Fully modified miR-34a and related conjugates, compositions and methods of use

Abstract

Fully chemically modified microRNAs (miRNAs) such as miR-34a; (i) miRNAs, (ii) targeting ligands such as folate, DUPA, or a ligand present in PSMA-617, and (iii) optionally a group that improves tumor uptake of the conjugate, such as a group containing an albumin-binding moiety; compositions comprising miRNAs / conjugates; and methods for treating cancer using the same.

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims the benefit of U.S. Application No. 63 / 454,177, filed Mar. 23, 2023, which is incorporated herein by reference in its entirety as if fully set forth herein.

[0002] Statement of Government Support This application was made under Government support awarded by the National Institutes of Health as CA226259 and CA205420 and by the Department of Defense as W81XWH - 21 - 1 - 0181. The Government has certain rights in this invention.

[0003] Incorporation by Reference of a Sequence Listing This application is filed electronically in ST26 format and includes a sequence listing that is incorporated herein by reference in its entirety. The ST26 file was created on Mar. 22, 2024, has the name "1165172WO1.xml", and is 18,581 bytes in size.

[0004] ? Technical Field The present invention relates to chemically modified microRNA (miRNA), conjugates comprising the same, compositions comprising miRNA / conjugates, and methods of using the same in the treatment of cancer.

Background Art

[0005] Background MicroRNA (miRNA)-based therapies are emerging as potential therapeutic tools for treating multiple diseases due to their unique ability to potently regulate the expression of multiple genes. Reduced miRNA stability, potential immunogenic effects associated with unmodified RNA, and the lack of safe delivery media are major obstacles to the clinical application of miRNAs. Unmodified miRNAs are rapidly degraded by nucleases, which impairs their activity and necessitates the use of high doses and repeated administrations, making them unsuitable for in vivo application. Several chemical modifications, including 2'-O-methyl and 2'-fluoro modifications to ribose and phosphorothioate substitutions to the backbone, have been used to stabilize RNA. Ribose modifications improve binding affinity and provide protection against nucleases, while phosphorothioate binding confers further resistance to exonucleases. Nevertheless, large-scale modifications alter target-gene affinity and increase RNA double-strand stability, thereby interfering with miRNA silencing activity and making it difficult for the RNA-induced silencing complex (RISC) to unwind the double-strand and load the active strand. Therefore, it is crucial to carefully design and select modifications that enhance RNA stability while simultaneously facilitating target gene suppression and RISC loading and processing. In the case of siRNA and antisense oligonucleotides (ASOs), chemical modifications induced effective and sustained silencing of targeted transcripts, ultimately reducing therapeutic doses. However, achieving the same benefits remains challenging for miRNA double-strands.

[0006] Because they are short, non-coding RNAs, miRNAs possess the unique ability to simultaneously downregulate multiple genes. For example, in the case of tumor suppressor miRNAs, several oncological pathways controlling cell proliferation, migration and invasion, resistance to apoptosis, and immune evasion can all be regulated by miRNA-34a targeting androgen receptors (AR), C-MYC, AXL, MET, sirtuin 1 (SIRT1), CD44, programmed death ligand-1 (PDL-1), and others. Despite the significant benefits achieved by simultaneous targeting of multiple genes, predicting the effects of chemical modifications on the multifaceted activity of miRNAs remains difficult. Therefore, laborious research to evaluate the effects of chemical modifications on miRNA stability and activity is necessary to bring modified miRNA therapies to clinical practice.

[0007] Ligand-mediated delivery of siRNA and miRNAs is being developed to achieve safe and specific targeting of cancer cells. This approach relies on the use of targeting ligands that have high affinity and specificity to receptors upregulated by the targeted cells. For example, we previously developed a folate-miRNA conjugate (FolamiR) for the delivery of miR-34a (FolamiR-34a). Systemic delivery of FolamiR-34a to tumor-bearing mice results in downregulation of miR-34a target genes, leading to in vivo inhibition of tumor growth. Despite the observed response, the activity of FolamiR-34a is limited by capture in endosomes and degradation by various nucleases. Inclusion of the endosomal escape portion allows for increased cytoplasmic accumulation of miR-34a, but the presence of cellular nucleases reduces the half-life of miR-34a, masking its maximum potential. One way to increase miRNA stability is through the use of fully modified nucleotides. However, the effects of complete chemical modification on the activity of tumor suppressor miRNA double helix and how these modifications affect targeting are not fully understood.

[0008] A few studies used fully modified miRNAs; however, in any case, they lacked in vivo efficacy. For example, fully modified let-7b, containing alternating 2'-O-methyl and 2'-fluororibose bases and phosphorothioate bonds conjugated to various lipids, silenced HMGA2 mRNA. However, the in vivo tumor-suppressive effect of let-7b was not demonstrated, likely due to the lack of a specific delivery medium. In further studies, single-stranded oligonucleotides mimicking the active (antisense) strand of the miR-34a double helix were produced. This chemical modification, after transfection, induced comparable miR-34a target gene silencing compared to unmodified miR-34a double helix. It was not determined whether the single-stranded oligonucleotides performed better than the corresponding double helix with the same modifications. Furthermore, the in vivo efficacy of chemically modified single-stranded oligos was not evaluated. Indeed, single-stranded oligos are subject to several barriers, including degradation by nucleases before reaching the targeting site. To overcome the aforementioned obstacles and deepen the influence of chemical modification on miRNA double-strand activity, we developed chemically modified miR-34a double-strands and compared their stability and activity to partially modified miR-34a both cellularly and in vivo, either post-transfection or using clinically relevant FolamiR-conjugates. [Overview of the project] [Problems that the invention aims to solve]

[0009] From the above perspective, an object of the present invention is to provide fully modified miRNAs, particularly for the treatment of cancer. Another object of the present invention is to provide conjugates containing fully modified miRNAs. These and other objects and advantages, as well as inventive features, will become apparent from the detailed description provided herein. [Means for solving the problem]

[0010] summary A fully chemically modified microRNA (miRNA) is provided, wherein the miRNA is modified with 2'-O-methyl, 2'-fluororibose bases and phosphorothioate bonds. The miRNA may be miR-34a. The sense strand of a miRNA that may be miR-34a may have 15 nucleotides, while the sense strand of a miRNA that may be anti-miR-34a may have 22 nucleotides. Each strand of the miRNA may contain an alternating pattern of 2'-O-methyl-modification and 2'-fluoro-modification sugars and phosphorothioate bonds at the 5' and 3' ends of the strand. In one embodiment, the sense strand is sequenced: / 52FG / *mC* / i2FU / mA / i2FA / mG / i2FA / mC / i2FA / mC / i2FU / mG / i2FC / *mC* / i2FA / / 3Azide N / (Sequence No. 4) It may have, and the antisense strand is in sequence: 5Phos / mU* / i2FG / *mG / i2FC / mA / i2FG / mU / i2FG / mU / i2FC / mU / i2FU / mA / i2FG / mC / i2FU / mG / i2FG / mU / i2FU / mG* / 32FU / (Sequence number 5) It may have, where m is 2'-O-methyl; F is 2'-fluoro; r is a ribonucleotide; i is internal; * is a phosphorothioate bond; and Phos is a 5'-phosphate.

[0011] Conjugates containing miRNAs and folates are also provided. The conjugates may further contain groups that improve tumor uptake of the conjugate, such as groups that contain or are albumin-binding moieties.

[0012] Further provided are conjugates comprising miRNA and ligands present in DUPA or PSMA-617. The conjugate may further comprise groups that improve tumor uptake of the conjugate, such as groups comprising or being albumin-binding moieties. Further provided are compositions comprising miRNA and pharmaceutically acceptable carriers, diluents, or additives.

[0013] Further compositions comprising a conjugate and a pharmaceutically acceptable carrier, diluent, or additive are also provided.

[0014] A method for treating cancer in a subject is also provided. The method involves administering to the subject a cancer-treatment-effective amount of miRNA, optionally as a composition comprising miRNA and a pharmaceutically acceptable carrier, diluent, or additive, thereby treating the cancer in the subject. The miRNA may be miR-34a. The sense strand of a miRNA that may be miR-34a may have 15 nucleotides, while the sense strand of a miRNA that may be anti-miR-34a may have 22 nucleotides. Each strand of miRNA may contain an alternating pattern of 2'-O-methyl-modified and 2'-fluoro-modified sugars and phosphorothioate bonds at the 5' and 3' ends of the strand. In one embodiment, the sense strand is sequenced: / 52FG / *mC* / i2FU / mA / i2FA / mG / i2FA / mC / i2FA / mC / i2FU / mG / i2FC / *mC* / i2FA / / 3Azide N / (Sequence No. 4) It may have, and the antisense strand is in sequence: 5Phos / mU* / i2FG / *mG / i2FC / mA / i2FG / mU / i2FG / mU / i2FC / mU / i2FU / mA / i2FG / mC / i2FU / mG / i2FG / mU / i2FU / mG* / 32FU / (Sequence number 5) It may have, where m is 2'-O-methyl; F is 2'-fluoro; r is a ribonucleotide; i is internal; * is a phosphorothioate bond; and Phos is a 5'-phosphate. The cancer may be lung cancer, breast cancer, ovarian cancer, or prostate cancer.

[0015] Further methods for treating cancer in a subject are provided. The method involves administering to the subject a conjugate containing a cancer-treatment-effective amount of miR-34a and folate, optionally as a composition comprising the conjugate and a pharmaceutically acceptable carrier, diluent, or additive, thereby treating the cancer in the subject. The conjugate may further contain groups that improve tumor uptake of the conjugate, such as groups containing or being albumin-binding moieties. The cancer may be lung cancer, breast cancer, ovarian cancer, or colorectal cancer, or medulloblastoma.

[0016] Further methods for treating cancer in a subject are provided. The method involves administering to the subject a cancer-treatment-effective amount of a conjugate containing a ligand present in DUPA or PSMA-617, optionally as a composition comprising the conjugate and a pharmaceutically acceptable carrier, diluent, or additive, thereby treating the cancer in the subject. The conjugate may further contain a group that improves tumor uptake of the conjugate, such as a group containing or being an albumin-binding moiety. The cancer may be prostate cancer. [Brief explanation of the drawing]

[0017] The embodiments disclosed and other characteristics, advantages, and aspects included herein, and matters relating to achieving them, will become apparent in light of the following detailed descriptions of various exemplary embodiments of the invention. Such detailed descriptions will be better understood in conjunction with the accompanying drawings.

[0018] [Figure 1]Figures 1A-1F. Chemical composition and stability of partially modified (PM) and fully modified (FM) miR-34a. A) Chemical modification patterns of PM-miR-34a and FM-miR-34a (SEQ ID NOs: 1-3). B) Structures of various chemical modifications used in (A). C) Representative gel red-stained polyacrylamide gels of PM and FM miR-34a show successful complete annealing of the miRNA double helix, as indicated by the shift in mobility on the gel (n=3). D) Representative gel red-stained polyacrylamide gels of unmodified (UM), PM, and FM miR-34a after exposure to 50% serum at various times (left panel). Band intensity was quantified using imageJ software and normalized to 0 o'clock in (E). F) FM-miR-34a was incubated with 50% serum for the indicated time, then packed into polyacrylamide gels and stained with gel red.

[0019] [Figure 2]Figures 2A-2F. Comparison of cellular activity of PM and FM-miR-34a. A) Targeted silencing of the miR-34a sea urchin sensor after transfection of MB231-miR-34a sensor cells with PM and FM-miR-34a double helix using various doses (n=3). B) Normalized firefly luciferase signaling in BEAS-2B cells after co-transfection with pmiRGlo plasmid (Promega) and PM-miR-34a, FM-miR-34a, or NC double helix (n=3). C) Western blot images show a significant decrease in MET and CD44 after transfection of MB-231 cells with FM-miR-34a and PM-miR-34a double helix at time 50 nM. D) Western blot images show a significant decrease in androgen receptor (AR) expression after transfection of LNCaP cells with 50 nM FM-miR-34a and PM-miR-34a bihedra. Evaluation of endogenous miR-34a target (E) or non-target (F) expression in MB-231 cells after transfection with 50 nM PM-miR-34a or FM-miR-34a bihedra by qRT-PCR (mean ± SD, (n=3). *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001 compared to siluc2 (one-way ANOVA). GAPDH was used as an endogenous control. NC: siluc2.

[0020] [Figure 3]Figures 3A-3E. FM-miR-34a inhibits cancer cell proliferation, migration, and invasion. Evaluation of the effect of PM-miR-34a or FM-miR-34a on the proliferation of MB-231 cells A) or LNCaP cells B) as measured by SRB assay (mean ± SD, n=3 **P<0.01, ***P<0.001, ****P<0.0001, one-way ANOVA). C) Representative images of MB-231 cells that migrated through 6 μm pore transwells for 6 hours after 72 hours of transfection with PM-miR-34a or FM-miR-34a (n=3). D) Representative images of LNCaP cells that invaded through the Matrigel matrix for 96 hours after 48 hours of transfection with PM-miR-34a or FM-miR-34a (n=3). E) Evaluation of the effect of PM-miR-34a or FM-miR-34a on the proliferation of MB-231 cells using a colony formation assay after transfection with NC or miR-34a double helix (n=3).

[0021] [Figure 4]Figures 4A-4F. FM-miR-34a activity requires AGO loading. A) Quantification of miR-34a using qrt-PCR after Ago immunoprecipitation. MB-231 cells were transfected with NC, PM-miR-34a, FM-miR-34a, or miR-34a mimetic, followed by Ago immunoprecipitation to quantify miR-34a. miR-34a expression in Ago-IP samples was normalized to miR-34a in IgG-IP and used as input. B-D) Effects of Ago2 knockdown on miR-34a activity, showing the contribution of Ago2 to FM-miR-34a activity. B) Sea lizard luciferase expression in MB-231 sensor cells after transfection with NC, PM-miR-34a, FM-miR-34a, or miR-34a mimetic in or without siRNA against Ago2 (mean ± SD, n=3, ****P<0.0001, two-sided Student's t-test). C-D) Western blot images show the reduced effect of FM-miR-34a on MET or AR expression after transfection of MB-231 or LNCaP cells with 50nM PM-miR-34a or FM-miR-34a, respectively, in the presence of 50nM siAgo2. E) Proliferation of MB-231 cells measured by SRB 120 hours after transfection with 50nM PM-miR-34a or FM-miR-34a in the presence of 50nM siAgo2 double helix (mean ± SD, n=3, **P<0.01, two-sided Student's t-test). F) Migration of MB-231 cells measured by migration assay after transfection with 50nM PM-miR-34a or FM-miR-34a in the presence of 50nM siAgo2 double helix.

[0022] [Figure 5]Figures 5A-5I. In vivo efficacy of fully modified miR-34a. A-B) Subcutaneous tumor growth using MB-231 cells transfected with 50nM PM-miR-34a, FM-miR-34a, or NC double helix (NC: n=6 and PM-miR-34a and FM-miR-34a: n=4; error bars: mean ± SEM; #: corresponds to ****P<0.0001); tumor volume is shown in (A) and (B) is a representative image showing tumors taken from mice at the endpoint of the study. C) Representative image shows sea urticaria luciferase sensor signaling in nude mice implanted with MB-231 sensor cells after a single intravenous injection of 1.5 nmol folate-NC(siluc2), folate-PM-miR-34a, or folate-FM-miR-34a. D) Effect of folate-FM-miR-34a delivery on miR-34a-sea mushroom sensor signaling over time (data normalized to day 0; error bars: mean ± SEM, n=3). E) Western blot images showing protein expression of miR-34a targets (MET, CD44, and AXL) in excised MB-231 tumors 120 hours after intravenous injection of a single dose (1.5 nmol) of folate-NC(siluc2), folate-PM-miR-34a, or folate-FM-miR-34a bistrand. F) Levels of miR-34a from excised MB-231 tumors quantified by quantitative reverse transcription polymerase chain reaction (qRT-PCR) 120 hours after injection of various folate conjugates (n=3 and at least 3 different technical replicates; error bars: mean ± SD; one-way ANOVA). G) Tumor volume after treatment with various folete-miRNA conjugates (folate-NC: n=6; folete-miR-34a: n=5; folete-FM-miR-34a: n=6). Arrows indicate treatment time (1.5 nmol, intravenous injection, once every 6 days). *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001; two-way ANOVA. Body weight measurements throughout the treatment period did not show significant changes, as shown in (H) (error bars: mean ± SD).As in the preliminary assessment of potential immune responses, FM-FolamiR-34a or PM-FolamiR-34a was injected into the tail vein of immunocompetent mice (FVB.129 background), and serum IL-6 (I, left panel) and TNF-α (I, right panel) cytokine levels were quantified 2 hours after injection. Compared to positive control mice injected with LPS, FM-FolamiR-34a or PM-FolamiR-34a resulted in a significant increase in cytokine levels compared to negative controls.

[0023] [Figure 6] This describes the synthesis of folate-DBCO using a solid-phase peptide synthesis method.

[0024] [Figure 7] This is a graph of time (hours) versus OD value (normalized to 24 hours).

[0025] [Figure 8] This shows the synthesis of OTL-38 (folate-NIR).

[0026] [Figure 9] This shows confirmation of FM-miR-34a detection using qRT-PCR (mean ± SD, n=3).

[0027] [Figure 10]Figures 10A-10G. FM-miR-34a gene targeting is more robust than PM-miR-34a. a) Total number of genes with statistically significant (p<0.05) expression differences in MB-231 cells transfected with PM-miR-34a or FM-miR-34a compared to siluc2-transfected (NC) or untreated (UT) cells. b) Volcano plots of upregulatory (orange) and downregulatory (blue) genes comparing cells transfected with PM-miR-34a and NC, or FM-miR-34a and NC. Gene labels represent the top 6 upregulatory and downregulatory genes based on the lowest p-value and the top 2 upregulatory and downregulatory genes based on the multiplier change from each comparison. Dashed lines represent the p-value cutoff (0.05). Gray dots indicate non-significant genes. c) Duplication of statistically significant downregulated genes in PM-miR-34a vs NC, FM-miR-34a vs NC, and FM-miR-34a vs PM-miR-34a comparisons. d) Heatmap of differentially expressed genes sorted based on the most different regulation between FM-miR-34a and NC. e) miRNA target enrichment analysis of statistically significant downregulated genes c comparing PM-miR-34a vs NC and FM-miR-34a vs NC based on the mirTarBase database. Dot size represents the number of identified target genes. From each comparison, the top 3 predicted miRNAs are labeled, and their p-values ​​and the number of target genes identified experimentally are shown in the table. f) Visualization of selected biological processes from gene set enrichment analysis comparing all statistically significant genes specific to biological processes for PM-miR-34a vs NC (yellow) and FM-miR-34a vs NC (red). In each sector, the x-axis represents the gene and the y-axis shows the magnification change. Red indicates genes regulated only under FM-miR-34a conditions, yellow indicates genes regulated only under PM-miR-34a conditions, and overlapping regions indicate genes common to both conditions. All analyses were performed using significantly altered genes (p<0.05).g) The line graph shows the cumulative number and rank of downregulatory genes in PM-miR-34a vs NC (black) or FM-miR-34a vs NC (red) that overlap with known / predicted miR-34a targets in the miRDB database. Target rank (y axis) starts from the highest-ranked miR-34a target gene and goes down to low-stringent targets. The inset plot shows similar plots for the top 100 miR-34a targets.

[0028] [Figure 11] Silencing of miR-34a sea urchin sensors after transfection with partially and fully modified miR-34a double helices. Sea urchin luciferase expression (mean ± SD, n=3) at 24 and 48 hours after transfection of MB-231 miR-34a sensor cells with various doses of PM-miR-34a and FM-miR-34a double helices. Data normalized for NC, one-way ANOVA, ****P<0.0001.

[0029] [Figure 12] Chemical modification patterns of FM-miR-34a (SEQ ID NOs: 1 and 14).

[0030] While the present invention may be subject to various modifications and other forms, exemplary embodiments are described herein in detail, illustrated in an illustrative manner. [Modes for carrying out the invention]

[0031] Detailed description For the purpose of facilitating an understanding of the principles, embodiments described herein will be referenced in the drawings, and specific terms will be used to describe the same. Nevertheless, it will be understood that the description of these embodiments is not intended to limit the scope. On the contrary, this disclosure includes alternatives, modifications, and equivalents that may be included within the spirit and scope of this application as defined by the attached claims.

[0032] This disclosure is based on the discovery that fully modified (FM) miRNAs, at least partially, can increase their stability by 400-fold compared to unmodified miRNAs without compromising their activity. Therefore, the term “fully modified miRNA” includes miRNA I, in which the 2'-OH groups of all ribose bases are replaced with 2'-F or 2'-OMe, and the double helix contains at least seven phosphorothioate bonds. In some embodiments, fully modified miRNAs may further contain 5'-vinyl phosphonates instead of 5'-phosphates. In particular, miRNAs known as miR-34a are fully modified, and when fully modified, miR-34a (FM-miR-34a) contains over 90% of the targets, including CD44, AXL, and MET, compared to partially modified (PM-miR-34a) miR-34a, and more robustly downregulates the targets of miR-34a. Downregulation occurs in an Argonaut 2 (Ago2) protein-dependent manner. Forced expression of FM-miR-34a in breast cancer cells more potently inhibited proliferation and invasion and delayed tumor growth compared to partially modified miR-34a (PM-miR-34a). Systemic delivery of a single dose of FM-miR-34a conjugated to folate (FM-FolamiR) induced potent and prolonged downregulation of target gene expression at a dose three times lower than that for PM-miR-34a conjugated to folate (PM-FolamiR). Surprisingly, FM-FolamiR significantly inhibited tumor growth in mice, and some mice achieved complete remission.

[0033] From the above perspective, the object of the present invention is to provide fully chemically modified microRNAs (miRNAs), such as those shown in Figure 1A. miRNA 100 is double-stranded and includes a sense strand (also called a passenger strand) 102 and an antisense strand (also called a guide strand) 104. One strand may be longer than the other, or one strand may be substantially the same length as the other (e.g., a 3-nucleotide base chain). Each strand of miRNA may independently be about 12 to about 40 nucleotides long, for example, in the range of 14-40, 16-40, 18-40, 20-40, 22-40, 24-40, 26-40, 28-40, 30-40, 14-38, 14-36, 14-34, 14-32, 14-30, 14-28, 14-26, 14-24, or 14-22. The sense 102 strand and the antisense 104 strand may or may not be of equal length. In one embodiment, the antisense strand 104 is, for example, 1, 2, 3, 4, 5, 6, or 7 nucleotides longer than the sense strand 102 (e.g., 1-5, 2-6, 3-7, or 2-7 nucleotides). In one embodiment, the sense strand 102 of the miRNA may have 15 nucleotides, while the antisense strand 104 of the miRNA may have 22 nucleotides.

[0034] In one embodiment, a fully chemically modified miRNA may include an antisense sequence comprising at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of SEQ ID NO: 1, for example, 7-10, 7-15, 8-16, 7-19, or 8-20 consecutive nucleotides of SEQ ID NO: 1. In one embodiment, the seven consecutive nucleotides are GGCAGUG, which is the same “seed” sequence shared by the miR-34 family of miRNAs, including miR-34a (UGGCAGUGUCUUAGCUGGUUGU; SEQ ID NO: 1), miR-34b (UAGGCAGUGUCAUUAGCUGAUUG; SEQ ID NO: 15), miR-34c (AGGCAGUGUAGUUAGCUGAUUGC; SEQ ID NO: 16), miR-449a (UGGCAGUGUAUUGUUAGCUGGU; SEQ ID NO: 17), miR-449b (AGGCAGUGUAUUGUUAGCUGGC; SEQ ID NO: 18), and miR-449c (UAGGCAGUGUAUUGCUAGCGGCUGU; SEQ ID NO: 19). For example, see Figure 2 in J Biol Chem. 2019 Mar 22; 294(12): 4381-4400, which is incorporated by reference as fully shown here. Accordingly, the present invention intends fully chemically modified miRNA versions of miR-34b, miR-34c, and miR-449a~c.

[0035] miRNAs have a double-stranded or dual-stranded region 106. Generally, the double-stranded region is 12 to 25 nucleotide base pairs long, for example, 12, 14, 16, 18, 20, 22, or 24 nucleotide base pairs long. In some embodiments, the double-stranded region is 20, 21, 22, 23, or 24 nucleotide base pairs long.

[0036] Referring to Figure 1A, when the sense and antisense strands have different lengths, the miRNA has a single-stranded or "overhanging" region 108. Generally, the single-stranded (overhanging) region 108 is at least about 4 nucleotides, at least about 5 nucleotides, at least about 6 nucleotides, or at least about 7 nucleotides long, for example, 7–20 nucleotides long or 4–20 nucleotides long. In one embodiment, the single-stranded region 108 is located at the 3' end of the antisense strand 104. In another embodiment, the single-stranded region 108 is located at the 5' end of the antisense strand.

[0037] The antisense strand 104 may align with the 5' end (or nearby) of the sense strand 102. When the antisense strand 104 aligns with the 5' end (or nearby) of the sense strand 102, a targeting ligand such as folate, DUPA, or a ligand present in PSMA-617 can bind to the 5' end of the antisense strand, where folate has the following structure: [ka] It has.

[0038] The structure of DUPA is shown below, as are the structures of other targeting ligands that can be used with the ligand present in PSMA-617 and miRNAs. [ka] PSMA-617 itself, structure: [ka] It has.

[0039] Alternatively, the antisense strand 104 can align with the 3' end (or nearby) of the sense strand 102, as shown in Figure 1A. Alignment with the 3' end (or nearby) of the sense strand 102 may enhance stability. When the antisense strand 104 aligns with the 3' end (or nearby) of the sense strand 102, targeting ligands such as folate, DUPA, or ligands present in PSMA-617 can bind to the 3' end of the sense strand 102. Another option is that the antisense strand 104 can align with the sense strand 102 at any position along its length, in which case the targeting ligand, such as folate, DUPA, or ligands present in PSMA-617, can align with the 5' or 3' end of the sense strand 102, for example, either end of the sense strand 102 being close to the end of the antisense strand 104.

[0040] miRNAs may and may not be at least partially modified, preferably fully modified. Examples of modifications include, but are not limited to, 2'-O-methyl, 2'-fluororibose bases and phosphorothioate bonds shown in Figure 1B. Any configuration of modifications that increase stability without impairing activity is available, including the inclusion of extended nucleic acids that can be incorporated into the 3' end of the antisense strand 104. One example of a suitable extended nucleic acid is given by formula: [ka] This is the case where "Base" means A, T, C, or G; T 1 is H or OH; and X 1 These are alkyl groups, such as C1-C3 alkyl groups, such as CH2, CH2CH2, and CH2CH2CH2. Such extended nucleic acids replace the phosphorothioate bond between G and U at the 3' end of antisense strand 104 in Figure 1A.

[0041] In one embodiment, the miRNA may contain at least one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, or more 2'-fluororibose bases. All 2'-fluororibose bases may be present on one strand, i.e., the antisense strand 104 or the sense strand 102. In one embodiment, the sense strand and antisense strand 102 / 104 contain at least one, two, three, four, five, six, or more 2'-fluororibose bases. In one embodiment, the sense strand 102 contains at least one, two, three, four, five, six, or seven 2'-fluororibose bases, and the antisense strand 104 contains at least one, two, three, four, five, six, seven, eight, nine, ten, or eleven 2'-fluororibose bases. 2'-fluoromodifications can occur in patterns of adjacent nucleotides, alternating nucleotides, or alternating and adjacent nucleotides. The location / pattern of 2'-fluoromodifications on one chain may differ from that of the other chain.

[0042] In one embodiment, the miRNA may contain at least one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, or more 2'-O-methyl-modified nucleotides. All 2'-O-methyl-modified nucleotides may be present on one strand, i.e., the antisense strand 104 or the sense strand 102. In one embodiment, the sense strand and antisense strand 102 / 104 contain at least one, two, three, four, five, six, or more 2'-O-methyl-modified nucleotides. In one embodiment, the sense strand 102 contains at least one, two, three, four, five, six, or seven 2'-O-methyl-modified nucleotides, and the antisense strand 104 contains at least one, two, three, four, five, six, seven, eight, nine, ten, or eleven 2'-O-methyl-modified nucleotides. 2'-O-methyl-modified nucleotides can occur in patterns of adjacent nucleotides, alternating nucleotides, or alternating and adjacent nucleotides. The position / pattern of 2'-O-methyl-modified nucleotides on one strand may differ from the position / pattern of 2'-O-methyl-modified nucleotides on the other strand.

[0043] Each of the nucleotides in the single-stranded (overhang) region 108 can be independently modified, for example, by 2'-sugar modifications, such as 2'-fluoro, 2'-O-methyl, thymidine (T), 2'-O-methoxyethyl-5-methyluridine, 2'-O-methoxyethyladenosine, and 2'-O-methoxyethyl-5-methylcytidine.

[0044] The 5' or 3' single-stranded region may be modified, for example, by phosphorylation at an internucleotide bond of a phosphorothioate or methylphosphonate, where the nucleotides may be identical or different. Other modifications include, but are not limited to, 5' phosphorylation by phosphoryl analogs. Examples of modifications include 5'-monophosphate, 5'-diphosphate, 5'-triphosphate, 5'-guanosine, 5'-adenosine, 5'-monothiophosphate, 5'-monodhithiophosphate, 5'-phosphorothiolate, and 5'-vinylphosphonate. [ka] This includes, but is not limited to, A, T, C, or G, where "Base" includes A, T, C, or G.

[0045] In one embodiment, each strand of miRNA contains an alternating pattern of 2'-O-methyl-modified and 2'-fluoro-modified sugars and phosphorothioate bonds at the 5' and 3' ends of the strand. In one embodiment, the phosphorothioate bonds may be present in a substantial portion of the single-stranded overhang region of the longer strand (e.g., the phosphorothioate bonds may be present throughout the entire single-stranded overhang region). Thus, for example, each strand of miRNA may contain phosphorothioate bonds at the 5' and 3' ends, including multiple bonds that extend into the single-stranded overhang of the longer strand. The miRNA may be miR-34a or a miR-34a mimetic (see, for example, U.S. Patent Application Publications 2012 / 0288933, 2013 / 0123329, and 2015 / 0087607, respectively, incorporated as fully shown herein by reference). In one embodiment, sense strand 102 is sequenced: / 52FG / *mC* / i2FU / mA / i2FA / mG / i2FA / mC / i2FA / mC / i2FU / mG / i2FC / *mC* / i2FA / / 3Azide N / (Sequence No. 4) The antisense strand 104 may have the following sequence: 5Phos / mU* / i2FG / *mG / i2FC / mA / i2FG / mU / i2FG / mU / i2FC / mU / i2FU / mA / i2FG / mC / i2FU / mG / i2FG / mU / i2FU / mG* / 32FU / (Sequence number 5) It may have m, where m is 2'-O-methyl; F is 2'-fluoro; r is a ribonucleotide; i is internal; * is a phosphorothioate bond; and Phos is a 5'-phosphate. See Figure 1A.

[0046] Conjugates containing a miRNA, e.g., miR-34a, and a ligand are also provided. Any suitable / desirable ligand can be bound to the miRNA. In various embodiments, the ligand is bound covalently, either directly or indirectly via a linker (L).

[0047] L can be any suitable linker. For example, L may be a "non-freeable linker" or a "non-cleavable linker." A "non-freeable linker" or "non-cleavable linker" refers to a linker that cannot be cleaved under extracellular physiological conditions (e.g., pH-unstable, acid-unstable, oxidative-unstable, or enzyme-unstable linkage). However, such linkers may include links that can be cleaved after entry into the cell.

[0048] In other examples, L may be a “free-liberating linker.” A “free-liberating linker” is a linker that contains at least one bond that can be broken under physiological conditions (e.g., pH-unstable, acid-unstable, oxidative-unstable, or enzyme-unstable bond). Free-liberating groups also include photochemically cleavable groups. Examples of photochemically cleavable groups include linkers containing the 2-(2-nitrophenyl)-ethane-2-ol group, o-nitrobenzyl, decyl, trans-o-cinnamoyl, m-nitrophenyl, or benzylsulfonyl group (see, for example, Dorman and Prestwich, Trends Biotech. 18:64-77 (2000); Greene and Wuts, Protective Groups in Organic Synthesis, 2nd ed., John Wiley & Sons, New York (1991); and U.S. Patents 5,143,854; 5,986,076; 5,917,016; 5,489,678; and 5,405,783, all of which are specifically incorporated by reference with respect to the teachings relating thereto).

[0049] L may contain atomic chains of approximately 3 to approximately 30 atoms (e.g., approximately 3 to 30 atoms, 3 to approximately 30 atoms, 3 to approximately 30 atoms, approximately 3 to approximately 7 atoms, approximately 5 to approximately 15 atoms, approximately 5 to approximately 25 atoms, approximately 5 to approximately 12 atoms, approximately 7 to approximately 15 atoms, approximately 7 to approximately 12 atoms, approximately 7 to approximately 15 atoms, or approximately 10 to approximately 30 atoms). L may contain atomic chains of approximately 5 Å to approximately 45 Å in length, e.g., approximately 5 Å to 45 Å, 5 Å to approximately 45 Å, or 5 Å to 45 Å. L may contain peptides. L may contain one or more phenylalanine residues, each independently substituted as desired. L may contain at least one phenylalanyl-phenylalanyl, where at least one phenyl is independently substituted as desired. L is polyoligoethylene glycol n (POEG n ), polyethylene glycol n (PEG n ), or mixtures thereof, where n=1 to 36.

[0050] In one embodiment, L may comprise at least one linker group, each linker group selected from the group consisting of polyethylene glycol (PEG), alkyl, sugar, and peptide. In one embodiment, the linker is a PEG (e.g., PEGylated), alkyl, sugar, and peptide-based dual linker.

[0051] The linker can be any suitable linker. For example, in one embodiment, the linker is a hydrophilic linker, e.g., a linker comprising one or more (identical or different) amino acids, alkyl chains, PEG monomers, PEG oligomers, PEG polymers, or any combination thereof. In one embodiment, the linker comprises a peptidoglycan, glycan, or an anionic oligomer. For linkers comprising one or more PEG units, all carbon and oxygen atoms of the PEG units are part of the main chain unless otherwise specified. The “main chain” of linker L may be the shortest continuous atomic chain that forms a covalent bond between T and X and / or T and A. In one embodiment, a polyvalent linker has a branched main chain, where each branch acts as a section of the main chain linker until it reaches the terminal.

[0052] The L groups described herein may have any suitable length and chemical composition. For example, L may have a chain length of at least about 7 atoms (e.g., 7 atoms). In one variation, L is at least about 10 atoms (e.g., 10 atoms) long. In another variation, L is at least about 14 atoms (e.g., 14 atoms) long. In yet another variation, L is about 7 to about 31 atoms (e.g., about 7 to 31, 7 to about 31, or 7 to 31), about 7 to about 24 atoms (e.g., about 7 to 24, 7 to about 24, or 7 to 24), or about 7 to about 20 atoms (e.g., about 7 to 20, 7 to about 20, or 7 to 20) long. In other variations, L has an atomic length of approximately 14–31 (e.g., approximately 14–31, 14–31, or 14–31), approximately 14–24 (e.g., approximately 14–24, 14–24, and 14–24), or approximately 14–20 (e.g., approximately 14–20, 14–20, or 14–20). In other variations, L can have a chain length of at least 7 atoms (e.g., 7 atoms), at least 14 atoms (e.g., 14 atoms), at least 20 atoms (e.g., 20 atoms), at least 25 atoms (e.g., 25 atoms), at least 30 atoms (e.g., 30 atoms), at least 40 atoms (e.g., 40 atoms), 1–15 atoms, 1–5 atoms, 5–10 atoms, 5–20 atoms, 10–40 atoms, or 25–100 atoms. An example of an L group with a chain length of 1–5 atoms is given by formula: [Chemical formula] is a group where R 1 is H, alkyl, arylalkyl, -alkyl-S-alkyl or arylalkyl or the side chain of any naturally occurring or non-naturally occurring amino acid, etc.; and the numbers represent the atoms to be counted as part of the chain, which in this example is 3 atoms. R 1 Examples of R include H (i.e., glycine), alkyl (e.g., alanine, valine, isoleucine, and leucine), -alkyl-S-alkyl (e.g., methionine), arylalkyl (e.g., phenylalanine, tyrosine, tryptophan, and naphthylalanine), etc. R 1 The atom to which R is attached may be chiral and may have any suitable relative configuration such as D- or L-configuration.

[0053] The atoms used to form L can be combined in all chemically related ways such as a chain of carbon atoms forming an alkylene group, a chain of carbon and oxygen atoms forming a polyoxyalkylene group, a chain of carbon and nitrogen atoms forming a polyamine, and others. Further, the bonds connecting the atoms of the chain can be saturated or unsaturated, for example, such that alkanes, alkenes, alkynes, cycloalkanes, arylenes, imides, and others that may be included in L can be divalent radicals. Further, the atoms forming the linker can cyclize with each other to form, in the linker, a formula: [Chemical formula] [In the formula, X 2 is independently CH2, N (when there is a bond attached to X 2 ), NH or O, and each X 3 is independently N, C (when there is a bond attached to X 3 ), or CH. ] It is understood that saturated or unsaturated divalent cyclic radicals such as etc. can also be formed. In each of the above-described and other L groups described herein, the chain forming the linker can be substituted or unsubstituted.

[0054] Apart from or in addition to chain length, L may have any suitable substituents that can affect the hydrophobicity or hydrophilicity of L. For example, L may have hydrophobic side chain groups such as alkyl, cycloalkyl, aryl, arylalkyl, or similar groups, each of which may be substituted as desired. If L contains one or more amino acids, L may contain hydrophobic amino acid side chains, including substituted variants thereof, such as one or more amino acid side chains from phenylalanine (Phe) and tyrosine (Tyr), as well as analogs and derivatives of such side chains.

[0055] L may include a moiety that is neutral under physiological conditions. However, L may each include a moiety that can be protonated or deprotonated to carry one or more positive charges or one or more negative charges. Alternatively, L may include a neutral moiety and a moiety that can be protonated to carry one or more positive charges. Examples of neutral moieties include polyhydroxyl groups, e.g., sugars, carbohydrates, saccharides, inositol, etc., and / or polyether groups, e.g., polyoxyalkylene groups, including polyoxyethylene, polyoxypropylene, etc. Examples of moieties that can be protonated to carry one or more positive charges may include polyaminoalkylenes, including ethylenediamine, propylenediamine, butylenediamine, etc., and / or heterocycles, including pyrrolidine, piperidine, piperazine, and other amino groups, each of which may be substituted as desired. Examples of moieties that can be deprotonated to carry one or more negative charges include carboxylic acids, such as aspartic acid, glutamic acid, and long-chain carboxylic acid groups, and sulfate esters, such as alkyl esters of sulfate.

[0056] Explanatory polyoxyalkylene groups include those of specific lengths in the range of about 4 to about 20 (e.g., about 4 to 20, 4 to about 20, or 4 to 20) polyoxyalkylene (e.g., polyethylene glycol) groups. Explanatory alkyl sulfates can also be introduced directly into the main chain by click chemistry. Explanatory L groups, including polyamines, are EDTA and DTPA radicals: [ka] (Poly)peptides: [ka] Beta-amino acids, etc.: [ka] and combinations thereof are obtained L groups, where each R 2 These are independently H, alkyl, arylalkyl, heterocyclylalkyl, ureido, aminoalkyl, alkylthio, or amidealkyl, as in the side chains of naturally occurring amino acids such as alanine, valine, leucine, isoleucine, phenylalanine, tyrosine, tryptophan, serine, threonine, asparagine, methionine, lysine, arginine, and histidine. Amino acids that do not exist naturally are also intended here.

[0057] The L group may have any suitable molecular weight, such as approximately 30 g / mol to approximately 1,000 g / mol (e.g., approximately 30 to 1,000; 30 to approximately 1,000; or 30 to 1,000), approximately 30 g / mol to approximately 300 g / mol (e.g., approximately 30 to 300; 30 to approximately 300; or 30 to 300), approximately 100 g / mol to approximately 500 g / mol (e.g., approximately 100 to 500; 100 to approximately 500; or 100 to 500), or approximately 150 g / mol to approximately 600 g / mol (e.g., approximately 150 to 600; 150 to approximately 600; or 150 to 600).

[0058] The terms “non-disengageable linkers” or “non-cleavable linkers” are used in relation to inter-exchange linkers. To the extent used herein, they refer to linkers that cannot be cleaved under extracellular physiological conditions (e.g., pH-unstable, acid-unstable, oxidative-unstable, or enzyme-unstable links). However, such linkers may include links that can be cleaved after entry into the cell.

[0059] L may include carbonyl, aminoalkyleneamino, aminoalkylenecarbonyl, carbonylalkylenecarbonyl, thionocarbonyl, alkylene, cycloalkylene, aminoalkylene, alkylenecycloalkyl, alkylenecycloalkylenecarbonyl, aminoalkylenecycloalkylenecarbonyl, alkylenecarbonyl, cycloalkylenecarbonyl, 1-alkylenesuccinimido-3-yl, 1-(carbonylalkyl)succinimido-3-yl, alkylenesulfoxyl, sulfonylalkyl, alkylenesulfoxylalkyl, alkylenesulfonylalkyl, carbonyltetrahydro-2H-pyranyl, carbonyltetrahydrofuranyl, 1-(carbonyltetrahydro-2H-pyranyl)succinimido-3-yl or 1-(carbonyltetrahydrofuranyl)succinimido-3-yl (each of which may be substituted as desired), and combinations thereof. In this example, L contains an alkylene carbonyl, cycloalkylene carbonyl, carbonylalkylcarbonyl, or 1-(carbonylalkyl)succinimido-3-yl group (each of which may be substituted as desired) that is bonded to nitrogen to form an amide, with further nitrogen (e.g., -NR) 3 -, here, R 3 L may contain (which may be H or alkyl). Alternatively, L may further contain a sulfur atom and an alkylene or cycloalkylene group (each of which may optionally be substituted with a carboxyl group) which can bond to sulfur to form a thiol. In other examples, L may contain a sulfur atom and a sulfur-bonded 1-alkylene succinimido-3-yl and 1-(carbonylalkyl) succinimido-3-yl group to form a succinimido-3-ylthiol.

[0060] L is given by the following formula: [ka] [In the formula, the asterisk indicates a bond point to a group present on L, T, A, or X; and x and y are independently 1, 2, 3, 4, or 5.] This may include alkylene aminoalkylene carbonyl, alkylene-thio-(carbonylalkylsuccinimido-3-yl), alkylene cycloalkylene carbonyl, aminoalkylene cycloalkylene carbonyl, alkylene carbonyl, cycloalkylene carbonyl, and combinations thereof, as further described by [translate].

[0061] L stands for C (e.g., -CH2-, C(O)), N (e.g., NH, NR) 4 And here, R 4 L can have any suitable combination of atoms in the chain, including, for example, H, alkyl, alkylaryl, O (e.g., -O-), P (e.g., -OP(O)(OH)O-), and S (e.g., -S-). For example, the atoms used to form L can be combined in all chemically related ways, including chains of carbon atoms that form alkyl groups, chains of carbon and oxygen atoms that form polyoxyalkyl groups, chains of carbon and nitrogen atoms that form polyamines, and rings that form aryl and heterocyclyl groups (e.g., triazole, oxazole, etc.). Furthermore, the bonds connecting the atoms of the chains that link the atoms of the L chain can be saturated or unsaturated, so as can be divalent radicals such as alkanes, alkenes, alkynes, cycloalkanes, arylenes, and imides contained in L. Furthermore, the chains that form L can be, for example, -N(R 4 ) It may be replaced by two units, or it may not be replaced at all.

[0062] Further examples of L include L groups comprising the groups 1-alkylsuccinimido-3-yl, carbonyl, thionocarbonyl, alkyl, cycloalkyl, alkylcycloalkyl, alkylcarbonyl, cycloalkylcarbonyl, carbonylalkylcarbonyl, 1-alkylsuccinimido-3-yl, 1-(carbonylalkyl)succinimido-3-yl, alkylsulfoxyl, sulfonylalkyl, alkylsulfoxylalkyl, alkylsulfonylalkyl, carbonyltetrahydro-2H-pyranyl, carbonyltetrahydrofuranyl, 1-(carbonyltetrahydro-2H-pyranyl)succinimido-3-yl, and 1-(carbonyltetrahydrofuranyl)succinimido-3-yl, where each group may be substituted or unsubstituted. Any of the aforementioned groups may be L or be included as part of L. In some cases, any of the aforementioned groups may be used in combination (or more than once) (e.g., -alkyl-C(O)-alkyl), and may further include additional nitrogen (e.g., alkyl-C(O)-NH-, -NH-alkyl-C(O)- or -NH-alkyl-), oxygen (e.g., -alkyl-O-alkyl-) or sulfur (e.g., -alkyl-S-alkyl-). Examples of such L groups may be alkylcarbonyl, cycloalkylcarbonyl, carbonylalkylcarbonyl, 1-(carbonylalkyl)succinimido-3-yl, and succinimido-3-ylthiol, where each group is substituted or unsubstituted.

[0063] The conjugate may include a freeable linker for L, for example, if in vivo release of A is desired. Freeable linkers for L are well known in this art.

[0064] L may be a “free linker” that can be cleaved by an enzyme. The enzyme may be a cathepsin, metalloproteinase, esterase, phosphatase, DNAase, or pyrophosphatase. L may be cleaved by reactive oxygen species (ROS). L may be a p-aminophenol ether. L may be cleaved by hypoxic activation. L may be a quinone, nitroaromatic, aliphatic N-oxide, or heteroaromatic N-oxide. Or L may contain, for example, an xN-xN moiety (e.g., a deoxythymidine-deoxythymidine (dT-dT) moiety) that can be cleaved by DNAase, where x is a ribonucleotide or deoxyribonucleotide; and each N is independently A, T, C, G, U, or a combination thereof. An example of such a dT-dT linker is: [ka] And this is: [ka] These could be part of a long linker.

[0065] An example of a miRNA having a dT-dT linker is shown in Figure 12. The miRNA shown in Figure 12 also includes the vinyl phosphonate at the 5' end of the antisense strand 104, an extended nucleic acid that can be incorporated at the 3' end of the antisense strand 104, and a dT-dT linker (which can be cleaved) at the 3' end of the sense strand 102. In one embodiment, the sense strand 102 has the sequence: / 5mC / *mC* / mA / i2FG / mC / i2FU / mA / i2FA / mG / i2FA / mC / i2FA / mC / i2FU / mG / mC* / *mC* / mU / T / T / 3Azide N / (SEQ ID NO: 14) The antisense strand 104 may have the following sequence: 5VPPhos / mU* / i2FG / *mG / i2FC / mA / i2FG / mU / i2FG / mU / i2FC / mU / i2FU / mA / i2FG / mC / i2FU / mG / i2FG* / mU* / i2FU* / mG* / 3yU / (Sequence number 1) It may have, where m is 2'-O-methyl; F is 2'-fluoro; r is ribonucleotide; i is internal; * is a phosphorothioate bond; VP is 5'-vinylphosphonate; and y is an extended nucleic acid, which is shown in Figure 12: [ka] That is the case.

[0066] While we do not wish to be bound by any particular theory, extended nucleic acids obtained by incorporating the antisense strand 104 at its 3' end are thought to provide exonuclease resistance.

[0067] One or more cleavable bonds can be present within and / or at one or both ends of a cleavable linker. Such physiological conditions resulting in bond breakdown include, for example, standard chemical hydrolysis reactions resulting from compartmentalization into organelles such as endosomes at physiological pH or at pH lower than cytoplasmic pH. For illustrative purposes, divalent linkers can also be cleaved under other physiological or metabolic conditions, such as the action of glutathione-mediated mechanisms. It is recognized that the instability of cleavable bonds can be modulated by the inclusion of functional groups or fragments into the divalent linker L that can assist or promote such bond breakdown, also known as neighbor-group involvement effects. The instability of cleavable bonds can also be modulated by substitutional changes, for example, at or near the cleavable bond, such as the insertion of an alpha branch adjacent to a cleavable disulfide bond, increased hydrophobicity of silicon substituents in the portion having a hydrolyzable silicon-oxygen bond, or homologation of alkoxy groups forming part of a hydrolyzable ketal or acetal. Furthermore, it has been recognized that additional functional groups or fragments may be cannonballed within the divalent linker L, which, when present, can assist or promote further fragmentation of the PSMA-bound drug linker conjugate after bond disruption.

[0068] As an example, L may contain one or more freeable linkers that are cleaved under the conditions described herein by a chemical mechanism involving beta-elimination. Such freeable linkers include beta-thio, beta-hydroxy, and beta-amino substituted carboxylic acids and their derivatives, such as esters, amides, carbonates, carbamates, and ureas. Such linkers may also include 2- and 4-thioaryl esters, carbamates, and carbonates.

[0069] An example of a free linker is given by formula: [ka] [In the formula, n is an integer selected from 0, 1, 2, and 3, and R 5 is H or alkyl, and R 6 This includes a substituent that can stabilize the positive charge by hydrogen, or by inductive means or resonance on an aryl ring, such as an alkoxy substituent. It includes a linker. The freeable linker can be further substituted.

[0070] The assisted cleavage of the freeable moiety of L may involve mechanisms such as benzylium intermediates, benzine intermediates, lactone cyclization, oxonium intermediates, and beta-elimination. In addition to fragmentation following cleavage of the freeable moiety of L, the initial cleavage of the freeable linker may be facilitated by neighboring group involvement mechanisms. Therefore, in the above example of the freeable moiety of L, a cyclizable hydroxyalkanoic acid, for example by an oxonium ion, facilitates the cleavage of the methylene bridge, and after the cleavage of the freeable linker, facilitates bond cleavage or subsequent fragmentation. Alternatively, acid-catalyzed, oxonium-ion-assisted cleavage of the methylene bridge can initiate this cascade of fragmentation of the explanatory divalent linker or its fragments. Alternatively, acid-catalyzed hydrolysis of a carbamate may be cyclized and, for example, facilitate beta-elimination of a hydroxyalkanoic acid, which facilitates the cleavage of the methylene bridge, for example by an oxonium ion. It is recognized that other chemical mechanisms of bond disruption or cleavage under metabolic, physiological, or cellular conditions may initiate such a cascade of fragmentation. It is recognized that other chemical mechanisms, such as metabolic, physiological, or cellular conditional disruption or cleavage, can initiate such fragmentation cascades.

[0071] The explanatory mechanisms for the cleavage of divalent linkers include the following 1,4 and 1,6 fragmentation mechanisms of carbonates and carbamates: [ka] [During the ceremony, Nuc - These include exogenous or endogenous nucleophiles, glutathione, or bioreducing agents, and R 7 One of Z is T (or X) connected via the other part of the divalent linker, and the other is X (or T) connected via the other part of the divalent linker. ] R 7 And the position of Z is, for example, that the obtained products are ZS-Nuc and HO-R 7 Or H2N-R 7 They may be swapped in that order.

[0072] Although the above fragmentation mechanism is described as a concerted mechanism, several individual steps may be carried out to perform the final fragmentation of the divalent linker to the end product shown. For example, bond cleavage can also be carried out by acid-catalyzed elimination of the carbamate moiety, which may involve neighboring group involvement through stabilization provided by the aryl group of the beta-sulfur or disulfide as shown in the above example. In such variations of this embodiment, the freeable linker is the carbamate moiety. Alternatively, fragmentation may be initiated by a nucleophilic attack of the disulfide group, which cleaves to form a thiolate. The thiolate can intermolecularly substitute the carbonic acid or carbamic acid moiety to form the corresponding thiocyclopropane. In the case of the benzyl-containing divalent linker, after explanatory rupture of the disulfide bond, the carbonic acid or carbamic acid moiety can be released by further fragmentation of the resulting phenylthiolate to form a resonance-stabilized intermediate. In any of these cases, the freeability of the explanatory divalent linker can be realized depending on what chemical, metabolic, physiological, or biological conditions are suitable for the mechanism present.

[0073] As described above, the freeable linker may therefore contain a disulfide group. Furthermore, examples of freeable linkers contained in L may include alkylene aziridin-1-yl, alkylene carbonyl aziridin-1-yl, carbonyl alkyl aziridin-1-yl, alkylene sulfoxyl aziridin-1-yl, sulfoxyl alkyl aziridin-1-yl, sulfonyl alkyl aziridin-1-yl, or a divalent radical containing an alkylene sulfonyl aziridin-1-yl group, where each of the freeable linkers is optionally substituted. Further examples of freeable linkers contained in L include methylene, 1-alkoxyalkylene, 1-alkoxycycloalkylene, 1-alkoxyalkylene carbonyl, 1-alkoxycycloalkylene carbonyl, carbonylarylcarbonyl, carbonyl(carboxyaryl)carbonyl, carbonyl(biscarboxyaryl)carbonyl, haloalkylene carbonyl, alkylene(dialkylsilyl), alkylene(alkylarylsilyl), alkylene(diarylsilyl), (dialkylsilyl The group may contain a divalent radical comprising an aryl, (alkylarylsilyl)aryl, (diarylsilyl)aryl, oxycarbonyloxy, oxycarbonyloxyalkyl, sulfonyloxy, oxysulfonylalkyl, iminoalkylidenyl, carbonylalkylideneiminyl, iminocycloalkylidenyl, carbonylcycloalkylideneiminyl, alkylenthio, alkylenearylthio, or carbonylalkylthio group, where each of the freeable linkers may be substituted as desired.

[0074] Further examples of freeable linkers in L may include an oxygen atom and a methylene, 1-alkoxyalkylene, 1-alkoxycycloalkylene, 1-alkoxyalkylene carbonyl, or 1-alkoxycycloalkylene carbonyl group, where each of the freeable linkers may be optionally substituted. Alternatively, the freeable linker may include an oxygen atom and a methylene group, where the methylene group may be optionally substituted with an aryl group, and the freeable linker may combine with oxygen to form an acetal or ketal. Furthermore, the freeable linker may include an oxygen atom and a sulfonyl alkyl group, and the freeable linker may combine with oxygen to form an alkyl sulfonate.

[0075] Further examples of freeable linkers contained in L include nitrogen (e.g., -NR) 5 -, here, R 5 The free linkers may comprise a group (where is H or alkyl) and an iminoalkylidenyl, carbonylalkylideneiminyl, iminocycloalkylidenyl, and carbonylcycloalkylideneiminyl group, where each of the free linkers may be optionally substituted, and the free linkers may bond with nitrogen to form a hydrazone. In another configuration, the hydrazone may be acylated with a carboxylic acid derivative, an orthoformic acid derivative, or a carbamoyl derivative to form various acylhydrazone free linkers.

[0076] Further examples of the freeable linkers contained in L may include an oxygen atom and an alkylene(dialkylsilyl), alkylene(alkylarylsilyl), alkylene(diarylsilyl), (dialkylsilyl)aryl, (alkylarylsilyl)aryl or (diarylsilyl)aryl group, where each of the freeable linkers may be optionally substituted, and the freeable linkers may combine with oxygen to form a silanol.

[0077] A further example of a freeable linker contained in L is two independent nitrogen atoms (e.g., -NR). 5-) and may include carbonylarylcarbonyl, carbonyl(carboxyaryl)carbonyl, or carbonyl(biscarboxyaryl)carbonyl, and the freeable linker may bond with a heteroatom nitrogen to form an amide, and via the amide bond Z or R 7 It can also be combined with other things.

[0078] Further examples of freeable linkers contained in L include oxygen atoms, nitrogen (e.g., -NR) 5 -), and may include carbonylarylcarbonyl, carbonyl(carboxyaryl)carbonyl, or carbonyl(biscarboxyaryl)carbonyl to form a free linker amide, via an amide bond of Z or R 7 It can also be combined with other things.

[0079] In one embodiment, the ligand is folate. In another embodiment, the ligand is 2-[3-(1,3-dicarboxypropyl)ureido]pentanedioic acid (DUPA) or a ligand present in PSMA-617.

[0080] "Forate" can be folate, folate analogs, or other folate receptor-binding molecules, including, for example, folinic acid (e.g., leucovorin), pteroid polyglutamic acid, pteroid-D-glutamic acid, and folate receptor-binding pteridines, such as tetrahydropterin, dihydrofolate, tetrahydrofolate (e.g., 5-methyltetrahydrofolate (5-MTHF)), and folate analogs and derivatives such as deaza and dideza analogs, but not limited to these.

[0081] When referring to a peptide, polypeptide, or protein, the “analog” or “derivative” means another or identical amino acid sequence or structure of the original peptide, polypeptide, or protein. The analog preferably satisfies at least one of the following: (a) a protein agent having an amino acid sequence identical to the original amino acid sequence by at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99%; (b) a protein agent encoded by a nucleotide sequence that hybridizes under stringent conditions to a nucleotide sequence encoding the original amino acid sequence; or (c) a protein agent encoded by a nucleotide sequence that is identical to the nucleotide sequence encoding the original amino acid sequence by at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99%.

[0082] The terms “deaza” and “dideaza” analogs refer to analogs recognized in this art that have a carbon atom replacing one or two nitrogen atoms of a naturally occurring folate structure, or an analog or derivative thereof. For example, deaza analogs include 1-deaza, 3-deaza, 5-deaza, 8-deaza, and 10-deaza analogs of folates, folic acid, pteropolyglutamic acid, and folate receptor-binding pteridines, such as tetrahydropterin, dihydrofolate, and tetrahydrofolate. Dideza analogs include, for example, 1,5-dideaza, 5,10-dideaza, 8,10-dideaza, and 5,8-dideaza analogs. The folate analogs are conventionally referred to as “folates” due to their ability to bind to folate receptors. Other folate receptor-binding analogs include aminopterin, amesopterin (methotrexate), N10-methylfolate, 2-deamino-hydroxyfolate, deaza analogs, such as 1-deazamesopterin or 3-deazamesopterin, and 3',5'-dichloro-4-amino-4-deoxy-N 10 -Contains methylpteroid glutamic acid (dichloromethotrexate).

[0083] The aforementioned analogs and / or derivatives are also referred to as “folate,” “the folate,” or “folates” due to their ability to bind to the folate receptor. When conjugated with exogenous molecules, such molecules may act to promote transmembrane transport, such as through folate-mediated endocytosis. The aforementioned can also be used as folate receptor-binding ligands as described herein.

[0084] L may contain a chain of atoms approximately 3 to approximately 30 atoms long (e.g., approximately 3 to 30, 3 to approximately 30, or 3 to 30). L may contain a chain of atoms approximately 5 Å to approximately 45 Å long (e.g., approximately 5 Å to 45 Å, 5 Å to approximately 45 Å, or 5 Å to 45 Å). L may contain a peptide. L may contain one or more phenylalanine residues, each independently substituted as desired. L may contain at least one phenylalanyl-phenylalanyl, where at least one phenyl is independently substituted as desired. L may contain polyoligoethylene glycol. n (POEG n ), polyethylene glycol n (PEG n ), or mixtures thereof, where n=1 to 36.

[0085] The conjugate may further include a pharmacokinetic modulator. Examples of pharmacokinetic modulators include, but are not limited to, lipophilic substances, bile acids, steroids, phospholipid analogs, peptides, protein binders, polyethylene glycol (PEG), vitamins (e.g., vitamins or biotin), cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglycerides, phospholipids, and sphingolipids. In various embodiments, the conjugate further includes a group that improves tumor uptake of the conjugate, for example, a group that includes or is an albumin-binding moiety. Examples of albumin-binding agents are: [ka] This includes, but is not limited to, the following:

[0086] Ligands can bind to miRNA at various positions, such as the 3' end, 5' end, or internal position, by methods known in the art and illustrated herein. In various embodiments, ligands are bound to miRNA by linkers. Monomers having chemical groups suitable for participation in click reactions, such as azide or alkyne termination linkers, can be incorporated. An example of a ligand that binds to an alkyne termination linker is shown in Figure 6 and labeled folate-DBCO: [ka]

[0087] The folete ligand contained in "Folete-DABCO" can be bound to miRNAs having azides at the end of the sense or antisense strand via alkynes, an example of which is shown in Figure 1A. The resulting ligand-bound miRNA has the formula: [ka] It may have, and here, R 8 is, base: [ka] It includes a group containing miRNAs such as, where R 9 This includes miRNAs such as FM-miRNAs like FM-miR-34a. An example of ligand-binding miRNA is formula: [ka] It has, and here, R 9 This includes or is FM-miR-34a, which is an example of "FolamiR" (shown above).

[0088] The ligand may bind to one or both chains. In some embodiments, the ligand may conjugate to nucleic acid bases, sugar moieties, or internucleotide bonds.

[0089] Further provisions are provided for compositions comprising miRNA or a conjugate thereof, and pharmaceutically acceptable carriers, diluents, or additives. “Pharmaceutically acceptable” means carriers, diluents, and additives that, within reasonable medical judgment, are suitable for use in contact with the tissues of a target, such as animals, particularly humans, without excessive toxicity, irritation, allergic response, or other problems or complications, and possess a reasonable benefit / risk ratio. Compositions may be formulated for administration in solid or liquid form, including those suitable for intravenous, subcutaneous, intratumoral, topical, rectal, vaginal, nasal, pulmonary, ocular, non-enteral, oral, sublingual, and transdermal administration. In various embodiments, compositions formulated for subcutaneous or intravenous (e.g., bolus or diffuse infusion) administration are used. Liposomes, DOPCs, gold nanoparticles, and lipid formulations may be used, if desired. Similarly, various encapsulation methods known in the art may be used.

[0090] A method for treating cancer in a subject is also provided. The method involves administering to the subject a cancer-treatment-effective amount of miRNA, optionally as a composition comprising miRNA and a pharmaceutically acceptable carrier, diluent, or additive, thereby treating the cancer in the subject. The miRNA may be miR-34a (see, for example, U.S. Patent Application Publication 2009 / 0227533, incorporated herein by reference, for teachings regarding genes affected by miR-34a in cancer cells). The sense strand of a miRNA that may be miR-34a may have 15 nucleotides, while the sense strand of a miRNA that may be anti-miR-34a may have 22 nucleotides. Each strand of miRNA may contain an alternating pattern of 2'-O-methyl-modified and 2'-fluoro-modified sugars and phosphorothioate bonds at the 5' and 3' ends of the strand. In one embodiment, the sense strand is sequenced: / 52FG / *mC* / i2FU / mA / i2FA / mG / i2FA / mC / i2FA / mC / i2FU / mG / i2FC / *mC* / i2FA / / 3Azide N / (Sequence No. 4) It may have, and the antisense strand is in sequence: 5Phos / mU* / i2FG / *mG / i2FC / mA / i2FG / mU / i2FG / mU / i2FC / mU / i2FU / mA / i2FG / mC / i2FU / mG / i2FG / mU / i2FU / mG* / 32FU / (Sequence number 5) It may have, where m is 2'-O-methyl; F is 2'-fluoro; r is a ribonucleotide; i is internal; * is a phosphorothioate bond; and Phos is a 5'-phosphate. Cancer can be, for example, lung cancer, breast cancer, ovarian cancer, or prostate cancer.

[0091] Furthermore, other methods for treating cancer in subjects are provided. The methods involve administering to a subject a conjugate containing a cancer-treatment-effective amount of miR-34a and folate, optionally as a composition comprising the conjugate and a pharmaceutically acceptable carrier, diluent, or additive, thereby treating the cancer in the subject. The conjugate may further contain groups that improve tumor uptake of the conjugate, such as groups containing or being albumin-binding moieties. The cancer may be any cancer overexpressing folate receptors, including epithelial cancers, including breast, lung, ovarian, kidney, and colon cancers, and various hematological malignancies such as acute myeloid leukemia. In one embodiment, the cancer may be lung cancer, breast cancer, ovarian cancer, or colorectal cancer, or medulloblastoma. The methods also have applications in treating diseases involving overexpression of folate receptors / transporters suitable for folate- and 5-methyltetrahydrofolate (5-MTHF) mediated delivery.

[0092] Further provided are other methods for treating cancer in a subject. The method involves administering to a subject a cancer-treatment-effective amount of a conjugate containing a prostate cancer-targeting ligand, such as a ligand present in miR-34a and DUPA or PSMA-617, as a composition optionally comprising the conjugate and a pharmaceutically acceptable carrier, diluent, or additive, thereby treating the cancer in the subject. The conjugate may further contain groups that improve tumor uptake of the conjugate, such as a group containing or being an albumin-binding moiety.

[0093] "Anti-cancer treatment dose" is the amount of miRNA, or a conjugate containing miRNA, that has a therapeutic effect on at least a subpopulation of cancer cells in a subject with a reasonable benefit / risk ratio applicable to any medical treatment. The actual dose level of miRNA, or a conjugate containing miRNA, may vary to obtain a therapeutic effect in a given subject, taking into account the composition, route of administration, and other factors such as the age, sex, weight, condition, general health, and prior medical history of the subject being treated. The unit dose may be less than 10 mg / kg body weight, for example, less than 5, 2, 1, 0.5, 0.1, 0.05, 0.01, 0.005, 0.001, 0.0005, 0.0001, 0.00005 or 0.00001 mg / kg body weight, and less than 200 nmole of miRNA per kg of body weight, for example, less than 150, 125, 100, 75, 50, 25, 15, 7.5, 5.0, 2.5, 1.5, 0.75, 0.15, 0.075, 0.015, 0.0075, 0.0015, 0.00075 or 0.00015 nmole of miRNA per kg of body weight. The unit dose may be administered less frequently than once daily, for example, less frequently than once every 2, 4, 8, 16, or 30 days. In one embodiment, the unit dose may be administered only once. The unit dose may be administered in conjunction with other traditional therapeutic modalities.

[0094] A conjugate, or a composition comprising a conjugate and a pharmaceutically acceptable carrier, diluent, or additive, may be administered via any suitable route, e.g., any suitable route used in cancer treatment. Examples of suitable routes include, but are not limited to, non-enteral routes such as intradermal, subcutaneous, intramuscular, intraperitoneal, intravenous, or intrathecal. Other routes include bladder infusion, nasal administration, inhalation, buccal absorption, percutaneous, rectal, and vaginal administration.

[0095] Examples of non-enteral administration forms include isotonic saline solutions, glucose solutions, or other well-known pharmaceutically acceptable liquid carriers, such as alcohols, glycols, esters, or amides, suspensions, or aqueous solutions of conjugates in liposomes. Non-enteral dosage forms may also be in the form of reconstituteable lyophilized products. Sustained-release administration forms, such as biodegradable carbohydrate matrices, may be used.

[0096] The above methods can be used in combination with other treatments. Examples of such treatments include, but are not limited to, chemotherapy, radiotherapy, immunotherapy, gene therapy, surgery, and the administration of other drugs such as immunomodulators, EGFR-TKIs (U.S. Patent Application Publication 2014 / 0309278), sorafenib (for example, for liver cancer; see U.S. Patent Application Publication 2015 / 0246070), and hormones.

[0097] Complete modification of miRNAs enhances stability (e.g., resistance to serum nucleases and extension of intracellular half-life). This enhanced stability, combined with specific, targeted delivery (e.g., to folate receptors on folate receptor-overexpressing cancer cells), enables enhanced activity at low doses and infrequent administration. Targeted delivery also reduces, if not eliminates, delivery to non-tumor-forming tissues.

[0098] The present invention relates, in particular, to the following numbered embodiments, where this list does not indicate order of importance: Embodiment 1. A fully chemically modified microRNA (miRNA) wherein the miRNA is modified with 2'-O-methyl, 2'-fluororibose bases and phosphorothioate bonds.

[0099] Embodiment 2. The fully chemically modified miRNA of Embodiment 1, wherein the miRNA is of the miR-34a family of miRNAs.

[0100] Embodiment 3. The fully chemically modified miRNA of Embodiment 1, wherein at least a portion of the miRNA is double-stranded.

[0101] Embodiment 4. The fully chemically modified miRNA of Embodiment 3, wherein each strand may independently be about 12 to 40 nucleotides in length.

[0102] Embodiment 5. The fully chemically modified miRNA of Embodiment 3, in which one strand is longer than the other.

[0103] Embodiment 6. The fully chemically modified miRNA of Embodiment 5, wherein one strand is an antisense strand and the other strand is an antisense strand, and the antisense strand is 1 to 7 nucleotides longer than the sense strand.

[0104] Embodiment 7. The fully chemically modified miRNA of Embodiment 3, wherein the miRNA includes a double-stranded region and a single-stranded region.

[0105] Embodiment 8. A fully chemically modified miRNA of Embodiment 7, wherein the double-stranded region is 12 to 25 nucleotide base pairs long and / or the single-stranded region is at least about 7 nucleotides long.

[0106] Embodiment 9. The fully chemically modified miRNA of Embodiment 3, wherein one strand is an antisense strand and the other strand is an antisense strand, the sense strand having 15 nucleotides and the antisense strand having 22 nucleotides.

[0107] Embodiment 10. Fully chemically modified miRNA of Embodiment 2, wherein the miRNA contains a minimum length of 6 nucleotides and a maximum length of 24 nucleotides.

[0108] Embodiment 11. The fully chemically modified miRNA of Embodiment 1, wherein the miRNA contains at least six consecutive nucleotide base pairs present in SEQ ID NO: 1.

[0109] Embodiment 12. The fully chemically modified miRNA of Embodiment 1, wherein the miRNA has at least 80% identity with SEQ ID NO: 1 or a portion thereof.

[0110] Embodiment 13. The fully chemically modified miRNA of Embodiment 2, wherein the miRNA is sequence number 3, 4, or 14.

[0111] Embodiment 14. A fully chemically modified miRNA according to any one of claims 1 to 13, wherein each chain comprises an alternating pattern of 2'-O-methyl-modified and 2'-fluoro-modified sugars and phosphorothioate bonds at the 5' and 3' ends of the chain.

[0112] Embodiment 15. Sense chain is an array: / 52FG / *mC* / i2FU / mA / i2FA / mG / i2FA / mC / i2FA / mC / i2FU / mG / i2FC / *mC* / i2FA / / 3Azide N / (Sequence No. 4) or / 5mC / *mC* / mA / i2FG / mC / i2FU / mA / i2FA / mG / i2FA / mC / i2FA / mC / i2FU / mG / mC* / *mC* / mU / T / T / 3Azide N / (SEQ ID NO: 14) It has an antisense chain in the array: 5Phos / mU* / i2FG / *mG / i2FC / mA / i2FG / mU / i2FG / mU / i2FC / mU / i2FU / mA / i2FG / mC / i2FU / mG / i2FG / mU / i2FU / mG* / 32FU / (Sequence number 5) or 5VPPhos / mU* / i2FG / *mG / i2FC / mA / i2FG / mU / i2FG / mU / i2FC / mU / i2FU / mA / i2FG / mC / i2FU / mG / i2FG* / mU* / i2FU* / mG* / 3yU / (Sequence number 1) It has, where m is 2'-O-methyl; F is 2'-fluoro; r is ribonucleotide; i is internal; * is a phosphorothioate bond; Phos is 5'-phosphate; VP is 5'-vinylphosphonate; and y is extended nucleic acid. A fully chemically modified miRNA of Embodiment 1.

[0113] Embodiment 16. A fully chemically modified miRNA of Embodiment 1, comprising a sense sequence and an antisense sequence, wherein the antisense sequence comprises at least seven consecutive nucleotides of SEQ ID NO: 1.

[0114] Embodiment 17. A conjugate comprising a fully chemically modified miRNA of any of claims 1 to 16, comprising a folate ligand.

[0115] Embodiment 18. The conjugate of Embodiment 17, further comprising a group that improves tumor uptake of the conjugate.

[0116] Embodiment 19. The conjugate of Embodiment 18, wherein the group that improves tumor uptake of the conjugate includes an albumin-binding moiety.

[0117] Embodiment 20. The conjugate of Embodiment 18, wherein the conjugate includes a linker.

[0118] Embodiment 21. A conjugate of Embodiment 20, wherein the linker comprises carbonyl, aminoalkyleneamino, carbonylalkylenecarbonyl, thionocarbonyl, alkylene, cycloalkylene, aminoalkylene, alkylenecycloalkyl, alkylenecycloalkylenecarbonyl, aminoalkylenecycloalkylenecarbonyl, alkylenecarbonyl, cycloalkylenecarbonyl, carbonylalkylcarbonyl, and combinations thereof.

[0119] Embodiment 22. The conjugate of Embodiment 20, wherein the linker further comprises a group that improves tumor uptake of the conjugate.

[0120] Embodiment 23. The conjugate of Embodiment 22, wherein the group that improves tumor uptake of the conjugate includes an albumin-binding moiety.

[0121] Embodiment 24. DUPA or formula: [ka] A conjugate comprising a ligand, comprising any fully chemically modified miRNA of claims 1 to 16.

[0122] Embodiment 25. The conjugate of Embodiment 24, further comprising a group that improves tumor uptake of the conjugate.

[0123] Embodiment 26. The conjugate of Embodiment 25, wherein the group that improves tumor uptake of the conjugate includes an albumin-binding moiety.

[0124] Embodiment 27. The conjugate of Embodiment 24, wherein the conjugate includes a linker.

[0125] Embodiment 28. The conjugate of Embodiment 27, wherein the linker comprises carbonyl, aminoalkyleneamino, carbonylalkylenecarbonyl, thionocarbonyl, alkylene, cycloalkylene, aminoalkylene, alkylenecycloalkyl, alkylenecycloalkylenecarbonyl, aminoalkylenecycloalkylenecarbonyl, alkylenecarbonyl, cycloalkylenecarbonyl, carbonylalkylcarbonyl, and combinations thereof.

[0126] Embodiment 29. The conjugate of Embodiment 27, wherein the linker further comprises a group that improves tumor uptake of the conjugate.

[0127] Embodiment 30. The conjugate of Embodiment 29, wherein the group that improves tumor uptake of the conjugate includes an albumin-binding moiety.

[0128] Embodiment 31. A composition comprising a fully chemically modified miRNA according to any of claims 1 to 16 and a pharmaceutically acceptable carrier, diluent, or additive.

[0129] Embodiment 32. The composition of Embodiment 31, wherein each strand of fully chemically modified miRNA contains an alternating pattern of 2'-O-methyl-modified and 2'-fluoro-modified sugars and phosphorothioate bonds at the 5' and 3' ends of the strands.

[0130] Embodiment 33. A composition comprising any conjugate of claims 17 to 23 and a pharmaceutically acceptable carrier, diluent, or additive.

[0131] Embodiment 34. A composition comprising any conjugate of claims 24 to 29 and a pharmaceutically acceptable carrier, diluent, or additive.

[0132] Embodiment 35. A method for treating cancer in a subject, comprising administering to the subject an effective amount of a fully chemically modified miRNA according to any one of claims 1 to 15.

[0133] Embodiment 36. The method of Embodiment 35, wherein each strand of fully chemically modified miRNA contains an alternating pattern of 2'-O-methyl-modified and 2'-fluoro-modified sugars and phosphorothioate bonds at the 5' and 3' ends of the strand.

[0134] Embodiment 37. A method for treating cancer in a subject, comprising administering to the subject an effective amount of the composition of Embodiment 31 for cancer treatment.

[0135] Embodiment 38. A method for treating cancer in a subject, comprising administering to the subject an effective amount of the composition of Embodiment 32 for cancer treatment.

[0136] Embodiment 39. A method for treating cancer in a subject, comprising administering to the subject an effective amount of the composition of Embodiment 33 for cancer treatment.

[0137] Embodiment 40. A method for treating cancer in a subject, comprising administering to the subject an effective amount of the composition of Embodiment 34 for cancer treatment.

[0138] Embodiment 41. The method of Embodiment 35, wherein the cancer is lung cancer, breast cancer, ovarian cancer, or prostate cancer.

[0139] Embodiment 42. The method of Embodiment 41, wherein the cancer is prostate cancer.

[0140] Embodiment 43. The method of Embodiment 36, wherein the cancer is lung cancer, breast cancer, ovarian cancer, or prostate cancer.

[0141] Embodiment 44. The method of Embodiment 37, wherein the cancer is lung cancer, breast cancer, ovarian cancer, or prostate cancer.

[0142] Embodiment 45. The method of Embodiment 38, wherein the cancer is lung cancer, breast cancer, ovarian cancer, or prostate cancer.

[0143] Embodiment 46. The method of Embodiment 39, wherein the cancer is lung cancer, breast cancer, ovarian cancer, or prostate cancer.

[0144] Embodiment 47. The method of Embodiment 40, wherein the cancer is lung cancer, breast cancer, ovarian cancer, or prostate cancer.

[0145] Embodiment The following examples are useful in illustrating the present invention and are not intended to limit the scope of the claimed invention in any way.

[0146] material and method cell culture MDA-MB-231 (hereinafter referred to as MB-231) and LNCaP cells were obtained from ATCC. MB-231 cells selected for high folate receptor expression were donated by Dr. Philip Low (Purdue University). MB-231-miR-34a reporter cells had been previously produced. All MB-231 strains were cultured in RPMI 1640 medium (folate-free, Life Technologies), while LNCaP cells (CRL-1740) were cultured in RPMI 1640 medium (folate-free, Life Technologies). TM ,ATCC) in RPMI-1640 medium (30-2001 TM They were cultured in ATCC. Both culture media were diluted with 10% fetal bovine serum (FBS; Sigma), penicillin (100 U / mL), and streptomycin (100 mg / mL) (HyClone, GE Healthcare Life Sciences). Cells were monitored monthly for mycoplasma-free status using the MycoAlert Mycoplasma Detection Kit (Lonza). MDA-MB-231 cells and MB-231-miR-34a sensor cells overexpressing folate receptors were authenticated by ATCC using short tandem repeat profiling.

[0147] miRNA double-strand preparation and serum stability assay Unmodified, partially modified, and fully modified miR-34a duplexes were prepared by annealing the corresponding sense and antisense strands in equimolar ratios in the presence of annealing buffer [10 mM Tris buffer, pH 7 (Sigma), 1 mM EDTA (Sigma), 50 mM NaCl (Sigma)], followed by incubation at 95°C for 5 minutes and slow cooling to room temperature. The annealed oligonucleotides were then used for cell transfection or otherwise stored at -80°C. To prepare folate-miRNA conjugates (FolamiR), azide-containing sense strands were mixed with folate-DBCO (see Figure 6) in a 1:10 molar ratio (sense strand: folate-DBCO) and incubated at 23°C for 10 hours with shaking. The following day, the folate-miRNA conjugates were purified using Oligo Clean & Concentrator (Zymo Research) and then annealed with the antisense strand in the presence of the above annealing buffer in equimolar ratios. To assess serum stability, miR-34a double helix (50 pmol) was incubated in 50% FBS (Sigma) at 37°C for the indicated time. At each time point, RNA samples were mixed with RNA loading dye and stored at -20°C. After the final time point, samples were analyzed on a 15% polyacrylamide gel with Glycerol Tolerant Gel Buffer (GTB buffer), and the RNA was then stained using gel red nucleic acid gel stain (Thermo Fisher Scientific, Biotium 41003). Oligo sequences can be seen in Table 1.

[0148] [Table 1] PM: Partial modification; FM: Full modification; siLuc2 and siLuc+: Anti-luciferase siRNA used as negative control (NC); miR: miRNA; m: 2'-O-methyl; F: 2'-fluoro; r: Ribonucleotide; i: Internal; *: Phosphothioate bond; Phos: 5' phosphate

[0149] In vitro shiitake mushroom ciferase assay MB-231 reporter cells were transfected with negative control (NC) RNA, PM-miR-34a, or FM-miR-34a at the indicated time points using Lipofectamine RNAiMAX (Life Technologies). At each time point, the sea urchin-Glo luciferase assay (Promega) was performed according to the manufacturer's instructions. Briefly, the sea urchin-Glo luciferase substrate was mixed with sea urchin-Glo buffer at a 1:1000 dilution and then added to each well. After shaking the plate at room temperature for 10 minutes, the sea urchin luciferase signal was measured using a GloMax plate reader (Promega). For the sea urchin luciferase assay after Ago2 knockdown, MB-231 sensor cells were seeded in individual wells of a 96-well plate. The following day, cells were co-transfected with siRNA against 50 nM Ago2 (gene solution GS27161; QIAGEN) or control siRNA (4390846; Thermo Fisher Scientific) along with 10 nM NC, PM-miR-34a, FM-miR-34a double helix, or miR-34a mimetic (MC11030; Ambion) using Lipofectamine RNAiMAX (Life Technologies). The sea urchin luciferase assay was performed 48 hours after transfection, as described above.

[0150] Protein analysis using Western blotting MB-231 or LNCaP cells (1 × 10⁻¹⁰ 5MB-231 or LNCaP cells were seeded into individual wells of a 24-well plate (coated with poly-D-lysine in the case of LNCaP) and then transfected with 50 nM PM-miR-34a, FM-miR-34a, or siLuc2 (negative control) using Lipofectamine RNAiMAX (Life Technologies). To quantify miR-34a target protein expression after Ago2 knockdown, MB-231 or LNCaP cells were seeded into individual wells of a 24-well plate and then co-transfected with 50 nM NC, PM-miR-34a, FM-miR-34a double helix, or miR-34a mimetic (MC11030; Ambion) with siRNA against 50 nM Ago2 (gene solution GS27161; QIAGEN) or control siRNA (4390846; Thermo Fisher Scientific) using Lipofectamine RNAiMAX (Life Technologies). At each time point shown, cells were lysed in RIPA buffer [Tris-HCl (pH 8.0, 50 mM), N P-40 (1%), sodium chloride (150 mM), sodium deoxycholate (0.5%), SDS (0.1%), ddH2O (up to 100 mL)] in the presence of a 1× protease inhibitor cocktail (PIA32955, Thermo Fisher Scientific). Protein concentration was measured using the Pierce BCA Protein Assay Kit. Protein lysates (50 μg) were degraded on a 12% TGX gel (Bio-Rad) and transferred to a polyvinylidene difluoride (PVDF) membrane. After membrane blocking with LI-COR buffer at room temperature for 1 hour, the membrane was incubated overnight with the primary antibody shown at 4°C. After incubation with the corresponding secondary antibody, the blots were scanned using Li-Cor Odyssey CLX (Li-Cor).The antibodies used were: rabbit androgen receptor (D6F11) XP (5153, Cell Signaling), rabbit MET (D1C2) XP (8198, Cell Signaling), mouse CD44 (156-3C11) (3570, Cell Signaling), mouse β-ACTIN (3700, Cell Signaling), rabbit AXL (C89E7) (8661, Cell Signaling), and rabbit GAPDH (14C10) (2118, Cell Signaling). All antibodies were used at a 1:1000 dilution, except for the following: anti-Ago, clone 2A8 (MABE56; Millipore), and rabbit AXL (C89E7) (8661, Cell Signaling), which were used at a 1:500 dilution.

[0151] mRNA quantification using qRT-PCR MB-231 cells (1 x 10 5Cells were seeded into individual wells of a 24-well plate. The following day, cells were transfected with 50 nM PM-miR-34a, FM-miR-34a, or siLuc2 (negative control) using Lipofectamine RNAiMAX (Life Technologies). After 48 hours, total RNA was isolated using the miRneasy Kit (217004, Qiagen) according to the manufacturer's instructions. After genomic DNA removal using DNase I digestion (79254, Qiagen), RNA integrity was assessed by degradation on a 1.5% agarose gel. RNA concentration was quantified using nanodrops. Using total RNA (500 ng), cDNA was produced using the miScript Reverse Transcriptase Kit (218161, Qiagen) with HiFlex buffer, according to the manufacturer's instructions. Real-time polymerase chain reaction (qPCR) was performed using the SYBR Green PCR Kit (QIAGEN) with the following primers: Hs_AXL_1_SG, Hs_SIRT1_1_SG, Hs_MET_1_SG, Hs_GAPDH_1_SG, Hs_GNB2L1_2_SG, Hs_TNS4_1_SG, and Hs_ACTB_1_SG (QuantiTect Primer Assay; QIAGEN). The data were then processed using 2 -ΔΔCt The analysis was performed using the specified method and expressed as a change in magnification.

[0152] Cell proliferation assay Cell proliferation was measured using the sulforhodamine B (SRB, Sigma) assay as previously reported. Briefly, MB-231 or LNCaP cells were seeded into individual wells of a 96-well plate (coated with poly-D-lysine in the case of LNCaP). The following day, cells were transfected with various miRNA double helix (50 nM for MB-231 and 10 nM for LNCaP) using Lipofectamine RNAiMAX (Life Technologies). At the indicated times, cells were fixed in complete medium with 10% trichloroacetic acid for 1 hour at 4°C. Subsequently, cells were stained with 0.04% (wt / vol) SRB in 1% acetic acid for 1 hour at 37°C, and then the unbound dye was washed five times with 1% acetic acid. Protein-bound dyes were extracted using unbuffered Tris base (10 mM), and absorbance at 510 nm, a surrogate for cell volume, was measured using a GloMax Multi+ spectrophotometer (Promega). For the colony formation assay, transfected MB-231 cells were counted and seeded in a 6-well plate at a density of 250 cells / well. At the indicated time, the cells were subjected to differential quik (登録商標) The fabric was dyed using a dyeing and weaving kit (Polysciences, cat no. 26419-16).

[0153] Cell migration and invasion assays Regarding the migration assay, 2 × 10 5 MB-231 cells were seeded in each well of a 6-well plate. After 24 hours, the cells were transfected with 5 nM PM-miR-34a, FM-miR-34a, or NC(siLuc2) in 50% complete medium using Lipofectamine RNAiMAX (Life Technologies) according to the manufacturer's instructions. After 72 hours of transfection, the cells were trypsinized and counted, with 6 × 10⁶ cells from each treatment. 4Cells were transferred to the apical chamber of a 5 μm pore size Transwell plate (07-200-149; Fisher Scientific). Basal medium was added to the apical chamber, and 20% FBS-containing medium was added to the bottom chamber. After 12 hours, the cells were fixed and subjected to differential quickness testing according to the manufacturer's instructions. (登録商標) Dyeing was performed using a dyeing kit (26419-16; Polysciences, Inc.). For the invasive assay, 2 × 10⁻⁶ samples were taken. 5 LNCaP cells were seeded and transfected as described above. After transfection, 5 × 10⁻⁶ cells were obtained. 4 The cells were transferred to an apical chamber in an 8 μm pore size Transwell plate (07-200-150; Fisher Scientific) coated with 100 μl of 200 μg / ml Matrigel matrix (08-774-122; Fisher Scientific) at 37°C for 1 hour. To image the migration or invasion chamber, cells were transferred to the apical side of the porous membrane using a cotton tip applicator, and the insert was placed on a glass slide. Four regions were randomly selected and imaged using an Olympus IX73 microscope at 10x magnification. Cell counts were quantified using ImageJ v1.53t (NIH). Images were converted to RGB stacks, and for the maximum contrast stack, the threshold was adjusted to "0-90" and the size (pixels) was adjusted. 2 The particles were analyzed by setting the parameter to "50 to infinity". The data was compiled and analyzed using GraphPad Prism v9.4.1 (GraphPad Software, LLC).

[0154] RNA sequencing MB-231 cells (2 x 10 5 The cells were seeded into individual wells of a 6-well plate. The following day, the cells were transfected with various miRNA double helix (50 nM) using Lipofectamine RNAiMAX (Life Technologies). After 48 hours, the RNA was transfected with mirVana TMThe RNA Isolation Kit (Thermo Fisher, AM1560) was used to extract genomic DNA from cells, which was then digested with DNase I (79254, Qiagen). Sample quantification and purity were determined by nanodrop, and sample integrity was confirmed using an Agilent Bioanalyzer (Agilent Technology, California USA). The RNA sequencing library was processed using Illumina® NEBNext® Ultra to remove ribosomal RNA. TM The libraries were prepared using a poly(A) enrichment method with the II RNA Library Prep Kit. The libraries were then validated using Qubit for quantification, real-time PCR, and a bioanalyzer for size distribution detection. RNA sequencing was performed using a NovaSeq 6000 platform with a 150-base pair end-pair strategy.

[0155] Bioinformatics analysis Raw reads were trimmed and adjusted for GRCh38 (Ensembl release 104). Read counts were normalized using DESeq2 (v1.36.0) to identify genes with differential expression. 38 The p-value cutoff for statistically significant genes was 0.05, and no cutoff was used for log2FC. Volcano plots were plotted using the EnhancedVolcano package (v1.14.0) in R. Area-proportional Venn diagrams were edited using the DeepVenn tool. 39 A heatmap was created using the R pheatmap package (v1.0.12), with distance measurement set to "Euclidean" and clustering method set to "ward.D2". Gene set enrichment and miRNA target enrichment analysis were performed using the R gprofiler2 package (v0.2.1), with statistical significance calculated using the g:SCS algorithm and set to 0.05. 40Terms with p-adj (corrected p-value) < 0.05 were selected for further analysis. Data from the miRNA target enrichment analysis were exported to the ggplot2 package (v3.3.6) in R and visualized. Circle plots of selected biological processes and their gene set expression were created using the circleize package (v0.4.15) in R. For the miR-34a known / predicted target analysis, targets were exported from the miRDB database. 41 This was combined with gene downregulation in PM-miR-34a vs. NC and FM-miR-34a vs. NC comparisons. Results were visualized using GraphPad Prism v9.5.0 (GraphPad Software, LLC). Full R analysis was performed using statistically significant genes (p<0.05) or gene ontology terms (p-adj<0.05) and was conducted in the RStudio environment (v2022.12.0+353).

[0156] RNA immunoprecipitation assay MB-231 cells (3 x 10 6 The cells were seeded in 10 cm plates. The following day, the cells from two plates were transfected with 10 nM each of miR-34a mimetic (Ambion), PM-miR-34a, FM-miR-34a, or siLuc2 (negative control) double helix using Lipofectamine RNAiMAX (Life Technologies). The transfection medium was replaced with complete medium 4 hours after transfection. After 24 hours, the culture medium was discarded, the cells were washed twice with ice-cold PBS, and then treated with 400 mJ / cm³. 2 Then, again, 200 mJ / cm² 2The cells were then cross-linked using a UV cross-linking reagent (XL-1000; SpectroLinker). Cell lysis buffer (1×PBS, 1% vol / vol NP40, 0.5% wt / vol sodium deoxycholate, and 0.1% wt / vol SDS) was added in the presence of a 1× protease inhibitor cocktail (PIA32955, Thermo Fisher Scientific) and an RNase inhibitor (AM2696; Invitrogen) while shaking at 30°C and 4°C. After shaking, the cells were scraped into a 1.5 ml microcentrifuge tube, and DNase I (79254, Qiagen) was added to remove genomic DNA. The resulting cell lysate was centrifuged at 16,000×g for 20 minutes at 4°C, and the supernatant was pre-cleared by incubation with 20 μl of Dynabead Protein A beads (Life Technologies). Precleared cell lysates were incubated overnight at 4°C with 2A8 anti-Ago (MABE56; Millipore) or normal mouse IgG (12-371; Millipore). Then, Dynabead Protein A beads linked to cross-linked antibodies, rabbit anti-mouse IgG, and Fcγ (NC9549822; Fisher Scientific) were added to each sample. Samples were incubated at 4°C for 2 hours, then the beads were washed and resuspended as previously described (22). RNA was extracted using Qiazol reagent (Qiagen), followed by ethanol precipitation. cDNA was produced using quantitative reverse transcription polymerase chain reaction (qRT-PCR) with the miRscript II RT kit (Qiagen), HiSpec buffer, and then the SYBR Green PCR kit (Qiagen). The following primers were used: MiR-34a-5p (miScript primer assay; QIAGEN) and RNU6B (non-target RNA, miScript primer assay; QIAGEN). Data were then collected. -ΔΔCt The analysis was performed using the specified method and expressed as a change in magnification.

[0157] Tumor transplantation and in vivo experiments To evaluate the effect of FM-miR-34a on tumor growth, MB-231 cells were transfected with 50 nM PM-miR-34a, FM-miR-34a, or NC (siLuc2) using Lipofectamine RNAiMAX (Life Technologies) in 10 cm plates. After 24 hours, cells were trypsinized, washed with 1 × PBS, and mixed with Matrigel (Corning) in a 1:1 dilution. 6 ) 8-10 week old female (NU / J, Foxn1 nu The drug was administered subcutaneously to the flank of mice (bloodline #:002019, Jackson Lab). Using calipers, the tumor volume was measured at the indicated time and calculated using the following formula: Tumor volume: length × width 2 / 2.

[0158] Regarding single-dose studies using FolamiR, MB-231 sensor cells (7 × 10⁶) 6 ) were fed a folete-deficient diet (TD.95247, Envigo) for one week prior to treatment and throughout the experiment. (NU / J, Foxn1) nu (Pedigree #:002019, Jackson Lab) Injected into the flank of mice. Tumor volume was approximately 200 mm 3Once the mice reached a certain stage, they were treated with a single dose of Folate-NC (siLuc2), PM-FolamiR-34a, or FM-FolamiR-34a (1.5 nmol) via tail vein injection. Luminescence signals were captured pre-treatment and for 120 hours using Coelenterazine h Bioluminescent Substrate (PerkinElmer), administered intraperitoneally according to the manufacturer's instructions. Whole-body imaging of the animals was performed using Spectral AMI (Spectral Instruments). For protein and RNA extraction from tumor samples, individual tumors were collected, and RNA was stored at -80°C in RNA later (Life Technologies) until processing. Tumor tissue (50 mg) was destroyed by grinding in a cold mortar using liquid nitrogen. Powder from each tumor sample was transferred to an Eppendorf tube, and then RIPA buffer [Tris-HCl (pH 8.0, 50 mM), NP-40 (1%), sodium chloride (150 mM), sodium deoxycholate (0.5%), SDS (0.1%), ddH2O (up to 100 mL)] was added in the presence of a 1× protease inhibitor cocktail (PIA32955, Thermo Fisher Scientific). After centrifugation, an equal volume of protein lysate (50 μg) was degraded on a TGX gel (Bio-Rad), and the protein was then analyzed by immunoassay. Total RNA was analyzed using mirVana. TM RNA Isolation Kit (Invitrogen) TM cDNA was extracted from tumor samples using AM1560. cDNA was prepared using 1 μg of total RNA with the miScript SYBR Green PCR Kit (Qiagen) supplemented with HiSpec buffer. Standard curve (1 × 10⁻¹⁰) 3 Copy ~ 1 x 10 8Copies were created using a miR-34a mimetic (Life Technologies). qRT-PCR reactions (at least 3 technical replicates per biological copy) were performed using a QuantStudio 6 Flex Real-time PCR machine (Life Technologies) with the miScript SYBR Green PCR Kit (Qiagen) and miRNA primer assay (Qiagen).

[0159] To determine the efficacy of FM-FolamiR-34a conjugate against tumor growth, MB-231 cells (5 × 10⁶) were used. 6 Similar to the single-dose test method described, 8-10 week old females (NU / J, Foxn1) fed a folete-deficient diet (TD.95247, Envigo) were subjected to the same method as described above. nu (Pedigree #:002019, Jackson Lab) Injected into the flank of mice. Tumor volume was approximately 150 mm 3 Once the mice reached a certain stage, they were treated via the tail vein every six days with folate-NC (siLuc2, n=6), PM-FolamiR-34a (n=5), or FM-FolamiR-34a (n=6) (all 1.5 nmol). Body weight was recorded, and the tumor volume of each mouse was measured every three days using calipers and calculated using the following formula: Tumor volume: (length × width) 2 ) / 2. All protocols were approved by the Purdue Animal Care and Use Committee and followed the National Institutes of Health (NIH) guidelines for animal use.

[0160] Serum cytokine quantification To evaluate the potential immune response in vivo, immunocompetent mice (FVB.129 background) were injected with lipopolysaccharide (LPS, 0.63 mg / kg, intraperitoneal), PBS, and FM-FolamiR-34a or PM-FolamiR-34a (1.5 nmol, n=4, tail vein). Two hours after injection, the mice were sacrificed and whole blood was collected. Whole blood was incubated at room temperature for 1 hour, during which time serum was collected by centrifugation at 2000 × g for 10 minutes in a refrigerated centrifuge and then stored at -80°C until cytokine analysis. Interleukin-6 (IL-6) and tumor necrosis factor alpha (TNF-α) levels were measured in serum samples using the ELISA Max Deluxe Kit (Biolegend) according to the manufacturer's instructions.

[0161] statistical analysis Statistical analysis was performed using the Prism statistical package (GraphPad Software, version 9). A two-tailed Student's t-test was used to determine the statistical difference between two groups. One-way or two-way ANOVA was used to compare differences between multiple groups, and multiple comparisons were corrected using Dunnett's post-hoc test or Tukey's post-hoc test. Data are presented as mean ± SD or mean ± SEM, as specified in the figure captions. Statistically significant p-values ​​are indicated in the corresponding figure captions. [Examples]

[0162] Example 1 Design, synthesis, and in vitro serum stability of partially and fully modified miR-34a When designing modified RNA oligonucleotides to regulate gene expression, it is necessary to ensure that the incorporated modifications do not interfere with gene silencing. Previously, we synthesized miR-34a containing a minimum number of 2'-O-methyl modifications to ribose sugars, which we called partially modified miR-34a (PM-miR-34a). To understand the effects of complete chemical modification on miRNA stability and activity, we designed fully modified miR-34a (FM-miR-34a) with an asymmetric pattern containing a 22-nucleotide guide strand annealed to a 15-nucleotide complementary strand, which reduces the thermodynamic stability between the two strands, promoting strand substitution by the RNA-induced silencing complex (RISC). This pattern has been previously used to stabilize siRNA (4). Each strand contains an alternating pattern of 2'-O-methyl and 2'-fluoro-modified sugars and two phosphorothioate bonds at the 3' and 5' ends of each strand to reduce immunogenicity and provide exonuclease resistance (Figure 1A-1B). PM-miR-34a and FM-miR-34a double helix were produced and confirmed (Figure 1C). The stability of FM-miR-34a was compared over time with the stability of PM-miR-34a and unmodified miR-34a double helix by incubation of the double helix with 50% serum. Unmodified and PM-miR-34a rapidly degraded after exposure to serum, while FM-miR-34a remained completely resistant up to 24 hours and remained intact even after 72 hours of incubation (Figures 1D-1F).

[0163] Example 2 Comparison of FM-miR-34a and PM-miR-34a for target gene silencing To evaluate the effects of chemical modifications on miR-34a function, we compared the silencing activity of FM-miR-34a versus PM-miR-34a against synthetic targets (100% complementary sequences) and endogenous biological targets of miR-34a. We used MB-231 cells (MB-231-34a sensor cells) engineered to stably express the miR-34a complementary sequence downstream of the *Cortinarius* gene, and evaluated the effects on sequences with 100% complementarity. Transfection of MB-231-34a sensor cells with FM-miR-34a or PM-miR-34a significantly downregulated *Cortinarius* luciferase expression, suggesting that various chemical modifications do not interfere with miR-34a silencing activity (Figures 2A and 11). Similarly, both miR-34a constructs downregulated further reporters based on firefly luciferase after transient transfection (Figure 2B). We also compared the silencing activities of FM-miR-34a and PM-miR-34a against multiple biological targets in breast cancer cell lines (MB-231) and prostate cancer cell lines (LNCaP). In MB-231 cells, FM-miR-34a transfection resulted in more robust downregulation of MET and CD44 (Figure 2C), while in LNCaP cells, androgen receptor (AR) was similarly downregulated by both FM-miR-34a and PM-miR-34a (Figure 2D). We also compared the effects of FM-miR-34a and PM-miR-34a on mRNA levels of target genes after transfection of MB-231 cells. Both FM-miR-34a and PM-miR-34a significantly downregulated the miR-34a targets AXL, MET, and SIRT1, while there was no significant effect on the levels of transcripts not predicted to be miR-34a targets (Figure 2F). In summary, these results suggest that the proposed complete chemical modification, when applied to miR-34a, results in similar or enhanced silencing of miR-34a target genes, and advances the evaluation of the whole transcriptome after transfection with FM-mi-34a.

[0164] Example 3 Targeting using FM-miR-34a is more efficient and broader compared to targeting using PM-miR-34a. To compare the activity of FM-miR-34a and PM-miR-34a at a comprehensive level and to assess whether FM-miR-34a has any unintended off-target effects, we transfected MB-231 cells with PM-miR-34a or FM-miR-34a, performed RNA sequencing, and evaluated gene expression and related biological processes and pathways. Gene expression was more significantly altered in cells transfected with FM-miR-34a compared to cells transfected with PM-miR-34a, even when the data was normalized to either cells transfected with a negative control (Figure 10A-10B) or untransfected cells (Figure 10A), although there was substantial overlap. Of all genes altered by PM-miR-34a, 62.2% of downregulatory genes (Figure 10C) and 59.8% of upregulatory genes were also significantly altered by FM-miR-34a. Among the downregulatory genes, AXL had the lowest p-value after transfection with both PM- and FM-miR-34a (see Figure 10B). In addition to numerous genes that were modified after FM-miR-34a transfection, genes were often more strongly modified compared to PM-miR-34a (Figure 10D).

[0165] To determine whether FM-miR-34a mimics the targeting activity of endogenous miR-34a, genes downregulated by FM-miR-34a and PM-miR-34a were evaluated for miR-34a target enrichment. Target enrichment analysis was performed using experimentally confirmed targets found in the microRNA-target interaction database (mirTarBase). For downregulated RNAs in the PM-miR-34a dataset, the top miRNA predictions for transcriptional alteration were miR-193b-3p (p-value = 1.5e-24), followed by miR-34a-5p and miR-215-5p (Figure 10E). However, regarding RNA downregulation in the FM-miR-34a dataset, the top predicted miRNAs were miR-34a-5p (p=6.4e-28), followed by miR-449a and miR-34c-5p (Figure 10E), all of which are members of the miR-34 family. Further analysis confirmed that FM-miR-34a mimics endogenous miR-34a, as numerous miR-34a target genes were significantly altered in the FM-miR-34a gene set compared to the PM-miR-34a gene set (190 vs. 137). This is because miR-34a controls multiple cellular processes, including cell cycle arrest, cell proliferation, programmed cell death, and others. 20, 21 We performed both downregulation and upregulation tests on major biological processes and pathways regulated by FM-miR-34a and PM-miR-34a. While the KEGG and REACTOME terms showed similar overall enrichment of biological processes, PM-miR-34a performed better in downregulation of cell cycle-related processes. On the other hand, FM-miR-34a performed better in downregulation of genes involved in cell proliferation and migration, and in cleansing of programmed cell death-related processes (Figure 10F).

[0166] To further understand the targeting ability of FM-miR-34a, known and predicted miR-34a targets were compared using RNA-seq data obtained from PM-miR-34a and FM-miR-34a transfected cells with the miRDB database. Cells transfected with FM-miR-34a not only suppressed a greater number of miR-34a targets than PM-miR-34a transfected cells (277 vs. 191), but transfection with FM-miR-34a also resulted in more robust downregulation of targets (Figure 10G). Of the top 100 predicted miR-34a targets, FM-miR-34a downregulated 43%, while PM-miR-34a downregulated only 27% (Figure 10G, inset). These results indicate that FM-miR-34a downregulates more miR-34a targets and provides more robust downregulation compared to PM-miR-34a.

[0167] Example 4 Fully modified miR-34a inhibits cancer cell proliferation, migration, and invasion in vitro. The effects of complete chemical modification of miR-34a on cancer cell proliferation, migration, and invasion were compared. Compared to PM-miR-34a, FM-miR-34a transfected into MB-231 cells resulted in significant and potent inhibition of cell proliferation (Figure 3A) and migration (Figure 3C). In LNCaP cells, both FM-miR-34a and PM-miR-34a significantly inhibited cell proliferation (Figure 3B) and invasion (Figure 3D) in similar manner. These results are consistent with the effects of FM-miR-34a and PM-miR-34a on target genes (see Figures 2C-2D). To further compare the effects of FM-miR-34a and PM-miR-34a on MB-231 cell proliferation, a colony formation assay was performed after transfection. This assay would allow for the determination of the effect on cell proliferation over a longer period, which we hypothesized would be greater for FM-miR-34a due to its stability. As shown in Figure 3E, FM-miR-34a induced a significant inhibition of MB-231 colony formation ability, as indicated by a reduction in smaller colonies and overall colony count. Cell proliferation of non-tumorogenic BEAS-2B cells after transfection with any version of miR-34a was not altered, suggesting that the effect on cancer cells is a result dependent on oncogenic signaling, which is suppressed by miR-34a (see Figure 7). Overall, these results indicate that FM-miR-34a induces equivalent or improved inhibition of cancer cell proliferation, migration, and invasion compared to PM-miR-34a.

[0168] Example 5 The activity of FM-miR-34a depends on its loading into the Argonaut (Ago). There are several mechanisms by which synthetic oligonucleotides can reduce the expression of target genes independently of the miRNA-mediated pathway. For example, antisense oligonucleotides can downregulate target genes by inducing RNase H-mediated degradation or by steric hindrance. To confirm that FM-miR-34a functions using the same mechanism as endogenous miR-34a, we evaluated the need for Argonaut (Ago), a major component of RISC essential for endogenous miRNA activity. RNA immunoprecipitation was performed in MB-231 cells after transfection with FM-miR-34a, PM-miR-34a, a commercially available miR-34a mimite, or NC. RNA loaded into Ago was immunoprecipitated with an anti-Ago antibody, and then miR-34a was quantified. Subsequent analysis determined that FM-miR-34a is loaded into Ago as efficiently as PM-miR-34a and miR-34a mimics, suggesting that the enhanced silencing of FM-miR-34a is not due to good loading into Ago, but rather to FM-miR-34a exhibiting high affinity binding to the endogenous target (Figure 4A). To further confirm the role of Ago in FM-miR activity, MB-231 Ago2 was knocked down, and the effect of FM-miR-34a on silencing the sea urchin reporter (Figure 4B) or the endogenous miR-34a gene (Figures 4C-4D) was evaluated. Both the synthetic reporter and the endogenous target were desuppressed when FM-miR-34a was combined with Ago2 knockdown. In addition, the inhibitory effect of FM-miR-34a on proliferation, migration, and invasion of both MDA-MB-231 and LNCaP cells was lost when FM-miR-34a was combined with Ago2 silencing (Figures 4E-4F). Overall, these results indicate that FM-miR-34a is loaded into Ago and intervenes in both exogenous and endogenous target gene silencing, leading to phenotypic effects.

[0169] Example 6 In vivo evaluation of FM-miR-34a activity To determine the effect of FM-miR-34a on tumor growth and progression, MB-231 cells were transfected with either FM-miR-34a or PM-miR-34a and then implanted in immunodeficient mice. As shown in Figure 5A, cells transfected with the FM-miR-34a oligo showed significantly slower tumor growth compared to cells transfected with PM-miR-34a. Tumors collected from the FM-miR-34a group were smaller than those collected from the PM-miR-34a group (average tumor weight 0.12g vs. 0.55g for the PM-miR-34a group, Figure 5B). Next, a folate-miRNA delivery strategy was employed that not only provides specific delivery to tumors but also completely eliminates the proposed toxic delivery medium. However, since no inclusion delivery medium is used, naked miRNAs are attached to both serum and cellular nucleases, which should mask the overall effect of the miRNA if it is unmodified. In this case, using FM-miR-34a, we hypothesized a stronger and longer-lasting antitumor effect. To test this hypothesis, we first verified the delivery of a folate-near-infrared conjugate (folate-NIR, see Figure 8 for synthesis scheme) to folate receptor (FR) overexpressing milk, cervical, and ovarian cancer cell lines. The folate-NIR conjugate specifically bound to FR-expressing MDA-MB-231, Hela, KB, and IGROV-1 cells, and binding was eliminated by competition in the presence of excess folate-glucosamine. Subsequently, the sense strands of conjugate PM-miR-34a and FM-miR-34a were conjugated to folate, and then the antisense strands were annealed to produce PM-FolamiR-34a and FM-FolamiR-34a double helix. To compare the activity of FolamiR, single doses of PM-FolamiR-34a, FM-FolamiR-34a, or Folate-NC were injected into the tail vein of nude mice carrying MDA-MB-231 sensor cells. In this case, the animals were administered 1.5 nM, a dose three times lower than that previously used for downregulation of sea urchin luciferase expression with the first-generation PM-FolamiR-34a conjugate.As previously observed, the cyanechozoanthid was downregulated in animals administered with PM-FolamiR-34a for approximately 48 hours after systemic injection; however, the signal returned to baseline after 24 hours. Conversely, the signal in FM-FolamiR-34a-treated mice decreased 24 hours after systemic injection and remained low for at least 96 hours post-injection (Figure 5C-5D). To evaluate the effect of FM-FolamiR-34a on biological targets, tumors were harvested 120 hours after injection and the expression of various miR-34a targets was assessed. MET, CD44, and AXL protein levels were significantly reduced in the FM-FolamiR-34a-treated group compared to tumors harvested from the PM-FolamiR-34a or Folate-NC groups, confirming FM-miR-34a's ability to potently silence its biological targets in vivo (Figure 5E). Compared to mice treated with low doses of PM-FolamiR-34a or Folate-NC, the number of miR-34a copies detected in tumors collected from FM-FolamiR-34a-treated mice was higher, which may be due to enhanced FM-miR-34a stability rather than lower cDNA synthesis (Figure 5F, Figure 9).

[0170] Next, the efficacy of FM-FolamiR-34a and PM-FolamiR-34a was evaluated in MDA-MB-231 tumor-bearing mice. Folate-conjugate was administered at a dose of 1.5 nmol every 6 days, based on the effect of FM-FolamiR-34a on the biological target 5 days after a single dose (see Figure 5E). PM-FolamiR-34a administration resulted in delayed tumor growth (average tumor volume approximately 1.5 times vs. 3 times with folate-NC), but FM-FolamiR-34a significantly inhibited tumor growth to the end of the 21-day study, with an average tumor volume smaller or equal to that on the first day of treatment. It is noteworthy that the tumors of two mice treated with FM-FolamiR-34a shrank to approximately 25-50% of their initial volume, and one mouse was completely cured with no residual tumor tissue 54 days after treatment.

[0171] Importantly, no significant changes in body weight were observed during the study, suggesting the safety of FM-FolamiR-34a (Figure 5H). As in the preliminary assessment of potential immune responses, FM-FolamiR-34a or PM-FolamiR-34a was injected into the tail vein of immunocompetent mice (FVB.129 background), and serum IL-6 and TNF-α cytokine levels were quantified 2 hours after injection. Compared to positive control mice injected with LPS, neither FM-FolamiR-34a nor PM-FolamiR-34a resulted in a significant increase in cytokine levels beyond those of negative controls (Figure 5I). In summary, these results indicate that FM-FolamiR-34a, compared to PM-FolamiR-34a in vivo, induces potent and long-lasting silencing of both the synthetic and biological targets of miR-34a, resulting in a significant delay in tumor growth.

[0172] Consideration The stability and activity of partially and fully modified miR-34a were directly compared using lipid transfection and folate-mediated miRNA delivery approaches. Full chemical modification of miR-34a extended stability compared to unmodified or partially modified miR-34a. FM-miR-34a induced stronger silencing of MET and CD44 protein expression in MDA-MB-231 breast cancer cells compared to PM-miR-34a. Consistent with this, FM-miR-34a-transfected cells showed a significant decrease in migratory ability. In prostate cancer cells (LNCaP), FM-miR-34a induced similar downregulation of AR protein expression and equivalent inhibition of invasiveness. The differences in the intensity of MET, CD44, and AR silencing by FM-miR-34a suggest that the effects of FM-miR-34a on various genes are sequence-dependent. This also suggests that the complete chemical modification approach can be generalized to induce targeting in multiple genes and various cell lines, and provides a rationale for future optimization of chemical modifications to achieve favorable effects in the case of LNCaP cells. The need for endogenous Ago for FM-miR-34a function was confirmed by immunoprecipitation and cell activity assays.

[0173] Using a more clinically relevant approach to miRNA delivery (FM-FolamiR-34a), we evaluated the effects of chemical modification on miR-34a activity in vivo. Previously, it was shown that a 5 nmol dose was necessary in vivo to downregulate sea urchin luciferase expression (used as a surrogate for miR-34a activity), and that the effect lasted only a few hours. Here, we compared the effects of folete-PM-miR-34a and folete-FM-miR-34a using low doses (3x very low, 1.5 nmol). The data showed that FM-FolamiR-34a exhibited potent downregulation of sea urchin luciferase expression, which remained suppressed longer than folete-PM-miR-34a. Furthermore, systemic administration of FM-FolamiR-34a (single dose, 1.5 nmol) showed significant silencing of miR-34a's biological targets (MET, CD44, and AXL) after 5 days. Furthermore, a greater amount of FM-miR-34a was present in the tumor compared to PM-miR-34a, suggesting enhanced stability of FM-miR-34a.

[0174] Enhanced miRNA stability and subsequent sustained silencing effect may eliminate the need for endosomal escape agents to release RNA from endosomes before degradation. This was observed in the case of fully modified siRNA conjugated with N-acetylgalactosamine (GalNAc) ligand (GalNAc-siRNA). GalNAc-siRNA exhibits sustained activity in vivo, partly due to its enhanced stability and slower release from acidic intracellular compartments. Overall, modification of miRNA duplexes using 2'-O-methyl and 2'-fluororibose bases and phosphorothioate bonds enhanced both miRNA stability and activity. The combination of folate ligands and full chemical modification is beneficial in reducing effective doses and avoiding toxic side effects resulting from nonspecific uptake or high miRNA doses.

[0175] All patents, patent applications, academic papers, textbooks, and other publications described herein are indicators of the level of skill of a person skilled in the art to which this disclosure relates. All such publications are incorporated herein by reference to the same extent as each individual publication is incorporated by reference separately and independently. In the event of any inconsistency in use between this document and any document incorporated by reference, the incorporated use by reference should be considered auxiliary to this document; in the event of an incompatible inconsistency, the use in this document shall prevail.

[0176] The inventions described herein can be adequately implemented even in the absence of one or more elements or limitations not specifically disclosed herein. Therefore, any instance of the terms “including,” “essentially consisting of,” and “consisting of” here may be replaced with any of the other two terms. Similarly, singular expressions include plural subjects unless clearly indicated by the context. Therefore, for example, a description of “method” includes one or more methods and / or processes of the type described herein and / or that will become apparent to those skilled in the art by reading this disclosure. The term “or” here is used to mean non-exclusive “or” unless otherwise specified.

[0177] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art. The following terms and phrases have the meanings shown.

[0178] The term “approximately” means that when referring to a number or numerical value or range (including integers, fractions, and percentages), the number or numerical range referred to is an approximation within experimental variability (or statistical experimental error), and therefore the number or range may vary by 1% to 15% (e.g., ±5% to 15% of the stated value, e.g., within 10%, 5%, or 1% of the limit of the stated value or range) insofar as a person skilled in the art would consider it equivalent to the stated value (e.g., having the same function or result). The term “substantially” means that the degree of variation in the value or range may be, for example, within 90%, 95%, 99%, 99.5%, 99.9%, 99.99%, or at least approximately 99.999% or more of the limit of the stated value or range.

[0179] Furthermore, any expressions or terms used herein that are not otherwise defined are to be understood as being for the purpose of description only and not as limitation. Any use of section titles is intended to aid in the reading of this document and should not be interpreted as limitation. In addition, information relating to a section title may be present within or outside that particular section.

Claims

1. A fully chemically modified microRNA (miRNA), wherein the miRNA is modified with 2'-O-methyl, 2'-fluororibose bases and phosphorothioate bonds.

2. The fully chemically modified miRNA according to claim 1, wherein the miRNA is of the miR-34a family of miRNAs.

3. The fully chemically modified miRNA according to claim 1, wherein at least a portion of the miRNA is double-stranded.

4. The fully chemically modified miRNA of claim 3, wherein each chain can independently be about 12 to 40 nucleotides in length.

5. The fully chemically modified miRNA of claim 3, wherein one strand is longer than the other.

6. The fully chemically modified miRNA of claim 5, wherein one strand is an antisense strand and the other strand is an antisense strand, and the antisense strand is 1 to 7 nucleotides longer than the sense strand.

7. The fully chemically modified miRNA according to claim 3, wherein the miRNA comprises a double-stranded region and a single-stranded region.

8. The fully chemically modified miRNA of claim 7, wherein the double-stranded region is 12 to 25 nucleotide base pairs long and / or the single-stranded region is at least about 7 nucleotides long.

9. The fully chemically modified miRNA of claim 3, wherein one strand is an antisense strand and the other strand is an antisense strand, the sense strand has 15 nucleotides and the antisense strand has 22 nucleotides.

10. The fully chemically modified miRNA of claim 2, wherein the miRNA comprises a minimum length of 6 nucleotides and a maximum length of 24 nucleotides.

11. The fully chemically modified miRNA according to claim 1, wherein the miRNA contains at least six consecutive nucleotide base pairs present in SEQ ID NO:

1.

12. The fully chemically modified miRNA according to claim 1, wherein the miRNA has at least 80% identity with SEQ ID NO: 1 or a portion thereof.

13. The fully chemically modified miRNA of claim 2, wherein the miRNA is sequence number 3, 4, or 14.

14. A fully chemically modified miRNA according to any one of claims 1 to 13, wherein each chain comprises an alternating pattern of 2'-O-methyl-modified and 2'-fluoro-modified sugars and phosphorothioate bonds at the 5' and 3' ends of the chain.

15. Sense chain is an array: / 52FG / *mC* / i2FU / mA / i2FA / mG / i2FA / mC / i2FA / mC / i2FU / mG / i2FC / *mC* / i2FA / / 3AzidN / (Sequence ID 4) or / 5mC / *mC* / mA / i2FG / mC / i2FU / mA / i2FA / mG / i2FA / mC / i2FA / mC / i2FU / mG / mC* / *mC* / mU / T / T / 3Azide N / (SEQ ID NO: 14) It has an antisense chain in the array: 5Phos / mU* / i2FG / *mG / i2FC / mA / i2FG / mU / i2FG / mU / i2FC / mU / i2FU / mA / i2FG / mC / i2FU / mG / i2FG / mU / i2FU / mG* / 32FU / (SEQ ID NO: 5) or 5VPPhos / mU* / i2FG / *mG / i2FC / mA / i2FG / mU / i2FG / mU / i2FC / mU / i2FU / mA / i2FG / mC / i2FU / mG / i2FG* / mU* / i2FU* / mG* / 3yU / (SEQ ID NO: 1) The expression is such that m is 2'-O-methyl; F is 2'-fluoro; r is ribonucleotide; i is internal; * is a phosphorothioate bond; Phos is 5'-phosphate; VP is 5'-vinylphosphonate; and y is an extended nucleic acid. The fully chemically modified miRNA according to claim 1.

16. The fully chemically modified miRNA of claim 1, comprising a sense sequence and an antisense sequence, wherein the antisense sequence comprises at least seven consecutive nucleotides of sequence number 1.

17. A conjugate comprising a fully chemically modified miRNA according to any one of claims 1 to 16, which includes a folate ligand.

18. The conjugate of claim 17, further comprising a group that improves tumor uptake of the conjugate.

19. The conjugate of claim 18, wherein the group that improves tumor uptake of the conjugate includes an albumin-binding moiety.

20. The conjugate of claim 18, wherein the conjugate includes a linker.

21. The conjugate of claim 20, wherein the linker comprises carbonyl, aminoalkyleneamino, carbonylalkylenecarbonyl, thionocarbonyl, alkylene, cycloalkylene, aminoalkylene, alkylenecycloalkyl, alkylenecycloalkylenecarbonyl, aminoalkylenecycloalkylenecarbonyl, alkylenecarbonyl, cycloalkylenecarbonyl, carbonylalkylcarbonyl, and combinations thereof.

22. The conjugate of claim 20, further comprising a linker that improves tumor uptake of the conjugate.

23. The conjugate of claim 22, wherein the group that improves tumor uptake of the conjugate includes an albumin-binding moiety.

24. DUPA or formula: 【Chemistry 1】 A conjugate comprising a ligand, comprising a fully chemically modified miRNA according to any one of claims 1 to 16.

25. The conjugate of claim 24, further comprising a group that improves tumor uptake of the conjugate.

26. The conjugate of claim 25, wherein the group that improves tumor uptake of the conjugate includes an albumin-binding moiety.

27. The conjugate of claim 24, wherein the conjugate includes a linker.

28. The conjugate of claim 27, wherein the linker comprises carbonyl, aminoalkyleneamino, carbonylalkylenecarbonyl, thionocarbonyl, alkylene, cycloalkylene, aminoalkylene, alkylenecycloalkyl, alkylenecycloalkylenecarbonyl, aminoalkylenecycloalkylenecarbonyl, alkylenecarbonyl, cycloalkylenecarbonyl, carbonylalkylcarbonyl, and combinations thereof.

29. The conjugate of claim 27, further comprising a linker that improves tumor uptake of the conjugate.

30. The conjugate of claim 29, wherein the group that improves tumor uptake of the conjugate includes an albumin-binding moiety.

31. A composition comprising a fully chemically modified miRNA according to any of claims 1 to 16 and a pharmaceutically acceptable carrier, diluent, or additive.

32. The composition of claim 31, wherein each strand of fully chemically modified miRNA contains an alternating pattern of 2'-O-methyl-modified and 2'-fluoro-modified sugars and phosphorothioate bonds at the 5' and 3' ends of the strands.

33. A composition comprising any conjugate of claims 17 to 23 and a pharmaceutically acceptable carrier, diluent, or additive.

34. A composition comprising any conjugate of claims 24 to 29 and a pharmaceutically acceptable carrier, diluent, or additive.

35. A method for treating cancer in a subject, comprising administering to the subject an effective amount of a fully chemically modified miRNA according to any one of claims 1 to 15.

36. The method of claim 35, wherein each strand of fully chemically modified miRNA contains an alternating pattern of 2'-O-methyl-modified and 2'-fluoro-modified sugars and phosphorothioate bonds at the 5' and 3' ends of the strands.

37. A method for treating cancer in a subject, comprising administering to the subject an effective amount of the composition of claim 31 for cancer treatment.

38. A method for treating cancer in a subject, comprising administering to the subject an effective amount of the composition of claim 32 for cancer treatment.

39. A method for treating cancer in a subject, comprising administering to the subject an effective amount of the composition of claim 33 for cancer treatment.

40. A method for treating cancer in a subject, comprising administering to the subject an effective amount of the composition of claim 34 for cancer treatment.

41. The method of claim 35, wherein the cancer is lung cancer, breast cancer, ovarian cancer, or prostate cancer.

42. The method of claim 41, wherein the cancer is prostate cancer.

43. The method of claim 36, wherein the cancer is lung cancer, breast cancer, ovarian cancer, or prostate cancer.

44. The method of claim 37, wherein the cancer is lung cancer, breast cancer, ovarian cancer, or prostate cancer.

45. The method of claim 38, wherein the cancer is lung cancer, breast cancer, ovarian cancer, or prostate cancer.

46. The method of claim 39, wherein the cancer is lung cancer, breast cancer, ovarian cancer, or prostate cancer.

47. The method of claim 40, wherein the cancer is lung cancer, breast cancer, ovarian cancer, or prostate cancer.

Images