A method for improving the metabolic production of heterotrophic microorganisms by reconstructing the Calvin cycle.

Abstract

This invention relates to the technologies of genetic engineering and fermentation engineering, and more specifically, to a method for improving the production of metabolites by heterotrophic microorganisms through the reconstruction of the Calvin cycle. In this invention, by adjusting the expression of Calvin cycle-related genes and reconstructing the Calvin cycle in heterotrophic microorganisms, the metabolism of heterotrophic microorganisms to lipid and carbon sources is efficiently promoted, the operation of the β-oxidation cycle is accelerated, and the ability of heterotrophic microorganisms to synthesize target metabolites from lipid and carbon sources is significantly improved. Through the strategy of adjusting Calvin cycle-related genes in this invention, the ability of microorganisms to synthesize metabolites such as PHA is significantly improved, the content and production amount of metabolites such as PHA produced by microorganisms through fermentation are improved, and a new modification target and method can be provided for the construction of genetically engineered microorganisms for target metabolites.

Description

Cross-reference

[0001] This application claims the priority of Chinese Patent Application No. 202310277052.2, titled "Method for Improving the Production of Metabolites of Heterotrophic Microorganisms by Reconstructing the Calvin Cycle", filed on March 21, 2023, and incorporates all the contents of this application by reference.

Technical Field

[0002] The present invention relates to the technical fields of genetic engineering and fermentation engineering, and specifically to a method for improving the production of metabolites of heterotrophic microorganisms by reconstructing the Calvin cycle.

Background Art

[0003] Polyhydroxyalkanoates (PHA) are renewable and degradable polymer materials with various material properties synthesized by microorganisms, and have broad application prospects in the fields of medicine, materials, and environmental protection. Polyhydroxyalkanoates are widely present in microbial cells and mainly function as storage carriers for carbon sources and energy.

[0004] Ralstonia eutropha (also known as Cupriavidus necator) is a heterotrophic microorganism and an important model bacterium in the research of PHA synthesis. Currently, how to improve the PHA production of Ralstonia eutropha is a hot topic and a difficulty in research.

[0005] The Calvin cycle (CBB cycle) is also called the photosynthetic carbon reduction cycle and is one of the carbon fixation pathways widely present in nature. However, in the natural environment, it mainly exists in autotrophic microorganisms.

[0006] In Ralstonia eutropha, two copies of the CBB recycling-related gene exist: one in genome 2 and the other in megaplasmid pHG1. Here, the cbbR in genome 2 regulates the cbb gene cluster on genome 2 and pHG1, while the cbbR in megaplasmid pHG1 is incomplete and therefore lacks regulatory ability (Genome sequence of the bioplastic-producing "Knallgas" bacterium Ralstonia eutropha H16, Nature biotechnology, 2006).

[0007] Conventional technologies have reported proposals for exogenously expressing key enzymes for CBB recycling (e.g., RuBisCo) in heterotrophic microorganisms to reduce carbon dioxide emissions, but there are no reports on how CBB recycling affects the production of target metabolites by heterotrophic microorganisms. [Overview of the project]

[0008] This invention provides a method for improving the metabolic production of heterotrophic microorganisms by reconstructing the Calvin cycle.

[0009] In this invention, we have found that by adjusting the expression of key genes in the Calvin cycle, the metabolism of heterotrophic microorganisms to lipid-carbon sources can be promoted, the operation of the β-oxidation cycle can be accelerated, and further, metabolism can be promoted into the metabolite synthesis pathway, thereby improving the ability of heterotrophic microorganisms to synthesize target metabolites from lipid-carbon sources.

[0010] Specifically, the present invention provides the following technical solutions.

[0011] The present invention relates to the use of any one of the following: a Calvin cycle-related gene, its coding protein, or a biological material containing the Calvin cycle-related gene, (1) Use to improve the ability of microorganisms to synthesize metabolites from lipids, (2) Use to improve the production of metabolic products by microorganisms using lipids, (3) Use to improve the production efficiency of metabolic products produced by microorganisms using lipids and fats, (4) Use for constructing genetically engineered microorganisms that produce metabolites from oils and fats, (5) Use to improve the metabolic capacity of microorganisms to lipids, (6) Use to promote the β-oxidation cycle of microorganisms, The invention provides a use in which the Calvin cycle-related genes are cbbL and cbbS.

[0012] In the present invention, the cbbL gene and the cbbS gene synthesize the large subunit and small subunit of ribulose-1,5-bisphosphate carboxylase / oxygenase (Rubisco), respectively, and further synthesize ribulose-1,5-bisphosphate carboxylase / oxygenase (Rubisco).

[0013] In the present invention, the biological material is an expression kit, a vector, or a host cell. Here, the expression kit may consist of a promoter and the Calvin cycle-related gene being operablely connected. Depending on the expression requirements and the sequence differences upstream and downstream of the expression kit, the expression kit may also include other transcriptional and translational regulatory elements such as terminators and enhancers. The vector is a rasmid vector, and these rasmid vectors include replicating vectors and non-replicating vectors. The vector is not limited to rasmid vectors, but may also be a bacteriophage, virus, or other vector. The host cell may be any microbial cell, such as Escherichia coli or Ralstonia eutropha.

[0014] Specifically, the use includes improving the expression levels of Calvin cycle-related genes and / or the enzymatic activity of the coding proteins of Calvin cycle-related genes in microorganisms.

[0015] To improve the expression of Calvin cycle-related genes in microorganisms, it is preferable to increase the expression level of cbbL to 2 to 141 times the pre-adjustment level, and to set the expression ratio of cbbL to cbbS to (0.5 to 1.2):1. By increasing the expression level of cbbL and setting the expression ratio of cbbL to cbbS within the above range, the PHA production capacity of the microorganism is significantly improved, and both the PHA content and PHA production are significantly increased.

[0016] It is more preferable to have a ratio of cbbL to cbbS expression levels of (0.5-0.97):1, and even more preferable to have a ratio of (0.57-0.91):1.

[0017] Since cbbL and cbbS each encode the large and small subunits of the Rubisco enzyme, theoretically, the optimal ratio of their expression levels should be 1:1. However, in this invention, we found that, surprisingly, controlling the ratio of cbbL and cbbS expression levels to between (0.5 and 0.97):1 still significantly improves the PHA production of microorganisms. Furthermore, in order to ensure the improvement in PHA production, it is necessary to control the degree of improvement in cbbL expression to 2 to 141 times the pre-adjustment level.

[0018] More preferably, improving the expression levels of Calvin cycle-related genes in microorganisms involves increasing the expression level of cbbL to 2 to 70 times (more preferably 2 to 65 times) the level before adjustment, and setting the expression ratio of cbbL to cbbS to (0.5 to 1.1):1 (more preferably 0.57 to 0.97:1, and most preferably 0.57 to 0.91:1).

[0019] Under the conditions that satisfy the above-mentioned proportional increase in cbbL expression level and the ratio of cbbL to cbbS expression levels, it is preferable to increase the cbbS expression level to 2 to 150 times the pre-adjustment level, and more preferably to increase it to 2 to 70 times the pre-adjustment level.

[0020] In this invention, improving the expression levels of the cbbL and cbbS genes is achieved by any one or a combination of any of the following (1) to (4). (1) Modify the regulatory proteins of cbbL and cbbS. (2) Modify the transcriptional regulatory element and / or translational regulatory element of cbbL, cbbS, (3) Modifying the sequences of the cbbL and cbbS genes. (4) Increase the number of copies of cbbL and cbbS.

[0021] In (1) above, the modified protein includes the cbbR protein. The modified cbbL and cbbS proteins increase the expression levels of the cbbL and cbbS genes by changing the way cbbR modifies the cbbL and cbbS genes through mutation of the cbbR protein.

[0022] In one embodiment of the present invention, the cbbR protein is mutated into a cbbR mutant containing G205D and G118D mutations. Preferably, the amino acid sequence of the cbbR mutant is as shown in Sequence ID No. 5. The cbbR mutant shown in Sequence ID No. 5 can be applied in particular to activate Ralstonia eutropha and improve the expression levels of the cbbL and cbbS genes under heterotrophic conditions, bringing the expression levels of cbbL and cbbS within the proportional range of the present invention, and further significantly improving the production of PHA.

[0023] The incorporation of the cbbR mutant described above is achieved by incorporating the coding gene of the cbbR mutant into the microbial chromosome or endogenous plasmid, and / or by an exogenous plasmid containing the coding gene of the cbbR mutant into the microorganism. Here, the primitive cbbR gene on the microbial chromosome is inactivated.

[0024] In certain embodiments of the present invention, the exogenous plasmid is made into a plasmid that can be stably expressed after being taken up by a microorganism so that it can be stably expressed. Stable expression of the plasmid is achieved by endowing the plasmid with a synthetic gene (e.g., proC gene) for metabolites essential for strain growth and inactivating the synthetic gene in the genome. Those skilled in the art should understand that the method for stable expression of the plasmid is not limited to this, and other technical means for the plasmid vector to stably express the target gene can also achieve the above object.

[0025] In certain embodiments of the present invention, the object of stable expression of the plasmid vector is achieved by knocking out the proC gene in the original genome and inserting the proC gene into the exogenous plasmid.

[0026] In (2) above, the transcription regulatory element includes a promoter, a terminator, an enhancer, etc. The translation regulatory element includes a ribosome binding site, etc. Modification of the transcription regulatory element and / or the translation regulatory element is to change the sequence of the regulatory element responsible for the transcription and translation of cbbL and cbbS. For example, other transcription regulatory elements and translation regulatory elements are inserted upstream of the coding regions of the cbbL and cbbS genes, or mutations are made based on the original transcription regulatory element and translation regulatory element (for example, the sequence of the binding region of cbbR in the promoter is mutated so that the promoter is not regulated by cbbR), or the original transcription regulatory element and translation regulatory element are replaced with other transcription regulatory elements and translation regulatory elements, etc. It is preferable that the original cbbR gene on the microbial chromosome is inactivated.

[0027] In one embodiment of the present invention, a promoter is inserted into the 5' end of the coding region of the cbbL gene to improve the expression levels of the cbbL and cbbS genes. The promoter is preferably a constitutive promoter, and more preferably a p53 promoter (where the p53 promoter is sequence number 53 in Chinese Patent Invention CN108977890B), a p52 promoter (where the p52 promoter is sequence number 52 in Chinese Patent Invention CN108977890B), or a p68 promoter (where the p68 promoter is sequence number 68 in Chinese Patent Invention CN108977890B). It is also preferable that the original cbbR gene on the chromosome is simultaneously inactivated.

[0028] In one embodiment of the present invention, the expression levels of the cbbL and cbbS genes are increased by inserting a p53 promoter (sequence number 53 in Chinese Patent Invention CN108977890B), a p52 promoter (sequence number 52 in Chinese Patent Invention CN108977890B), or a p68 promoter (sequence number 68 in Chinese Patent Invention CN108977890B) into the 5' end of the coding region of the cbbL gene, and the terminator between the cbbS and cbbX genes is not knocked out. It is preferable that the original cbbR gene on the chromosome is simultaneously inactivated.

[0029] In (3) above, if the coding protein sequences of the cbbL and cbbS genes are not changed, their expression levels can be improved by optimizing the codons of the cbbL and cbbS genes.

[0030] In (4) above, an increase in the copy number of cbbL and cbbS is achieved by increasing the copy number of the cbbL and cbbS genes in the chromosome and / or endogenous plasmid, or by introducing an exogenous plasmid containing the cbbL and cbbS genes. When introducing an exogenous plasmid, the cbbL and cbbS genes may be in the same plasmid or in different plasmids.

[0031] In one embodiment of the present invention, an exogenous plasmid containing the cbbL and cbbS genes is introduced. Here, the cbbL gene is transcribed from the p53 promoter, and the cbbS gene is transcribed from the p47 promoter (the p47 promoter is sequence number 47 in Chinese patent invention CN108977890B).

[0032] To ensure that the incorporated exogenous plasmid can be stably expressed after being taken up by a microorganism, the plasmid is designed to stably express the exogenous plasmid. Stable plasmid expression is achieved by providing the plasmid with a gene for synthesizing a metabolite essential for strain growth (e.g., the proC gene) and inactivating the said synthetic gene in the genome. Those skilled in the art should understand that the method for stably expressing a plasmid is not limited to this, and that other technical means by which a rasmid vector stably expresses the target gene can also achieve the above objective.

[0033] In one embodiment of the present invention, the objective of stable expression of the rasmid vector is achieved by knocking out the proC gene in the primitive genome and inserting the proC gene into an exogenous plasmid.

[0034] As described above, improving the enzymatic activity of the coding proteins of the cbbL and cbbS genes is achieved by altering the amino acid sequence of the coding proteins.

[0035] While the present invention has described the above-mentioned means as examples in specific embodiments, any other technical means that can achieve the objective of adjusting the expression of the cbbL and cbbS genes, as understood by those skilled in the art, are equivalent variations of the technical means of the present invention and therefore should be understood to be within the scope of protection of the present invention.

[0036] In the present invention, the Calvin cycle-related genes may be genes derived from heterotrophic microorganisms. Due to the similarity in the function, metabolic pathways, and regulation of the Calvin cycle in heterotrophic microorganisms, and the similarity in the metabolic pathways of heterotrophic microorganisms to lipids, the uses described in (1) to (6) above, such as improving the ability of microorganisms to synthesize metabolites from lipids by adjusting the Calvin cycle-related genes provided by the present invention, can be applied to all heterotrophic microorganisms. These heterotrophic microorganisms include, but are not limited to, Ralstonia eutropha, Escherichia coli, yeast, Pseudomonas, or Halomonas.

[0037] In one embodiment of the present invention, the Calvin cycle-related genes are the cbbL and cbbS genes derived from Ralstonia eutropha.

[0038] In Ralstonia eutropha, the aforementioned Calvin cycle-related genes are either located on the genome of chromosome 2 or on plasmid pHG1.

[0039] The cbbL and cbbS genes located on chromosome 2 of the genome and the cbbL and cbbS genes located on plasmid pHG1 exhibit a high degree of similarity, and their functions are highly identical. Therefore, regulating the cbbL and cbbS genes located on chromosome 2 of the genome and regulating the cbbL and cbbS genes located on plasmid pHG1 can produce equivalent effects.

[0040] In this invention, the proportional increase in cbbL expression level and the ratio of cbbL to cbbS expression levels are calculated from the total expression levels of cbbL and cbbS in microbial cells, and are not separated into chromosomal and plasmid-side cbbL and cbbS. The proportional increase in cbbL expression level and the ratio of cbbL to cbbS expression levels described above may be achieved by adjusting the chromosomal cbbL and cbbS genes individually, by adjusting the plasmid cbbL and cbbS genes individually, or by adjusting the chromosomal and plasmid-side cbbL and cbbS genes in combination.

[0041] In this invention, there are no particular restrictions on the sequences of the cbbL and cbbS genes; any sequence that has the function of the cbbL and cbbS genes (large and small subunits encoding the Rubisco enzyme) is acceptable.

[0042] In one embodiment of the present invention, the coding protein sequence of the cbbL gene is the sequence shown in SEQ ID NOs: 1 and 2, or a sequence having at least 80% similarity to the sequences shown in SEQ ID NOs: 1 and 2. The coding protein sequence of the cbbS gene is the sequence shown in SEQ ID NOs: 3 and 4, or a sequence having at least 80% similarity to the sequences shown in SEQ ID NOs: 3 and 4.

[0043] The similarity of the above amino acid sequences may be at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%.

[0044] In one embodiment of the present invention, the amino acid sequence of the protein encoded by cbbL is shown in SEQ ID NO: 1 and / or SEQ ID NO: 2, and the amino acid sequence of the protein encoded by cbbS is shown in SEQ ID NO: 3 and / or SEQ ID NO: 4.

[0045] Here, Sequence ID No. 1 and Sequence ID No. 3 are the sequences of proteins encoded by the cbbL and cbbS genes on the genome of chromosome 2, respectively, and Sequence ID No. 2 and Sequence ID No. 4 are the sequences of proteins encoded by the cbbL and cbbS genes on plasmid pHG1, respectively.

[0046] In this invention, the microorganisms are heterotrophic microorganisms. Due to the similarities in the function, metabolic pathways, and regulation of the Calvin cycle in heterotrophic microorganisms, and the similarities in the metabolic pathways of heterotrophic microorganisms to lipids, the uses described in (1) to (6) above, such as improving the ability of microorganisms to synthesize metabolites from lipids by adjusting Calvin cycle-related genes, can be applied to all heterotrophic microorganisms. These heterotrophic microorganisms include, but are not limited to, Ralstonia eutropha, Escherichia coli, yeast, Pseudomonas, or Halomonas.

[0047] Preferably, the microorganism is one that can synthesize / accumulate the metabolites.

[0048] In one embodiment of the present invention, the microorganism is Ralstonia eutropha.

[0049] In the present invention, it is preferable that the metabolites use metabolites of the β-oxidation cycle as synthesis precursors. In the present invention, according to a mechanism that promotes the ability of microorganisms to produce metabolites from lipids by adjusting Calvin cycle-related genes, the adjustment of Calvin cycle-related genes promotes the metabolism of the β-oxidation cycle in lipids by microorganisms, further improves the synthesis flux of metabolites in the β-oxidation cycle, provides more metabolites in the β-oxidation cycle as precursors, and enables the synthesis of downstream metabolites. Therefore, the adjustment strategy and effects of the present invention can be applied to metabolites that use metabolites of the β-oxidation cycle as synthesis precursors.

[0050] As an example, the metabolites may use acetyl-CoA, acyl-CoA, enoyl-CoA, hydroxyacyl-CoA, and / or ketoacyl-CoA as synthetic precursors.

[0051] The metabolites mentioned above include, but are not limited to, polyesters, organic acids, amino acids, alcoholic or hydrocarbon compounds.

[0052] Here, polyester metabolites include PHA, etc. Organic acid metabolites include glycolic acid, 3-hydroxypropionic acid, fatty acids, etc. Hydrocarbon metabolites include lycopene, β-carotene, etc.

[0053] In specific embodiments of the present invention, as an example of these metabolites, in the case of PHA, although the PHA synthesis pathway, its precursors, and intermediates are not related to the microbial Calvin cycle, the microbial PHA synthesis ability can be significantly improved and the PHA production can be increased by adjusting the expression of the microbial Calvin cycle-related genes cbbL and cbbS.

[0054] With respect to PHA, the present invention provides the use of the Calvin cycle-related genes, their coding proteins, or biomaterials containing the Calvin cycle-related genes for improving the PHA synthesis ability of microorganisms, improving the PHA content in microbial cells, improving the PHA production of microorganisms, or constructing genetically engineered microorganisms for PHA production. The Calvin cycle-related genes are cbbL and cbbS.

[0055] In the present invention, it is preferable that the PHA synthesis ability of the microorganism, the PHA content in the microbial cells, and the PHA production amount of the microorganism are those of a case where PHA is produced by fermentation under heterotrophic conditions.

[0056] The fermentation production of the aforementioned PHA is preferably carried out using oils and fats as a carbon source.

[0057] In the present invention, the oil is one or more of vegetable oils, animal oils, and kitchen waste oils, where the vegetable oil is a mixture of one or more selected from palm oil, palm kernel oil, coconut oil, peanut oil, soybean oil, linseed oil, rapeseed oil, castor oil, and corn oil.

[0058] Those skilled in the art will understand that the inventive concept of the present invention is not limited to the specific selection of a carbon source, but can be realized using any oil or fat as a carbon source, since all pathways for PHA biosynthesis using oils and fats as a carbon source rely on acyl-CoA obtained by β-oxidation as a key raw material, and their metabolic pathways and regulatory mechanisms are substantially the same.

[0059] The present invention provides a method for improving the yield of metabolites produced by microorganisms using lipids and fats. The method includes modifying the microorganism to improve the expression level of Calvin cycle-related genes and / or the enzymatic activity of the coding proteins of Calvin cycle-related genes in the microorganism.

[0060] The aforementioned Calvin cycle-related genes are cbbL and cbbS.

[0061] To improve the expression levels of Calvin cycle-related genes in the aforementioned microorganisms, it is preferable to increase the expression level of cbbL to 2 to 141 times the pre-modification level, and to set the expression ratio of cbbL to cbbS to (0.5 to 1.2):1. When the degree of improvement in cbbL expression and the expression ratio of cbbL to cbbS are within the above range, the PHA production capacity of the microorganisms can be significantly improved, resulting in a significant increase in both PHA content and PHA production.

[0062] The ratio of cbbL to cbbS expression levels is more preferably (0.5-0.97):1, and even more preferably (0.57-0.91):1.

[0063] To improve the expression levels of Calvin cycle-related genes in the aforementioned microorganisms, it is even more preferable to increase the expression level of cbbL to 2 to 70 times (more preferably 2 to 65 times) the level before modification, and to set the ratio of cbbL to cbbS expression levels to (0.5 to 1.1):1 (more preferably 0.57 to 0.97:1, and most preferably 0.57 to 0.91:1).

[0064] Under the conditions that satisfy the above-mentioned proportional increase in cbbL expression level and the ratio of cbbL to cbbS expression levels, it is preferable to increase the cbbS expression level to 2 to 150 times the level before modification, and more preferably to increase it to 2 to 70 times the level before modification.

[0065] In the methods described above, the microorganisms are heterotrophic. Due to the similarities in the function, metabolic pathways, and regulation of the Calvin cycle in heterotrophic microorganisms, and the similarities in the metabolic pathways of heterotrophic microorganisms to lipids, the uses described in (1) to (6) above, such as improving the ability of microorganisms to synthesize metabolites from lipids by adjusting Calvin cycle-related genes provided by the present invention, can be applied to all heterotrophic microorganisms. These heterotrophic microorganisms include, but are not limited to, Ralstonia eutropha, Escherichia coli, yeast, Pseudomonas, or Halomonas.

[0066] Preferably, the microorganism is one that can synthesize / accumulate the metabolites.

[0067] In one embodiment of the present invention, the microorganism is Ralstonia eutropha.

[0068] The metabolites described above preferably use metabolites of the β-oxidation cycle as synthesis precursors. In the present invention, according to a mechanism that promotes the ability of microorganisms to produce metabolites from lipids by adjusting Calvin cycle-related genes, the adjustment of Calvin cycle-related genes promotes the metabolism of the β-oxidation cycle in lipids by microorganisms, further improves the synthesis flux of metabolites in the β-oxidation cycle, provides more metabolites in the β-oxidation cycle as precursors, and enables the synthesis of downstream metabolites. Therefore, the adjustment strategy and effects of the present invention can be applied to metabolites that use metabolites of the β-oxidation cycle as synthesis precursors.

[0069] As an example, the metabolites may use acetyl-CoA, acyl-CoA, enoyl-CoA, hydroxyacyl-CoA, and / or ketoacyl-CoA as synthetic precursors.

[0070] The metabolites mentioned above include, but are not limited to, polyesters, organic acids, amino acids, alcoholic or hydrocarbon compounds.

[0071] Here, polyester metabolites include PHA, etc. Organic acid metabolites include glycolic acid, 3-hydroxypropionic acid, fatty acids, etc. Hydrocarbon metabolites include lycopene, β-carotene, etc.

[0072] In specific embodiments of the present invention, as an example of these metabolites, in the case of PHA, although the PHA synthesis pathway, its precursors, and intermediates are not related to the microbial Calvin cycle, the microbial PHA synthesis ability can be significantly improved and the PHA production can be increased by adjusting the expression of the microbial Calvin cycle-related genes cbbL and cbbS.

[0073] The present invention provides a method for improving the PHA production of microorganisms, comprising modifying the microorganism to improve the expression level of Calvin cycle-related genes and / or the enzymatic activity of the coding proteins of Calvin cycle-related genes, wherein the Calvin cycle-related genes are cbbL and cbbS.

[0074] The present invention provides genetically engineered microorganisms modified to enhance the expression levels of cbbL and cbbS.

[0075] Here, the expression level of cbbL is increased to 2 to 141 times the level before modification, and the expression ratio of cbbL to cbbS in the genetically engineered microorganism is set to (0.5 to 1.2):1.

[0076] It is preferable to increase the expression level of cbbL to 2 to 70 times (more preferably 2 to 65 times) the level before modification, and to set the ratio of the expression levels of cbbL to cbbS to (0.5 to 1.1):1 (more preferably 0.57 to 0.97:1, and most preferably 0.57 to 0.91:1).

[0077] Under the conditions that satisfy the above-mentioned proportional increase in cbbL expression level and the ratio of cbbL to cbbS expression levels, it is preferable to increase the cbbS expression level to 2 to 150 times the level before modification, and more preferably to increase it to 2 to 70 times the level before modification.

[0078] The microorganism is preferably a heterotrophic microorganism, and more preferably Ralstonia eutropha, Escherichia coli, yeast, Pseudomonas, or Halomonas.

[0079] The microorganism is preferably one that can synthesize / accumulate PHA.

[0080] The microorganism is more preferably Ralstonia eutropha. In the present invention, the Ralstonia eutropha starting strain for constructing the genetically engineered microorganism is not particularly limited and can be any strain capable of synthesizing / accumulating PHA.

[0081] The genetically engineered microorganism is more preferably genetically modified Ralstonia eutropha.

[0082] The modifications to the genetically engineered microorganisms described above are one or more selected from (1) to (4) below. (1) Modification of the regulatory proteins of cbbL and cbbS, (2) Modification of the transcriptional regulatory elements and / or translational regulatory elements of cbbL, cbbS, (3) Modification of the cbbL and cbbS gene sequences, (4) Increase in the number of copies of cbbL and cbbS.

[0083] In (1) above, the modified protein includes the cbbR protein. The modified cbbL and cbbS proteins increase the expression levels of the cbbL and cbbS genes by changing the way cbbR modifies the cbbL and cbbS genes through mutation of the cbbR protein.

[0084] In one embodiment of the present invention, the cbbR protein is mutated into a cbbR mutant containing G205D and G118D mutations. Preferably, the amino acid sequence of the cbbR mutant is as shown in Sequence ID No. 5. The cbbR mutant shown in Sequence ID No. 5 can be applied in particular to activate Ralstonia eutropha and improve the expression levels of the cbbL and cbbS genes under heterotrophic conditions, thereby increasing the expression levels of cbbL and cbbS within the proportional range of the present invention and significantly improving the production of PHA.

[0085] The incorporation of the cbbR mutant described above is achieved by incorporating the coding gene of the cbbR mutant into the microbial chromosome or endogenous plasmid, and / or by incorporating an exogenous plasmid containing the coding gene of the cbbR mutant into the microorganism. Here, the primitive cbbR gene on the microbial chromosome is inactivated.

[0086] In one embodiment of the present invention, the exogenous plasmid is made into a plasmid that can be stably expressed after being taken up by a microorganism. Stable plasmid expression is achieved by making the plasmid carry a gene for synthesizing a metabolite essential for strain growth (e.g., the proC gene) and inactivating the said synthetic gene in the genome. Those skilled in the art should understand that the method for stably expressing a plasmid is not limited to this, and that other technical means by which a rasmid vector stably expresses the target gene can also achieve the above objective.

[0087] In one embodiment of the present invention, the objective of stable expression of the rasmid vector is achieved by knocking out the proC gene in the primitive genome and inserting the proC gene into an exogenous plasmid.

[0088] In (2) above, the transcriptional regulatory element includes a promoter, terminator, enhancer, etc. The translational regulatory element includes a ribosome binding site, etc. Modification of the transcriptional regulatory element and / or translational regulatory element involves changing the sequence of the regulatory element responsible for the transcription and translation of cbbL and cbbS. For example, this involves inserting another transcriptional regulatory element or translational regulatory element upstream of the coding region of the cbbL and cbbS genes, or mutating the original transcriptional regulatory element or translational regulatory element (for example, mutating the sequence of the cbbR binding region in the promoter so that the promoter is not regulated by cbbR), or replacing the original transcriptional regulatory element or translational regulatory element with another transcriptional regulatory element or translational regulatory element. It is preferable that the original cbbR gene on the microbial chromosome is inactivated.

[0089] In one embodiment of the present invention, a promoter is inserted into the 5' end of the coding region of the cbbL gene to improve the expression levels of the cbbL and cbbS genes. The promoter is preferably a constitutive promoter, and more preferably a p53 promoter (where the p53 promoter is sequence number 53 in Chinese Patent Invention CN108977890B), a p52 promoter (where the p52 promoter is sequence number 52 in Chinese Patent Invention CN108977890B), or a p68 promoter (where the p68 promoter is sequence number 68 in Chinese Patent Invention CN108977890B). It is also preferable that the original cbbR gene on the chromosome is simultaneously inactivated.

[0090] In one embodiment of the present invention, the expression levels of the cbbL and cbbS genes are increased by inserting a p53 promoter (sequence number 53 in Chinese Patent Invention CN108977890B), a p52 promoter (sequence number 52 in Chinese Patent Invention CN108977890B), or a p68 promoter (sequence number 68 in Chinese Patent Invention CN108977890B) into the 5' end of the coding region of the cbbL gene, and the terminator between the cbbS and cbbX genes is not knocked out. It is preferable that the original cbbR gene on the chromosome is simultaneously inactivated.

[0091] In (3) above, if the coding protein sequences of the cbbL and cbbS genes are not changed, their expression levels can be improved by optimizing the codons of the cbbL and cbbS genes.

[0092] In (4) above, an increase in the copy number of cbbL and cbbS is achieved by increasing the copy number of the cbbL and cbbS genes in the chromosome and / or endogenous plasmid, or by introducing an exogenous plasmid containing the cbbL and cbbS genes. When introducing an exogenous plasmid, the cbbL and cbbS genes may be in the same plasmid or in different plasmids.

[0093] In one embodiment of the present invention, an exogenous plasmid containing the cbbL and cbbS genes is introduced. Here, the cbbL gene is transcribed from the p53 promoter, and the cbbS gene is transcribed from the p47 promoter (the p47 promoter is sequence number 47 in Chinese patent invention CN108977890B).

[0094] To ensure that the incorporated exogenous plasmid can be stably expressed after being taken up by a microorganism, the plasmid is designed to stably express the exogenous plasmid. Stable plasmid expression is achieved by providing the plasmid with a gene for synthesizing a metabolite essential for bacterial growth (e.g., the proC gene) and inactivating the said synthesizing gene in the genome. Those skilled in the art should understand that the method for stably expressing a plasmid is not limited to this, and that other technical means by which a rasmid vector stably expresses its target gene can also achieve the above objective.

[0095] In one embodiment of the present invention, the objective of stable expression of the rasmid vector is achieved by knocking out the proC gene in the primitive genome and inserting the proC gene into an exogenous plasmid.

[0096] The present invention provides the use of the above-mentioned genetically engineered microorganisms for fermentation production of metabolites using oils and fats.

[0097] The oils and fats mentioned above are one or more of vegetable oils, animal oils, and kitchen waste oils, where the vegetable oil is a mixture of one or more selected from palm oil, palm kernel oil, coconut oil, peanut oil, soybean oil, linseed oil, rapeseed oil, castor oil, and corn oil.

[0098] The present invention provides a method for producing metabolites, which includes the step of obtaining metabolites from a culture obtained by culturing the genetically engineered microorganism using oil and fat as a carbon source.

[0099] In one embodiment of the present invention, the method includes inoculating the genetically engineered microorganism into a primary seed medium to perform primary seed culture, inoculating the primary seed solution into a secondary seed medium to perform secondary seed culture, obtaining a secondary seed solution, inoculating the secondary seed solution into a fermentation medium to perform fermentation culture, and obtaining a culture.

[0100] The fermentation culture is preferably carried out using oil and fat as a carbon source. The oil and fat is one or more of the following: vegetable oil, animal oil, and kitchen waste oil, where the vegetable oil is one or a mixture of one or more selected from palm oil, palm kernel oil, coconut oil, peanut oil, soybean oil, linseed oil, rapeseed oil, castor oil, and corn oil.

[0101] The beneficial effects of the present invention are as follows: By adjusting the expression of Calvin cycle-related genes cbbL and cbbS, the present invention reconstructs the Calvin cycle in heterotrophic microorganisms, efficiently promotes the metabolism of heterotrophic microorganisms to lipid and carbon sources, accelerates the operation of the β-oxidation cycle, facilitates the entry of metabolism into the metabolite synthesis pathway, and significantly improves the ability of heterotrophic microorganisms to synthesize target metabolites from lipid and carbon sources. The Calvin cycle-related gene adjustment strategy of the present invention can significantly improve the ability of microorganisms to synthesize metabolites such as PHA, and furthermore, can efficiently improve the content and production amount of metabolites such as PHA that microorganisms ferment and produce, providing new modification targets and methods for constructing genetically engineered microorganisms for target metabolites.

[0102] To more clearly explain the technical concepts of the present invention or the prior art, the following briefly introduces the drawings that may be used in the examples or descriptions of the prior art. However, the drawings in these descriptions represent only some examples of the present invention, and it is clear that those skilled in the art can obtain other drawings from these drawings without any creative effort. [Brief explanation of the drawing]

[0103] [Figure 1] This shows the expression status of cbbL and cbbS of recombinant bacteria compared to the control bacteria in Example 1 of the present invention.

[0104] [Figure 2] This shows the expression status of cbbL and cbbS of recombinant bacteria compared to the control bacteria in Example 2 of the present invention.

[0105] [Figure 3]This shows the expression status of cbbL and cbbS of recombinant bacteria compared to the control bacteria in Example 3 of the present invention.

[0106] [Figure 4] This shows the expression status of recombinant cbbL and cbbS in relation to the control bacteria in Example 4 of the present invention.

[0107] [Figure 5] This shows the expression status of recombinant cbbL and cbbS in relation to the control bacteria in Example 5 of the present invention.

[0108] [Figure 6] This shows the expression status of recombinant cbbL and cbbS in comparison to the control bacteria in Example 6 of the present invention.

[0109] [Figure 7] This shows the expression status of recombinant cbbL and cbbS in relation to the control bacteria in Example 7 of the present invention.

[0110] [Figure 8] This shows the expression status of cbbL and cbbS of recombinant bacteria compared to the control bacteria in Example 8 of the present invention.

[0111] [Figure 9] This shows the expression status of recombinant cbbL and cbbS in relation to the control bacteria in Example 9 of the present invention.

[0112] [Figure 10] This shows the expression status of cbbL and cbbS of recombinant bacteria compared to the control bacteria in Example 10 of the present invention.

[0113] [Figure 11] This shows the expression status of cbbL and cbbS of recombinant bacteria compared to the control bacteria in Example 11 of the present invention. [Modes for carrying out the invention]

[0114] To further clarify the purpose, technical proposal, and advantages of the present invention, a clear and complete description of the technical proposal in the present invention is provided below with reference to the drawings of the present invention. It is clear that the described examples are not all examples, but only some examples of the present invention. Based on the examples of the present invention, all other examples obtained without creative labor by those skilled in the art are all within the scope of protection of the present invention.

[0115] Unless otherwise specified, all materials and reagents used in the following examples are obtained through commercial channels. The enzyme reagents used were purchased from New England Biolabs (NEB), the plasmid extraction kit was purchased from TIANGEN Biotech (Beijing) Co., Ltd., and the DNA fragment recovery kit was purchased from Omega, Inc. (USA). The appropriate operating procedures were strictly followed in accordance with the product instructions. Unless otherwise specified, all culture media were prepared with deionized water.

[0116] The formulation of the culture medium used in the following examples is as follows:

[0117] Seed medium I: 10g / L peptone, 5g / L Yeast Extract, 3g / L Fructose.

[0118] Seed medium II: 0.15% palm oil, 10g / L peptone, 5g / L Yeast Extract.

[0119] Production medium: 1.0% palm oil, 9.85 g / L Na2HPO4·12H2O, 1.5 g / L KH2PO4, 3.0 g / L NH4Cl, 10 mL / L trace element solution I, and 1 mL / L trace element solution II. Here, the composition of trace element solution I is 20 g / L MgSO4, 2 g / L CaCl2. The composition of trace element solution II is 100 mg / L ZnSO4·7H2O, 30 mg / L MnCl2·4H2O, 300 mg / L H3BO3, 200 mg / L CoCl2·6H2O, 10 mg / L CuSO4·5H2O, 20 mg / L NiCl2·6H2O, 30 mg / L NaMoO4·2H2O. All of the above reagents were purchased from Sinopharm Chemical Reagent Co., Ltd.

[0120] In the following examples, the experimental data were all obtained from three or more parallel experiments.

[0121] In the following examples, the PHA content is the mass percentage of PHA relative to the dry weight of the cells.

[0122] In the following example, the formula for calculating the PHA production amount is as follows: PHA production = CDW × PHA%. Here, CDW is the cell dry weight, and PHA% is the percentage of PHA relative to the cell dry weight.

[0123] Example 1: Construction and characterization of a recombinant cbbR mutant strain. In this example, Ralstonia eutropha H16 (abbreviated as Re H16) was used as the starting strain. The cbbR gene in the genome was knocked out, and a stable plasmid containing a double mutant cbbR gene (with mutation sites G205D and G118D, and the amino acid sequence shown in SEQ ID NO: 5) was introduced, and characterization was performed.

[0124] Step 1: Knockout of the proC gene on the Ralstonia eutrophogenem by homologous recombination. (1) Using the genome of Ralstonia eutropha H16 as a template, PCR amplification was performed to obtain the upstream homology arm proC-H1 using proC-H1F and proC-H1R, and the downstream homology arm proC-H2 using proC-H2F and proC-H2R. The modified plasmid pK18mob (Orita I, Iwazawa R, Nakamura S, et al. Identification of mutation points in Cupriavidus necator NCIMB 11599 and genetic reconstitution of glucose-utilization ability in wild strain H16 for polyhydroxyalkanoate production[J]. Journal of Bioscience & Bioengineering, 2012, 113(1):63~69) was used as a template, and amplification was performed using pK-F and pK-R to obtain vector fragments. The sequences of the primers used are shown in Table 1. proC-H1 and proC-H2 were ligated to a vector fragment using the Gibson Assembly method to obtain the basal plasmid pKO-ΔproC. The sequences of the homology arms proC-H1 and proC-H2 are shown in SEQ ID NO: 6.

[0125] [Table 1]

[0126] (2) The recombinant plasmid pKO-ΔproC was introduced into Escherichia coli S17-1, and then into Ralstonia eutropha H16 by conjugation. Taking advantage of the fact that suicide plasmids cannot replicate in the host bacteria, positive clones were screened on LB plates containing kanamycin 250 μg / mL and apramycin 100 μg / mL simultaneously. The recombinant plasmid containing homologous fragments in the positive clones was incorporated into specific positions in the genome where proC-H1 and proC-H2 exist to obtain the first homologous recombinant bacteria. The first homologous recombinant bacteria were streaked onto LB plates containing sucrose 100 mg / mL and 0.2% proline, and single clones were cultured. From these single clones, clones without kanamycin resistance were screened, and recombinant bacteria with inserted target genes were identified by PCR using primers proC-F:ctggcggtttccaagaccg and proC-R:gtgttgccgctcaatgcgc. The resulting recombinant bacteria were designated as Ralstonia eutropha ReΔproC.

[0127] Step 2: Knockout of the cbbR gene on the genome using homologous recombination. (1) Using the genome of Ralstonia eutropha H16 as a template, PCR amplification was performed to obtain the upstream homology arm cbbR-H1 using cbbR-H1F and cbbR-H1R, and the downstream homology arm cbbR-H2 using cbbR-H2F and cbbR-H2R. Using the modified plasmid pK18mob (Orita, I., Iwazawa, et al. J. Biosci. Bioeng. 113, 63~69) as a template, amplification was performed using pK-F and pK-R to obtain vector fragments. The sequences of the primers used are shown in Table 2. cbbR-H1 and cbbR-H2 were ligated to the vector fragments by the Gibson Assembly method to obtain the base plasmid pKO-ΔcbbR. Here, the sequences of homology arms cbbR-H1 and cbbR-H2 are shown in SEQ ID NO: 7.

[0128] [Table 2]

[0129] (2) The recombinant plasmid pKO-ΔcbbR described above was introduced into Escherichia coli S17-1, and further introduced into ReΔproC by conjugation. Taking advantage of the fact that suicide plasmids cannot replicate in the host bacterium, positive clones were screened on an LB plate containing 250 μg / mL kanamycin, 100 μg / mL apramycin, and 0.2% proline simultaneously. The recombinant plasmid containing homologous fragments in the positive clones was incorporated into specific positions in the genome where cbbR-H1 and cbbR-H2 exist to obtain the first homologous recombinant bacterium. The first homologous recombinant bacterium was streaked onto an LB plate containing 100 mg / mL sucrose and 0.2% proline, and single clones were cultured. From these single clones, clones without kanamycin resistance were screened, and recombinant bacters with inserted target genes were identified by PCR using cbbR-F:agtattcacgtccgaccatcgcg and cbbR-R:ggaagcgcatgtcttccaggc. The resulting recombinant bacteria were designated as Ralstonia eutropha ReΔproCΔcbbR.

[0130] Step 3: Construction of a stable plasmid strain containing the cbbR (G205D, G118D) double mutant genes. (1) A plasmid that can be stably inherited in Ralstonia eutropha was constructed, and the proC gene and the cbbR (G205D, G118D) double mutant gene were loaded onto it. The proC gene with a BsaI interface sequence was synthesized, specifically the sequence shown in SEQ ID NO: 8. The pSP plasmid with a BsaI interface sequence was synthesized, specifically the sequence shown in SEQ ID NO: 9. The cbbR (G205D, G118D) gene with a BsaI adapter sequence was synthesized, specifically the sequence shown in SEQ ID NO: 10. Golden gate assembly was performed on the above three plasmids to obtain the recombinant plasmid pSP-proC-cbbR(G205D, G118D).

[0131] (2) Recombinant plasmids pSP-proC-cbbR (G205D, G118D) were introduced into Escherichia coli S17-1, and then introduced into ReΔproCΔcbbR by conjugation. Positive clones were screened on LB plates containing kanamycin 250 μg / l. The resulting recombinant strains were designated as Ralstonia eutropha Re 01.

[0132] Step 4: Characterization of recombinant strains The fermentation characteristics of recombinant strain Re 01 were measured using Ralstonia eutropha H16 as a control. (1) Each strain (1000 μL) constructed in Example 1 of glycerol tube storage was inoculated into seed medium I (20 mL) and primary seed culture was performed for 12 hours. Subsequently, 1 v / v% seed culture solution I was inoculated into seed medium II and secondary seed culture was performed for 13 hours. Then, 10 v / v% seed culture solution II was inoculated into a 2 L small fermentation tank (T&J Bioengineering) containing 1.1 L of production medium. The operating conditions were a culture temperature of 30 °C, a stirring speed of 800 rpm, aeration rate of 1 L / min, normal air as the passing gas, and a pH of 6.7 to 6.8. A 28% aqueous ammonia solution was used for pH control. During cultivation, palm oil was continuously added as a carbon source, and the residual oil content of the fermentation liquid during the fermentation process was monitored using low-field nuclear magnetic resonance spectroscopy. When the residual oil content fell below 1.0 g / L, feeding was carried out to maintain the residual oil content at 1.0-2.0 g / L throughout the subsequent fermentation process. Feeding was stopped half an hour before the completion of fermentation, and the culture time was 54 hours.

[0133] (2) The fermentation liquid was collected and centrifuged to obtain microbial cells. The microbial cells were dried to a certain weight. The weight of the dried microbial cells was measured and recorded as the dry weight. 100 mL of chloroform was added to the obtained dried microbial cells and stirred at room temperature overnight to extract polyester from the microbial cells. After filtering off the microbial residue, the mixture was concentrated in an evaporator to a total volume of approximately 30 mL. Then, approximately 90 mL of hexane was slowly added and the mixture was left to stand for 1 hour with slow stirring. After filtering off the precipitated polyester, it was vacuum-dried at 5 CTC for 3 hours. The mass of the dried polyester was measured and the polyester content in the microbial cells was calculated. At the same time, the oil consumption rate and amount of oil consumed were calculated based on the rate of palm oil consumption.

[0134] (3) As a result, as shown in Table 3, compared to the starting strain ReH16, the dry weight of Re01 improved by 7.2%, the PHA% improved by 7.2%, and the yield (titer) improved by 15.0%.

[0135] [Table 3]

[0136] Step 5: Measurement of cbbL and cbbS expression levels of recombinant strains during fermentation. The bacterial suspension fermented for 10 hours in step 4 above was collected, and transcriptome data was measured by a commercial company. As shown in Figure 1, the expression levels of cbbL and cbbS in recombinant strain Re01 compared to the control strain ReH16 were as follows: the wild-type cbbR gene was replaced with a double mutant cbbR (G205D, G118D), the expression level of cbbL increased to 64 times that of the control strain, the expression level of cbbS increased to 58 times that of the control strain, and the ratio of cbbL to cbbS expression levels in strain Re 01 was 1.02.

[0137] Example 2: Construction and characterization of recombinant strains in which a low-intensity promoter was inserted before cbbL. Using Ralstonia eutropha H16 as the starting strain, the cbbR gene was silenced, and the wild-type promoter prior to cbbL was replaced with a low-intensity constitutive promoter (sequence number 53 in Chinese patent invention CN108977890B, hereinafter referred to as p53). Its characteristics were then measured.

[0138] Step 1: Construction of recombinant bacteria with a replaced promoter using homologous recombination. (1) Using the genome of Ralstonia eutropha H16 as a template, PCR amplification was performed to obtain the upstream homology arm pcbbL-H1 of the promoter insertion site using pcbbL-H1F and pcbbL-H1R, and the downstream homology arm pcbbL-H2 of the promoter using pcbbL-H2F and pcbbL-H2R. Using the modified plasmid pK18mob as a template, amplification was performed using pK-F and pK-R to obtain vector fragments. The sequences of the primers used are shown in Table 4. pcbbL-H1 and pcbbL-H2 were ligated to the vector fragments by the Gibson Assembly method to obtain the base plasmid pKO-L. Here, the sequences of homology arms pcbbL-H1 and pcbbL-H2 are shown in SEQ ID NO: 11.

[0139] [Table 4]

[0140] (2) The constitutive promoter p53 (SEQ ID NO: 15) was synthesized, and to facilitate subsequent operations, GGTCTCATCGT was added upstream of the synthesized DNA sequence and ACGCAGAGACC was added downstream.

[0141] (3) The above-mentioned basic plasmid pKO-L and the synthesized constitutive promoter p53 were assembled using the Golden Gate method to obtain the recombinant plasmid pKO-L-p53. The recombinant plasmid was introduced into Escherichia coli S17-1, and then into Ralstonia eutropha H16 by conjugation. Taking advantage of the property that suicide plasmids cannot replicate in the host bacterium, positive clones were screened using an LB plate containing kanamycin 250 μg / mL and apramycin 100 μg / mL simultaneously. The recombinant plasmid containing homologous fragments in the positive clones was incorporated into specific positions in the genome where pcbbL-H1 and pcbbL-H2 exist to obtain the first homologous recombinant bacterium. The first homologous recombinant strain was streaked onto an LB plate containing 100 mg / mL of sucrose, and single clones were cultured. From these single clones, clones without kanamycin resistance were screened, and recombinant strains with inserted target genes were identified by PCR using primers pcbbL-F:gacatatgcgcaacatgccaga and pcbbL-R:ggacggccgaacttgtccag. The resulting recombinant strains were designated Ralstonia eutropha Re 02.

[0142] Step 2: Characterization of recombinant strains The fermentation characteristics of Ralstonia eutropha Re 02 were measured using Ralstonia eutropha H16 as a control strain. The specific operating steps were the same as in step 4 of Example 1 described above. As a result, as shown in Table 5, compared to the starting strain Re H16, the dry weight of Re 02 increased by 16.7%, the PHA% increased by 15.8%, and the yield (titer) increased by 35.1%.

[0143] [Table 5]

[0144] Step 3: Measurement of cbbL and cbbS expression levels of recombinant strains during fermentation. The bacterial suspension fermented for 10 hours in step 2 above was taken, and transcriptome data was measured by a commercial company. As shown in Figure 2, the expression levels of cbbL and cbbS in recombinant Re 02 compared to the control strain Re H16 showed that the expression level of cbbL in recombinant Re 02 increased to 2.4 times that of the starting strain Re H16, and the expression level of cbbS increased to 2.9 times that of the starting strain, with a ratio of cbbL to cbbS expression levels of 0.77 in recombinant Re 02.

[0145] Example 3: Construction and characterization of recombinant strains in which a medium-strength promoter was inserted before cbbL. Using Ralstonia eutropha H16 as the starting strain, the cbbR gene was silenced, and the wild-type promoter prior to cbbL was replaced with a moderate-strength constitutive promoter (derived from sequence number 52 in Chinese patent invention CN108977890B, hereinafter referred to as p52), and its characteristics were measured.

[0146] Step 1: Construction of recombinant bacteria with a replaced promoter using homologous recombination. (1) The constitutive promoter p52 (SEQ ID NO: 16) was synthesized, and to facilitate subsequent operations, GGTCTCATCGT was added upstream of the synthesized DNA sequence and ACGCAGAGACC was added downstream.

[0147] (2) The pKO-L obtained in step 1 of Example 2 above and the synthesized constitutive promoter p52 were assembled using the Golden Gate method to obtain the recombinant plasmid pKO-L-p52. The recombinant plasmid was introduced into Escherichia coli S17-1 and then into Ralstonia eutropha H16 by conjugation. Taking advantage of the property that suicide plasmids cannot replicate in the host bacterium, positive clones were screened using an LB plate containing kanamycin 250 μg / mL and apramycin 100 μg / mL simultaneously. The recombinant plasmid containing homologous fragments in the positive clones was incorporated into a specific position in the genome where pcbbL-H1 and pcbbL-H2 exist to form the first homologous recombinant bacterium. The first homologous recombinant strain was streaked onto an LB plate containing 100 mg / mL of sucrose, and single clones were cultured. From these single clones, clones without kanamycin resistance were screened, and recombinant strains with inserted target genes were identified by PCR using primers pcbbL-F:gacatatgcgcaacatgccaga and pcbbL-R:ggacggccgaacttgtccag. The resulting recombinant strains were designated Ralstonia eutropha Re 03.

[0148] Step 2: Characterization of recombinant strains The fermentation characteristics of Ralstonia eutropha Re 03 were measured using Ralstonia eutropha H16 as a control strain. The specific operating steps were the same as in step 4 of Example 1 described above. As a result, as shown in Table 6, the dry weight of recombinant Re 03 increased by 19.3%, the PHA% increased by 14.9%, and the yield (titer) increased by 37.1% compared to the starting strain Re H16.

[0149] [Table 6]

[0150] Step 3: Measurement of cbbL and cbbS expression levels of recombinant strains during fermentation. The bacterial suspension fermented for 10 hours in step 2 above was taken, and transcriptome data was measured by a commercial company. As shown in Figure 3, the expression levels of cbbL and cbbS of recombinant Re 03 compared to the control strain Re H16 showed that the expression level of cbbL in recombinant Re 03 increased to 18.6 times that of the starting strain Re H16, and the expression level of cbbS increased to 23.1 times that of the starting strain, with a ratio of cbbL to cbbS expression levels of 0.75 in recombinant Re 03.

[0151] Example 4: Construction and characterization of recombinant strains in which a high-intensity promoter was inserted before cbbL. Using Ralstonia eutropha H16 as the starting strain, the cbbR gene was silenced, and the wild-type promoter prior to cbbL was replaced with a moderate-strength constitutive promoter (derived from sequence number 68 in Chinese patent invention CN108977890B, hereinafter referred to as p68), and its characteristics were measured.

[0152] Step 1: Construction of recombinant bacteria with a replaced promoter using homologous recombination. (1) The constitutive promoter p68 (SEQ ID NO: 17) was synthesized, and to facilitate subsequent operations, GGTCTCATCGT was added upstream of the synthesized DNA sequence and ACGCAGAGACC was added downstream.

[0153] (2) The basic plasmid pKO-L obtained in step 1 of Example 2 above and the synthesized constitutive promoter p68 were assembled using the Golden Gate method to obtain the recombinant plasmid pKO-L-p68. The recombinant plasmid was introduced into Escherichia coli S17-1 and then into Ralstonia eutropha H16 by conjugation. Taking advantage of the property that suicide plasmids cannot replicate in the host bacterium, positive clones were screened using an LB plate containing kanamycin 250 μg / mL and apramycin 100 μg / mL simultaneously. The recombinant plasmid containing homologous fragments in the positive clones was incorporated into specific positions in the genome where pcbbL-H1 and pcbbL-H2 exist to obtain the first homologous recombinant bacterium. The first homologous recombinant strain was streaked onto an LB plate containing 100 mg / mL of sucrose, and single clones were cultured. From these single clones, clones without kanamycin resistance were screened, and recombinant strains with inserted target genes were identified by PCR using primers pcbbL-F:gacatatgcgcaacatgccaga and pcbbL-R:ggacggccgaacttgtccag. The resulting recombinant strains were designated Ralstonia eutropha Re 04.

[0154] Step 2: Characterization of recombinant strains The fermentation characteristics of Ralstonia eutropha Re 04 were measured using Ralstonia eutropha H16 as a control strain. The specific operating steps were the same as in step 4 of Example 1 described above. As a result, as shown in Table 7 below, the dry weight of recombinant Re 04 increased by 13.7%, the PHA% increased by 10.4%, and the yield (titer) increased by 25.6% compared to the starting strain Re H16.

[0155] [Table 7]

[0156] Step 3: Measurement of cbbL and cbbS expression levels of recombinant strains during fermentation. The bacterial suspension fermented for 10 hours in step 2 above was taken, and transcriptome data was measured by a commercial company. As shown in Figure 4, the expression levels of cbbL and cbbS of recombinant Re 04 compared to the control strain Re H16 showed that the expression level of cbbL in recombinant Re 04 increased to 64.9 times that of the starting strain Re H16, and the expression level of cbbS increased to 66.5 times that of the starting strain, with a ratio of cbbL to cbbS expression levels of 0.91 in recombinant Re 04.

[0157] Example 5: Construction and characterization of recombinant strains in which a high-intensity promoter was inserted before cbbL. Using Ralstonia eutropha H16 as the starting strain, the cbbR gene was silenced, and the wild-type promoter prior to cbbL was replaced with an ultra-high-intensity constitutive promoter (derived from sequence number 81 in Chinese patent invention CN108977890B, hereinafter referred to as p81), and its characteristics were measured.

[0158] Step 1: Construction of recombinant bacteria with a replaced promoter using homologous recombination. (1) The constitutive promoter p81 (SEQ ID NO: 18) was synthesized, and to facilitate subsequent operations, GGTCTCATCGT was added upstream of the synthesized DNA sequence and ACGCAGAGACC was added downstream.

[0159] (2) The basic plasmid pKO-L obtained in step 1 of Example 2 above and the genetically synthesized constitutive promoter p81 were assembled using the Golden Gate method to obtain the recombinant plasmid pKO-L-p81. The recombinant plasmid was introduced into Escherichia coli S17-1 and then into Ralstonia eutropha H16 by conjugation. Taking advantage of the property that suicide plasmids cannot replicate in the host bacterium, positive clones were screened using an LB plate containing kanamycin 250 μg / mL and apramycin 100 μg / mL simultaneously. The recombinant plasmid containing homologous fragments in the positive clones was incorporated into specific positions in the genome where pcbbL-H1 and pcbbL-H2 exist to obtain the first homologous recombinant bacterium. The first homologous recombinant strain was streaked onto an LB plate containing 100 mg / mL sucrose, and single clones were cultured. From these single clones, clones without kanamycin resistance were screened, and recombinant strains with inserted target genes were identified by PCR using primers pcbbL-F:gacatatgcgcaacatgccaga and pcbbL-R:ggacggccgaacttgtccag. The resulting recombinant strains were designated Ralstonia eutropha Re 05.

[0160] Step 2: Characterization of recombinant strains The fermentation characteristics of Ralstonia eutropha Re 05 were measured using Ralstonia eutropha H16 as a control strain. The specific operating steps were the same as in step 4 of Example 1 described above. As a result, as shown in Table 8, the dry weight, PHA% and yield of recombinant strain Re 05 did not significantly improve compared to the starting strain Re H16.

[0161] [Table 8]

[0162] Step 3: Measurement of cbbL and cbbS expression levels of recombinant strains during fermentation. The bacterial suspension fermented for 10 hours in step 2 above was taken, and transcriptome data was measured by a commercial company. As shown in Figure 5, the expression levels of cbbL and cbbS in recombinant Re 05 compared to the control strain Re H16 were 141.5 times higher for Re 05 and 152.4 times higher for cbbS compared to the starting strain Re H16, with a cbbL to cbbS expression ratio of 0.86 for recombinant Re 05.

[0163] Example 6: Construction and characterization of cbbR mutant strains with the terminator between the cbbS and cbbX genes knocked out. Using the recombinant Ralstonia eutropha ReΔproCΔcbbR strain obtained in Example 1 above as the starting strain, we constructed strains containing the stable plasmid pSP-proC-cbbR (G205D, G118D) in which the terminator between the cbbS and cbbX genes was knocked out, and measured their characteristics.

[0164] Step 1: Knockout of the terminator between cbbS and cbbX using homologous recombination. (1) Using the genome of Ralstonia eutropha H16 as a template, PCR amplification was performed to obtain the upstream homology arm cbbS-X-H1 of the terminator using cbbS-X-H1F and cbbS-X-H1R, and the downstream homology arm cbbS-X-H2 of the terminator using cbbS-X-H2F and cbbS-X-H2R. Using the modified plasmid pK18mob as a template, amplification was performed using pK-F and pK-R to obtain vector fragments. The sequences of the primers used are shown in Table 9. For cbbS-X-H1 and cbbS-X-H2, the vector fragments were ligated using the Gibson Assembly method to obtain the base plasmid pKO-ΔS-X. Here, the sequences of the homology arms cbbS-X-H1 and cbbS-X-H2 are shown in SEQ ID NO: 12.

[0165] [Table 9]

[0166] (2) The recombinant plasmid pKO-ΔS-X was introduced into Escherichia coli S17-1, and then introduced into Ralstonia eutropha ReΔproCΔcbbR by conjugation. The method for constructing the recombinant strain was the same as in step 2 of Example 1, with primers proC-F and proC-R being replaced accordingly with primers cbbS-XF:tggggcgacatcagcttcaacta and cbbS-XR:gttggactcgaagaaacggtcca. The resulting recombinant strain was named Ralstonia eutropha ReΔproCΔcbbRΔS-X.

[0167] Step 2: Construction of a stable plasmid strain containing the cbbR (G205D, G118D) double mutant genes. The plasmid pSP-proC-cbbR (G205D, G118D) constructed in step 3 of Example 1 above was introduced into Escherichia coli S17-1, and then introduced into ReΔproCΔcbbRΔS-X by conjugation. Positive clones were screened on an LB plate containing 250 μg / l kanamycin. The resulting recombinant bacteria were designated as Ralstonia eutropha Re 06.

[0168] Step 3: Characterization of recombinant strains Using Ralstonia eutropha H16 as a control, the fermentation characteristics of the recombinant strain were measured as in step 4 of Example 1. As a result, as shown in Table 10, the dry weight of recombinant strain Re 06 increased by 6.8%, the PHA% increased by 6.8%, and the yield (titer) increased by 14.1% compared to the starting strain Re H16.

[0169] [Table 10]

[0170] Step 4: Measurement of cbbL and cbbS expression levels of recombinant strains during fermentation. The bacterial suspension fermented for 10 hours in step 3 above was taken, and transcriptome data was measured by a commercial company. As shown in Figure 6, the expression levels of cbbL and cbbS of recombinant Re 06 compared to the control strain Re H16 showed that the expression level of cbbL in recombinant Re 06 increased to 30.3 times that of the starting strain Re H16, and the expression level of cbbS increased to 29.1 times that of the starting strain, with a ratio of cbbL to cbbS expression levels of 0.97 for recombinant Re 06.

[0171] Example 7: Construction and characterization of recombinant strains obtained by knocking out the terminator between the cbbS and cbbX genes and inserting a low-intensity promoter before cbbL. Using the recombinant strain Ralstonia eutropha Re 02 obtained in Example 2 above as the starting strain, recombinant bacteria were constructed by knocking out the terminator between the cbbS and cbbX genes, and their characteristics were measured.

[0172] Step 1: Knockout of the terminator between cbbS and cbbX using homologous recombination. The recombinant plasmid pKO-ΔS-X constructed in Step 1 of Example 6 above was introduced into Escherichia coli S17-1, and then introduced into recombinant strain Re 02 obtained in Example 2 above by conjugation. The specific steps were the same as in Step 1 of Example 6, and the resulting recombinant strain with the terminator knocked out was designated as Ralstonia eutropha Re 07.

[0173] Step 2: Characterization of recombinant strains Using Ralstonia eutropha H16 as a control, the fermentation characteristics of the recombinant strain were measured as in step 4 of Example 1. As shown in Table 11, there were no significant differences in dry weight, PHA%, or yield (titer) of recombinant strain Re 07 compared to the starting strain Re H16.

[0174] [Table 11]

[0175] Step 3: Measurement of cbbL and cbbS expression levels of recombinant strains during fermentation. The bacterial suspension fermented for 10 hours in step 2 above was taken, and transcriptome data was measured by a commercial company. As shown in Figure 7, the expression levels of cbbL and cbbS of recombinant Re 07 compared to the control strain Re H16 showed that the expression level of cbbL in recombinant Re 07 increased to 3.4 times that of the starting strain Re H16, and the expression level of cbbS increased to 2.5 times that of the starting strain, with a cbbL to cbbS expression ratio of 1.25 in recombinant Re 07.

[0176] Example 8: Construction and characterization of recombinant strains in which the terminator between the cbbS and cbbX genes is knocked out and a medium-strength promoter is inserted before cbbL. Using the recombinant strain Ralstonia eutropha Re 03 obtained in Example 3 above as the starting strain, recombinant bacteria were constructed by knocking out the terminator between the cbbS and cbbX genes, and their characteristics were measured.

[0177] Step 1: Knockout of the terminator between cbbS and cbbX using homologous recombination. The recombinant plasmid pKO-ΔS-X constructed in Step 1 of Example 6 above was introduced into Escherichia coli S17-1, and then introduced into recombinant strain Re 03 of Example 3 above by conjugation. The specific steps were the same as in Step 1 of Example 6, and the resulting recombinant strain with the terminator knocked out was designated as Ralstonia eutropha Re 08.

[0178] Step 2: Characterization of recombinant strains Using Ralstonia eutropha H16 as a control, the fermentation characteristics of the recombinant strain were measured as in step 4 of Example 1. As shown in Table 12, there were no significant differences in dry weight, PHA%, or yield (titer) of recombinant strain Re 08 compared to the starting strain Re H16.

[0179] [Table 12]

[0180] Step 3: Measurement of cbbL and cbbS expression levels of recombinant strains during fermentation. The bacterial suspension fermented for 10 hours in step 2 above was taken, and transcriptome data was measured by a commercial company. As shown in Figure 8, the expression levels of cbbL and cbbS of recombinant strain Re 08 compared to the control strain Re H16 were as follows: the expression level of cbbL in recombinant strain Re 08 increased to 21.2 times that of the starting strain Re H16, and the expression level of cbbS increased to 7.6 times that of the starting strain, with a cbbL to cbbS expression ratio of 2.60 for recombinant strain Re 08.

[0181] Example 9: Construction and characterization of recombinant strains obtained by knocking out the terminator between the cbbS and cbbX genes and inserting a high-intensity promoter before cbbL. Using the recombinant strain Ralstonia eutropha Re 04 obtained in Example 4 above as the starting strain, recombinant bacteria were constructed by knocking out the terminator between the cbbS and cbbX genes, and their characteristics were measured.

[0182] Step 1: Knockout of the terminator between cbbS and cbbX using homologous recombination. The recombinant plasmid pKO-ΔS-X constructed in Step 1 of Example 6 above was introduced into Escherichia coli S17-1, and then introduced into recombinant strain Re 04 of Example 3 above by conjugation. The specific steps were the same as in Step 1 of Example 6, and the resulting recombinant strain with the terminator knocked out was designated as Ralstonia eutropha Re 09.

[0183] Step 2: Characterization of recombinant strains Using Ralstonia eutropha H16 as a control, the fermentation characteristics of the recombinant strain were measured as in step 4 of Example 1. As a result, as shown in Table 13, the dry weight, PHA%, and yield (titer) of recombinant strain Re 09 were not significantly improved compared to the starting strain Re H16.

[0184] [Table 13]

[0185] Step 3: Measurement of cbbL and cbbS expression levels of recombinant strains during fermentation. The bacterial suspension fermented for 10 hours in step 2 above was taken, and transcriptome data was measured by a commercial company. As shown in Figure 9, the expression levels of cbbL and cbbS of recombinant strain Re 09 compared to the control strain Re H16 showed that the expression level of cbbL in recombinant strain Re 09 increased to 79.7 times that of the starting strain Re H16, and the expression level of cbbS increased to 40.6 times that of the starting strain, with a cbbL to cbbS expression ratio of 1.83 for recombinant strain Re 09.

[0186] Example 10 Overexpression of cbbL and cbbS in a stable plasmid In this example, the Ralstonia eutropha ReΔproC strain from Example 1 was used as the starting strain. A stable plasmid containing cbbL expressed with the p47 promoter (derived from Sequence ID No. 47 in Chinese Patent Invention CN108977890B, hereinafter referred to as p47) and cbbS expressed with the p53 promoter was introduced into it, and characterization was performed.

[0187] Step 1: Construct a recombinant strain of stable plasmid containing cbbL expressed with the p47 promoter and cbbS expressed with the p53 promoter. (1) A plasmid that can be stably inherited in Ralstonia eutropha was constructed, and the proC, cbbS, and cbbL genes were loaded onto it. The proC gene with a BsaI interface sequence was synthesized, specifically the sequence shown in SEQ ID NO: 8. The pSP plasmid with a BsaI interface sequence was synthesized, specifically the sequence shown in SEQ ID NO: 9. The p53-cbbS-p47-cbbL gene with a BsaI interface sequence was synthesized, specifically the sequence shown in SEQ ID NO: 13. Golden gate assembly was performed on the above three plasmids to obtain the recombinant plasmid pSP-proC-p53-cbbS-p47-cbbL.

[0188] (2) The recombinant plasmid pSP-proC-p53-cbbS-p47-cbbL was introduced into Escherichia coli S17-1, and then introduced into ReΔproC by conjugation. Positive clones were screened on an LB plate containing kanamycin 250 μg / l. The resulting recombinant bacteria were designated as Ralstonia eutropha Re 10.

[0189] Step 2: Characterization of recombinant strains The fermentation characteristics of Ralstonia eutropha Re 10 were measured using Ralstonia eutropha H16 as a control strain. The specific operating steps were the same as in step 4 of Example 1 described above. As a result, as shown in Table 14, the dry weight, PHA% and yield (titer) of recombinant strain Re 10 did not significantly improve compared to the starting strain Re H16.

[0190] [Table 14]

[0191] Step 3: Measurement of cbbL and cbbS expression levels of recombinant strains during fermentation. The bacterial suspension fermented for 10 hours in step 2 above was taken, and transcriptome data was measured by a commercial company. As shown in Figure 10, the expression levels of cbbL and cbbS in the control strain relative to recombinant strain Re 10 were as follows: compared to the starting strain Re H16, the expression level of cbbL in recombinant strain Re 10 increased to 5.7 times that of the starting strain, and the expression level of cbbS increased to 3.9 times that of the starting strain. The ratio of cbbL to cbbS expression levels in recombinant strain Re 10 was 1.41.

[0192] Example 11: Overexpression of cbbL and cbbS in a stable plasmid In this example, ReΔproC was used as the starting strain, and a stable plasmid containing cbbL expressed with the p53 promoter and cbbS expressed with the p47 promoter was introduced into it, followed by characterization.

[0193] Step 1: Construct a recombinant strain of stable plasmid containing cbbL expressed with a low-intensity promoter and cbbS expressed with a high-intensity promoter. (1) A plasmid that can be stably inherited in Ralstonia eutropha was constructed, and the proC gene and the cbbS and cbbL genes were loaded onto it. The proC gene with a BsaI interface sequence was synthesized, specifically the sequence shown in SEQ ID NO: 8. The pSP plasmid with a BsaI interface sequence was synthesized, specifically the sequence shown in SEQ ID NO: 9. The p47-cbbS-p53-cbbL gene with a BsaI interface sequence was synthesized, specifically the sequence shown in SEQ ID NO: 14. Golden gate assembly was performed on the above three plasmids to obtain the recombinant plasmid pSP-proC-p47-cbbS-p53-cbbL.

[0194] (2) The recombinant plasmid pSP-proC-p47-cbbS-p53-cbbL was introduced into Escherichia coli S17-1, and then introduced into ReΔproC by conjugation. Positive clones were screened on an LB plate containing kanamycin 250 μg / l. The resulting recombinant strain was designated Ralstonia eutropha Re 11.

[0195] Step 2: Characterization of recombinant strains The fermentation characteristics of Ralstonia eutropha Re 11 were measured using Ralstonia eutropha H16 as a control strain. The specific operating steps were the same as in step 4 of Example 1 described above. As a result, as shown in Table 15, compared to the starting strain Re H16, the dry weight of recombinant Re 11 increased by 12.5%, the PHA% increased by 9.5%, and the yield (titer) increased by 25.7%.

[0196] [Table 15]

[0197] Step 3: Measurement of cbbL and cbbS expression levels of recombinant strains during fermentation. The bacterial suspension fermented for 10 hours in step 2 above was taken, and transcriptome data was measured by a commercial company. As shown in Figure 11, the expression levels of cbbL and cbbS in recombinant strain Re 11 compared to the starting strain Re H16 were 3.4 times higher for recombinant strain Re 11, 5.5 times higher for cbbS, and the ratio of cbbL to cbbS expression levels in recombinant strain Re 11 was 0.57.

[0198] In the above embodiments, only a portion of the methods for adjusting the expression levels of cbbL and cbbS were shown. According to the experimental results of the present invention, regardless of the method of adjusting gene expression, if the expression levels of cbbL and cbbS are kept within the range described in the present invention, an improvement in PHA production can be achieved. Therefore, the method of adjusting the expression levels of cbbL and cbbS is not limited to the examples shown in the above embodiments. Furthermore, although the above embodiments only showed the experimental results of fermentation experiments using palm oil as a carbon source, according to the common technical knowledge in this field, the synthesis pathways of PHA organisms using different oils and fats as carbon sources all use acyl-CoA obtained by β-oxidation as a key raw material, and their metabolic pathways and adjustment methods are substantially the same. Therefore, the actual inventive concept of the present invention is not limited to the specific selection of a carbon source, and other oil and fat carbon sources (e.g., vegetable oil, animal oil, kitchen waste oil, etc.) can all achieve the effects of the present invention.

[0199] The above embodiments are merely for illustrating the technical concepts of the present invention and do not limit them. Although the present invention has been described in detail using the above embodiments, it will be obvious to those skilled in the art that the technical concepts described in each of the above embodiments may be modified or some of their technical features may be replaced. These modifications and replacements do not cause the corresponding technical concepts to deviate from the spirit and scope of the technical concepts in each embodiment of the present invention. [Industrial applicability]

[0200] This invention provides the use of Calvin cycle-related genes cbbL and cbbS to adjust the ability of heterotrophic microorganisms to synthesize target metabolites from lipid carbon sources. Specifically, by improving the expression levels of Calvin cycle-related genes cbbL and cbbS, the ability of microorganisms to synthesize metabolites from lipids, the yield, and the efficiency of production can be improved. The Calvin cycle-related gene adjustment strategy provided by this invention can significantly improve the ability of microorganisms to synthesize metabolites such as PHA, and furthermore, it can efficiently improve the content and yield of metabolites such as PHA produced by microorganisms through fermentation, providing new modification targets and methods for constructing genetically engineered microorganisms for target metabolites.

Claims

1. The use of any one of the following: a Calvin cycle-related gene, its coding protein, or a biological material containing the said Calvin cycle-related gene, (1) Use to improve the ability of microorganisms to synthesize metabolites from lipids, (2) Use to improve the production volume of metabolic products produced by microorganisms using lipids, (3) Use to improve the production efficiency of metabolic products produced by microorganisms using lipids, (4) Use for constructing genetically engineered microorganisms that produce metabolites from oils and fats, (5) Use to improve the metabolic capacity of microorganisms to lipids, (6) Use to promote the β-oxidation cycle of microorganisms, The aforementioned Calvin cycle-related genes are cbbL and cbbS.

2. The use described above includes improving the expression level of the Calvin cycle-related gene and / or the enzymatic activity of the coding protein of the Calvin cycle-related gene in a microorganism. Preferably, improving the expression level of the Calvin cycle-related genes in the microorganisms increases the expression level of cbbL to 2 to 141 times the pre-adjustment level, and sets the expression ratio of cbbL to cbbS to (0.5 to 1.2):

1. The use described in feature 1.

3. The Calvin cycle-related genes are derived from heterotrophic microorganisms, preferably from Ralstonia eutropha, Escherichia coli, yeast, Pseudomonas, or Halomonas bacteria. and / or, the microorganism is a heterotrophic microorganism, preferably Ralstonia eutropha, Escherichia coli, yeast, Pseudomonas, or Halomonas. The use according to feature 1 or 2.

4. The use according to any one of claims 1 to 3, characterized in that the metabolite is synthesized using a metabolite of the β-oxidation cycle as a precursor.

5. The aforementioned metabolites use acetyl-CoA, acyl-CoA, enoyl-CoA, hydroxyacyl-CoA, and / or ketoacyl-CoA as synthetic precursors. Preferably, the metabolite is a polyester, an organic acid, an amino acid, an alcohol-based or hydrocarbon-based compound. The use described in feature 4.

6. This includes modifying microorganisms to improve the expression level of Calvin cycle-related genes and / or the enzymatic activity of coding proteins of Calvin cycle-related genes in microorganisms. The Calvin cycle-related genes are cbbL and cbbS. A method for improving the production volume of metabolites produced by microorganisms using lipids and fats, characterized by the features described above.

7. The method according to claim 6, characterized in that improving the expression level of Calvin cycle-related genes in the microorganisms involves increasing the expression level of cbbL to 2 to 141 times the pre-modification level, and setting the expression ratio of cbbL to cbbS to (0.5 to 1.2):

1.

8. The method according to 6 or 7, characterized in that the microorganism is a heterotrophic microorganism, preferably Ralstonia eutropha, Escherichia coli, yeast, Pseudomonas, or Halomonas.

9. The method according to any one of claims 6 to 8, characterized in that the metabolite is synthesized using a metabolite of the β-oxidation cycle as a precursor.

10. The aforementioned metabolites use acetyl-CoA, acyl-CoA, enoyl-CoA, hydroxyacyl-CoA, and / or ketoacyl-CoA as synthetic precursors. Preferably, the method according to 9, characterized in that the metabolite is a polyester, an organic acid, an amino acid, an alcohol-based or hydrocarbon-based compound.

Images