects of gene expression in diverse physiological and pathophysiological processes. The METTL3-METTL14 methyltransferase complex introduces m6A methylation onto mRNAs within the common DRACH sequence motif (D = A, G, or U; R = A or G; H = A, C, or U). However, only a fraction (approximately 5%) of DRACH sequences in a subset of cellular transcripts is selected for methylation. Furthermore, m6A exhibits a significant regional bias in its transcriptome distribution, being highly enriched near unusually long internal exons and stop codons. Despite the central importance of specific m6A deposition in m6A-mediated gene regulation, the mechanistic basis of m6A specificity remains poorly understood. There remains a need for compositions and methods that exploit this mechanistic basis to improve transgene expression in organisms of interest. Summary of the Invention

[0004] In a first aspect, the disclosure features a method for codon optimization of a polynucleotide sequence encoding a polypeptide of interest, the method comprising substituting one or more nucleotides within a DRACH motif in the polynucleotide sequence with an equivalent amount of alternative nucleotides to eliminate the DRACH motif, where the substitution does not alter the amino acid sequence of the encoded polypeptide.

[0005] In some embodiments, the polynucleotide sequence contains multiple DRACH motifs, and substitutions are made only within a subset of the DRACH motifs. In some embodiments, substitutions are made only within DRACH motifs that are at least 10 nucleotides away from a splice junction site within the polynucleotide sequence. In some embodiments, substitutions are made only within DRACH motifs that are at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, or more nucleotides away from a splice junction site within the polynucleotide sequence.

[0006] In some embodiments, substitutions are made only within the DRACH motif that is about 10 to about 200 nucleotides, about 20 to about 190 nucleotides, about 30 to about 180 nucleotides, about 40 to about 170 nucleotides, about 50 to about 160 nucleotides, about 60 to about 150 nucleotides, about 70 to about 140 nucleotides, about 80 to about 130 nucleotides, about 90 to about 120 nucleotides, or about 100 nucleotides away from a splice junction site within the polynucleotide sequence.

[0007] In some embodiments, substitutions are made within a DRACH motif selected from the group consisting of AGACA, AGACT, GAACC, GAACT, GGACA, GGACT, TGACT, AAACA, AAACC, AAACT, AGACC, GAACA, GGACC, TAACA, TAACC, TAACT, TGACA, and TGACC. In some embodiments, substitutions are made within a DRACH motif selected from the group consisting of AGACA, AGACT, GAACC, GAACT, GGACA, GGACT, and TGACT.

[0008] In some embodiments, substitution of one or more nucleotides within the DRACH motif is made using one or more codon usage guidelines selected from the group consisting of: (a) never use the codon GAC to code for aspartic acid when eliminating the DRACH motif; (b) never using the codon GAA to code for glutamic acid when eliminating the DRACH motif; (c) never use the codon GGA to code for glycine when eliminating the DRACH motif; (d) never use the codon AAA to code for lysine when eliminating the DRACH motif; (e) never using the codon AAC to code for asparagine when eliminating the DRACH motif, and / or (f) When eliminating the DRACH motif, the codon ACG is always used to code for threonine.

[0009] In some embodiments, codon optimization further comprises implementing one or more codon usage guidelines across the entire polynucleotide sequence selected from the group consisting of: (a) never use the codon GAC to code for aspartic acid throughout the polynucleotide sequence; (b) never use the codon GAA to code for glutamic acid throughout the polynucleotide sequence; (c) never use the codon GGA to code for glycine throughout the polynucleotide sequence; (d) never use the codon AAA to code for lysine throughout the polynucleotide sequence; (e) never using the codon AAC to code for asparagine throughout the entire polynucleotide sequence; and / or (f) The codon ACG is consistently used throughout the polynucleotide sequence to code for threonine.

[0010] In some embodiments, prior to substitution of one or more nucleotides within the DRACH motif, the polynucleotide sequence is codon-optimized by replacing one or more nucleotides within the codon with an equivalent alternative nucleotide that constitutes a synonymous codon that naturally occurs more frequently in the target organism compared to the frequency of the unmodified codon in the target organism.

[0011] In some embodiments, prior to substitution of one or more nucleotides within the DRACH motif, the polynucleotide sequence is codon-optimized by replacing one or more codons within the polynucleotide sequence with equivalent synonymous codons that naturally occur at a higher frequency in the target organism compared to the frequency of occurrence of one or more unmodified codons in the target organism. In some embodiments, the target organism is a mammal, and optionally the mammal is a human.

[0012] In some embodiments, prior to substitution of one or more nucleotides within the DRACH motif, the polynucleotide sequence is codon optimized by a codon optimization web tool, codon optimization software, quantum computing, heuristic scoring methods, neural networks, or a combination thereof.

[0013] In some embodiments, prior to substitution of one or more nucleotides within the DRACH motif, the polynucleotide sequence is codon-optimized by adjusting the polynucleotide guanine-cytosine (GC) content, polynucleotide secondary structure, mRNA motif, ribosome binding site, and / or translation rate.

[0014] In some embodiments, the polynucleotide GC content is adjusted to between 50% and 80%. In some embodiments, the polynucleotide GC content is adjusted to between 65% and 75%.

[0015] In some embodiments, after replacing one or more nucleotides within the DRACH motif, the codon optimization method further comprises replacing one or more nucleotides within the codon with an equivalent amount of alternative nucleotides that constitute a synonymous codon that naturally occurs more frequently in the target organism compared to the frequency of the unmodified codon in the target organism.

[0016] In some embodiments, after replacing one or more nucleotides within the DRACH motif, the codon optimization method further comprises replacing one or more codons within the polynucleotide sequence with equivalent synonymous codons that naturally occur at a higher frequency in the target organism compared to the frequency of occurrence of the one or more unmodified codons in the target organism. In some embodiments, the target organism is a mammal, and optionally the mammal is a human.

[0017] In some embodiments, after substitution of one or more nucleotides within the DRACH motif, the codon optimization method further comprises codon optimization by a codon optimization web tool, codon optimization software, quantum computing, heuristic scoring methods, neural networks, or a combination thereof.

[0018] In some embodiments, after substituting one or more nucleotides within the DRACH motif, the codon optimization method further includes adjusting the polynucleotide GC content, polynucleotide secondary structure, mRNA motif, ribosome binding site, and / or translation rate.

[0019] In some embodiments, the polynucleotide GC content is adjusted to between 50% and 80%. In some embodiments, the polynucleotide GC content is adjusted to between 65% and 75%.

[0020] In some embodiments, the amino acid sequence of the protein or polypeptide shares at least 85% sequence identity with the wild-type amino acid sequence of the protein or polypeptide after codon optimization, hi some embodiments, the amino acid sequence of the protein or polypeptide shares 100% sequence identity with the wild-type amino acid sequence of the protein or polypeptide after codon optimization.

[0021] In some embodiments, the number of DRACH motifs in the polynucleotide sequence is reduced by at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, or at least 10% compared to a corresponding polynucleotide sequence that has not been subjected to the method, hi some embodiments, the number of DRACH motifs in the polynucleotide sequence is reduced by 100% compared to a corresponding polynucleotide sequence that has not been subjected to the method.

[0022] In some embodiments, the codon optimization method increases the stability or half-life of the mRNA transcript.

[0023] In some embodiments, increased stability or half-life of an mRNA transcript is assessed by an increase in concentration or relative abundance compared to a corresponding polynucleotide sequence that has not been subjected to the method.

[0024] In some embodiments, the increase in concentration or relative abundance of an mRNA transcript compared to an mRNA transcript of a native polynucleotide sequence is measured by RT-PCR, fluorimetry, colorimetry, spectrophotometry, flow cytometry, in situ hybridization, Northern blot analysis, or an array using one or more hybridizing oligonucleotides or antibodies to the mRNA transcript of interest.

[0025] In some embodiments, increased stability or half-life of an mRNA transcript is assessed by a decreased decay rate as detected by one or more pulse-chase techniques.

[0026] In some embodiments, reducing the number of DRACH motifs in a polynucleotide sequence reduces the number of N(6)-methyladenosine (m6A) modifications in mRNA transcripts compared to a corresponding polynucleotide sequence that has not been subjected to the method.

[0027] In some embodiments, the codon optimization method increases the expression or stability of the protein compared to a protein encoded by a corresponding polynucleotide sequence that has not been subjected to the method, hi some embodiments, the corresponding polynucleotide sequence is a wild-type polynucleotide sequence.

[0028] In some embodiments, protein expression or stability is increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, or more than 100% compared to a corresponding polynucleotide sequence that has not been subjected to the method.

[0029] In some embodiments, protein expression or stability is increased by about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold, about 15-fold, about 20-fold, about 25-fold, about 30-fold, about 35-fold, about 40-fold, about 45-fold, about 50-fold, or more than 50-fold, compared to a corresponding polynucleotide sequence that has not been subjected to the method.

[0030] In some embodiments, increased protein expression is measured by mass spectrometry, Western blot analysis, enzyme-linked immunosorbent assay (ELISA), immunoprecipitation, flow cytometry, fluorimetry, colorimetry, spectrophotometry, or arrays using aptamers or antibodies to the protein of interest.

[0031] In another aspect, the disclosure features a polynucleotide produced by the method of any one of the aforementioned aspects or embodiments of the disclosure.

[0032] In another aspect, the disclosure features a method for delivering a polynucleotide sequence encoding a polypeptide to a host cell, the method including (i) substituting one or more nucleotides of a DRACH motif in the polynucleotide sequence with an equivalent amount of alternative nucleotides to eliminate the DRACH motif (this substitution does not alter the amino acid sequence of the encoded polypeptide), and (ii) providing the resulting polynucleotide sequence to a host cell.

[0033] In a further aspect, the disclosure features a method for expressing an mRNA transcript from a polynucleotide sequence encoding a polypeptide in a host cell, the method including: (i) substituting one or more nucleotides of a DRACH motif in the polynucleotide sequence with an equivalent amount of alternative nucleotides to eliminate the DRACH motif (this substitution does not alter the amino acid sequence of the encoded polypeptide); and (ii) providing the polynucleotide sequence to a host cell.

[0034] In yet another aspect, the disclosure features a method for expressing a protein from a polynucleotide sequence encoding the protein in a host cell, the method including: (i) substituting one or more nucleotides of a DRACH motif in the polynucleotide sequence with an equivalent amount of alternative nucleotides to eliminate the DRACH motif (wherein the substitution does not alter the amino acid sequence of the encoded protein); and (ii) providing the polynucleotide sequence to a host cell.

[0035] In a further aspect, the disclosure features a method for delivering a polynucleotide sequence encoding a polypeptide to a subject, the method including (i) replacing one or more nucleotides of a DRACH motif in the polynucleotide sequence with an equivalent amount of alternative nucleotides to eliminate the DRACH motif (wherein the substitution does not alter the amino acid sequence of the encoded polypeptide), and (ii) providing the resulting polynucleotide sequence to a subject.

[0036] In a further aspect, the disclosure features a method for expressing an mRNA transcript from a polynucleotide sequence encoding a polypeptide in a subject, the method including: (i) replacing one or more nucleotides of a DRACH motif in the polynucleotide sequence with an equivalent amount of alternative nucleotides to eliminate the DRACH motif (the substitution does not alter the amino acid sequence of the encoded polypeptide); and (ii) providing the polynucleotide sequence to the subject.

[0037] In another aspect, the disclosure features a method for expressing a protein in a subject from a polynucleotide sequence encoding the protein, the method including: (i) replacing one or more nucleotides of a DRACH motif in the polynucleotide sequence with an equivalent amount of alternative nucleotides to eliminate the DRACH motif (the substitution does not change the amino acid sequence of the encoded protein); and (ii) providing the polynucleotide sequence to the subject.

[0038] In some embodiments of any of the preceding aspects of the disclosure, the substitution is made within a DRACH motif selected from the group consisting of AGACA, AGACT, GAACC, GAACT, GGACA, GGACT, TGACT, AAACA, AAACC, AAACT, AGACC, GAACA, GGACC, TAACA, TAACC, TAACT, TGACA, and TGACC. In some embodiments, the substitution is made within a DRACH motif selected from the group consisting of AGACA, AGACT, GAACC, GAACT, GGACA, GGACT, and TGACT.

[0039] In some embodiments, substitution of one or more nucleotides within the DRACH motif is made using one or more codon usage guidelines selected from the group consisting of: (a) never use the codon GAC to code for aspartic acid when eliminating the DRACH motif; (b) never using the codon GAA to code for glutamic acid when eliminating the DRACH motif; (c) never use the codon GGA to code for glycine when eliminating the DRACH motif; (d) never use the codon AAA to code for lysine when eliminating the DRACH motif; (e) never using the codon AAC to code for asparagine when eliminating the DRACH motif, and / or (f) When eliminating the DRACH motif, the codon ACG is always used to code for threonine.

[0040] In some embodiments, codon optimization further comprises implementing one or more codon usage guidelines across the entire polynucleotide sequence selected from the group consisting of: (a) never use the codon GAC for aspartic acid throughout the entire polynucleotide sequence; (b) never use the codon GAA for glutamic acid throughout the polynucleotide sequence; (c) never using the codon GGA for glycine throughout the polynucleotide sequence; (d) never using the codon AAA for lysine throughout the polynucleotide sequence; (e) never using the codon AAC for asparagine throughout the entire polynucleotide sequence; and / or (f) Consistently use the codon ACG for threonine throughout the polynucleotide sequence.

[0041] In some embodiments, prior to substitution of one or more nucleotides within the DRACH motif, the polynucleotide sequence is codon-optimized by replacing one or more nucleotides within the codon with an equivalent alternative nucleotide that constitutes a synonymous codon that naturally occurs more frequently in the target organism compared to the frequency of the unmodified codon in the target organism.

[0042] In some embodiments, prior to substitution of one or more nucleotides within the DRACH motif, the polynucleotide sequence is codon-optimized by replacing one or more codons within the polynucleotide sequence with equivalent synonymous codons that naturally occur at a higher frequency in the target organism compared to the frequency of occurrence of one or more unmodified codons in the target organism. In some embodiments, the target organism is a mammal, and optionally the mammal is a human.

[0043] In some embodiments, prior to substitution of one or more nucleotides within the DRACH motif, the polynucleotide sequence is codon optimized by a codon optimization web tool, codon optimization software, quantum computing, heuristic scoring methods, neural networks, or a combination thereof.

[0044] In some embodiments, prior to substitution of one or more nucleotides within the DRACH motif, the polynucleotide sequence is codon-optimized by adjusting the polynucleotide GC content, polynucleotide secondary structure, mRNA motif, ribosome binding site, and / or translation rate.

[0045] In some embodiments, the polynucleotide GC content is adjusted to between 50% and 80%. In some embodiments, the polynucleotide GC content is adjusted to between 65% and 75%.

[0046] In some embodiments, after substituting one or more nucleotides within the DRACH motif, the method further comprises substituting one or more nucleotides within the codon with an equivalent amount of alternative nucleotides that constitute a synonymous codon that naturally occurs more frequently in the target organism compared to the frequency of the unmodified codon in the target organism.

[0047] In some embodiments, after substituting one or more nucleotides within the DRACH motif, the method further comprises substituting one or more codons within the polynucleotide sequence with equivalent synonymous codons that naturally occur at a higher frequency in the target organism compared to the frequency of occurrence of the one or more unmodified codons in the target organism. In some embodiments, the target organism is a mammal, and optionally the mammal is a human.

[0048] In some embodiments, after substituting one or more nucleotides within the DRACH motif, the method further comprises codon optimization by a codon optimization web tool, codon optimization software, quantum computing, heuristic scoring methods, neural networks, or a combination thereof.

[0049] In some embodiments, after substituting one or more nucleotides within the DRACH motif, the codon optimization method further includes adjusting the polynucleotide GC content, polynucleotide secondary structure, mRNA motif, ribosome binding site, and / or translation rate.

[0050] In some embodiments, the polynucleotide GC content is adjusted to between 50% and 80%. In some embodiments, the polynucleotide GC content is adjusted to between 65% and 75%.

[0051] In some embodiments, the amino acid sequence of the protein or polypeptide shares at least 85% sequence identity with the wild-type amino acid sequence of the protein or polypeptide after codon optimization.

[0052] In some embodiments, the amino acid sequence of the protein or polypeptide shares 100% sequence identity with the wild-type amino acid sequence of the protein or polypeptide after codon optimization.

[0053] In some embodiments, the number of DRACH motifs in a polynucleotide sequence is reduced by at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, or at least 10% compared to a corresponding polynucleotide sequence not subjected to the method.

[0054] In some embodiments, the number of DRACH motifs in a polynucleotide sequence is reduced by 100% compared to a corresponding polynucleotide sequence that has not been subjected to the method.

[0055] In some embodiments, the method increases the stability or half-life of the mRNA transcript.

[0056] In some embodiments, increased stability or half-life of an mRNA transcript is assessed by an increase in concentration or relative abundance compared to a corresponding polynucleotide sequence that has not been subjected to the method.

[0057] In some embodiments, the increase in concentration or relative abundance of an mRNA transcript compared to an mRNA transcript of a native polynucleotide sequence is measured by RT-PCR, fluorimetry, colorimetry, spectrophotometry, flow cytometry, in situ hybridization, Northern blot analysis, or an array using one or more hybridizing oligonucleotides or antibodies to the mRNA transcript of interest.

[0058] In some embodiments, increased stability or half-life of an mRNA transcript is assessed by a decreased decay rate as detected by one or more pulse-chase techniques.

[0059] In some embodiments, reducing the number of DRACH motifs in a polynucleotide sequence reduces the number of N(6)-methyladenosine (m6A) modifications in mRNA transcripts compared to a corresponding polynucleotide sequence that has not been subjected to the method.

[0060] In some embodiments, the method increases the expression or stability of the protein compared to a protein encoded by a corresponding polynucleotide sequence that has not been subjected to the method.

[0061] In some embodiments, the corresponding polynucleotide sequence is a wild-type polynucleotide sequence.

[0062] In some embodiments, protein expression or stability is increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, or more than 100% compared to a corresponding polynucleotide sequence that has not been subjected to the method.

[0063] In some embodiments, protein expression or stability is increased by about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold, about 15-fold, about 20-fold, about 25-fold, about 30-fold, about 35-fold, about 40-fold, about 45-fold, about 50-fold, or more than 50-fold, compared to a corresponding polynucleotide sequence that has not been subjected to the method.

[0064] In some embodiments, increased protein expression is measured by mass spectrometry, Western blot analysis, enzyme-linked immunosorbent assay (ELISA), immunoprecipitation, flow cytometry, fluorimetry, colorimetry, spectrophotometry, or arrays using aptamers or antibodies to the protein of interest.

[0065] In some embodiments, the polynucleotide is delivered to a host cell by contacting the host cell with a vehicle containing the polynucleotide.

[0066] In some embodiments, the polynucleotide is delivered to the subject by administering to the subject a vehicle containing the polynucleotide.

[0067] In some embodiments, the vehicle is selected from the group consisting of a lipid nanoparticle, a liposome, a viral genome, and a viral vector.

[0068] In some embodiments, the viral vector is an adeno-associated virus (AAV), adenovirus, retrovirus, or lentivirus.

[0069] In some embodiments, the viral vector is AAV. In some embodiments, the AAV is pseudotyped. In some embodiments, the AAV comprises inverted terminal repeat (ITR) sequences and capsid proteins from different serotypes.

[0070] In some embodiments, delivery to a host cell occurs in vivo, in vitro, or ex vivo.

[0071] In some embodiments, delivery to a subject is achieved by (i) administering the polynucleotide to the subject in vivo, or (ii) expressing the polynucleotide ex vivo in a host cell followed by administering the host cell to the subject.

[0072] In some embodiments, the methods are used to treat a subject suffering from or at risk of suffering from a disease characterized by underexpression or activity of a protein.

[0073] In another aspect, the disclosure features a method of treating a subject suffering from or at risk of developing a disease, the method including: (i) substituting one or more nucleotides of a DRACH motif in a polynucleotide sequence encoding a polypeptide associated with the disease with an equivalent amount of alternative nucleotides to eliminate the DRACH motif (wherein the substitution does not alter the amino acid sequence of the encoded polypeptide); and (ii) administering the polynucleotide sequence to the subject.

[0074] In a further aspect, the disclosure features a method of treating a subject suffering from or at risk of developing a disease, the method comprising administering to the subject a polynucleotide sequence encoding a polypeptide associated with the disease, wherein prior to administration, one or more nucleotides of a DRACH motif in the polynucleotide sequence have been replaced with an equivalent amount of alternative nucleotides to eliminate the DRACH motif (the substitution does not alter the amino acid sequence of the encoded polypeptide).

[0075] In some embodiments, substitutions are made within a DRACH motif selected from the group consisting of AGACA, AGACT, GAACC, GAACT, GGACA, GGACT, TGACT, AAACA, AAACC, AAACT, AGACC, GAACA, GGACC, TAACA, TAACC, TAACT, TGACA, and TGACC. In some embodiments, substitutions are made within a DRACH motif selected from the group consisting of AGACA, AGACT, GAACC, GAACT, GGACA, GGACT, and TGACT.

[0076] In some embodiments, substitution of one or more nucleotides within the DRACH motif is made using one or more codon usage guidelines selected from the group consisting of: (a) never use the codon GAC to code for aspartic acid when eliminating the DRACH motif; (b) never using the codon GAA to code for glutamic acid when eliminating the DRACH motif; (c) never use the codon GGA to code for glycine when eliminating the DRACH motif; (d) never use the codon AAA to code for lysine when eliminating the DRACH motif; (e) never using the codon AAC to code for asparagine when eliminating the DRACH motif, and / or (f) When eliminating the DRACH motif, the codon ACG is always used to code for threonine.

[0077] In some embodiments, prior to administration, the polynucleotide sequence is codon-optimized by a method comprising implementing, throughout the polynucleotide sequence, one or more codon usage guidelines selected from the group consisting of: (a) never use the codon GAC to code for aspartic acid throughout the polynucleotide sequence; (b) never use the codon GAA to code for glutamic acid throughout the polynucleotide sequence; (c) never use the codon GGA to code for glycine throughout the polynucleotide sequence; (d) never use the codon AAA to code for lysine throughout the polynucleotide sequence; (e) never using the codon AAC to code for asparagine throughout the entire polynucleotide sequence; and / or (f) The codon ACG is consistently used throughout the polynucleotide sequence to code for threonine.

[0078] In some embodiments, prior to substitution of one or more nucleotides within the DRACH motif, the polynucleotide sequence is codon-optimized by replacing one or more nucleotides within the codon with an equivalent alternative nucleotide that constitutes a synonymous codon that naturally occurs more frequently in the target organism compared to the frequency of the unmodified codon in the target organism.

[0079] In some embodiments, prior to substitution of one or more nucleotides within the DRACH motif, the polynucleotide sequence is codon-optimized by replacing one or more codons within the polynucleotide sequence with equivalent synonymous codons that naturally occur at a higher frequency in the target organism compared to the frequency of occurrence of one or more unmodified codons in the target organism. In some embodiments, the target organism is a mammal, and optionally the mammal is a human.

[0080] In some embodiments, prior to substitution of one or more nucleotides within the DRACH motif, the polynucleotide sequence is codon optimized by a codon optimization web tool, codon optimization software, quantum computing, heuristic scoring methods, neural networks, or a combination thereof.

[0081] In some embodiments, prior to substitution of one or more nucleotides within the DRACH motif, the polynucleotide sequence is codon-optimized by adjusting the polynucleotide guanine-cytosine (GC) content, polynucleotide secondary structure, mRNA motif, ribosome binding site, and / or translation rate.

[0082] In some embodiments, the polynucleotide GC content is adjusted to between 50% and 80%. In some embodiments, the polynucleotide GC content is adjusted to between 65% and 75%.

[0083] In some embodiments, after substituting one or more nucleotides within the DRACH motif, the method further comprises substituting one or more nucleotides within the codon with an equivalent amount of alternative nucleotides that constitute a synonymous codon that naturally occurs more frequently in the target organism compared to the frequency of the unmodified codon in the target organism.

[0084] In some embodiments, after substituting one or more nucleotides within the DRACH motif, the method further comprises substituting one or more codons within the polynucleotide sequence with equivalent synonymous codons that naturally occur at a higher frequency in the target organism compared to the frequency of occurrence of the one or more unmodified codons in the target organism. In some embodiments, the target organism is a mammal, and optionally the mammal is a human.

[0085] In some embodiments, after substitution of one or more nucleotides within the DRACH motif, the method further comprises codon optimization using a codon optimization web tool, codon optimization software, quantum computing, heuristic scoring methods, neural networks, or combinations thereof.

[0086] In some embodiments, after substituting one or more nucleotides within the DRACH motif, the method further comprises adjusting the polynucleotide GC content, polynucleotide secondary structure, mRNA motif, ribosome binding site, and / or translation rate.

[0087] In some embodiments, the polynucleotide GC content is adjusted to between 50% and 80%. In some embodiments, the polynucleotide GC content is adjusted to between 65% and 75%.

[0088] In some embodiments, the amino acid sequence of the protein or polypeptide shares at least 85% sequence identity with the wild-type amino acid sequence of the protein or polypeptide after codon optimization.

[0089] In some embodiments, the amino acid sequence of the protein or polypeptide shares 100% sequence identity with the wild-type amino acid sequence of the protein or polypeptide after codon optimization.

[0090] In some embodiments, the number of DRACH motifs in a polynucleotide sequence is reduced by at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, or at least 10% compared to a corresponding polynucleotide sequence not subjected to the method.

[0091] In some embodiments, the number of DRACH motifs in a polynucleotide sequence is reduced by 100% compared to a corresponding polynucleotide sequence that has not been subjected to the method.

[0092] In some embodiments, the method increases the stability or half-life of the mRNA transcript.

[0093] In some embodiments, increased stability or half-life of an mRNA transcript is assessed by an increase in concentration or relative abundance compared to a reference.

[0094] In some embodiments, the increase in concentration or relative abundance of an mRNA transcript compared to an mRNA transcript of a native polynucleotide sequence is measured by RT-PCR, fluorimetry, colorimetry, spectrophotometry, flow cytometry, in situ hybridization, Northern blot analysis, or an array using one or more hybridizing oligonucleotides or antibodies to the mRNA transcript of interest.

[0095] In some embodiments, reducing the number of DRACH motifs in a polynucleotide sequence reduces the number of N(6)-methyladenosine (m6A) modifications in mRNA transcripts compared to a corresponding polynucleotide sequence that has not been subjected to the method.

[0096] In some embodiments, the method increases the expression or stability of the protein as compared to a reference.

[0097] In some embodiments, the corresponding polynucleotide sequence is a wild-type polynucleotide sequence.

[0098] In some embodiments, the reference is a sample taken from a subject not receiving treatment, or a sample taken from the subject prior to treatment.

[0099] In some embodiments, protein expression or stability is increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, or more than 100% compared to a reference.

[0100] In some embodiments, protein expression or stability is increased by about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold, about 15-fold, about 20-fold, about 25-fold, about 30-fold, about 35-fold, about 40-fold, about 45-fold, about 50-fold, or more than 50-fold compared to a reference.

[0101] In some embodiments, increased protein expression is measured by mass spectrometry, Western blot analysis, enzyme-linked immunosorbent assay (ELISA), immunoprecipitation, flow cytometry, fluorimetry, colorimetry, spectrophotometry, or arrays using aptamers or antibodies to the protein of interest.

[0102] In some embodiments, the polynucleotide is administered to the subject by contacting the subject with a vehicle comprising the polynucleotide.

[0103] In some embodiments, the vehicle is selected from a lipid nanoparticle, a liposome, a viral genome, and a viral vector. In some embodiments, the viral vector is an adeno-associated virus (AAV), an adenovirus, a retrovirus, a lentivirus, or a double-stranded DNA virus. In some embodiments, the viral vector is an AAV. In some embodiments, the AAV is pseudotyped. In some embodiments, the AAV comprises an inverted terminal repeat (ITR) sequence and capsid proteins from different serotypes.

[0104] In some embodiments, administration is carried out in vivo by providing the polynucleotide directly to a subject, or ex vivo by expressing the polynucleotide in a host cell and then administering the host cell to a subject.

[0105] In some embodiments, delivery is performed by intramuscular, subcutaneous, intradermal, intravenous, intraperitoneal, intraarterial, intraventricular, intranasal, intraorbital, intracranial, or intraosseous administration.

[0106] In some embodiments, the treatment is a monotherapy. In some embodiments, the method is combined with the administration of one or more additional therapeutic agents.

[0107] In a further aspect, the disclosure features a kit including an insert that instructs a user to perform a codon optimization method that includes modifying a polynucleotide sequence encoding a polypeptide by substituting one or more nucleotides within a DRACH motif in the polynucleotide sequence without changing the amino acid sequence of the encoded polypeptide, thereby eliminating one or more DRACH motifs.

[0108] In a further aspect, the disclosure features a kit including a package insert instructing a user to practice the method of any one of the above aspects or embodiments of the disclosure.

[0109] In some embodiments, the kit comprises an apparatus for administering the polynucleotide sequence to a subject, hi some embodiments, the kit comprises one or more binding molecules for detecting expression of an mRNA transcript encoding the polypeptide or expression or activity of the polypeptide.

[0110] The accompanying drawings are included to illustrate and further understand embodiments of the present disclosure. [Brief explanation of the drawings]

[0111] [Figure 1] FIG. 1 is a schematic diagram showing the features of the pAAV ZsGreen1 plasmid map. [Figure 2A]This bar graph shows the relative ZsGreen fluorescent protein production from a fully codon-optimized open reading frame (ORF) with or without the elimination of DRACH motifs. Flow cytometry measurements were performed on HEK293T cells 2 or 3 days after 1:4 transfection with a plasmid containing a fully codon-optimized ORF in which all codons were replaced with the most frequently used synonymous codons according to Table 1. "+m6A" indicates that 14 DRACH motifs were present in the transfected ORF, while the sample group labeled "-m6A" was further modified using six codon usage rules to eliminate all DRACH motifs present in the coding sequence prior to transfection. [Figure 2B] This is a bar graph showing the relative ZsGreen fluorescent protein production from a fully codon-optimized ORF with or without elimination of the DRACH motif. Flow cytometry measurements were performed on HEK293T cells 2 days after 1:16 transfection with a plasmid containing a fully codon-optimized ORF in which all codons were replaced with the most frequently used synonymous codons according to Table 1. "+m6A" indicates that 14 DRACH motifs were present in the transfected ORF, while "-m6A" indicates that the ORF was further modified using six codon usage rules to eliminate all DRACH motifs present in the coding sequence prior to transfection. [Figure 3A]This is a bar graph showing the relative ZsGreen fluorescent protein production from the proportional codon usage-optimized ORF with or without elimination of the DRACH motif. Flow cytometry measurements were performed on HEK293T cells 2 or 3 days after 1:4 transfection with plasmids containing the proportional codon usage-optimized ORF, with codons represented based on their reported frequencies shown in Table 1. "+m6A" indicates that 16 DRACH motifs were present in the transfected ORF, and "-m6A" indicates that the ORF was further modified using six codon usage rules to eliminate all DRACH motifs present in the coding sequence prior to transfection. [Figure 3B] This is a bar graph showing the relative ZsGreen fluorescent protein production from the proportional codon usage-optimized ORF with or without elimination of the DRACH motif. Flow cytometry measurements were performed on HEK293T cells 2 days after 1:16 transfection with plasmids containing the proportional codon usage-optimized ORF, with codons represented based on the reported frequencies shown in Table 1. "+m6A" indicates that 16 DRACH motifs were present in the transfected ORF, and "-m6A" indicates that the ORF was further modified using six codon usage rules to eliminate all DRACH motifs present in the coding sequence prior to transfection. [Figure 4] 1 is a bar graph showing relative GLP-1-Fc protein secretion from ORFs codon-optimized using a commercially available codon optimization web tool, with or without further modification to eliminate the DRACH motif. The ORF from which the DRACH motif was eliminated is indicated by "-m6A." Protein secretion was measured by enzyme-linked immunosorbent assay (ELISA). [Figure 5]This is a bar graph showing relative GLP-1-Fc protein secretion measured in HEK293T cells transfected with AAV containing ORFs codon-optimized using four different strategies. "CH" indicates that the GLP-1-Fc ORF was codon-optimized by replacing all codons with synonymous codons with the highest usage frequency. "IDT" indicates that the GLP-1-Fc ORF was codon-optimized using a commercially available codon optimization web tool. "-m6A" indicates that the ORF was further modified to eliminate the DRACH sequence according to the indicated codon optimization strategy. Protein concentrations were measured by ELISA. [Figure 6A] This graph shows detectable serum GLP-1-Fc protein levels in mice at various times after intramuscular administration of a low dose (1 x 10 genome copies per mouse) of AAV carrying either the native ORF or an ORF codon-optimized using one of four different strategies. "CH" indicates that the GLP-1-Fc ORF was codon-optimized by replacing all codons with synonymous codons with the highest usage frequency. "IDT" indicates that the GLP-1-Fc ORF was codon-optimized using a commercially available codon optimization web tool. "-m6A" indicates that the ORF was further modified to eliminate the DRACH sequence according to the indicated codon optimization strategy. Protein concentrations were measured by ELISA. [Figure 6B]This graph shows detectable serum GLP-1-Fc protein levels in mice at various times after intramuscular administration of a high dose (1 x 10 genome copies per mouse) of AAV carrying either the native ORF or an ORF codon-optimized using one of four different strategies. "CH" indicates that the GLP-1-Fc ORF was codon-optimized by replacing all codons with synonymous codons with the highest usage frequency. "IDT" indicates that the GLP-1-Fc ORF was codon-optimized using a commercially available codon optimization web tool. "m6A" indicates that the ORF was further modified to eliminate the DRACH sequence according to the indicated codon optimization strategy. Protein concentrations were measured by ELISA. [Figure 7] This is a bar graph showing detectable serum GLP-1-Fc protein levels in mice 14 days after intramuscular administration of a low dose (1 x 10 genome copies per mouse) of AAV carrying either the native ORF or an ORF codon-optimized using one of two different codon optimization strategies. "CH" indicates that the GLP-1-Fc ORF was codon-optimized by replacing all codons with the most frequently used synonymous codons. "m6A" indicates that after codon optimization, the ORF was further modified to eliminate the DRACH sequence. Protein concentrations were measured by ELISA. [Figure 8A] 1 is a bar graph showing detectable serum GLP-1-Fc protein levels in mice 28 days after intramuscular administration of a low dose (1×10 genome copies per mouse) of AAV with an ORF that was codon-optimized using a commercially available codon optimization web tool, in which the DRACH motif was either left unmodified (+m6A) or removed by an additional substitution (-m6A). Protein concentrations were measured by ELISA. [Figure 8B]1 is a bar graph showing detectable serum GLP-1-Fc protein levels in mice 28 days after intramuscular administration of a low dose (1×10 genome copies per mouse) of AAV with an ORF that was codon-optimized by replacing all codons with the most frequently used synonymous codons, in which the DRACH motif was either left unmodified (+m6A) or removed by further substitution (-m6A). Protein concentrations were measured by ELISA. [Figure 8C] 1 is a bar graph showing detectable serum GLP-1-Fc protein levels in mice 28 days after intramuscular administration of a high dose (1×10 genome copies per mouse) of AAV with an ORF that was codon-optimized using a commercially available codon optimization web tool, in which the DRACH motif was either left unmodified (+m6A) or removed by an additional substitution (-m6A). Protein concentrations were measured by ELISA. [Figure 8D] 1 is a bar graph showing detectable serum GLP-1-Fc protein levels in mice 28 days after intramuscular administration of a high dose (1×10 genome copies per mouse) of AAV carrying an ORF that was codon-optimized by replacing all codons with the most frequently used synonymous codons, in which the DRACH motif was either left unmodified (+m6A) or removed by further substitution (-m6A). Protein concentrations were measured by ELISA. [Figure 9A] 1 is a bar graph showing relative GLP-1-Fc mRNA transcript levels in mouse muscle tissue 60 days after intramuscular administration of a low dose (1×10 genome copies per mouse) of AAV with an ORF that was codon-optimized using a commercially available codon optimization web tool, in which the DRACH motif was either left unmodified (+m6A) or removed by an additional substitution (-m6A). Transcript levels were measured by qPCR. [Figure 9B]1 is a bar graph showing relative GLP-1-Fc mRNA transcript levels in mouse muscle tissue 60 days after intramuscular administration of a low dose (1×10 genome copies per mouse) of AAV with an ORF that was codon-optimized by replacing all codons with the most frequently used synonymous codons, in which the DRACH motif was either left unmodified (+m6A) or removed by further substitution (-m6A). Transcript levels were measured by qPCR. [Figure 9C] 1 is a bar graph showing relative GLP-1-Fc mRNA transcript levels in mouse muscle tissue 60 days after intramuscular administration of a high dose (1×10 genome copies per mouse) of AAV with an ORF that was codon-optimized using a commercially available codon optimization web tool, in which the DRACH motif was either left unmodified (+m6A) or removed by an additional substitution (-m6A). Transcript levels were measured by qPCR. [Figure 9D] 1 is a bar graph showing relative GLP-1-Fc mRNA transcript levels in mouse muscle tissue 60 days after intramuscular administration of a high dose (1×10 genome copies per mouse) of AAV with an ORF that was codon-optimized by replacing all codons with the most frequently used synonymous codons, in which the DRACH motif was either left unmodified (+m6A) or removed by further substitution (-m6A). Transcript levels were measured by qPCR. [Figure 10A] 1 is a bar graph showing relative GLP-1-Fc mRNA transcript levels in mouse liver tissue 60 days after intramuscular administration of a low dose (1×10 genome copies per mouse) of AAV with an ORF that was codon-optimized using a commercially available codon optimization web tool, in which the DRACH motif was either left unmodified (+m6A) or removed by an additional substitution (-m6A). Transcript levels were measured by qPCR. [Figure 10B]1 is a bar graph showing relative GLP-1-Fc mRNA transcript levels in mouse liver tissue 60 days after intramuscular administration of a low dose (1×10 genome copies per mouse) of AAV with an ORF that was codon-optimized by replacing all codons with the most frequently used synonymous codons, in which the DRACH motif was either left unmodified (+m6A) or removed by further substitution (-m6A). Transcript levels were measured by qPCR. [Figure 10C] 1 is a bar graph showing relative GLP-1-Fc mRNA transcript levels in mouse liver tissue 60 days after intramuscular administration of a high dose (1×10 genome copies per mouse) of AAV with an ORF that was codon-optimized using a commercially available codon optimization web tool, in which the DRACH motif was either left unmodified (+m6A) or removed by an additional substitution (-m6A). Transcript levels were measured by qPCR. [Figure 10D] 1 is a bar graph showing relative GLP-1-Fc mRNA transcript levels in mouse liver tissue 60 days after intramuscular administration of a high dose (1×10 genome copies per mouse) of AAV carrying an ORF that was codon-optimized by replacing all codons with the most frequently used synonymous codons, in which the DRACH motif was either left unmodified (+m6A) or removed by further substitution (-m6A). Transcript levels were measured by qPCR.

[0112] definition Unless otherwise defined herein, scientific and technical terms used herein have the meaning commonly understood by one of ordinary skill in the art. In case of any potential ambiguity, the definitions provided herein take precedence over any dictionary or extrinsic definitions. Unless otherwise required by context, singular terms shall include the plural and plural terms shall include the singular. The use of "or" means "and / or" unless expressly stated otherwise. The use of the term "including," as well as other forms such as "includes" and "included," is not limiting.

[0113] As used herein, the term "about," when attached to one or more values ​​of interest, refers to a value that is within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction of (above or below) the stated reference value, unless otherwise stated or otherwise clear from the context (except where such number would exceed 100% of the possible values).

[0114] As used herein, the term "codon optimization" refers to the process of altering the codons or coding sequence of a given gene with the intent of increasing expression of the encoded polypeptide without changing the amino acid sequence of the polypeptide. This process takes advantage of the redundancy in the genetic code, where multiple three-base pair codon combinations encode a single amino acid. These codons, which encode the same amino acid but in different nucleic acid sequences, are referred to herein as "synonymous codons." As a non-limiting example, the amino acid leucine can be encoded by any one of the following six codons: UUA, UUG, CUA, CUG, CUU, or CUC, all of which are synonymous with one another. The process of codon optimization generally improves mRNA expression, mRNA stability, and / or efficiency of polypeptide synthesis compared to an unmodified gene or coding sequence. Codon optimization often improves expression of a target gene by modifying codon sequences taking into account the abundance of tRNAs in a cell type or organism, secondary structural elements within the polynucleotide sequence, and / or binding interactions between the polynucleotide sequence and one or more binding partners (e.g., ribosomes, methyltransferases, tRNA molecules, and other binding partners known in the art). With respect to codon optimization, "alternative nucleotides" or "alternative codons" refer to different nucleotides or codons that ultimately encode the same amino acid sequence of a polypeptide or protein of interest.

[0115] As used herein, the terms "codon usage table," "codon bias table," "codon frequency lookup table," and the like are used interchangeably and refer to a table that correlates each codon that may be used to encode a particular amino acid with the frequency with which that codon is used to encode the corresponding amino acid in a particular setting. The setting may be, for example, (i) a particular organism (e.g., a mammalian subject such as a human), (ii) a particular class of genes within a given organism, or (iii) one or more synthetic polynucleotides. Hybrid codon usage or hybrid codon bias tables can also be constructed by combining two or more codon usage tables, possibly according to a variety of rules.

[0116] As used herein, "organism" or "target organism" with respect to codon optimization refers to an organism that is intended to receive delivery of one or more polynucleotides described herein (e.g., one or more codon-optimized polynucleotides).

[0117] As used herein, "coding sequence" refers to an open reading frame (ORF) in a nucleic acid that, upon expression, produces a polypeptide or protein. An ORF is a contiguous segment of DNA or RNA that begins with a start codon (e.g., methionine (ATG for DNA sequences, AUG for RNA sequences)) and ends with a stop codon (e.g., TAA, TAG, or TGA for DNA sequences, UAA, UAG, or UGA for RNA sequences). ORFs typically encode proteins. The sequences disclosed herein may further include additional elements, e.g., 5' and 3' untranslated regions (UTRs), although it will be understood that these elements, unlike the ORF, are not necessarily present in the RNA polynucleotides (e.g., mRNA transcripts) disclosed herein.

[0118] As used herein with respect to a target protein product, the terms "level of expression" or "expression level" are used interchangeably and refer to the amount of protein product in a subject or biological sample. "Expression" of a desired protein, as the term is used herein, refers to the overall process by which a gene of interest is processed (e.g., by one or more enzymes or organelles in a subject, within a cell, or ex vivo obtained from a cell) to produce a protein product. In particular, the term "expression" can be used to describe one or more of the following events: (1) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of the RNA transcript (e.g., by splicing, editing, 5' capping, and / or 3' end processing); (3) translation of the RNA into a polypeptide or protein; and (4) post-translational modification of the polypeptide or protein. Thus, genes expressed using the compositions and methods described herein include genes that are transcribed into a polynucleotide (such as mRNA) and then translated into a polypeptide or protein, as well as genes that are transcribed into an RNA polynucleotide but not translated into a polypeptide (e.g., transfer RNA and ribosomal RNA). Fragments of a transcribed polynucleotide, a translated polypeptide, or polynucleotide and / or polypeptide modifications (e.g., post-translational modifications of a polypeptide) should also be considered expressed, regardless of whether they are derived from a transcript generated by alternative splicing or a degraded transcript, or from post-translational processing of a polypeptide, for example, by proteolysis.

[0119] Expression of a gene of interest in a subject can be determined, for example, by detecting, in a sample obtained from the subject, an increase in the amount or concentration of mRNA encoding the corresponding protein (e.g., assessed using RNA detection procedures described herein or known in the art, such as quantitative polymerase chain reaction (qPCR), RT-PCR, and RNA-seq techniques), an increase in the amount or concentration of the corresponding protein (e.g., assessed using protein detection methods described herein or known in the art, such as enzyme-linked immunosorbent assay (ELISA), mass spectrometry, Western blot analysis, flow cytometry, immunofluorescence, colorimetric analysis, or arrays using targeted antibodies or hybridized nucleotides), and / or an increase in the activity of the corresponding protein (e.g., in the case of an enzyme, assessed using enzyme activity assays known in the art).

[0120] As used herein, the term "polynucleotide" or "nucleic acid" refers to a polymer of nucleotides of any length, including DNA and / or RNA. Nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides (e.g., containing modified nucleobases), and / or their analogs, which can be incorporated into a polymer by DNA or RNA polymerase or by a synthetic reaction. Thus, for example, polynucleotides as defined herein include, but are not limited to, single- and double-stranded DNA, DNA containing single- and double-stranded regions, single- and double-stranded RNA, and RNA containing single- and double-stranded regions, and hybrid molecules containing DNA and RNA that can be single-stranded or, more typically, double-stranded, or can contain single- and double-stranded regions. Additionally, as used herein, the term "polynucleotide" refers to triple-stranded regions, including RNA or DNA, or both RNA and DNA. The strands of such regions can be from the same molecule or different molecules. A region can include all of one or more of the molecules, but more typically includes only a region of some of the molecules. One of the molecules in the triple helix region is often an oligonucleotide.

[0121] The term "polynucleotide" specifically includes complementary DNA (cDNA). In some embodiments, a polynucleotide is a codon-optimized gene product, in which case the polynucleotide (e.g., a polynucleotide encoding a protein of interest) has been subjected to one or more methods of codon optimization described herein.

[0122] A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and their analogs. Modifications to the nucleotide structure, if present, may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after synthesis, such as by conjugation with a label. Other types of modifications include, for example, "caps," substitution of one or more of the naturally occurring nucleotides with an analogue, internucleoside modifications such as those with uncharged linkages (e.g., methylphosphonates, phosphotriesters, phosphoramidates, carbamates, etc.) and those with charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), modifications containing pendant moieties such as proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), modifications with intercalators (e.g., acridine, psoralens, etc.), modifications containing chelators (e.g., metals, radioactive metals, boron, oxidative metals, etc.), modifications containing alkylating agents, modifications with altered linkages (e.g., alpha anomeric nucleic acids, etc.), and unmodified forms of the polynucleotide(s). Additionally, any of the hydroxyl groups normally present in the sugar may be replaced with, for example, a phosphonate group, a phosphate group, protected with a standard protecting group, or activated to prepare an additional linkage to another nucleotide or to attach to a solid or semi-solid support. The 5' and 3' terminal OH may be phosphorylated or substituted with an amine or an organic capping group moiety containing 1 to 20 carbon atoms. Other hydroxyls may also be derivatized with standard protecting groups. Polynucleotides may also contain analogous forms of ribose or deoxyribose sugars commonly known in the art, including, for example, 2'-O-methyl-, 2'-O-allyl-, 2'-fluoro-, or 2'-azido-ribose, carbocyclic sugar analogs, α-anomeric sugars, epimeric sugars such as arabinose, xylose, or lyxose, pyranose sugars, furanose sugars, sedoheptulose, acyclic analogs, and abasic nucleoside analogs such as methyl riboside.One or more phosphodiester linkages may be replaced with alternative linking groups. These alternative linking groups include, but are not limited to, embodiments in which phosphate is replaced with P(O)S ("thioate"), P(S)S ("dithioate"), "(O)NR2 ("amidate"), P(O)R, P(O)OR', CO, or CH2 ("formacetal"), where each R or R' is independently H or substituted or unsubstituted alkyl (1-20C) (optionally containing an ether (-O-) linkage), aryl, alkenyl, cycloalkyl, cycloalkenyl, or araldyl. Not all linkages in a polynucleotide need be identical. The foregoing description applies to all polynucleotides referred to herein, including RNA and DNA.

[0123] As used herein, the terms "adenine" and "adenosine" are interchangeable terms with respect to nucleotides having an adenine base. As used herein, the terms "cytosine" and "cytidine" are interchangeable terms with respect to nucleotides having a cytosine base. As used herein, the terms "guanine" and "guanidine" are interchangeable terms with respect to nucleotides having a guanine base. As used herein, the terms "thymine" and "thymidine" are interchangeable terms with respect to nucleotides having a thymine base. As used herein, the terms "uracil" and "uridine" are interchangeable terms with respect to nucleotides having a uracil base.

[0124] As used herein, the term "splice junction site" refers to a region within a nucleic acid (e.g., DNA or RNA) sequence that is the boundary between an intron and an exon in a gene. The characteristics of splice junction sites or "splice sites" and the mechanisms of splicing are described in the art, for example, in Roca et al. Genes Dev. 27(2):129-144, 2013, which is incorporated herein by reference.

[0125] As used herein, "messenger RNA," "mRNA," or "mRNA transcript" is an RNA molecule that encodes (at least one) polypeptide or fragment thereof and that can be translated to produce the encoded polypeptide or fragment in vitro, in vivo, in situ, or ex vivo. The structural and topological features of mRNA, as well as post-transcriptional modifications, are described herein and are well known in the art.

[0126] As used herein, the term "peptide" refers to a polymer that contains multiple amino acid monomers (or analogs thereof) and that is 50 amino acids or less in length (e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids in length).

[0127] As used herein, the term "polypeptide" refers to a polymer of amino acid residues linked together by peptide bonds. As used herein, the term encompasses polypeptides of any size, structure, or function. Thus, polypeptides include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments, and other equivalents, variants, and analogs of the foregoing. A polypeptide may be a single molecule or a multimolecular complex, such as a dimer, trimer, or tetramer. The term polypeptide may also apply to amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids.

[0128] As used herein, the term "protein" refers to a sequence of amino acids or amino acid residues. Typically, proteins have a function. However, proteins also encompass polypeptides and smaller sequences of consecutive amino acids that lack functional activity. Examples of functional proteins include, but are not limited to, tagged or modified (e.g., for diagnostic or other clinical applications) enzymes (e.g., dehydrogenases, hydrolases, oxidoreductases, transferases, lyases, ligases, etc.), receptors, receptor ligands, cytokines, antibodies, immunomodulatory molecules, signaling molecules, or proteins. Useful general classes of enzymes include, but are not limited to, proteases, cellulases, lipases, hemicellulases, laccases, amylases, glucoamylases, esterases, lactases, polygalacturonases, galactosidases, ligninases, oxidases, peroxidases, glucose isomerases, nitrilases, hydroxylases, polymerases, and depolymerases. In addition to enzymes, encoded proteins that can be used in the present invention include, but are not limited to, transcription factors, antibodies, receptors, growth factors (PDGF, EGF, FGF, SCF, HGF, TGF, TNF, insulin, IGF, LIF, oncostatin, and CSFs), immunomodulatory factors, peptide hormones, cytokines, integrins, interleukins, adhesion molecules, thrombus-regulating molecules, protease inhibitors, angiostatin, defensins, CD antigens, interferons, chemokines, antigens, including those derived from infectious viruses and organisms, oncogene products, thrombopoietin, erythropoietin, tissue plasminogen activator, and other biologically active proteins desirable for use in a clinical setting. Also included are deletion mutants of such proteins, individual domains of such proteins, fusion proteins made from such proteins, and mixtures of such proteins, with those with increased half-life and / or increased activity being particularly useful.

[0129] As used herein, the term "DRACH motif" refers to a short, five-base-pair nucleic acid consensus sequence, where "D" in the DRACH consensus sequence refers to guanine, adenine, or uracil, "R" refers to guanine or adenine, "A" refers to adenine, "C" refers to cytosine, and "H" refers to adenine, uracil, or cytosine. DRACH motifs can be present within a polynucleotide sequence, such as an RNA molecule (e.g., an mRNA transcript). As described herein, the presence of one or more DRACH motifs within a polynucleotide sequence can shorten the half-life of the polynucleotide (e.g., an mRNA transcript), resulting in a reduced concentration of the translated protein or polypeptide encoded by the polynucleotide. Without being bound by any particular theory, DRACH motifs may be more likely to be modified with an N(6)-methyladenosine ("m6A") modification on the adenine base at the third position of the motif. Such modifications may shorten the half-life of the modified mRNA transcript in a cell or sample containing the mRNA transcript. One or more DRACH motifs within a nucleic acid sequence (e.g., a polynucleotide sequence, e.g., an mRNA sequence) may be removed or eliminated by substituting one or more nucleotides within the one or more DRACH motifs to provide synonymous codons, thereby replacing the codons that form part of the DRACH motif, while retaining the amino acid sequence of the encoded polypeptide product. The terms "removed" and "eliminated" and variations thereof with respect to a DRACH motif are understood to be interchangeable.

[0130] As used herein, the term "antibody" refers to a molecule that specifically binds to or is immunologically reactive with a particular antigen and contains at least the variable domain of a heavy chain, usually containing at least the variable domains of an immunoglobulin heavy and light chain. Antibodies and antigen-binding fragments, variants, or derivatives thereof include polyclonal, monoclonal, multispecific, human, humanized, primatized, or chimeric antibodies, single-chain antibodies, epitope-binding fragments (e.g., Fab, Fab', F(ab'), Fd, Fv, single-chain Fv (scFv), single-chain antibodies, disulfide-linked Fv (sdFv), V, and the like. L Domain or V H Antibody molecules of the present invention may be of any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2), or subclass of immunoglobulin molecule. Furthermore, unless otherwise specified, the term "monoclonal antibody" (mAb) is intended to include both intact molecules and antibody fragments (e.g., Fab and F(ab')2 fragments) that are capable of specifically binding to a target protein. Fab and F(ab')2 fragments lack the Fc fragment of an intact antibody.

[0131] As used herein, the term "antigen-binding fragment" refers to one or more fragments of an immunoglobulin that retain the ability to specifically bind to a target antigen. The antigen-binding function of an immunoglobulin can be performed by a fragment of a full-length antibody. An antibody fragment can be a Fab, F(ab')2, scFv, SMIP, diabody, triabody, affibody, nanobody, aptamer, or domain antibody. Examples of binding fragments encompassed by the term "antigen-binding fragment" of an antibody include: (i) a Fab fragment, a V L , V H , C L, and C H (ii) F(ab')2 fragment, a bivalent fragment containing two Fab fragments linked by a disulfide bridge at the hinge region; (iii) V H and C H (iv) a single-arm V of an antibody; L and V H Fv fragment consisting of domains, (v) V H and V L domain-containing dAb (Ward et al., Nature 341:544-546, 1989), (vi) V H (vii) a dAb fragment consisting of the V domain; H or V L These include, but are not limited to, dAbs consisting of domains V, VIII, VIV ... L and V H Although the V are encoded by separate genes, they can be joined by a linker that allows them to be made as a single protein chain using recombinant methods. L and V H The regions pair to form a monovalent molecule known as a single-chain Fv (scFv). These antibody fragments can be obtained using conventional techniques known to those skilled in the art, and the fragments can be screened for utility in the same manner as intact antibodies. Antigen-binding fragments can be produced by recombinant DNA techniques, by enzymatic or chemical cleavage of intact immunoglobulins, or, in certain cases, by chemical peptide synthesis procedures known in the art.

[0132] As used herein, the term "primer" refers to a natural or synthetic oligonucleotide that can form a duplex with a polynucleotide template and then serve as an initiation point for nucleic acid synthesis to extend from its 3' end along the template nucleic acid, forming an extended duplex. The sequence of nucleotides added during the extension process is determined by the sequence of the template polynucleotide. Typically, primers are extended by a DNA polymerase. Primers typically have lengths ranging from 3 to 36 nucleotides, 5 to 24 nucleotides, or 14 to 36 nucleotides. In certain embodiments, primers are universal or non-universal primers. A pair of primers can flank a sequence or set of sequences of interest. The primer and probe can be sequentially denatured. In certain embodiments, primers bind adjacent to a target sequence, whether it is a sequence to be captured for analysis or a tag to be copied.

[0133] The term "vector" includes nucleic acids, e.g., DNA (e.g., plasmids) or RNA, that contain a polynucleotide encoding a gene product of interest, optionally in combination with one or more additional elements (e.g., promoters, enhancers, untranslated regions, or splicing modulators) that facilitate expression of the gene product. Vectors include both viral and non-viral vectors. Various vectors have been developed for delivering polynucleotides encoding foreign proteins into eukaryotic or prokaryotic cells. Examples of such expression vectors are described, for example, in WO 1994 / 011026, the disclosure of which is incorporated herein by reference as it relates to vectors suitable for expressing genes of interest. Specific vectors that can be used to express the transgenes described herein include plasmids containing regulatory sequences, such as promoter and enhancer regions, that drive gene transcription. Other vectors useful for expressing transgenes contain polynucleotide sequences that increase the translation rate of these genes or improve the stability or nuclear export of mRNA resulting from gene transcription. These sequence elements include, for example, 5' and 3' untranslated regions, an internal ribosome entry site (IRES), and a polyadenylation signal site, which direct efficient transcription of genes carried on the expression vector. Expression vectors suitable for use in conjunction with the compositions and methods described herein may also contain a polynucleotide encoding a marker for selection of cells containing such a vector. Examples of suitable markers are genes encoding resistance to antibiotics such as ampicillin, chloramphenicol, kanamycin, nourseothricin, or zeocin.

[0134] As used herein, the term "isolated" refers to a substance or entity that has been altered or removed from its natural state (e.g., at least some components associated with it in the natural state have been altered or removed). For example, a nucleic acid or peptide naturally occurring in a living animal is not "isolated," but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is. An isolated nucleic acid or protein can exist in a substantially purified form or can exist in a non-native environment, such as, for example, a host cell. Such a polynucleotide can be part of a vector, and / or such a polynucleotide or polypeptide can be part of a composition, and such a vector or composition is still considered isolated in that it is not part of the environment in which it is found in nature. In some embodiments, an isolated nucleic acid is recombinant (e.g., incorporated into a vector). Methods for isolating polynucleotides and proteins or polypeptides are routine in the art.

[0135] As used herein, the term "native" or "wild-type" means existing in nature without artificial assistance, i.e., human intervention. "Native" or "wild-type" may refer to the naturally occurring form of a biomolecule, sequence, or entity.

[0136] As used herein, the phrase "operably linked" refers to a functional connection between two or more molecules, constructs, transcripts, entities, portions, etc. For example, one DNA segment can be operably linked to another segment of DNA, such as a promoter or enhancer placed relative to a coding region to facilitate transcription of the coding region, when they are located on the same contiguous DNA molecule and have a structural or functional relationship to each other. In other examples, operably linked nucleic acids are noncontiguous but are positioned in such a way that they are functionally related to each other as nucleic acids or as proteins expressed thereby. For example, enhancers need not be contiguous. Linking can be achieved by ligation at convenient restriction enzyme sites or by use of synthetic oligonucleotide adapters or linkers.

[0137] As used herein, the term "contacting" (i.e., contacting a cell with an agent) is intended to include incubating an agent and a cell together in vitro (e.g., adding an agent to cells in culture) or administering an agent to a subject, such that the agent and cells of a subject contact in vivo. The term "contacting" is not intended to include exposure of a cell to factors that may occur naturally within a subject (i.e., exposure that may occur as a result of natural physiological processes).

[0138] As used herein, the terms "associated," "conjugated," "linked," "bound," and "tethered," when used in reference to two or more moieties, mean that the moieties are physically associated or connected to one another, either directly or through one or more additional moieties that function as linking agents, to form a structure that is sufficiently stable so that the moieties remain physically associated under the conditions in which the structure is used, e.g., physiological conditions. The "association" need not be strictly through a direct covalent chemical bond. The term can also imply connectivity based on ionic or hydrogen bonds, or hybridization, that is sufficiently stable so that the "associated" entities remain physically associated.

[0139] As used herein, the term "stability" with respect to a biological material or molecule (e.g., a polynucleotide or polypeptide) refers to the balance, or steady-state level, of production (e.g., transcription or translation) and decay or degradation of the biological material within a system such as a whole organism, an organ, a tissue or a subset of tissues, a cell or a subset of cells, or a dish or container. In some embodiments, stability refers to the half-life of the biological material or molecule.

[0140] As used herein, the term "cell type" refers to a group of cells that share a statistically separable phenotype based on gene expression data. For example, cells of a common cell type may share similar structural and / or functional characteristics, such as similar gene activation patterns and antigen presentation properties. Cells of a common cell type may include those isolated from a common tissue (e.g., epithelial, nervous, connective, or muscle tissue) and / or those isolated from a common organ, tissue system, blood vessel, or other structure and / or region in an organism.

[0141] As used herein, the term "in vitro" refers to events that take place not in a living organism (e.g., an animal, plant, or microorganism) but in an artificial environment, e.g., in a test tube or reaction vessel, in a cell culture, in a Petri dish, etc.

[0142] As used herein, the term "in vivo" refers to events that take place inside an organism (e.g., an animal, plant, or microorganism, or cells or tissues thereof).

[0143] As used herein, the term "ex vivo" refers to what happens to a component of an organism (e.g., a tissue, cell, or subcellular fraction) when that component is removed from its natural environment (e.g., the body or a natural structure) and placed in an artificial environment (e.g., a test tube or culture dish, flask, or other container) for experimental or clinical application. In some cases, an ex vivo experiment or application may involve administering (e.g., by implantation, injection, deposition, infusion, among other suitable routes of administration) the component to the same subject or another recipient subject after one or more ex vivo applications.

[0144] As used herein, "modified" refers to an altered state or structure of a molecule of the invention (e.g., a polynucleotide, e.g., DNA or mRNA, e.g., a polypeptide or protein, e.g., an amino acid residue). Molecules can be modified in many ways, such as structural modification (e.g., mutation of one or more base pairs or amino acid residues) or chemical modification (e.g., methylation, acetylation, reduction or oxidation, glycosylation, lipidation, ubiquitination of one or more base pairs or amino acid residues). In some embodiments, a molecule such as DNA or mRNA is altered to remove, reduce, or eliminate DRACH motifs, thereby reducing the number of m6A methylation modifications within a gene or coding sequence of interest.

[0145] As used herein, the term "exogenous" refers to a molecule (e.g., a polypeptide, nucleic acid, or cofactor) that is not naturally found in a particular organism (e.g., a human) or in a particular location within an organism (e.g., an organ, tissue, or cell, e.g., a human cell). Exogenous materials include materials provided from an external source to an organism or a culture extracted therefrom.

[0146] As used herein, the terms "identity" or "homology" refer to the overall relatedness between polymers, e.g., between nucleic acid molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. In some embodiments, polymer molecules are considered to be homologous to one another if their sequences are at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical. In some embodiments, polymer molecules are considered to be homologous to one another if their sequences are at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% similar. The term homology necessarily refers to a comparison between at least two sequences (polynucleotide or polypeptide sequences).

[0147] "Percent sequence identity (%)" with respect to a reference polynucleotide or polypeptide sequence is defined as the percentage of nucleic acids or amino acids in a candidate sequence that are identical to the nucleic acids or amino acids in the reference polynucleotide or polypeptide sequence, after aligning the sequences to achieve the maximum percent sequence identity and introducing gaps as necessary.Alignment for determining percent nucleic acid or amino acid sequence identity can be achieved in a variety of ways within the capabilities of those skilled in the art, for example, using publicly available computer software such as BLAST, BLAST-2, or Megalign software.Those skilled in the art can determine the appropriate parameters for aligning sequences, including any algorithms required to achieve maximum alignment across the entire length of the sequences being compared.For example, percent sequence identity values ​​can be generated using the sequence comparison computer program BLAST. By way of illustration, the percent sequence identity of a given nucleic acid or amino acid sequence A to, with, or against a given nucleic acid or amino acid sequence B (which may alternatively be expressed as a given nucleic acid or amino acid sequence A having a certain percent sequence identity to, with, or against a given nucleic acid or amino acid sequence B) is calculated as follows: 100×(fraction X / Y) where X is the number of nucleotides or amino acids scored as identical matches by a sequence alignment program (e.g., BLAST) in that program's alignment of A and B, and Y is the total number of nucleic acids in B. It will be recognized that if the length of nucleic acid or amino acid sequence A is not equal to the length of nucleic acid or amino acid sequence B, then the percent sequence identity of A to B will not equal the percent sequence identity of B to A.

[0148] In certain embodiments, the term "reference level" herein refers to a value obtained from a "reference sample" for measuring the effect induced by the methods described herein. The reference level may be an indicator or measurement measured before the administration or performance of a method (e.g., one or more codon optimization methods or one or more treatments described herein). The reference level may also be an indicator or measurement measured in a reference sample in which the methods described herein have not been performed (e.g., a negative control sample; e.g., a control healthy subject or a subject with a disease or condition). The reference level may also be an indicator or measurement measured in a reference sample exhibiting a known or expected effect to evaluate the effectiveness of the methods described herein (e.g., an effect produced by a routine method of protein production or an effect produced by a known treatment method). In some embodiments, the reference level may be a predetermined value or a certain value. As will be understood by one of skill in the art, the reference level is predetermined and set, for example, to meet requirements for specificity and / or sensitivity. For example, the sensitivity or specificity of an assay may need to be set at a certain limit, e.g., 80%, 90%, or 95%, respectively. These requirements may be defined in terms of positive or negative predictive value. In one embodiment, the reference level is determined in a healthy individual. In one embodiment, the reference value is previously determined for the disease to which the subject belongs. In certain embodiments, the reference level can be set to any percentage, e.g., 25% to 75% of the overall distribution of values ​​for the disease being investigated. In other embodiments, the reference level can be set to, for example, the median, tertile, quartile, or quintile, determined from the overall distribution of values ​​for the disease being investigated or a given population. In one embodiment, the reference level is set to the median, determined from the overall distribution of values ​​for the disease being investigated. In some embodiments, the reference level may be a value depending on the patient's gender, e.g., a different reference level for men than for women.

[0149] As used herein, the term "sample" refers to a subset of tissues, cells, or components thereof (e.g., bodily fluids including, but not limited to, peripheral blood, serum, plasma, ascites, urine, cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial fluid, aqueous humor, amniotic fluid, earwax, breast milk, bronchoalveolar lavage fluid, semen, prostatic fluid, Cowper's or pre-ejaculatory fluid, sweat, feces, hair, tears, cyst fluid, pleural and peritoneal fluid, pericardial fluid, lymph, chyme, chyle, bile, interstitial fluid, menstrual fluid, pus, sebum, vomit, vaginal secretions, mucosal secretions, stool, pancreatic juice, sinus lavage, bronchopulmonary aspirate, blastocyst cavity fluid, and umbilical cord blood). A sample may also include homogenates, lysates, or extracts prepared from a whole organism, or a subset of its tissues, cells, or components, or a fraction or portion thereof, including, but not limited to, plasma, serum, spinal fluid, lymphatic fluid, external portions of the skin, respiratory, intestinal, and genitourinary tracts, tears, saliva, milk, blood cells, tumors, organs, etc. Additionally, a sample may refer to a culture medium, such as a nutrient broth or gel, which may contain cellular components such as proteins or nucleic acid molecules.

[0150] As used herein, "treatment" and "treating," with respect to a disease or condition, refer to an approach for obtaining a beneficial or desired result, e.g., a clinical result. Beneficial or desired results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, whether detectable or undetectable, reduction in the extent of the disease or condition, a stable (i.e., not worsening) state of the disease, disorder, or condition, prevention of the spread of the disease or condition, slowing or slowing the progression of the disease or condition, amelioration or palliation of the disease or condition, and remission (whether partial or complete). "Ameliorating" or "alleviating" a disease or condition means reducing the extent and / or undesirable clinical signs of the disease, disorder, or condition and / or slowing or prolonging the time course of progression compared to the extent or time course in the absence of treatment. "Treatment" can also mean prolonging survival compared to expected survival in the absence of treatment. Those in need of treatment include those already with the condition or disorder as well as those prone to the condition or disorder, or those in whom the condition or disorder is to be prevented.

[0151] As used herein, the terms "effective amount," "therapeutically effective amount," and "sufficient amount" of a composition described herein refer to an amount sufficient to produce beneficial or desired results, including clinical results, when administered to a subject (e.g., a mammal, e.g., a human subject); therefore, "effective amount" or its synonyms will depend on the context in which it is applied. The amount of a given composition described herein that corresponds to such an amount will vary depending on various factors, such as the given therapeutic agent (e.g., polynucleotide, transgene, or coding sequence), pharmaceutical formulation, route of administration, type of disease or disorder, and characteristics of the subject or host being treated (e.g., age, sex, weight), but can nevertheless be routinely determined by one of skill in the art. Also, as used herein, a "therapeutically effective amount" of a composition of the present disclosure is an amount that produces beneficial or desired results in a subject compared to a reference (e.g., a subject before treatment, a healthy control, or an untreated subject). As defined herein, a therapeutically effective amount of a composition of the present disclosure can be readily determined by one of skill in the art using routine methods known in the art. Dosage regimens may be adjusted to provide an optimal therapeutic response.

[0152] As used herein, "administration" refers to dispensing, delivering, or applying a composition of the present disclosure to a desired location in a subject by any suitable route for delivering a composition (e.g., a polynucleotide, e.g., a polynucleotide encoding a transgene). Exemplary routes of administration include intramuscular, subcutaneous, intradermal, intravenous, intraperitoneal, intraarterial, intraventricular, intranasal, intraorbital, intracranial, or intraosseous administration.

[0153] As used herein, the term "administered in combination" or "co-administration" means administering two or more agents to a subject simultaneously or at intervals such that the effects of each agent on the subject in need thereof can overlap. In some embodiments, the agents are administered within about one week or more, one day or more, one hour or more, or one minute or more of each other. In some embodiments, the agents are administered close enough together to achieve a combinatorial (e.g., synergistic) effect.

[0154] As used herein, the term "pharmaceutically acceptable" refers to compounds, materials, compositions, and / or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of a subject, such as a mammal (e.g., a human) without undue toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0155] As used herein, the term "pharmaceutically acceptable excipient" refers to any ingredient, other than an active agent (e.g., as described herein), present in a pharmaceutical composition that has substantially non-toxic and non-inflammatory properties in a subject.

[0156] As used herein, the term "pharmaceutical composition" refers to a mixture containing a therapeutic agent, optionally in combination with one or more pharmaceutically acceptable excipients, diluents, and / or carriers, administered to a subject, such as a mammal (e.g., a human), to prevent, treat, or manage a particular disease or condition that is or may affect the subject. DETAILED DESCRIPTION OF THE INVENTION

[0157] Described herein are compositions and methods for use in codon optimization techniques, for example, to improve mRNA stability and half-life to enhance production of exogenous proteins.

[0158] Advantageously, the methods described herein allow for improved production of recombinant or exogenous proteins by modifying a polynucleotide sequence encoding a protein of interest to reduce m6A methylation in the transcribed mRNA sequence, thereby increasing mRNA stability and resulting in more robust protein expression compared to conventional protein production methods. For example, the methods described herein may be applied to express proteins in vitro, in vivo, and / or ex vivo for therapeutic purposes, such as gene therapy, drug delivery, and / or vaccine development.

[0159] I. Codon Optimization Methods The codon optimization methods described herein may be used alone or in combination to improve protein expression in applications involving transgene expression or heterologous gene expression. Generally, codon optimization improves the efficiency of translation of a target gene or transcript into a polypeptide or protein product, thereby increasing protein yield. The codon optimization methods described herein may be applied to genes or polynucleotide sequences encoding any type of protein, including soluble proteins, transmembrane proteins, membrane-bound proteins, intracellular proteins, or secreted proteins. In some embodiments, the codon optimization methods described herein are applied to genes or polynucleotide sequences encoding entire proteins (e.g., complete amino acid sequences), polypeptides, or protein fragments (e.g., one or more protein domains, polypeptides of a protein, and / or one or more protein chains). In further embodiments, the codon optimization methods described herein are applied to genes or polynucleotide sequences encoding fusion proteins (e.g., Fc fusion proteins or albumin fusion proteins), which may further improve protein stability and / or protein half-life.

[0160] A. Reduction or elimination of the DRACH motif In the methods described herein, increased expression of a protein of interest can be achieved through codon optimization techniques that reduce or eliminate DRACH motifs within the gene or coding sequence of a target of interest. A DRACH motif refers to a short, five-base pair nucleic acid consensus sequence, where "D" refers to guanine, adenine, or uracil; "R" refers to guanine or adenine; "A" refers to adenine; "C" refers to cytosine; and "H" refers to adenine, uracil, or cytosine. DRACH motifs include the following unique sequences: AGACA, AGACT, GAACC, GAACT, GGACA, GGACT, TGACT, AAACA, AAACC, AAACT, AGACC, GAACA, GGACC, TAACA, TAACC, TAACT, TGACA, and TGACC.

[0161] DRACH motifs are likely to undergo N(6)-methyladenosine ("m6A") modification at the adenosine base at the third position, resulting in a decreased half-life of the target mRNA in cells or biological samples containing the mRNA. By modifying a gene or coding sequence to reduce or eliminate one or more DRACH motifs, the resulting mRNA transcript may have fewer m6A modifications compared to the unmodified gene or coding sequence, thereby increasing its half-life. In some embodiments, the increased half-life of the modified mRNA transcript may be due to increased stability or decreased decay. For example, proteins of the YTHDF protein family (e.g., YTHDF2 and YTHDC2) recognize m6A-modified mRNA transcripts in the cytoplasm and mediate their degradation by destabilizing the m6A-modified mRNA transcripts and / or recruiting exonucleases.

[0162] The DRACH motif has a tendency or high probability of undergoing m6A modification, as shown by methylation enrichment studies. The tendency of a DRACH motif to undergo m6A modification may depend on the primary sequence of the motif, the location of the motif within a gene or coding sequence, the gene or sequence topology, e.g., secondary or tertiary structural elements surrounding the motif, or a combination thereof. For example, one or more of these factors may increase the accessibility of the DRACH sequence to methyltransferases such as METTL3, METTL14, WTAP, KIAA1439, METTL16, RBM15, and / or ZC3H13 for m6A modification. DRACH motifs having a nucleotide sequence selected from the group consisting of AGACA, AGACT, GAACC, GAACT, GGACA, GGACT, and TGACT are more likely to undergo m6A modification. The sequence-dependent enrichment of m6A modification in DRACH motifs has been discussed in other publications, such as Schwartz et al. (Cell Rep. 8(1):284-296, 2014), which is incorporated herein by reference. Polynucleotide topology and sequence elements also influence the enrichment of m6A-modified DRACH motifs within mRNA transcripts. For example, m6A modification may be enriched in DRACH motifs located near the coding sequence, 3' untranslated region, and / or stop codon of a gene. In contrast, DRACH motifs located near splice junctions or within the 5' untranslated region are less likely to undergo m6A modification. In some embodiments, if the DRACH motif is within about 50 nucleotides or less (e.g., about 60, about 55, about 50, about 45, about 40, about 35, about 30, about 25, about 20, about 15, about 10, or about 5 nucleotides) of a splice junction, the motif is unlikely to undergo m6A modification.

[0163] The presence of m6A modification in the DRACH motif of RNA molecules can be detected by methods known in the art, such as RNA cross-linking and immunoprecipitation combined with next-generation sequencing and nanopore sequencing.Methods for detecting m6A modification in mRNA transcripts are known in the art, and are described in detail in, for example, Meyer et al. (Cell.149(7):1635-1646, 2012), Dominissini et al. (Nature.29(485):201-206, 2012), Linder et al. (Nat Methods.12(8):767-772, 2015), Ke et al. (Genes Dev.31(10):990-1006, 2017), and Lorenz et al. (RNA.26:19-28, 2020), each of which is incorporated herein by reference.

[0164] In some embodiments, the gene or coding sequence is modified to remove 1 to 5 DRACH motifs (e.g., 1, 2, 3, 4, or 5 DRACH motifs) from the gene or coding sequence. In some embodiments, the gene or coding sequence is modified to remove 5 to 10 DRACH motifs (e.g., 5, 6, 7, 8, 9, or 10 DRACH motifs) from the gene or coding sequence. In some embodiments, the gene or coding sequence is modified to remove 10 to 20 DRACH motifs (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 DRACH motifs) from the gene or coding sequence. In some embodiments, the gene or coding sequence is modified such that 20 to 40 DRACH motifs (e.g., 20 to 25, 25 to 30, 30 to 35, 30 to 40, e.g., 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 DRACH motifs) are removed from the gene or coding sequence. In some embodiments, the gene or coding sequence is modified to remove 40 to 80 DRACH motifs (e.g., 40 to 45, 45 to 50, 50 to 55, 55 to 60, 60 to 65, 65 to 70, 70 to 75, 75 to 80, e.g., 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 DRACH motifs) from the gene or coding sequence.In some embodiments, the gene or coding sequence is modified such that 50 to 100 DRACH motifs (e.g., 50 to 60, 60 to 70, 70 to 80, 80 to 90, 90 to 100, e.g., 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 DRACH motifs) are removed from the gene or coding sequence. In other embodiments, more than 100 DRACH motifs are removed from the gene or coding sequence (e.g., more than 100, more than 110, more than 120, more than 130, more than 140, more than 150, more than 160, more than 170, more than 180, more than 190, or more than 200 DRACH motifs).

[0165] The gene or coding sequence may be modified to remove or eliminate all DRACH motifs from the gene or coding sequence, hi some embodiments, the gene or coding sequence is modified such that the number of DRACH motifs in the sequence is reduced by at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, or at least 10% compared to the native gene or coding sequence.

[0166] The method of removing one or more DRACH motifs may be combined with additional codon usage practices to further reduce the likelihood of m6A modification of a sequence. In some embodiments, the additional codon usage practices to reduce m6A modification employ one or more of the following six guidelines: (1) never use GAC for aspartic acid (Asp or D), (2) never use GAA for glutamic acid (Glu or E), (3) never use GGA for glycine (Gly or G), (4) never use AAA for lysine (Lys or K), (5) never use AAC for asparagine (Asn or N), and / or (6) always use ACG for threonine (Thr or T).

[0167] In some embodiments, removal of one or more DRACH motifs requires iterative modification of a polynucleotide of interest to avoid the introduction of new DRACH motifs and / or to preserve amino acid sequence identity. In some embodiments, removal of one or more DRACH motifs involves replacing one or more codons in a polynucleotide sequence with synonymous codons (i.e., codons that encode the same amino acid sequence). In some embodiments, removal of one or more DRACH motifs involves replacing nucleotides such that the primary sequence (i.e., amino acid sequence) of the polypeptide or protein has 100% sequence identity.

[0168] Other considerations that can affect mRNA stability or total protein production include the GC content of the mRNA, mRNA secondary structure, accessibility of ribosome binding sites, and relative abundance of tRNAs, among other considerations known in the art. In some embodiments, higher GC content within the coding sequence inhibits mRNA degradation and repression mechanisms within the cell (e.g., localization to P-body granules or reduced interaction with translational repressors), improving mRNA stability and half-life. The optimal GC content for improved protein production may be 50% to 80% GC content (e.g., 50-60%, 60-70%, or 70-80%, e.g., 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, or 80%) across the entire length of the coding sequence of interest. Structural considerations for mRNA transcripts include secondary structures, such as hairpins or stem-loops, which may inhibit translation initiation or promote ribosome stalling. A hairpin or stem loop can form when an intramolecular hydrogen bond is formed between complementary nucleotides (e.g., A and T, A and U, or G and C). The mechanisms of ribosome scanning and ribosome fidelity that affect protein production are known in the art and have been discussed elsewhere, for example, in Zaher and Green (Cell. 136(4):746-762, 2009), which is incorporated herein by reference. The codon optimization method of removing one or more DRACH motifs may be performed iteratively to achieve an optimal value for any one or combination of the aforementioned considerations. In some embodiments, the codon optimization method is performed one, two, three, or more than three times to achieve optimal mRNA GC content and structural considerations.

[0169] In some embodiments, codon optimization by removing or eliminating one, multiple, or all DRACH motifs present enhances the half-life (e.g., stability) of the mRNA of a gene or coding sequence of interest. In some embodiments, eliminating one, multiple, or all DRACH motifs present in a gene or coding sequence of interest increases the half-life of the mRNA by about 1.25-fold, about 1.5-fold, about 1.75-fold, about 2-fold, about 2.25-fold, about 2.5-fold, about 2.75-fold, about 3-fold, or more, compared to a polynucleotide sequence in which the DRACH motifs have not been removed, such as a native gene or coding sequence. In some embodiments, elimination of one, more, or all DRACH motifs present in a gene or coding sequence of interest increases the half-life of the mRNA by about 5-fold to about 50-fold (e.g., about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold, about 15-fold, about 20-fold, about 25-fold, about 30-fold, about 35-fold, about 40-fold, about 45-fold, about 50-fold, or more than 50-fold) compared to a polynucleotide sequence in which the DRACH motifs have not been removed, such as a native gene or coding sequence.

[0170] In some embodiments, eliminating one, more, or all DRACH motifs present in a gene or coding sequence of interest increases the half-life of the mRNA by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, or more than 100% compared to a polynucleotide sequence from which the DRACH motifs have not been removed, such as a native gene or coding sequence. In some embodiments, eliminating one, more, or all DRACH motifs present in a gene or coding sequence of interest increases the half-life of the mRNA by, for example, about 1 to 24 hours or more (e.g., about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 5 hours, about 10 hours, about 15 hours, about 20 hours, about 24 hours, or more) compared to a polynucleotide sequence from which the DRACH motifs have not been removed, such as a native gene or coding sequence. Methods for measuring mRNA half-life or stability include those known in the art and described herein.

[0171] In some embodiments, eliminating one, more, or all DRACH motifs present in a gene or coding sequence of interest increases production of a protein or fragment thereof (e.g., protein expression). In some embodiments, eliminating one, more, or all DRACH motifs present in a gene or coding sequence of interest increases protein expression by about 1.5-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, or more than 5-fold compared to a polynucleotide sequence in which the DRACH motifs have not been removed, such as a native gene or coding sequence, e.g., a native gene or coding sequence of interest. In some embodiments, elimination of one, more, or all DRACH motifs present in a gene or coding sequence of interest results in an increase in protein expression of about 5-fold to about 50-fold (e.g., about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold, about 15-fold, about 20-fold, about 25-fold, about 30-fold, about 35-fold, about 40-fold, about 45-fold, about 50-fold, or more than 50-fold) compared to a native gene or coding sequence, e.g., a polynucleotide sequence in which the DRACH motifs have not been removed, such as a native gene or coding sequence.

[0172] In some embodiments, elimination of one, more, or all DRACH motifs present in a gene or coding sequence of interest results in an increase in protein expression of at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, or more than 100% compared to a polynucleotide sequence in which the DRACH motifs have not been removed, such as a native gene or coding sequence. In some embodiments, increased expression of a protein of interest or a fragment thereof is defined by an increase in total protein yield from recombinant production or an increase in measured protein in a biological sample. Methods for measuring protein expression are known in the art and are described herein.

[0173] B. Codon Optimization Based on Codon Usage Bias In some embodiments, the method for expressing heterologous genes by reducing or eliminating DRACH motifs may further include codon optimization based on codon usage bias. Codon usage bias refers to the biological phenomenon of preferentially using certain codons over other synonymous codons, which can affect the rate and efficiency of protein translation. Codon usage bias can affect RNA processing, ribosome scanning, translation initiation or termination, and / or protein folding and protein stability. Codon usage bias varies depending on the organism encoding the sequence due to evolutionary influences on the genome of the organism, including mutation, recombination rate, and genetic drift. Varying codon usage bias is observed in organisms of different species, families, or groups, and even in different genes within the same species. Therefore, codon usage bias may be taken into consideration for applications involving heterologous gene expression. For example, a polynucleotide sequence native to a human cell, when produced in an Escherichia coli cell, may produce less protein than in a human cell unless it is first modified based on E. coli codon usage.

[0174] In some embodiments, codon optimization for expression of a heterologous gene involves the use of a codon usage table for a given organism. An example of a codon usage table for humans is shown in Table 1 below.

[0175] [Table 1]

[0176] Codon optimization methods for increasing protein expression of a target of interest may be achieved by modifying a gene or coding sequence to replace one or more codons with synonymous codons having the highest frequency of usage. For example, a gene or coding sequence for protein expression in humans may be modified so that for a particular amino acid in the modified sequence, only the codon with the highest frequency shown in Table 1 is represented in all cases (e.g., all codons encoding leucine are modified to CTG).

[0177] In some embodiments, a gene or coding sequence for protein expression may be modified so that all of the codons listed are replaced with synonymous codons with the highest usage frequency in the organism. In some embodiments, a gene or coding sequence for protein expression may be modified so that 5% to 50% (e.g., 5% to 10%, 10% to 25%, 20% to 40%, or 25% to 50%, e.g., about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, or about 50%) of the listed codons are replaced with synonymous codons with the highest usage frequency. In some embodiments, genes or coding sequences for protein expression may be modified so that 25% to 75% (e.g., 25% to 40%, 30% to 50%, 40% to 60%, or 50% to 75%, e.g., about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, or about 75%) of the listed codons are replaced with synonymous codons with the highest usage frequency. In some embodiments, genes or coding sequences for protein expression may be modified so that 75% to 100% (e.g., 75% to 85%, 80% to 90%, 85% to 95%, 90% to 100%, e.g., about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%) of the listed codons are replaced with synonymous codons with the highest usage frequency.

[0178] Codon optimization methods for increasing expression of a protein of interest may be achieved by modifying a gene or codon sequence so that one or more codons are represented in proportion to their reported frequency of usage in the organism. For example, a gene or codon sequence for protein expression in humans may be modified so that codons encoding specific amino acids are represented according to their frequency of usage as shown in Table 1 (e.g., modifying the codon encoding leucine so that CTG is represented in about 41% of cases, CTC is represented in about 20% of cases, TTG is represented in about 13% of cases, etc.).

[0179] In some embodiments, a gene or coding sequence for protein expression may be modified so that all codons listed are replaced with synonymous codons based on their proportional usage. In some embodiments, a gene or coding sequence for protein expression may be modified so that 5% to 50% (e.g., 5% to 10%, 10% to 25%, 20% to 40%, or 25% to 50%, e.g., about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, or about 50%) of the listed codons are replaced with synonymous codons based on their proportional usage. In some embodiments, genes or coding sequences for protein expression may be modified such that 25% to 75% (e.g., 25% to 40%, 30% to 50%, 40% to 60%, or 50% to 75%, e.g., about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, or about 75%) of the listed codons are replaced with synonymous codons based on their proportional usage. In some embodiments, genes or coding sequences for protein expression may be modified such that 75% to 100% (e.g., 75% to 85%, 80% to 90%, 85% to 95%, 90% to 100%, e.g., about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%) of the listed codons are replaced with synonymous codons based on their proportional usage.

[0180] In some embodiments, the codon optimization method is performed using available software or web tools known in the art, where the codon optimization is automated or algorithmically performed. In some embodiments, the codon optimization method includes a heuristic scoring method. In some embodiments, the codon optimization method includes the use of a neural network. In some embodiments, the codon optimization method is performed using quantum computing (see, e.g., Fox et al. PLoS ONE 16(10):e0259101, 2021, incorporated herein by reference). In some embodiments, the codon optimization method is performed iteratively to achieve optimal mRNA guanine-cytosine (GC) content, mRNA secondary structure, mRNA motifs, and ribosome binding sites, among other considerations.

[0181] C. Evaluation of Codon Optimization Methods Codon optimization methods may be evaluated by measuring the mRNA stability or half-life of the modified gene or coding sequence compared to the native gene or coding sequence. In some embodiments, one or more of the codon optimization methods described herein, or a combination thereof, result in mRNA transcripts with increased stability or half-life. In some embodiments, the half-life of the mRNA is assessed by one or more measurements of the concentration, relative abundance, or relative stability of the mRNA transcript detected in a biological sample. The concentration, relative abundance, or relative stability of the mRNA transcript may be assessed by reverse transcription polymerase chain reaction (RT-PCR), fluorimetry, colorimetry, spectrophotometry, flow cytometry, in situ hybridization, Northern blot analysis, or an array using one or more hybridized oligonucleotides or antibodies against the mRNA transcript of interest. In further embodiments, the half-life or stability of the mRNA transcript of interest is assessed by structural or biochemical methods. In some embodiments, the half-life or stability of an mRNA transcript is assessed by selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) or modified methodologies thereof (see, e.g., Wilkinson et al. (Nat. Prot. 1:1610-1616, 2006, incorporated herein by reference)). In further embodiments, the half-life or stability of an mRNA transcript of interest may be assessed by mass spectrometry to assess the presence of chemical modifications. Any combination of one or more of the methods for assessing mRNA half-life or stability described herein may be used, optionally in addition to other methods known in the art.

[0182] In some embodiments, the half-life or stability of the mRNA transcript of interest is assessed by pulse-chase analysis to analyze mRNA degradation. In some embodiments, the mRNA half-life of the mRNA transcript of interest is assessed by measuring the rate of mRNA degradation after inhibiting transcription (e.g., by adding actinomycin D to a biological sample (the biological sample is derived from a subject or a cell population cultured in vitro)). In any one of the above embodiments, the stability or half-life of the mRNA transcript from the modified gene or coding sequence may be compared with a reference sample. In some embodiments, the reference sample is derived from a natural gene or coding sequence. In other embodiments, the reference sample is a housekeeping gene (e.g., a gene related to viability that is stably expressed in cells; e.g., β-actin, GAPDH, rRNA).

[0183] Additionally or alternatively, codon optimization methods may be evaluated by measuring protein production by modified genes or coding sequences compared to native genes or coding sequences. In some embodiments, protein production is evaluated by measuring the concentration of the protein of interest in a sample. In some embodiments, the concentration of the protein of interest is measured by mass spectrometry, Western blot analysis, ELISA, immunoprecipitation, flow cytometry, fluorometry, colorimetry, spectrophotometry, or arrays using oligonucleotides, such as aptamers or antibodies, bound to one or more proteins of interest.

[0184] Codon optimization method can be evaluated based on the protein quality or protein stability of the target protein or polypeptide produced.Protein quality or stability can be measured by functional assays or binding assays specific to the target protein (for example, enzyme activity assays or binding assays using one or more known binding partners as ligands or analytes).Protein quality or stability can also be evaluated by biochemical or biophysical methods known in the art, such as differential scanning fluorimetry, thermal shift assay, circular dichroism, dynamic light scattering, analytical ultracentrifugation, size exclusion chromatography, isothermal titration calorimetry, microscale thermophoresis, mass spectrometry, hydrogen-deuterium exchange, among other methods known in the art (see, for example, Le Basle et al. (J.Pharm.Sci.109(1):169-190,2020)).

[0185] II. Application of codon optimization methods A. Protein Production Methods Any of the codon optimization methods described herein may be used alone or in combination to express heterologous or transgenic genes in host cells, such as eukaryotic or prokaryotic cells. In some embodiments, the host cells are bacterial cells, yeast cells, insect cells, plant cells, or mammalian cells. In further embodiments, the host cells are cultured in vitro for heterologous gene expression or recombinant protein production. In some embodiments, the host cells are cultured as adherent cells or suspension cells. In some embodiments, the host cells are established model cell lines, such as cell lines for culture available through the American Type Culture Collection (ATCC).

[0186] In some embodiments, the host cells are within an organism for in vivo production of the protein (e.g., transgenic expression). In some embodiments, the host cells are derived from an organism (e.g., a human subject) for in vitro culture methods, and following in vitro culture, the host cells may be transplanted, injected, deposited, or administered to the same or a different organism (e.g., for autologous or allogeneic therapy or treatment).

[0187] B. Methods for Delivery of Codon-Optimized Gene Products The codon-optimized gene product (e.g., a transgene, an mRNA transcript, or a purified or partially purified protein) may be delivered to a host cell or subject by a variety of delivery techniques. The following sections describe exemplary, non-limiting modes for delivering a polynucleotide of interest (e.g., a polynucleotide in which one or more DRACH motifs have been eliminated according to the methods described herein) to a host cell or subject.

[0188] i. Viral genomes for delivery of codon-optimized gene products Viral genomes provide a rich source of vectors that can be used to efficiently deliver genes of interest into the genome of target cells (e.g., mammalian cells, such as human cells) of host cells. Viral genomes are particularly useful vectors for gene delivery because the polynucleotides contained within such genomes are usually integrated into the genome of target cells by general or specific transduction. These processes occur as part of the natural viral replication cycle and do not require additional proteins or reagents to induce gene integration. Examples of viral vectors that may be used in conjunction with the compositions and methods described herein are adeno-associated viruses (AAV), retroviruses, adenoviruses (e.g., Ad5, Ad26, Ad34, Ad35, and Ad48), parvoviruses (e.g., adeno-associated viruses), coronaviruses, negative-strand RNA viruses such as orthomyxoviruses (e.g., influenza viruses), rhabdoviruses (e.g., rabies virus and vesicular stomatitis virus), paramyxoviruses (e.g., measles and Sendai), positive-strand RNA viruses such as picornaviruses and alphaviruses, as well as double-stranded DNA viruses, including adenoviruses, herpesviruses (e.g., herpes simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus), and poxviruses (e.g., vaccinia, mutant vaccinia Ankara (MVA), fowlpox, and canarypox). Other viruses that may be used in conjunction with the compositions and methods described herein include, for example, Norwalk virus, togavirus, flavivirus, reovirus, papovavirus, hepadnavirus, and hepatitis virus. Examples of retroviruses include avian leukosis sarcoma virus, mammalian C, B, and D viruses, the HTLV-BLV complex, lentivirus, and spumavirus (Coffin, JM, Retroviridae: The viruses and their replication, In Fundamental Virology, Third Edition, BN Fields, et al., Eds., Lippincott-Raven Publishers, Philadelphia, 1996).Other examples include murine leukemia viruses, murine sarcoma viruses, mouse mammary tumor viruses, bovine leukemia viruses, feline leukemia viruses, feline sarcoma viruses, avian leukemia viruses, human T-cell leukemia viruses, baboon endogenous viruses, gibbon leukemia viruses, Mason-Pfizer monkey viruses, simian immunodeficiency viruses, simian sarcoma viruses, Rous sarcoma viruses, and lentiviruses. Other examples of vectors are described, for example, in U.S. Patent No. 5,801,030, the disclosure of which is incorporated herein by reference with respect to viral vectors for use in gene therapy.

[0189] ii. AAV vectors for delivery of codon-optimized gene products In some embodiments, the codon-optimized polynucleotides (e.g., modified genes or coding sequences) described herein are incorporated into recombinant AAV (rAAV) vectors to facilitate introduction into cells. rAAV vectors useful in combination with the compositions and methods described herein include recombinant nucleic acid constructs containing (1) a transgene encoding a codon-optimized sequence to enhance protein production, and (2) one or more nucleic acids that drive expression of the modified gene or coding sequence. The viral nucleic acid may include rAAV cis-acting elements (e.g., functional inverted terminal repeats, or "ITRs") for replicating and packaging DNA into viral particles. Such rAAV vectors may also contain marker or reporter genes. Useful rAAV vectors include vectors that lack all or part of one or more native AAV genes but retain functional flanking ITR sequences. The AAV ITRs may be of any serotype (e.g., from serotype 2) appropriate for a particular application. Methods for using rAAV vectors are described, for example, in Tal et al. (J. Biomed. Sci. 7:279-291, 2000) and Monahan and Samulski (Gene Delivery. 7:24-30, 2000), the disclosures of each of which are incorporated herein by reference with respect to AAV vectors for gene delivery.

[0190] The nucleic acids and vectors described herein can be incorporated into rAAV viral particles to facilitate the introduction of the nucleic acid or vector into cells. The AAV capsid protein constitutes the outer, non-nucleic acid portion of the viral particle and is encoded by the AAV cap gene. The cap gene encodes three viral coat proteins, VP1, VP2, and VP3, required for viral particle assembly. Construction of rAAV viral particles is described, for example, in U.S. Pat. Nos. 5,173,414, 5,139,941, 5,863,541, 5,869,305, 6,057,152, and 6,376,237, as well as by Rabinowitz et al. (J. Virol. 76:791-801, 2002) and Bowles et al. (J. Virol. 77:423-432, 2003), the disclosures of each of which relate to AAV vectors for gene delivery and are incorporated herein by reference.

[0191] rAAV viral particles useful in combination with the compositions and methods described herein include those derived from various AAV serotypes, including AAV1, 2, 3, 4, 5, 6, 7, 8, and 9, among others. The construction and use of AAV vectors and AAV proteins of different serotypes are described, for example, in Chao et al., Mol. Ther. 2:619-623, 2000), Davidson et al. (Proc. Natl. Acad. Sci. USA 97:3428-3432, 2000), Xiao et al. (J. Virol. 72:2224-2232, 1998), Halbert et al. (J. Virol. 74:1524-1532, 2000; Halbert et al. (J. Virol. 75:6615-6624, 2001), and Auricchio et al. (Hum. Molec. Genet. 10:3075-3081, 2001), the disclosures of each of which are incorporated herein by reference as they relate to AAV vectors for gene delivery.

[0192] Pseudotyped rAAV vectors are also useful in combination with the compositions and methods described herein. Pseudotyped vectors include AAV vectors of a given serotype (e.g., AAV2) pseudotyped with capsid proteins from a serotype other than the given serotype (e.g., AAV1, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, or AAV9, etc.). For example, a representative pseudotyped vector is an AAV2 vector encoding a therapeutic protein pseudotyped with capsid proteins from AAV serotype 8 or AAV serotype 9. In some embodiments, a pseudotyped AAV has ITRs from one AAV serotype (e.g., AAV2) and VP1, VP2, and / or VP3 capsid proteins from a different AAV serotype (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrhlO, or AAVrhl74). Techniques involving the construction and use of pseudotyped rAAV viral particles are known in the art and are described, for example, in Duan et al., J. Virol. 75:7662-7671 (2001); Halbert et al. (J. Virol. 74:1524-1532, 2000); Zolotukhin et al. (Methods, 28:158-167, 2002); and Auricchio et al. (Hum. Molec. Genet. 10:3075-3081, 2001).

[0193] In some embodiments, the AAV comprises a capsid as disclosed, for example, in WO2017 / 218842, the disclosure of which is incorporated herein by reference. In some embodiments, the AAV comprises a capsid protein as disclosed in Lin et al. (Mol Brain. 13:138, 2020), the disclosure of which is incorporated herein by reference. In some embodiments, the AAV comprises an AAV2-retrocapsid protein or an AAV9-retrocapsid protein. In some embodiments, the AAV comprises a capsid protein conjugated to a ligand or aptamer.

[0194] AAV viral particles with mutations in the viral particle capsid may be used to infect specific cell types more efficiently than non-mutated capsid viral particles. For example, suitable AAV mutants may have ligand insertion mutations to facilitate targeting of AAV to specific cell types. The construction and characterization of AAV capsid mutants, including insertion mutants, alanine screening mutants, and epitope tag mutants, are described in Wu et al. (J. Virol. 74:8635-45, 2000). Other rAAV viral particles that can be used in the methods of the present invention include capsid hybrids generated by viral molecular breeding and exon shuffling. See, for example, Soong et al. (Nat. Genet., 25:436-439, 2000) and Kolman and Stemmer (Nat. Biotechnol. 19:423-428, 2001).

[0195] iii. Additional Methods for Delivery of Codon-Optimized Gene Products into Host Cells In addition to the above viral-based delivery methods, various non-viral techniques can also be used to introduce codon-optimized genes or coding sequences into subject or host cells (e.g., host cells derived from human subjects). For example, electroporation can be used to permeabilize mammalian cells (e.g., human cells) by applying an electrostatic potential to the target cells. Mammalian cells, such as human cells, exposed to an external electric field in this manner are then susceptible to the uptake of exogenous nucleic acids. Electroporation of mammalian cells is described in detail, for example, in Chu et al. (Nucleic Acids Res. 15:1311, 1987), the disclosure of which is incorporated herein by reference. A similar technique, Nucleofection™, utilizes the application of an electric field to stimulate the uptake of exogenous polynucleotides into the nucleus of eukaryotic cells. Nucleofection™ and protocols useful for carrying out this technique are described, for example, in Distler et al. (Exp. Dermatol. 14:315, 2005), and in US2010 / 0317114, the disclosures of each of which are incorporated herein by reference.

[0196] Additional techniques useful for transfecting target cells include squeeze-poration. This technique induces rapid mechanical deformation of cells to stimulate the uptake of foreign DNA through membrane pores that form in response to applied stress. This technique is advantageous in that it does not require a vector to deliver nucleic acids to cells, such as human target cells. Squeeze-poration is described in detail, for example, in Sharei et al. (J.Vis.Exp.81:e50980,2013), the disclosure of which is incorporated herein by reference.

[0197] Lipofection is another technique useful for transfecting target cells. This method involves loading nucleic acids into liposomes, which often present cationic functional groups, such as quaternary amines or protonated amines, on the exterior of the liposomes. This, due to the anionic nature of the cell membrane, promotes electrostatic interactions between the liposomes and cells, ultimately leading to the uptake of exogenous nucleic acids, for example, by direct fusion of the liposome with the cell membrane or by endocytosis of the complex. Lipofection is described in detail, for example, in U.S. Patent No. 7,442,386, the disclosure of which is incorporated herein by reference. A similar technique that utilizes ionic interactions with the cell membrane to induce the uptake of exogenous nucleic acids involves contacting cells with cationic polymer-nucleic acid complexes. Exemplary cationic molecules that associate with polynucleotides to impart a positive charge favorable for interaction with cell membranes are activated dendrimers (e.g., as described in Dennig (Topics in Current Chemistry, 228:227, 2003), the disclosure of which is incorporated herein by reference) and diethylaminoethyl (DEAE)-dextran, the use of which as a transfection agent is detailed, for example, in Gulick et al. (Curr. Protoc. in Mol. Biol. 40:1:9.2:9.2.1, 1997), the disclosure of which is incorporated herein by reference. Magnetic beads are another tool that can be used to transfect target cells in a gentle and efficient manner, as this methodology utilizes the application of a magnetic field to direct the uptake of nucleic acids. This technique is described in detail, for example, in US2010 / 0227406, the disclosure of which is incorporated herein by reference.

[0198] Another useful tool for inducing the uptake of exogenous nucleic acid by target cells is laser infection, which is a technique that involves exposing cells to electromagnetic radiation of a specific wavelength to gently permeabilize cells and allow polynucleotides to penetrate the cell membrane.This technique is described in detail, for example, in Rhodes et al. (Methods in Cell Biology 82:309,2007), the disclosure of which is incorporated herein by reference.

[0199] Microvesicles represent another potential vehicle that can be used to modify the genome of target cells according to the methods described herein. For example, microvesicles induced by the simultaneous overexpression of glycoprotein VSV-G and a genome-modifying protein, such as a nuclease, can be used to efficiently deliver proteins that subsequently catalyze the site-specific cleavage of endogenous polynucleotide sequences to cells, preparing the genome of the cell for the covalent integration of a target polynucleotide, such as a gene or regulatory sequence. The use of such vesicles, also known as gesicles, for the genetic modification of eukaryotic cells is described in detail, for example, in Quinn et al., Mol. Ther. 23: Supplement 1, Abstract No. 122, 2015.

[0200] C. Treatment method i. Therapeutic utility of codon-optimized gene sequences The codon optimization methods and protein production methods described herein may be applied to methods for treating a disease or condition in a subject in need thereof. In some embodiments, the treatment method may be a prophylactic treatment for a subject at risk for the disease or condition. In other embodiments, the treatment method may alleviate, reverse, ameliorate, stabilize, or improve the disease state or pathology in a subject. In other embodiments, the method may be used to alleviate, ameliorate, reduce, or reverse the clinical symptoms of a disease or condition.

[0201] In some embodiments, the therapeutic methods are intended to treat diseases or conditions resulting from a deficiency or defect in a single gene or a single gene product (e.g., a single polynucleotide or protein). In some embodiments, the therapeutic methods are intended to treat diseases or conditions resulting in a deficiency or defect in multiple gene products. In some embodiments, the deficiency or defect is defined by reduced expression, reduced activity, and / or abnormal localization of one or more gene products. In some embodiments, the gene product is delivered for transient expression. In other embodiments, the gene product is integrated into the host genome.

[0202] In some embodiments, treatment methods are intended to replace, complement, or replenish missing, defective (e.g., low expression levels), or deficient (e.g., mutated, loss-of-function, or low biological or catalytic activity) gene products in subjects with a disorder or condition. In some embodiments, the disorder or condition is characterized by a loss-of-function mutation or gene deletion. In other embodiments, the disorder or condition is acquired (e.g., a missing or deficient gene product due to stochastic or environmental factors). In some embodiments, the codon-optimized gene product encodes a polypeptide or protein identical to the wild-type amino acid sequence (i.e., retains 100% sequence identity) and replaces, complements, or replenishes low levels of one or more missing or deficient gene products. In other embodiments, the codon-optimized gene product encodes a polypeptide or protein that shares at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to the wild-type amino acid sequence that encodes a polypeptide or protein with improved biological function (e.g., increased catalytic function or reduced immunogenicity). Examples of how polypeptides or proteins may be modified to improve biological function include mutating or adding sites for post-translational modifications (e.g., glycosylation, phosphorylation, ubiquitination, nitrosylation, methylation, acetylation, lipidation, etc., or combinations thereof), mutating or adding cysteines to alter or add disulfide bonds, modifying binding sites to increase binding activity between a protein of interest and one or more known binding partners, modifying sites of protease binding or target cleavage, modifying signal sequences to enhance secretion or alter localization, among many other protein modifications known in the art.

[0203] In some embodiments, therapeutic methods are intended to increase or complement the expression of a normally expressed gene product (e.g., present at concentrations within an acceptable healthy range) in a subject suffering from a disorder or condition that would benefit from increased expression of said gene product, such as increasing the rate of an enzymatic reaction, enhancing the efficacy or speed of a signaling response (e.g., intracellular or extracellular), modulating the movement or adhesion of cells or cellular components, or modulating the binding or transient interaction (e.g., the affinity or K of two or more molecules). D Increasing expression of a normally expressed gene product may be desirable due to an increased likelihood or propensity for a disease (based on the occurrence of a gene mutation) or for the regulation of one or more biological processes. Such methods may be clinically useful for increasing expression of a protein that has a redundant function to a defective or deficient protein. Such methods may also be clinically useful for modulating disease-causing gene products that are logistically difficult to use as codon-optimized gene products for therapeutic purposes due to a variety of factors, including, but not limited to, large gene size, poor accessibility to target cells or tissues, and / or high immunogenicity of the gene product.

[0204] In some embodiments, therapeutic methods increase expression of a protein or polypeptide (e.g., upregulating or inducing expression of an exogenous protein or polypeptide) to regulate or control another causative agent underlying the disease. Such embodiments may be clinically useful for blocking, inhibiting, proteolyzing, mediating clearance, or otherwise attenuating the effects of an etiologic agent, such as a pathogen (e.g., a virus, bacteria, fungus, or parasite) or a proinflammatory protein (e.g., a cytokine or cytokine receptor).

[0205] In some embodiments, treatment with an effective amount of a codon-optimized gene product (e.g., a polynucleotide encoding a protein of interest, e.g., a transgene encoding a protein of interest packaged in an AAV) or a pharmaceutical composition comprising the same reduces expression of the gene product by about 5% to 50% (e.g., about 5%, about 10%, or more) compared to a reference sample, such as a biological sample from a healthy control subject or a biological sample from the same subject, prior to administration of the treatment. , about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, or about 50%, about 50% to 100% (about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%), or more than 100% (about 100%, about 125%, about 150%, about 175%, about 200%, about 225%, about 250%, about 275%, about 300%, or more). In some embodiments, treatment with an effective amount of a codon-optimized gene product (e.g., a polynucleotide encoding a protein of interest, e.g., a transgene encoding a protein of interest packaged in an AAV) increases expression of the gene product by about 1-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold, about 11-fold, about 12-fold, about 13-fold, about 14-fold, about 15-fold, about 16-fold, about 17-fold, about 18-fold, about 19-fold, about 20-fold, about 25-fold, about 30-fold, about 35-fold, about 40-fold, about 45-fold, about 50-fold, or more, as compared to a reference sample, such as a biological sample from a healthy control subject or a biological sample from the same subject prior to administration of the treatment. In any of the foregoing embodiments, treatment with an effective amount of a codon-optimized gene product may result in increased expression globally (e.g., in all organ systems or all tissues of a subject; e.g., throughout the body) or locally (e.g., in a subset of tissues, in one or more organs, or in one or more organ systems of interest).

[0206] In some embodiments, the therapeutic methods relate to the treatment of metabolic disorders, hematological disorders, cardiovascular disorders, neurological disorders, visual or ophthalmological disorders, reproductive disorders, infectious diseases, autoimmune or immunological disorders, or certain cancers. Exemplary diseases and target genes that may benefit from the methods and applications described herein are summarized in Table 2 below.

[0207] [Table 2-1]

[0208] [Table 2-2]

[0209] [Table 2-3]

[0210] [Table 2-4]

[0211] [Table 2-5]

[0212] [Table 2-6]

[0213] [Table 2-7]

[0214] [Table 2-8]

[0215] [Table 2-9]

[0216] Table 2-10

[0217] Table 2-11

[0218] Table 2-12

[0219] Table 2-13

[0220] Table 2-14

[0221] Table 2-15

[0222] Table 2-16

[0223] Table 2-17

[0224] Table 2-18

[0225] Table 2-19

[0226] [Table 2-20]

[0227] [Table 2-21]

[0228] [Table 2-22]

[0229] [Table 2-23]

[0230] [Table 2-24]

[0231] [Table 2-25]

[0232] ii. Administration of codon-optimized gene products The therapeutic method comprises delivering a codon-optimized gene product or a pharmaceutical composition comprising the same to a subject (e.g., a human) by any suitable route of administration (e.g., intramuscular, subcutaneous, intradermal, intravenous, intraperitoneal, intraarterial, intracerebroventricular, intranasal, intraorbital, intracranial, or intraosseous administration). In some embodiments, the therapeutic method comprises administering a codon-optimized gene product, or a pharmaceutical composition comprising the same, to a subject to produce a therapeutic effect. In some embodiments, the codon-optimized gene product or a pharmaceutical composition comprising the same is administered to a subject as monotherapy. In some embodiments, the codon-optimized gene product or a pharmaceutical composition comprising the same is administered to a subject as combination therapy with one or more additional therapies (e.g., 1, 2, 3, 4, or 5 additional therapeutic agents). In some embodiments, the combination therapy comprises delivering two or more (e.g., 2, 3, 4, 5, or more than 5) codon-optimized gene products or pharmaceutical compositions comprising the same to a subject. In some embodiments, the combination therapy involves delivering one or more codon-optimized gene products or pharmaceutical compositions containing same to a subject along with one or more additional therapeutic agents or other standard of care interventions for a particular disease or condition, in some embodiments, the combination therapy is administered to a subject to provide an additive or synergistic therapeutic effect.

[0233] The codon-optimized gene product or pharmaceutical composition containing the same may be administered at any suitable dose. The actual dose of the composition of the present disclosure administered to a patient can be determined by physical and physiological factors, such as body weight, severity of the condition, prior or concurrent therapeutic interventions, the patient's idiopathic disease, and the route of administration. Depending on the dose and route of administration, the preferred dose and / or the number of administrations of an effective amount may vary depending on the subject's response. In some embodiments, treatment is used to alleviate, slow, and / or inhibit the onset or progression of a disease or condition. In other embodiments, the method may be used to alleviate, ameliorate, reduce, or reverse clinical symptoms of a disease or condition. In some embodiments, the treatment method involves administering one or more codon-optimized gene products to a subject in a single dose. In some embodiments, the treatment method involves administering one or more codon-optimized gene products to a subject in multiple doses. Administration may be administered any suitable number of times per day, week, month, or year, and for as long as necessary. The subject may be an adult or a child, with or without comorbidities.

[0234] iii. Efficacy assessment To determine the effectiveness of the therapeutic methods described herein, it may be necessary to assess a subject's response to the treatment. The subject's response may be assessed in an inpatient or outpatient setting. The subject's response may be assessed one or more times after administration of one or more codon-optimized gene products or pharmaceutical compositions comprising same. The subject's response may be assessed continuously, either sporadically or at designated time points after administration of one or more codon-optimized gene products. The subject's response may be assessed, for example, 1 to 10 days after administration of one or more codon-optimized gene products (e.g., 7 to 10 days, 6 to 8 days, 5 to 7 days, 3 to 5 days, 2 to 4 days, 1 to 3 days, or less than 1 day after administration of one or more codon-optimized gene products; e.g., 10 days, 9 days, 8 days, 7 days, 6 days, 5 days, 4 days, 3 days, 2 days, 1 day, or less than 1 day after administration of one or more codon-optimized gene products). The subject's response may be assessed 1 to 12 weeks or later after administration of the one or more codon-optimized gene products (e.g., 10 to 12 weeks, 8 to 12 weeks, 6 to 12 weeks, 8 to 10 weeks, 6 to 10 weeks, 4 to 10 weeks, 6 to 8 weeks, 4 to 8 weeks, 2 to 8 weeks, 4 to 6 weeks, 2 to 6 weeks, 3 to 6 weeks, 2 to 4 weeks, 1 to 3 weeks, or 1 to 2 weeks after administration of the one or more codon-optimized gene products; e.g., 12 weeks or later, 12 weeks, 11 weeks, 10 weeks, 9 weeks, 8 weeks, 7 weeks, 6 weeks, 5 weeks, 4 weeks, 3 weeks, 2 weeks, or 1 week after administration of the one or more codon-optimized gene products). The subject's response may be assessed 1 to 12 months after administration of the one or more codon-optimized gene products (e.g., 10 to 12 months, 8 to 10 months, 6 to 8 months, 4 to 6 months, 3 to 5 months, 2 to 4 months, or 1 to 3 months after administration of the one or more codon-optimized gene products; e.g., 12 months, 11 months, 10 months, 9 months, 8 months, 7 months, 6 months, 5 months, 4 months, 3 months, 2 months, or 1 month after administration of the one or more codon-optimized gene products).The subject's response may be assessed 1 to 5 years or more after administration of the one or more codon-optimized gene products (e.g., 4 to 5 years, 3 to 5 years, 2 to 3 years, or 1 to 3 years after administration of the one or more codon-optimized gene products; e.g., 5 years or more, 5 years, 4 years, 3 years, 2 years, or 1 year after administration of the one or more codon-optimized gene products).

[0235] The effectiveness of a treatment method may be evaluated by comparing one or more indicators of a subject receiving treatment with a relevant control or reference. In some embodiments, the effectiveness of a treatment method is evaluated by comparing one or more indicators of a subject receiving treatment with one or more indicators of the same subject before treatment. In some embodiments, the effectiveness of a treatment method is evaluated by comparing one or more indicators of a subject receiving treatment with one or more indicators of another subject with the same disease or condition but not receiving treatment. In further embodiments, the effectiveness of a treatment method is evaluated by comparing one or more indicators of a subject receiving treatment with one or more indicators of a healthy subject (e.g., a subject without a disease or condition).

[0236] In some embodiments, the indicator is the expression level of a protein or polypeptide encoded by the codon-optimized gene product or its mRNA transcript. In some embodiments, the measure is the activity or biological function of the protein or polypeptide, where the protein is the same as or a different protein (e.g., a downstream protein, an effector protein, or a binding protein) from the protein encoded by the codon-optimized gene product. In some embodiments, the expression or activity of one or more proteins of interest is assessed by obtaining one or more biological samples from the subject and comparing the results with previous measurements of the subject and / or results of the subject measured before administering one or more codon-optimized gene products. In some embodiments, the expression or activity of one or more proteins of interest is detected by biological or analytical methods known in the art or described herein.

[0237] Depending on the effectiveness of the treatment administered to a subject, the treatment regimen may be modified over the course of treatment. The treatment regimen and its effectiveness may be determined by one skilled in the art (e.g., a physician, clinician, or medical professional). In some embodiments, the dose of one or more codon-optimized gene products or pharmaceutical compositions comprising same may be adjusted (e.g., decreased or increased) over the course of treatment. In some embodiments, the dose of one or more codon-optimized gene products or pharmaceutical compositions comprising same may be increased by about 10%, 25%, 50%, 75%, 100%, 125%, 150%, 175%, 200%, or more over the course of treatment. In some embodiments, the dose of one or more codon-optimized gene products or pharmaceutical compositions may be decreased by about 10%, 25%, 50%, 75%, or more than 75% over the course of treatment. In some embodiments, the frequency of administration of one or more codon-optimized gene products or pharmaceutical compositions may be increased or decreased over the course of treatment. In further embodiments, depending on the disease or condition and its standard of care, one or more additional therapies may be further added to the treatment plan.

[0238] III. Kit The compositions or methods described herein may be provided in kits for use in producing proteins or gene products. In some embodiments, the compositions and methods described herein may be provided in kits for use in treating a disease or condition. In some embodiments, the kits may include a package insert instructing a user of the kit to perform any one of the codon optimization methods described herein. In further embodiments, the kits may include a package insert instructing a user of the kit to perform any one of the treatment methods described herein. The kits may optionally include a syringe or device for administering the compositions of the present disclosure. In some embodiments, the kits may include one or more additional therapeutic agents. In some embodiments, the kits include one or more antibodies or binding molecules for detecting the expression or activity of a protein of interest. [Example]

[0239] Example 1. Determination of ZsGreen fluorescent protein yields by four different codon optimization methods This example describes the process of codon-optimizing a sequence encoding a ZsGreen fluorescent protein reporter using two common codon usage schemes and comparatively analyzing the resulting sequence and its protein production with or without a set of codon usage rules to reduce or eliminate the DRACH motif. The two common codon usage schemes are the "all-best" (also referred to herein as "AllBest") scheme, which refers to replacing one or more codons with synonymous codons with the highest usage frequency, and the "proportional usage" (also referred to herein as "AllProb") scheme, which refers to modifying a gene or codon sequence so that one or more codons are represented in proportion to their reported usage frequency. Exemplary codons and their usage frequencies are shown in Table 1. Codon usage rules (also referred to herein as "pRules") are a strategy for reducing m6A modifications through removal of the DRACH motif and are applied in this and subsequent examples after modifying the coding sequence using one of the described codon usage schemes. The codon usage rules, or pRules, are as follows: 1. Never use GAC for aspartic acid (D) 2. Never use GAA for glutamic acid (E) 3. Never use GGA for glycine (G) 4. Never use AAA for lysine (K) 5. Never use AAC for asparagine (N) 6. Always use ACG for threonine (T) In this example, when six codon usage rules were used, they were applied to every instance of the D, E, G, K, N, and T codons appearing in the coding sequence. This approach eliminated all DRACH motifs and altered many codons that were not involved in the m6A modification.

[0240] The open reading frame (ORF) of the ZsGreen DNA sequence after applying one or more codon optimization strategies to eliminate the DRACH motif is shown below: 1. ZsG ORF (SEQ ID NO: 1) after codon optimization using the overall best codon usage scheme >ZsG_AllBest ATGGCCCAGAGCAAGCACGGCCTGACCAAGGAGATGACCATGAAGTACCGGATGGAGGGCTGCGTGGACGGCCACAAGTTCGTGATCACCGGCGAGGGCATCGGCTACCCCTTCAAGGGCAAGCAGGCCATCAACCTGTGCGTGGTGGAGGGCGGCCCCCTGCCCTTCGCCGAG GACATCCTGAGCGCCGCCTTCATGTACGGCAACCGGGTGTTCACCGAGTACCCCCAGGACATCGTGGACTACTTCAAGAACAGCTGCCCCGCCGGCTACACCTGGGACCGGAGCTTCCTGTTCGAGGACGGCGCCGTGTGCATCTGCAACGCCGACATCACCGTGAGCGTGGAG GAGAACTGCATGTACCACGAGAGCAAGTTCTACGGCGTGAACTTCCCCGCCGACGGCCCCGTGATGAAGAAGATGACCGACAACTGGGAGCCCAGCTGCGAGAAGATCATCCCCGTGCCCAAGCAGGGCATCCTGAAGGGCGACGTGAGCATGTACCTGCTGCTGAAGGACGGC GGCCGGCTGCGGTGCCAGTTCGACACCGTGTACAAGGCCAAGAGCGTGCCCCGGAAGATGCCCGACTGGCACTTCATCCAGCACAAGCTGACCCGGGAGGACCGGAGCGACGCCAAGAACCAGAAGTGGCACCTGACCGAGCACGCCATCGCCAGCGGCAGCGCCTGCCCTGA 2. ZsG ORF (SEQ ID NO: 2) after codon optimization using the all-best codon usage scheme and subsequent application of the six codon usage rules >ZsG_ABpRules ATGGCCCAGAGCAAGCACGGCCTGACGAAGGAGATGACGATGAAGTACCGGATGGAGGGCTGCGTGGATGGCCACAAGTTCGTGATCACGGGCGAGGGCATCGGCTACCCCTTCAAGGGCAAGCAGGCCATCAATCTGTGCGTGGTGGAGGGCGGCCCCCTGCCCTTCGCCGAGGATATCCTGAGCGCCGCCTTCATGTACGGCAATCGGGTGTTCACGGAGTACCCCCAGGATATCGTGGATTACTTCAAGAATAGCTGCCCCGCCGGCTACACGTGGGATCGGAGCTTCCTGTTCGAGGATGGCGCCGTGTGCATCTGCAATGCCGATATCACGGTGAGCGTGGAGGAGAATTGCATGTACCACGAGAGCAAGTTCTACGGCGTGAATTTCCCCGCCGATGGCCCCGTGATGAAGAAGATGACGGATAATTGGGAGCCCAGCTGCGAGAAGATCATCCCCGTGCCCAAGCAGGGCATCCTGAAGGGCGATGTGAGCATGTACCTGCTGCTGAAGGATGGCGGCCGGCTGCGGTGCCAGTTCGATACGGTGTACAAGGCCAAGAGCGTGCCCCGGAAGATGCCCGATTGGCACTTCATCCAGCACAAGCTGACGCGGGAGGATCGGAGCGATGCCAAGAATCAGAAGTGGCACCTGACGGAGCACGCCATCGCCAGCGGCAGCGCCCTGCCCTGA 3. Codon-optimized ZsG ORF (SEQ ID NO: 3) using a codon usage scheme with a proportion >ZsG_AllProb ATGGCCCAGTCAAAACATGGACTCACTAAAGAGATGACCATGAAATACAGAATGGAGGGGTGCGTCGATGGTCACAAATTCGTCATCACCGGCGAGGGGATTGGATATCCATTCAAGGGAAAGCAGGCCATTAACCTGTGCGTCGTGGAAGGAGGACCACTGCCTTTCGCAGAA GATATCCTCAGTGCCGCATTCATGTATGGAAACAGGGTCTTCACTGAGTACCCACAGGATATTGTTGACTATTTTAAAAATTCTTGCCCAGCCGGCTATACATGGGACCGCTCCTTCCTCTTTGAAGACGGAGCGGTGTGTATCTGCAACGCAGATATCACAGTGTCCGTTGAG GAAAACTGCATGTATCACGAAAGCAAGTTCTATGGCGTGAATTTCCCTGCGGACGGGCCCGTTATGAAGAAGATGACAGACAATTGGGAGCCCAGTTGCGAGAAAATCATTCCAGTGCCCAAGCAGGGGATTCTCAAGGGCGACGTAAGCATGTACCTGCTGCTAAAGGATGGA GGTCGCTTACGCTGCCAGTTTGACACCGTCTATAAAGCCAAGAGCGTCCCCCGGAAGATGCCGACTGGCATTTTATCCAGCACAAGCTGACCCGTGAGGACAGGTCTGATGCCAAAAATCAGAAGTGGCACTTAACTGAGCATGCTATCGCAAGCGGATCAGCACTCCCGTGA 4. ZsG ORF (SEQ ID NO: 4) after codon optimization using the proportional usage codon usage scheme and subsequent application of the six codon usage rules >ZsG_APpRules ATGGCCCAGTCAAAGCATGGCCTCACGAAGGAGATGACGATGAAGTACAGAATGGAGGGGTGCGTCGATGGTCACAAGTTCGTCATCACGGCGAGGGGATTGGGTATCCATTCAAGGGCAAGCAGGCCATTAATCTGTGCGTCGTGGAGGGCGGCCCACTGCCTTTCGCAGAG GATATCCTCAGTGCCGCATTCATGTATGGCAATAGGGTCTTCACGGAGTACCCACAGGATATTGTTGATTATTTTAAGAATTCTTGCCCAGCCGGCTATACGTGGGATCGCTCCTTCCTCTTTGAGGATGGGGCGGTGTGTATCTGCAATGCAGATATCACGGTGTCCGTTGAG GAGAATTGCATGTATCACGAGAGCAAGTTCTATGGCGTGAATTTCCCTGCGGATGGGCCCGTTATGAAGAAGATGACGGATAATTGGGAGCCCAGTTGCGAGAAGATCATTCCAGTGCCCAAGCAGGGGATTCTCAAGGGCGATGTAAGCATGTACCTGCTGCTAAAGGATGGC GGTCGCTTACGCTGCCAGTTTGATACGGTCTATAAGGCCAAGAGCGTCCCCCGGAAGATGCCGATTGGCATTTTATCCAGCACAAGCTGACGCGTGAGGATAGGTCTGATGCCAAGAATCAGAAGTGGCACTTAACGGAGCATGCTATCGCAAGCGGTTCAGCACTCCCGTGA According to the codon optimization strategy, the number of DRACH motifs in the ZsGreen open reading frame was quantified, and the results are shown in Table 3 below.

[0241] [Table 3]

[0242] After quantifying the number of DRACH motifs, the resulting ORFs were aligned and compared to assess the differences between the codon optimization strategies, as shown below, where identical nucleotides are indicated with an asterisk (*) and polynucleotide sequence differences are indicated in bold and underlined.

[0243] 1. Alignment of ZsGreen ORF according to the overall best codon usage scheme without (SEQ ID NO: 1) and with (SEQ ID NO: 2) the six codon usage rules:

[0244] JPEG2026508559000029.jpg236170

[0245] 2. Alignment of ZsGreen ORF according to the codon usage scheme with proportional usage without (SEQ ID NO: 3) and with (SEQ ID NO: 4) the six codon usage rules:

[0246] JPEG2026508559000030.jpg225170

[0247] JPEG2026508559000031.jpg38170

[0248] Each of the four ZsGreen fluorescent protein ORFs was then commercially ordered as synthetic double-stranded DNA (dsDNA) fragments and cloned between the BamHI and EcoRI restriction enzyme sites of the plasmid pAAV ZsGreen1 (Figure 1). After verifying the sequence of the cloned plasmids by Sanger sequencing, the ZsGreen1 plasmid variants, along with a control pUC19 plasmid to equalize the total DNA amount, were transiently transfected into HEK293T cells in 24-well plates using Lipofectamine 3000 according to the manufacturer's instructions. The DNA transfection conditions are listed in Table 4 below.

[0249] [Table 4]

[0250] Two or three days after transfection, transfected HEK293 cells were harvested by trypsinization, and the relative protein production by each ORF variant in both transfection conditions was analyzed by flow cytometry, measuring relative ZsGreen fluorescence in the green channel. ORFs generated from the overall best codon usage scheme, with or without the six additional codon usage rules, were compared after transfection (Figure 2). ORFs generated from the proportional usage codon usage scheme, with or without the six additional codon usage rules, were also compared (Figure 3).

[0251] Example 2. Determination of GLP-1-Fc protein yield using a commercially available codon optimization web tool with or without reduced DRACH motif This example describes the process of codon-optimizing a sequence encoding the GLP-1-Fc protein using a commercially available web tool, followed by a comparative analysis of the resulting sequence and its protein production with and without a set of codon usage rules to reduce or eliminate the DRACH motif. The codon usage rules, or pRules, are as follows: 1. Never use GAC for aspartic acid (D) 2. Never use GAA for glutamic acid (E) 3. Never use GGA for glycine (G) 4. Never use AAA for lysine (K) 5. Never use AAC for asparagine (N) 6. Always use ACT for threonine (T)

[0252] In this example, the six codon usage rules are applied only to the observed DRACH motif, and not to all instances where the D, E, G, K, N, and T codons appear within the sequence. To generate a codon-optimized GLP1-Fc ORF for protein production, the amino acid sequence was entered into the IDT Codon Optimization web tool available on the Integrated DNA Technologies website. After entering the amino acid sequence, the ORF for GLP-1-Fc was generated and the DRACH motif was quantified. The ORF for GLP-1-Fc (SEQ ID NO: 5) generated by the IDT Codon Optimization web tool is shown below: >IDT ATGATCCCCGCAAAGGACATGGCGAAGGTAATGATTGTGATGCTGGCAATCTGCTTTCTGACTAAGTCAGACGGGAAGTCAGTTAAGAAGCGCCACGGCGAAGGCACCTTTACCAGTGATGTTAGCTCGTATCTGGAGGAACAGGCCGCCAAAGAGTTCATCGCCTGGCTCGTGAAGGGGGGAGGCGGAGGAGGTGGATCTGGGGGCGGTGGGTCCGGTGGTGGCGGCTCCGCGGAATCGAAATACGGCCCTCCTTGTCCACCATGCCCCGCTCCTGAAGCCGCAGGAGGACCCTCTGTCTTTCTCTTCCCACCTAAGCCTAAAGATACTCTTATGATAAGTCGAACCCCTGAGGTGACATGCGTGGTGGTCGATGTTTCACAGGAAGACCCTGAGGTCCAGTTCAACTGGTATGTTGATGGGGTAGAGGTACACAATGCCAAAACAAAGCCTAGAGAGGAACAGTTCAATAGCACATATCGCGTGGTTTCCGTGCTGACAGTGCTGCACCAGGACTGGCTCAACGGAAAGGAGTACAAGTGTAAGGTTAGCAACAAAGGCCTTCCAAGTTCGATAGAGAAGACAATCTCTAAAGCTAAGGGACAGCCTAGAGAGCCACAGGTTTACACTCTGCCCCCCAGTCAGGAGGAAATGACCAAAAACCAGGTCAGCCTGACTTGTCTGGTGAAGGGATTCTATCCATCAGATATTGCCGTCGAGTGGGAAAGCAATGGGCAGCCTGAGAATAATTACAAAACCACACCCCCCGTGCTGGATAGCGACGGCAGCTTTTTCCTATATTCCCGACTTACCGTTGACAAGTCCCGCTGGCAGGAAGGCAATGTGTTTTCTTGCAGTGTGATGCACGAGGCATTGCATAATCACTATACCCAGAAAAGCCTGAGCCTGTCCCTGGGGTGA A total of 19 DRACH motifs appeared in the GLP-1-Fc ORF. The ORF was then further modified according to six codon usage rules to modify the DRACH motifs. Following these rules, 18 DRACH motifs were removed by synonymous codon substitution. Due to cloning constraints, one DRACH motif in the sequence could not be altered and was left in the ORF without replacement. The resulting modified sequence (IDT-m6A) (SEQ ID NO: 6), in which all but one DRACH motif was removed from the IDT sequence, is shown below: >IDT-m6A ATGATCCCCGCAAAGGATATGGCGAAGGTAATGATTGTGATGCTGGCAATCTGCTTTCTGACGAAGTCAGACGGGAAGTCAGTTAAGAAGCGCCACGGCGAAGGCACCTTTACCAGTGATGTTAGCTCGTATCTGGAGGAGCAGGCCGCCAAAGAGTTCATCGCCTGGCTCGTGAAGGGGGGAGGCGGAGGAGGTGGATCTGGGGGCGGTGGGTCCGGTGGTGGCGGCTCCGCGGAATCGAAATACGGCCCTCCTTGTCCACCATGCCCCGCTCCTGAAGCCGCAGGAGGCCCCTCTGTCTTTCTCTTCCCACCTAAGCCTAAAGATACTCTTATGATAAGTCGAACGCCTGAGGTGACGTGCGTGGTGGTCGATGTTTCACAGGAGGATCCTGAGGTCCAGTTCAACTGGTATGTTGATGGGGTAGAGGTACACAATGCCAAGACGAAGCCTAGAGAGGAGCAGTTCAATAGCACATATCGCGTGGTTTCCGTGCTGACGGTGCTGCACCAGGATTGGCTCAACGGAAAGGAGTACAAGTGTAAGGTTAGCAACAAAGGCCTTCCAAGTTCGATAGAGAAGACGATCTCTAAAGCTAAGGGCCAGCCTAGAGAGCCACAGGTTTACACTCTGCCCCCCAGTCAGGAGGAAATGACGAAGAATCAGGTCAGCCTGACGTGTCTGGTGAAGGGATTCTATCCATCAGATATTGCCGTCGAGTGGGAAAGCAATGGGCAGCCTGAGAATAATTACAAGACGACACCCCCCGTGCTGGATAGCGACGGCAGCTTTTTCCTATATTCCCGACTTACCGTTGATAAGTCCCGCTGGCAGGAAGGCAATGTGTTTTCTTGCAGTGTGATGCACGAGGCATTGCATAATCACTATACCCAGAAAAGCCTGAGCCTGTCCCTGGGGTGA The resulting GLP1-Fc ORFs in which the DRACH motif was either left intact (IDT) (SEQ ID NO: 5) or removed after application of the six codon usage rules (IDT-m6A) (SEQ ID NO: 6) were compared and are shown below, with identical nucleotides indicated by an asterisk (*) and differences in polynucleotide sequence indicated in bold and underlined.

[0253] JPEG2026508559000033.jpg182170

[0254] JPEG2026508559000034.jpg201170

[0255] The two ORFs were ordered as synthetic dsDNA fragments and cloned between the BamHI and EcoRI restriction enzyme sites of the pAAV ZsGreen1 plasmid (Figure 1). After verifying the sequences of the cloned plasmids by Sanger sequencing, the plasmids containing the ORF variants, along with a control pUC19 plasmid (total DNA amount: 0.5 μg), were transiently transfected into HEK293T cells in 24-well plates using Lipofectamine 3000 according to the manufacturer's instructions. The DNA transfection conditions are listed in Table 5 below.

[0256] [Table 5]

[0257] Two days after transfection, cell culture supernatants were collected, and the amount of secreted GLP-1-Fc protein was quantified by ELISA. The detected concentration of GLP-1-Fc protein was more than five-fold increased in the samples with the DRACH motif reduced compared to the samples with codon optimization alone using the IDT web tool (Figure 4).

[0258] Example 3. Measurement of GLP-1-Fc protein production yield by AAV transduction after elimination of the DRACH motif This example describes the process of codon-optimizing a sequence encoding the GLP-1-Fc protein, following codon optimization whereby all amino acids within the ORF were coded with the most preferred codon (i.e., the most frequently used codon) in all cases. The codon-optimized ORF was then subjected to codon usage rules to eliminate the DRACH motif. The codon usage rules, or pRules, are as follows: 1. Never use GAC for aspartic acid (D) 2. Never use GAA for glutamic acid (E) 3. Never use GGA for glycine (G) 4. Never use AAA for lysine (K) 5. Never use AAC for asparagine (N) 6. Always use ACT for threonine (T) The codon-optimized ORF (designated CH) encoding GLP-1-Fc (SEQ ID NO: 7) contains 19 DRACH motifs and is shown below: >CH atgatccccgccaaggacatggccaaggtgatgatcgtgatgctggccatctgcttcctgaccaagtccgacggcaagtccgtgaagaagcgccacggcgagggcaccttcaccagcgacgtgtctagctacctggaggagcaggccgccaaggagttcatcgcctggctggtgaagggcggcggcggcggcggcggcagcggcggcggcggcagcggcggcggcggcagcgccgagagcaagtacggccccccctgccccccctgccccgcccccgaggccgccggcggccccagcgtgttcctgttcccccccaagcccaaggacaccctgatgatcagcaggacccccgaggtgacctgcgtggtggtggacgtgagccaggaggaccccgaggtgcagttcaactggtacgtggacggcgtggaggtgcacaacgccaagaccaagcccagggaggagcagttcaacagcacctacagggtggtgagcgtgctgaccgtgctgcaccaggactggctgaacggcaaggagtacaagtgcaaggtttctaacaagggcctgcccagcagcatcgagaagaccatcagcaaggccaagggccagcccagggagccccaggtgtacaccctgccccccagccaggaggagatgaccaagaaccaagttagcctgacctgcctggtgaagggcttctaccccagcgacatcgccgtggagtgggagagcaacggccagcccgagaacaactacaagaccaccccccccgtgctggacagcgacggcagcttcttcctgtacagccgactgaccgtggacaagagcaggtggcaggagggcaacgtgttcagctgcagcgtgatgcacgaggccctgcacaaccactacacccagaagagcctgagcctgagcctgggctga

[0259] The CH ORF was further modified by eliminating the DRACH motifs according to the six codon usage rules, resulting in 20 base pair substitutions and the removal of all 19 DRACH motifs present in the codon-optimized CH ORF. The further modified ORF encoding GLP-1-Fc (designated CH-m6A) (SEQ ID NO: 8) in which all DRACH motifs have been removed is shown below, with all modified base pairs shown in bold and underlined.

[0260] JPEG2026508559000036.jpg114170 An alignment of the codon-optimized GLP-1-Fc ORF(CH) (SEQ ID NO: 7) and the codon-optimized GLP-1-Fc ORF(CH-m6A) (SEQ ID NO: 8) from which the DRACH motif sequence has been removed is shown below, where identical nucleotides in the sequences are indicated with an asterisk (*), and in the CH-m6A sequence, the nucleotide portion containing the DRACH motif is shown as uppercase letters, and modified nucleotides are shown in bold and underlined.

[0261] JPEG2026508559000037.jpg69170

[0262] JPEG2026508559000038.jpg233170

[0263] JPEG2026508559000039.jpg45170

[0264] After verifying the polynucleotide sequences of the ORFs, the amino acid sequences encoded by each ORF were aligned to ensure that the GLP-1-Fc proteins retained 100% sequence identity after eliminating the DRACH motif within the ORFs. An alignment of the amino acid sequences from the CH ORF (SEQ ID NO: 9) and CH-m6a ORF (SEQ ID NO: 10) is shown below, with identical amino acids indicated by an asterisk (*) in the sequences.

[0265] JPEG2026508559000040.jpg136170

[0266] After confirming the polynucleotide and amino acid sequences, both the CH and CH-m6A GLP-1-Fc ORFs (SEQ ID NOs: 7 and 8) were ordered as synthetic dsDNA fragments and subsequently cloned into the pAAV ZsGreen1 plasmid between the BamHI and EcoRI restriction enzyme sites. The sequences of the cloned plasmids were verified by Sanger sequencing.

[0267] AAV9 vectors were then constructed from the CH and CH-m6A plasmids, and the IDT and IDT-m6A plasmids described in Example 2, by triple transfection into HEK293 cells using standard methods known in the art. The recovered AAV9.GLP-1Fc vectors were titered by qPCR to determine vector genome concentrations, and then transfected into HEK293 cells at 1 x 10 6 The cells were transfected with GLP-1-Fc protein at a multiplicity of infection (MOI) of 100 vector genomes / cell. Three days after protein transduction, the supernatants of HEK293 cell cultures were collected and the levels of secreted GLP-1-Fc protein were measured by ELISA.

[0268] The GLP-1-Fc protein levels in each sample were compared with those of the CH codon-optimized ORF sample (Figure 5). The CH-m6A sample, in which all DRACH motifs were removed from the codon-optimized CH ORF (SEQ ID NO: 8), showed a 3-fold increase in detectable GLP-1-Fc protein secretion compared to the CH sample using the CH ORF (SEQ ID NO: 7). The ORF (SEQ ID NO: 5) codon-optimized using the IDT codon optimization web tool showed a 1.3-fold increase in detectable GLP-1-Fc protein secretion compared to the CH sample. Furthermore, the IDT codon-optimized ORF (SEQ ID NO: 6), in which all but one DRACH motif was removed, showed a 6.8-fold increase in detectable GLP-1-Fc protein secretion compared to the CH sample.

[0269] Example 4. Evaluation of circulating GLP-1-Fc protein in vivo after AAV delivery This example illustrates the effect of different codon optimization methods described in Examples 2 and 3 on protein production in vivo.

[0270] In addition to the four AAV vectors prepared as described in Example 3, a native ORF encoding GLP-1-Fc (i.e., an ORF without any codon optimization methods applied) was generated based on the human GLP-1 gene sequence. The native GLP-1-Fc ORF (SEQ ID NO: 11) is shown below: >Natural ATGATACCTGCAAAAGACATGGCTAAAGTTATGATTGTCATGTTGGCAATTTGTTTTCTTACAAAATCGGATGGGAAATCTGTAAAGAAGCGGCATGGAGAAGGGACCTTTACCAGTGATGTAAGTTCTTATTTGGAAGAACAAGCTGCCAAGGAATTCATTGCTTGGCTGGTGAAAGGCGGAGGAGGGGGGGGGGGGTCAGGCGGAGGGGGCTCCGGAGGAGGAGGATCTGCAGAGTCCAAATATGGTCCCCCATGCCCACCATGCCCAGCACCTGAGGCTGCAGGGGGACCATCAGTCTTCCTGTTCCCCCCAAAACCCAAGGACACTCTCATGATCTCCCGGACCCCTGAGGTCACGTGCGTGGTGGTGGACGTGAGCCAGGAAGACCCCGAGGTCCAGTTCAACTGGTACGTGGATGGCGTGGAGGTGCATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTTCAACAGCACGTACCGTGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACTGGCTGAACGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGGCCTCCCGTCCTCCATCGAGAAAACCATCTCCAAAGCCAAAGGGCAGCCCCGAGAGCCACAGGTGTACACCCTGCCCCCATCCCAGGAGGAGATGACCAAGAACCAGGTCAGCCTGACCTGCCTGGTCAAAGGCTTCTACCCCAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGGAGAACAACTACAAGACCACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTACAGCAGGCTCACCGTGGACAAGAGCAGGTGGCAGGAGGGGAATGTCTTCTCATGCTCCGTGATGCATGAGGCTCTGCACAACCACTACACACAGAAGAGCCTCTCCCTGTCTCTGGGTTGA

[0271] Plasmids and AAV vectors encoding the native GLP-1-Fc sequence were generated and validated using the same methods as described in Example 3.

[0272] To test the in vivo protein production of the four described codon-optimized methods, each of the described GLP-1-Fc AAV vectors was administered at a low dose (1 × 10 per mouse). 9 genome copies (GC)) or high dose (1 × 10 per mouse 10 Mice were injected with either IgG or GC. Eight 8-week-old female rag mice were included in each vector and treatment group.

[0273] Each mouse received a single intramuscular injection of 10 μL of the GLP-1-Fc AAV vector in the leg. Serum samples were collected from the mice every two weeks for 60 days after injection. Muscle tissue at the injection site and liver samples were collected at necropsy, as these tissues were the primary organs for protein transduction after intramuscular AAV administration. Serum protein levels of GLP-1-Fc were assessed by ELISA, and GLP-1-Fc mRNA transcript levels in muscle and liver tissue homogenates were measured by qPCR.

[0274] In both treatment groups, the CH-m6A and CH codon-optimized AAV vectors produced the highest detectable serum GLP-1-Fc protein concentrations at all time points over 42 days (Figures 6A-6B). On day 14, serum GLP-1-Fc protein levels were lowest in samples containing vectors encoding the native sequence and highest in samples containing vectors encoding the CH codon-optimized sequence (CH-m6A) (SEQ ID NO: 8) with the DRACH motif removed. The vector encoding the CH-m6A sequence (SEQ ID NO: 8) produced 4.5-fold higher serum GLP-1-Fc protein concentrations compared to the vector encoding the native sequence (Figure 7).

[0275] To further evaluate the impact of the m6A modification (i.e., the presence of the DRACH motif) on protein production efficiency, we performed pairwise comparisons of detectable serum GLP-1-Fc protein levels based on the codon optimization strategy and dosing group 28 days after AAV vector administration (Figure 8A-D). Three of the four comparative experimental groups demonstrated increased serum GLP-1-Fc protein levels when the DRACH motif was removed. The IDT codon-optimized scheme after DRACH motif removal (SEQ ID NO: 6) resulted in a 3.6-fold increase in serum GLP-1-Fc protein levels compared to the IDT codon-optimized scheme alone (SEQ ID NO: 5) after low-dose injection of each AAV vector (Figure 8A). The CH codon-optimized scheme after DRACH motif removal (SEQ ID NO: 8) resulted in a 1.75-fold increase in serum GLP-1-Fc protein levels compared to the CH codon-optimized scheme alone (SEQ ID NO: 7) after low-dose injection of each AAV vector (Figure 8B). Similarly, at high doses, the IDT codon-optimized scheme after DRACH motif removal (SEQ ID NO: 6) resulted in a 2.0-fold increase in GLP-1-Fc protein levels compared to the ID codon-optimized scheme alone (SEQ ID NO: 5) (Figure 8D). However, no significant differences in serum GLP-1-Fc protein levels were observed with high-dose injections of either variation of the CH codon-optimized vector.

[0276] Similar trends were observed for GLP-1-Fc mRNA transcript levels in both muscle and liver tissues. In all groups except the low-dose CH codon-optimized vector, vectors with the DRACH motif removed after codon optimization yielded higher detectable GLP-1-Fc mRNA transcripts (Figures 9-10). The greatest difference in tissue GLP-1-Fc mRNA transcript expression was observed in muscle tissue after injection of the high-dose IDT codon-optimized vector, where removal of the DRACH motif from the codon-optimized ORF resulted in a 15.2-fold increase in detectable GLP-1-Fc mRNA levels after 60 days (Figure 9C). Collectively, these results demonstrate that removal of the DRACH motif can result in increased expression of both mRNA transcripts and protein after transduction.

[0277] Other embodiments All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.

[0278] While the invention has been described in relation to particular embodiments thereof, it will be understood that the invention is capable of further modifications, and this application is intended to cover any changes, uses, or adaptations which generally follow the principles of the invention and come within known or customary practice in the art to which the invention pertains, and which are applicable to the essential features hereinbefore set forth, including departures therefrom in accordance with the scope of the claims.

[0279] Other embodiments are within the scope of the following claims.

Claims

1. A method for codon optimization of a polynucleotide sequence encoding a polypeptide of interest, the method comprising replacing one or more nucleotides within a DRACH motif in the polynucleotide sequence with an equivalent amount of alternative nucleotides to eliminate the DRACH motif, wherein the substitution does not change the amino acid sequence of the encoded polypeptide.

2. 2. The method of claim 1, wherein the polynucleotide sequence comprises multiple DRACH motifs and the substitutions are made only within a subset of the DRACH motifs.

3. 3. The method of claim 2, wherein the substitutions are made only within DRACH motifs at least 10 nucleotides away from splice junction sites within the polynucleotide sequence.

4. 4. The method of claim 3, wherein the substitutions are made only within DRACH motifs at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, at least 200, or more nucleotides away from a splice junction site within the polynucleotide sequence.

5. 3. The method of claim 2, wherein the substitutions are made only within the DRACH motif that are about 10 to about 200 nucleotides, about 20 to about 190 nucleotides, about 30 to about 180 nucleotides, about 40 to about 170 nucleotides, about 50 to about 160 nucleotides, about 60 to about 150 nucleotides, about 70 to about 140 nucleotides, about 80 to about 130 nucleotides, about 90 to about 120 nucleotides, or about 100 nucleotides away from a splice junction site within the polynucleotide sequence.

6. 6. The method of any one of claims 1 to 5, wherein the substitution is made within a DRACH motif selected from the group consisting of AGACA, AGACT, GAACC, GAACT, GGACA, GGACT, TGACT, AAACA, AAAC, AAAC, AGACC, GAACA, GGACC, TAACA, TAACC, TAACT, TGACA, and TGACC.

7. 7. The method of claim 6, wherein the substitution is made within a DRACH motif selected from the group consisting of AGACA, AGACT, GAACC, GAACT, GGACA, GGACT, and TGACT.

8. The substitution of the one or more nucleotides within the DRACH motif is performed by (a) in eliminating the DRACH motif, the codon GAC is never used to code for aspartic acid; (b) in eliminating the DRACH motif, the codon GAA is never used to code for glutamic acid; (c) in eliminating the DRACH motif, the codon GGA is never used to code for glycine; (d) never using the codon AAA to code for lysine when eliminating the DRACH motif; (e) never using the codon AAC to code for asparagine when eliminating the DRACH motif; and / or (f) always using the codon ACG to code for threonine when eliminating the DRACH motif. The method of any one of claims 1 to 7, carried out using one or more codon usage guidelines selected from the group consisting of:

9. The codon optimization comprises: (a) the codon GAC is never used to code for aspartic acid throughout said polynucleotide sequence; (b) the codon GAA is never used to code for glutamic acid throughout said polynucleotide sequence; (c) the codon GGA is never used to code for glycine throughout said polynucleotide sequence; (d) the codon AAA is never used to code for lysine throughout said polynucleotide sequence; (e) never using the codon AAC to code for asparagine throughout said polynucleotide sequence; and / or (f) consistently using the codon ACG to code for threonine throughout said polynucleotide sequence; 9. The method of any one of claims 1 to 8, further comprising enforcing throughout said polynucleotide sequence one or more codon usage guidelines selected from the group consisting of:

10. 10. The method of any one of claims 1 to 9, wherein prior to the substitution of the one or more nucleotides within the DRACH motif, the polynucleotide sequence has been codon-optimized by replacing one or more nucleotides within a codon with an equivalent amount of alternative nucleotides that constitute a synonymous codon that naturally occurs more frequently in a target organism compared to the frequency of the unmodified codon in the target organism.

11. 11. The method of any one of claims 1 to 10, wherein prior to the substitution of the one or more nucleotides within the DRACH motif, the polynucleotide sequence has been codon-optimized by replacing one or more codons within the polynucleotide sequence with equivalent synonymous codons that naturally occur at a higher frequency in a target organism compared to the frequency of one or more unmodified codons in the target organism.

12. 12. The method of claim 10 or 11, wherein the target organism is a mammal, optionally wherein the mammal is a human.

13. 13. The method of any one of claims 1 to 12, wherein prior to the substitution of the one or more nucleotides within the DRACH motif, the polynucleotide sequence has been codon-optimized by a codon optimization web tool, codon optimization software, quantum computing, a heuristic scoring method, a neural network, or a combination thereof.

14. 14. The method of any one of claims 1 to 13, wherein prior to the substitution of the one or more nucleotides within the DRACH motif, the polynucleotide sequence is codon-optimized by adjusting polynucleotide guanine-cytosine (GC) content, polynucleotide secondary structure, mRNA motif, ribosome binding site, and / or translation rate.

15. The method of claim 14, wherein the polynucleotide GC content is adjusted to 50% to 80%.

16. The method of claim 15, wherein the polynucleotide GC content is adjusted to 65% to 75%.

17. 17. The method of any one of claims 1 to 16, wherein after the substitution of the one or more nucleotides within the DRACH motif, the codon optimization method further comprises substituting an equivalent amount of alternative nucleotides within the codon that constitute a synonymous codon that naturally occurs more frequently in a target organism compared to the frequency of the unmodified codon in the target organism.

18. 17. The method of any one of claims 1 to 16, wherein after the substitution of the one or more nucleotides within the DRACH motif, the codon optimization method further comprises replacing one or more codons in the polynucleotide sequence with equivalent synonymous codons that naturally occur at a higher frequency in a target organism compared to the frequency of one or more unmodified codons in the target organism.

19. 19. The method of claim 17 or 18, wherein the target organism is a mammal, optionally wherein the mammal is a human.

20. 20. The method of any one of claims 1 to 19, wherein after the substitution of the one or more nucleotides within the DRACH motif, the codon optimization method further comprises codon optimization by a codon optimization web tool, codon optimization software, quantum computing, a heuristic scoring method, a neural network, or a combination thereof.

21. 21. The method of any one of claims 1 to 20, wherein after the substitution of the one or more nucleotides within the DRACH motif, the codon optimization method further comprises adjusting polynucleotide GC content, polynucleotide secondary structure, mRNA motif, ribosome binding site, and / or translation rate.

22. 22. The method of claim 21, wherein the polynucleotide GC content is adjusted to 50% to 80%.

23. 23. The method of claim 22, wherein the polynucleotide GC content is adjusted to 65% to 75%.

24. 24. The method of any one of claims 1 to 23, wherein the amino acid sequence of the protein or polypeptide shares at least 85% sequence identity with the wild-type amino acid sequence of the protein or polypeptide after codon optimization.

25. 25. The method of any one of claims 1 to 24, wherein the amino acid sequence of the protein or polypeptide shares 100% sequence identity with the wild-type amino acid sequence of the protein or polypeptide after codon optimization.

26. 26. The method of any one of claims 1 to 25, wherein the number of DRACH motifs in the polynucleotide sequence is reduced by at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, or at least 10% compared to a corresponding polynucleotide sequence not subjected to the method.

27. 27. The method of claim 26, wherein the number of DRACH motifs in the polynucleotide sequence is reduced by 100% compared to a corresponding polynucleotide sequence not subjected to the method.

28. 28. The method of any one of claims 1 to 27, wherein the codon optimization method increases the stability or half-life of the mRNA transcript.

29. 29. The method of claim 28, wherein the increased stability or half-life of the mRNA transcript is assessed by an increase in concentration or relative abundance compared to a corresponding polynucleotide sequence that has not been subjected to the method.

30. 30. The method of claim 29, wherein the increase in concentration or relative abundance of said mRNA transcript as compared to a native mRNA transcript of said polynucleotide sequence is measured by RT-PCR, fluorimetry, colorimetry, spectrophotometry, flow cytometry, in situ hybridization, Northern blot analysis, or an array using one or more hybridizing oligonucleotides or antibodies against said mRNA transcript of interest.

31. 29. The method of claim 28, wherein the increased stability or half-life of the mRNA transcript is assessed by a decreased decay rate detected by one or more pulse-chase techniques.

32. 32. The method of claims 1-31, wherein reducing the number of DRACH motifs in the polynucleotide sequence reduces the number of N(6)-methyladenosine (m6A) modifications in mRNA transcripts compared to a corresponding polynucleotide sequence not subjected to the method.

33. 33. The method of any one of claims 1 to 32, wherein the codon optimization method increases the expression or stability of a protein compared to the protein encoded by a corresponding polynucleotide sequence that has not been subjected to the method.

34. The method of any one of claims 26 to 33, wherein the corresponding polynucleotide sequence is a wild-type polynucleotide sequence.

35. 35. The method of claim 33 or 34, wherein the expression or stability of the protein is increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, or more than 100% compared to a corresponding polynucleotide sequence not subjected to the method.

36. 36. The method of any one of claims 33-35, wherein the expression or stability of the protein is increased by about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold, about 15-fold, about 20-fold, about 25-fold, about 30-fold, about 35-fold, about 40-fold, about 45-fold, about 50-fold, or more than 50-fold, compared to a corresponding polynucleotide sequence that has not been subjected to the method.

37. 37. The method of any one of claims 33 to 36, wherein the increase in protein expression is measured by mass spectrometry, Western blot analysis, enzyme-linked immunosorbent assay (ELISA), immunoprecipitation, flow cytometry, fluorimetry, colorimetry, spectrophotometry, or an array using aptamers or antibodies against the protein of interest.

38. A polynucleotide produced by the method of any one of claims 1 to 37.

39. A method for delivering a polynucleotide sequence encoding a polypeptide to a host cell, the method comprising: (i) replacing one or more nucleotides of a DRACH motif in the polynucleotide sequence with an equivalent amount of alternative nucleotides to eliminate the DRACH motif, wherein the substitution does not change the amino acid sequence of the encoded polypeptide; and (ii) providing the resulting polynucleotide sequence to the host cell.

40. A method for expressing an mRNA transcript in a host cell from a polynucleotide sequence encoding a polypeptide, the method comprising: (i) replacing one or more nucleotides of a DRACH motif in the polynucleotide sequence with an equivalent amount of alternative nucleotides to eliminate the DRACH motif, wherein the substitution does not change the amino acid sequence of the encoded polypeptide; and (ii) providing the polynucleotide sequence to the host cell.

41. A method for expressing a protein in a host cell from a polynucleotide sequence encoding the protein, the method comprising: (i) replacing one or more nucleotides of a DRACH motif in the polynucleotide sequence with an equivalent amount of alternative nucleotides to eliminate the DRACH motif, wherein the substitution does not change the amino acid sequence of the encoded protein; and (ii) providing the polynucleotide sequence to the host cell.

42. A method for delivering a polynucleotide sequence encoding a polypeptide to a subject, the method comprising: (i) replacing one or more nucleotides of a DRACH motif in the polynucleotide sequence with an equivalent amount of alternative nucleotides to eliminate the DRACH motif, wherein the substitution does not change the amino acid sequence of the encoded polypeptide; and (ii) providing the resulting polynucleotide sequence to the subject.

43. A method for expressing an mRNA transcript in a subject from a polynucleotide sequence encoding a polypeptide, the method comprising: (i) replacing one or more nucleotides of a DRACH motif in the polynucleotide sequence with an equivalent amount of alternative nucleotides to eliminate the DRACH motif, wherein the substitution does not change the amino acid sequence of the encoded polypeptide; and (ii) providing the polynucleotide sequence to the subject.

44. A method for expressing a protein in a subject from a polynucleotide sequence encoding the protein, the method comprising: (i) replacing one or more nucleotides of a DRACH motif in the polynucleotide sequence with an equivalent amount of alternative nucleotides to eliminate the DRACH motif, wherein the substitution does not change the amino acid sequence of the encoded protein; and (ii) providing the polynucleotide sequence to the subject.

45. 45. The method of any one of claims 39 to 44, wherein the substitution is made within a DRACH motif selected from the group consisting of AGACA, AGACT, GAACC, GAACT, GGACA, GGACT, TGACT, AAACA, AAAC, AAAC, AGACC, GAACA, GGACC, TAACA, TAACC, TAACT, TGACA, and TGACC.

46. 46. ​​The method of claim 45, wherein the substitution is made within a DRACH motif selected from the group consisting of AGACA, AGACT, GAACC, GAACT, GGACA, GGACT, and TGACT.

47. The substitution of the one or more nucleotides within the DRACH motif is performed by (a) in eliminating the DRACH motif, the codon GAC is never used to code for aspartic acid; (b) in eliminating the DRACH motif, the codon GAA is never used to code for glutamic acid; (c) in eliminating the DRACH motif, the codon GGA is never used to code for glycine; (d) never using the codon AAA to code for lysine when eliminating the DRACH motif; (e) never using the codon AAC to code for asparagine when eliminating the DRACH motif; and / or (f) always using the codon ACG to code for threonine when eliminating the DRACH motif.

47. The method of any one of claims 39 to 46, carried out using one or more codon usage guidelines selected from the group consisting of:

48. The codon optimization comprises: (a) never using the codon GAC for aspartic acid throughout said polynucleotide sequence; (b) never using the codon GAA for glutamic acid throughout said polynucleotide sequence; (c) never using the codon GGA for glycine throughout said polynucleotide sequence; (d) never using the codon AAA for lysine throughout said polynucleotide sequence; (e) never using the codon AAC for asparagine throughout said polynucleotide sequence; and / or (f) consistently using the codon ACG for threonine throughout said polynucleotide sequence.

48. The method of any one of claims 39 to 47, further comprising enforcing throughout said polynucleotide sequence one or more codon usage guidelines selected from the group consisting of:

49. 49. The method of any one of claims 39-48, wherein prior to the substitution of the one or more nucleotides within the DRACH motif, the polynucleotide sequence has been codon-optimized by replacing one or more nucleotides within a codon with an equivalent alternative nucleotide that constitutes a synonymous codon that naturally occurs more frequently in a target organism compared to the frequency of the unmodified codon in the target organism.

50. 50. The method of any one of claims 39-49, wherein prior to said substitution of said one or more nucleotides within said DRACH motif, said polynucleotide sequence has been codon-optimized by replacing one or more codons within said polynucleotide sequence with equivalent synonymous codons that naturally occur at a higher frequency in a target organism compared to the frequency of one or more unmodified codons in said target organism.

51. 51. The method of claim 49 or 50, wherein the target organism is a mammal, optionally wherein the mammal is a human.

52. 52. The method of any one of claims 39-51, wherein prior to said substitution of said one or more nucleotides within said DRACH motif, said polynucleotide sequence has been codon-optimized by a codon optimization web tool, codon optimization software, quantum computing, heuristic scoring methods, neural networks, or a combination thereof.

53. 53. The method of any one of claims 39-52, wherein prior to the substitution of the one or more nucleotides within the DRACH motif, the polynucleotide sequence is codon-optimized by adjusting polynucleotide GC content, polynucleotide secondary structure, mRNA motif, ribosome binding site, and / or translation rate.

54. 54. The method of claim 53, wherein the polynucleotide GC content is adjusted to between 50% and 80%.

55. 55. The method of claim 54, wherein the polynucleotide GC content is adjusted to between 65% and 75%.

56. 56. The method of any one of claims 39-55, wherein after the substitution of the one or more nucleotides within the DRACH motif, the method further comprises substituting one or more nucleotides within the codon with an equivalent amount of alternative nucleotides that constitute a synonymous codon that naturally occurs at a higher frequency in the target organism compared to the frequency of the unmodified codon in the target organism.

57. 57. The method of any one of claims 39-56, wherein after said substitution of said one or more nucleotides within said DRACH motif, said method further comprises replacing one or more codons in said polynucleotide sequence with equivalent synonymous codons that naturally occur at a higher frequency in a target organism compared to the frequency of occurrence of one or more unmodified codons in said target organism.

58. 58. The method of claim 56 or 57, wherein the target organism is a mammal, optionally wherein the mammal is a human.

59. 59. The method of any one of claims 39-58, wherein after said substitution of said one or more nucleotides within said DRACH motif, said method further comprises codon optimization by a codon optimization web tool, codon optimization software, quantum computing, heuristic scoring methods, neural networks, or combinations thereof.

60. 60. The method of any one of claims 39-59, wherein after the substitution of the one or more nucleotides within the DRACH motif, the codon optimization method further comprises adjusting polynucleotide GC content, polynucleotide secondary structure, mRNA motif, ribosome binding site, and / or translation rate.

61. 61. The method of claim 60, wherein the polynucleotide GC content is adjusted to between 50% and 80%.

62. 62. The method of claim 61, wherein the polynucleotide GC content is adjusted to between 65% and 75%.

63. 63. The method of any one of claims 39 to 62, wherein the amino acid sequence of the protein or polypeptide shares at least 85% sequence identity with the wild-type amino acid sequence of the protein or polypeptide after codon optimization.

64. 64. The method of any one of claims 39 to 63, wherein the amino acid sequence of the protein or polypeptide shares 100% sequence identity with the wild-type amino acid sequence of the protein or polypeptide after codon optimization.

65. 65. The method of any one of claims 39-64, wherein the number of DRACH motifs in the polynucleotide sequence is reduced by at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, or at least 10% compared to a corresponding polynucleotide sequence not subjected to the method.

66. 66. The method of claim 65, wherein the number of DRACH motifs in the polynucleotide sequence is reduced by 100% compared to a corresponding polynucleotide sequence not subjected to the method.

67. 67. The method of any one of claims 39 to 66, wherein the method increases the stability or half-life of an mRNA transcript.

68. 68. The method of Claim 67, wherein the increased stability or half-life of the mRNA transcript is assessed by an increase in concentration or relative abundance compared to a corresponding polynucleotide sequence that has not been subjected to the method.

69. 69. The method of Claim 68, wherein the increase in concentration or relative abundance of said mRNA transcript as compared to a naturally occurring mRNA transcript of said polynucleotide sequence is measured by RT-PCR, fluorimetry, colorimetry, spectrophotometry, flow cytometry, in situ hybridization, Northern blot analysis, or an array using one or more hybridizing oligonucleotides or antibodies to said mRNA transcript of interest.

70. 68. The method of claim 67, wherein the increased stability or half-life of the mRNA transcript is assessed by a decreased decay rate as detected by one or more pulse-chase techniques.

71. 71. The method of any one of claims 39-70, wherein reducing the number of DRACH motifs in the polynucleotide sequence reduces the number of N(6)-methyladenosine (m6A) modifications in mRNA transcripts compared to a corresponding polynucleotide sequence not subjected to the method.

72. 72. The method of any one of claims 39 to 71, wherein the method increases the expression or stability of a protein compared to the protein encoded by a corresponding polynucleotide sequence that has not been subjected to the method.

73. 73. The method of any one of claims 65 to 72, wherein the corresponding polynucleotide sequence is a wild-type polynucleotide sequence.

74. 74. The method of claim 72 or 73, wherein the expression or stability of the protein is increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, or more than 100% compared to a corresponding polynucleotide sequence not subjected to the method.

75. 75. The method of any one of claims 72-74, wherein expression or stability of the protein is increased by about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold, about 15-fold, about 20-fold, about 25-fold, about 30-fold, about 35-fold, about 40-fold, about 45-fold, about 50-fold, or more than 50-fold, compared to a corresponding polynucleotide sequence that has not been subjected to the method.

76. 76. The method of any one of claims 72 to 75, wherein the increase in protein expression is measured by mass spectrometry, Western blot analysis, enzyme-linked immunosorbent assay (ELISA), immunoprecipitation, flow cytometry, fluorimetry, colorimetry, spectrophotometry, or an array using aptamers or antibodies against the protein of interest.

77. 77. The method of any one of claims 39-41 and 45-76, wherein the polynucleotide is delivered to the host cell by contacting the host cell with a vehicle comprising the polynucleotide.

78. 77. The method of any one of claims 42 to 76, wherein the polynucleotide is delivered to the subject by administering to the subject a vehicle comprising the polynucleotide.

79. 79. The method of claim 77 or 78, wherein the vehicle is selected from the group consisting of a lipid nanoparticle, a liposome, a viral genome, and a viral vector.

80. 80. The method of claim 79, wherein the viral vector is an adeno-associated virus (AAV), an adenovirus, a retrovirus, or a lentivirus.

81. The method of any one of claims 77 to 80, wherein the viral vector is AAV.

82. 82. The method of claim 81, wherein the AAV is pseudotyped.

83. 83. The method of claim 81 or 82, wherein the AAV comprises inverted terminal repeat (ITR) sequences and capsid proteins from different serotypes.

84. 84. The method of any one of claims 39-41 and 45-83, wherein said delivering to said host cell is effected in vivo, in vitro, or ex vivo.

85. 84. The method of any one of claims 42-83, wherein said delivering to said subject is effected by (i) administering said polynucleotide to said subject in vivo, or (ii) expressing said polynucleotide ex vivo in a host cell followed by administering said host cell to said subject.

86. 86. The method of any one of claims 1 to 85, wherein the method is used to treat a subject suffering from or at risk of suffering from a disease characterized by underexpression or underactivity of a protein.

87. A method for treating a subject suffering from or at risk of developing a disease, the method comprising: (i) replacing one or more nucleotides of a DRACH motif in a polynucleotide sequence encoding a polypeptide associated with the disease with an equivalent amount of alternative nucleotides to eliminate the DRACH motif, wherein the substitution does not change the amino acid sequence of the encoded polypeptide; and (ii) administering the polynucleotide sequence to the subject.

88. A method for treating a subject suffering from or at risk of developing a disease, the method comprising administering to the subject a polynucleotide sequence encoding a polypeptide associated with the disease, wherein prior to said administration, one or more nucleotides of a DRACH motif in said polynucleotide sequence have been replaced with an equivalent amount of alternative nucleotides to eliminate said DRACH motif, and said substitution does not change the amino acid sequence of the encoded polypeptide.

89. 89. The method of claim 87 or 88, wherein the substitution is made within a DRACH motif selected from the group consisting of AGACA, AGACT, GAACC, GAACT, GGACA, GGACT, TGACT, AAACA, AAAC, AAAC, AGACC, GAACA, GGACC, TAACA, TAACC, TAACT, TGACA, and TGACC.

90. 90. The method of claim 89, wherein the substitution is made within a DRACH motif selected from the group consisting of AGACA, AGACT, GAACC, GAACT, GGACA, GGACT, and TGACT.

91. The substitution of the one or more nucleotides within the DRACH motif is performed by (a) in eliminating the DRACH motif, the codon GAC is never used to code for aspartic acid; (b) in eliminating the DRACH motif, the codon GAA is never used to code for glutamic acid; (c) in eliminating the DRACH motif, the codon GGA is never used to code for glycine; (d) never using the codon AAA to code for lysine when eliminating the DRACH motif; (e) never using the codon AAC to code for asparagine when eliminating the DRACH motif; and / or (f) always using the codon ACG to code for threonine when eliminating the DRACH motif.

91. The method of any one of claims 87 to 90, performed using one or more codon usage guidelines selected from the group consisting of:

92. Prior to said administration, said polynucleotide sequence is (a) the codon GAC is never used to code for aspartic acid throughout said polynucleotide sequence; (b) the codon GAA is never used to code for glutamic acid throughout said polynucleotide sequence; (c) the codon GGA is never used to code for glycine throughout said polynucleotide sequence; (d) the codon AAA is never used to code for lysine throughout said polynucleotide sequence; (e) never using the codon AAC to code for asparagine throughout said polynucleotide sequence; and / or (f) consistently using the codon ACG to code for threonine throughout said polynucleotide sequence; 92. The method of any one of claims 87 to 91, wherein the polynucleotide sequence has been codon-optimized throughout by a method comprising implementing one or more codon usage guidelines selected from the group consisting of:

93. 93. The method of any one of claims 87-92, wherein prior to said substitution of said one or more nucleotides within said DRACH motif, said polynucleotide sequence has been codon-optimized by replacing one or more nucleotides within a codon with an equivalent amount of alternative nucleotides that constitute a synonymous codon that naturally occurs more frequently in a target organism compared to the frequency of the unmodified codon in said target organism.

94. 94. The method of any one of claims 87-93, wherein prior to said substitution of said one or more nucleotides within said DRACH motif, said polynucleotide sequence has been codon-optimized by replacing one or more codons within said polynucleotide sequence with equivalent synonymous codons that naturally occur at a higher frequency in a target organism compared to the frequency of one or more unmodified codons in said target organism.

95. 95. The method of claim 93 or 94, wherein the target organism is a mammal, optionally wherein the mammal is a human.

96. 96. The method of any one of claims 87-95, wherein prior to said substitution of said one or more nucleotides within said DRACH motif, said polynucleotide sequence has been codon-optimized by a codon optimization web tool, codon optimization software, quantum computing, heuristic scoring methods, neural networks, or a combination thereof.

97. 99. The method of any one of claims 87-98, wherein prior to said substitution of said one or more nucleotides within said DRACH motif, said polynucleotide sequence is codon-optimized by adjusting polynucleotide guanine-cytosine (GC) content, polynucleotide secondary structure, mRNA motif, ribosome binding site, and / or translation rate.

98. 98. The method of claim 97, wherein the polynucleotide GC content is adjusted to between 50% and 80%.

99. 99. The method of claim 98, wherein the polynucleotide GC content is adjusted to between 65% and 75%.

100. 100. The method of any one of claims 87-99, wherein after the substitution of the one or more nucleotides within the DRACH motif, the method further comprises substituting one or more nucleotides within the codon with an equivalent amount of alternative nucleotides that constitute a synonymous codon that naturally occurs at a higher frequency in the target organism compared to the frequency of the unmodified codon in the target organism.

101. 101. The method of any one of claims 87-100, wherein after said substitution of said one or more nucleotides within said DRACH motif, said method further comprises substituting one or more codons in said polynucleotide sequence with equivalent synonymous codons that naturally occur at a higher frequency in a target organism compared to the frequency of occurrence of one or more unmodified codons in said target organism.

102. 102. The method of claim 100 or 101, wherein the target organism is a mammal, optionally wherein the mammal is a human.

103. 103. The method of any one of claims 87-102, wherein after said substitution of said one or more nucleotides within said DRACH motif, said method further comprises codon optimization by a codon optimization web tool, codon optimization software, quantum computing, heuristic scoring methods, neural networks, or combinations thereof.

104. 104. The method of any one of claims 87-103, wherein after the substitution of the one or more nucleotides within the DRACH motif, the method further comprises adjusting the polynucleotide GC content, polynucleotide secondary structure, mRNA motif, ribosome binding site, and / or translation rate.

105. The method of claim 104, wherein the polynucleotide GC content is adjusted to between 50% and 80%.

106. 106. The method of claim 105, wherein the polynucleotide GC content is adjusted to between 65% and 75%.

107. 107. The method of any one of claims 87 to 106, wherein the amino acid sequence of the protein or polypeptide shares at least 85% sequence identity with the wild-type amino acid sequence of the protein or polypeptide after codon optimization.

108. 108. The method of any one of claims 87 to 107, wherein the amino acid sequence of the protein or polypeptide shares 100% sequence identity with the wild-type amino acid sequence of the protein or polypeptide after codon optimization.

109. 109. The method of any one of claims 87-108, wherein the number of DRACH motifs in the polynucleotide sequence is reduced by at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, or at least 10% compared to a corresponding polynucleotide sequence not subjected to the method.

110. 110. The method of claim 109, wherein the number of DRACH motifs in said polynucleotide sequence is reduced by 100% compared to a corresponding polynucleotide sequence not subjected to said method.

111. 111. The method of any one of claims 87 to 110, wherein said method increases the stability or half-life of an mRNA transcript.

112. 112. The method of claim 111, wherein the increased stability or half-life of the mRNA transcript is assessed by an increase in concentration or relative abundance compared to a reference.

113. 113. The method of Claim 112, wherein the increase in concentration or relative abundance of said mRNA transcript as compared to a naturally occurring mRNA transcript of said polynucleotide sequence is measured by RT-PCR, fluorimetry, colorimetry, spectrophotometry, flow cytometry, in situ hybridization, Northern blot analysis, or an array using one or more hybridizing oligonucleotides or antibodies to said mRNA transcript of interest.

114. 114. The method of claims 87-113, wherein reducing the number of DRACH motifs in the polynucleotide sequence reduces the number of N(6)-methyladenosine (m6A) modifications in mRNA transcripts compared to a corresponding polynucleotide sequence not subjected to the method.

115. 115. The method of any one of claims 87 to 114, wherein the method increases protein expression or stability compared to a reference.

116. 116. The method of any one of claims 109 to 115, wherein the corresponding polynucleotide sequence is a wild-type polynucleotide sequence.

117. The method of any one of claims 112 to 116, wherein the reference is a sample taken from a subject not receiving treatment or a sample taken from the subject prior to treatment.

118. 118. The method of any one of claims 115-117, wherein expression or stability of the protein is increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, or more than 100% compared to a reference.

119. 119. The method of any one of claims 115-118, wherein the expression or stability of the protein is increased by about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold, about 15-fold, about 20-fold, about 25-fold, about 30-fold, about 35-fold, about 40-fold, about 45-fold, about 50-fold, or more than 50-fold as compared to a reference.

120. 120. The method of any one of claims 115 to 119, wherein the increase in protein expression is measured by mass spectrometry, Western blot analysis, enzyme-linked immunosorbent assay (ELISA), immunoprecipitation, flow cytometry, fluorimetry, colorimetry, spectrophotometry, or arrays using aptamers or antibodies against the protein of interest.

121. 121. The method of any one of claims 87 to 120, wherein the polynucleotide is administered to the subject by contacting the subject with a vehicle comprising the polynucleotide.

122. 122. The method of claim 121, wherein the vehicle is selected from a lipid nanoparticle, a liposome, a viral genome, and a viral vector.

123. 123. The method of claim 122, wherein the viral vector is an adeno-associated virus (AAV), an adenovirus, a retrovirus, a lentivirus, or a double-stranded DNA virus.

124. 124. The method of claim 122 or 123, wherein the viral vector is AAV.

125. 125. The method of claim 124, wherein the AAV is pseudotyped.

126. 126. The method of claim 124 or 125, wherein the AAV comprises inverted terminal repeat (ITR) sequences and capsid proteins from different serotypes.

127. 127. The method of any one of claims 87 to 126, wherein said administering is effected in vivo by providing said polynucleotide directly to said subject, or ex vivo by expressing said polynucleotide in a host cell and then administering said host cell to said subject.

128. 128. The method of any one of claims 87-127, wherein said delivery is performed by intramuscular, subcutaneous, intradermal, intravenous, intraperitoneal, intraarterial, intraventricular, intranasal, intraorbital, intracranial, or intraosseous administration.

129. 129. The method of any one of claims 87 to 128, wherein the treatment is a monotherapy.

130. 129. The method of any one of claims 87 to 128, wherein said method is combined with the administration of one or more additional therapeutic agents.

131. A kit comprising an instruction sheet instructing a user to perform a codon optimization method, which comprises modifying a polynucleotide sequence encoding a polypeptide by substituting one or more nucleotides within a DRACH motif of the polynucleotide sequence without changing the amino acid sequence of the encoded polypeptide, thereby eliminating the one or more DRACH motifs.

132. A kit comprising a package insert instructing a user to carry out the method of any one of claims 1 to 37 and 39 to 130.

133. 133. The kit of claim 131 or 132, wherein the kit comprises an apparatus for administering a polynucleotide sequence to a subject.

134. 134. The kit of any one of claims 131 to 133, wherein the kit comprises one or more binding molecules for detecting expression of an mRNA transcript encoding the polypeptide or expression or activity of the polypeptide.

Images