Fusion protein, corresponding nucleic acid, in vitro synthesis system, and manufacturing method
The fusion protein with a defined linker structure for in vitro synthesis addresses manufacturing inefficiencies in immunotoxins, achieving high yield and stability for therapeutic use.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- KANGMA (SHANGHAI) BIOTECH LTD
- Filing Date
- 2024-04-01
- Publication Date
- 2026-04-14
AI Technical Summary
Existing immunotoxins face challenges such as high manufacturing costs, low production efficiency, and instability due to complex chemical bonding methods and expression systems, limiting their industrial application and therapeutic efficacy.
A fusion protein is developed with a specific linker structure linking an effector and guide vector portion, suitable for in vitro synthesis using a yeast cell-free system, enhancing production efficiency and stability.
The fusion protein achieves high yield and activity comparable to commercial products, with lower costs and shorter cycles, suitable for industrial production and therapeutic applications.
Smart Images

Figure 2026511877000001_ABST
Abstract
Description
[Technical Field]
[0001] This invention belongs to the field of biotechnology and specifically relates to fusion proteins, corresponding nucleic acids, in vitro synthesis systems, and production methods. [Background technology]
[0002] Globally, the incidence of cancer is gradually increasing, the number of patients is growing year by year, and the number of cancer-related deaths is also gradually increasing annually. In conventional cancer treatment, chemotherapy and radiation therapy often cause pain to patients because they have low selectivity between cancer cells and normal cells. Recently, immunotherapies with selectivity, such as targeted drugs, monoclonal antibodies, bispecific antibodies, ADCs, and immunotoxins, have been rapidly developing.
[0003] Immunotoxins generally consist of a guide vector portion and an effector portion. The guide vector portion is responsible for binding the immunotoxin molecule to tumor cells that have a target site. The effector portion is responsible for killing the tumor cells. The guide vector portion of an immunotoxin is often derived from the immune system, including antibodies, cytokines, and growth factors. The effector portion consists of several toxin proteins. By removing the binding domain of a naturally occurring toxin protein and replacing it with the guide vector portion, the toxin protein acquires the ability to target tumor cells. These toxin proteins may be derived from bacterial, fungal, plant, or even animal toxin proteins. Commonly used bacterial toxin proteins include Vibrio cholerae toxin (ChxA), Shiga toxin, Pseudomonas exotoxin A (PE), and diphtheria toxin (DT).
[0004] Immunotoxins have undergone three generations of development.
[0005] First-generation immunotoxins used complete monoclonal antibody molecules. While the antibody specificity and stability were not problematic, the molecules were too large to penetrate tissues and reach the target site. Furthermore, they had the disadvantage of being highly immunogenic and easily inducing an immune response. For these reasons, this method is no longer used.
[0006] Second-generation immunotoxins use Fab instead of complete antibody molecules. This solves the problem of large molecular size, but it still requires the use of chemical bonds to link the toxin protein and antibody. Chemical bonding methods require the addition of chemical reagents, resulting in low binding efficiency, high manufacturing costs, and reduced product uniformity due to the numerous binding sites on the protein. Chemical bonds are easily cleaved, leading to leakage of toxic substances and increasing the risk of toxic side effects. Furthermore, the naked antibodies produced by degradation can block antigens, reducing therapeutic efficacy.
[0007] Third-generation immunotoxins utilize genetically engineered recombinant expression, which involves fusing a gene encoding a guide functional polypeptide with a gene encoding a toxin polypeptide and expressing them in a suitable expression system. Compared to immunotoxins produced by chemical bonding methods, this significantly improves product uniformity and stability, enabling mass production of immunotoxins. However, they are currently expressed primarily through cells and still have some limitations.
[0008] For example, single-chain antibody immunotoxins are currently expressed primarily using E. coli expression systems. The guide sites of the immunotoxins often form inclusion bodies because they do not fold properly within the E. coli expression system. Regeneration of these inclusion bodies is a very complex process. Generally, the protein regeneration efficiency is about 20%. While some of the drawbacks of E. coli expression can be overcome via eukaryotic secretion, the long fermentation cycle and high cost make it difficult to compete for industrialization.
[0009] Furthermore, in the third generation, antibody Fv fragments are now widely used in their construction. This is because Fv fragments are the smallest units containing a complete antigen-binding site, and their small molecular size makes them easily expressed in cell systems. However, the Fv structure is unstable in the body and prone to dissociation because it cannot form a covalent bond between VH and VL. [Overview of the project] [Problems that the invention aims to solve]
[0010] This invention provides fusion proteins and corresponding nucleic acids, in vitro synthesis systems, and production methods suitable for low cost, short cycles, and high production, thereby overcoming some of the aforementioned shortcomings of existing immunotoxins. [Means for solving the problem]
[0011] For this purpose, the present invention provides the following technical solutions.
[0012] The present invention provides a fusion protein used to kill target cells, comprising an effector portion A containing a toxin molecule, a guide vector portion B that binds to a target site on the target cell and is derived from an antibody or cytokine, and a first linker L1 that links the effector portion A and the guide vector portion B, wherein the first linker L1 contains at least three amino acid residues, preferably 3 to 20 amino acid residues, more preferably 3 to 10 amino acid residues, and even more preferably, the effector portion A, the first linker L1, and the guide vector portion B are linked in the direction A-L1-B from the N-terminus to the C-terminus, or in the direction B-L1-A from the N-terminus to the C-terminus.
[0013] The fusion protein provided by the present invention also includes a toxic polypeptide in which the toxin molecule is any one of the following: (a) plant-derived toxin, (b) bacterial-derived toxin, (c) fungal-derived toxin, (d) human-derived protein toxin, (e) any one of (a) to (d), (f) a functional fragment derived from any one of (a) to (d), or a variant of the functional fragment. Preferably, the toxin molecule has characteristics derived from diphtheria toxin, Pseudomonas aeruginosa exotoxin A, or Vibrio cholerae toxin.
[0014] The fusion protein provided by the present invention also has a structure in which the toxin molecule contained in the effector portion is (1) Preferably, the diphtheria toxin transport domain DT and catalytic domain DA are linked in the direction of DA-DT from the N-terminus to the C-terminus. (2) The catalytic domain DA of diphtheria toxin, (3) Preferably, the transport domain PT and catalytic domain PA of Pseudomonas aeruginosa exotoxin A are linked in the direction of PT-PA from the N-terminus to the C-terminus. (4) The catalytic domain PA of Pseudomonas aeruginosa exotoxin A, (5) Preferably, the transport domain CT and catalytic domain CA of the Vibrio cholerae toxin are linked in the direction of CT-CA from the N-terminus to the C-terminus. (6) The catalytic domain CA of Vibrio cholerae toxin, It has one of the following characteristics.
[0015] The fusion protein provided by the present invention is also characterized in that the toxin molecule has an amino acid sequence shown in any one of SEQ ID NOs: 1 to 9, or an amino acid sequence having at least 80%, 85%, 90%, 95%, or 99% sequence homology percentage with any one of SEQ ID NOs: 1 to 9.
[0016] The fusion protein provided by the present invention also has a guide vector portion which is an antibody, and the antibody is one or more of the following: monoclonal antibody, chimeric antibody, modified antibody, small molecule antibody, or polyvalent antibody. Preferably, the antibody is one or more of a small molecule antibody or a multivalent antibody, More preferably, The small molecule antibody is one or more of Fv, Fab, ScFv, ScFab, ScIgG, dsFv, nanobody, and single domain antibody.
[0017] The multivalent antibody is a tandem antibody formed by tandemly linking at least two single-chain antibodies and an antibody multimer fusion protein formed by a small molecule antibody and a polymer protein. Furthermore, the antibody multimer fusion protein has the characteristic of being a dimer or a tetramer.
[0018] The fusion protein provided by the present invention also has the characteristic that the antibody is ScFab, ScFv, ScIgG, nanobody, tandem linkage of two ScFabs, tandem linkage of two ScFvs, tandem linkage of two nanobodies, fusion of ScFab and antibody fragment CH3, fusion of ScFv and antibody fragment CH3, tandem linkage in which two nanobodies are fused via CH3 (for example, VHH1-L3-CH3-L3-VHH2), fusion of ScFab and Tamavidins2 protein, or fusion of ScFv and Tamavidins2 protein.
[0019] The fusion protein provided by the present invention also has the characteristic that the structure of ScFab is such that the light chain part and the heavy chain part of ScFab are linked in the direction from the N-terminus to the C-terminus, or the heavy chain part and the light chain part of ScFab are linked in the direction from the N-terminus to the C-terminus, and between ScFab and the antibody fragment CH3, they are linked in the direction from the N-terminus to the C-terminus or from the C-terminus to the N-terminus, the heavy chain part and the light chain part of ScFv are linked in the direction from the N-terminus to the C-terminus, and the fusion of ScFab and Tamavidins2 protein is linked in the direction from Tamavidins2 protein to ScFab from the N-terminus to the C-terminus, The fusion of ScFab and Tamavidins2 protein has the characteristic of satisfying the condition of being linked in the direction from Tamavidins2 protein to ScFv from the N-terminus to the C-terminus.
[0020] The fusion protein provided by the present invention also links the light chain and heavy chain portions of ScFab, ScFv, ScFv, and ScIgG, respectively, via a second linker L2, wherein the second linker L2 contains at least 15 amino acid residues, preferably 15-180, 15-120, 15-90, 15-65, or 20-60 amino acid residues.
[0021] The fusion protein provided by the present invention also includes a second linker L2 comprising one or more major amino acid residues from among G, S, T, and A, wherein the number of major amino acid residues accounts for at least 50%, 60%, 70%, 80%, or 90% of the total number of amino acid residues in the second linker, and more preferably, the major amino acid residues comprise one or more amino acid residues from among G and S, and the total amount of these residues accounts for at least 40%, or more than 45%, or more than 60%, or more than 70%, or more than 80% of the total number of amino acid residues in the second linker. Furthermore, the second linker L2 is characterized by having an amino acid sequence shown in any one of sequence numbers 10, 12, 13, 14, 17, 28, 45, and 47, or having an amino acid sequence having at least 80%, 85%, 90%, 95%, and 99% sequence homology percentages with any one of sequence numbers 10, 12, 13, 14, 17, 28, 45, and 47.
[0022] The fusion protein provided by the present invention also has a third linker L3 connecting two single-chain antibodies, a small molecule antibody and a polymer protein, wherein the third linker L3 is either free of amino acid residues or contains at least three amino acid residues, preferably 5 to 20 amino acid residues, preferably 8 to 20 amino acid residues, or 8 to 15 or 8 to 12 amino acid residues, and more preferably contains two major amino acid residues, G and S, and the number of major amino acid residues accounts for 40% or more of the total number of amino acid residues in the third linker. For example, the third linker L3 is characterized by having an amino acid sequence shown in any one of SEQ ID NOs: 10, 14, 18, 20-30, 44, and 48-51, or having an amino acid sequence that has at least 80%, 85%, 90%, 95%, or 99% sequence homology percentage with any one of SEQ ID NOs: 10, 14, 18, 20-30, 44, and 48-51.
[0023] The fusion protein provided by the present invention is also characterized in that the antibody is an antibody that specifically binds to one or more antibodies from among Her2 and CD22.
[0024] The fusion proteins provided by the present invention also have antibodies selected from IgM, IgG, IgA, IgD, and IgE, preferably from trastuzumab, rituximab, bevacizumab, adalimumab, pembrolizumab, ustekinumab, and nivolumab. It has characteristics selected from (Nivolumab), Ocrelizumab, Palizumab, Infliximab, Omalizumab, Envafolimab, Atlizumab, Atezolizumab, or Cetuximab, or their variants.
[0025] The fusion protein provided by the present invention also, For Fab or ScFab: The light chain portion constituting Fab or ScFab has the amino acid sequence shown in SEQ ID NO: 32, or has an amino acid sequence having at least 80%, 85%, 90%, 95%, or 99% sequence homology percentages with SEQ ID NO: 32, or The variable domains constituting the heavy chain portion of Fab or ScFab have the amino acid sequence shown in SEQ ID NO: 33 or 55, or have an amino acid sequence having at least 80%, 85%, 90%, 95%, or 99% sequence homology percentages with SEQ ID NO: 33 or 55, or The first constant domain CH1, which constitutes the heavy chain portion of Fab or ScFab, has the amino acid sequence shown in SEQ ID NO: 34 or 57, or has an amino acid sequence having at least 80%, 85%, 90%, 95%, or 99% sequence homology percentages with SEQ ID NO: 34 or 57. For Fv, dsFv, or ScFv: The variable domain constituting the light chain portion of Fv, dsFv, or ScFv has the amino acid sequence shown in SEQ ID NO: 35 or 54, or has an amino acid sequence having at least 80%, 85%, 90%, 95%, or 99% sequence homology percentage with SEQ ID NO: 35 or 54, or The variable domain constituting the heavy chain portion of Fv, dsFv, or ScFv has the amino acid sequence shown in SEQ ID NO: 33 or 55, or has a sequence homology percentage of at least 80%, 85%, 90%, 95%, or 99% with SEQ ID NO: 33 or 55. In the case of ScIgG: The light chain portion constituting ScIgG has the amino acid sequence shown in SEQ ID NO: 32 or 56, or has an amino acid sequence having at least 80%, 85%, 90%, 95%, or 99% sequence homology percentages with SEQ ID NO: 32 or 56, or The heavy chain portion constituting ScIgG has the amino acid sequence shown in SEQ ID NO: 36 or 17, or has an amino acid sequence having at least 80%, 85%, 90%, 95%, or 99% sequence homology percentages with SEQ ID NO: 36 or 17. In the case of the relevant antibody fragment CH3, the antibody fragment CH3 has the amino acid sequence shown in SEQ ID NO: 37, or has an amino acid sequence having at least 80%, 85%, 90%, 95%, and 99% sequence homology percentages with SEQ ID NO: 37. In the case of the related Tamavidins2 protein, the Tamavidins2 protein has the amino acid sequence shown in SEQ ID NO: 38, or has an amino acid sequence having at least 80%, 85%, 90%, 95%, and 99% sequence homology percentages with amino SEQ ID NO: 38. In the case of related nanoantibodies, they have the amino acid sequence shown in SEQ ID NO: 52 or 53, or an amino acid sequence having at least 80%, 85%, 90%, 95%, or 99% sequence homology percentages with SEQ ID NO: 52 or 53. The activity of fusion proteins against target cells, especially IC 50 It possesses features comparable to the commercially available DS-8201a or T-DM1.
[0026] The fusion protein provided by the present invention is also suitable for cell-free in vitro synthesis, and preferably, the cell-free in vitro synthesis is characterized by the step of obtaining the fusion protein in a cell-free in vitro synthesis system, using the nucleic acid encoding the fusion protein as a DNA template or RNA template, culturing it under predetermined conditions for a predetermined time.
[0027] The fusion protein provided by the present invention is also characterized in that the cell-free in vitro synthesis system comprises a cell extract, the cell extract is derived from a yeast strain, and further, the yeast strain is a combination of one or more species of Saccharomyces cerevisiae and Kluyveromyces yeasts, and in another preferred example, the Kluyveromyces yeast is a combination of one or more species of Kluyveromyces lactis, Kluyveromyces marxianus and Kluyveromyces dobzhanskii.
[0028] The fusion protein provided by the present invention also features a yeast strain that has been genetically engineered to possess toxin resistance.
[0029] The fusion protein provided by the present invention is also characterized in that the first linker L1 has an amino acid sequence shown in any one of SEQ ID NOs: 10, 11, 15, 16, 18-20, 31, and 43, or an amino acid sequence having at least 80%, 85%, 90%, 95%, and 99% sequence homology percentages with any one of SEQ ID NOs: 10, 11, 15, 16, 18-20, 31, and 43.
[0030] The present invention also provides isolated nucleic acids characterized by encoding the fusion protein.
[0031] The present invention also provides a vector characterized by containing the nucleic acid.
[0032] The present invention also provides a host cell characterized by comprising the nucleic acid or vector, preferably the host cell being a yeast cell, further comprising a combination of one or more species of Saccharomyces cerevisiae and Kluyveromyces yeasts, and in another preferred example, the Kluyveromyces yeast being a combination of one or more species of Kluyveromyces lactis, Kluyveromyces marxianus and Kluyveromyces dobzhanskii.
[0033] The present invention also provides an in vitro cell-free protein synthesis system characterized by synthesizing a fusion protein using mRNA or DNA encoding the fusion protein as a template.
[0034] The in vitro cell-free protein synthesis system provided by the present invention also includes: (1) mRNA or DNA template, (2) A yeast cell extract, further derived from a strain of one or more of the following: Saccharomyces cerevisiae, Pichia pastoris, and Kluyveromyces, preferably the yeast cell extract is derived from Kluyveromyces, and more preferably from Kluyveromyces lactis, (3) A combination of one or more of the following: amino acid mixture, dNTPs, RNA polymerase, DNA polymerase, energy supply system, polyethylene glycol, and aqueous solvent. It has characteristics that include one or more of the following.
[0035] The in vitro cell-free protein synthesis system provided by the present invention is also characterized in that the bacterial strain is genetically engineered to be resistant to toxins.
[0036] The present invention also provides an in vitro cell-free method for synthesizing a fusion protein, comprising the step of performing an in vitro synthesis reaction using mRNA or DNA encoding the fusion protein as a template in a reaction system including the cell-free in vitro protein synthesis system, wherein preferably the volume ratio range of the DNA template to other components involved in the in vitro synthesis reaction is 1:10 to 1:50, or 1:20 to 1:40, or 1:25 to 1:35, or 1:30.
[0037] The in vitro cell-free synthesis method provided by the present invention also comprises a cell-free in vitro protein synthesis system comprising a yeast cell extract, an amino acid mixture, dNTPs, RNA polymerase, DNA polymerase, an energy supply system, polyethylene glycol, and an aqueous solvent, wherein the mother cell extract is derived from a strain of one or more of the following: Saccharomyces cerevisiae, Pichia pastoris, and Kluyveromyces, preferably the yeast cell extract is derived from Kluyveromyces, more preferably Kluyveromyces lactis, and further characterized in that the strain is genetically engineered to have toxin resistance.
[0038] The in vitro cell-free synthesis method provided by the present invention is also characterized in that the volume ratio of yeast cell extract to the entire cell-free in vitro protein synthesis system is 50-80%.
[0039] The present invention also provides the use of the nucleic acid, or the vector, or the host cell, or the in vitro cell-free protein synthesis system in the production of the fusion protein.
[0040] The present invention also provides the use of the fusion protein in the treatment of diseases, or the use of the fusion protein as a pharmaceutically active ingredient for treating diseases, preferably for use in the treatment of antitumor, anti-transplant rejection, and autoimmune diseases.
[0041] The use provided by the present invention is also characterized in that the treatment of the disease is a treatment that targets one or more of HER2 and CD22.
[0042] The present invention also provides the use of the nucleic acid, or the vector, or the host cell, or the fusion protein in the manufacture of a pharmaceutical product used for the treatment of the disease. [Effects of the Invention]
[0043] The effects and mechanisms of the present invention. The fusion protein, corresponding nucleic acid, in vitro synthesis system, and manufacturing method provided by this invention have undergone extensive and thorough research. As a result of extensive screening and exploration, we have discovered for the first time a fusion protein suitable for in vitro synthesis and high expression. The fusion protein of this invention is formed by linking an effector moiety and a guide vector moiety via a specific first linker, exhibiting high yield and activity comparable to commercially available products. Therefore, this demonstrates that the fusion protein of this invention has activity that can replace existing immunotoxins.
[0044] Furthermore, since the fusion protein of the present invention can be synthesized in an in vitro protein synthesis system, it has lower production costs, shorter cycles, and is suitable for industrial production and sales promotion compared to existing cell expression methods for synthetic immunotoxins.
[0045] In particular, the fusion protein provided by the present invention successfully expresses a structure that allows the use of the Fab fragment as the guide vector portion B, compared to conventional immunotoxin structures mainly composed of the Fv fragment, and its activity has reached the same level as commercially available products. [Brief explanation of the drawing]
[0046] [Figure 1] These are the results of the cytotoxicity tests for the four fusion proteins in this example. [Figure 2] The cytotoxicity of SK-BR-3 highly expressing Her2 from several fusion proteins with different molecular number codes in Example 4 was tested, while a commercially available ADC (RC48) was used as a control. [Figure 3] The cytotoxicity of SK-BR-3 highly expressing Her2 from several fusion proteins with different molecular number codes in Example 4 was tested, while a commercially available ADC (RC48) was used as a control. [Figure 4]The cytotoxicity of SK-BR-3 highly expressing Her2 from several fusion proteins with different molecular number codes in Example 4 was tested, while a commercially available ADC (RC48) was used as a control. [Figure 5] In Example 4, the cytotoxicity of several expressed fusion proteins was tested using the NCI-N87 human gastric cancer cell line, which highly expresses Her2, and added to 96-well plates at a rate of 3000 cells / well. The results are shown in Figure 5. [Figure 6] In Example 4, the cytotoxicity of several expressed fusion proteins was tested using the NCI-N87 human gastric cancer cell line, which highly expresses Her2, and added to 96-well plates at a rate of 5000 cells / well. The results are shown in Figure 6. [Figure 7] In Example 4, the cytotoxicity of several expressed fusion proteins was tested using the NCI-N87 human gastric cancer cell line, which highly expresses Her2, and added to 96-well plates at a rate of 1000 cells / well. The results are shown in Figure 7. [Figure 8] This is a graph showing the change in tumor volume after intratumor injection in Example 5. [Figure 9] This graph shows the change in tumor weight after intratumor injection in Example 5. [Figure 10] This is a graph showing the change in tumor volume after tail vein injection in Example 5. [Figure 11] This is a graph showing the change in tumor weight after tail vein injection in Example 5. [Modes for carrying out the invention]
[0047] Specific embodiments of the present invention will be described below with reference to the drawings. Those skilled in the art can, based on the technical concept of the present invention, make ordinary alternatives or selections for the specific methods or materials used in the embodiments, and are not limited to the specific descriptions of the embodiments of the present invention.
[0048] Unless otherwise noted, all methods used in the examples are standard procedures. Unless otherwise stated, all materials and reagents used are commercially available.
[0049] The definitions of terms used herein aim to integrate the definitions of each term recognized in the biotechnology field. Examples are provided and illustrated where appropriate. Unless specifically limited in particular circumstances, either individually or as part of a larger group, these definitions apply to the terms used throughout this specification.
[0050] As used herein, "mutant" refers to a polypeptide or polynucleotide sequence that differs from a reference polypeptide or polynucleotide sequence but retains its basic properties. Typically, mutants are very similar overall to the reference polypeptide or polynucleotide sequence and are identical in many regions.
[0051] The mutant may include, for example, the amino acid sequence of the parent polypeptide sequence containing at least one conserved amino acid substitution. Alternatively, the mutant may include the amino acid sequence of the parent polypeptide sequence containing at least one non-conserved amino acid substitution. In such cases, the non-conserved amino acid substitution can enhance the biological activity of the mutant without interfering with or inhibiting the biological activity of the functional mutant, resulting in the biological activity of the mutant being increased compared to the activity of the parent polypeptide.
[0052] When used in reference to polypeptide or polynucleotide sequences, the term “percentage of sequence homology” refers to a comparison between a polynucleotide and a polypeptide, determined by comparing two optimally aligned sequences through a comparison window. Here, some of the polynucleotide or polypeptide sequences within the comparison window may contain additions or deletions (i.e., gaps) compared to a reference sequence (without additions or deletions) used to optimally align the two sequences. The percentage is calculated by determining the number of positions where the same nucleic acid base or amino acid residue exists in the two sequences, determining the number of matching positions, dividing the number of matching positions by the total number of positions in the longer sequence within the comparison window, and multiplying the result by 100. Homology is evaluated using one of the various sequence comparison algorithms and programs known in the art. Such algorithms and programs include, but are not limited to, TBLASTN, BLASTP, FASTA, TFASTA, and CLUSTALW.
[0053] In some embodiments, the homology between protein and nucleic acid sequences is evaluated using the Basic Local Alignment Search Tool ("BLAST"), which is widely known in the art (see, for example, Karlin and Altschul, 1990, Proc. Natl. Acad. Sci. USA 87:2267-2268; Altschul et al., 1990, J. Mol. Biol. 215:403-410; Altschul et al., 1993, Nature Genetics 3:266272; Altschul et al., 1997, Nuc. Acids Res. 25:3389-3402).
[0054] In this specification, cytokines are interpreted as small molecules with broad biological activity that are synthesized and secreted by stimulated immune cells (e.g., mononuclear cells, macrophages, T cells, B cells, NK cells) and certain non-immune cells (endothelial cells, epidermal cells, fibroblasts). Cytokines generally regulate immune responses by binding to corresponding receptors to control cell growth, differentiation, and effects. Cytokines (CKs) are low-molecular-weight soluble proteins produced by various cells, induced by immunogens, mitogens, or other stimulants. Cytokines have diverse functions, including regulating innate and adaptive immunity, hematopoietic cell production, cell growth, APSC pluripotency, and tissue repair. Cytokines are classified into interleukins (ILs), interferons, tumor necrosis factor family (TNFs), colony-stimulating factors (CSFs), chemokines, and growth factors (GFs).
[0055] In this specification, the term “antibody” is used in its broadest sense to refer to any immunoglobulin (Ig) molecule comprising two heavy chains and two light chains, and any antibody fragment, mutant, variant, or derivative thereof, insofar as it exhibits ideal biological activity (e.g., epitope-binding activity).
[0056] Antibodies include, but are not limited to, polyclonal antibodies, monoclonal antibodies, chimeric antibodies, fully human antibodies, domain antibodies, single-chain antibodies, Fab and F(ab')2 fragments, scFv and Fab expression libraries, etc.
[0057] A complete antibody is a structure having two full-length light chains and two full-length heavy chains, where each light chain (L) is linked to a heavy chain (H) via a disulfide bond. Complete antibodies include IgA, IgD, IgE, IgM, and IgG, with IgG including subclasses IgG1, IgG2, IgG3, and IgG4. Furthermore, in humans, the light chains may be κ chains or λ chains.
[0058] The V regions of the heavy chain and light chain are called VH and VL, respectively. Recognition binding, which binds to the target, is the primary function of the N-terminal variable ("V") regions of the heavy chain ("H") and light chain ("L").
[0059] The C regions of the heavy and light chains are called CH and CL, respectively. The length of CH is heterogeneous. The C regions of the IgG, IgA, and IgD heavy chains have three domains: CH1, CH2, and CH3, while the C regions of the IgM and IgE heavy chains have four domains: CH1, CH2, CH3, and CH4.
[0060] An "antibody fragment" includes a portion of a complete antibody, preferably including the antigen-binding region or variable region of the complete antibody. Examples of antibody fragments include Fab, Fab', F(ab')2 and Fv fragments, biantibodies (Db), tandem bispecific antibodies (taDb), linear antibodies (e.g., Example 2 of U.S. Patent 5,641,870, Zapata et al., Protein Eng. 8(10):1057-1062 (1995)), single-arm antibodies, single variable domain antibodies, miniantibodies (minibodies), single-chain antibody molecules, and multispecific antibodies formed from antibody fragments (e.g., Db-Fc, taDb-Fc, taDb-CH3 and ((scFV)4-Fc)).
[0061] As used herein, the term "monoclonal antibody" (mAb) refers to an antibody produced by a single hybridoma cell that is specific to a single antigen epitope.
[0062] Chimeric antibodies, specifically human-mouse chimeric antibodies (chimerie Abs), maintain the specificity and affinity of mouse-derived monoclonal antibodies while significantly reducing their immunogenicity in humans. Simultaneously, by converting antibodies into different subclasses, it is possible to generate antibody molecules that possess the same specificity but mediate different effects.
[0063] Reshaping antibodies (reshaping Ab) or humanized antibodies (hu-manized Ab) refer to the reconstruction of humanized antibodies with the specificity and affinity of mouse-derived monoclonal antibodies by using genetic engineering techniques to replace the AA sequence of the complementarity-determining region (CDR) in the variable region (V) of a human antibody with the CDR sequence of a mouse-derived monoclonal antibody.
[0064] In this specification, small molecule antibodies refer to, for example, antigen-binding fragments (Fab), variable region fragments (Fv), single-chain variable region fragments (ScFv), disulfide-stabilized variable fragments (ds Fv), single-chain antigen-binding fragments (ScFab), and ScIgG.
[0065] The "Fab" fragment is an antigen-binding fragment produced by papain degradation of an antibody, and consists of the entire light chain, the variable region domain (VH) of the heavy chain, and the first constant domain (CH1) of one heavy chain. Papain degradation of an antibody produces two identical Fab fragments. Treatment of the antibody with pepsin produces one large F(ab')2 fragment, which is roughly equivalent to two disulfide-linked Fab fragments with bivalent antigen-binding activity and can still crosslink antigens. The Fab' fragment differs from the Fab fragment in that it has several additional residues at the carboxyl terminus of the CH1 domain, including cysteine derived from one or more antibody hinge regions. Fab'-SH, as used herein, refers to a Fab' whose cysteine residue in its constant domain has a free thiol group. The F(ab')2 antibody fragment originally refers to a pair of Fab' fragments that have a hinge cysteine between them.
[0066] "Fv" consists of a dimer of one heavy chain and one light chain variable region domain, closely and non-covalently linked. The folding of these two domains forms six hypervariable loops (three loops each in the H and L chains). These loops provide amino acid residues used for antigen binding, conferring antigen-binding specificity to the antibody. In this specification, "single chain" is used in its broadest sense and refers to a single polypeptide chain formed by linking different fragments, for example, by linking two antibody fragments, with or without a linker between the two fragments.
[0067] In double-chain Fv (dsFv), the heavy-chain variable region and the light-chain variable region are linked via disulfide bonds, while in single-chain Fv (scFv), the heavy-chain variable region and the light-chain variable region are generally covalently linked via peptide linkers.
[0068] Regarding single-chain antigen-binding fragments (Single-chain Fab, ScFab), in 2007, Stefan Dubel published research findings on single-chain Fab (ScFab) in the journal BMC Biotechnology. Compared to ScFv, ScFab exhibits better stability and maintains affinity for the original antibody. ScFab is a single polypeptide chain composed of the entire light chain, the variable region domain (VH) of the heavy chain, and the first constant domain (CH1) of a single heavy chain.
[0069] "ScIgG" or "single-chain cleaved IgG" refers to all immunoglobulin G class molecules that have a heterodimer structure containing two heavy chains and two light chains. Here, one heavy chain is cleaved by protein hydrolysis as a single heavy chain, while the other heavy chain remains intact.
[0070] Single-domain antibodies contain only the heavy chain variable region, making their structure even smaller than that of the Fv subunit, and these are molecules that possess antigen-binding activity. Compared to complete antibodies, single-domain antibodies still have comparable binding ability and stability to the antibody.
[0071] Nanoantibodies: Individually cloned and expressed VHH structures possess structural stability and antigen-binding activity comparable to the original heavy-chain antibodies, and are the smallest units known to bind to target antigens. VHH crystals are 2.5 nm to 4 nm in length and have a molecular weight of only 15 kDa, hence they are also called nanoantibodies (Nb).
[0072] In this specification, multispecific antibodies refer to the ability to specifically bind to two or more different targets on the same or different targets.
[0073] In this specification, a polyvalent antibody refers to a structure having multiple domains capable of binding to the same target site, for example, two identical ScFvs linked in series.
[0074] In the structure of each antibody described herein, the portion derived from the light chain L of the full-length antibody is collectively referred to as the light chain portion, and the portion derived from the heavy chain H of the full-length antibody is collectively referred to as the heavy chain portion. For example, in the portion constituting Fab or ScFab, the light chain portion is derived from the light chain L of the full-length antibody, and the heavy chain portion includes a variable domain VH derived from the heavy chain H of the full-length antibody and a first constant domain (CH1) of one heavy chain H. It should be noted that "derived" in this specification does not simply mean directly selecting and using the original sequence of the portion from which it is derived, but rather emphasizes that it is derived from it. In this specification, each chain or domain portion that is constructed may be exactly the same as the corresponding chain or domain sequence of the original source, or it may be a variant of the corresponding sequence of the original source. For example, in the case of a variable domain derived from heavy chain H, the amino acid sequence of the variable domain in the portion constituting Fab or ScFab may be the variable domain of the heavy chain H of the source antibody, or it may be a variant of the variable domain of the heavy chain H of the source antibody. The same explanation applies elsewhere. In the case of ScIgG, the light chain portion is a single light chain L of the entire length, and the heavy chain portion is a single heavy chain of the entire length. Of the parts that make up Fv, dsFv, and ScFv, the light chain portion originates from the variable region VL of the full-length light chain L, and the heavy chain portion originates from the variable region domain VH of the full-length heavy chain H. In the case of full-length antibodies, all light chains L are also called light chain portions, and all heavy chains H are also called heavy chain portions.
[0075] In this specification, the "activity" of a fusion protein is, for example, its affinity EC. 50 Value and / or IC 50 It refers to a value.
[0076] In this invention, "in vitro cell-free protein synthesis system" has the same meaning as expressions such as "in vitro expression system," "in vitro protein synthesis system," "in vitro protein synthesis reaction system," and "cell-free protein synthesis system," and can be described as a protein in vitro synthesis system, in vitro protein synthesis system, cell-free system, cell-free protein synthesis system, cell-free in vitro protein synthesis system, in vitro cell-free protein synthesis system, in vitro cell-free synthesis system, CFS system (cell-free system), CFPS system (cell-free protein synthesis system), etc. It also includes in vitro translation systems, in vitro transcription and translation systems (IVTT systems), etc.
[0077] In vitro protein synthesis reactions refer to reactions that synthesize proteins in an in vitro cell-free synthesis system, and include at least a translation process. This includes, but is not limited to, IVTT reactions (in vitro transcription and translation reactions). In the present invention, IVTT reactions are preferred. An IVTT reaction, corresponding to an IVTT system, is a process of transcribing and translating DNA into protein in vitro. Therefore, these types of in vitro protein synthesis systems as used herein are also called D2P systems, D-to-P systems, D_to_P systems, and DNA-to-Protein systems. The corresponding in vitro protein synthesis methods are also called D2P methods, D-to-P methods, D_to_P methods, and DNA-Protein methods.
[0078] In the in vitro cell-free synthesis method of the present invention, the technical elements such as the in vitro protein synthesis system, template, plasmid, target protein, in vitro protein synthesis reaction (incubation reaction), various manufacturing methods, and various detection methods can each be independently selected from the following literature to determine the most suitable embodiment or implementation method. The literature includes CN111484998A, CN106978349A, CN108535489A, CN108690139A, CN108949801A, CN108642076A, CN109022478A, CN109423496A, CN109423497A, CN109423509A, CN109837293A, CN109971783A, and CN1099 This includes, but is not limited to, 88801A, CN109971775A, CN110093284A, CN110408635A, CN110408636A, CN110551745A, CN110551700A, CN110551785A, CN110819647A, CN110845622A, CN110938649A, CN110964736A, etc. Unless contrary to the purpose of the present invention, these documents and their cited documents are cited in their entirety and in their entirety.
[0079] Fusion protein The fusion protein provided in the present invention is also an immunotoxin and may also be called a fusion toxin protein (FTP), and comprises an effector portion A, a guide vector portion B, and a first linker L1. The linking order of effector portion A, guide vector portion B, and first linker L1 is not particularly limited. In one example, effector portion A, first linker L1, and guide vector portion B are linked in the A-L1-B direction from the N-terminus to the C-terminus.
[0080] Effector section A contains toxic molecules and is used to kill target cells.
[0081] Guide vector portion B binds to a target target on the target cell, specifically targeting the immunotoxin at the desired location. Specifically, it refers to an amino acid, peptide, polypeptide, or protein having a specific binding affinity to the target cell's receptor or antigen. In this specification, the guide vector portion is mainly derived from an antibody or cytokine.
[0082] The first linker L1 connects the effector portion A and the guide vector portion B. In one example, the first linker L1 contains at least 3 amino acid residues, 3 to 20 amino acid residues, or 3 to 10 amino acid residues.
[0083] In one example, the first linker L1 has an amino acid sequence represented by any one of sequence numbers 10, 11, 15, 16, 18-20, 31, and 43, or an amino acid sequence having at least 80%, 85%, 90%, 95%, and 99% sequence homology percentages with any one of sequence numbers 10, 11, 15, 16, 18-20, 31, and 43.
[0084] The toxin molecule is a toxic polypeptide that is one of the following: (a) a plant-derived toxin, (b) a bacterial-derived toxin, (c) a fungal-derived toxin, (d) a human-derived protein toxin, (e), (f) a functional fragment derived from any one of (a) to (d), or a variant of the said functional fragment. That is, the toxin molecule may be the entire toxin, or it may be only a functional fragment of the toxin that can kill target cells.
[0085] Toxic polypeptides of a particular origin may be existing toxins or their variants. For example, plant-derived toxins may be existing plant-derived toxins or variants of these existing plant-derived toxins.
[0086] Preferably, the toxin molecule is derived from diphtheria toxin, Pseudomonas aeruginosa exotoxin A (PE38), or Vibrio cholerae toxin. Here, the types of toxins from which the toxin molecule is derived are described, and in specific interpretation, this refers to diphtheria toxin, functional fragments of diphtheria toxin, variants of diphtheria toxin, variants of functional fragments of diphtheria toxin, Pseudomonas aeruginosa exotoxin A, functional fragments of Pseudomonas aeruginosa exotoxin A, variants of functional fragments of Pseudomonas aeruginosa exotoxin A, Vibrio cholerae toxin, functional fragments of Vibrio cholerae toxin, variants of Vibrio cholerae toxin, and variants of functional fragments of Vibrio cholerae toxin.
[0087] The toxin contains three domains: a binding domain (B domain), a transport domain (T domain), and a catalytic domain (A domain). The binding domain binds to receptors or antigens on the surface of target cells, the transport domain is transported to the cytoplasm through internalization and transmembrane transport, and the catalytic domain inhibits protein synthesis or induces cell death through intracellular catalysis, thereby achieving the effect of killing target cells.
[0088] The functional fragments of toxins as described herein include, for example, only the catalytic domain A of the toxin, or, for example, the toxin transport domain T and the catalytic domain A.
[0089] The structure of the toxin molecules contained in the effects pedal section is, (1) Preferably, the diphtheria toxin transport domain DT and catalytic domain DA are linked in the direction of DA-DT from the N-terminus to the C-terminus. (2) The catalytic domain DA of diphtheria toxin, (3) Preferably, the transport domain PT and catalytic domain PA of Pseudomonas aeruginosa exotoxin A are linked in the direction of PT-PA from the N-terminus to the C-terminus. (4) The catalytic domain PA of Pseudomonas aeruginosa exotoxin A, (5) Preferably, the transport domain CT and catalytic domain CA of the Vibrio cholerae toxin are linked in the direction of CT-CA from the N-terminus to the C-terminus. (6) The catalytic domain CA of Vibrio cholerae toxin, It is one of the following.
[0090] In one example, the toxin molecule has an amino acid sequence represented by any one of sequence numbers 1-9, or an amino acid sequence having at least 80%, 85%, 90%, 95%, or 99% sequence homology percentages with any one of sequence numbers 1-9.
[0091] In one example, the guide vector portion is an antibody, which is one or more of the following: a monoclonal antibody, a chimeric antibody, a modified antibody, a small molecule antibody, a multispecific antibody, and a polyvalent antibody.
[0092] In one example, the antibody may be one or more types of small molecule antibodies or polyvalent antibodies.
[0093] Preferably, the small molecule antibody is one or more of the following: Fv, Fab, ScFv, ScFab, ScIgG, dsFv, and single-domain antibodies. In one example, the light chain and heavy chain portions of ScFab, ScFv, and ScIgG are linked via a second linker L2, for example, The structural formula of ScFab is, for example, L-L2-VH-CH1 or VH-CH1-L2-L. The structural formula of ScFv is, for example, VH-L2-VL. The structural formula of ScIgG is, for example, L-L2-H.
[0094] The second linker contains at least 25 amino acid residues, preferably 28-180, 30-120, 30-90, 30-85, or 30-82 amino acid residues.
[0095] In one example, the second linker L2 contains one or more major amino acids among G, S, and T, and the percentage of the number of major amino acids to the total number of amino acids in the second linker is at least 40%, more preferably 45%, and more preferably 60%.
[0096] Furthermore, the second linker L2 has the amino acid sequence shown in any one of SEQ ID NOs: 10, 12, 13, 14, 17, 28, 45, and 47, or has at least 80%, 85%, 90%, 95%, and 99% sequence homology percentages with any one of SEQ ID NOs: 10, 12, 13, 14, 17, 28, 45, and 47.
[0097] In one example, the structure of ScFab satisfies the condition that the light chain portion and heavy chain portion of ScFab are linked in the direction from the N-terminus to the C-terminus, or that the heavy chain portion and light chain portion of ScFab are linked in the direction from the N-terminus to the C-terminus.
[0098] In one example, the heavy and light chain portions of ScFv are linked from the N-terminus to the C-terminus.
[0099] Preferably, the polyvalent antibody is a tandem antibody formed by linking at least two single-chain antibodies in series, for example, two ScFv units linked in series or two ScFab units linked in series. There may or may not be a linker between the two series-linked unit structures.
[0100] Preferably, the polyvalent antibody is an antibody-multimer fusion protein formed from small molecule antibodies and a polymer protein, in which multiple small molecule antibodies are polymerized into a multimer via the polymer protein. Preferably, the antibody-multimer fusion protein is a dimer or a tetramer.
[0101] Furthermore, examples of antibody-multimer fusion proteins include the fusion of ScFab with antibody fragment CH3, the fusion of ScFv with antibody fragment CH3, the fusion of ScFab with Tamavidins2 protein, and the fusion of ScFv with Tamavidins2 protein.
[0102] Here, Tamavidins is an antifungal protein. According to U.S. Patent US12 / 716182, it is a novel streptavidin-like protein purified from Pleurotus comucopiae (Tamogitake). The gene derived from the purified protein is called tam1, and the protein having the amino acid sequence encoded by it is called tamavidin1. A homolog of tam1 is called tam2, and the protein having the amino acid sequence encoded by it is called tamavidin2. Tamavidin1 and 2 have 46.7% and 48.1% homology of their amino acid sequences to streptavidin, respectively, and 31.2% and 36.2% homology of their amino acid sequences to avidin, respectively.
[0103] Preferably, the fusion of ScFab and Tamavidins2 protein is linked from the N-terminus to the C-terminus, and from the Tamavidins2 protein towards ScFab. The fusion of ScFv and the Tamavidins2 protein involves ligation from the Tamavidins2 protein towards ScFv, starting from the N-terminus and moving towards the C-terminus.
[0104] The linkage between ScFab and the antibody fragment CH3 is either from the N-terminus to the C-terminus or from the C-terminus to the N-terminus.
[0105] In one example, the light chain portion constituting Fab or ScFab has the amino acid sequence shown in SEQ ID NO: 32, or has an amino acid sequence having at least 80%, 85%, 90%, 95%, or 99% sequence homology percentages with SEQ ID NO: 32.
[0106] In one example, the variable domain constituting the heavy chain portion of Fab or ScFab has the amino acid sequence shown in SEQ ID NO: 33 or 55, or has an amino acid sequence having at least 80%, 85%, 90%, 95%, or 99% sequence homology percentages with SEQ ID NO: 33 or 55.
[0107] In one example, the first constant domain CH1 constituting the heavy chain portion of Fab or ScFab has the amino acid sequence shown in SEQ ID NO: 34 or 57, or has an amino acid sequence having at least 80%, 85%, 90%, 95%, or 99% sequence homology percentages with SEQ ID NO: 34 or 57.
[0108] In one example, the variable domain constituting the light chain portion of Fv, dsFv, or ScFv has the amino acid sequence shown in SEQ ID NO: 35 or 54, or has an amino acid sequence having at least 80%, 85%, 90%, 95%, or 99% sequence homology percentages with SEQ ID NO: 35 or 54.
[0109] In one example, the variable domain constituting the heavy chain portion of Fv, dsFv, or ScFv has the amino acid sequence shown in SEQ ID NO: 33 or 55, or has an amino acid sequence having at least 80%, 85%, 90%, 95%, or 99% sequence homology percentages with SEQ ID NO: 33 or 55.
[0110] In one example, the light chain portion constituting ScIgG has the amino acid sequence shown in SEQ ID NO: 32 or 56, or has an amino acid sequence having at least 80%, 85%, 90%, 95%, or 99% sequence homology percentages with SEQ ID NO: 32 or 56.
[0111] In one example, the heavy chain portion constituting ScIgG has the amino acid sequence shown in SEQ ID NO: 36 or 17, or has an amino acid sequence having at least 80%, 85%, 90%, 95%, or 99% sequence homology percentages with SEQ ID NO: 36 or 17.
[0112] In one example, in the fusion protein provided by the present invention, the relevant nanoantibody fragment CH3 has the amino acid sequence shown in SEQ ID NO: 37, or has an amino acid sequence having at least 80%, 85%, 90%, 95%, and 99% sequence homology percentages with SEQ ID NO: 37. In one example, in the fusion protein provided by the present invention, the relevant Tamavidins2 protein has the amino acid sequence shown in SEQ ID NO: 38, or has an amino acid sequence having at least 80%, 85%, 90%, 95%, or 99% sequence homology percentages with SEQ ID NO: 38.
[0113] In one example, the relevant nanoantibody has either the amino acid sequence shown in SEQ ID NO: 52 or 53, or an amino acid sequence having at least 80%, 85%, 90%, 95%, or 99% sequence homology percentages with SEQ ID NO: 52 or 53.
[0114] Two single-chain antibodies, and small molecule antibodies and polymer proteins, are linked via the third linker L3. For example, A series connection structure of two ScFabs is, for example, ScFab(L-L2-VH-CH1)-L3-ScFab(L-L2-VH-CH1), The structural formula for two ScFv units connected in series is, for example, ScFv(VH-L2-VL)-L3-ScFv(VH-L2-VL), The serial linkage structure between ScFab and antibody fragment CH3 is, for example, It is CH3-L3-ScFab(L-L2-VH-CH1), The series linkage structure between ScFv and antibody fragment CH3 is, for example, CH3-L3-ScFv(VH-L2-VL) The structure of the fusion of the Tamavidins2 protein and ScFab is, for example, Tamavidins2-L3-ScFab (L-L2-VH-CH1).
[0115] The third linker L3 either contains no amino acid residues or contains at least three amino acid residues, preferably 5 to 20 amino acid residues.
[0116] In one example, the third linker L3 contains two major amino acid residues, G and S, and the percentage of the number of major amino acid residues relative to the total number of amino acids in the third linker is 40% or more, preferably 50% or more, 60%, 65% or more, 70%, or 75% or more.
[0117] In one example, the third linker L3 is either the hinge region of IgG1 or a fragment whose amino acid sequence is at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 99% identical to the hinge region.
[0118] For example, the third linker L3 has an amino acid sequence represented by any one of sequence numbers 10, 14, 18, 20-30, 44, and 48-51, or has an amino acid sequence with a sequence homology percentage of at least 80%, 85%, 90%, 95%, or 99% with any one of sequence numbers 10, 14, 18, 20-30, 44, and 48-51.
[0119] In one example, the antibody is one that specifically binds to either Her2 or CD22.
[0120] The human epidermal growth factor receptor (HER) family includes four structurally related members: HER1 (ErbB1, also known as EGFR), HER2 (ErbB2, also known as HER2 / neu), HER3 (ErbB3), and HER4 (ErbB4). HER2 is a 185 kDa protein with an extracellular ligand-binding domain (ECD, or extracellular domain) and an intracellular tyrosine kinase domain. The N-terminal ECD can be divided into four subdomains (I-IV). HER2 is overexpressed in approximately one-quarter of breast cancer patients, making it a promising target for breast cancer treatment (Bange et al., 2001, Nature Medicine 7:548). In vitro studies have shown that inhibiting HER2 can induce significant cell death in breast cancer cells (Faltus T et al., Neoplasia. 2004; 6(6):786~95; Yang G et al., J Biol Chem. 2004; 279(6):4339~45). Recently, HER2 has become an important biomarker and therapeutic target for approximately 30% of breast cancer patients.
[0121] CD22 is a lineage-restrictive B-cell antigen expressed in 60-70% of B-cell lymphomas and leukemias. CD22 is not present on the cell surface in the early stages of B-cell development and is not expressed in stem cells (Tedder, TF et al., Annu. Rev. Immunol., 5:481-504 (1997)).
[0122] Furthermore, the antibody source is selected from IgM, IgG, IgA, IgD, and IgE. Preferably, the origin of the antibody is selected from Trastuzumab, Rituximab, Bevacizumab, Adalimumab, Pembrolizumab, Ustekinumab, Nivolumab, Ocrelizumab, Palizumab, Infliximab, Omalizumab, Envafolimab, Atlizumab, Atezolizumab or Cetuximab, or variants thereof.
[0123] In one example, the EC of the fusion protein provided by the present invention 50 value is 1 nM or less, or 0.8 nM or less, or 0.7 nM or less, or 0.6 nM or less, or 0.5 nM or less, or 0.4 nM or less, or 0.2 nM or less.
[0124] In one example, the IC of the fusion protein 50 value is the IC of commercially available DS-8201a 50 value or the IC of T-DM1 50 value. (The IC of DS-8201a 50 value is described in Yusuke Ogitani et al., DS-8201a, a novel HER2-targeting ADC with a novel DNA topoisomerase I inhibitor, demonstrates a promising anti-tumor efficacy with differentiation from T-DM1, March 29, 2016; DOI: 10.1158 / 1078-0432.CCR-15-2822; the IC50 of T-DM1 50For values, see Junttila TT, Li G, Parsons K, Phillips GL, Sliwkowski MX,Trastuzumab-DM1 (T-DM1) retains all the mechanisms of action of trastuzumab and efficiently inhibits growth of lapatinib insensitive breast cancer. Breast cancer research and treatment. 2011;128:347-56).
[0125] The fusion protein provided by the present invention is suitable for cell-free in vitro synthesis. Preferably, cell-free in vitro synthesis is a step of obtaining the fusion protein by using the nucleic acid encoding the fusion protein as a DNA template in a cell-free in vitro synthesis system and culturing it for a predetermined time under predetermined conditions.
[0126] In one example, the cell-free in vitro synthesis system includes a cell extract, which is derived from a yeast strain. Furthermore, the yeast cells are a combination of one or more species from Saccharomyces cerevisiae and Kluyveromyces yeasts. In another preferred example, the Kluyveromyces yeasts are a combination of one or more species from Kluyveromyces lactis, Kluyveromyces marxianus, and Kluyveromyces dobzhanskii.
[0127] In one example, a yeast strain can be genetically engineered to be resistant to toxins, and cell extracts obtained from this toxin-resistant strain can overcome the toxicity problems of immunotoxins if they are involved in in vitro protein synthesis.
[0128] In this specification, "toxin-resistant" means having a predetermined tolerance to the toxicity of immunotoxins.
[0129] Preferably, the strain from which the cell extract is derived in this specification has reduced expression or activity of the DPH gene in its cells and / or a mutation in the amino acid sequence of eEF2. Preferably, the expression level of the DPH gene is ≤10%, preferably ≤5%, more preferably ≤2%, and / or the reduction in DPH gene expression or activity satisfies the condition that the A1 / A0 ratio is ≤30%, preferably ≤10%, more preferably ≤5%, even more preferably ≤2%, and most preferably 0-2%. Here, A1 is the expression or activity of the DPH gene in the genetically modified cells, and A0 is the expression or activity of the wild-type DPH gene.
[0130] More preferably, the reduction in the expression or activity of the DPH gene in the cells can be achieved through methods selected from gene editing, gene mutation, gene knockout, gene disruption, RNA interference technology, or a combination thereof.
[0131] More preferably, the DPH gene is selected from one or more of the DPH1 to DPH7 genes, specifically the DPH1, DPH2, DPH3, DPH4, DPH5, DPH6, and DPH7 genes.
[0132] More preferably, mutations occur at positions 699 and / or 701 in the eEF2 amino acid sequence.
[0133] More preferably, the histidine (H) at position 699 in the eEF2 amino acid sequence is mutated to methionine (M).
[0134] More preferably, the glycine (G) at position 701 in the eEF2 amino acid sequence is mutated to arginine (R).
[0135] More preferably, the cells include at least a knockout of the DPH gene.
[0136] More preferably, the DPH gene in the cells is knocked out, and a mutation occurs in the amino acid sequence of eEF2.
[0137] More preferably, the amino acid sequence of the protein encoded by the DPH gene is either sequence numbers 59-65, or a polypeptide having ≥85%, ≥90%, ≥95%, ≥97%, ≥98%, or ≥99% homology to the amino acid sequences shown in sequence numbers 59-65, and having the same activity as the sequences of sequence numbers 59-65.
[0138] More preferably, the amino acid sequence of eEF2 is either SEQ ID NO: 66, or a polypeptide having ≥85%, ≥90%, ≥95%, ≥97%, ≥98%, or ≥99% homology to the amino acid sequence shown in SEQ ID NO: 66, and having the same activity as the sequence of SEQ ID NO: 66.
[0139] nucleic acid The present invention also provides isolated nucleic acids. "Nucleic acid molecules" include DNA (e.g., genomic DNA or complementary DNA) and mRNA molecules, which may be single-stranded or double-stranded.
[0140] "Isolated" means that nucleic acid molecules are not located within a cell or are not otherwise supplied into the cell.
[0141] vector The present invention also provides a vector comprising the nucleic acid.
[0142] In one example, the vector is an expression vector.
[0143] host cell The present invention also provides a host cell containing the nucleic acid or the vector.
[0144] Preferably, the host cell is a yeast cell. Furthermore, the yeast cells are a combination of one or more species from Saccharomyces cerevisiae and Kluyveromyces yeasts. In another preferred example, the Kluyveromyces yeasts are a combination of one or more species from Kluyveromyces lactis, Kluyveromyces marxianus, and Kluyveromyces dobzhanskii.
[0145] In one example, a strain derived from yeast cells possesses toxin resistance through the aforementioned genetic manipulation.
[0146] In vitro cell-free protein synthesis system The present invention also provides an in vitro cell-free protein synthesis system for synthesizing a fusion protein using mRNA or DNA encoding a fusion protein as described in any one of claims 1 to 17 as a template.
[0147] In one example, the in vitro cell-free protein synthesis system provided by the present invention is (1) The mRNA or DNA encoding the protected fusion protein is used as a template. (2) A yeast cell extract, further derived from a strain of one or more of the following: Saccharomyces cerevisiae, Pichia pastoris, and Kluyveromyces, preferably the yeast cell extract contains Kluyveromyces, preferably Kluyveromyces lactis, and more preferably a cell extract derived from Kluyveromyces. (3) A combination of one or more of the following: amino acid mixture, dNTPs, RNA polymerase, DNA polymerase, energy supply system, polyethylene glycol, and aqueous solvent. It includes one or more of the following.
[0148] In one example, in an in vitro cell-free protein synthesis system, the bacterial strain from which the cell extract is derived possesses the toxin resistance through the aforementioned genetic manipulation.
[0149] In vitro cell-free synthesis method The present invention also provides an in vitro cell-free synthesis method for the fusion protein, In the reaction system including the cell-free in vitro protein synthesis system, the fusion protein is obtained by performing an in vitro synthesis reaction using mRNA or DNA encoding the fusion protein as a template, preferably in the range of volume ratio of the DNA template to other components involved in the in vitro synthesis reaction being 1:10 to 1:50, more preferably 1:20 to 1:40, most preferably 1:25 to 1:35, and particularly preferably 1:30.
[0150] In one example, in the in vitro cell-free synthesis method provided in the present invention, the in vitro cell-free protein synthesis system comprises a yeast cell extract, an amino acid mixture, dNTPs, RNA polymerase, DNA polymerase, an energy supply system, polyethylene glycol, and an aqueous solvent. moreover, The yeast cell extract is derived from one or more of the following: Saccharomyces cerevisiae, Pichia pastoris, and Kluyveromyces. Preferably, the yeast cell extract is derived from Kluyveromyces, and more preferably from Kluyveromyces lactis. More preferably, the strain is genetically engineered to have toxin resistance.
[0151] In one example, in the in vitro cell-free synthesis method provided by the present invention, the percentage of yeast cell extract in the overall cell-free in vitro protein synthesis system is 50-80%, or 50-55%, 50-60%, or 50-65%.
[0152] Use in the production of fusion proteins The present invention also provides the use of the nucleic acid in the production of the fusion protein, The present invention also provides the use of the vector in the production of the fusion protein, The present invention also provides the use of the host cell in the production of the fusion protein, The present invention also provides the use of the in vitro cell-free protein synthesis system in the production of the fusion protein.
[0153] Use in the treatment of diseases The present invention also provides the use of the fusion protein in the treatment of diseases, preferably for the treatment of tumors, anti-transplant rejection, and autoimmune diseases.
[0154] In one example, the treatment for the disease involves HER2-targeted therapy.
[0155] The fusion protein provided by the present invention has an affinity EC for target targets such as HER2. 50 The value can reach 0.16 nM, and the toxic IC for target cells. 50 The value can reach the same level as existing products and can be used to treat the above-mentioned diseases.
[0156] Preferably, it is used when the resistant cancer is lung cancer, urothelial carcinoma, colorectal cancer, prostate cancer, ovarian cancer, pancreatic cancer, breast cancer, bladder cancer, stomach cancer, gastrointestinal matrix tumor, cervical cancer, esophageal cancer, squamous cell carcinoma, peritoneal cancer, liver cancer, hepatocellular carcinoma, colon cancer, rectal cancer, colorectal cancer, endometrial cancer, uterine cancer, salivary gland cancer, kidney cancer, vulvar cancer, thyroid cancer, penile cancer, leukemia, malignant lymphoma, plasma cell carcinoma, myeloma, or sarcoma; more preferably, it is used when the resistant cancer is breast cancer, stomach cancer, colorectal cancer, or non-small cell lung cancer; and even more preferably, it is used when the resistant cancer is breast cancer or stomach cancer.
[0157] Use in the manufacture of pharmaceuticals The present invention also provides the use of nucleic acids in the manufacture of a pharmaceutical product for treating the disease.
[0158] The present invention also provides the use of the vector in the manufacture of a pharmaceutical product for treating the disease.
[0159] The present invention also provides the use of the host cells in the manufacture of a pharmaceutical product for treating the disease.
[0160] The present invention also provides the use of the fusion protein in the manufacture of a pharmaceutical product for treating the disease. [Examples]
[0161] The present invention will be further described below through specific examples.
[0162] Example 1: Molecular design of the fusion protein of the present invention We will specifically explain this by using diphtheria toxin and PE38 active fragment, each possessing their respective activities, as effector portion A, and antibodies derived from targeting Her2 and CD22, respectively, as guide vector portion B.
[0163] The effector section A and the guide vector section B are connected using the first linker L1, and the length and arrangement of the first linker L1 have been optimized.
[0164] Using a diphtheria toxin fragment containing catalytic domain A and transport domain T, we deleted the binding domain that could recognize its natural target site, specifically the fragment containing the amino acid positions 1-389.
[0165] The PE toxin protein contains three domains. Domain I at the amino terminus is responsible for binding to the natural target, intermediate domain II is responsible for transmembrane targeting (transport domain PT), and carboxyl-terminus domain III is the catalytic domain (catalytic domain PA). In this specification, we selected the transport domain PTI and catalytic domain PAI fragments and deleted domain I, specifically the fragment containing amino acids at positions 251-613.
[0166] Trastuzumab is a humanized IgG1 monoclonal antibody targeting Her2, and its Fv fragment, Fab fragment, or full-length antibody was selected as guide vector portion B. The trastuzumab fragment or full-length antibody was designed into single-chain molecules containing single-chain Fv (ScFv), single-chain Fab (ScFab), and single-chain IgG (ScIgG). Here, ScFv links VL and VH (VL-VH) or VH and VL (VH-VL), ScFab links the L chain and VH-CH1 fragment, and ScIgG links the L chain and H chain. These linkages are performed using a second linker L2, and the linkage length and amino acid sequence have been optimized.
[0167] The CD22 antibody used is the antibody portion of inotuzumab ozogamicin, an ADC drug approved by the FDA for marketing purposes. It is a humanized IgG4 monoclonal antibody that targets CD22. The specific design of the single-chain molecule followed the design of the previously mentioned humanized IgG1 monoclonal antibody targeting Her2.
[0168] To improve the affinity between guide vector portion B and the target, the immunotoxin ScFv or ScFab was linked in series to form ScFv-ScFv or ScFab-ScFab molecular structures, and the linked ScFv and ScFab were connected using a third linker L3. Simultaneously, ScFv and ScFab were fused using the dimer and tetramer-mediating CH3 and Tam2 proteins to form ScFv-CH3, CH3-ScFv, ScFab-CH3, CH3-ScFab, ScFv-Tam2, Tam2-ScFv, ScFab-Tam2, and Tam2-ScFab molecular structures, all of which were linked via the third linker L3. The length and amino acid sequence of the third linker L3 were optimized.
[0169] The specific molecular design information for the fusion protein is shown in Table 1. For specific sequences related to each part of the molecule, please refer to Table 6.
[0170] [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4]
[0171] In Table 1, when tandem antibodies have the same structure, the structural description of one of them has been omitted. For example, in "DT-L1-ScFab(L-L2-VH-CH1)-L3-ScFab," the structural description of one of the two ScFabs is omitted because their structures are identical. The same applies below.
[0172] Production of the fusion protein in Example 2 The following examples use the fusion protein DTH2-13 as an example, but the experimental methods are the same for fusion proteins with other structures.
[0173] 2.1 Construction of Fusion Protein Expression Plasmid First, an expression plasmid of 8His-DTH2-eGFP-8His was constructed, and based on this, an antibody or antibody fragment was inserted into the carboxyl terminus of the DT fragment (effector portion A) via homologous recombination.
[0174] Specific methods: First, the ScFab DNA sequence was amplified from a plasmid containing the trastuzumab ScIgG DNA sequence using primer 1 and primer 2. Primer 1: CTGGTGGTGGTGGTTCTGACATCCAAATGACCCAATCTCCATCTTC, Primer 2: GTGGTGGTGAGAACCACCCTTGTCACAAGACTTTGGTTCAACCTTC.
[0175] Next, PCR amplification was performed on the SUMO-DT-8His-eGFP-8His expression plasmid using primers 3 and 4. Primer 3: GAACCAAAGTCTTGTGACAAGGGTGGTTCTCACCACCACCAC, Primer 4: GGAGATTGGGTCATTTGGATGTCAGAACCACCACCACCAGAACC.
[0176] The two amplified DNA fragments were mixed in a 1:1 volume ratio to a total volume of 10 μL. 1 μL of DpnI endonuclease was added, and the mixture was incubated at 37°C for 4-5 hours. Subsequently, the mixture was transformed into E. coli DH5α (competent cells), plated onto solid LB medium containing ampicillin, and cultured overnight at 37°C.
[0177] On the second day, a single clone was taken from the solid medium, inoculated into 200 μL of LB medium, and incubated in a shaker at 37°C for approximately 6 hours. Subsequently, bacterial suspension was passed through to perform sequence sequencing.
[0178] A precisely sequenced bacterial suspension was inoculated into 5 mL of LB medium and incubated overnight in a 37°C shaker. The following day, plasmids were extracted using a plasmid extraction kit, and the construction of the expression plasmid was completed.
[0179] 2.2 In vitro protein synthesis and fusion protein expression The method will be explained using a 30 mL reaction system as an example.
[0180] First, an AMPi amplification system for the expression plasmid was prepared (the AMPi amplification system is a product sold by KANGMA-HEALTHCODE (SHANGHAI) BIOTECH CO., LTD., product number PROTN_AMPiN10V03500). 100 μL of AMPi reaction solution was taken and added to 900 μL of ultrapure water, approximately 0.5 μL of AMPIase enzyme was added, and the DTH2 molecule expression plasmid was added as a template to achieve a final concentration of 2 ng / μL. The mixture was incubated overnight at 37°C.
[0181] The AMPi amplification results were analyzed using a DNA gel. After the expression plasmid was amplified, 1 mL of the AMPi amplification system was added to 30 mL of D2P in vitro protein synthesis system (IVTT) in a volume ratio of 1:30. The mixture was incubated in a shaker at 30°C for 3-4 hours.
[0182] The composition of the in vitro cell-free protein synthesis system (IVTT) used was: 4-(2-hydroxyethyl)piperazine-1-ethanesulfonic acid at a final concentration of 22 mM and pH 7.4, 30-150 mM potassium acetate, 1.0-5.0 mM magnesium acetate, 1.5-4 mM nucleoside triphosphate mixture (adenosine triphosphate, guanosine triphosphate, cytidine triphosphate, and uridine triphosphate), and 0.08-0.24 mM amino acid mixture (glycine, alanine, valine, leucine, isoleucine, phenylalanine). (Lysine, proline, tryptophan, serine, tyrosine, cysteine, methionine, asparagine, glutamine, threonine, aspartic acid, glutamic acid, lysine, arginine, and histidine), 25 mM creatine phosphate, 1.7 mM dithiothreitol, 0.27 mg / mL creatine phosphate kinase, 0.027–0.054 mg / mL T7 RNA polymerase, 1%–4% polyethylene glycol, 0.5%–2% sucrose, and finally 50–80% by volume of yeast cell extract were added.
[0183] The yeast cell extract used was derived from Kluiveromyces lactis cell extract, and the yeast cells were a dph2 knockout strain (dph2△ transformed strain).
[0184] 2.3 Purification of Fusion Proteins A quantity of Ni magnetic beads equivalent to 0.2% of the IVTT volume was taken and washed 2-3 times with ultrapure water for later use.
[0185] After incubation in vitro for 3 hours, magnetic beads were added to the reaction system and incubated for a further 1 hour. After removing the magnetic beads from the reaction system using a magnet, the cells were washed twice, once, and once again with 1 mL of washing buffer containing 5 mM imidazole, 20 mM imidazole, and 60 mM imidazole, respectively. Finally, the cells were eluted with 2–5 mL of elution buffer containing 250 mM imidazole.
[0186] The wash buffer and elution buffer eluates were used for SDS-PAGE purity analysis, and the immunotoxin expression levels were calculated based on the fluorescence readings of fusion-expressed eGFP.
[0187] The expression results showed that, with the exception of abnormal results, each fusion protein synthesized from in vitro cell-free proteins in this invention achieved a minimum expression level of over 10 mg / L after 3 hours of purification, thanks to the rational design of the linker. Expression levels of some fusion proteins were close to 2000 mg / L and 5000 mg / L after 3 hours. Compared to existing cell expression systems, the production cycle is shorter and the cost is lower. It should be noted that expression levels expressed in existing CHO cell systems are limited to 2-5 mg / L. Furthermore, for example, existing secretory expression systems using Pichia pastris require more than 42 hours of induction to reach an expression level of approximately 30 mg / L and require various culture conditions.
[0188] Some of the molecules listed in Table 1 were expressed and purified. The yield results are shown in Table 2.
[0189] [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5]
[0190] Example 3: In vitro affinity test of fusion protein The IVTT system of DTH2 molecules was cultured in a 24-well plate, with each molecule cultured in 150 μL and incubated at 37°C for 3 hours.
[0191] Recombinant human Her2 at a concentration of 1 mg / ml was diluted to 0.25 μg / mL with a coating solution, added to an ELISA plate at a concentration of 100 μL / well, and incubated overnight at 4°C.
[0192] After washing the plate three times with 300 μL of PBST each time, 200 μL of blocking solution was added, and the plate was blocked at 37°C for 1 hour, after which it was washed three times with 300 μL of PBST each time. The sample was diluted to 20 μg / mL using diluent (PBST containing 1% BSA), and then diluted threefold to a total of 11 samples, which were added to ELISA plates at a rate of 100 μL / well. Diluents were added to create a blank control group, and the samples were incubated at 37°C for 1 hour.
[0193] After washing the plates three times with 300 μL of PBST each time, 100 μL / wet of HRP-labeled rabbit anti-human IgG (Fabspecific) (diluted at 1:5000) was added, and the plates were incubated at 37°C for 1 hour.
[0194] The plates were washed three times, 100 μL / well of TMB chromogenic solution was added, and the plates were allowed to develop color at 37°C for 10 minutes. 50 μL / well of stop solution (2M sulfuric acid) was added, and the absorbance at 450 nm was measured using a microplate reader.
[0195] Select 4-Parameter from the Prism software, plot a curve with sample concentration on the x-axis and A450 on the y-axis, then calculate affinity EC. 50 The value was calculated.
[0196] A portion of the primary purified protein is selected and EC is performed using the same method. 50 The analysis was performed. The results are shown in Table 3.
[0197] [Table 3]
[0198] Example 4: Cytotoxicity test of the fusion protein (1) The cytotoxicity of the expressed fusion protein was tested using the SK-BR-3 breast cancer cell line, which highly expresses Her2. This cell line is an adherent cell line. After re-turbidity, the cell count was recorded, and then the cells were added to a 96-well plate at a rate of 3000 cells / well. The volume of cell medium in each well was 100 μL, and the cells were cultured overnight in a 37°C incubator.
[0199] The purified fusion protein was diluted to 30 nM after measuring the target protein concentration using eGFP fluorescence scanning. A 3-fold gradient dilution was then performed to produce 10 protein samples. 50 μL of each protein sample was added to 100 μL of cell medium, resulting in final protein concentrations ranging from 10 nM to approximately 0.5 pM. 50 μL of PBS was added to one well to create a negative control group. The cell medium was incubated at 37°C for 72 hours.
[0200] The number of viable cells remaining in each well was measured using an MTT kit. The viability was obtained by dividing the cell count in each sample well by the cell count in the negative control well containing PBS. The viability data corresponding to 10 sample concentrations for each sample were fitted using Prism to determine the IC50 of the protein samples. 50 The value was obtained.
[0201] 1) Cytotoxicity Test: The results were analyzed using the cytotoxicity results of DTH2-4 as an example. Simultaneously, ScFab cells without toxic activity fragments (DT molecules, toxin molecules) were used to test whether the cytotoxicity to SK-BR-3 was due to the fusion of DT molecules. Subsequently, DTH2-4 was applied to Her2-low-expressing HEK-293 cells to test the safety and selectivity of the protein.
[0202] Figure 1 shows the results of a cytotoxicity test of one of the fusion proteins in the example.
[0203] As shown on the left side of Figure 1, the current cytotoxic IC of DTH2-4 50The value reached 62.29 pM. Within the same concentration range, ScFab did not have a cell-killing effect on SK-BR-3 cells, demonstrating that the cytotoxicity of DTH2-4 is due to the presence of the toxic molecule. As shown on the right side of Figure 1, within the same protein concentration range, DTH2-4 did not have a significant cell-killing effect on HEK-293 cells, indicating that its safety has been verified and it can be used.
[0204] 2) Subsequently, the cytotoxicity of various fusion proteins with several different molecular numbers was tested against the SK-BR-3 breast cancer cell line, which highly expresses Her2. Simultaneously, a commercially available common ADC (RC48) was used as a control. The results are shown in Table 4, Figures 2, 3, and 4.
[0205] [Table 4]
[0206] (2) Using the same method, the cytotoxicity of several fusion proteins was tested using the NCI-N87 human gastric cancer cell line, which highly expresses Her2. Using the method described above, cells were added to 96-well plates in quantities of 1000, 3000, and 5000 per well, respectively. The results are shown in Table 5, Figure 5, Figure 6, and Figure 7, respectively.
[0207] [Table 5]
[0208] As described above, the EC of some compounds in Table 4 or Table 5 50 Although the value is greater than 1 nM, cytotoxicity experiments show that it achieves superior activity compared to commercially available products, indicating that it can be used as a substitute for existing commercially available compounds. Specifically, the corresponding target structure and IC as needed. 50 By selecting the appropriate molecule, we obtained one with the required toxicity size.
[0209] Example 5: Animal Experiments Inhibition of tumor growth in a mouse tumor model of DTH2-1 (nude mouse ectopic tumor (BT474)): Frozen BT474 cells were revived, seeded in culture dishes, and cultured at 37°C in a 5% CO2 incubator. After culturing for the prescribed time, the cells were subcultured, and after subculture, the cells were transferred to new cell culture dishes and cultured. The cells were subcultured in vitro at least 2-3 times to ensure that the cells were in an optimal growth state at the time of inoculation. When the cell count and growth state met the test requirements, the cells were collected and resuspended in PBS. A sufficient amount of cell suspension for inoculation was prepared according to the number of test animals.
[0210] Using a 1 mL disposable syringe, a homogeneously mixed cell suspension was taken and slowly injected into the subcutaneous tissue of the right foreleg of nude mice. The inoculation dose was 5 × 10⁻⁶. 6 The count was cells / mice. After tumor cell inoculation, the longest diameter (A) and shortest diameter (B) of the tumor were measured daily using vernier calipers, and the tumor volume was calculated.
[0211] At the time of administration, intratumoral injection or tail vein injection was selected. The mice were divided into 2-3 injection sites, and each nude mouse was injected with medical saline, a 5 mg / kg protein standard of PC(RC48), or a 5 mg / kg protein test of (DTH2-1). Three nude mice were injected in each group.
[0212] After administration, the longest (A) and shortest (B) diameters of the tumor were measured daily using vernier calipers, and the tumor volume was calculated (see Figures 8 and 10).
[0213] The drug was administered once or twice a week. The study concluded two weeks after the first administration, at which point the tumors were removed and weighed (see Figures 9 and 11). Negative control: Injection of medical saline solution. Positive control: RC48.
[0214] The results of intratumor injection are shown in Figures 8 and 9. The results of tail vein injection are shown in Figures 10 and 11.
[0215] All sequences relevant to this specification are summarized in Table 6.
[0216] [Table 6-1] [Table 6-2] [Table 6-3] [Table 6-4] [Table 6-5]
Claims
1. It is a fusion protein, Effector part A, which contains a toxic molecule and is used to kill target cells. A guide vector portion B, which binds to a target on the target cell and is derived from an antibody or cytokine, It includes a first linker L1 that connects the effector portion A and the guide vector portion B, Here, the first linker L1 contains at least three amino acid residues, preferably 3 to 20 amino acid residues, and more preferably 3 to 10 amino acid residues. A fusion protein characterized in that the effector portion A, the first linker L1, and the guide vector portion B are linked in the direction A-L1-B from the N-terminus to the C-terminus, or in the direction B-L1-A from the N-terminus to the C-terminus.
2. The toxin molecule is a toxic polypeptide which is any one of the following: (a) plant-derived toxin, (b) bacterial-derived toxin, (c) fungal-derived toxin, (d) human-derived protein toxin, (e) any one functional fragment of (a) to (d), (f) a functional fragment derived from any one of (a) to (d), or a variant of the functional fragment. Preferably, the fusion protein according to claim 1 is characterized in that the toxin molecule is derived from diphtheria toxin, Pseudomonas aeruginosa exotoxin A, or Vibrio cholerae toxin.
3. The structure of the toxin molecule contained in the effector portion is, (1) Preferably, the diphtheria toxin transport domain DT and catalytic domain DA are linked in the direction of DA-DT from the N-terminus to the C-terminus. (2) The catalytic domain DA of the diphtheria toxin, (3) Preferably, the transport domain PT and catalytic domain PA of Pseudomonas aeruginosa exotoxin A are linked in the direction of PT-PA from the N-terminus to the C-terminus. (4) The catalytic domain PA of Pseudomonas aeruginosa exotoxin A, (5) Preferably, the transport domain CT and catalytic domain CA of the Vibrio cholerae toxin are linked in the direction of CT-CA from the N-terminus to the C-terminus. (6) The catalytic domain CA of the cholera toxin, The fusion protein according to claim 1 or 2, characterized in that it is one of the following.
4. The fusion protein according to claim 3, characterized in that the toxin molecule has an amino acid sequence shown in any one of SEQ ID NOs: 1 to 9, or an amino acid sequence having at least 80%, 85%, 90%, 95%, or 99% sequence homology percentage with any one of SEQ ID NOs: 1 to 9.
5. The guide vector portion is an antibody, and the antibody is one or more of the following: monoclonal antibody, chimeric antibody, modified antibody, small molecule antibody, multispecific antibody, and polyvalent antibody. Preferably, the antibody is one or more types of small molecule antibodies or polyvalent antibodies. More preferably, the small molecule antibody is one or more of the following: Fv, Fab, ScFv, ScFab, ScIgG, dsFv, nanoantibodies, and single-domain antibodies. The fusion protein according to claim 1 or 2, wherein the polyvalent antibody is a tandem antibody formed by linking at least two single-chain antibodies in series, and an antibody-multimer fusion protein formed by a small molecule antibody and a polymer protein, and further, the antibody-multimer fusion protein is a dimer or a tetramer.
6. The fusion protein according to claim 5, characterized in that the antibody is ScFab, ScFv, ScIgG, nanoantibody, two ScFabs linked in series, two ScFvs linked in series, two nanoantibodies linked in series, a fusion of ScFab and antibody fragment CH3, a fusion of ScFv and antibody fragment CH3, a fusion of two nanoantibodies fused via CH3, a fusion of ScFab and Tamavidins2 protein, or a fusion of ScFv and Tamavidins2 protein.
7. The structure of ScFab is such that the light chain portion and heavy chain portion of ScFab are linked from the N-terminus to the C-terminus, or the heavy chain portion and light chain portion of ScFab are linked from the N-terminus to the C-terminus. The link between ScFab and antibody fragment CH3 is from the N-terminus to the C-terminus, or from the C-terminus to the N-terminus. The heavy and light chain portions of ScFv are linked from the N-terminus to the C-terminus. The fusion of ScFab and Tamavidins2 protein involves a linkage from the Tamavidins2 protein towards ScFab, from the N-terminus to the C-terminus. The fusion protein according to claim 6, characterized in that the fusion of ScFv and Tamavidins2 protein is linked from the Tamavidins2 protein toward ScFab from the N-terminus toward the C-terminus.
8. The light chain portions and heavy chain portions of ScFab, ScFv, ScFv, and ScIGG are connected via the second linker L2. The fusion protein according to claim 6 or 7, characterized in that the second linker L2 comprises at least 15 amino acid residues, preferably 15 to 180, 15 to 120, 15 to 90, 15 to 65, or 20 to 60 amino acid residues.
9. The second linker L2 contains one or more major amino acid residues from among G, S, T, and A, and the number of the major amino acid residues accounts for at least 50%, 60%, 70%, 80%, or 90% of the total number of amino acid residues in the second linker, and more preferably, the major amino acid residues contain one or more amino acid residues from among G and S, and the total amount contained therein accounts for at least 40%, or more than 45%, or more than 60%, or more than 70%, or more than 80% of the total number of amino acid residues in the second linker. Furthermore, the fusion protein according to claim 7, characterized in that the second linker L2 has an amino acid sequence shown in any one of SEQ ID NOs: 10, 12, 13, 14, 17, 28, 45, and 47, or has an amino acid sequence having at least 80%, 85%, 90%, 95%, and 99% sequence homology percentages with any one of SEQ ID NOs: 10, 12, 13, 14, 17, 28, 45, 46, and 47.
10. The two single-chain antibodies, and the small molecule antibody and polymer protein, are linked via the third linker L3. The third linker L3 either contains no amino acid residues or contains at least three amino acid residues, preferably 5 to 20 amino acid residues, preferably 8 to 20 amino acid residues, or 8 to 15, or 8 to 12 amino acid residues, and more preferably contains two major amino acid residues, G and S, and the percentage of the number of major amino acid residues to the total number of amino acid residues of the third linker is 40% or more. For example, the fusion protein according to any one of claims 5 to 9, characterized in that the third linker L3 has an amino acid sequence shown in any one of sequence numbers 10, 14, 18, 20-30, 44, and 48-51, or has an amino acid sequence that has at least 80%, 85%, 90%, 95%, or 99% sequence identity with any one of sequence numbers 10, 14, 18, 20-30, 44, and 48-51.
11. The fusion protein according to any one of claims 1 to 7, characterized in that the antibody is an antibody that specifically binds to one or more antibodies among Her2 and CD22.
12. The antibody is selected from IgM, IgG, IgA, IgD, and IgE. Preferably, the antibody is derived from trastuzumab, rituximab, bevacizumab, adalimumab, pembrolizumab, ustekinumab, nivolumab, ocrelizumab, or pallidum. The fusion protein according to claim 11, characterized in that it is selected from zumab, infliximab, omalizumab, envafolimab, atlizumab, atezolizumab, or cetuximab, or a variant thereof.
13. For Fab or ScFab: The light chain portion constituting Fab or ScFab has the amino acid sequence shown in SEQ ID NO: 32, or has an amino acid sequence having at least 80%, 85%, 90%, 95%, or 99% sequence homology percentages with SEQ ID NO: 32, or The variable domain constituting the heavy chain portion of Fab or ScFab has the amino acid sequence shown in SEQ ID NO: 33 or 55, or has an amino acid sequence having at least 80%, 85%, 90%, 95%, or 99% sequence homology percentages with SEQ ID NO: 33 or 55, or The first constant domain CH1 constituting the heavy chain portion of Fab or ScFab has the amino acid sequence shown in SEQ ID NO: 34 or 57, or has an amino acid sequence having at least 80%, 85%, 90%, 95%, or 99% sequence homology percentages with SEQ ID NO: 34 or 57. For Fv, dsFv, or ScFv: The variable domains constituting the light chain portion of Fv, dsFv, or ScFv have the amino acid sequence shown in SEQ ID NO: 35 or 54, or have an amino acid sequence having at least 80%, 85%, 90%, 95%, or 99% sequence homology percentages with SEQ ID NO: 35 or 54, or The variable domain constituting the heavy chain portion of Fv, dsFv, or ScFv has the amino acid sequence shown in SEQ ID NO: 33 or 55, or has an amino acid sequence having at least 80%, 85%, 90%, 95%, or 99% sequence homology percentage with SEQ ID NO: 33 or 55. In the case of ScIGG: The light chain portion constituting ScIgG has the amino acid sequence shown in SEQ ID NO: 32 or 56, or has an amino acid sequence having at least 80%, 85%, 90%, 95%, or 99% sequence homology percentages with SEQ ID NO: 32 or 56, or The heavy chain portion constituting ScIgG has the amino acid sequence shown in SEQ ID NO: 36 or 17, or has an amino acid sequence having at least 80%, 85%, 90%, 95%, or 99% sequence homology percentages with SEQ ID NO: 36 or 17. In the case of the related antibody fragment CH3, the antibody fragment CH3 has the amino acid sequence shown in SEQ ID NO: 37, or has an amino acid sequence having at least 80%, 85%, 90%, 95%, and 99% sequence homology percentages with SEQ ID NO:
37. In the case of the related Tamavidins2 protein, the Tamavidins2 protein has the amino acid sequence shown in SEQ ID NO: 38, or has an amino acid sequence having at least 80%, 85%, 90%, 95%, and 99% sequence homology percentages with aminoSEQ ID NO:
38. The fusion protein according to any one of claims 5 to 12, characterized in that, in the case of the related nanoantibody, it has the amino acid sequence shown in SEQ ID NO: 52 or 53, or has an amino acid sequence having at least 80%, 85%, 90%, 95%, or 99% sequence homology percentage with SEQ ID NO: 52 or 53.
14. The fusion protein is suitable for cell-free in vitro synthesis, and preferably the cell-free in vitro synthesis is characterized by the step of obtaining the fusion protein in a cell-free in vitro synthesis system by using the nucleic acid encoding the fusion protein as a DNA template or RNA template and culturing it for a predetermined time under predetermined conditions. This is the fusion protein according to any one of claims 1 to 13.
15. The cell-free in vitro synthesis system comprises a cell extract, the cell extract being selected from a yeast strain. Furthermore, the fusion protein according to claim 14, characterized in that the yeast strain is a combination of one or more species from Saccharomyces cerevisiae and Kluyveromyces yeasts, and in another preferred example, the Kluyveromyces yeast is a combination of one or more species from Kluyveromyces lactis, Kluyveromyces marxianus and Kluyveromyces dobzhanskii.
16. The fusion protein according to claim 15, characterized in that the yeast strain is genetically modified to have toxin resistance.
17. The fusion protein according to any one of claims 1 to 16, characterized in that the first linker L1 has an amino acid sequence shown in any one of SEQ ID NOs: 10, 11, 15, 16, 18-20, 31 and 43, or has an amino acid sequence having at least 80%, 85%, 90%, 95%, and 99% sequence homology percentages with any one of SEQ ID NOs: 10, 11, 15, 16, 18-20, 31 and 43.
18. An isolated nucleic acid characterized by encoding a fusion protein according to any one of claims 1 to 17.
19. A vector characterized by comprising the nucleic acid described in claim 18.
20. It is a host cell, comprising the nucleic acid according to claim 18, or the vector according to claim 19, Preferably, the host cell is a yeast cell. Furthermore, the host cell is characterized in that the yeast cell is a combination of one or more Saccharomyces cerevisiae and yeasts of the genus Kluyveromyces, and in another preferred example, the yeast of the genus Kluyveromyces is a combination of one or more Kluyveromyces lactis, Kluyveromyces marxianus and Kluyveromyces dobzhanskii.
21. An in vitro cell-free protein synthesis system characterized by synthesizing the fusion protein using mRNA or DNA encoding the fusion protein described in any one of claims 1 to 17 as a template.
22. (1) The mRNA or DNA template, (2) A yeast cell extract, further derived from one or more of Saccharomyces cerevisiae, Pichia pastoris, and Kluyveromyces, preferably the strain from which the yeast cell extract is derived is Kluyveromyces, and more preferably Kluyveromyces lactis, (3) One or more of the following: amino acid mixture, dNTPs, RNA polymerase, DNA polymerase, energy supply system, polyethylene glycol, and aqueous solvent. The in vitro cell-free protein synthesis system according to claim 21, characterized by comprising one or more of the following.
23. The strain is genetically engineered to have toxin resistance, preferably having reduced expression or activity of the DPH gene in the strain cells and / or having a mutation in the amino acid sequence of eEF2, preferably having an expression level of ≤10%, preferably ≤5%, more preferably ≤2%, and / or the reduction in DPH gene expression or activity satisfies the condition that the A1 / A0 ratio is ≤30%, preferably ≤10%, more preferably ≤5%, even more preferably ≤2%, and most preferably 0-2%, where A1 is the expression or activity of the DPH gene in the genetically engineered cells and A0 is the expression or activity of the wild-type DPH gene, as described in claim 22.
24. A method for in vitro cell-free synthesis of a fusion protein according to any one of claims 1 to 17, comprising a reaction system including a cell-free in vitro protein synthesis system according to any one of claims 21 to 23, wherein an in vitro synthesis reaction is performed using mRNA or DNA encoding the fusion protein according to any one of claims 1 to 17 as a template to obtain the fusion protein, and preferably the volume ratio range of the DNA template to other components involved in the in vitro synthesis reaction is 1:10 to 1:50, or 1:20 to 1:40, or 1:25 to 1:35, or 1:
30.
25. The cell-free in vitro protein synthesis system comprises yeast cell extract, amino acid mixture, dNTPs, RNA polymerase, DNA polymerase, energy supply system, polyethylene glycol, and aqueous solvent. moreover, The yeast cell extract is derived from one or more of the following: Saccharomyces cerevisiae, Pichia pastoris, and Kluyveromyces, preferably from Kluyveromyces, and more preferably from Kluyveromyces lactis. The in vitro cell-free synthesis method according to claim 24, further characterized in that the bacterial strain is genetically modified to have toxin resistance.
26. The in vitro cell-free synthesis method according to claim 25, characterized in that the yeast cell extract accounts for 50 to 80% of the total volume of the cell-free in vitro protein synthesis system.
27. The use of the nucleic acid according to claim 18, or the vector according to claim 19, or the host cell according to claim 20, or the in vitro cell-free protein synthesis system according to any one of claims 21 to 23, in the production of the fusion protein according to any one of claims 1 to 18.
28. Use of the fusion protein according to any one of claims 1 to 17 in the treatment of a disease, or use of the fusion protein according to any one of claims 1 to 17 as a pharmaceutical active ingredient for treating a disease, preferably used for the treatment of an antitumor, anti-transplant rejection, and autoimmune disease, and more preferably characterized in that the treatment of the disease is a treatment that targets one or more of HER2 and CD22.
29. The use of the nucleic acid described in claim 18, or the vector described in claim 19, or the host cell described in claim 20, or the fusion protein described in any one of claims 1 to 17, in the manufacture of a pharmaceutical product used in the use described in claim 28.