Lipid composition of Archexin

Abstract

This specification describes lipid nanoparticle (LNP) formulations for delivering activators (including Archexin).

Description

Cross - reference to related applications

[0001] This application claims priority and the benefit of U.S. Provisional Application No. 63 / 493,576, filed Mar. 31, 2023, the content of which is incorporated herein in its entirety by reference. Incorporation by reference of sequence listings

[0002] The sequence listing filed on Mar. 21, 2024, as a text file named "11650 - 003PV1_2023_03_30_Sequence_Listing" created on Mar. 30, 2023, has a file size of 2,566 bytes and is incorporated herein by reference pursuant to 37 C.F.R. § 1.52(e)(5).

Background Art

[0003] AKT - 1 (Archexin) is the protein product of the akt - 1 proto - oncogene, which promotes cell proliferation and suppresses apoptosis of cancer cells, thus exerting an effect on cancer progression (see Revathidevi S, et al., Semin Cancer Biol. 2019;59:80 - 91, and Uko NE, et al., Curr Top Med Chem. 2020;20(10):883 - 900). Archexin is a fully thiolated 20 - mer antisense oligonucleotide that can specifically bind to AKT - 1 mRNA and cause RNAse H - based down - regulation of AKT - 1. Archexin suppresses the translation of AKT - 1 mRNA and inhibits tumor growth. However, due to its low membrane permeability and in vivo stability, and the further requirement of an administration schedule by continuous infusion for 14 days, Archexin is restricted by problems inherent to antisense oligonucleotides.

[0004] There is a need to enhance the intracellular delivery and circulation time of oligonucleotides (e.g., Archexin).

[0005] The compositions and methods disclosed herein solve these and other needs. [Overview of the project]

[0006] This specification describes pharmaceutical compositions comprising lipid nanoparticles encapsulating an activator. The lipid nanoparticles may include 2.5 mol% to 15 mol% of one or more cationic lipids, 30 mol% to 50 mol% of one or more ionized lipids, 30 mol% to 65 mol% of one or more neutral lipids, and 2.5 mol% to 15 mol% of one or more PEGylated lipids. In some embodiments, the activator may include RX-0201,5' gctgcatuatctccttggcg 3',SEQ ID NO: 1.

[0007] This specification further describes methods for the treatment of cancer, the prevention of cancer, the prevention of cancer metastasis, the prevention of cancer recurrence, or the prevention of angiogenesis. These methods may include the step of administering the pharmaceutical compositions described herein to subjects in need.

[0008] This specification further describes methods for inducing cytotoxicity in cancer cells. These methods may include the step of bringing the cells into contact with the pharmaceutical compositions described herein.

[0009] This specification further describes a method for producing lipid nanoparticle groups encapsulated with an activator. The method may include the steps of (a) mixing one or more ethanol solutions containing a lipid mixture with an aqueous solution and oxidizing them to induce the formation of empty lipid nanoparticle groups; (b) contacting the empty lipid nanoparticle groups with an aqueous solution containing an activator to encapsulate the activator in the empty lipid nanoparticle groups, thereby producing lipid nanoparticle groups encapsulated with the activator; and (c) performing tangential flow filtration on the lipid nanoparticle groups encapsulated with the activator to replace the buffer solution and remove any remaining ethanol. In some embodiments, the lipid mixture contains 2.5 mol% to 15 mol% of one or more cationic lipids, 30 mol% to 50 mol% of one or more ionized lipids, 30 mol% to 65 mol% of one or more neutral lipids, and 2.5 mol% to 15 mol% of one or more PEGylated lipids. [Brief explanation of the drawing]

[0010] [Figure 1A] This figure shows the effect of the Hepa1-6 gene of WGI-0301 on tumor growth in a hepatocellular carcinoma model. [Figure 1B] This figure shows the effect of the WGI-0301 Hepa1-6 gene on survival in a hepatocellular carcinoma model. [Figure 2A] This is a diagram showing the number of branching points in relation to concentration. [Figure 2B] This is a diagram showing the relationship between capillary length and concentration. [Figure 3A] This figure shows the anti-angiogenic effects of WGI-0301 monotherapy and combination therapy (0.1% DMSO and WGI-0301). [Figure 3B] This figure shows the anti-angiogenic effects of WGI-0301 monotherapy and combination therapy (2 μM sorafenib and WGI-0301). [Figure 3C]This figure shows the anti-angiogenic effects of WGI-0301 monotherapy and combination therapy (5 μM lenvatinib and WGI 0301). [Figure 4] This flowchart shows the manufacturing process for lipid nanoparticles described herein. [Figure 5] This study demonstrates the effect of the test product on mouse body weight in the Hepa 1-6 model. [Figure 6] This study demonstrates the effect of the test product on body weight changes in mice in the Hepa 1-6 model. [Figure 7] This study demonstrates the effect of the test sample on tumor volume in the Hepa 1-6 model. [Figure 8] The survival curves for the test specimens in the Hepa 1-6 model are shown. [Figure 9] This figure shows the command voltage program for an hERG test using manual patch clamps. [Figure 10] Archexin free acid: Concentration response curve shown. [Figure 11] This graph shows the change in body weight after administration of the test substance to female Balb / c nude mice carrying Hep3B-luc tumor cells. Data points represent the group mean body weight. Error bars indicate the standard error (SEM) of the mean. [Figure 12] This shows the percentage change in body weight (BW) after administration of the test substance to female Balb / c nude mice carrying Hep3B-luc tumor cells. The change in BW is calculated based on the animal's body weight in PG-D0. Each data point represents the group-mean percentage change in BW. Error bars indicate the standard error (SEM) of the mean. [Figure 13] This shows the body weight changes of female Balb / c nude mice carrying the Hep3B-luc model. [Figure 14] This shows bioluminescence traces from female Balb / c nude mice carrying the Hep3B-luc model. [Figure 15]Survival curves of single-agent or combined treatment with WGI-0301 and lenvatinib on human hepatocellular carcinoma Hep3B-luc in situ model in female Balb / c nude mice are shown. [Figure 16] Survival curves of single-agent or combined treatment with WGI-0301 and sorafenib on human hepatocellular carcinoma Hep3B-luc in situ model in female Balb / c nude mice are shown. [Figure 17] Survival curves of single-agent or combined treatment with WGI-0301 and cabozantinib on human hepatocellular carcinoma Hep3B-luc in situ model in female Balb / c nude mice are shown. [Figure 18-1] A table of images with bioluminescence results is shown. [Figure 18-2] A table of images with bioluminescence results is shown (continued). [Figure 18-3] A table of images with bioluminescence results is shown (continued). [Figure 18-4] A table of images with bioluminescence results is shown (continued). [Figure 18-5] A table of images with bioluminescence results is shown (continued). [Figure 18-6] A table of images with bioluminescence results is shown (continued). [Figure 18-7] A table of images with bioluminescence results is shown (continued). [Figure 18-8] A table of images with bioluminescence results is shown (continued).

Mode for Carrying Out the Invention

[0011] Before disclosing and explaining these methods and systems, it should be understood that these methods and systems are not limited to specific synthesis methods, specific components or specific compositions. It should also be understood that the terms used in this specification are only used for the purpose of explaining specific embodiments and are not intended to be limiting.

[0012] As used herein and in the appended claims, the terms “inclusion” (and its various forms, derivatives, or variations) and “inclusion” (and its various forms, derivatives, or variations) are inclusive (i.e., open) and do not exclude other elements or steps. For example, as used herein, the terms “inclusion” and / or “inclusion” identify the presence of the aforementioned features, integers, steps, operations, elements, and / or components, but do not exclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or groups thereof. Unless otherwise specified, all figures used herein and in the claims to indicate component amounts, reaction conditions, geometric shapes, dimensions, etc., should be interpreted based on at least the number of significant figures and the usual method of rounding, and should be understood not as intended to limit the application of the equivalence principle to the claims.

[0013] Therefore, these terms are intended to encompass not only the elements or steps listed, but also other elements or steps that are not explicitly listed. Also, as used herein, the terms “one,” “one kind,” and “the said” can mean “one” when used with an element, but also conform to the situations of “one or more,” “at least one,” and “one or more.” Thus, unless further constraints are imposed, an element beginning with “one” or “one kind” does not preclude the existence of other identical elements.

[0014] Here, a range can be expressed as "approximately" from a particular value and / or "approximately" to another particular value. "Approximately" means within 5% of the value, for example, within 4%, 3%, 2%, or 1% of the value. When such a range is indicated, another aspect includes from a particular value and / or to another particular value. Similarly, when a value is expressed as an approximation, the use of the antecedent "approximately" makes it clear that the particular value forms the other aspects. As can be further understood, each endpoint of each range is distinct from and independent of the other endpoints. As can also be understood, many values ​​are disclosed in this specification, and in addition to the values ​​themselves, each value is also disclosed in this specification as "~" the particular value. For example, if the value "10" is disclosed, the value "approximately 10" is also disclosed. A range can be interpreted as including the beginning and end of the range. For example, the range from 10% to 20% (i.e., the 10%~20% range) may include 10% and may include 20%, and includes percentages between 10% and 20%, unless otherwise specified in this specification.

[0015] As used herein, the terms “may,” “optionally,” and “may optionally,” are interchangeable and mean both when the condition is met and when it is not. Therefore, for example, the statement that a formulation “may contain excipients” means both when the formulation contains excipients and when the formulation does not contain excipients.

[0016] To ensure that it is understood, when disclosing combinations, subsets, or groups of elements (for example, combinations of components in a composition or combinations of steps in a method), each of the various individual and collective combinations and arrangements of these elements is specifically considered and described herein, although specific references may not be explicitly disclosed.

[0017] "Administration" to a subject includes any route through which the reagent is introduced or delivered to the subject. Administration may be carried out by any suitable route and includes oral administration, topical administration, transdermal administration, transdermal absorption administration, intra-articular administration, intra-arteriole administration, intradermal administration, intraventricular administration, intrafocal administration, intranasal administration, rectal administration, intravaginal administration, administration by inhalation, administration via an implantable storage device, and parenteral administration (e.g., subcutaneous injection, intravenous injection, intramuscular injection, intra-articular injection, intrasynovial injection, intrasternal injection, intrathecal injection, intraperitoneal injection, intrahepatic injection, intrafocal injection, and administration by intracranial injection or infusion techniques). As used herein, "parallel administration," "combined administration," "simultaneous administration," or "simultaneous administration" means administering multiple compounds at the same time or substantially in close proximity to each other. In the latter case, the administration times of the two compounds are sufficiently close that the observed results are indistinguishable from the results obtained when the compounds are administered at the same time. "Systemic administration" refers to the introduction or delivery of a reagent to a subject via a route that introduces or delivers the reagent to a wide area of ​​the subject's body (e.g., more than 50% of the body), such as administration by entering the circulatory or lymphatic system. In contrast, "local administration" refers to the introduction or delivery of a reagent to a subject via a route that introduces or delivers the reagent to the area of ​​the administration site or an area immediately adjacent to the administration site, and does not involve the systemic introduction of a therapeutically significant amount of the reagent. For example, a locally administered reagent may be easily detectable in the vicinity of the administration site, but may not be detectable in distal parts of the subject's body, or the amount detected may be negligible. Administration includes self-administration and administration by another person.

[0018] As used herein, “sustained-release,” “sustained-release drug delivery,” or “continuous release” refers to the controlled release or administration of a drug from a given dosage form to achieve desired pharmacokinetic properties in vivo. One aspect of “controlled-release” drug delivery is the ability to manipulate the formulation and / or dosage form to establish desired drug release kinetics.

[0019] As used herein, “beneficial reagent” and “activator” are interchangeable terms and refer to compounds or compositions having beneficial biological effects. Beneficial biological effects include therapeutic effects (i.e., effects that treat disease or other harmful physiological conditions) and prophylactic effects (i.e., effects that prevent disease or other harmful physiological conditions). The terms also include, but are not limited to, pharmaceutically acceptable pharmacologically active derivatives of beneficial reagents specifically mentioned herein, including salts, esters, amides, prodrugs, active metabolites, isomers, fragments, analogs, etc. When using the terms “beneficial reagent” or “activator,” or when specifically identifying a particular drug, it should be understood that the terms include not only the reagent itself, but also pharmaceutically acceptable pharmacologically active salts, esters, amides, prodrugs, conjugates, active metabolites, isomers, fragments, analogs, etc.

[0020] The term "therapeutic agent" refers to any composition having a beneficial biological effect. Beneficial biological effects include therapeutic effects, such as treating a disease or other adverse physiological condition, and preventive effects, such as preventing a disease or other adverse physiological condition. The term also includes, but is not limited to, pharmaceutically acceptable pharmacologically active derivatives of beneficial reagents specifically mentioned herein, including salts, esters, amides, prodrugs, active metabolites, isomers, fragments, and analogs. When using the term "therapeutic agent," or when specifically identifying a particular drug, it should be understood that the term includes not only the reagent itself, but also pharmaceutically acceptable pharmacologically active salts, esters, amides, prodrugs, conjugates, active metabolites, isomers, fragments, and analogs.

[0021] "Reduction" refers to any change that reduces the amount of symptoms, disease, components, conditions, or activities. A substance is understood to reduce the genetic output of a gene if the genetic output of the gene product is less in the presence of that substance compared to the genetic output of the gene product in the absence of that substance. For example, reduction refers to a change in the symptoms of a disease condition, where the symptoms are less than previously observed. Reduction means a statistically significant reduction in any single value, median, or mean of a disease condition, symptoms, activity, or component. Therefore, as long as the reduction is statistically significant, a reduction can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100%.

[0022] "Inhibition" refers to a reduction in activity, response, symptom, disease, or other biological parameters. This includes, but is not limited to, the complete disappearance of activity, response, symptom, or disease. It also includes, for example, a 10% reduction in activity, response, symptom, or disease compared to natural or control levels. Therefore, compared to natural or control levels, the reduction may be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any percentage in between.

[0023] "Inactivation" refers to the reduction or disappearance of activity, response, symptoms, disease, or other biological parameters through a chemical reaction (formation of a covalent bond) between a ligand and its biological target.

[0024] "Decrease" or other forms of the word refer to a reduction in an event or characteristic (e.g., tumor growth). This is usually related to some standard or predictive value, in other words, relative, but it should be understood that it does not necessarily have to refer to a standard or relative value. For example, "reduce tumor growth" means reducing the rate of tumor growth compared to a standard or control.

[0025] As used herein, the terms “treatment” or “procedure” with respect to a subject include administering a drug to a subject for the purpose of preventing, curing, promoting healing, reducing, alleviating, modifying, relieving, improving, enhancing, stabilizing, or influencing a disease or condition, or the symptoms of a disease or condition. The terms “treatment” and “procedure” may also refer to reducing the severity and / or frequency of symptoms, eliminating symptoms and / or their underlying causes, preventing the onset of symptoms and / or their underlying causes, and improving or relieving injuries.

[0026] "Prevention," or any other form thereof, refers to stopping a particular event or characteristic, stabilizing or delaying the occurrence or progression of a particular event or characteristic, or minimizing the probability of a particular event or characteristic occurring. Prevention does not require a comparison with a control because it is usually a more absolute concept than "reduction," etc. Where used herein, some things can be reduced but not prevented, while some things that can be reduced can also be prevented. Similarly, some things can be prevented but not reduced, while some things that can be prevented can also be reduced. Where "reduction" or "prevention" is used, it should be understood that the use of the other term is also clearly disclosed unless otherwise explicitly stated. For example, the terms "prevention" or "suppression" may refer to a treatment that preemptively prevents or delays the onset of a disease or condition, or reduces the severity of a disease or condition. Thus, if a treatment can treat a disease in a subject who has symptoms of the disease, the treatment can also prevent or suppress the disease in a subject who does not yet have some or all symptoms. As used herein, the term “prevention” of a pathological condition or undesirable physiological event in a subject specifically means preventing the onset of symptoms and / or their underlying causes, in which the subject may or may not be highly susceptible to the pathological condition or event.

[0027] The term "effective dose" of a therapeutic agent refers to a quantity of a beneficial reagent that is non-toxic but sufficient to provide the desired effect. The amount of an "effective" beneficial reagent varies from subject to subject and depends on the subject's age and general condition, the specific beneficial reagent, etc. Therefore, it is not always possible to specify an exact "effective dose." However, in any case, an appropriate "effective" dose can be determined by a person skilled in the art using standard experiments. Furthermore, as used herein, unless otherwise explicitly stated, a beneficial "effective dose" may also include the therapeutic effective dose and the prophylactic effective dose.

[0028] The "effective dose" of drug needed to achieve a therapeutic effect may vary depending on factors such as the subject's age, sex, and weight. The dosage schedule can be adjusted to obtain the optimal therapeutic response. For example, the drug may be administered in several divided doses per day, or the dosage may be proportionally reduced depending on the urgency of the treatment situation.

[0029] As used herein, the “therapeutic dose” of a therapeutic agent means the amount that effectively achieves the desired therapeutic outcome, and the “preventive dose” of a therapeutic agent means the amount that effectively prevents an undesirable physiological condition. The therapeutic and preventive doses of a particular therapeutic agent usually vary depending on the type and severity of the condition or disease being treated, as well as factors such as the subject's age, sex, and weight. The term “therapeutic dose” may also refer to the amount of therapeutic agent or the rate of delivery of the therapeutic agent (e.g., change in amount over time) that effectively promotes the desired therapeutic effect. The exact desired therapeutic effect varies depending on the condition being treated, the subject's tolerance, the drug and / or drug formulation being administered (e.g., the efficacy of the therapeutic agent (drug), the drug concentration in the formulation, etc.), and various other factors understood by those skilled in the art.

[0030] As used herein, the term “pharmaceutically acceptable” means an ingredient that is not biologically or otherwise undesirable; that is, an ingredient that, when incorporated into the drug formulation of the present invention and administered to a subject as described herein, does not cause any significant undesirable biological effects and does not interact in a harmful manner with any other ingredient in the formulation containing the ingredient. When the term “pharmaceutically acceptable” is used to refer to an excipient, it usually implies that the ingredient meets the standards of toxicological and manufacturing testing, or is included in the non-active ingredient guidelines developed by the U.S. Food and Drug Administration.

[0031] Furthermore, as used herein, the term "pharmacological activity" (or abbreviated as "activity") refers to a derivative or analog that has, for example, "pharmacological activity," and that possesses the same type of pharmacological activity as the parent compound, and to a degree that is approximately equivalent (e.g., salts, esters, amides, conjugates, metabolites, isomers, fragments, etc.).

[0032] A "control" refers to a surrogate subject or sample used in an experiment for comparison purposes. A control may be a "positive control" or a "negative control."

[0033] As used herein, “subject” refers to an individual. Therefore, “subject” may include domesticated animals (e.g., cats, dogs, etc.), livestock (e.g., cattle, horses, pigs, sheep, goats, etc.), laboratory animals (e.g., mice, rabbits, rats, guinea pigs, goats, sheep, pigs, dogs, cats, etc.), and birds (e.g., chickens, turkeys, songbirds, etc.). “Subject” may also include primates or mammals such as humans. Therefore, a subject may be a human or veterinary patient. The term “patient” refers to a subject receiving treatment from a clinician (e.g., a physician). Administration of therapeutic agents may be carried out in doses and for durations that effectively treat the subject. In some embodiments, the subject is human.

[0034] As used herein, the term "nucleic acid" refers to a polymer composed of nucleotides such as deoxyribonucleotides or ribonucleotides.

[0035] As used herein, the terms “ribonucleic acid” and “RNA” refer to polymers composed of ribonucleotides.

[0036] As used herein, the terms “deoxyribonucleic acid” and “DNA” refer to polymers composed of deoxyribonucleotides.

[0037] The term "oligonucleotide" refers to a single-stranded or double-stranded nucleotide polymer consisting of approximately 2 to 100 nucleotides in length. Suitable oligonucleotides can be prepared by the phosphoramidite method described in Beaucage and Carruthers, Tetrahedron Lett., 22:1859-1862 (1981) or by the triester method in accordance with Matteucci, et al., J. Am. Chem. Soc., 103:3185 (1981), both of which are incorporated herein by reference or can be prepared by commercially available autooligonucleotide synthesizers or other chemical methods using VLSIPS™ technology. When an oligonucleotide is referred to as "double-stranded," it will be understood by those skilled in the art that a pair of oligonucleotides typically exist as a hydrogen-bonded helical sequence that associates with, for example, DNA. As used herein, the term “double-stranded” refers not only to the 100% complementary form of a double-stranded oligonucleotide, but also to forms that include structural features such as protrusions and loops, which are described in more detail in biochemical texts such as Stryer, Biochemistry, Third Ed., (1988), which are incorporated herein by reference for all purposes.

[0038] In the context of two or more nucleic acid or polypeptide sequences, the term “homology” or “identity” percentage refers to two or more sequences or subsequences that have a specific percentage of the same or identical amino acid residues or nucleotides when comparing and aligning maximum correspondence within a comparison window or specified region (i.e., approximately 60% identity within a specific region, preferably 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%). , 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity, measured using the BLAST or BLAST2.0 sequence comparison algorithm with the default parameters described below, or by manual alignment and visual inspection (see, for example, the NCBI website). Hereinafter, such sequences will be referred to as "substantially identical". This definition may also relate to or apply to the complement of the test sequence. The above definition further includes sequences with deletions and / or additions, as well as sequences with substitutions. As described below, preferred algorithms can interpret gaps, etc. Preferably, the identity resides in a region of at least about 10 amino acids or 20 nucleotides in length, or more preferably in a region of 10 to 50 amino acids or 20 to 50 nucleotides in length. As used herein, amino acid sequence identity percentage (%) is defined as the percentage of amino acids in a candidate sequence that are identical to those in a reference sequence, after the sequences have been aligned and deletions (if necessary) have been introduced to achieve the maximum sequence identity percentage. Alignment for determining the sequence identity percentage can be performed in various forms well known to those skilled in the art, for example, using commonly available computer software such as BLAST, BLAST-2, ALIGN, ALIGN-2, or Megalign (DNASTAR) software.The appropriate parameters used to measure alignment can be determined by known methods, including any algorithm necessary to achieve the maximum alignment on the full-length array being compared.

[0039] For sequence comparison, typically one sequence is used as the reference sequence, and the test sequence is compared to this reference sequence. When using a sequence comparison algorithm, the test sequence and reference sequence are input into the computer, sub-sequence coordinates are specified (if necessary), and sequence algorithm program parameters are specified. Preferably, default program parameters are used, or alternative parameters can be specified. The sequence comparison algorithm then calculates the sequence identity percentage of the test sequence to the reference sequence based on the program parameters.

[0040] Examples of algorithms suitable for determining sequence identity percentages and sequence similarity percentages include the BLAST and BLAST 2.0 algorithms, described in Altschul et al. (1977) Nuc. Acids Res. 25:3389-3402 and Altschul et al. (1990) J. Mol. Biol. 215:403-410, respectively. Software for performing BLAST analysis is publicly available from the National Center for Biotechnology Information (http: / / www.ncbi.nlm.nih.gov / ). The algorithm first labels high-scoring sequence pairs (HSPs) by labeling short segments of length W in the query sequence, which then match or satisfy a certain positive threshold score T when aligned with segments of the same length in the database sequence. T is called the neighboring segment score threshold (Altschul et al. (1990) J. Mol. Biol. 215:403-410). These initial neighbor segment hits serve as the starting point for the search to find longer HSPs containing them. Segment hits are extended in both directions along each sequence as long as the cumulative alignment score can increase. For nucleotide sequences, the cumulative score is calculated using parameters M (reward score for a pair of matched residues, always >0) and N (penalty score for mismatched residues, always <0). For amino acid sequences, the cumulative score is calculated using a scoring matrix. Segment hit extension in each direction stops if the cumulative alignment score falls by a value of X from its maximum achieved value, if the cumulative score becomes zero or less due to the accumulation of one or more residue alignments that give negative scores, or if the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of alignment. The BLASTN program (for nucleotide sequences) defaults to a word length (W) of 11, an expected value (E) of 10, M=5, N=-4, and comparison of two strands.For amino acid sequences, the BLASTP program defaults to a word length of 3, an expected value (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff and Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915). Default values ​​are alignment (B) of 50, expected value (E) of 10, M=5, N=-4, and comparison of two strands.

[0041] The BLAST algorithm further performs statistical analysis on the similarity between two sequences (see, for example, Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5787). One measure of similarity provided by the BLAST algorithm is the minimum sum probability (P(N)), which indicates the probability that a match between two nucleotide or amino acid sequences will occur by chance. For example, in a comparison between a test nucleic acid and a reference nucleic acid, if the minimum sum probability is less than about 0.2, more preferably less than about 0.01, the nucleic acid is considered similar to the reference sequence.

[0042] The term "nuclear base" refers to the portion of a nucleotide that has the ability to form Watson / Crick base pairs. The most common natural nuclear bases, adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T), have hydrogen bonding ability, allowing one nucleic acid strand to be linked to another in a sequence-specific manner.

[0043] Antisense compounds are tools that can be used to introduce modifications to nucleic acids found in living cells. The term "antisense" refers to the concept that nucleic acids "code" proteins; that is, the sequence of nucleotides found in a given nucleic acid determines what kind of protein is produced. The "sense" sequence of a complete gene produces a normal amount of normal protein in response to a given stimulus. "Sense" oligonucleotides hybridize with normal gene sequences and do not affect the amount or properties of the protein. "Nonsense" sequences may produce no product or a product that does not have function. For example, if a "nonsense" codon or oligomer is inserted into a gene, a cleaved, dysfunctional protein may be produced. "Antisense" oligonucleotides hybridize with normal genes but produce proteins with altered structure or quantity. Antisense oligomers, i.e., relatively short antisense compounds, have been found to be easily inserted into cells and to modify gene function within cells.

[0044] Antisense compounds have the ability to modify gene expression with high specificity and can be used to elucidate the function of specific genes; therefore, they are commonly used as reagents for studying and detecting gene function. For example, antisense compounds can be used to distinguish the functions of multiple members in a biological pathway.

[0045] Antisense oligonucleotides can be used to selectively block pathogenic genes, thereby suppressing the production of disease-related proteins. Some antisense oligonucleotides have already been administered safely and effectively to humans, and many clinical trials are underway. Oligonucleotides can be used for the treatment of cells, tissues, and animals, particularly humans. In the context of this invention, the term “oligonucleotide” refers to oligomers or polymers of ribonucleic acid (RNA), deoxyribonucleic acid (DNA), or their mimics. The term includes oligonucleotides composed of naturally occurring nuclear bases, sugars, and covalent nucleosides (back chain), and oligonucleotides containing non-naturally occurring moieties with similar functions. These modified or substituted oligonucleotides are generally preferred over their natural forms because they possess desired properties, such as enhanced cellular uptake, increased affinity to nucleic acid targets, and increased stability in the presence of nuclear bases.

[0046] The compositions and methods described herein utilize oligonucleotide compounds, particularly antisense oligonucleotides, which target the nucleotide-coding portion of Akt-1 and regulate Akt-1 expression. The oligonucleotide compounds are designed to specifically hybridize with one or more nucleic acids encoding Akt-1.

[0047] Targeting an antisense compound of a specific gene involves determining the target nucleic acid sequence and selecting one or more sites within that sequence to be modified. Once the target site is determined, an oligonucleotide that is sufficiently complementary to the target site is selected, thereby specifically hybridizing with the site, i.e., hybridizing sufficiently well and sufficiently specifically to achieve the desired effect.

[0048] As used herein, the term “nucleic acid encoding Akt-1” includes DNA encoding Akt-1, RNA transcribed from said DNA (including pre-mRNA), and DNA derived from said RNA. The antisense oligomer compound specifically hybridizes with the target nucleic acid, thereby interfering with its normal function. The functions of the DNA affected include replication and transcription. The functions of the RNA affected include all important functions such as the translocation of RNA to protein translation sites, transcription of proteins from said RNA, splicing of said RNA to produce one or more mRNAs, and catalytic activity in which RNA is involved or promoted. The combined effect of such interference with the function of the target nucleic acid is to regulate protein expression or production. In the context of this invention, “regulation” means an increase (stimulation) or decrease (suppression) of gene expression.

[0049] In the context of this invention, “hybridize” refers to hydrogen bonds between complementary nucleosides or nucleoside bases formed via Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonds. For example, adenine and thymine are complementary nuclear bases and form a pair via hydrogen bonds. As used herein, “complementary” refers to the ability of two nucleotides to pair precisely. For example, if a nucleotide at a certain position in an oligonucleotide can form a hydrogen bond with a nucleotide at the same position in a DNA or RNA molecule, then the oligonucleotide and the DNA or RNA are considered complementary at that position. The oligonucleotide and the DNA or RNA are complementary if a sufficient number of corresponding positions in each molecule are occupied by nucleotides capable of forming hydrogen bonds with each other. Thus, the terms “specifically hybridizable” and “complementary” are used to indicate sufficient complementarity or precise pairing to result in a stable and specific bond between the oligonucleotide and the DNA or RNA target. It is known in the art that the sequence of an antisense compound does not need to be 100% complementary to the target nucleic acid with which it specifically hybridizes. If an antisense compound binds to a target DNA or RNA molecule and interferes with the normal function of the target DNA or RNA, rendering it ineffective, then the antisense compound is specifically hybridizable and has sufficient complementarity to avoid nonspecific binding between the antisense compound and the non-target sequence under conditions where specific binding is desired, i.e., physiological conditions for in vivo measurement or therapeutic treatment, and conditions under which the measurement is performed for in vitro measurement.

[0050] Antisense oligonucleotides are a preferred form of antisense compound, but the present invention further includes other oligomeric antisense compounds and includes, but is not limited to, oligonucleotide mimetic compounds such as those described below. The antisense compounds according to the present invention preferably contain about 10 to about 30 nuclear bases. Particularly preferred are antisense oligonucleotides containing about 20 nuclear bases (i.e., about 20 linked nucleosides). It is well known in the art that nucleosides are base-sugar bonds. The base portion of a nucleoside is usually a heterocyclic base. The two most common types of such heterocyclic bases are purines and pyrimidines. A nucleotide is a nucleoside further containing a phosphate group covalently bonded to the sugar portion of the nucleoside. For nucleosides containing flupentoses, the phosphate group can be bonded to the 2', 3', or 5' hydroxyl portion of the sugar. In the process of oligonucleotide formation, the phosphate groups covalently link adjacent nucleosides to each other, forming a linear polymerization compound. Each end of the linear polymer structure can be further linked to form a cyclic structure, but the linear structure is generally preferred. Within the oligonucleotide structure, the phosphate group is usually called the internucleoside skeleton that forms the oligonucleotide. The normal binding or skeleton of RNA and DNA is a 3'-5' phosphodiester bond.

[0051] Specific examples of preferred antisense compounds used in the present invention include oligonucleotides containing a modified skeleton or unnatural internucleoside bonds. As defined herein, oligonucleotides having a modified skeleton include those that retain a phosphorus atom in the main chain and those that do not. For the purposes of this specification, and as may be referred to in the art, modified oligonucleotides that do not have a phosphorus atom in the internucleoside main chain can also be considered as oligonucleosides.

[0052] Preferred modified oligonucleotide backchains include, for example, thiophosphate esters, chiral thiophosphate esters, dithiophosphate esters, phosphate triesters, aminoalkyl phosphate triesters, methyl groups and other alkylphosphonic acids (including 3'-hydrocarbylphosphonic acid esters and chiral phosphonic acid esters), phosphonites, phosphoramidites (including 3'-aminophosphoramidites and aminoalkylphosphoramidites), thiolphosphoramidites, thiolalkylphosphonic acid esters, thiolalkylphosphonic acid triesters, boranyl phosphate esters having the usual 3'-5' linkage, their 2'-5' linkage analogues, and compounds with reversed polarity, where adjacent nucleoside units are linked from 3'-5' to 5'-3', 2'-5', or 5'-2'. Multiple salts, mixed salts, and free acid forms are also included.

[0053] Preferred modified oligonucleotide backchains that do not contain phosphorus atoms are formed by short-chain alkyl or cycloalkyl nucleoside bonds, mixed heteroatoms or alkyl or cycloalkyl nucleoside bonds, or one or more short-chain heteroatoms or heterocyclic nucleoside bonds. These backchains include backchains having morpholino bonds (partially formed from the sugar moiety of the nucleoside), siloxane backchains, sulfides, sulfoxides and sulfones, formylacetyl and thioformylacetyl group backchains, methyleneformylacetyl and thioformylacetyl group backchains, alkenyl group backchains, aminosulfonic acid ester backchains, methyleneimino and methylenehydrazino backchains, sulfonic acid esters and sulfonamides, amides, and other backchains having mixed components of N, O, S and CH2.

[0054] In other preferred oligonucleotide mimetic compounds, the sugar-nucleoside bond, i.e., the backbone, of the nucleotide unit is replaced with a new group. The base unit is retained to hybridize with a suitable nucleic acid target compound. Such oligomeric compounds are already oligonucleotide mimetic compounds that exhibit excellent hybridizing properties and are called peptide nucleic acids (PNAs). In PNA compounds, the sugar backbone of the oligonucleotide is replaced with a backbone containing an amide, particularly an aminoethylglycine backbone. The nuclear base is retained and directly or indirectly bonded to the nitrogen heteroatom of the amide portion of the backbone.

[0055] The most preferred embodiments of the present invention are oligonucleotides having a thiophosphate ester back chain and oligonucleotides having a heteroatom back chain, particularly -CH2-NH-O-CH2-, -CH2-N(CH3)-O-CH2- [called methylene (methylimino) or MMI back chain], -CH2-ON(CH3)-CH2-, -CH2-N(CH3)-N(CH3)-CH2-, and -ON(CH3)-CH2-CH2- [where the natural phosphate diester back chain is given as -OPO-CH2-]. More preferably are oligonucleotides having a morpholino back chain structure.

[0056] Modified oligonucleotides may contain one or more substituted sugar moieties. Preferred oligonucleotides contain at the 2' position any of OH, F, O-, S-, or N-alkyl group, O-, S-, or N-alkenyl group, O-, S-, or N-alkynyl group, or O-alkyl-O-alkyl group, where the alkyl group, alkenyl group and alkynyl group may be substituted or unsubstituted C1-C10 alkyl groups or C2-C10 alkenyl groups and alkynyl groups. Particularly preferred are O[(CH2)nO]mCH3, O(CH2)nOCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, and O(CH2)nON[(CH2)nCH3)]2, where n and m are 1 to about 10. Other preferred oligonucleotides include, at the 2' position, any of the following substituents: C1-C10 lower alkyl groups, substituted lower alkyl groups, alkylaryl groups, arylalkyl groups, O-alkylaryl groups or O-arylalkyl groups, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocyclic alkyl groups, heterocyclic alkylaryl groups, aminoalkylamino groups, polyalkylamino groups, substituted silyl groups, RNA cleavage groups, reporter groups, intercalators, groups that improve the pharmacokinetic properties of oligonucleotides, or other substituents having similar properties. Preferred modifications include the 2'-methoxyethoxy group (2'-O-CH2CH2OCH3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78, 486-504), i.e., an alkoxyalkoxy group. A more preferred modification involves a 2'-dimethylaminooxyethoxy group, i.e., the O(CH2)2ON(CH3)2 group is also called 2'-DMAOE, as shown in the following examples.

[0057] Other preferred modifications include 2'-methoxy groups (2'-O-CH3), 2'-aminopropoxy groups (2'-OCH2CH2CH2NH2), and 2'-fluoro groups (2'-F). Similar modifications can be made at other positions on oligonucleotides, particularly at the 3' position of a sugar on the 3'-terminal nucleotide, or in 2'-5'-linked oligonucleotides and at the 5' position of the 5'-terminal nucleotide. Oligonucleotides may be sugar mimetic, for example, those having a cyclobutyl moiety instead of a furanopentose sugar. Oligonucleotides may further include nuclear base (usually abbreviated as "base" in the literature) modifications or substitutions. "Unmodified" or "natural" nuclear bases as used herein include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nuclear bases include other synthetic and native nuclear bases, such as 5-methylcytosine (5-Me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, the 6-methyl group and other alkyl derivatives of adenine and guanine, the 2-propyl group and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, and cytosine. These include thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halogens, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenines and guanines, 5-halogens, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine, and 8-azaadenine, 7-deazaguanine and 7-deazaadenine, and 3-deazaguanine and 3-deazaadenine. Some nuclear bases can be used in particular to increase the binding affinity of the oligomeric compounds of the present invention.These nuclear bases include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines, as well as 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. Substitution with 5-methylcytosine has been shown to increase the stability of nucleic acid double helix by 0.6 to 1.2°C and is a preferred base substitution of the present invention, particularly preferred when combined with 2'-O-methoxyethyl sugar modification.

[0058] Other modifications of oligonucleotides of the present invention include chemical bonding of one or more portions of the oligonucleotide or chemical bonding with a conjugate to enhance the activity, cell distribution, or cell uptake of the oligonucleotide. These portions include, but are not limited to, lipid portions (e.g., cholesterol portions, cholic acid), thioethers (e.g., hexyl-S-tritylthiol, thiocholesterol), aliphatic chains (e.g., sebacilic acid or undecyl residues), phospholipids (e.g., di-hexadecyl-racemic-glycerol or triethylammonium 1,2-di-O-hexadecyl-racemic-glycerol-3-H-phosphonate), polyamine or polyethylene glycol chains, or adamantane acetate, palmityl portions, or octadecylamine or hexylamino-carbonyl-oxycholesterol portions.

[0059] It is not necessary for all positions in a given compound to be uniformly modified; in fact, two or more of the modifications proposed above can be introduced into a single compound, or even a single nucleoside within an oligonucleotide. The present invention also encompasses antisense compounds that are chimeric compounds. In the background of the present invention, a “chimeric” antisense compound or “chimeric form” is an antisense compound, particularly an oligonucleotide, which contains two or more chemically distinct regions, each region consisting of at least one monomeric unit, i.e., for oligonucleotides, the monomeric unit is a nucleotide. These oligonucleotides typically contain at least one region, which is modified to confer greater resistance to degradation by nucleases, stronger cellular uptake, and / or greater binding affinity to target nucleic acids. The additional region of the oligonucleotide can serve as a substrate for an enzyme capable of cleaving RNA:DNA or RNA:RNA hybrid molecules. Specifically, RNA enzyme H is an intracellular endonuclease that cleaves the RNA strand of an RNA:DNA double helix. Therefore, activation of RNA enzyme H cleaves the RNA target, thereby significantly enhancing the gene expression repression efficiency by the oligonucleotide. Therefore, when using chimeric oligonucleotides, comparable results can usually be obtained with shorter oligonucleotides compared to phosphorothioate deoxyoligonucleotides that hybridize to the same target region. Cleavage of the RNA target can be detected by gel electrophoresis according to conventional methods and, if necessary, can be used in combination with nucleic acid hybridization techniques known in the art.

[0060] The chimeric antisense compounds of the present invention can form complex structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides, and / or oligonucleotide mimetic compounds described above. These compounds are referred to in the art as hybrids or gapmers.

[0061] The antisense compounds used in this invention can be synthesized simply and conventionally by well-known solid-phase synthesis techniques. The equipment used in this synthesis is available from several vendors, including, for example, Applied Biosystems (Foster City, Calif.). Additionally or alternatively, any other method known in the art and applicable to this synthesis may be used. It is well known that oligonucleotides, such as thiophosphate esters and alkylated derivatives, can be prepared using similar techniques.

[0062] The antisense compounds of the present invention do not include antisense compositions of bio-derived or gene carrier constructs designed to guide the in vivo synthesis of antisense molecules, and are synthesized in vitro. The compounds of the present invention can be further mixed, embedded, conjugated, or otherwise bound to lipids, receptor target molecules, and mixtures of other molecules, molecular structures, or compounds, such as oral, rectal, topical, or other formulations, thereby aiding uptake, distribution, and / or absorption.

[0063] The antisense compounds of the present invention include any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compounds, which, when administered to animals including humans, may (directly or indirectly) provide a bioactive metabolite or residue thereof. Accordingly, for example, this disclosure also relates to prodrugs and pharmaceutically acceptable salts of the compounds of the present invention, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.

[0064] The term "prodrug" refers to a therapeutic agent prepared in an inactive form that is converted to an active form (i.e., a drug) in vivo or within living cells by the action of endogenous enzymes or other chemical substances and / or conditions. Specifically, the prodrug form of the oligonucleotide of the present invention is prepared as a SATE[(S-acetyl-2-thioethyl)phosphate] derivative.

[0065] The term "pharmaceutically acceptable salt" refers to a physiologically and pharmaceutically acceptable salt of the compound of the present invention, that is, a salt that retains the desired biological activity of the parent compound without conferring its undesirable toxicological effects.

[0066] Preferred examples of pharmaceutically acceptable salts of oligonucleotides include, but are not limited to, (a) salts with cations such as sodium, potassium, ammonium, magnesium, and calcium, and polyamines such as spermine and spermidine; (b) acid addition salts with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, and nitric acid; (c) salts with organic acids such as acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, and polygalacturonic acid; and (d) salts with basic anions such as chlorine, bromine, and iodine.

[0067] composition This specification describes pharmaceutical compositions containing lipid nanoparticles encapsulating an activator.

[0068] In some embodiments, the activator may include RX-0201,5' gctgcatgatctccttggcg 3',SEQ ID NO: 1. RX-0201 targets the 5' cgccaaggagatcatgcagc 3' site at site 1478 of the Akt-1 gene coding region having the following sequence: Akt-1 gene (Genebank # BC000479) (SEQ ID NO: 2). The skeletal sequence of RX-0201 is complementary to this site. Archexin (RX-0201) is described in U.S. Patent No. 7,122,527, the contents of which are incorporated herein by reference. In some embodiments, the compound is an antisense oligonucleotide. In some embodiments, the antisense oligonucleotide has at least one modified nucleoside bond, i.e., a thiophosphate bond.

[0069] Suitable cationic lipids include DOTMA:[1-(2,3-silyloxy)propyl)]-N,N,N-trimethylammonium chloride, DMRIE, di-C14-amidine, DOTIM, SAINT, DC-Chol, BGTC, CTAP, DODAP, DOSPA(2,3-dioleoyloxy-N-[2-(spermidinecarboxamide)ethyl]-N,N-dimethyl-1-propanaminonium trifluoroacetate), DORIE(N-[1-(2,3-dioleoyloxy (Propyl)-N,N-dimethyl-N-hydroxyethylammonium bromide), DODAB, DOIC, DMEPC, DOGS: Dioctadecylamide glycidylamine, DIMRI: Dimyristoyloxypropyldimethylhydroxyethylammonium bromide, DOTAP: Dioleoyloxy-3-(trimethylammonium)propane, DC-6-14: O,O-ditetradecanoyl-N-α-trimethylaminoacetyl)diethanolamine chloride, CLIP 1: Racemic-[(2,3-dioctadecyloxypropyl)(2-hydroxyethyl)]-dimethylammonium chloride, CLIP6: Racemic-[2(2,3-dihexadecyloxypropoxymethoxy)ethyl]-trimethylammonium, CLIP9: Racemic-[2(2,3-dihexadecyloxypropoxysuccinoyloxy)ethyl]-trimethylammonium, oligofectamine, lipids as described in U.S. Patent No. 5,049,386, N-[1-(2,3-dioleoyloxypropyl)]- as disclosed in International Publication Nos. WO91 / 16024 and WO97 / 019675 This may include, but is not limited to, N,N-dimethyl-N-hydroxyethylammonium bromide (DORIE), 2,3-dioleoyloxy-N-[2-(spermidinecarboxamide)ethyl]-N,N-dimethyl-1-propanaminonium trifluoroacetate (DOSPA), and (3R,4R)-3,4-bis((Z)-hexadeca-9-enoxy)-1-methylpyrrolidine and N-methyl-N,N-bis(2-((Z)-octadeca-6-enoxy)ethyl)amine disclosed in International Publication WO2011 / 13636, or any combination thereof.

[0070] In some embodiments, the lipid nanoparticles may contain 2.5 mol% to 15 mol% of one or more cationic lipids.

[0071] In some embodiments, one or more cationic lipids may be present in lipid nanoparticles in an amount of at least 2.5 mol% (e.g., at least 5 mol%, at least 7.5 mol%, at least 10 mol%, or at least 12.5 mol%). In some embodiments, one or more cationic lipids may be present in lipid nanoparticles in an amount of 15 mol% or less (e.g., 12.5 mol% or less, 10 mol% or less, 7.5 mol% or less, or 5 mol% or less).

[0072] One or more cationic lipids may be present in lipid nanoparticles in amounts ranging from any of the minimum to any of the maximum values ​​described above. For example, in some embodiments, one or more cationic lipids may be present in lipid nanoparticles in amounts of 2.5 mol% to 15 mol% (e.g., 2.5 mol% to 12.5 mol%, 2.5 mol% to 10 mol%, 2.5 mol% to 7.5 mol%, 2.5 mol% to 5 mol%, 5 mol% to 15 mol%, 5 mol% to 12.5 mol%, 5 mol% to 10 mol%, or 5 mol% to 7.5 mol%).

[0073] Suitable neutral lipids may include, but are not limited to, dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylethanolamine (DOPE), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), palmitoyloleoylphosphatidylcholine (POPC), phosphatidylcholine (EPC), distearoylphosphatidylcholine (DSPC), cholesterol, or any combination thereof. In some embodiments, one or more neutral lipids may include cholesterol, DOPE, DOPC, or a combination thereof. In some embodiments, one or more neutral lipids may include (1) cholesterol and (2) DOPE, DOPC, or a combination thereof.

[0074] In some embodiments, the lipid nanoparticles may contain 30 mol% to 65 mol% of one or more types of neutral lipids.

[0075] In some embodiments, the one or more neutral lipids are present in the lipid nanoparticles in an amount of at least 30 mol% (e.g., at least 35 mol%, at least 40 mol%, at least 45 mol%, at least 50 mol%, at least 55 mol%, or at least 60 mol%). In some embodiments, the one or more neutral lipids are present in the lipid nanoparticles in an amount of 65 mol% or less (e.g., 60 mol% or less, 55 mol% or less, 50 mol% or less, 45 mol% or less, 40 mol% or less, or 35 mol% or less).

[0076] One or more types of neutral lipids may be present in lipid nanoparticles in amounts ranging from any of the minimum to any of the maximum values ​​mentioned above. For example, in some embodiments, one or more types of neutral lipids are present in lipid nanoparticles in amounts of 30 mol% to 65 mol% (e.g., 35 mol% to 60 mol%, 40 mol% to 55 mol%, or 45 mol% to 50 mol%).

[0077] Suitable PEGylated lipids may include, but are not limited to, PEG-ditetradecylacetamide, PEG-myristoylglycerol diester, PEG-diacylglycerol, PEG-dialkoxypropyl, PEG-phospholipid, PEG-ceramide, PEG-DMG, PEG-DSPE, or any combination thereof. In some embodiments, one or more PEGylated lipids include 1,2-dimiristoyl-sn-glycero(DMG-PEG).

[0078] In some embodiments, the lipid nanoparticles may contain 2.5 mol% to 15 mol% of one or more PEGylated lipids. In some embodiments, one or more PEGylated lipids may be present in the lipid nanoparticles in an amount of at least 2.5 mol% (e.g., at least 5 mol%, at least 7.5 mol%, at least 10 mol%, or at least 12.5 mol%). In some embodiments, one or more PEGylated lipids may be present in the lipid nanoparticles in an amount of 15 mol% or less (e.g., 12.5 mol% or less, 10 mol% or less, 7.5 mol% or less, or 5 mol% or less).

[0079] One or more types of PEGylated lipids may be present in lipid nanoparticles in amounts ranging from any of the minimum to any of the maximum values ​​mentioned above. For example, in some embodiments, one or more types of PEGylated lipids may be present in lipid nanoparticles in amounts ranging from 2.5 mol% to 15 mol% (e.g., 2.5 mol% to 10 mol%, 2.5 mol% to 7.5 mol%, 2.5 mol% to 5 mol%, 5 mol% to 15 mol%, 5 mol% to 10 mol%, 5 mol% to 7.5 mol%, 7.5 mol% to 10 mol%, 7.5 mol% to 15 mol%, 7.5 mol% to 12.5 mol%, 10 mol% to 12.5 mol%, 10 mol% to 15 mol%, or 12.5 mol% to 15 mol%).

[0080] Suitable ionized lipids include N,N-dimethyl-2,3-dioleoyloxypropylamine (DODMA), [(4-hydroxybutyl)azadiyl]di(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315), 8-{(2-hydroxyethyl)[6-oxo-6-(undecyloxy)hexyl]amino}octanoic acid 9-heptadecyl ester (SM-102), and International Publication No. WO200. The ionized lipids may include, but are not limited to, DLin-MC3-DMA, DLin-KC2-DMA, DLinDMA, etc., as disclosed in publication 5 / 121348, DLin-K-DMA, etc., as disclosed in international publication WO2009 / 086558, 1-(2,3-bis(((9Z,12Z)-octadecenyl-9,12-dien-1-yl)oxy)propyl)pyrrolidine (A066), or any combination thereof. In some embodiments, one or more ionized lipids include N,N-dimethyl-2,3-dioleoyloxypropylamine (DODMA).

[0081] In some embodiments, the lipid nanoparticles may contain one or more ionized lipids in an amount of 30 mol% to 50 mol%. In some embodiments, one or more ionized lipids may be present in the lipid nanoparticles in an amount of at least 30 mol% (e.g., at least 35 mol%, at least 40 mol%, or at least 45 mol%). In some embodiments, one or more ionized lipids may be present in the lipid nanoparticles in an amount of 50 mol% or less (e.g., 45 mol% or less, 40 mol% or less, or 35 mol% or less).

[0082] One or more types of ionized lipids may be present in lipid nanoparticles in amounts ranging from any of the minimum to any of the maximum values ​​described above. For example, in some embodiments, one or more types of ionized lipids may be present in lipid nanoparticles in amounts of 30 mol% to 50 mol% (e.g., 30 mol% to 45 mol%, 30 mol% to 40 mol%, 30 mol% to 35 mol%, 35 mol% to 50 mol%, 35 mol% to 45 mol%, 35 mol% to 40 mol%, 40 mol% to 50 mol%, 40 mol% to 45 mol%, or 45 mol% to 50 mol%).

[0083] In some embodiments, the lipid nanoparticles include DOTAP, DODMA, DOPC, cholesterol, and DMG-PEG. In some embodiments, DOTAP, DODMA, DOPC, cholesterol, and DMG-PEG may be present in molar ratios of 5:40:25:20:10, 5:40:27.5:20:7.5, or 5:40:30:20:5. In some embodiments, DOTAP, DODMA, DOPC, cholesterol, and DMG-PEG may be present in molar ratios of 5:40:27.5:20:7.5.

[0084] In some embodiments, lipid nanoparticles and activators may be present in weight ratios of lipid nanoparticles to activators of 5:1 to 20:1, 7.5:1 to 15:1, 7.51:1 to 10:1, 7.5:1 to 12:1, 10:1 to 12:1, 10.1 to 15:1, or 12:1 to 15:1. In some embodiments, lipid nanoparticles and activators may be present in weight ratios of lipid nanoparticles to activators of 15:1, 12:1, 10:1, or 7.5:1.

[0085] In some embodiments, the composition may include a group of lipid nanoparticles, the average particle size of which, as measured by dynamic light scattering, is at least 50 nm (e.g., at least 60 nm, at least 70 nm, at least 75 nm, or at least 65 nm).

[0086] In some embodiments, the composition may include a group of lipid nanoparticles, the average particle size measured by dynamic light scattering being 80 nm or less (e.g., 75 nm or less, 70 nm or less, 65 nm or less, or 60 nm or less).

[0087] The composition may contain a group of lipid nanoparticles, the average particle size measured by dynamic light scattering being from any minimum to any maximum value above. For example, in some embodiments, the composition may contain a group of lipid nanoparticles, the average particle size measured by dynamic light scattering being 50 nm to 80 nm (e.g., 50 nm to 70 nm, 50 nm to 60 nm, 55 nm to 70 nm, 55 nm to 65 nm, 55 nm to 60 nm, 60 nm to 80 nm, 55 nm to 75 nm, 60 nm to 75 nm, 60 nm to 70 nm, 60 nm to 65 nm, 65 nm to 80 nm, 65 nm to 70 nm, 70 nm to 75 nm, 70 nm to 80 nm, or 75 nm to 80 nm). In some embodiments, the group of lipid nanoparticles may have an average particle size of about 55 nm measured by dynamic light scattering.

[0088] In some embodiments, the composition may include a group of lipid nanoparticles, the average zeta potential of which is at least -0.6mV (for example, at least -0.1mV, at least 0.5mV, at least 1mV, at least 1.5mV, or at least 2mV).

[0089] In some embodiments, the composition may contain a group of lipid nanoparticles, the average zeta potential of which is 2.5 mV or less (for example, 2 mV or less, 1.5 mV or less, 1 mV or less, 0.5 mV or less, 0.1 mV or less, or -0.1 mV or less).

[0090] The composition may also contain lipid nanoparticles, which have an average zeta potential ranging from any of the minimum values ​​to any of the maximum values ​​mentioned above. For example, in some embodiments, the composition may contain a group of lipid nanoparticles, the average zeta potential of which is -0.6mV to 2.5mV (e.g., -0.6mV to 2mV, -0.6mV to 1.5mV, -0.6mV to 1mV, -0.6mV to 0.5mV, -0.6mV to 0.1mV, -0.1mV to 2.5mV, -0.1mV to 2mV, -0.1mV to 1.5mV, -0.1mV to 1mV, -0.1mV to 0.5mV, 0.5mV to 2mV, 0.5mV to 1.5mV, 0.5mV to 1mV, 1mV to 2mV, 1mV to 1.5mV, 1.5mV to 2mV, 1.5mV to 2.5mV, or 2mV to 2.5mV). In some embodiments, the lipid nanoparticle group may have an average zeta potential of -5.5 mV.

[0091] In some embodiments, the composition may include a group of lipid nanoparticles having a polydispersity index (PDI) of at least 0.15 (e.g., at least 0.2, at least 0.25, at least 0.3, at least 0.35, at least 0.4, or at least 0.45).

[0092] In some embodiments, the composition may include a group of lipid nanoparticles having a polydispersity index (PDI) of 0.5 or less (e.g., 0.45 or less, 0.4 or less, 0.35 or less, 0.3 or less, 0.25 or less, 0.2 or less, or 0.15 or less).

[0093] The composition may include a group of lipid nanoparticles having a polydispersity index (PDI) ranging from any of the minimum to any of the maximum values ​​described above. For example, in some embodiments, the composition may include a group of lipid nanoparticles having a polydispersity index (PDI) of 0.15 to 0.5 (e.g., 0.15 to 0.4, 0.15 to 0.3, 0.15 to 0.2, 0.2 to 0.3, 0.2 to 0.5, 0.2 to 0.4, 0.2 to 0.3, 0.3 to 0.4, 0.3 to 0.5, or 0.4 to 0.5).

[0094] In some embodiments, lipid nanoparticles are dispersed in a pharmaceutically acceptable carrier.

[0095] "Pharmacopoeia acceptable carrier" (sometimes referred to as "carrier") means a carrier or excipient that can be used to prepare a drug or therapeutic composition that is normally safe and nontoxic, and includes carriers that can be accepted for veterinary and / or human drug or therapeutic use. The term "carrier" or "pharmacopoeia acceptable carrier" may include, but is not limited to, aqueous solutions of phosphate buffers, water, emulsions (e.g., oil / water or water / oil emulsions) and / or various wetting agents. As used herein, the term "carrier" includes, but is not limited to, any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer or other material used in drug formulations known in the art and further described herein.

[0096] "Excipients" include any and all solvents, diluents or other liquid media, dispersing or suspending aids, surfactants, isotonic agents, thickeners or emulsifiers, preservatives, solid binders, lubricants, etc., suitable for the desired specific dosage form. General considerations regarding formulation and / or manufacture are described below, for example, in Remington's Pharmaceutical Sciences, Sixteenth Edition, EW Martin (Mack Publishing Co., Easton, Pa., 1980) and Remington: The Science and Practice of Pharmacy, 21st Edition (Lippincott Williams & Wilkins, 2005).

[0097] Exemplary excipients include, but are not limited to, non-toxic, inert solid, semi-solid, or liquid fillers, diluents, encapsulating materials, or any type of preparation aid. Examples of materials that can be used as excipients include, but are not limited to, sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols such as propylene glycol; esters such as ethyl oleate and ethyl laurate; agar; cleaning agents such as Tween 80; buffers such as magnesium hydroxide and aluminum hydroxide; alginic acid; water free of pyrogens; isotonic saline; Ringer's solution; ethyl alcohol; and phosphate buffers, as well as other non-toxic compatible lubricants such as sodium lauryl sulfate and magnesium stearate; and colorants, release agents, coating agents, sweeteners, flavoring agents, and fragrances. Preservatives and antioxidants may also be present in the composition at the discretion of the compounder. As will be understood by those skilled in the art, excipients may be selected depending on the intended use of the composition. For example, in the case of pharmaceutical compositions, the selection of excipients depends on the route of administration, the drug to be delivered, the time course of drug delivery, etc., and the composition may be administered to humans and / or animals orally, rectally, parenterally, intracisionally, vaginally, intranasally, intraperitoneally, topically (e.g., by powder, cream, ointment, or infusion), orally, or as an oral or nasal spray. In some examples, the active compounds disclosed herein are administered topically.

[0098] Exemplary diluents include calcium carbonate, sodium carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate, calcium hydrogen phosphate, sodium phosphate, lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, inositol, sodium chloride, dry starch, corn starch, powdered sugar, and combinations thereof.

[0099] Examples of granulating and / or dispersing agents include potato starch, corn starch, tapioca starch, sodium glycolate starch, clay, alginic acid, guar gum, citrus pulp, agar, bentonite, cellulose and wood products, natural sponges, cation exchange resins, calcium carbonate, silicates, sodium carbonate, cross-linked polyvinylpyrrolidone (crospovidone), sodium carboxymethyl starch (sodium glycolate starch), carboxymethylcellulose, cross-linked sodium carboxymethylcellulose (croscarmellose), methylcellulose, pregelatinized starch (starch 1500), microcrystalline starch, water-insoluble starch, calcium carboxymethylcellulose, magnesium aluminum silicate (Veegum), sodium lauryl sulfate, quaternary ammonium compounds, and combinations thereof.

[0100] Examples of surfactants and / or emulsifiers include natural emulsifiers (e.g., acacia, agar, alginic acid, sodium alginate, tragacanth, chondrux, cholesterol, xanthan gum, pectin, gelatin, egg yolk, casein, lanolin, cholesterol, wax, lecithin), colloidal clays (e.g., bentonite [aluminum silicate], beegum [magnesium aluminum silicate]), long-chain amino acid derivatives, high molecular weight alcohols (e.g., stearyl alcohol, cetyl alcohol, oleyl alcohol, triacetylglycerol, monostearate, ethylene glycol) Distearate, glyceryl monostearate, propylene glycol monostearate, polyvinyl alcohol), carbomer (e.g., carboxypolymethylene, polyacrylic acid, acrylic acid polymer, carboxyvinyl polymer), carrageenan, cellulose derivatives (e.g., sodium carboxymethylcellulose, powdered cellulose, hydroxymethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, methylcellulose), sorbitan fatty acid esters (e.g., polyoxyethylene sorbitan monolaurate [Tween 20], polyoxyethylene sorbitan [Tween 60], polyoxyethylene sorbitan monooleate [Tween 80], sorbitan monopalmitate [Span 40], sorbitan monostearate [Span 60], sorbitan tristearate [Span 65], glyceryl monooleate, sorbitan monooleate [Span

[80] ), polyoxyethylene esters (e.g., polyoxyethylene monostearate [Myrj45], polyoxyethylene hydrogenated castor oil, polyethoxylated castor oil, polyoxymethylene stearate, Solutol), sucrose fatty acid esters, polyethylene glycol fatty acid esters (e.g., Cremophor), polyoxyethylene ethers (e.g., polyoxyethylene lauryl ether [Brij30]), poly(vinylpyrrolidone), diethylene glycol monolaurate, triethanolamine oleate, sodium oleate, potassium oleate, ethyl oleate, oleic acid, ethyl laurate, sodium lauryl sulfate, Pluronic F-68, Poloxamer-188, cetrimonium bromide, cetylpyridinium chloride, benzalkonium chloride This includes docusate sodium ((alcohol), and / or combinations thereof.)

[0101] Exemplary binders include starches (e.g., corn starch and starch paste), gelatin, sugars (e.g., sucrose, glucose, dextrose, dextrin, molasses, lactose, lactitol, mannitol, etc.), natural and synthetic gums (e.g., acacia, sodium alginate, Irish moss extract, panwar gum, ghatti gum, mucilage of isapol husks, carboxymethylcellulose, methylcellulose, ethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, microcrystalline cellulose, cellulose acetate, poly(vinylpyrrolidone), magnesium aluminum silicate (bee gum), and larch alabogalactan), alginates, polyethylene oxide, polyethylene glycol, inorganic calcium salts, silicic acid, polymethacrylate, waxes, water, alcohol, etc., and / or combinations thereof.

[0102] Examples of preservatives include antioxidants, chelating agents, antimicrobial preservatives, antifungal preservatives, alcohol preservatives, acidic preservatives, and other preservatives.

[0103] Exemplary antioxidants include α-tocopherol, ascorbic acid, ascorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, monothioglycerol, potassium metabisulfite, propionic acid, propyl gallate, sodium ascorbate, sodium bisulfite, sodium metabisulfite, and sodium sulfite.

[0104] Examples of chelating agents include ethylenediaminetetraacetic acid (EDTA) and its salts and hydrates (e.g., sodium edetate, disodium edetate, trisodium edetate, calcium disodium edetate, dipotassium edetate, etc.), citric acid and its salts and hydrates (e.g., citric acid monohydrate), fumaric acid and its salts and hydrates, malic acid and its salts and hydrates, phosphoric acid and its salts and hydrates, and tartaric acid and its salts and hydrates.

[0105] Exemplary antimicrobial preservatives include benzalkonium chloride, benzethonium chloride, benzyl alcohol, bronopol, cetrimide, cetylpyridinium chloride, chlorhexidine, chlorobutanol, chlorocresol, chloroxylenol, cresol, ethyl alcohol, glycerin, hexetidine, imidourea, phenol, phenoxyethanol, phenylethyl alcohol, phenylmercury nitrate, propylene glycol, and thimerosal.

[0106] Exemplary antifungal preservatives include butylparaben, methylparaben, ethylparaben, propylparaben, benzoic acid, hydroxybenzoic acid, potassium benzoate, potassium sorbate, sodium benzoate, sodium propionate, and sorbic acid.

[0107] Exemplary alcohol preservatives include ethanol, polyethylene glycol, phenol, phenolic compounds, bisphenol, chlorobutanol, hydroxybenzoic acid esters, and phenylethyl alcohol.

[0108] Exemplary acidic preservatives include vitamin A, vitamin C, vitamin E, beta-carotene, citric acid, acetic acid, dehydroacetic acid, ascorbic acid, sorbic acid, and phytic acid. Other preservatives include tocopherol, tocopherol acetate, deferoxamine mesylate, cetrimide, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), ethylenediamine, sodium lauryl sulfate (SLS), sodium lauryl ether sulfate (SLES), sodium bisulfite, sodium metabisulfite, potassium sulfite, potassium metabisulfite, Glydant Plus, Phenonip, methylparaben, Germall 115, Germaben II, Neolone, Kathon, and Euxyl. In certain embodiments, the preservative is an antioxidant. In other embodiments, the preservative is a chelating agent.

[0109] Exemplary buffers include citrate buffer, acetate buffer, phosphate buffer, ammonium chloride, calcium carbonate, calcium chloride, calcium citrate, calcium glubionate, calcium gluceptate, calcium gluconate, D-gluconic acid, calcium glycerophosphate, calcium lactate, propionic acid, calcium levulinate, pentanoic acid, dibasic calcium phosphate, phosphoric acid, tribasic calcium phosphate, calcium hydroxide phosphate, potassium acetate, potassium chloride, potassium gluconate, potassium mixtures, dibasic potassium phosphate, monobasic potassium phosphate, potassium phosphate mixtures, sodium acetate, sodium bicarbonate, sodium chloride, sodium citrate, sodium lactate, dibasic sodium phosphate, monobasic sodium phosphate, sodium phosphate mixtures, tromethamine, magnesium hydroxide, aluminum hydroxide, alginic acid, water without pyrogens, isotonic saline, Ringer's solution, ethyl alcohol, and combinations thereof.

[0110] Exemplary lubricants include magnesium stearate, calcium stearate, stearic acid, silica, talc, malt, glyceryl behanate, hydrogenated vegetable oil, polyethylene glycol, sodium benzoate, sodium acetate, sodium chloride, leucine, magnesium lauryl sulfate, sodium lauryl sulfate, and combinations thereof.

[0111] Examples of natural oils include almond, apricot kernel, avocado, babassu, bergamot, blackcurrant seed, borage, cade, chamomile, canola, caraway, carnauba, castor oil, cinnamon, cocoa butter, coconut, taral liver, coffee, corn, cottonseed, emu, eucalyptus, evening primrose, fish, flaxseed, geraniol, gourd, grape seed, hazelnut, hyssop, isopropyl myristate, jojoba, kukui nut, lavandin, This includes oils from lavender, lemon, litsea cubeba, macadamia nuts, mallow, mango seeds, meadowfoam seeds, mink, nutmeg, olive, orange, orange roughy, palm, palm kernel, peach kernel, peanut, poppy seeds, pumpkin seeds, rapeseed, rice bran, rosemary, safflower, sandalwood, susquana, savory, sea buckthorn, sesame, shea butter, silicone, soy, sunflower, tea tree, thistle, camellia, vetiver, walnut, and wheat germ. Exemplary synthetic oils include, but are not limited to, butyl stearate, caprylic triglyceride, capric triglyceride, cyclomethicone, diethyl sebacate, dimethicone 360, isopropyl myristic acid, mineral oil, octyldodecanol, oleyl alcohol, silicone oil, and combinations thereof.

[0112] Liquid compositions include emulsions, microemulsions, solutions, suspensions, syrups, and elixirs. In addition to the active compound, the liquid composition may also contain inert diluents commonly used in the art, such as water or other solvents, ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (especially cottonseed oil, peanut oil, corn oil, germ oil, olive oil, castor oil, and sesame oil), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycol, and fatty acid esters of sorbitan, and mixtures thereof. In addition to inert diluents, oral compositions may also contain auxiliary agents such as wetting agents, emulsifiers, suspending agents, sweeteners, flavoring agents, and fragrances.

[0113] Injectable compositions (e.g., aqueous or oily suspensions for injection) can be formulated according to known techniques using appropriate dispersants or wetting agents and suspending agents. Sterile injectable formulations may be injectable solutions, suspensions, or emulsions in non-toxic, parenterally acceptable diluents or solvents, such as 1,3-butanediol solution. Acceptable media and solvents that can be used in pharmaceutical or cosmetic compositions include water, Ringer's solution, USP, and isotonic sodium chloride solution. Sterile fixatives have also been conventionally used as solvents or suspension media. Any non-irritating fixative, including synthetic monoglycerides and diglycerides, can be used. Fatty acids, such as oleic acid, can also be used in the preparation of injectable formulations. In certain embodiments, particles are suspended in a carrier fluid containing 1% (w / v) sodium carboxymethylcellulose and 0.1% (v / v) Tween 80. The injectable composition can be sterilized, for example, by filtration through a bacterial-retaining filter, or by incorporating a sterilizing agent in the form of a sterile solid composition that can be dissolved or dispersed in sterile water or other sterile injectable medium before use.

[0114] Solid compositions include capsules, tablets, pills, powders, and granules. In such solid compositions, particles are mixed with at least one excipient and / or (a) fillers or bulking agents such as starch, lactose, sucrose, glucose, mannitol, and silicic acid; (b) binders such as carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidone, sucrose, and acacia; (c) humectants such as glycerol; (d) disintegrants such as agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; (e) dissolution retarders such as paraffin; (f) absorption enhancers such as quaternary ammonium compounds; (g) wetting agents such as cetyl alcohol and glycerol monostearate; (h) absorbents such as kaolin and bentonite clay; and (i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium lauryl sulfate, and mixtures thereof. In the case of capsules, tablets, and pills, the dosage form may also include a buffer. Similar types of solid compositions can also be used as fillers for flexible and rigid gelatin capsules, using excipients such as lactose or milk sugar and high molecular weight polyethylene glycol.

[0115] Tablets, capsules, pills, and granules can be prepared using coatings and shells, such as enteric coatings and other coatings well known in the field of pharmaceutical formulations. The dosage forms may optionally contain opacifying agents and may be composed to optionally release the active ingredient only to or preferentially to specific parts of the intestinal tract in a delayed manner. Examples of usable embedding compositions include polymeric substances and waxes. Similar types of solid compositions can also be used as fillers for soft-filled and hard-filled gelatin capsules using excipients such as lactose or milk sugar and high molecular weight polyethylene glycol.

[0116] Compositions for topical or transdermal administration include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, or patches. The active compound is mixed with excipients and necessary preservatives and buffers as needed.

[0117] In addition to the active compound, ointments, pastes, creams, and gels may contain excipients such as animal and vegetable fats, oils, waxes, paraffin, starch, tragacanth, cellulose derivatives, polyethylene glycol, silicone, bentonite, silicic acid, talc, zinc oxide, or mixtures thereof.

[0118] In addition to the active compound, the powder or spray may contain excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicate, polyamide powder, or mixtures of these substances. The spray may also contain common propellants such as chlorofluorohydrocarbons.

[0119] Transdermal patches also offer the advantage of controlled in vivo delivery of compounds. Such dosage forms can be prepared by dissolving or distributing nanoparticles in a suitable medium. Absorption enhancers can also be used to increase the influx of compounds through the skin. The rate can be controlled by providing a rate-controlling membrane or by dispersing the particles in a polymer matrix or gel.

[0120] How to use This specification also describes methods for treating cancer, preventing cancer, preventing cancer metastasis, preventing cancer recurrence, or preventing angiogenesis. In some embodiments, such methods may include administering the pharmaceutical compositions described herein to a subject in need. In some embodiments, the cancer may be hepatocellular carcinoma.

[0121] The compositions used in the methods described herein may be administered by any suitable methods and techniques currently or hereafter known to those skilled in the art. For example, the active ingredients described herein may be formulated in physiologically or pharmaceutically acceptable forms and administered by any suitable route known in the art, including, for example, oral and parenteral administration routes. As used herein, the term “parenteral” includes subcutaneous, intradermal, intravenous, intramuscular, intraperitoneal, and intrasternal administration, such as by injection. The activator may be administered by any route. In some examples, the activator is administered by a variety of routes, including oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, subcutaneous, intraventricular, percutaneous, interdermal, rectal, vaginal, intraperitoneal, topical (e.g., by powder, ointment, cream, and / or eye drops), mucosal, nasal, buccal, enteral, sublingual, intratracheal infusion, bronchial infusion, and / or inhalation, and / or oral spray, nasal spray, and / or aerosol. Generally, the most appropriate route of administration varies depending on various factors, such as the properties of the active ingredient (e.g., stability in the gastrointestinal environment) and the subject's condition (e.g., whether the subject can tolerate oral administration). The administration of the active ingredient of the composition can be a single dose or administered at continuous and clearly defined intervals, as can be easily determined by those skilled in the art.

[0122] In certain embodiments, it may be desirable to deliver one or more compounds sequentially to patients who require them. For intravenous or intra-arterial routes, this can be achieved using infusion systems such as intravenous administration. For topical applications, the compound can be applied repeatedly or administered continuously over a long period using patches.

[0123] The active ingredient may be administered in the amount, time, and route deemed necessary to achieve the desired outcome. The exact amount of the active ingredient will vary from subject to subject, depending on the subject's species, age, general condition, severity of infection, specific active ingredient, method of administration, mode of activity, etc. For ease of administration and dose uniformity, the active ingredient, whether as the active compound itself or in combination with other drugs, is preferably formulated in dose unit form. However, the total daily dose of the active ingredient is understood to be determined by the attending physician within the bounds of appropriate medical judgment. A specific therapeutically effective dose level for a particular subject will vary depending on various factors, including the disease being treated and its severity, the activity of the active ingredient used, the specific composition used, the patient's age, weight, general health, sex, diet, administration time, route of administration, excretion rate of the specific active ingredient used, duration of treatment, drugs used in combination with or concurrently with the specific active ingredient used, and similar factors well known in the medical field.

[0124] The exact amount of "active ingredient" required to achieve a therapeutic or prophylactic effective dose varies from subject to subject, depending on the subject's species, age, and overall condition, the severity of side effects or disorders, the identity of the specific compound, and the method of administration. For example, the dose administered to children or adolescents is determined by a physician or person skilled in the art and may be less than or equal to the dose administered to adults.

[0125] Useful doses of the compositions disclosed herein can be determined by comparing their in vitro and in vivo activities in animal models. Methods for extrapolating effective doses in mice and other animals to humans are known in the art.

[0126] The dosage range for administering a composition is sufficient to produce the desired effect that affects the symptoms or disorder. The dosage should not be so high that it causes adverse side effects such as undesirable cross-reactions or anaphylactic reactions. Typically, the dosage varies depending on the patient's age, condition, sex, and the severity of the disease, and can be determined by those skilled in the art. If there are contraindications, the individual physician may adjust the dosage. The dosage can be varied and may be administered once or in multiple doses over one or several days.

[0127] In some embodiments, the compositions described herein may be administered in combination with additional activators or therapies.

[0128] Activating agent As used herein, “activator” means a therapeutic, diagnostic, or prophylactic agent. As discussed herein, therapeutic agents may be released from the disclosed compounds, compositions, and systems in a biologically active form.

[0129] Furthermore, as used herein, the term “therapeutic agent” is understood to mean one or more therapeutic agents, active ingredients, or substances that can be used to treat a medical condition. Therapeutic agents include compositions of synthetic or naturally occurring bioactive compounds or substances that, when administered to a living organism (human or non-human animal), induce a desired pharmacological, immunogenic, and / or physiological effect by local and / or systemic action. Thus, this term includes compounds or chemical substances that have traditionally been considered drugs, vaccines, or biopharmaceuticals, including molecules such as proteins, peptides, hormones, nucleic acids, and gene constructs. Examples of therapeutic agents are listed in well-known literature such as the Merck Index (14th edition), Physicians' Desk Reference (64th edition), and The Pharmacological Basis of Therapeutics (12th edition), and include, but are not limited to, pharmaceuticals; vitamins and minerals such as essential amino acids, calcium, iron, potassium, zinc, and vitamin B12; substances used to treat, prevent, diagnose, cure, or alleviate diseases or illnesses; substances that affect the structure or function of the body, or prodrugs that become biologically active or more active after being placed in a physiological environment. For example, the term "therapeutic agent" includes adjuvants; antibacterial agents (including antibiotics, antivirals, antiparasitic agents, and antifungal agents), anti-inflammatory agents (including steroids and non-steroidal anti-inflammatory drugs), anticoagulants, eye drops, gastrointestinal drugs, antiplatelet agents, disinfectants, steroids, antitumor agents, anticancer agents, antigens, antibodies, contraceptives, progesterones, anticholinergics, nutritional supplements, analgesics and combinations of analgesics such as acetaminophen and acetylsalicylic acid; anesthetics such as lidocaine and xylocaine, appetite suppressants such as dexadrine and fendimethrazine tartrate; antiepileptic drugs, topical and general anesthetics, hypnotics, sedatives, antipsychotics, nerve blockers, and antidepressants (such as isocarboxide and amoxapine);Anxiolytics, antagonists, neuronal blockers, anticholinergics and cholinergics, antimuscarinic and muscarinic drugs, antiparkinsonian drugs, anti-Alzheimer's drugs, anti-adrenergic drugs, antiarrhythmics, antihypertensive drugs, hormones (e.g., insulin, progestins, estrogen, corticoids, glucocorticoids, androgens); nutrients, antiarthritis drugs such as methylprednisolone and ibuprofen; terbutaline sulfate, theophilic acid Antiasthmatic drugs such as ephedrine; anticonvulsants such as phenytoin sodium and diazepam; antiallergic drugs and antihistamines such as diphenhydramine hydrochloride and chlorpheniramine maleate; antiemetics, antitumor drugs, antipruritics, and antipyretics; anticonvulsants such as belladonna alkaloids and dicyclomine hydrochloride; prazosin hydrochloride, nitroglycerin, propranolol hydrochloride, hydralazine hydrochloride, pancrelipase, and succinate dehydrogenase. Cardiovascular drugs such as enzymes; vasoactive agents, cardiovascular preparations (including calcium channel blockers, beta-blockers, beta-agonists, and antiarrhythmics), antihypertensives, diuretics such as furosemide and spironolactone; vasodilators; central nervous system stimulants; cough suppressants and cold medicines; decongestants; diagnostic agents; bone growth stimulants and bone resorption inhibitors; muscle relaxants; psychostimulants; sedatives; such as thorazine, diazepam, chlorpromazine hydrochloride, reserpine, and chlordiazepoxide hydrochloride. Tranquilizers; anti-ulcer drugs such as lancidin hydrochloride and cimetidine hydrochloride; anti-asthma drugs, antidiarrheals, anti-obesity drugs, antithrombotic drugs, antitussives, antiuricemia drugs, anti-angina drugs, appetite suppressants, expectorants, hyperglycemia drugs, hypoglycemia drugs, thyroid drugs and antithyroid drugs, tissue growth agents, uterine relaxants, immunomodulators (including cytokines, interleukins, interferons, colony-stimulating factors, tumor necrosis factors, etc.); immunosuppressants such as rapamycin and tacrolimus; immunological agents;Antigens, factors, growth factors, amino acids, peptides and proteins, and their fragments (whether naturally occurring, chemically synthesized or recombinant), such as LHRH, somatostatin, calcitonin, growth hormone, glucagon-like peptides, growth release factors, angiotensin, FSH, EGF, bone morphogenetic protein (BMP), erythropoietin (EPO), interferon, interleukin, collagen, fibrinogen, insulin, factor VIII, factor IX, Enbrel®, Rituxam®, Herceptin®, α-glucosidase, etc. This includes, but is not limited to, Cerazyme / Ceredose®, vasopressin, ACTH, human serum albumin, gamma globulin, structural proteins, blood product proteins, complex proteins, antigens or antigen polypeptides, enzymes, antibodies, monoclonal antibodies, etc.; nucleic acid molecules (polymeric forms of two or more nucleotides, polynucleotides, ribonucleotides (RNA) or deoxyribonucleotides (DNA) including both double-stranded and single-stranded molecules, gene constructs, expression vectors, antisense molecules, etc.), small molecules (e.g., doxorubicin), and other bioactive macromolecules such as proteins and enzymes. This agent may be a bioactive agent used in medical (including veterinary) applications, agriculture (e.g., plants), and other fields. In certain embodiments of this disclosure, the agent delivered may be a mixture of activators.

[0130] Typical examples of antibiotics include amikacin, amoxicillin, ampicillin, atovaquone, azithromycin, aztreonam, bacitracin, carbenicillin, cefadroxil, cefazolin, cefdinir, cefditoren, cefepime, cefiderol, cefoperazone, cefotetan, cefoxitin, cefotaxime, cefpodoxime, cefprodil, cephthaloline, ceftazidime, ceftibutene, and ceftizo Xim, ceftriaxone, chloramphenicol, colistimetamethasone, cefuroxime, cephalexin, cefradiin, cilastatin, cinoxacin, ciprofloxacin, clarithromycin, clindamycin, dalbavancin, dalphopristine, daptomycin, demeclocycline, dicloxacillin, doripenem, doxycycline, ellabacycline, ertapenem, erythromycin, fidaxomycin Syn, fosfomycin, gatifloxacin, gemifloxacin, gentamicin, imipenem, refamulin, lincomycin, linezolid, lomefloxacin, loracalbef, meropenem, metronidazole, minocycline, moxifloxacin, nafcillin, nalidixic acid, neomycin, norfloxacin, ofloxacin, omadacycline, oritabancin, oxacillin, oxytetracycline, paro This includes momycin, penicillin, pentamidine, piperacillin, prazomycin, quinupristin, rifaximin, thalecycline, secnidazole, sparfloxacin, spectinomycin, sulfamethoxazole, sulfisoxazole, tedizolid, telavancin, telithromycin, ticarcillin, tigecycline, tobramycin, trimethoprim, trovafloxacin, and vancomycin.

[0131] Typical examples of antiviral drugs include abacavir, acyclovir, adefovir, amantadine, amprenavir, atazanavir, paravir, baloxavir, marboxil, boceprevir, cidofovir, cobicistat, daclatasvir, darunavir, delavirdin, didanosine, docasanol, dolutegravir, doravirine, ecoliever, edoxudine, efavirenz, elvitegravir, emtricitabine, and erythrocytes. Fubirtide, Entecavir, Etravirine, Famciclovir, Homivirsen, Fosamprenavir, Forscarnet, Fosnonet, Famciclovir, Favipravir, Homivirsen, Foscavir, Ganciclovir, Ibasitabine, Idoxuridine, Indinavir, Inosine, Inosine Pranobex, Interferon type I, Interferon type II, Interferon type III, La Mivudine, letermovir, letermovir, lopinavir, roviride, maraviroc, methisazone, moloxidine, nelfinavir, nevirapine, nitazoxanide, oseltamivir, pegylated interferon α-2a, pegylated interferon α-2b, penciclovir, peramivir, preconalil, podophyllotoxin, pyramidine, raltegravir, remdesevir, ribavirin, rilpivirine, rimantadine, lintadine This includes, but is not limited to, limod, mornupiravir, ritonavir, saquinavir, simeprevir, sofosbuvir, stabudine, tarabivirin, telaprevir, terbivudine, tenofovir alafenamide, tenofovir disoproxil, tenofovir, tipranavir, trifluridine, trizivir, tromantadine, umifenovir, valacyclovir, valganciclovir, vidarabine, zalcitabine, zanamivir, and zidovudine.

[0132] Typical examples of anticoagulants include, but are not limited to, heparin, warfarin, rivaroxaban, dabigatran, apixaban, edoxaban, enoxaparin, and fondaparinux.

[0133] Typical examples of antiplatelet agents include, but are not limited to, clopidogrel, ticagrelor, prasugrel, dipyridamole, dipyridamole / aspirin, ticlopidine, and eptifivatide.

[0134] Typical examples of antifungal agents include, but are not limited to, voriconazole, itraconazole, posaconazole, fluconazole, ketoconazole, clotrimazole, isabconazonium, miconazole, caspofungin, anidurafungin, micafungin, griseofulvin, terbinafine, flucytosine, terbinafine, nystatin, and amphotericin b.

[0135] Typical examples of steroidal anti-inflammatory drugs include, but are not limited to, hydrocortisone, dexamethasone, prednisolone, prednisone, triamcinolone, methylprednisolone, budesonide, betamethasone, cortisone, and deflazacort. Typical examples of nonsteroidal anti-inflammatory drugs include, but are not limited to, ibuprofen, naproxen, ketoprofen, tolmetin, etodolac, fenoprofen, flurbiprofen, diclofenac, piroxicam, indomethacin, sulindax, meloxicam, nabumetone, oxaprozin, mefenamic acid, and diflunisal.

[0136] Other examples of activators include chloroquine, hydroxychloroquine, pyridoxal phosphate, vitamin D, and vitamin C.

[0137] Typical examples of anti-cytokine agents or immunomodulators include, but are not limited to, tocilizumab, sarilumab, bevacizumab, fingolimod, imiquimod, and eculizumab.

[0138] Typical examples of contraceptives include, but are not limited to, progestins, estrogens, or combinations thereof. For example, suitable progestins include, but are not limited to, natural and synthetic compounds with progesterone activity, such as progesterone, chlormadinone acetate, norethindrone, cyproterone acetate, norethindrone acetate, desogestrel, levonorgestrel, drospirenone, trimegestone, norgestrel, norgestrimate, norrellegestromine, etonogestrel, gestodene, and other natural and / or synthetic gestagens. For example, suitable estrogens include, but are not limited to, natural and synthetic compounds with estrogen activity, such as estradiol (17β-estradiol), 17α-estradiol, estriol, estrone, and their esters, such as acetate, sulfate, valerate, or benzoate esters of these compounds (e.g., including estradiol 17β-cypionate, estradiol 17-propionate, estradiol 3-benzoate, and piperazine estrone sulfate); ethinylestradiol; conjugated estrogens (natural and synthetic); mestranol; agonist anti-estrogens; and selective estrogen receptor modulators. Other examples of contraceptives include gonodotropin-releasing hormone (GnRh) or its analogues, such as deslorerin, avorerin, leuprolide, triptorelin, nafarelin, goserelin, buserelin, and fertilelin.

[0139] The term "steroid" refers to compounds belonging to or related to the following families of compounds, including corticosteroids, mineral steroids, and sex steroids (e.g., potentially androgenic or estrogenic, or antiandrogenic and anti-estrogenic molecules). These include, for example, prednisone, prednisolone, methylprednisolone, triamcinolone, fluocinolone, aldosterone, spironolactone, and danazol (also known as Optina). In some embodiments, the therapeutic agent may include a steroid.

[0140] Exemplary cancer treatments or anticancer agents include, but are not limited to, antimetabolite anticancer agents, antimitotic anticancer agents, and combinations thereof. Various antimetabolites and antimitotic anticancer agents (including single or combinations thereof) can be used in the methods and compositions described herein.

[0141] Antimetabolites (ANMTs) are typically structurally similar to natural metabolites involved in the normal metabolic processes of cancer cells, such as the synthesis of nucleic acids and proteins. However, because antimetabolites differ significantly from natural metabolites, they inhibit the metabolic processes of cancer cells. Within cells, antimetabolites are mistaken for similar metabolites and processed by cells in the same way as normal compounds. The presence of these "decoy" metabolites prevents cells from performing essential functions, and the cells are unable to grow or survive. For example, antimetabolites can exert cytotoxic activity by replacing these incorrect nucleotides in the cell's DNA, thereby interfering with cell division, or by inhibiting important cellular enzymes, thereby hindering DNA replication.

[0142] Therefore, in one embodiment, antimetabolites are nucleotides or nucleotide analogs. In certain embodiments, for example, the antimetabolite may include purines (e.g., guanine or adenosine) or analogs with or without a sugar moiety, or pyrimidines (cytidine or thymidine) or analogs.

[0143] Antimetabolites suitable for use in this disclosure can typically be classified according to the metabolic process they affect and may include, but are not limited to, analogs and derivatives of folate, pyrimidine, purine, and cytidine. In one embodiment, the antimetabolites are selected from the group consisting of cytidine analogs, folate analogs, purine analogs, pyrimidine analogs, and combinations thereof.

[0144] In certain embodiments, for example, the antimetabolite is a cytidine analog. In this embodiment, for example, the cytidine analog may be selected from the group consisting of cytarabine (cytosine arabinoside), azacitidine (5-azacitidine), and their salts, analogs, and derivatives.

[0145] In another specific embodiment, for example, antimetabolites are folate analogs. Folate analogs or folate antagonists typically function by inhibiting dihydrofolate reductase (DHFR), an enzyme involved in nucleotide formation. When this enzyme is inhibited, nucleotides are not formed, and DNA replication and cell division are inhibited. In a particular embodiment, for example, folate analogs may be selected from the group consisting of denopterin, methotrexate (ametopterin), pemetrexed, pteropterin, larcitrexed, trimethrexate, and their salts, analogs, and derivatives.

[0146] In another specific embodiment, for example, antimetabolites are purine analogs. Purine-based antimetabolites work by inhibiting DNA synthesis, such as by suppressing the production of purines containing nucleotides, adenine, and guanine, thereby stopping DNA synthesis and thus stopping cell division. Purine analogs can also be incorporated into the DNA molecule itself during DNA synthesis, potentially interfering with cell division. In certain embodiments, for example, the purine analog may be selected from the group consisting of acyclovir, allopurinol, 2-aminoadenosine, arabinosyladenine (ara-A), azacitidine, azatipurine, 8-azaadenosine, 8-fluoroadenosine, 8-methoxyadenosine, 8-oxoadenosine, cladribine, deoxycoformycin, fludarabine, ganciclovir, 8-azaguanosine, 8-fluoroguanosine, 8-methoxyguanosine, 8-oxoguanosine, guanosine diphosphate, guanosine diphosphate-β-L-2-aminofucose, guanosine diphosphate-D-arabinose, guanosine diphosphate-2-fluorofucose, guanosine diphosphate fucose, mercaptopurine (6-MP), pentostatin, thiamipurine, thioguanine (6-TG), and their salts, analogs, and derivatives.

[0147] In yet another specific embodiment, for example, antimetabolites are pyrimidine analogs. Similar to the purine analogs described above, pyrimidine-based antimetabolites inhibit the synthesis of pyrimidine-containing nucleotides (cytosine and thymine in DNA, and cytosine and uracil in RNA). Pyrimidine-based compounds can act as a "decoy" to prevent nucleotide production and / or be incorporated into a growing DNA strand to induce its termination. In certain embodiments, for example, pyrimidine analogs include ancitabine, azacitidine, 6-azauridine, bromouracil (e.g., 5-bromouracil), capecitabine, carmofur, chlorouracil (e.g., 5-chlorouracil), cytarabine (cytosine arabinoside), cytosine, dideoxyuridine, 3'-azide-3'-deoxythymidine, 3'-dideoxycytidine-2'-ene, 3'-deoxy-3'-deoxythymidine-2'-ene, and dihydrouracil. The pyrimidine analogs can be selected from the group consisting of syl, doxyfluridine, enocitabine, phloxuridine, 5-fluorocytosine, 2-fluorodeoxycytidine, 3-fluoro-3'-deoxythymidine, fluorouracil (e.g., 5-fluorouracil (also known as 5-FU)), gemcitabine, 5-methylcytosine, 5-propynylcytosine, 5-propynylthymine, 5-propynyluracil, thymine, uracil, uridine, and their salts, analogs, and derivatives. In one embodiment, the pyrimidine analog is anything other than 5-fluorouracil. In another embodiment, the pyrimidine analog is gemcitabine or a salt thereof.

[0148] In certain embodiments, the antimetabolite is selected from the group consisting of 5-fluorouracil, capecitabine, 6-mercaptopurine, methotrexate, gemcitabine, cytarabine, fludarabine, pemetrexed, and their salts, analogs, derivatives, and combinations. In other embodiments, the antimetabolite is selected from the group consisting of capecitabine, 6-mercaptopurine, methotrexate, gemcitabine, cytarabine, fludarabine, pemetrexed, and their salts, analogs, derivatives, and combinations. In a particular embodiment, the antimetabolite is something other than 5-fluorouracil. In a particularly preferred embodiment, the antimetabolite is gemcitabine or a salt thereof (e.g., gemcitabine hydrochloride (Gemzar®)).

[0149] Other antimetabolite anticancer drugs include Acanthi folic acid, aminothiadiazole, Brekinal sodium, Ciba-Geigy CGP-30694, cyclopentylcytosine, cytarabine phosphate stearate, cytarabine conjugate, Lilly DATHF, Merrel Dow DDFC, desaguanine, dideoxycytidine, dideoxyguanosine, didox, Yoshitomi DMDC, Wellcome EHNA, Merck & Co. EX-015, fazarabine, fludarabine phosphate, N-(2'-flanidyl)-5-fluorouracil, and Daiichi Seiyaku FO-152. The following substances may be selected, but are not limited to, those listed above: FO-152), 5-FU-fibrinogen, isopropylpyrrolidine, Lilly LY-188011 (Lilly LY-188011); Lilly LY-264618, metobenzaprim, Wellcome MZPES, norspermidine, NCI NSC-127716, NCI NSC-264880, NCI NSC-39661, NCI NSC-612567, Warner-Lambert PALA, pentostatin, pyritrexime, plicamycin, Asahi Chemical PL-AC, Takeda TAC-788, thiazophrine, Erbamont TIF, tyrosine kinase inhibitors, Taiho UFT, uricin, etc.

[0150] In one embodiment, the anti-mitotic anticancer agent is a microtubule inhibitor or microtubule stabilizer. Generally, microtubule stabilizers such as taxanes and epothirones enhance microtubule assembly by binding to the inner surface of β-microtubule chains, promoting the nucleation and elongation steps of the polymerization reaction, and lowering the critical tubulin subunit concentration required for microtubule assembly. Unlike microtubule inhibitors (e.g., vinca alkaloids) that hinder microtubule assembly, microtubule stabilizers (e.g., taxanes) shorten the delay time and dramatically shift the dynamic equilibrium between tubulin dimers and microtubule polymers toward polymerization. Therefore, in one embodiment, the microtubule stabilizer is a taxane or epothirone. In another embodiment, the microtubule inhibitor is a vinca alkaloid.

[0151] In some embodiments, the therapeutic agent may include a taxane or a derivative or analog thereof. The taxane may be a naturally occurring compound or a related form having antitumor properties, or a chemically synthesized compound or a derivative thereof. Taxanes are a group of terpenes and include, but are not limited to, paclitaxel (Taxol®) and docetaxel (Taxotere®). These are mainly extracted from the Pacific yew tree, Taxus brevifolia, and are active against certain tumors, particularly breast cancer and ovarian cancer. In one embodiment, the taxane is docetaxel or paclitaxel. Paclitaxel is a preferred taxane and is considered an antimitotic agent that stabilizes microtubules by promoting microtubule assembly from tubulin dimers and preventing depolymerization. This stability suppresses the normal dynamic rearrangement of the microtubule network, which is essential for vital interphase and mitotic cell function.

[0152] This also includes a variety of known taxane derivatives, including both hydrophilic and hydrophobic derivatives. Taxane derivatives include, but are not limited to, the galactose and mannose derivatives described in International Patent Application WO 99 / 18113, the piperazino and other derivatives described in WO 99 / 14209, the taxane derivatives described in WO 99 / 09021, WO 98 / 22451, and U.S. Patent No. 5,869,680, the 6-thio derivatives described in WO 98 / 28288, the sulfenamide derivatives described in U.S. Patent No. 5,821,263, the deoxygenated paclitaxel compounds described in U.S. Patent No. 5,440,056, and the taxol derivatives described in U.S. Patent No. 5,415,869. As described above, this includes, but is not limited to, the prodrugs of paclitaxel described in WO 98 / 58 927, WO 98 / 13059, and U.S. Patent No. 5,824,701. The taxane may be a taxane conjugate such as paclitaxel-PEG, paclitaxel-dextran, paclitaxel-xylose, docetaxel-PEG, docetaxel-dextran, or docetaxel-xylose. Other derivatives are mentioned in references such as "Synthesis and Anticancer Activity of Taxol Derivatives," DGI Kingston et al., Studies in Organic Chemistry, vol. 26, and "New Trends in Natural Products Chemistry" (1986), Atta-ur-Rabman, PWle Quesne, Eds. (Elsevier, Amsterdam 1986). Each of these references is incorporated herein by reference in its entirety.

[0153] Various taxanes can be readily prepared using techniques known to those skilled in the art (see also WO 94 / 07882, WO 94 / 07881, WO 94 / 07880, WO 94 / 07876, WO 93 / 23555, WO 93 / 10076; U.S. Patent Nos. 5,294,637; 5,283,253; 5,279,949; 5,274,137; 5,202,448; 5,200,534; 5,229,529; and EP 590,267) (each incorporated herein by reference in its entirety) or can be obtained from various commercial suppliers, such as Sigma-Aldrich Co., St. Louis, Mo.

[0154] Alternatively, the anti-mitotic anticancer agent may be a microtubule inhibitor, and in a preferred embodiment, the microtubule inhibitor is a vinca alkaloid. Generally, vinca alkaloids are toxins of the mitotic spindle. Vinca alkaloid drugs act during mitosis, when chromosomes begin to move along the tubules of the mitotic spindle toward one of its poles before chromosomes divide and cells separate. The action of these spindle toxins causes chromosomes to disperse and the spindle to become disordered during mitosis, affecting cell reproduction. According to a particular embodiment, for example, the vinca alkaloid is selected from the group consisting of vinblastine, vincristine, vindesine, vinorelbine, and their salts, analogs, and derivatives.

[0155] Antimitotic anticancer agents may also be epothirones. Generally, epothirone-class compounds stabilize microtubule function via a mechanism similar to that of taxanes. Epothirones induce cell cycle arrest at the G2-M transition phase, leading to cytotoxicity and ultimately apoptosis. Suitable epithirones include epothirone A, epothirone B, epothirone C, epothirone D, epothirone E, and epothirone F, as well as their salts, analogs, and derivatives. A specific epothirone analog is ixabepyrone (Ixempra™), an epothirone B analog.

[0156] In certain embodiments, the antimitotic anticancer agent is selected from the group consisting of taxanes, epothirones, vinca alkaloids, and their salts and combinations. For example, in one embodiment, the antimitotic agent is a taxane. In this embodiment, the antimitotic agent is more preferably paclitaxel or docetaxel, and more preferably paclitaxel. In another embodiment, the antimitotic agent is epothirone (e.g., an epothirone B analog). In yet another embodiment, the antimitotic agent is a vinca alkaloid.

[0157] Examples of anticancer drugs available in this disclosure include, but are not limited to, thalidomide, platinum complexes such as cisplatin (cis-DDP), oxaliplatin, and carboplatin; anthracendions such as mitoxantrone; substituted ureas such as hydroxyurea; methylhydrazine derivatives such as procarbazine (N-methylhydrazine, MIH); corticosteroids such as mitotane (o,p'-DDD) and aminoglutethimide; RXR agonists such as bexarotene; and tyrosine kinase inhibitors such as sunitimib, imatinib, axitinib, dasatinib, erlotinib, nilotinib, and pazopanib. Other examples of anticancer drugs include alkylating agents, antimetabolites, natural products, hormones and antagonists, and other drugs. Alternative names are shown in parentheses. Examples of alkylating agents include nitrogen mustards, e.g., mechloretamine, cyclophosphanide, ifosfamide, melphalan (sarcolicin), chlorambucil; ethyleneimine and methylmelamine, e.g., hexamethylmelamine, thiotepa; alkyl sulfonates, e.g., busulfan; nitrosoureas, e.g., carmustine (BCNU), semustine (methyl-CCNU), lomustine (CCNU), streptozotocin (streptozotocin); DNA synthesis antagonists, e.g., estramustine phosphate; triazines, e.g., dacarbazine (DTIC, dimethyl-triazenoimidazole carboxamide), temozolomide. Examples of antimetabolites include folate analogs such as methotrexate (ametopterin); pyrimidine analogs such as fluorouracin (5-fluorouracil, 5-FU, SFU), phloxuridine (fluorodeoxyuridine, FUdR), cytarabine (cytosine arabinoside), and gemcitabine; purine analogs such as mercaptopurine (6-mercaptopurine, 6-MP), thioguanine (6-thioguanine, TG), pentostatin (2'-deoxycoformycin, deoxycoformycin), cladribine, and fludarabine; and topoisomerase inhibitors such as amsacrin.Examples of natural products include vinca alkaloids such as vinblastine (VLB) and vincristine; taxanes such as paclitaxel, protein-bound paclitaxel (Abraxane), and docetaxel (Taxotere); epipodophyllotoxins such as etoposide and teniposide; camptothecines such as topotecan and irinotecan; antibiotics such as dactinomycin (actinomycin D), daunorubicin (daunomycin, rubidomycin), doxorubicin, histrelin, bleomycin, mitomycin (mitomycin C), idarubicin, and epirubicin; enzymes such as L-asparaginase; and biological reaction modifiers such as interferon-α and interleukin-2. Examples of hormones and antagonists include luteinizing hormone-releasing hormone agonists such as buserelin; corticosteroids such as prednisone and related preparations; progestins such as hydroxyprogesterone caproate, megestrol acetate, and megestrol acetate; estrogens such as diethylstilbestrol and ethinylestradiol and related preparations; estrogen antagonists such as tamoxifen and anastrozole; androgens such as testosterone propionate and fluoxymesterone and related preparations; androgen antagonists such as flutamide and bicalutamide; and gonadotropin-releasing hormone analogs such as leuprorelin. The alternative names and trade names of these anticancer drugs and other examples, as well as their methods of use (including dosage and administration regimen), are known to those skilled in the art.

[0158] In some embodiments, anticancer agents may include chemotherapeutic agents. Suitable chemotherapeutic agents include, but are not limited to, alkylating agents, antibiotics, antimetabolites, hormonal agents, plant-derived agents and their synthetic derivatives, anti-angiogenic agents, differentiation-inducing agents, cell growth-inhibiting agents, apoptosis-inducing agents, cytotoxic agents, agents that affect the bioenergy of cells, i.e., agents that affect cellular ATP levels and the molecules / activities that regulate these levels, biological agents (e.g., monoclonal antibodies, kinase inhibitors, growth factor and receptor inhibitors), gene therapies, cell therapies (e.g., stem cells), or any combination thereof.

[0159] According to these embodiments, the chemotherapeutic agent is selected from the group consisting of cyclophosphamide, chlorambucil, melphalan, mechloretamine, ifosfamide, busulfan, lomustine, streptozocin, temozolomide, dacarbazine, cisplatin, carboplatin, oxaliplatin, procarbazine, uramustine, methotrexate, pemetrexed, fludarabine, cytarabine, fluorouracil, phloxuridine, gemcitabine, capecitabine, vinblastine, vincristine, vinorelbine, etoposide, paclitaxel, docetaxel, doxorubicin, daunorubicin, epirubicin, idarubicin, mitoxantrone, bleomycin, mitomycin, hydroxyurea, topotecan, irinotecan, amsacrin, teniposide, erlotinib hydrochloride, and combinations thereof. Each possibility represents a specific aspect of the present invention.

[0160] In certain embodiments, the therapeutic agent may include a biological agent, particularly an antibody. In some embodiments, the antibody is selected from cetuximab, anti-CD24 antibody, panitumumab, and bevacizumab.

[0161] Growth factors useful as therapeutic agents include transforming growth factor α ("TGF-α"), transforming growth factor ("TGF-β"), platelet-derived growth factor ("PDGF"), fibroblast growth factor ("FGF") (including FGF acidic isoforms 1 and 2, FGF basic form 2, FGF 4, 8, 9 and 10), nerve growth factor ("NGF") (including NGF 2.5s, NGF 7.0s, beta NGF and neurotrophic factor), brain-derived neurotrophic factor, cartilage-derived factor, bone growth factor (BGF), and basic fibroblast growth factor. This includes, but is not limited to, cytoplasmic growth factors, insulin-like growth factors (IGF), vascular endothelial growth factors (VEGF), granulocyte colony-stimulating factor (G-CSF), insulin-like growth factors (IGF) I and II, hepatocyte growth factors, glial neurotrophic growth factors (GDNF), stem cell factors (SCF), keratinocyte growth factors (KGF), transforming growth factors (TGF) (including TGFα, β, β1, β2, β3), skeletal growth factors, bone matrix-derived growth factors, and bone-derived growth factors, as well as mixtures thereof.

[0162] Vascular endothelial growth factor (VEGF) inhibitors useful as therapeutic agents include, but are not limited to, sunitinib, pazopanib, sorafenib, tivozanib, cabozantinib, bevacizumab, aflibercept, ranibizumab, dasatinib, and nilotinib.

[0163] Cytokines useful as therapeutic agents include, but are not limited to, cardiotrophins, stromal cell-derived factors, macrophage-derived chemokines (MDCs), melanoma growth-stimulating activity (MGSA), macrophage inflammatory proteins 1α (MIP-1α), 2, 3α, 3β, 4, and 5, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, TNF-α, and TNF-β. Immunoglobulins useful in this disclosure include, but are not limited to, IgG, IgA, IgM, IgD, IgE, and mixtures thereof. Preferred growth factors include VEGF (vascular endothelial growth factor), NGF (nerve growth factor), PDGF-AA, PDGF-BB, PDGF-AB, FGFb, FGFa, and BGF.

[0164] Other molecules useful as therapeutic agents include, but are not limited to, growth hormone, leptin, leukemia suppressor factor (LIE), tumor necrosis factor α and β, endostatin, thrombospondin, osteomorphogenetic protein-1, osteomorphogenetic proteins 2 and 7, osteonectin, somatomedin-like peptides, osteocalcin, interferon α, interferon αA, interferon β, interferon γ, interferon 1α, and interleukin 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, and 18.

[0165] Diagnostic agents include gases, metals, commercially available imaging agents used in positron emission tomography (PET), computed tomography (CAT), single-photon emission computed tomography, X-ray, fluoroscopy, magnetic resonance imaging (MRI), and contrast agents. Examples of materials suitable as MRI contrast agents include gadolinium chelates, as well as iron, magnesium, manganese, copper, and chromium. Examples of materials useful for CAT and X-ray imaging include iodine-based materials.

[0166] Therapeutic and prophylactic agents include, but are not limited to, antibiotics, nutritional supplements, and vaccines. Vaccines may include isolated proteins or peptides, inactivated organisms and viruses, dead organisms and viruses, genetically modified organisms or viruses, cell extracts, and RNA encoding at least one antigen polypeptide or its immunogenic fragment (e.g., an immunogenic fragment capable of inducing an immune response to the antigen polypeptide). Therapeutic and prophylactic agents can be used in combination with interleukins, interferons, cytokines, and adjuvants (e.g., cholera toxin, alum, Freund's adjuvant, etc.).As preventative measures, the following are used: Streptococcus pneumoniae, Haemophilus influenzae, Staphylococcus aureus, Pyrogenes bacteria, Neisseria diphtheriae, Listeria monocytogenes, Bacillus anthracis, Neisseria tetanus, Clostridium botulinum, Clostridium perfringens, Neisseria meningitidis, Neisseria gonorrhoeae, Streptococcus mutans, Pseudomonas aeruginosa, Salmonella typhi, Haemophilus influenzae parainfluenzae, Bordetella pertussis, Bordetella francisella, Francisella tularensis, Plague bacillus, Vibrio cholerae, Legionella pneumophila, Mycobacterium tuberculosis, Mycobacterium leprae, Treponema pallidum, Interogans (leptospiratus), Borrelia burgdorferi, Camphiloba Antigens of bacteria such as Kutar Jejuni; human metapneumovirus (hMPV), human parainfluenza virus (hPIV) types 1, 2, and 3 (hPIV1, hPIV2, and hPIV3, respectively), respiratory syncytial virus (RSV), measles virus (MeV), coronaviruses (e.g., MERS-CoV, SARS-CoV, SARS-CoV2, HCoV-OC43, HCoV-229E, HCoV-NL63, HCoV-NL, HCoV-NH, HCoV-HKU1) Antigens of viruses such as poxviruses (e.g., smallpox, monkeypox), influenza A and B, HIV, varicella-zoster virus, herpes simplex virus types 1 and 2, cytomegalovirus, Epstein-Barr virus, rotavirus, rhinovirus, adenovirus, papillomavirus, poliovirus, mumps, rabies, rubella, coxsackievirus, equine encephalitis, Japanese encephalitis, yellow fever, Rift Valley fever, hepatitis A, B, C, D, and E viruses; cryptococcus The materials may include infectants such as antigens of fungi, protozoa, and parasites, including Neoformans, Histoplasma capsulatum, Candida albicans, Candida tropicalis, Nocardia asteroides, Rickettsia rickettsia, Typhus rickettsia, Mycoplasma pneumoniae, Chlamydia psittaci, Chlamydia trachomatis, Plasmodium falciparum, Trypanosoma brusey, Entamoeba histolytica, Toxoplasma gondii, Trichomonas vaginalis, and Schistosoma mansoni. These antigens may take the form of sterilized whole organisms, peptides, proteins, glycoproteins, carbohydrates, or combinations thereof.

[0167] Furthermore, this specification also describes a method for inducing cytotoxicity in cancer cells, which includes contacting cells with the pharmaceutical composition described herein.

[0168] Furthermore, this specification describes a method for generating a group of lipid nanoparticles that encapsulate an activator, the method comprising: (a) mixing one or more ethanol solutions containing a lipid mixture with an aqueous solution and acidifying it to induce the formation of empty lipid nanoparticle groups; (b) contacting the empty lipid nanoparticle groups with an aqueous solution containing an activator, thereby encapsulating the activator in the empty lipid nanoparticle groups to generate a group of lipid nanoparticles that encapsulate the activator; and (c) subjecting the group of lipid nanoparticles that encapsulate the activator to tangential flow filtration, exchanging the buffer solution, and removing residual ethanol. In some embodiments, the lipid mixture comprises 2.5 mol% to 15 mol% of one or more cationic lipids, 30 mol% to 50 mol% of one or more ionizable lipids, 30 mol% to 65 mol% of one or more neutral lipids, and 2.5 mol% to 15 mol% of one or more PEGylated lipids. In some embodiments, the activator comprises RX-0201, 5'gctgcatgatctccttggcg 3', SEQ ID NO: 1. In some embodiments, RX-0201 is an antisense oligonucleotide. In some embodiments, RX-0201 has at least one modified internucleoside bond which is a phosphorothioate bond. In some embodiments, the lipid nanoparticles comprise DOTAP, DODMA, DOPC, cholesterol, and DMG-PEG. In some embodiments, DOTAP, DODMA, DOPC, cholesterol, and DMG-PEG in the lipid nanoparticles are present in molar ratios of 5:40:25:20:10 (DOTAP:DODMA:DOPC:cholesterol:DMG-PEG), 5:40:27.5:20:7.5 (DOTAP:DODMA:DOPC:cholesterol:DMG-PEG), or 5:40:30:20:5 (DOTAP:DODMA:DOPC:cholesterol:DMG-PEG). In some embodiments, lipid nanoparticles and activators exist in weight ratios of 5:1 to 20:1, 7.5:1 to 15:1, 7.5:1 to 10:1, 7.5:1 to 12:1, 10:1 to 12:1, 10:1 to 15:1, or 12:1 to 15:1.In some embodiments, the lipid nanoparticles have an average particle size of 50 nm to 80 nm, 55 nm to 75 nm, or 55 nm to 60 nm, as measured by dynamic light scattering. In some embodiments, the lipid nanoparticles have an average ζ potential of -0.6 mV to 2.5 mV. In some embodiments, the lipid nanoparticles have a polydispersity index (PDI) of 0.15 to 0.5, 0.15 to 0.4, 0.15 to 0.3, 0.15 to 0.2, 0.2 to 0.3, 0.2 to 0.5, 0.2 to 0.4, 0.2 to 0.3, 0.3 to 0.4, 0.3 to 0.5, or 0.4 to 0.5. [Examples]

[0169] The following examples are for illustrative purposes only and do not limit the scope of the present invention in any way.

[0170] Example 1: Antitumor and anti-angiogenic effects of a lipid nanoparticle suspension of AKT-1 antisense oligonucleotides AKT-1 plays a crucial role in cancer progression by promoting cell proliferation and inhibiting apoptosis (see Revatidevi S, et al., Semin Cancer Biol. 2019;59:80-91, and Uko NE, et al., Curr Top Med Chem. 2020;20(10):883-900). AKT inhibition has been shown to suppress tumor growth and angiogenesis (see Nitlescu GM, et al., Int J Oncol. 2016;48(3):869-85). Archexin is a fully thiolated 20-mer antisense oligonucleotide that can specifically bind to AKT-1 mRNA, causing downregulation of AKT-1 based on RNA enzyme H. WGI-0301 is a proprietary lipid nanoparticle (LNP) formulation of Archexin designed to enhance delivery. Recently, a Phase I clinical trial of WGI-0301 for solid tumors was initiated.

[0171] The antitumor effect of WGI-0301 was studied in vivo using a Hepa1-6 syngeneic mouse tumor model of hepatocellular carcinoma (HCC). Mice were intravenously injected with either a solvent control or WGI-0301 at 8 mg / kg once a week for four weeks (n=8). Tumor size and body weight changes were monitored daily. Furthermore, the anti-angiogenic activity of WGI-0301 was studied in vitro using human umbilical vein endothelial cells (HUVECs) (see DeCicco-Skinner KL, et al., J Vis Exp. 2014 Sep 1;(91):e51312, and Arnaoutova I, et al., Nat Protoc. 2010;5(4):628-35). This study investigated the potential synergistic effects of WGI-0301 in combination with lenvatinib or sorafenib. Three experimental groups were established: WGI-0301 (0, 0.2, 2, 20 μM), WGI-0301 + 2 μM sorafenib, and WGI-0301 + 5 μM lenvatinib. Cells were plated 1.5 × 10⁴ per well. Cells were treated with 50% Matrigel, cultured three times in 24-well plates, and incubated for an additional 6 hours.

[0172] In an in vivo study, the antitumor effect of WGI-0301 was demonstrated in the Hepa1-6 model. The tumor growth inhibition percentage (TGI) of WGI-0301 was 46.16%, and the median survival time (MST) in the treatment group was 55 days, significantly different from the control group (37 days). No serious adverse events were observed during the study. In an in vitro anti-angiogenic study, dose-dependent inhibition of angiogenesis was demonstrated with WGI-0301 alone or in combination with 2 μM sorafenib and 5 μM lenvatinib. Compared to the control group, 20 μM WGI-0301 alone or in combination with 2 μM sorafenib and 5 μM lenvatinib showed a significant inhibitory effect on angiogenesis. The combination of 2 μM WGI-0301 and 5 μM lenvatinib also showed a remarkable inhibitory effect on angiogenesis. The results are shown in Figures 1A-3C.

[0173] The dose-dependent inhibitory effect of WGI-0301 on angiogenesis was observed both as monotherapy and, particularly in combination with 5 μM lenvatinib, suggesting that angiogenesis inhibition may be an important mechanism of antitumor activity. Furthermore, combination therapy with WGI-0301 and lenvatinib showed high therapeutic efficacy.

[0174] As the research results show, WGI-0301 exhibited significant antitumor and anti-angiogenic effects in a Hepa1-6 syngeneic mouse tumor model of HCC. Furthermore, when WGI-0301 was used in combination with sorafenib or lenvatinib, even stronger anti-angiogenic effects were obtained compared to WGI-0301 monotherapy. These results suggest that WGI-0301 is a selective AKT-1 inhibitor.

[0175] Example 2: WGI-0301 Lipid Nanoparticles The drug base is Archexin (RX-0201), an antisense oligonucleotide developed by Rexahn Pharmaceuticals (Rockville, MD). The drug WGI-0301 is manufactured in the form of a lyophilized powder. Both preclinical and clinical studies have shown RX-0201 to possess promising antitumor activity and tolerability. RX-0201 also achieved early success in Phase II trials for renal cell carcinoma and pancreatic cancer. However, RX-0201 has been limited by challenges inherent to antisense oligonucleotides, including low membrane permeability, poor in vivo stability, and the need for a rigorous administration plan involving continuous 14-day infusion.

[0176] To further improve the in vivo delivery and therapeutic performance of RX-0201, Zhejiang Haichang Biomedical Technology Co., Ltd. (HCBio) developed RX-0201 as a lipid nanoparticle (LNP) suspension formulation (WGI-0301). WGI-0301, an LNP formulation, utilizes a combination of quaternary and tertiary lipoamines along with other neutral and stabilizing lipids for pH-sensitive delivery. WGI-0301 has been proposed as a promising therapeutic candidate for hepatocellular carcinoma. A detailed list of the components of the clinical lot is shown in the following table.

[0177] [Table 1] Note: 1. DOTAP is a cationic lipid, and its chemical name is 1,2-dioleoyl-3-trimethylammoniumpropane. 2. DODMA is an ionized lipid, and its chemical name is 1,2-dienoxy-3-dimethylaminopropane. 3. DOPC is a neutral lipid, and its chemical name is 1,2-dioleoyl-sn-glycero-3-phosphocholine. 4. DMG-PEG2000 is a PEGylated lipid, and its chemical name is 1,2-dimyristoyl-rac-glycero-3-methylpolyoxyethylene 2000. 5. During the process preparation, sucrose, ammonium chloride, acetic acid, sodium hydroxide, and ethanol are removed. LNP is suspended in a 0.9% sodium chloride solution.

[0178] Since the aqueous form of RX-0201 cannot be stored stably at 2-8°C, it is recommended to set the long-term storage temperature of WGI-0301 to -20°C and thaw it before use. To meet clinical needs, WGI-0301 is supplied in the form of 6.573 mg of free Archexin acid per 7 mL (equivalent to 7.0 mg of Archexin / RX-0201). Based on existing experience with HCBio, different formulations were developed and studied. These formulations were studied based on CQA and therapeutic efficacy, and the appropriate formulation and formulation process were selected.

[0179] [Table 2] TIFF2026514441000003.tif216162 TIFF2026514441000004.tif216163 TIFF2026514441000005.tif217163 TIFF2026514441000006.tif134158

[0180] Archexin(RX-0201)5'-GCTGC ATGAT CTCCT TGGCG-3', SEQ ID NO: 1, Pharmacological classification: Thiophosphate oligonucleotide, 20 nucleotides in length, Molecular formula: C194H247N70O103P19S19Na19. Physicochemical properties: RX-0201 is a white lyophilized powder. It has no particular odor, is hygroscopic, and is readily soluble in water. It is unstable at high temperatures and sensitive to light and oxidation conditions. Aqueous solutions decompose when stored for long periods at 4°C. The stability of aqueous solutions depends heavily on the pH value, and RX-0201 decomposes more rapidly under relatively low pH conditions.

[0181] Chemical structure: TIFF2026514441000007.tif32152

[0182] We combined experimental data on drug-induced influence factors, studied different auxiliary materials, and considered and evaluated the compatibility between APIs and auxiliary materials.

[0183] Selection of auxiliary materials (1) Cationic lipids and ionized lipids Permanently ionized lipids (e.g., lipids with quaternary ammonium moieties) and conditionally ionized lipids (e.g., lipids with tertiary amine moieties) are used in LNP formulations for the delivery of nucleic acid drugs.

[0184] Quaternary cationic lipids like DOTAP-Cl possess a permanent positive charge, and their cationicity does not change under different pH conditions. Quaternary ammonium cationic lipids are widely used in the formulation of LNP gene delivery systems. They have a high charge density and contribute to the aggregation of large nucleic acid drugs into stable, nanoscale complexes. Their positive charge also interacts with blood components, potentially leading to toxicity.

[0185] On the other hand, ionizable lipids like DODMA are mostly uncharged at neutral pH values ​​and become positively charged only under acidic conditions. When DODMA is incorporated into LNP formulations, the DODMA becomes charged after LNP endocytosis, and subsequently, under low pH conditions in late endosomes or lysosomes, the extrusion of the capsular gene material loaded onto the LNP is promoted.

[0186] This design leverages the advantages of the high charge density provided by the quaternary aliphatic amine (DOTAP-Cl) and the pH responsiveness of the conditionally ionizable tertiary aliphatic amine (DODMA), thereby achieving an optimal balance between the charge of oligonucleotide delivery and endosomal escape. DOTAP-Cl also contributes to the structural stability of LNPs under physiological pH conditions, and the permanently positively charged DOTAP-Cl interacts better with negatively charged oligonucleotides, resulting in relatively smaller nanoparticle sizes compared to nanoparticles containing only tertiary aliphatic amines. Ionization of DODMA promotes electrostatic interactions between cationic lipids and the endosomal anion membrane under acidic conditions such as late endosomes or lysosomes, inducing exocytosis and facilitating the escape of oligonucleotides into the cytoplasm. In this study, commercially available DOTAP-Cl and DODMA were selected as cationic lipids in the WGI-0301 product formulation.

[0187] (2) PEGylated lipids and neutral lipids PEGylated lipids are widely used in nanoparticle delivery systems. Cationic lipids are readily recognized and removed by mononuclear phagocytic systems through electrostatic interactions and nonspecific interactions with charged components in serum. PEGylated lipids can impart LNP-hiding properties, reducing nonspecific interactions with negatively charged serum components, inhibiting drug uptake by the reticular endothelial system (RES), and thereby extending the half-life of the drug in plasma. Furthermore, PEGylated lipids can enhance the stability of formulations by reducing interactions with nucleases and improving the overall colloidal stability.

[0188] However, the presence of the PEG layer spatially interferes with the interaction between LNPs and the cell membrane, reducing cellular uptake and suppressing the interaction between LNPs and endosomal and lysosomal membranes. Therefore, polyethylene glycolated lipids are necessary to improve formulation stability and extend blood circulation time, but after the nanoparticles reach the target organ, they must be rapidly released from the LNPs to increase intracellular uptake. It is necessary to promote endosomal escape. Therefore, timely release of polyethylene glycolated lipids from LNPs is crucial. Numerous studies have revealed that the duration of PEGylated lipid attachment to LNPs depends on the length of the PEGylated lipid fatty acid chain. Due to stronger intermolecular forces, long-chain PEGylated lipids (e.g., PEG-C20) are less likely to be released from LNPs, thereby giving the LNPs greater stability and circulation time. Short-chain PEGylated lipids (e.g., PEG-C8) can be easily removed from nanoparticles. The length of the PEGylated lipid chain is unrelated to the ability of LNPs to accumulate at tumor sites. PEGylated lipids have been reported to have a strong immune response. Compared to LNPs with short fatty acid chains (e.g., PEG-s-DMG or PEG-CerC14), LNPs with long fatty acid chains (e.g., PEG-DSPE, PEG-s-DSG) have a faster clearance rate.

[0189] Based on the principle of LNP delivery, three different LNP formulations were prepared. Formulation 1: DOTAP-Cl, DODMA, DOPC, cholesterol, and DMG-PEG 2000; Formulation 2: DOTAP-Cl, DODMA, DSPC, cholesterol, and DMG-PEG 2000; Formulation 3: DOTAP-Cl, DODMA, DOPC, cholesterol, and DSPE-PEG 2000. The particle size of the API-supported LNP was used as the selection criterion for the formulations. The designs of the different formulations are shown in the table below.

[0190] [Table 3] Note: The preparation further includes lipid oxidation using ammonium chloride and glacial acetic acid, sucrose as an osmotic pressure regulator, NaOH as a pH adjuster, anhydrous ethanol as a lipid solubilizer, and sterile water for injection as the solvent. Since the above components are present in the same amount in the three preparations, this report will not consider them.

[0191] [Table 4]

[0192] As shown in the table above, formulation 1 has the smallest particle size at 47.53 nm, formulation 3 has the particle size at 67.19 nm, formulation 2 has the largest particle size at 123.1 nm, and has the highest PDI value at 0.807.

[0193] API-supported LNPs with small particle sizes (<100 nm) are more likely to be taken up by target tissues such as tumors as the particle size increases. DMG-PEG2000, which contains PEG-C14, tends to dissociate the positively charged PEG layer more rapidly than PEG layers with longer fatty acid chains. These accumulate in the largest amounts in organs of the reticular endothelial system, particularly the liver. Since WGI-0301 aims to develop potential therapeutic methods for hepatocellular carcinoma, DMG-PEG 2000 was selected as the PEGylated lipid.

[0194] Neutral lipids such as DOPC and DOPE are used as bilayer-forming lipids for LNPs due to their low cytotoxicity and immunogenicity. While the biological properties of neutral lipids (e.g., DOPC, DOPE) are pH-independent, they limit the loading and delivery capacity of negatively charged oligonucleotide drugs by LNPs. Based on the above formulation selection results, DOPC was selected as the neutral lipid for LNP formulations.

[0195] Cholesterol is a neutral lipid that acts as a regulator of membrane fluidity and plays an important role in lipid self-organization and LNP stabilization.

[0196] Selection of excipients according to the route of administration Clinical lots of WGI-0301 were prepared using 1,2-dioleoyl-3-trimethylammonium chloride propane (DOTAP-Cl), 1,2-dioleoyloxy-3-dimethylaminopropane (DODMA), 1,2-diolacyl-sn-glycero-3-phosphorylcholine (DOPC), cholesterol (CHOL), 1,2-dimyristoyl rac-glycero-3-methylpolyoxyethylene 2000 (DMG-PEG 2000), sucrose, ammonium chloride, glacial acetic acid, sodium hydroxide, and sodium chloride.

[0197] DOTAP-Cl and DODMA provide positive charge balance and interact with anionic oligonucleotides. DOPC is used as a bilayer-forming lipid. Cholesterol is a lipid modifier of membrane fluidity, increasing membrane rigidity and conferring stability. By selecting DMG-PEG 2000 as the lipid, detargeting uptake and immunogenicity are reduced, and circulation time is extended. Sucrose and sodium chloride are osmotic regulators. Ammonium chloride and glacial acetic acid are lipid oxidizers for protonating DODMA. NaOH is used to adjust the pH value.

[0198] formulation This design leverages the advantages of the high charge density provided by cationic quaternary aliphatic amine (DOTAP-Cl) and the pH responsiveness of conditionally ionizable tertiary aliphatic amine (DODMA) to achieve an optimal balance between charge for oligonucleotide delivery and endosomal escape. DOTAP-Cl also contributes to the structural stability of LNPs under physiological pH conditions; the permanently positively charged DOTAP-Cl interacts better with negatively charged oligonucleotides, resulting in relatively smaller nanoparticle sizes compared to nanoparticles containing only tertiary aliphatic amines. DOPC is used as a bilayer-forming lipid. Cholesterol is a lipid modifier for membrane fluidity, increasing membrane rigidity and providing stability. By selecting DMG-PEG 2000 as the lipid, untargeted uptake and immunogenicity are reduced, and circulation time is extended. Sucrose acts as an osmotic regulator. Ammonium chloride and glacial acetic acid are used as lipid oxidizers to protonate DODMA under low pH conditions and allow it to interact with the API. After forming an electrostatic complex, NaOH is used as a pH modifier to raise the pH value to the physiological pH value. Next, the buffer system is replaced with a 0.9% NaCl solution by tangential flow filtration.

[0199] Determination of lipid molar ratio Several different formulations are selected to determine the optimal ratio of lipid components. The molar ratios of the formulations are as follows: Formulation 1: DOTAP / DODMA / DOPC / Cholesterol / DMG-PEG = 5 / 40 / 27.5 / 20 / 7.5 Formulation 2: DOTAP / DODMA / DOPC / Cholesterol / DMG-PEG=5 / 40 / 25 / 20 / 10 Formulation 3: DOTAP / DODMA / DOPC / Cholesterol / DMG-PEG=5 / 40 / 30 / 20 / 5.

[0200] The particle size and zeta potential of LNPs were detected. The molar ratio of lipids was confirmed by HPLC-ELSD. Refer to the table below for formulation design.

[0201] [Table 5] Note: The formulation further includes ammonium chloride and glacial acetic acid as lipid oxidizing agents, sucrose as an osmotic pressure regulator, NaOH as a pH regulator, and anhydrous ethanol and sterile water for injection as solvents. Since the content of each component is the same in the three formulations, this report omits the examination in this section.

[0202] [Table 6]

[0203] As the results show, the DOTAP / DODMA / DOPC / cholesterol / DMG-PEG formulation with a molar ratio of 5 / 40 / 27.5 / 20 / 7.5 had the smallest particle size and PDI, with a particle size of 47.53 nm and a PDI of 0.234. Smaller LNPs are more likely to penetrate porous target tissues such as tumors. Therefore, the optimal lipid molar ratio was set at 5 / 40 / 27.5 / 20 / 7.5.

[0204] Checking the lipid ratio Based on the lipids and molar ratios selected in the previous study, four different lipid-to-drug ratio formulations were designed. The therapeutic effects of these formulations were studied using clinical quality analysis (CQA) and pharmacological animal experiments as selection criteria. The composition and analytical results of the formulations are shown in the table below.

[0205] [Table 7] Note: The formulation further includes using anhydrous ethanol and sterile water for injection as solvents, and pH 7.4 PBS as a substitution buffer. Since the amounts of these components are the same in each formulation, a detailed examination is omitted here.

[0206] [Table 8]

[0207] As the results show, the smallest particle size was observed when the lipid:drug (w / w) ratio was 7.5:1. Smaller LNPs are more likely to penetrate porous target tissues such as tumors. Therefore, the optimal lipid:drug (w / w) ratio was set at 7.5:1.

[0208] Pharmacodynamic studies: WGI-0301 (formerly RX-0301) was composed of different lipid:drug (w / w) ratios and administered at a dose level of 8 mg / kg (the 8 mg / kg dose level represents Archexin, equivalent to 7.5 mg / kg of free Archexin acid) to evaluate its antitumor effect in a C57BL / 6 mouse syngeneic Hepa1-6 model.

[0209] Statistical analysis of tumor growth suppression [Table 9]

[0210] [Table 10]

[0211] 34 days after administration (QW x 4 weeks), the mean tumor volume (MTV) of the negative control group was 2045.44 mm3. The WGI-0301 control group (15:1, excluding RX-0201) (8 mg / kg) had an MTV of 1417.07 mm3 and a TGI (%) of 31%, with no significant difference compared to the negative control group (p=0.300). The RX-0201 (8 mg / kg) control group had an MTV of 1676.36 mm3 and a TGI (%) of 18%, with no significant difference compared to the negative control group (p=0.419). The WGI-0301 (15:1) (8 mg / kg) treatment group had an MTV of 1500.58 mm3 and a TGI (%) of 27%, with no significant difference compared to the negative control group (p=0.300). The WGI-0301(12:1)(8mg / kg) treatment group had an MTV of 1027.11 mm3 and a TGI (%) of 50%, which was significantly different from the negative control group (p=0.041). The WGI-0301(10:1)(8mg / kg) treatment group had an MTV of 1260.48 mm3 and a TGI (%) of 38%, which was not significantly different from the negative control group (p=0.156). The WGI-0301(7.5:1)(8mg / kg) treatment group had an MTV of 545.46 mm3 and a TGI (%) of 73%, which was significantly different from the negative control group (p=0.007). As the results show, WGI-0301 (12:1) and WGI-030 1 (7.5:1) had a significant antitumor effect against the syngeneic Hepa1-6 model of C57BL / 6 mice.

[0212] Survival analysis [Table 11]

[0213] [Table 12]

[0214] As can be seen from the survival analysis results, the median survival time (MST) for WGI-0301 (15:1), WGI-0301 (12:1), and WGI-0301 (10:1) was not significantly different from that of the RX-0201 control. Compared to the RX-0201 control, WGI-0301 (15:1), and WGI-0301 (12:1), the survival time for WGI-0301 (7.5:1) was clearly longer. Overall, the lipid:drug ratio selected in this study was 7.5:1.

[0215] manufacturing process This product is an injection suspension, and its preparation process includes API solution preparation, empty LNP preparation, drug loading, pH titration, tangential flow filtration, sterile filtration, packing, capping, sealing, packaging, and freezing. The ethanol dilution method is used for LNP preparation. An ethanol-lipid solution containing cationic lipids (DOTAP-Cl, DODMA), bilayer-forming lipids (DOPC), PEGylated lipids (DMG-PEG 2000), and cholesterol was mixed and oxidized to approximately pH 4.0. Subsequently, empty LNP and oligonucleotide aqueous solution were rapidly mixed to prepare LNP at a lipid:drug ratio of 1:1 (v / v), and the pH value was also brought to the physiological range. The LNP was stabilized by removing ethanol using tangential flow filtration instead of buffer. High-throughput controllable microfluidic technology is used to obtain high-quality, nanoscale, and stable LNP.

[0216] The advantage of microfluidic technology in LNP preparation is that the prepared LNPs have higher encapsulation efficiency and smaller particle size, allowing for rapid production from laboratory scale to GMP production scale. Microfluidic technology is an online continuous process for preparing LNPs. One advantage of this technology is that the formulation components and proportions, equipment, and process parameters remain unchanged from laboratory scale to laboratory scale, intermediate testing scale, and GMP production scale. Furthermore, the critical quality parameters of the pharmaceutical product clearly do not change, demonstrating the stability of the process.

[0217] The manufacturing process for empty LNPs used in nonclinical studies is similar to that of WGI-0301, except that a 20% sucrose solution is used instead of the API solution. A schematic diagram of the manufacturing process is shown in Figure 4.

[0218] Solution preparation Preparation of 50 mM ammonium chloride / 50 mM glacial acetic acid solution: 18.72 g of glacial acetic acid was weighed, dissolved in an appropriate amount of sterile water for injection, mixed uniformly, and ultrafiltered through an ultrafiltration membrane to remove bacterial endotoxins. Preparation of 20% (w / v) sucrose solution: 1600 g of sucrose was weighed, dissolved in an appropriate amount of sterile water for injection, mixed uniformly, and ultrafiltered through an ultrafiltration membrane to remove bacterial endotoxins. Preparation of API solution (RX-0201 in 0.9% sucrose): 10.50 g of RX-0201 and 5698 g of the 20% sucrose solution from step #1.2 were weighed and mixed to obtain 1.88 mg / mL of Archexin free acid (API solution). Preparation of 0.9% (w / w) sodium chloride solution: 450 g of solid sodium chloride was weighed, dissolved in an appropriate amount of sterile water for injection, mixed uniformly, and ultrafiltered through an ultrafiltration membrane to remove bacterial endotoxins. Preparation of 1M sodium hydroxide (NaOH) solution: 20.0 g of sodium hydroxide was weighed and dissolved in an appropriate amount of sterile water for injection. Preparation of lipid solution: 3.84 g of DOTAP-Cl, 27.21 g of DODMA, 23.72 g of DOPC, 8.50 g of cholesterol, and 20.74 g of DMG-PEG 2000 (molar ratio = 5:40:27.5:20:7.5) were weighed out, the lipids were dissolved in 798.50 g of anhydrous ethanol, mixed with a magnetic stirrer in a 40°C water bath, and the lipid solution was filtered through a 0.45 μm PVDF syringe filter.

[0219] Preparation of air lipid nanoparticles The piping of the SY03 syringe pump system was connected, and the piping connected to the SY03 syringe pump system was flushed with a 0.1 M sodium hydroxide solution. The inlets of pumps #1 and #2 were connected to sterile water for injection. The SY03 syringe pump system was flushed with sterile water for injection until the pH value was neutral. The sterile water for injection was drained, and the SY03 syringe pump system was shut down. The water bath temperature of the heated magnetic stirrer (DF-101T; #1) was set to 40°C. 4200 grams (4.2 liters) of ammonium chloride / glacial acetic acid solution in a 5 liter screw-cap reagent bottle was preheated to 40°C (tolerable temperature range: 38~42°C) while magnetically stirring. The water bath temperature of the heated magnetic stirrer (DF-101T; #2) was set to 40°C. 846.21 grams (1.05 liters) of filtration lipid solution in a 1-liter screw-cap reagent bottle was preheated to 40°C (tolerable temperature range: 38-42°C) while magnetically stirring. The water bath temperature of the heated magnetic stirrer (DF-101T; #3) was set to 40°C. A 5-liter screw-cap reagent bottle was preheated in a water bath while magnetically stirring. The inlet of pump #1 was connected to the preheated 40°C ammonium chloride / glacial acetic acid solution, and the inlet of pump #2 was connected to the preheated 40°C lipid solution. A stainless steel needle (16G; 1.19 mm; 300 mm) was placed in the 5 L screw-cap reagent bottle preheated in a 40°C water bath. The SY03 syringe pump system was started to prepare empty lipid nanoparticles. The empty lipid nanoparticle solution was received using the preheated 5 L screw-cap reagent bottle. After preparing the empty lipid nanoparticles, stirring of the empty lipid nanoparticle solution was continued at 40°C for 15 minutes.

[0220] Preparation of WGI-0301 lipid nanoparticles The water bath temperature of the heated magnetic stirrer (DF-101T;#2) was set to 40°C. 5.25 L of RX-0201 solution (in a 5 L screw-cap reagent bottle) was preheated to 40°C (allowable temperature range: 38~42°C) while magnetically stirring. A 5 L screw-cap reagent bottle containing the blank lipid nanoparticle solution was transferred from stirrer #3 (DF-101T;#3) to stirrer #2 (DF-100T;#2) while magnetically stirring. The water bath temperature of the heated magnetic stirrer (DF-101T;#3) was set to 40°C. A 10 L empty screw-cap reagent bottle was preheated in a 40°C water bath while magnetically stirring. The SY03 fuel injection pump system piping was connected. The inlet of pump #1 was connected to the RX-0201 solution preheated to (40°C), and the inlet of pump #2 was connected to the empty lipid nanoparticle solution preheated to (40°C). The two ends of the branched extension were connected to the outlets of two 25 ml syringes, and the head of the branched extension was connected to a stainless steel syringe. A stainless steel syringe needle (16G; 1.19 mm; 510 mm) was placed in a preheated 10 L screw-cap reagent bottle. The SY03 syringe pump system was started to prepare the WGI-0301 lipid nanoparticles. The WGI-0301 lipid nanoparticle solution was received using a preheated 10 L screw-cap reagent bottle. After preparation, the WGI-0301 lipid nanoparticle solution was stirred at 40°C for 15 minutes.

[0221] Crude WGI-0301 solution was placed in a cold water bath and cooled to room temperature (15-25°C). pH titration was performed by adding 1M sodium hydroxide (NaOH) solution to the WGI-0301 solution using a magnetic stirrer until the pH value reached 7.0-7.4.

[0222] A tangential flow filtration (TFF) system was set up. A new hollow fiber column filter was pre-treated, first washed with water, and then repeatedly washed with 0.2 M NaOH solution for 60 minutes. Afterward, it was washed with sterile water for injection until the pH of the wash water became neutral. The pre-treated hollow fiber column filter was used as a tangential flow filter, with 0.9% NaCl solution as the tangential displacement solution, and the suspension medium for WGI-0301 was changed to 0.9% NaCl solution. Tangential flow filtration was performed until 25,000 g of 0.9% NaCl solution was consumed, and then the replenished 0.9% NaCl solution was pumped into the hollow fiber column filter. The remaining WGI-0301 solution in the column was washed into a 10 L screw-cap reagent bottle. The WGI-0301 solution content was tested by sampling.

[0223] Crude WGI-0301 solution was diluted with 0.9% sodium chloride solution to obtain a final WGI-0301 solution with the desired API concentration. The WGI-0301 solution was filtered into Merck Millipore sterile bags using two 0.22 μm PVDF sterile filters. The bags were heat-sterilized at 121°C for 30 minutes. The vials were washed using a washing machine and then sterilized in a tunnel drying oven (330 ± 15°C, ≤ 55 vials / min). Under laminar flow conditions, WGI-0301 was filled into 10 mL borosilicate glass vials in a RABS, the filled vials were purged with nitrogen, and then blocked.

[0224] Lipid concentration sorting In the process optimization of empty LNP formulations, total lipid concentrations of 150 mg / mL, 75 mg / mL, and 37.5 mg / mL were tested. The SY03 syringe pump system was used to prepare empty LNPs and API-supported LNPs, with a lipid:drug ratio (w / w) of 7.5:1. Subsequently, pH titration was performed to physiological pH using a 1 M NaOH solution. Appropriate lipid concentrations were selected based on particle size distribution as acceptance criteria. The experimental design and results are shown in the table below.

[0225] [Table 13]

[0226] In the empty LNP, drug loading, and pH titration steps, the effect of lipid concentration on particle size distribution and PDI was selected using different lipid concentrations (150 mg / mL, 75 mg / mL, and 37.5 mg / mL). As can be seen from the test results, the particle size of the empty LNP decreased with decreasing lipid concentration, and at a lipid concentration of 150 mg / mL, the particle size in the drug loading and titration steps decreased due to greater electrostatic interactions. However, at lipid concentrations of 75 mg / mL and 37.5 mg / mL, the particle size increased after the drug loading and titration steps, particularly for the 37.5 mg / mL lipid concentration group, where the particle size increased from 35.87 nm to 65.28 nm, indicating instability. In summary, the final particle size was smallest and most stable at a lipid concentration of 75 mg / mL. Therefore, a lipid concentration of 75 mg / mL was selected.

[0227] Selection of ammonium chloride / glacial acetic acid concentrations for use in lipid oxidation In optimizing the preparation process for empty LNPs, 25 mM / 25 mM, 50 mM / 50 mM, and 100 mM / 100 mM ammonium chloride / glacial acetic acid solutions were studied. The SY03 syringe pump system was used to prepare empty LNPs and API-supported LNPs, with a lipid:drug ratio (w / w) of 7.5:1. Subsequently, pH titration was performed to physiological pH using a 1 M NaOH solution. Appropriate lipid concentrations were selected based on particle size distribution as acceptance criteria. The experimental design and results are shown in the table below.

[0228] [Table 14]

[0229] The pKa of the cationic lipid DODMA was 6–7. The lipid was completely ionized at acidic pH. After oxidizing the lipid solutions with 25 mM / 25 mM, 50 mM / 50 mM, and 100 mM / 100 mM ammonium chloride / glacial acetic acid, empty LNPs were formed, with pH values ​​of 4.556, 4.197, and 3.814, respectively. Literature has shown that the binding of DODMA to oligonucleotides is best when the oligonucleotide is completely ionized. At pH 4.556, DODMA was not sufficiently ionized, but at pH 4.197 and pH 3.814, DODMA was sufficiently ionized. As can be seen from the particle size distribution results, the particle size was much smaller when the ammonium chloride / glacial acetic acid solution was 50 mM / 50 mM than when it was 25 mM / 25 mM and 100 mM / 100 mM. Since small LNPs are likely to be taken up by target tissues such as tumors, a 50 mM / 50 mM ammonium chloride / glacial acetic acid solution concentration was selected.

[0230] Selection based on organic-water ratio In the optimization process for empty LNP preparation, the following ratios of lipid solution (organic phase) and ammonium chloride / glacial acetic acid solution (aqueous phase) were selected: 1:8, 1:4, and 1:2. Empty LNPs were prepared using the SY03 syringe pump system. The particle size distribution was used as a criterion for selecting an appropriate organic-aqueous phase ratio (v / v). The experimental design and results are shown in the table below.

[0231] TIFF2026514441000020.tif105159

[0232] As the experimental results show, when the organic-hydrogen ratio was 1:8 (particle size: 45.11 nm) or 1:4 (particle size: 44.80 nm), the particle size was significantly smaller than when the organic-hydrogen ratio was 1:2 (particle size: 58.49 nm). However, when the organic-hydrogen ratio was 1:8 and its PDI was 0.392, it was significantly larger than the 0.251 when the organic-hydrogen ratio was approximately 1:4, indicating that the particle size distribution was more uniform when the organic-hydrogen ratio was 1:4. Therefore, 1:4 was selected as the v / v organic-hydrogen ratio (LNP).

[0233] Selection of needle inner diameter For process optimization of empty LNPs, empty LNPs were prepared using the SY03 syringe pump system. When lipid and oxidizing solutions passed through a T-type connector at a constant flow rate (40 and 160 mL / min, respectively) through a microfluidic channel of a constant size, the lipid and acidic solutions could be rapidly and completely dispersed in a laminar flow. Tested needle sizes included 14G (1.60 mm inner diameter, 300 mm length), 16G (1.19 mm inner diameter, 300 mm length), and 18G (0.84 mm inner diameter, 300 mm length). Particle size distribution was used as a selection criterion. The experimental design and results are shown in the table below.

[0234] [Table 15]

[0235] As the results show, the particle size of the empty LNPs was smallest when the needle specification was 16G. When the needle was 18G, high shear fluid pressure was generated due to the narrower inner diameter. Therefore, the selected needle was 16G (inner diameter 1.19 mm, length 300 mm) and was used for the preparation of empty LNPs.

[0236] Selection of syringe pump systems for lipid solutions and ammonium chloride / glacial acetic acid solutions. In optimizing the empty LNP preparation process, empty LNPs were prepared using the SY03 syringe pump system. When different lipid and acidic solutions pass through the T-connector, they pass through a microfluidic channel of constant size at a constant flow velocity in a laminar flow, allowing the lipid and acidic solutions to disperse rapidly and completely. Stainless steel syringe needles (16G, inner diameter 1.19 mm, length 300 mm) were used as mixing and dispersing microfluidic channels, and the syringe pump speed combinations for the lipid and acidic solutions were set to 40 and 160 mL / min, 20 and 80 mL / min, and 10 and 40 mL / min, respectively. Appropriate syringe pump speed combinations for the lipid and acidic solutions were selected based on the particle size distribution. The experimental design and results are shown in the table below.

[0237] [Table 16]

[0238] The maximum flow rate of the SY03 syringe pump system was 170 mL / min. Using a lipid solution / oxidized solution ratio (v / v) of 1:4 (i.e., flow rate ratio), the syringe pump speed combinations for the lipid solution and oxidized solution were set to 40 & 160 mL / min, 20 & 80 mL / min, and 10:40 mL / min. As can be seen from the results, when the syringe pump speed combination was 40 & 160 mL / min, the particle size of the formed empty LNPs was smallest (particle size of 34.24 nm), and the preparation time was also the shortest. Therefore, 40 & 160 mL / min was selected as the syringe pump speed combination for the lipid solution and oxidized solution and used for the preparation of empty LNPs.

[0239] Needle-type sorting In the process of optimizing drug loading, empty LNPs were prepared using the SY03 syringe pump system. The empty LNPs and the API solution passed through a microfluidic channel of a certain size in a laminar flow, passed through a combination of T-connectors at a certain flow rate combination (40 and 160 mL / min), which allowed for rapid and complete mixing. The needle sizes tested included 14G (inner diameter 1.60 mm, length 300 mm), 16G (inner diameter 1.19 mm, length 300 mM), and 18G (inner diameter 0.84 mm, length 300 mm). The particle size distribution was used as a criterion for selection. The experimental design and results are shown in the table below.

[0240]

Table 17

[0241] As can be seen from the results, when using needles of different diameters, there was no significant difference in the drug-loaded particle size distribution. When the needle was 16G, the particle size of the loaded LNPs was the smallest, at 42.10 nm. When the needle was 18G, due to the small inner diameter, the internal pressure was high, which might cause leakage of the solenoid valve of the syringe pump. Therefore, the diameter of the needle for drug loading by the microfluidic method was selected to be 16G.

[0242] Selection of the empty LNP and API solution syringe pump system In the process of optimizing drug loading, the SY03 syringe pump system was adopted to prepare API-loaded LNPs. The empty LNPs and the API solution passed through a microfluidic channel of a certain size in a laminar flow, passed through a combination of T-connectors at a certain flow rate combination (40 & 160 mL / min), which allowed for rapid and complete mixing. A 16G needle was placed to determine the influence of different syringe pump speed combinations of 160 & 160 mL / min, 80 & 80 mL / min, and 40 & 40 mL / min of the empty LNPs and the API solution. An appropriate syringe pump speed combination was determined using the particle size as a criterion. The experimental design and results are shown in the table below.

[0243] [Table 18]

[0244] The maximum flow rate of the SY03 syringe pump system was 170 mL / min. As can be seen from the results, there was no significant difference in the particle size distribution of WGI-0301 prepared with different injection rate combinations of empty LNP and API solution. When the syringe pump rate combination was 160 & 160 mL / min, the processing time was shortest, and a shorter processing time is preferable compared to WGI-0301 prepared by microfluidic technology. Therefore, 160 & 160 mL / min was selected as the syringe pump rate combination for empty LNP and API solution.

[0245] Selection of breeding temperature and breeding time Microfluidic continuous mixing techniques were used to prepare empty LNPs and to load them with APIs. In both preparations, the solutions were maintained at the same temperature. The conditions of the API solution (RX-0201 in sucrose solution), empty LNPs, and API-supported LNPs were studied at different incubation temperatures (25°C, 40°C, and 55°C) and incubation times.

[0246] RX-0201 readily dissolves in sucrose solution when stirred at room temperature. API solutions may be exposed to high temperatures for extended periods during continuous microfluidic processing. At high temperatures, RX-0201 is unstable, and impurities may increase. Small amounts of API were dissolved, and measurements and impurities were evaluated under different temperature conditions. The experimental design and validation results are as follows.

[0247] [Table 19]

[0248] RX-0201 was dissolved in a 20% sucrose solution, resulting in a final concentration of 1.88 mg / mL of free Archexin acid, which was the API solution (RX-0201 can dissolve in 20% sucrose solution, and since the dissolution time is very short, it did not need to be investigated). The stability of the API solutions was then studied by incubating them at 25°C, 40°C, and 55°C for 12 hours, respectively. As can be seen from the results, impurities increased over time at different temperatures, with the amount of impurities increasing with increasing temperature. However, it should be noted that the absence of significant changes in the measured values ​​is important.

[0249] Using the SY03 syringe pump system, the previously selected process parameters were used to prepare empty LNPs and API-loaded LNPs. The preparation / incubation temperatures for empty LNPs were set to 25°C, 40°C, and 55°C, respectively, and the particle size distribution, encapsulation effect, and effects on LPCs and impurities were studied for different incubation times (15 minutes, 30 minutes, 1 hour, 3 hours, 6 hours, 9 hours, 12 hours, and 24 hours). The preparation / incubation temperatures for empty LNPs were set to 25°C, 40°C, and 55°C, respectively, and the effects on LPCs and impurities were studied for different incubation times (15 minutes, 30 minutes, 1 hour, 3 hours, 6 hours, 9 hours, 12 hours, and 24 hours). The experimental design and results are as follows.

[0250] [Table 20]

[0251] [Table 21]

[0252] As can be seen from the results, when the incubation temperature was 25 °C, the particle size of the empty LNP gradually decreased with the increase of the incubation time (from 48.47 nm to 39.35 nm), the PDI gradually decreased with the extension of the incubation time (from 0.483 to 0.265), and the LPC content increased with the extension of the incubation time (from 0.013 mg / mL to 0.023 mg / mL).

[0253] When the incubation temperature was 4 °C, the particle size of the empty LNP gradually increased with the extension of the incubation time (from 37.23 nm to 46.46 nm), the PDI gradually decreased with the extension of the incubation time (from 0.340 to 0.233), and the LPC content was constant at 12 hours but increased at 24 hours.

[0254] When the incubation temperature was 55 °C, the particle size of the empty LNP within 12 hours gradually increased with the increase of the incubation time (from 41.54 nm to 49.75 nm), but decreased rapidly to 41.54 nm at 24 hours, indicating that the empty LNP may be damaged or crushed at 24 hours.

[0255]

Table 22

[0256] As can be seen from the results, when the incubation temperature was 25 °C, the particle size after drug loading increased from 48.47 nm to 59.66 nm, and the particle size of the drug-loaded LNP decreased slightly with the incubation time. When the incubation temperature was 40 °C, the particle size increased from 37.23 nm to 48.24 nm, and with the increase of the incubation time, there was no further significant change in the particle size. When the incubation temperature was 55 °C, the particle size after API loading increased from 41.54 nm to 58.12 nm, and with the increase of the incubation time, no significant change was observed in the particle size. When the preparation / incubation temperature was 40 °C, the changes in both the particle size and PDI were very small.

[0257] No significant changes were observed in the encapsulation rate or LPC content of LNPs incubated at different temperatures for 24 hours. At different temperatures, the maximum single and total impurities increased with increasing incubation time, and impurities increased rapidly at relatively high temperatures.

[0258] RX-0201 sucrose solution (API solution), empty LNPs, and API-supported LNPs were incubated at different temperatures (25°C, 40°C, and 55°C), and particle size distribution, measured values, impurities, LPC content, and encapsulation efficiency were evaluated. It was decided to prepare empty LNPs at 40°C, with an incubation time of 15 minutes.

[0259] Tangential flow filtration displacement solution A Spectrum hollow fiber membrane column (mPES; 100Ka 115 cm2) was used as the TFF (Tissue Filling) apparatus, and 0.9% NaCl solution and pH 7.4 PBS solution were used as TFF substitution solutions. These two types of TFF substitution solutions were studied to understand their effects on drug products. The experimental results are shown in the table below.

[0260] [Table 23]

[0261] Drug-carrying LNPs with physiological pH were exchanged using TFF with different buffer systems (0.9% NaCl solution or pH 7.4 PBS solution). As can be seen from the results, there were no significant differences in particle size distribution, measured values, encapsulation rate, lipids, LPC content, impurities, or residual solvent (ethanol) between the different buffer systems. No significant changes in particle size distribution were observed in freeze-thaw experiments. However, according to animal experiment data (lot number 19111301 / 02 / 03 / 04, TFF using pH 7.4 PBS buffer), some toxicity was observed when pH 7.4 PBS solution was used as the final buffer system. Furthermore, according to the literature, intravenous injection of pH 7.4 PBS solution has been shown to have some toxicity. Therefore, 0.9% NaCl solution was selected as the buffer solution.

[0262] TFF cycle verification A hollow fiber membrane column (mPES; 100Ka 115cm2) was used as the TFF module, and a 0.9% NaCl solution was used as the substitution buffer. TFF was performed for up to 8 cycles. Particle size distribution and residual solvent (ethanol) were used as selection criteria. The experimental results are shown in the table below.

[0263] [Table 24]

[0264] As the results show, no significant changes were observed in particle size or PDI with increasing TFF cycle count. Furthermore, the amount of residual ethanol decreased with increasing TFF cycle count. The proposed quality standard set residual ethanol at <0.25%. At least four TFF buffer exchange cycles are required to achieve the ethanol removal quality standard. The number of TFF buffer exchange cycles was set at six.

[0265] Selection of membrane filtration materials LNPs loaded with API were sterilized using Millipore Durapore® 0.22 μm PVDF syringe filters and Millipore Express® 0.22 μm PES syringe filters, respectively, and the effects of different filter materials on sterile filtration were examined.

[0266] [Table 25]

[0267] As the results show, no significant changes were observed in particle size distribution, measured values, encapsulation rate, LPC content, or impurities after sterile filtration with PVDF or PES membranes. The lipid content of LNPs filtered with PVDF or PES membranes was almost the same, and there was no significant difference in lipid retention and adsorption between the different membrane materials. Therefore, the selection of PVDF or PES membranes for the sterile filtration process is preferable because it does not significantly affect the chemical or physical properties of LNPs.

[0268] The test drug was stored at -20°C and warmed to room temperature before administration. In-use stability studies were performed on the test lot to evaluate the compatibility between the packaging components and the drug. The WGI-0301 product was thawed at 5°C ± 3°C and held at room temperature for 2 hours. The drug was diluted to concentrations of 0.019 mg / mL, 0.19 mg / mL, 0.47 mg / mL, and 0.70 mg / mL using 0.9% sodium chloride injection, and the diluted solutions were injected into PVC sterile bags. Sampling and testing were performed at 0 hours, 1.5 hours, and 6 hours, and the results are summarized in the table below.

[0269] Data on stability and compatibility during use showed a significant change in the Di(90) value when the sample solution was 0.019 mg / mL. The particle sizes of the 0.019 mg / mL and 0.19 mg / mL sample solutions from lot number QT-SY2020022 increased to 55 nm and 53 nm, respectively. No significant differences were observed in other specifications, indicating compatibility between the packaging components and the pharmaceutical product.

[0270] Furthermore, accelerated and long-term stability studies revealed that the packaging components are compatible with pharmaceuticals when stored at -20°C.

[0271] Example 3: In vivo effect of WGI-0301 in a mouse model of cancer The AKT pathway is an important therapeutic target in cancer drug development because it is a major point of transmission for extracellular and intracellular oncogenic signals. Furthermore, alterations in the AKT pathway have been observed in several cancers (Cheng, JQ, et al., Oncogene, 24(50), 7482-7492 (2005)). Archexin (also named RX-0201) is a fully thiophosphated 20-mer oligonucleotide complementary to Akt1 mRNA. Archexin can specifically target the Akt-1 mRNA sequence, which in turn suppresses translation to Akt-1 mRNA and the activity of its downstream pathways (Bellacosa, A., et al., Adv Cancer Res, 94, 29-86 (2005), Liang, J., et al., JM, Cell Cycle, 2(4), 339-345 (2003), Staal, SP Proc Natl Acad Sci USA, 84(14), 5034-5037 (1987), Staal, SP, et al. Proc Natl Acad Sci USA, 74(7), 3065-3067 (1977), Testa, JR, et al. Proc Natl Acad Sci USA, 98(20), 10983-10985 (2001) and Yoon, H., et al., J Cell Biochem, 108(4), 832-838 (2009). Archexin (RX-0201) was developed for cancer treatment under IND 69763. In vitro pharmacological studies revealed that Archexin's suppression of Akt-1 mRNA is sequence-specific. After treatment with Archexin, Akt-1 mRNA levels and Akt-1 protein expression were significantly reduced in human tumor cells of the brain, mammary gland, cervix, liver, lung, ovary, prostate, and stomach, as well as in melanin tumors. These studies also revealed that Archexin suppresses the proliferation of these human cancer cells.Archexin's growth inhibition appears to be dose-dependent, with the concentration range that elicited a 50% inhibition of cell growth (IC50) in these human cancer cells being 2nM to 50nM.

[0272] Three clinical trials of Archexin were conducted based on IND 69763: one Phase I monotherapy trial and two Phase II combination therapy trials. In the Phase I monotherapy dose-escalation trial, 17 subjects with advanced solid tumors received doses ranging from 6 to 315 mg / m2 / day for at least 14 consecutive days. The maximum tolerated dose of a single dose of the prepared Archexin was 250 mg / m2 / day, equivalent to 6.76 mg / kg / day.

[0273] WGI-0301 is a lipid nanoparticle formulation of Archexin. Non-clinical studies conducted to support the development of WGI-0301 included initial pharmacological studies that demonstrated the in vivo tumor-suppressing effect and survival-extending effect of WGI-0301 in cancer mouse models. Safety pharmacological studies were conducted to investigate any adverse pharmacological effects of WGI-0301 on the central and peripheral nervous systems, cardiovascular system, and respiratory system. In vivo pharmacokinetic and tissue distribution studies, as well as in vivo plasma stability studies, were conducted to characterize the distribution and metabolic stability of WGI-0301 in toxicological test subjects, and toxicological evaluations, including toxicological analysis of WGI-0301, were performed.

[0274] To evaluate the nonclinical safety of WGI-0301, acute toxicity studies were conducted in Sprague-Dawley rats and Beagle dogs to determine the maximum tolerated dose for these two animal species. Repeated dose toxicity was studied in rats and dogs after weekly intravenous administration for 1 hour over 29 days (a total of 4 weeks and 5 doses), followed by a 28-day recovery period. Further studies are being conducted to evaluate the potential immunotoxicity and in vitro hemolytic potential of WGI-0301 in dogs.

[0275] WGI-0301 was a modified lipid nanoparticle suspension of Archexin. Based on the tissue distribution characteristics of the lipid nanoparticles, the liver was the primary target of WGI-0301. In pharmacodynamic studies, mouse cancer models were selected to investigate the therapeutic effects of WGI-0301. In an in vivo Hepa1-6 liver cancer mouse model study (study number: E4275-T1906), after treatment with intravenous injection of WGI-0301 or Archexin, administered once weekly at a dose of 8 mg / kg each time (a total of four drugs), WGI-0301 showed better tumor suppression and significantly longer survival than Archexin. Compared to the excipient control group, the tumor growth inhibition rate for WGI-0301 was 46.16%, while the tumor growth inhibition rate for Archexin under the same dosing regimen was 3.32%. The median survival times for the carrier-control group, the Archexin treatment group, and the WGI-0301 treatment group were 37, 41, and 55 days, respectively, with a significant difference between the carrier-control group and the WGI-0301 treatment group (p=0.042).

[0276] Archexin lipid nanoparticle formulation WGI-0301 is expected to achieve promising antitumor and / or survival-prolonging effects with relatively low administration frequency and relatively low amounts of Archexin.

[0277] WGI-0301 demonstrated antitumor growth and extended survival in a mouse cancer model at a relatively low dose level of 8 mg / kg (0.65 mg / kg HED). Furthermore, no neurological behavioral changes related to the test substance were observed in rats, and no changes were observed in electrocardiographic qualitative and quantitative evaluations, blood pressure, heart rate, respiratory parameters, or neurological examination parameters. In vitro hERG measurements showed little inhibitory effect at Archexin free acid concentrations up to 274.1 μM.

[0278] Pharmacokinetic research The nonclinical pharmacokinetics of WGI-0301 were largely similar in the main species used for pharmacokinetic and toxicological evaluation (Sprague-Dawley rats and Beagle dogs). In all animal species that received a single dose of WGI-0301, the plasma half-life (T1 / 2) increased with increasing dose levels, and the systemic exposure to free Archexin (AUC0-last and Cmax) increased proportionally with increasing dose, except for AUC0-last in female dogs. In a 3-week period of weekly intravenous injection, a cumulative effect was observed in Cmax in male rats, but not in dogs. Studies of rat tissue distribution showed that WGI-0301 rapidly enters the liver, kidneys, and spleen from the bloodstream after administration and tends to reside in the liver for 7 days.

[0279] toxicity research In acute toxicity studies of WGI-0301, the lethal dose and MTD in rats were 12 mg / kg and 6 mg / kg, respectively, while the MTD in dogs was 9 mg / kg, which was the maximum tolerable dose. In a 4-week canine toxicological study, dogs were treated with intravenous injections of WGI-0301 up to 5 mg / kg weekly for 4 weeks (a total of 5 doses), and no adverse reactions were observed. The NOAEL and HNSTD of WGI-0301 in dogs were 5 mg / kg / dose, corresponding to a HED of 2.77 mg / kg. In a 4-week rat toxicological study, rats were given intravenous injections of 2, 4, or 6 mg / kg of WGI-0301 weekly for 4 weeks (a total of 5 doses), and there were no treatment-related adverse effects on morbidity / mortality, clinical symptoms, body weight, food consumption, ophthalmic examination, blood coagulation, and urinalysis.

[0280] Example 4: First human open-label dose-escalation study to evaluate the safety, tolerability, and pharmacokinetics of WGI-0301 (a lipid nanoparticle suspension of Akt-1 antisense oligonucleotide) in patients with advanced solid tumors. Cancer is the leading cause of death and a significant obstacle to increasing life expectancy worldwide. According to a 2019 World Health Organization (WHO) modeling study, cancer was the leading or second leading cause of death among those under 70 in 112 out of 183 countries, and the third or fourth leading cause in 23 other countries. In 2020, an estimated 19.3 million new cancer cases (18.1 million excluding non-melanoma skin cancers) were reported worldwide, and approximately 10 million people (9.9 million excluding non-melanoma skin cancers) died from cancer.[1] To date, available treatments for cancer include surgery, chemotherapy, hormone therapy, immunotherapy, and radiation therapy. Each of these treatments has its limitations, such as unbearable toxicity, insufficient efficacy, and limited accessibility to the general public. Therefore, the need for safe and effective treatments is constantly growing.

[0281] The Akt (also known as protein kinase B or PKB) gene family consists of three closely related proto-onco genes, known as Akt-1, Akt-2, and Akt-3, which are widely expressed. When activated, Akt protein products can phosphorylate various proteins, thereby regulating several cellular processes (Staal, 1987)[2]. In cancer cells, constitutively activated overexpression of the Akt-1 gene promotes cell transformation through two distinct mechanisms. Strong evidence shows that the Akt-1 protein plays a crucial role in the progression of cancer by stimulating cell proliferation and suppressing apoptosis. Akt-1 appears to promote proliferation even under conditions where cell growth should normally cease. Furthermore, Akt-1 suppresses apoptosis by inhibiting virtually all cell death-inducing molecules. Through these mechanisms, Akt-1 can promote the survival of tumor cells under conditions where they should normally die.

[0282] Furthermore, there is strong evidence that overexpression of p-Akt may contribute to the development and progression of malignancies (e.g., prostate cancer (Van de Sande, T et al., 2005)[3], breast cancer (Stal et al., 2003)[4], ovarian cancer (Kurose et al., 2001)[5], endometrial cancer (Uegaki et al., 2005)[6], squamous cell carcinoma (Massarelli et al., 2005)[7], and kidney cancer (Rathmell et al., 2005))[8] and may have adverse effects on prognosis. Elevated antiphosphorylation-specific Akt immunostaining was significantly associated with reduced cancer-specific survival and metastasis in renal cell carcinoma (Horiguchi et al., 2003)[9]. Elevated cytoplasmic and nuclear p-Akt levels were independent prognostic factors for reduced survival in patients with kidney cancer (Hager et al., 2009)

[10] . Regulating Akt-1 activity is an effective way to control cancer cell survival. Therefore, Akt-1 may be an attractive drug target in cancer treatment.

[0283] The potential of antisense oligonucleotides in gene silencing was discovered about 40 years ago, leading to increased interest in their chemical, mechanism of action, and metabolic pathway aspects. Currently, one approach to regulating Akt-1 involves using antisense oligonucleotides to alter and regulate the mRNA that controls Akt-1 expression and production.

[0284] Archexin is a 20-mer oligonucleotide (the API of WGI-0301) complementary to Akt-1 mRNA. Archexin has been tested in several in vitro and in vivo models, and these studies have demonstrated that Archexin is a selective and specific antitumor agent. In vitro studies have shown that Archexin specifically inhibits the growth of human cancer cells in the brain, breast, cervix, colon, kidney, liver, lung, ovary, pancreas, prostate, skin, and stomach by suppressing Akt mRNA and protein expression. In vivo studies have also shown that Archexin significantly inhibits tumor mass growth in human prostate and brain cancer cells in nude mice and improves the survival rate of human kidney or pancreatic cancer cells in nude mouse cancer models.

[0285] Archexin has demonstrated tolerability and safety in three clinical trials conducted in cancer patients to date. The most frequently reported adverse event (AE) was fatigue (70.6%), of which 29.4% were mild fatigue, 23.5% moderate fatigue, and 17.6% severe fatigue. Mild or moderate nausea, loss of appetite, and arthralgia were the second most frequently reported adverse events. Two Phase II trials of Archexin tested combination therapy with gemcitabine and everolimus for metastatic pancreatic cancer and renal cell carcinoma, respectively. However, neither of the primary objectives was achieved due to lack of therapeutic effect or early termination of the studies. Despite the early termination, the short duration of action of naked archexin is considered the main reason for its ineffectiveness.

[0286] To further advance research, WGI-0301 was designed to improve the in vivo delivery and therapeutic performance of the drug Archexin. WGI-0301 is formulated as a lipid nanoparticle suspension formulation of Archexin using a combination of quaternary and tertiary lipoamines and other neutral and stabilizing lipids for pH-sensitive delivery. Permanently ionized lipids and conditionally ionized lipids are widely used in LNP formulations for the delivery of nucleic acid drugs. The WGI-0301 product uses the quaternary cationic lipid DOTAP-CI, which is permanently positively charged regardless of pH conditions, to help condense large nucleic acid drugs into nano-sized stable complexes. The LNP formulation also contains DODMA as an ionized lipid, which is hardly charged at neutral pH and is cationized only under acidic conditions. When DODMA is incorporated into the LNP formulation, the DODMA becomes charged after endocytosis of the LNP, and then, under low pH conditions, the nucleic acid gene material encapsulated in the LNP, which is then filled into the LNP, facilitates its escape from late endosomes and lysosomes. Furthermore, Archexin's LNP formulation leverages its well-supported enhanced penetration and retention (EPR) effect and a cleavable PEG coating that reduces uptake by mononuclear phagocytic cell systems (MPS). As a result, Archexin preferentially accumulates within tumor sites, limiting off-target exposure.

[0287] Furthermore, in vivo animal studies of WGI-0301 have shown that it enhances efficacy, alters the tissue distribution profile within the liver, and makes liver cancer a very promising target. Further research is planned following the proposed initial human trials.

[0288] WGI-0301 is evaluated in patients with advanced solid tumors.

[0289] Preclinical research Pharmaceutical product WGI-0301 WGI-0301 was a lipid nanoparticle suspension of Archexin. Re-modification of Archexin improved its efficacy in cancer mouse models. In an in vivo model study of liver cancer mice, the tumor growth inhibition rate of WGI-0301 at 8 mg / mL, iv, QW*4 weeks was 46.16%, which was significantly higher than that of the same dose of Archexin, namely 3.32%.

[0290] Single dose and once-weekly dose for 3 weeks In rats and dogs, WGI-0301 was administered intravenously once a week for 1 hour, for a period of 3 weeks. In rats, the single-dose levels were 2, 4, and 6 mg / kg, and the weekly dose level was 4 mg / kg. In dogs, the single-dose levels were 0.75, 1.5, and 3 mg / kg, respectively, and the weekly dose level was 3 mg / kg.

[0291] clinical research The safety and tolerability of WGI-0301 in patients with advanced solid tumors were evaluated by determining dose-limiting toxicity (DLT), maximum tolerated dose (MTD), and / or recommended phase 2 dose (RP2D). The pharmacokinetic (PK) characteristics of WGI-0301 and free Archexin (where measurable) were determined in patients with advanced solid tumors. Initial tumor responses in patients with advanced solid tumors treated with WGI-0301 were evaluated. The relationship between potential biomarkers and their clinical responses was studied through biochemical and / or genetic analysis of blood and / or tumor samples (Akt-1 mRNA, pAkt-1, pGSK-3β, pPRAS40, PTEN). Immunogenicity (anti-WGI-0301, anti-PEG) and its impact on PK, PD, and clinical response (where applicable) were determined.

[0292] Product, dosage, and route of administration WGI-0301 is a lipid nanoparticle formulation of Archexin® used to treat advanced solid tumors. WGI-0301 was administered intravenously once weekly over one hour, with an initial dose of 0.1 mg / kg for four consecutive weeks (one cycle). Treatment cycles were continued unless disease progression, unacceptable toxicity, or any clinical findings meeting the discontinuation criteria were observed. Subjects with dose-limiting toxicity (DLT) were removed, and other subjects in the same cohort accepted the dose from the previous cohort.

[0293] For detailed information on handling and administering the test product, please refer to the "Pharmacy Manual."

[0294] method A "3+3" design was adopted to determine dose-limiting toxicity (DLT) and maximum tolerated dose (MTD) / recommended phase 2 dose (RP2D). Each treatment cohort consisted of 3 to 6 patients who received WGI-0301 via weekly 1-hour intravenous infusion for 4 weeks (1 cycle), with an initial dose of 0.1 mg / kg. All relevant safety data were reviewed and decided 28 days after the start of the cycle. Unless clearly interpreted by an underlying disease, comorbidity, or concomitant medication, all toxicities were considered WGI-0301-related, and the treatment cycle was continued unless disease progression, unacceptable toxicity, or clinical findings meeting any of the discontinuation criteria were detected. The 3+3 design was implemented as follows: Initially, 3 patients were enrolled in a cohort, and if one patient experienced a DLT, an additional 3 patients were enrolled. If one or more DLTs occurred in ≤6 patients in the treatment cohort, dose escalation was stopped, and the dose level was determined to be an unacceptable dose. In this case, the MTD may be defined as the previous low dose, or as the dose between the unacceptable dose and the previous low dose, and a more precise search may be required to define an appropriate MTD.

[0295] Dosage escalation plan The dose escalation in this study follows a modified Fibonacci schedule.

[0296] Before upgrading to the next higher dose level, the safety monitoring committee reviews the safety data for all patients at their previous dose level.

[0297] [Table 26]

[0298] [Table 27]

[0299] Dosage selection, dosing interval, and escalation schedule The starting dose is 0.1 mg / kg administered intravenously over one hour per week, in four-week cycles. Treatment cycles are continued unless disease progression, unacceptable toxicity, or clinical observations meeting the discontinuation criteria are observed. This dose selection is supported by toxicological and pharmacokinetic studies in rats and dogs.

[0300] The weekly dosing intervals in the proposed clinical study are the same as those investigated in repeated-dose toxicology studies in rats and dogs. Dose escalation in this study will follow a modified Fibonacci schedule. The exposure level of WGI-0301 at dose level 5, i.e., 1.3 mg / kg / week, falls within the safety margin obtained from repeated-dose toxicity studies in rats. Where possible, dose escalation will be continued cautiously up to 1.75 mg / kg to establish the maximum tolerated dose (MTD). The exposure level at the proposed maximum dose falls within the safety margin obtained from repeated-dose studies in dogs. Intensive clinical monitoring will be conducted based on the adverse events collected. Note that both the 1.3 and 1.75 mg / kg / week doses of WGI-0301 are USP <85> It meets the recommended endotoxin requirement of 5 EU / kg per hour. The endotoxin levels of the clinical trial drug have been retested, and the result is less than 2.5 mg / kg.

[0301] The total study period will be approximately 16 months. The number of treatment cycles is not fixed in this study. Participants who do not withdraw consent, experience disease progression (PD), or suffer unacceptable toxicity, and who continue to receive clinical benefit from the study treatment, may continue the study treatment. Patients can withdraw consent at any time. The principal investigator may discontinue treatment at any time in the best interests of the participant. Specific criteria for discontinuing patient participation are outlined.

[0302] DLT is defined, according to the National Cancer Institute Common Terminology Criteria for Adverse Events (NCI-CTCAE) version 5.0, as a treatment-related adverse event (TEAE) that occurs during the DLT evaluation period (day 1 to day 2) and is not attributable to the disease or disease-related process.

[0303] The number of study participants is approximately 24, depending on the size of the cohort being studied.

[0304] To participate in this study, subjects must meet all of the following criteria: The subject must have a histologically or cytologically confirmed progressive solid tumor that is not eligible for potentially curative treatment, has progressed from current treatment or relapsed after previous treatment, and is measurable as a disease based on RECIST 1.1. The subject must have a pathologically confirmed solid tumor. The subject must have an advanced solid tumor (unresectable or metastatic) that has failed standard treatment (disease progression or intolerance). The subject must understand written informed consent, submit a signed, dated, and witnessed written informed consent, and agree to follow the study protocol. The subject must be at least 10 years old at the time of the initial screening / examination visit. The subject must have an Eastern Cooperative Oncology Group (ECOG) performance status of 0-2 as measured within 72 hours after initial treatment. The subject must have adequate hematological function [absolute neutrophil count (ANC) ≥ 1.5 × 10⁹ / L], [platelets ≥ 100 × 10⁹ L], [hemoglobin ≥ 9 g / dL], and [serum albumin ≥ 2.8 g / dL]. Glomerular filtration rate (eGFR) ≥ 50 mL / min calculated using the CKD-EPI creatinine equation (2021). Adequate liver function (total bilirubin ≤ 1.5 x UNL, AST (aspartate transaminase) or ALT (alanine transaminase) ≤ 3 x UNL, or ≤ 5 x UNL if there is liver infiltration due to tumor). Women of childbearing age (WOCBP) must have negative pregnancy tests, and men must agree to use highly effective contraception if they have not undergone surgical sterilization before study participation, during drug administration, and for 3 months after the last dose. See Appendix 1 for acceptable effective contraceptive methods. Participants are expected to have a life expectancy of at least 12 weeks.

[0305] Subjects meeting one or more of the following criteria will be excluded: being breastfeeding, pregnant, or planning to become pregnant; having received anticancer therapy or other investigational drugs within four weeks prior to the first dose of the investigational drug; being a patient using a sensitive substrate for major cytochrome P450 enzymes and transporters, or a potent inducer of transporter P-gp, including apalutamide, carbamazepine, enzalutamide, mitotane, phenytoin, rifampicin, or St. John's wort, based on the FDA's Table of Drug Development and Drug Interactions, Substrates, Inhibitors, and Inducers. In patients using potent transporter inhibitors, prior to the initiation of the study treatment, all acute toxic effects from previous antitumor therapy have not resolved to Grade 1 (except for alopecia [Grade 1 or 2 is acceptable], neurotoxicity [Grade ≤ 2 is acceptable], or certain laboratory parameters [Grade < 2 is acceptable, with the exception of the following]), there is evidence of another malignancy that has not gone into remission within the past three years, or a history of such a malignancy (except for treated basal cell carcinoma or squamous cell carcinoma of the skin, or primary cervical cancer), synchronous malignancies other than carcinoma in situ, basal cell carcinoma, or squamous cell carcinoma of the skin.Low-grade prostate cancer treated with prostatectomy more than 5 years ago, early-stage melanoma treated with complete surgical resection more than 5 years ago, cervical intraepithelial neoplasia treated with conization more than 8 years ago, primary brain tumor or symptomatic central nervous system (CNS) metastases unless the metastases have been stable for 3 months, unstable bleeding disorder or receiving anticoagulation therapy for which no current standard exists (excluding the use of heparinized saline to maintain central venous catheter patency), a history of symptomatic congestive heart failure (New York Heart Association (NYHA) class II-IV) or severe arrhythmia requiring treatment, a history of myocardial infarction or unstable angina within 6 months prior to enrollment, QTcF prolongation exceeding 470 ms on three 12-lead electrocardiograms, or increased risk of participation in the trial as determined by the principal investigator. Other abnormalities include: having grade 3 or higher hypertension (≥160 / 100 mmHg) or ≤0 / 50 mmHg on re-examination; having a heart rate (HR) of ≥100 beats / min (bpm) or ≤45 bpm; having evidence of electrolyte imbalance such as NCI-CTCAE grade 2 or higher hypokalemia, hypocalcemia, or hypomagnesemia (symptoms present and requiring intervention); having undergone major surgery other than tumor resection within 4 weeks prior to screening; having uncontrolled diabetes mellitus, neurological or psychiatric disorder, a progressive systemic (including opportunistic) clinically significant infection, or any other serious or unstable comorbidity that the principal investigator has determined may increase the participant's risk; or having a history of human immunodeficiency virus (HIV).

[0306] References [1] Sung, H., Ferlay, J., Siegel, R. L., Laversanne, M., Soerjomataram, I., Jemal, A., & Bray, F. (2021). Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA: A Cancer Journal for Clinicians, 71(3), 209-249. [2] taal, S. P. (1987). Molecular cloning of the akt oncogene and its human homologues AKT1 and AKT2: amplification of AKT1 in a primary human gastric adenocarcinoma. Proc Natl Acad Sci U S A, 84(14), 5034-5037. [3] van de Sande, T., Roskams, T., Lerut, E., Joniau, S., van Poppel, H., Verhoeven, G., & Swinnen, J. V. (2005). High-level expression of fatty acid synthase in human prostate cancer tissues is linked to activation and nuclear localization of Akt / PKB. The Journal of Pathology, 206(2), 214-219. [4] Stal, O., Perez-Tenorio, G., AKerberg, L., Olsson, B., Nordenskjold, B., Skoog, L., & Rutqvist, L. E. (2003). Akt kinases in breast cancer and the results of adjuvant therapy. Breast Cancer Research, 5(2). [5] Kurose, K., Zhou, X. P., Araki, T., Cannistra, S. A., Maher, E. R., & Eng, C. (2001). Frequent Loss of PTEN Expression Is Linked to Elevated Phosphorylated Akt Levels, but Not Associated with p27 and Cyclin D1 Expression, in Primary Epithelial Ovarian Carcinomas. The American Journal of Pathology, 158(6), 2097-2106. [6] Uegaki, K., Kanamori, Y., Kigawa, J., Kawaguchi, W., Kaneko, R., Naniwa, J., Takahashi, M., Shimada, M., Oishi, T., Itamochi, H., & Terakawa, N. (2005). PTEN-positive and phosphorylated-Akt-negative expression is a predictor of survival for patients with advanced endometrial carcinoma. Oncology Reports. Published. [7] Massarelli, E., Liu, D. D., Lee, J. J., El-Naggar, A. K., lo Muzio, L., Staibano, S., de Placido, S., Myers, J. N., & Papadimitrakopoulou, V. A. (2005). Akt activation correlates with adverse outcome in tongue cancer. Cancer, 104(11), 2430-2436. [8] Rathmell, W. K., Wright, T. M., & Rini, B. I. (2005). Molecularly targeted therapy in renal cell carcinoma. Expert Review of Anticancer Therapy, 5(6), 1031-1040. https: / / doi.org / 10.1586 / 14737140.5.6.1031 [9] HORIGUCHI, A., OYA, M., UCHIDA, A., MARUMO, K., & MURAI, M. (2003). Elevated Akt Activation and Its Impact on Clinicopathological Features of Renal Cell Carcinoma. The Journal of Urology, 710-713.

[10] Hager, G. L., McNally, J. G., & Misteli, T. (2009). Transcription Dynamics. Molecular Cell, 35(6), 741-753.

[11] Kilanowska, A., & Studzinska, S. (2020). In vivoandin vitrostudies of antisense oligonucleotides - a review. RSC Advances, 10(57), 34501-34516.

[0307] Example 5: Study of the in vivo therapeutic effect of the test product in the treatment of a subcutaneous Hepa1-6 mouse cancer model in female C57BL / 6 mice. The purpose of this study is to evaluate the in vivo therapeutic effect of the test product in the treatment of a subcutaneous Hepa1-6 mouse liver cancer model in female C57BL / 6 mice.

[0308] Materials: Female house mice C57BL / 6. Mice were 7-8 weeks old. Mice were housed at a maximum density of 5 per cage in an environment of 20-26°C, 40-70% humidity, 12 hours light, 12 hours dark, and were freely supplied with standard rodent feed, irradiated feed, reverse osmosis (RO) water filtered through a 0.2 μm filter, and autoclaved food. Mice were monitored by daily cage-side observations and weekly clinical observations. Hepa1-6 tumor cells were maintained in vitro using 10% fetal bovine serum in DMEM medium at 37°C under a 5% CO2 atmosphere. Tumor cells were collected during the exponential growth phase and counted for tumor inoculation. Each mouse was subcutaneously inoculated into the right anterior flank with 0.1 mL of Hepa1-6 tumor cells (5 × 10⁶) in PBS to develop tumors.

[0309] experiment The processing of the Hepa 1-6 model studies is shown in Table 28 below.

[0310] [Table 28] Note: In this report, "empty LNP control" refers to the "RX-0301 (1:15) control" in all experimental records. Changes were approved by the sponsor.

[0311] Randomization was initiated when the average tumor size reached approximately 81 mm³. This study recruited a total of 48 mice, which were divided into six groups of eight mice each, as shown in Table 4. Randomization was performed using the "matched distribution" method (Study Director™ software, version 3.1.399.19). The date of randomization was designated as day 0.

[0312] After tumor inoculation, the incidence and mortality rates of the animals were observed daily. During the normal monitoring period, the effects of tumor growth and treatment on behavior, including activity, food and water consumption, weight gain / loss (weight measured twice a week after randomization), eyes / coat / paw pads, and any other abnormalities, were examined. Mortality rates and observed clinical symptoms per animal were recorded in detail.

[0313] After randomization, tumor volume was measured in two dimensions twice a week using calipers. The volume was expressed in mm³, and the formula was V=(LxWxW) / 2, where V was the tumor volume, L was the tumor length (longest tumor size), and W was the tumor width (longest tumor size perpendicular to L). Administration, tumor size, and body weight measurements were performed in a clean bench.

[0314] Study Director TM Body weight and tumor volume were measured using software (version 3.1.399.19).

[0315] Drug preparations TIFF2026514441000035.tif169162

[0316] Administration of the test substance Treatment was initiated on the day of randomization according to the study design (Table 4). Dosage in this Hepa1-6 model study was carried out from day 0 to day 21. If a mean BWL > 10% was observed in the treatment group, all mice were given Dietgel Recovery. To prevent cannibalism, animals exhibiting ulceration or necrotizing tumors were immediately isolated, housed individually, and monitored daily until the animals were euthanized or the tumors had completely regressed. Mice with tumor ulceration covering more than approximately 25% of the tumor surface were euthanized.

[0317] To compare tumor volumes in different groups on pre-specified dates, the assumption of homogeneity of variance across all groups was first confirmed using Bartlett's test. If the p-value of Bartlett's test was 0.05, a one-way ANOVA was performed to test the overall homogeneity of means across all groups. If the p-value of the one-way ANOVA was less than 0.05, Tukey's HSD (Honest Significance) test was performed for all paired comparisons, and Dunnett's test was performed to compare each treatment group with the median group for further post-hoc testing. If the p-value of Bartlett's test was less than 0.05, the Kruskal-Wallis test was performed to test the overall equality of medians across all groups. If the p-value of the Kruskal-Wallis test was less than 0.05, Conover's non-parametric test was performed for all paired comparisons, or for each treatment group with the median group, with a one-step p-adjustment, for further hoc tests. All statistical analyses were performed in R (version 3.3.1), a language and environment for statistical calculations and graphics. Unless otherwise specified, all tests were performed two-sided, and a p-value < 0.05 was considered statistically significant.

[0318] In the survival analysis, survival time was analyzed using the Kaplan-Meier method. Survival time was defined as the time from the randomization date to the animal's death or ethical endpoint. For each group, the median survival time (MST) and increase in lifespan (ILS) were calculated. Kaplan-Meier curves were also constructed for each group, and a log-rank test was used to compare survival curves between groups.

[0319] result Figures 5 and 6 show the results of weight and weight change at different points in time, respectively.

[0320] In this study, most mice experienced a slight or moderate weight loss after treatment, but they were able to gradually recover within the dosing interval. G4-118 mice were killed, and death of GS-197 mice was observed on day 9. The maximum mean weight loss for the negative control, empty LNP, RX-0201 (8 mg / kg), RX-0301 (15:1) (8 mg / kg), RX-0301 (12:1) (8 mg / kg), RX-0301 (10:1) (8 mg / kg), and RX-0301 group (7.5:1) (8 mg / kg) (administered from day 0) was none, -13.91% (day 2), none, -13.39% (day 2), -16.13% (day 3), -13.37% (day 2), and -10.71% (day 2), respectively. Mean tumor growth curves at different time points are shown in Figure 7. Table 29 below summarizes the tumor growth inhibition of test products used to treat a subcutaneous cancer model of Hepa 1-6 human liver cancer in female C57BL / 6 mice.

[0321] [Table 29] Note: a. Mean ± SEM, b. Comparison with tumor volume of Group 1 on day 30.

[0322] The detailed statistical analysis of the multiple comparisons on day 30 is as follows:

[0323] TIFF2026514441000037.tif146158

[0324] In this study, the average tumor size of negative control mice reached 1470.17 mm3 on day 30 after randomization. Empty LNP was administered at 0 mg / kg QW, and a mild antitumor effect was observed in the Hepa 1-6 model. The TGI value at day 30 was 26.56%, but there was no statistically significant difference compared to the control group (P>0.05). RX-0201 was administered at 8 mg / kg QW, and a mild antitumor effect was observed in the Hepa 1-6 model. The TGI value at day 30 was 3.32%, but there was no statistically significant difference compared to the control group (P>0.05). RX-0301 (15:1) was administered at 8 mg / kg QW, and a mild antitumor effect was observed in the Hepa 1-6 model. The TGI value at day 30 was 27.93%, but there was no statistically significant difference compared to the control group (P>0.05). RX-0301 (12:1) was administered at 8 mg / kg QW, and a mild antitumor effect was observed in the Hepa 1-6 model. The TGI value at day 30 was 41.87%, but there was no statistically significant difference compared to the control group (P>0.05). RX-0301 (10:1) was administered at 8 mg / kg QW, and a mild antitumor effect was observed in the Hepa 1-6 model. The TGI value at day 30 was 38.09%, but there was no statistically significant difference compared to the control group (P>0.05). RX-0301 (7.5:1) was administered at 8 mg / kg QW, and a mild antitumor effect was observed in the Hepa 1-6 model. The TGI value at day 30 was 46.16%, but there was no statistically significant difference compared to the control group (P>0.05).

[0325] Survival analysis Survival time was evaluated as the time it took for the tumor volume to reach 3000 mm3. The data were analyzed using Kaplan-Meier survival curves, which are shown in Table 30 and Figure 8.

[0326] [Table 30] Note: a. Compare with the carrier-control group using the Log-Rank test.

[0327] A detailed statistical survival analysis of multiple comparisons is as follows:

[0328] TIFF2026514441000039.tif25081

[0329] In this study, the median survival time (MST) for each group was also investigated. Mice with tumor volume exceeding 3000 mm3 were euthanized. RX-0301 (7.5:1) showed a significant therapeutic effect in extending the survival time of Hepa 1-6 tumor-bearing mice, but this effect was not observed with the other test products.

[0330] The tolerability and efficacy of the test sample were studied in a subcutaneous cancer model of Hepa1-6 liver cancer in female C57BL / 6 mice.

[0331] In summary, the designed dosing regimen resulted in good tolerability of Hepa 1-6 tumor-bearing mice over a 4-week treatment phase. Tumor volume statistical analysis was performed based on data from day 30, at which point all animals were either alive or did not meet the exclusion criteria of a tumor volume exceeding 3000 mm3. At day 30, the TGI% for empty LNP, RX-0201 (8 mg / kg), RX-0301 (15:1) (8 mg / kg), RX-0301 (12:1) (8 mg / kg), RX-0301 (10:1) (8 mg / kg), and RX-0301 (7.5:1) (8 mg / kg) were 26.56%, 3.32%, 27.93%, 41.87%, 38.09%, and 46.16%, respectively, compared to the carrier-control group. There were no significant differences between the treatment group and the carrier-control group. The experiment concluded on day 56, and the survival-prolonging effect of the test product was studied. Compared to the carrier control group and the RX-0201 treatment group, the RX-0301 (7.5:1) (8 mg / kg) group showed a significant therapeutic effect in extending the survival time of Hepa 1-6 tumor-bearing mice.

[0332] Example 6: Archexin free acid: Effect on current passing through cloned HERG potassium channels stably expressed in human fetal kidney (HEK293) cells using manual patch-clamp technique. The objective of this study was to evaluate the in vitro concentration-response relationship of the effect of free archexin acid on current passing through hERG (human ether-a-go-go-related gene) potassium channels (a rapidly activated delayed-rectifying cardiac potassium current, IKr) stably expressed in the HEK293 cell line using manual patch-clamp technique. Free archexin acid is the active pharmaceutical ingredient, and the concentrations of the test samples in this report represent the concentrations of free archexin acid.

[0333] Visual inspection revealed that free Archexin acid dissolved in extracellular solution (ECS) at concentrations up to 300 μM without precipitation. The highest concentration of free Archexin acid in the ECS was found at a pH of 6.9, which was within the target range of 6.5–7.8. pH adjustment was not necessary in the treatment medium.

[0334] To support the final dose selection, a dose range measurement was performed first. The ICso of free Archexin acid was determined using the final hERG measurement.

[0335] ECS was selected as the solvent based on the solubility of free Archexin acid.

[0336] For dose range testing, working solutions of free Archexin acid at 3, 30, and 300 μM were prepared. No precipitates were observed visually at any of the concentrations. Two cells were used for each of the three concentrations (3, 30, and 300 μM) to evaluate the effect of free Archexin acid on hERG current. Free Archexin acid inhibited hERG current by 5.99%, 6.63%, and 11.69% at 3, 30, and 300 μM, respectively. Therefore, the concentrations selected for final hERG measurements were 10, 30, 100, and 300 μM, with measured concentrations in the post-perfusion solution being 9.591, 26.85, 105.6, and 274.1 μM, respectively.

[0337] In the final hERG measurement, the working solution was analyzed. The measured concentrations of the concentration validation sample were within 82% to 104% of the nominal value, and the measured concentrations of the homogeneity validation sample were within 98% to 102% of the nominal value. The RSD (relative standard deviation) values ​​were within the acceptable range. Archexin free acid was not detected in the carrier / negative control working solution.

[0338] In the current study, the hERG current remained stable for at least 15 minutes in the negative control. The inhibition rate of the hERG current by 100 nM terfenadine was 78.84%, which was within the range of previous positive control data. The criteria for sealing, current amplitude, and solution perfusion met the predefined ranges. All of these data validated the measurement.

[0339] In the final hERG measurements, three replicated cells were used for each concentration of free Archexin acid, but no precipitation was observed at any concentration. Under the conditions of this study, the ICso value for the inhibitory effect of free Archexin acid on the hERG potassium current could not be determined, and no inhibitory effect of free Archexin acid on the hERG potassium current was observed up to a post-perfusion solution concentration of 274.1 μM.

[0340] The objective of this study was to evaluate the in vitro concentration-response relationship of the effect of artynine-free acid on current passing through hERG (human ether-a-go-go-related gene) potassium channels (a substitute for IKr, a rapidly activated delayed-rectifying cardiac potassium current) stably expressed in the HEK293 cell line using manual patch-clamp technique.

[0341] material and method Basic principles of ion channel and expression system selection Cardiac hERG potassium channels are responsible for rapid delayed rectifier current (IKr) in the human ventricle. Suppression of IKr is the most common mechanism of increased ventricular action potential duration caused by non-cardiac drugs. Increased action potential duration leads to QT interval prolongation on the electrocardiogram, associated with torsades de pointes, a dangerous ventricular arrhythmia. Therefore, testing the interaction between compounds and hERG potassium channels in heterologous expression systems is recommended by the International Council for Harmonisation of Technical Requirements for Registration of Pharmaceuticals for Human Use (ICH) as one of the nonclinical testing methods to assess the potential of test compounds to prolong the QT interval. In this study, hERG channels were stably expressed in human embryonic kidney (HEK293) cells.

[0342] This study used the human embryonic kidney cell line HEK293-hERG. HEK293-hERG cells were obtained from Sophion Biosciences BPS Biosciences (San Diego, CA) and subcultured and frozen at Yaoming Kangde (Suzhou) Co., Ltd. The cell stock was stored in liquid nitrogen. All batches of the cell stock were tested and determined to be free of mycoplasma contamination. Cells were not used after the 20th subculturing.

[0343] Culture medium and cell culture conditions The complete medium was MEM medium supplemented with 10% fetal bovine serum, 1% non-essential amino acids, 1 mM sodium pyruvate, 400 μg / mL Geneticin@selective antibiotic (G418), and 1% penicillin / streptomycin. The recovery medium was MEM medium containing 10% fetal bovine serum, 1% non-essential amino acids, and 1 mM sodium pyruvate.

[0344] HEK293 hERG cells were cultured in a humidified incubator in 5% CO2 (4%~8%) air at 37°C (±2°C).

[0345] The cells were restored in recovery medium and subcultured in complete medium. In the final subculture before the patch-clamp experiment, the culture medium was switched to recovery medium.

[0346] Solubility and pH tests The test samples were dissolved in ECS at a maximum concentration of 300 μM. The pH of the ECS containing the highest soluble concentration was 6.9 in the pH test, and was within the range of 6.5 to 7.8.

[0347] Dose range measurement For dose range measurement, the working solution concentrations of the test product were 3, 30, and 300 μM. Visual inspection of precipitation was performed before testing. To evaluate the effect on hERG current, the three concentrations of 3, 30, and 300 μM were tested, and two replicated cells were tested for each concentration.

[0348] Preparation of target cells We collected exponentially growing HEK293-hERG cells and used them suspended in an ECS.

[0349] Manual patch clamp setup hERG currents were recorded at physiological temperatures (33°C–37°C) using whole-cell patch-clamp technology. The output signals from the patch-clamp amplifiers were digitized and low-pass filtered at 2.9 kHz. Recording was controlled using Patchmaster Pro software.

[0350] A recording chamber inoculated with cells was placed on an inverted microscope stage. One cell from the recording chamber was randomly selected and tested. The cells were continuously perfused from a perfusion system.

[0351] In the manual patch-clamp study, micropipettes filled with ICS were used as recording electrodes. The micropipettes were prepared on the day of the patch-clamp experiment using a glass capillary (BF150-117-10, SUTTER INSTRUMENT USA). After filling with ICS, the pipette resistance (Rp) was in the range of 2–5 MO.

[0352] The cells were voltage-clamped to a holding potential of -80mV. The hERG current was activated by depolarizing at +60mV for 850ms, then the current was returned to -50mV and held for 1275ms to deactivate and observe the inactivation tail current. The peak tail current was measured and collected for data analysis. Finally, the voltage was lowered to the holding potential (-80mV). This command voltage protocol was continuously repeated every 15 seconds during the application of the test specimen. See Figure 9.

[0353] During the initial recording period using the carrier-control working solution, the peak-tail current amplitude was monitored for at least 10 sweeps until it stabilized. The average peak-tail current amplitude of the last 5 sweeps during the monitoring period was used as the current amplitude (initial current) of the carrier-control working solution.

[0354] Next, perfusion of the test sample was initiated at a low concentration and continued until the peak-tail current amplitude stabilized again after at least 10 sweeps and lasted for at least 5 minutes. Then, working solutions of higher concentrations of the test sample were applied. The average peak-tail current amplitude over the last 5 sweeps for each concentration was adopted as the peak-tail current amplitude for the concentration for data analysis.

[0355] Final hERG measurement For the final hERG measurements, working solutions of four test samples at concentrations of 10, 30, 100, and 300 μM were tested, based on the results of the dose-range measurements. Visual inspection of precipitates was performed before testing. Three replicated cells were tested for each concentration. Target cell preparation was performed as described in the dose-range measurements. Manual patch-clamp setup was performed as described in the dose-range measurements. Positive and negative controls were evaluated in the final measurements.

[0356] Negative control group A negative control was performed in a separate cell population (three cells) to assess current stability (rundown or runup) during a recording period of at least 15 minutes. The mean peak-tail current amplitude of the last five sweeps at 5-minute intervals was used to assess the decrease or increase in current. All values ​​were normalized to the values ​​for the first five minutes and expressed as percentages. A current decrease of less than 15% during the rundown or runup measurement period was considered acceptable.

[0357] Positive control To evaluate the validity of the test system, terfenadine was used as a positive control. In this study, a final working solution of 100 nM positive control was prepared. The positive control was detected in three cells.

[0358] To ensure consistent responsiveness of the test system, the suppression rate of positive controls must be equivalent to the historical positive control data range.

[0359] Quality control of manual patch clamp data acceptance

[0360] Seal standards: When acquiring the whole cell configuration, membrane parameters (Cm, Rm, and Rs) were collected while applying a holding potential (e.g., -80mV). A "good" whole cell record was generally defined as having a series resistance (Rs) less than 10 MΩ, a membrane resistance (Rm) greater than 500 MΩ, and a membrane capacitance (Cm) less than 100 pF.

[0361] Current amplitude criteria: Before administering the test sample / positive control, the peak current amplitude had to be between 400 pA and 5000 pA; otherwise, the cells were discarded.

[0362] Leak criteria: At a holding potential of -80 mV, the absolute leakage current must be less than 200 pA. The current amplitude was adjusted for a leakage current of -80 mV. Scans with an absolute leakage current greater than 200 pA were not used in the data analysis.

[0363] data For each cell, the percentage of inhibition for each test substance / positive control concentration is calculated based on the following formula. (1 - Test sample / Peak current amplitude of positive control working solution perfusion / Peak current amplitude of carrier control working solution perfusion (initial current)) x 100%. The suppression percentage values ​​of all recorded cells were averaged. The final ICso value of the test sample was determined by the Hill-fitted concentration-response curve in Origin software. y = Average value of suppression percentage values ​​for all recording units TIFF2026514441000040.tif2460 Here, Vmax = 100%, x = working solution concentration after perfusion of the test sample, n = Hill coefficient, and k = concentration of the test sample at 50% inhibition. The data is expressed as mean ± SEM. The data is expressed as mean ± SEM. TIFF2026514441000041.tif1236 Here the standard deviation is as follows: TIFF2026514441000042.tif2243x = mean (number 1, number 2…), n = sample size.

[0364] Acceptance Criteria During the monitoring period, the CV of the peak-tail current amplitude in the last 10 consecutive scans of the carrier control was less than 10%, eliminating any initial drop or rise. The steady-state current amplitude is defined as the coefficient of variation (CV) of the peak current amplitude over 10 consecutive scans. If the average current amplitude over 10 scans is less than 200 pA, then the CV is less than 10% or less than 30%. If the average percentage suppression value is less than 70%, the standard deviation (SD) of percentage suppression values ​​across different recording unit cells must be less than 15%. If the average percentage suppression value is greater than 70%, the SD of percentage suppression values ​​across different recording cells must be less than 10%.

[0365] result Solubility and pH tests The test sample was soluble in high concentrations of 300 μM and ECS, and no precipitation was observed at any concentration during visual inspection. pH testing showed that the pH of the ECS containing the 300 μM test sample was 6.9, which was within the acceptable range of 6.5 to 7.8. Therefore, there is no need to adjust the pH in the processing medium.

[0366] Analysis of the working and post-perfusion solutions Final hERG measurements showed that the concentration of free Archexin acid in the carrier / negative control working solution was lower than the limit of the Quantificationx dilution factor, indicating the absence of free Archexin acid in the carrier / negative control working solution. Concentration analysis verified the concentrations of free Archexin acid in 10, 30, 100, and 300 μM working solutions (all within the range of 82% to 104% of the nominal concentration), confirming the accuracy of the preparation of the test working solutions. Homogeneity analysis verified the homogeneity of free Archexin acid in 10 and 300 μM working solutions (all within the range of 98% to 102% of the nominal concentration, with RSDs of top, middle, and bottom samples of both formulations all within the range of 1% to 2%), demonstrating the homogeneity of the test working solutions. The concentrations of the working solutions corresponded to 10, 30, 100, and 300 μM, while the actual concentrations of the post-perfusion solutions were 9.591, 26.85, 105.6, and 274.1, respectively.

[0367] Dose range discovery and measurement In dose-range discovery measurements, three concentrations—3, 30, and 300 μM—were tested to evaluate the effect of free Archexin acid on hERG current, and two copy cells were tested at each concentration. The results of hERG current suppression are shown in Table 31. At 3, 30, and 300 μM, the average current suppression rates were observed to be 5.99%, 6.63%, and 11.69%, respectively.

[0368] [Table 31]

[0369] Final measurement According to the results of dose range discovery measurements, the concentrations of the working solutions of the test samples selected for the final hERG measurement were 10, 30, 100, and 300 μM. Table 32 shows the hERG current suppression data for negative controls, and Table 33 shows the hERG current suppression data for positive controls. Figure 10 shows the Archexin free acid concentration response curve, and Table 34 shows the hERG current suppression data for Archexin free acid.

[0370] [Table 32]

[0371] [Table 33]

[0372] [Table 34]

[0373] Negative control A negative control was tested in a single group of cells (3 cells), and current stability (decrease or increase) was evaluated during a recording period of at least 15 minutes. As can be seen from the results, no significant decrease or increase in current was observed during the recording period.

[0374] Positive control (terfenadine) Three copy cells were tested with a positive control of 100 nM terfenadine. No precipitation was observed at any concentration. The suppression rate of hERG current by 100 nM terfenadine was 78.84%, demonstrating the effectiveness of the measurement within the range of historical positive control data.

[0375] Archexin free acid Three copy cells were tested with Archexin free acid at each concentration. No precipitation was observed at any concentration. Based on the actual concentration of the post-perfusion solution, the ICso value for hERG current suppression of Archexin free acid was greater than 274.1 μM.

[0376] conclusion In this study, the hERG current was stabilized for at least 15 minutes in the negative control. The inhibition rate of the hERG current by 100 nM terfenadine was 78.84%, which was within the range of historical positive control data. The seal criteria, current amplitude, and leak criteria were within the predefined range, demonstrating the validity of this analysis. Under the conditions of this study, the ICso value for hERG current inhibition of Archexin free acid was greater than 274.1 μM, based on the actual concentration of the post-perfusion solution.

[0377] Example 7: WGI-0301 and sorafenib Indications for progressive HCC Hepatocellular carcinoma (HCC) is the most common liver cancer in adults in the United States. It is a primary malignancy of the liver and occurs in about 90% of patients with cirrhosis, with a low five-year survival rate (22% overall, 3.5% in patients with metastatic disease). Major risk factors for HCC include chronic hepatitis B or C virus infection, alcoholic liver disease, and non-alcoholic fatty liver disease or non-alcoholic steatohepatitis [1]. As of January 1, 2020, there were 102,997 people living with liver cancer and intrahepatic cholangiocarcinoma in the United States (<0.1% of the population). The mortality rate from liver cancer and intrahepatic cholangiocarcinoma from 2016 to 2020 was 6.6 per 100,000 people. In 2023, the number of new cases is estimated at 41,210 and the number of deaths at 29,380 [2].

[0378] Several factors limit the effectiveness of treatment, including impaired liver function, chemotherapy resistance of the tumor, and high expression of drug resistance genes [3]. On the other hand, HCC is an angiomoma in which angiogenesis plays a major role in tumor growth and metastasis [4].

[0379] The proposed clinical use of WGI-0301 is to treat advanced HCC as a second-line treatment for patients who have failed frontline immunotherapy (IO) in combination with the tyrosine kinase inhibitor (TKI) sorafenib. In recent years, immunotherapies or combinations of immunotherapies with superior efficacy data have gradually become mainstream as first-line treatments for advanced HCC. However, these patients receiving IO therapy or IO combination therapy may eventually become resistant to or unable to tolerate frontline treatment, and there are limited sequential and subsequent treatment options based on strong clinical evidence for such patients. As of the time of submission, this study received orphan drug designation from the FDA on September 20, 2023.

[0380] WGI-0301 and sorafenib combination therapy This study aims to determine the MTD of WGI-0301 in combination with sorafenib for advanced HCC and to evaluate the safety and efficacy of WGI-0301 in combination with sorafenib in the treatment of advanced unresectable HCC in adults who have previously received PD-1 / PD-L1 immune checkpoint suppressors.

[0381] The rationale for the study evaluating the combination of WGI-0301 and sorafenib compared to sorafenib alone in patients with advanced HCC is as follows:

[0382] Treating advanced HCC in patients who have previously received PD-1 / PD-L1 immune checkpoint suppressors remains a significant challenge with unmet medical needs.

[0383] Systemic therapy plays a crucial role in the treatment of advanced HCC. Previously, the standard first-line systemic treatments for advanced HCC were sorafenib and lenvatinib. However, rapid advances in immunotherapy and molecular targeted therapy have altered the systemic treatment strategy for advanced HCC. Second-line systemic therapies include regorafenib, cabozantinib, and ramucirumab. All current options are approved for patients previously treated with sorafenib. The treatment landscape for advanced HCC that progresses or becomes toxic after first-line therapy is different now. Combination therapy with atezolizumab and bevacizumab (Atezo-Bev) is currently the first-line treatment due to its superior survival benefits compared to sorafenib [5]. There is little data to guide the selection of second-line therapy in patients whose disease progresses on first-line IO therapy. In patients who have previously received PD-1 / PD-L1 immune checkpoint suppressors and whose liver function is well-preserved, there is no established best way to order available systemic treatment options. Therefore, there remains a high level of unmet medical need for patients with progressive HCC whose disease has progressed with immunotherapy or who could not tolerate immunotherapy drugs.

[0384] Sorafenib represents a significant therapeutic advance as a monotherapy for advanced HCC.

[0385] Sorafenib has a well-studied safety profile and is readily available to patients due to its long history of clinical use. It was the first systemic treatment to demonstrate a placebo-over-overall survival (OS) benefit in patients with HCC, validated by a randomized controlled trial.[6] The drug has been used worldwide for more than a decade to treat advanced HCC. However, atezobev or the durvalumab-tremelimumab combination has shown superior OS results than sorafenib.[5,7] Sorafenib may be an alternative first-line treatment option for patients with contraindications or limited access to atezobev or durvalumab-tremelimumab, or it may be used empirically as a second-line treatment after IO therapy. As shown in several small retrospective studies, sorafenib may provide a moderate survival benefit compared to placebo in patients with advanced HCC whose disease progressed during atezobev treatment.[8] Aside from empirical use, the role of sorafenib combination therapy as a second-line therapy for patients whose disease has progressed on first-line IO therapy is not well established.

[0386] The combination of WGI-0301 and sorafenib has shown potential synergistic antitumor activity in HCC.

[0387] WGI-0301 may enhance the antitumor effect of sorafenib through various mechanisms of action (MoA). In preclinical models, synergistic effects have been observed when WGI-0301 is used in combination with sorafenib, with enhanced inhibition of angiogenesis and tumor growth. This combination therapy is attracting attention because no significant interaction between WGI-0301 and cytochrome P450 enzymes has been observed, suggesting a low likelihood of pharmacokinetic drug interactions with concurrent sorafenib therapy. Preliminary evaluations have indicated that the combination of WGI-0301 and sorafenib is highly safe and effective, and is a promising candidate for the treatment of advanced HCC, particularly in patients who have developed resistance to PD-1 / PD-L1 inhibitors. Ongoing research into this combination therapy could bring new perspectives to HCC management and represent a significant step forward in the search for more effective cancer treatments.

[0388] The combination of WGI-0301 and sorafenib may offer a mechanism to overcome sorafenib resistance.

[0389] Sorafenib is a well-supported, foundational treatment for HCC, backed by strong evidence and clinical experience. Unfortunately, drug resistance to sorafenib is becoming increasingly common due to compensatory activation of the PI3K / AKT pathway.

[0390] Drug resistance is a complex phenomenon involving multiple mechanisms, including the activation of signaling pathways such as phosphatidylinositol 3 kinase (PI3K) / AKT / mammalian target of rapamycin (mTOR). Sorafenib can activate the PI3K / AKT pathway, and the potential compensatory mechanisms presented by the PI3K / AKT pathway may cause sorafenib resistance in HCC patients [9]. Current preclinical and clinical evidence suggests that inhibitors of the PI3K / AKT / mTOR pathway may help evade cancer cell resistance in combination with other anticancer therapies

[10] . Double blockade with AKT-1 inhibitors may prevent or delay the development of resistance. Therefore, there is also an opportunity to investigate whether different therapeutic combinations can overcome sorafenib resistance and improve the response in HCC patients, and sorafenib and WGI-0301 as a combination therapy strategy is worth further investigation.

[0391] Indications The combination of WGI-0301 and sorafenib will be studied in patients with advanced HCC who have previously received PD-1 / PD-L1 immune checkpoint suppressor therapy.

[0392] General method This study investigates whether the combination of WGI-0301 and sorafenib improves clinical outcomes in patients with advanced HCC in second-line treatment. It follows a two-stage design consisting of a dose escalation phase (Phase 1: patients with advanced HCC) and a dose expansion phase (Phase 2: patients with advanced HCC who have received up to one immunotherapy).

[0393] In Phase 1, the MTD / RP2D of WGI-0301 in combination with sorafenib will be investigated using a "conventional 3+3" study design, and the PK, PD, safety, tolerability, and preliminary efficacy of the combination therapy for advanced HCC will be evaluated. The starting dose of WGI-0301 will be 0.6 mg / kg / week, with sorafenib 400 mg administered orally in BID (Block Intake). In Phase 1, three dose levels of WGI-0301 (0.6, 1.0, and 1.3 mg / kg / week) in combination with sorafenib are planned. Once the MTD / RP2D of WGI-0301 is determined in Phase 1 by the Safety Monitoring Committee (SMC), Phase 2 will be initiated.

[0394] In Phase 2, the safety and efficacy of combinations of different WGI-0301 dose levels with standard dose sorafenib, or standard dose sorafenib alone, in a 2:2:1 ratio will be evaluated in patients with advanced HCC who have received up to one line of PD-1 / PD-L1 immune checkpoint suppressor or combination therapy as first-line treatment.

[0395] Phases 1 and 2 were conducted in both the United States and China. The U.S. site will initiate Phase 1 as soon as it receives FDA approval, regardless of the status of the China segment. If one or more sites are activated, the study will be conducted using a competitive registration method.

[0396] Types of clinical trials conducted within one year of submission An open-label Phase 2 trial investigating the combination therapy of WGI-0301 and sorafenib as a second-line treatment for patients with advanced HCC will be conducted in the United States and China. The U.S. site will initiate Phase 1 upon FDA approval, regardless of the status of the China segment. If one or more sites are activated, the study will be conducted using a competitive registration method. Once the MTD / RP2D of WGI-0301 in combination with sorafenib is determined by the SMC in Phase 1, Phase 2 will commence.

[0397] Estimated number of patients Approximately 9 to 18 people register in Stage 1, and approximately 50 people register in Stage 2.

[0398] risk As of October 30, 2023, 11 patients with advanced solid tumors have been enrolled in the ongoing Phase 1 clinical trial of WGI-0301 monotherapy (WGI0301P1U, NCT05267899). Dose escalation is continuing without any DLTs up to a dose level of 0.6 mg / kg / week. The most frequently observed adverse events (≥20% of patients) in the WGI-0301 monotherapy clinical trial (WGI0301P1U), regardless of causal relationship, were dehydration, anemia, fluid-related reactions, and hyperglycemia. To date, no Grade 3 or higher treatment-related adverse events (TRAEs) or serious treatment-related adverse events have been identified. Further clinical trial data will continue to be collected and closely monitored to establish the safety profile of WGI-0301.

[0399] Fluid response In cases of fluid reflexology, it is crucial for clinical staff to recognize and differentiate anaphylactic reactions. While both reactions may share some overlapping characteristics, anaphylaxis is accompanied by respiratory distress (wheezing, dyspnea, cyanosis, etc.), hypotension, and peripheral organ dysfunction, which are not typically seen in standard fluid reflexology reactions. As of October 30, 2023, 3 out of 11 subjects (27.3%) in the safety analysis dataset developed mild to moderate fluid reflexology reactions without pretreatment. Events associated with WGI-0301 were classified into categories of adverse events of LNP infusion products that may occur during or immediately after administration of LNP-containing therapy, based on the severity of symptoms, the presence or absence of respiratory dysfunction, and the response to treatment (steroids and antihistamines). The exact causes of fluid reflexology reactions to LNP products are not always clear; they are thought to be caused by the body's immune response to the LNP itself or the payload delivered by the LNP. Components of LNP preparations, such as lipid mixtures, may also influence these reactions. To minimize the likelihood of such events occurring, prophylactic regimens including corticosteroids and antihistamines, with or without nonsteroidal anti-inflammatory drugs, were proposed and used during Phase I studies recommended by the SMC Committee. Serum tryptase tests are also performed to rule out anaphylaxis. However, at the base, care must always be taken to distinguish between anaphylaxis and fluid reactions using available emergency medications and equipment.

[0400] hepatotoxicity Regarding hepatotoxicity, as of October 30, 2023, no clinically significant elevations in liver function tests (LFT) have been observed during the Phase I trial. Furthermore, the incidence of severe drug-induced liver injury, defined as transaminases exceeding 20 times the upper limit of normal or accompanied by significant clinical sequelae (e.g., elevated INR, ascites, fatal event, or transplantation), was 2 out of 3,357 patients (0.06%) in the global sorafenib monotherapy database. However, treating patients with advanced HCC using WGI-0301 and sorafenib requires maintaining a careful balance between therapeutic efficacy and the potential for hepatotoxicity, even in patients with Child-Pugh liver function class A. Therefore, this study will frequently perform LFT to capture early signs through clinical evaluation. If elevated LFT is observed, researchers should address the significant increase in liver enzymes or bilirubin levels by discontinuing treatment or reducing the dose, as described in Section 6.2 of the study protocol.

[0401] immunogenicity It is not known that antibody formation or immune responses occur in response to oligonucleotide administration. No immunogenic activity was detected in patients during Phase 1 and Phase 2 clinical trials of Archexin. However, WGI-0301 is an LNP-encapsulated version of Archexin, and the immunogenicity of the encapsulated API and the lipid nanoparticles themselves will be tested during the study. Assays to measure binding and neutralizing antibodies are currently under development. Once validation is complete, collected samples will be tested for immunogenicity in the proposed study.

[0402] Immune-related adverse events Regarding immune-related adverse events (irAEs), special attention was paid to discontinuation rules and management plans in the WGI-0301 FIH study. However, no immune-related adverse events or cytokine release syndromes have been reported to date. The relationship with dose is complex, and the immune system's response to treatment is not always predictable; therefore, it is important to carefully monitor all patients receiving immunotherapy, regardless of dose. Dose adjustment, temporary suspension or discontinuation of treatment, and the use of corticosteroids or other immunosuppressants are common strategies for managing irAEs when they occur.

[0403] hyperglycemia Hyperglycemia has also been reported with other cancer therapies that target the PI3K / AKT pathway. This pathway plays a crucial role in regulating insulin sensitivity and glucose metabolism

[11] . As a result, hyperglycemia is one of the most common targeted side effects of PI3K / AKT inhibitors. Management of this side effect is extremely important, and it is necessary to follow ADA guidelines or other local guidelines based on the latest experience and consensus regarding hyperglycemia induced by such therapies.

[0404] Other risks or sorafenib-related risks Other potential risks associated with this combination, such as gastrointestinal reactions, abdominal pain, fatigue, and other nonspecific adverse events, should be collected, reported, and managed with all possible efforts. Among the risks listed on the sorafenib label, the most common side effects observed in at least 20% of patients thought to be sorafenib-related include fatigue, weight loss, rash / desquamation, hand-foot skin reactions, alopecia, diarrhea, loss of appetite, nausea, and abdominal pain. For additional risks associated with patients taking sorafenib, refer to the sorafenib prescribing information.

[0405] References 1.Asafo-Agyei, Kwabena O. 「Hepatocellular Carcinoma.」 StatPearls - NCBI Bookshelf, 12 Feb. 2023. 2.SEER*Explorer Application. seer.cancer.gov / statistics- network / explorer / application.html?site=35&data_type=5&graph_type=12&compareBy=sex &chk_sex_1=1&chk_sex_3=3&chk_sex_2=2&series=9&race=1&age_range=1&prev_durati on=1&advopt_precision=1&hdn_view=1&advopt_show_apc=on&advopt_display=2. 3.Marin, Jose J. G., et al. 「Molecular Bases of Drug Resistance in Hepatocellular Carcinoma.」 Cancers, vol. 12, no. 6, MDPI, June 2020, p. 1663. 4.Yang, Zhen, and Ronnie T. P. Poon. 「Vascular Changes in Hepatocellular Carcinoma.」 Anatomical Record-advances in Integrative Anatomy and Evolutionary Biology, vol. 291, no. 6, Wiley, June 2008, pp. 721-34. 5.Finn RS, Qin S, Ikeda M, et al. Atezolizumab plus Bevacizumab in Unresectable Hepatocellular Carcinoma. N Engl J Med. 2020 May 14.382(20):1894-1905. 6.Llovet JM, Ricci S, Mazzaferro V, et al. SHARP Investigators Study Group. Sorafenib in advanced hepatocellular carcinoma. N Engl J Med. 2008 Jul 24.359(4):378-90. 7.Abou-Alfa GK, Chan SL, Kudo M et al. Phase 3 randomized, open-label, multicenter study of Tremelimumab (T) and Durvalumab (D) as first-line therapy in patients (pts) with unresectable hepatocellular carcinoma (uHCC): HIMALAYA. J Clin Oncol 2022.40(4Suppl.):379. 8.Yoo C, Kim JH, Ryu MH et al. Clinical Outcomes with Multikinase Inhibitors after Progression on First-Line Atezolizumab plus Bevacizumab in Patients with Advanced Hepatocellular Carcinoma: A Multinational Multicenter Retrospective Study. Liver Cancer. 2021 Apr;10(2):107-114.[6] Neeraj Agarwal, Sumanta K. Pal, Richard C, et al. Results of a phase II study to evaluate the safety and efficacy of RX-0201 in combination with everolimus in subjects with metastatic renal cell carcinoma (mRCC). J Clinical Oncol 37:646-646. 9.Manning BD, Toker A. AKT / PKB Signaling: Navigating the Network. Cell. 2017 Apr 20;169(3):381-405. 10.Fruman DA, Chiu H, Hopkins BD, et al. The PI3K Pathway in Human Disease. Cell. 2017 Aug 10;170(4):605-635. 11.Huang X, Liu G, Guo J, et al. The PI3K / AKT pathway in obesity and type 2 diabetes. Int J Biol Sci. 2018 Aug 6;14(11):1483-1496. doi: 10.7150 / ijbs.27173. 12.Qin, Shukui, et al. 「Pembrolizumab Versus Placebo as Second-Line Therapy in Patients From Asia With Advanced Hepatocellular Carcinoma: A Randomized, Double-Blind, Phase III Trial.」 Journal of Clinical Oncology, vol. 41, no. 7, American Society of Clinical Oncology, Mar. 2023, pp. 1434-43. 13.「American Cancer Society | Cancer Facts and Statistics.」 https: / / cancerstatisticscenter.cancer.org / data-analysis / 91Q4dqjU 14.「American Cancer Society | Cancer Facts and Statistics.」 https: / / cancerstatisticscenter.cancer.org / data-analysis / dw1qthUo

[0406] Example 8: Evaluation of in vivo therapeutic efficacy of WGI-0301 combined with a tyrosine kinase inhibitor (TKI) (lenvatinib, sorafenib, or cabozantinib) in the treatment of a human liver cancer Hep3B-luc in-situ model in female Balb / c nude mice. Archexin is a fully thiolated 20-mer antisense oligonucleotide that is complementary to AKT-1 mRNA and can inhibit the translation and downstream pathway activity of AKT-1 messenger ribonucleic acid. WGl-0301 is a dedicated lipid nanoparticle formulation (QTsome™) of Archexin, intended to enhance delivery. Currently, a Phase I clinical study of WGl-0301 as monotherapy for patients with advanced solid tumors is underway in the United States. Given the limited efficacy of TKIs compared to immunotherapy and the ever-increasing drug resistance, the combination of WGl-0301 and TKl may enhance the therapeutic response to TKl by suppressing AKT-1 and overcoming drug resistance through enhanced angiogenesis blockade.

[0407] WGI-0301 is a study of the therapeutic efficacy of WGI-0301 in combination with lenvatinib, sorafenib, or cabozantinib to treat a human liver cancer Hep3B-luciferase home position model in female Balb / c nude mice. 64 female Balb / c nude mice were randomly divided into two groups (8 mice each), including a carrier-control group. Mice were treated for 28 days with either WGI-0301, lenvatinib, sorafenib, cabozantinib, or WGI-0301 in combination with lenvatinib / sorafenib / cabozantinib. WGI-0301 was administered intravenously at a dose of 8 mg / kg once weekly for a total of four doses, while lenvatinib / sorafenib / cabozantinib were administered orally at doses of 10 mg / kg, 20 mg / kg, and 20 mg / kg, respectively, for a total of 28 days. Body weight was monitored twice weekly. Whole-body fluorescence imaging was performed twice a week, and tumor burden was measured using bioluminescence. After discontinuing medication, treatment was temporarily suspended from day 29 to day 70 to observe survival.

[0408] [Table 35] aN: Animal number. b. Lenvatinib and cabozantinib were prepared in DMSO:0.5% CMC-Na=1:49 (v / v), sorafenib in cremophor EL:(95%) ethanol=1:1 (v / v), and WGI-0301 was prepared in physiological saline. The carrier for group 1 was physiological saline. c. Dosage volume: Adjust the dosage volume of 10 μL / g based on body weight. d. PG-D0 patients are divided into groups, and treatment is initiated starting with PG-D1. The administration plan for lenvatinib, sorafenib, and cabozantinib is QD, and the administration method for the carrier and WGI-0301 is QW. e. Treatment is temporarily suspended from PG-D29, and survival observation is performed until PG-D70, with body weight measured twice a week and bioluminescence measured once a week.

[0409] Experimental method cell culture Hep3B-luc (derived from Wuxi) tumor cells were maintained in vitro in EMEM medium at 37°C, in an atmosphere of 5% CO2 in air, supplemented with 10% fetal bovine serum and 1% antibiotic / antifungal agent. Tumor cells were subjected to two standard weekly subculturing cycles. Cells that had grown during the exponential growth phase were harvested and counted for use in tumor inoculation.

[0410] Tumor Inoculation Each mouse was inoculated with tumor cells (3 x 10⁶) mixed with 0.02 mL of DPBS and Matrigel (volume ratio = 1:1) into the left lobe of its liver to promote tumor development. Four days after cell inoculation, when the tumors reached an average bioluminescence of 3.85 x 10⁷ photons / second, they were randomly divided into groups and administered the following day, with each group consisting of 8 mice. The animals were randomly divided into PG-D0 groups and into PG-D1 groups on the first day of administration. Randomization software based on Excel was used to divide the animals into groups, and hierarchical randomization was performed based on their bioluminescence values. Each group consisted of 8 tumor-bearing mice. The test samples were administered to the mice according to the predetermined plan shown in the experimental design sheet (Table 35).

[0411] Preparation of carrier solvent and test product formulation [Table 36] TIFF2026514441000049.tif87158 Note: a. Lenvatinib, sorafenib, and cabozantinib stock solutions were stored at -20°C. b. Lenvatinib and cabozantinib diluents were kept at 4°C and used within 3 days of preparation. Sorafenib and WGI-0301 were freshly prepared before use. Processing started from c.PG-D1.

[0412] observation The proposed plan for animal husbandry and use in this study, as well as any proposed modifications or procedures, were reviewed and approved by the IACUC (Institute of Animal Husbandry, Care and Use) prior to implementation. During the study period, animal husbandry and use were carried out in accordance with the regulations of the Association for the Evaluation and Accreditation of Laboratory Animal Husbandry and Care (AAALAC). After inoculation, the incidence and mortality rates of the animals were examined daily. During the normal monitoring period, the animals were examined for tumor growth and the effects of treatment on normal behavior, such as activity level, food and water consumption, weight gain / loss, eye / coat / paw pad and any other abnormal effects. Deaths and observed clinical symptoms were recorded based on the number of animals in each subgroup.

[0413] Tumor measurement and endpoints Mice inoculated during surgery were weighed and luciferin was injected intraperitoneally at a dose of 150 mg / kg. Ten minutes after luciferin injection, the animals were pre-anesthetized with a mixture of oxygen and isoflurane. When the animals were fully anesthetized, the mice were transferred to an imaging chamber and bioluminescence measurements were performed using the IVIS (Lumina III) imaging system.

[0414] The primary endpoint was whether the growth of tumor bioluminescence could be delayed, reduced, or eliminated, and the other primary endpoint was observing the survival time of mice after treatment, e.g., death of one mouse or reaching the euthanasia criterion. The goal was to prevent bioluminescent metastasis of tumors or cure mice. Body weight was measured twice a week. Bioluminescence values ​​of the entire animal (including primary and metastatic tumors) were measured and recorded twice a week during the treatment period. After treatment, survival time was observed, and the bioluminescence values ​​of the animals were measured once a week. If the animal's health deteriorated, it died (significant weight loss of 20% or more), it was unable to eat or drink normally, or it was unable to move or was paralyzed, a veterinarian's notice had to be prepared. After veterinarian's evaluation, the animal was euthanized immediately with carbon dioxide if necessary. The RTB of each mouse was calculated using the formula RTB = Bt / B0, where Bt was the tumor bioluminescence value of the mouse on a given date and B0 was the tumor bioluminescence value of the mouse on the day of group assignment.

[0415] The T / C ratio (expressed as a percentage) is an indicator of antitumor efficacy. The T / C ratio (%) for each group was calculated using the formula T / C% = TRTB / CRTB x 100. TRTB was the average RTB of the treatment group on a given date, and CRTB was the average RTC of the carrier-control group on the same date as the treatment group.

[0416] The TGI (%) for each group was calculated using the formula TGI(%) = [1 - (Ti - T0) / (Ci - C0)] × 100, where Ti was the average tumor bioluminescence value of the treatment group on a given date, T0 was the average tumor bioluminescence value of the treatment group on the first day of treatment, Ci was the average tumor bioluminescence value of the carrier / control group on the day of Ti addition, and C0 was the average tumor bioluminescence value of the carrier group on the first day of treatment.

[0417] Based on the survival time of animals within each group, the average survival time (in days) for each group was calculated, and the extended lifespan was analyzed based on the average survival times of the treatment group and the excipient group.

[0418] statistical analysis Summary statistical data (including mean and standard error of mean (SEM)) of bioluminescence for each group at each time point are provided. Statistical analysis was performed based on the bioluminescence of PG-D24 to evaluate differences between groups. A t-test was used for comparisons between two groups. Dunnett's one-way ANOVA and multiple comparison tests were used for group comparisons. Data were analyzed using SPSS and GraphPad Prism 9. A p<0.05 value was considered statistically significant.

[0419] result As the results show, the antitumor effect (TGI: 66.05%, 86.81%, 75.89%) of the combination group (WGI-0301 with lenvatinib, sorafenib, or cabozantinib) was superior to that of the lenvatinib / sorafenib / cabozantinib group (TGI: 50.84%, 55.68%, 47.84%). The fluorescence signal intensity (56.74*10⁸, 22.28*10⁸, 40.40*10⁸ photons / sec) of the combination group was slightly lower than that of the lenvatinib / sorafenib / cabozantinib group (81.97*10⁸, 73.95*10⁸, 86.96*10⁸ photons / sec). The median survival time (MST) in the combination therapy groups was 55.5, 58.0, and 53.5 days, respectively, slightly higher than that of the lenvatinib / sorafenib / cabozantinib groups (46.0, 55.5, and 51.5 days). Based on limited safety endpoints (mortality, clinical symptoms, and body weight), there was no substantial increase in toxicity in mice treated with WGI-0301 with lenvatinib 8+10 mg / kg, WGI-0300 with sorafenib 8+20 mg / kg, and WGI-030 with cabozantinib 8+20 mg / kg compared to lenvatinib / sorafenib / cabozantinib monotherapy. No serious adverse reactions were observed in the combination therapy groups.

[0420] Compared to lenvatinib / sorafenib / cabozantinib, which is currently used in clinical practice, the combination of WGI-0301 and lenvatinib / sorafenib / cabozantinib showed superior antitumor efficacy. Without a significant increase in toxicity, the combination of WGI-0301 and TKls demonstrated superior antitumor efficacy compared to TKI monotherapy.

[0421] The results are shown in Figures 11-18 and Tables 35-42.

[0422] Mortality rate, clinical observations, and weight gain / loss As an indirect measure of toxicity, the animals' body weight was monitored regularly. During the course of treatment, mouse #8-3 in group 4 (sorafenib, 20 mg / kg, oral administration, QDx4W) showed a weight loss of more than 15% on PG-D24, so it was provided with PG-D25 to PG-D27 dietary gels to maintain its weight. Veterinary autopsy revealed that mouse #1-1 in group 1 (carrier, intravenous injection, QWx4W) died on PG-D27, and the cause of death was possibly related to deterioration of health due to a large tumor.

[0423] In the carrier group, three mice showed abdominal distension and in-situ liver protrusion 17 days after administration. In the WGI-0301, lenvatinib, and cabozantinib groups, six mice, one mouse, and one mouse showed abdominal distension and liver protrusion 21, 21, and 24 days after administration, respectively. No significant abnormalities were observed in the other treatment groups during the treatment period. Details of the clinical observations are shown in Table 37.

[0424] Body weight (BW) and BW change curves in the treatment efficacy study using the Hep3B-luc model are shown in Figures 11 and 12.

[0425] [Table 37] TIFF2026514441000051.tif222157 TIFF2026514441000052.tif67160

[0426] Bioluminescence curve Figure 14 shows the tumor bioluminescence curves after administration of the test substance to female Balb / c nude mice suffering from Hep3B-luc tumors.

[0427] Bioluminescence intensity Tables 38 and 39 show the average bioluminescence values ​​over time for female Balb / c nude mice carrying human cancer cells Hep3B-luc.

[0428] [Table 38] TIFF2026514441000054.tif169162 a. Data are shown as mean ± SEM. b. Number of days after grouping. c. Due to animal deaths, bioluminescence data from PG-D24 onward was incomplete.

[0429] [Table 39] a. Data are shown as mean ± SEM. b. Bioluminescence data for the number of days after grouping and the survival observation period.

[0430] Tumor growth suppression analysis Based on bioluminescence measured in PG-D24, the tumor growth inhibition of the test material for treating female Balb / c nude mice carrying human hepatocellular carcinoma Hep3B-luc was calculated. The data are shown in Tables 40 and 41.

[0431] [Table 40] a. Data are shown as mean ± SEM. Data analysis was performed based on the bioluminescence of PG-D24, rather than PG-D28, because the bioluminescence data for PG-D28 was incomplete due to animal death. b. Tumor growth inhibition (TGI) was calculated using the formula TGI(%) = [1 - (T24 - T0) / (C24 - C0)] × 100, where T24 = average bioluminescence value of PG-D24 in the treatment group and C24 = average biofluorescence value of PG-D4 in the control group. Antitumor activity (T / C) was calculated using the formula T / C% = TRTB / CRTB × 100, where TRTB = average RTB of PG-D24 in the treatment group and CRTB = average RTB of PG-D4 in the control group. c. One-way ANOVA was performed using SPSS to compare the bioluminescence values ​​of the carrier group and the treatment group. ns: no significant difference, * indicates p<0.05.

[0432] [Table 41] a. An independent sample t-test was performed using SPSS to compare the bioluminescence values ​​of group 3 and group 6. ns: No significant difference. b. An independent sample t-test was performed using SPSS to compare the bioluminescence values ​​of group 4 and group 7. ns: No significant difference. c. An independent sample t-test was performed using SPSS to compare the bioluminescence values ​​of group 5 and group 8. ns: No significant difference.

[0433] survival Following the IACUC protocol, euthanasia was performed on animals whose health deteriorated due to excessive tumor size or significant weight loss. The average survival time of the animals was observed to be 42 days. The average survival time of the carrier group animals was 37.63 days. The mean animal survival times for Group 2 (WGI-0301, 8 mg / kg), Group 3 (lenvatinib, 10 mg / kg), Group 4 (sorafenib, 20 mg / kg), Group 5 (cabozantinib, 20 mg / kg), Group 6 (WGI-0301 + lenvatinib, 8 + 10 mg / kg), Group 7 (WGI-0301 + sorafenib, 8 + 20 mg / kg), and Group 8 (WGI-1031 + cabozantinib, 8 + 20 mg / kg) were 35.88, 47.00, 53.25, 52.25, 53.00, 58.88, and 53.75 days, respectively. The mean survival rates for each treatment group were 95.35%, 124.90%, 141.51%, 138.85%, 140.85%, 156.47%, and 142.84%, respectively. The median survival time for the carrier group was 35 days. The median survival times for animals in groups 2 (WGI-0301, 8 mg / kg), 3 (lenvatinib, 10 mg / kg), 4 (sorafenib, 20 mg / kg), 5 (cabozantinib, 20 mg / kg), 6 (WGI-0301 + lenvatinib, 8 + 10 mg / kg), 7 (WGI-0301 + sorafenib, 8 + 20 mg / kg), and 8 (WGI-1031 + cabozantinib, 8 + 20 mg / kg) were 35.5, 46.0, 55.5, 51.5, 55.5, and 53.5 days, respectively.

[0434] The Kaplan-Meier survival curves for each group of animals are shown in Figures 15, 16, and 17. The results of the survival time analysis are shown in Table 42.

[0435] [Table 42] a. Mean survival time ± SEM. b. The mean survival rate (%) was calculated by dividing the mean survival time of the drug group by the mean survival time of the control group. c. Using GraphPad Prism 9, the median survival time and p-value were calculated based on survival analysis compared to the control group. **: p<0.01, *: p<0.05, ns: no significant difference.

[0436] Summary and Review of Results This study investigated the therapeutic effects of WGI-0301, used to treat a human liver cancer Hep3B-luc in-situ model, in combination with lenvatinib, sorafenib, or cabozantinib in female Balb / c nude mice.

[0437] As an indirect measure of toxicity, animal body weight was monitored regularly. Body weight and changes in body weight after administration of the test substance are shown in Figures 11 and 12. On day 27 of administration, mouse #1-1 in the carrier group was found to have died. Based on veterinary autopsy evaluation, this may be related to decreased physical strength due to tumor overload. Mice treated with lenvatinib 10 mg / kg and sorafenib 20 mg / kg (monotherapy or combination therapy) showed a slight decrease in body weight during the treatment period. Based on mortality, clinical symptoms, and body weight endpoint data, no substantial increase in toxicity was observed in mice treated with WGI-0301 + lenvatinib 8 + 10 mg / kg, WGI-0301 + sorafenib 8 + 20 mg / kg, and WGI-0301 + cabozantinib 8 + 20 mg / kg compared to lenvatinib / sorafenib / cabozantinib monotherapy.

[0438] T / C and TGI are both indicators of antitumor treatment efficacy, and PG-D24 data are shown in Tables 40 and 41. Compared to the carrier group (bioluminescence = 166.36 x 10⁸ photons / second), WGI-0301 + sorafenib 8 + 20 mg / kg and WGI-0301 + cabozantinib 8 + 20 mg / kg showed significant antitumor activity, with mean bioluminescence of 22.28 x 10⁸ photons / second (T / C = 12.75%, TGI = 86.81%, p = 0.014) and 40.40 x 10⁸ photons / second (T / C = 23.52%, TGI = 75.89%, p = 0.030), while WGI-0301 8 mg / kg, lenvatinib 10 mg / kg, sorafenib 20 mg / kg, cabozantinib 20 mg / kg and WGI-0301 + lenvatinib 8 + 10 The mg / kg dose showed a mild tumor-suppressing effect, with mean bioluminescence values ​​of 161.59 x 10⁸ photons / sec (T / C=98.53%, TGI=2.87%, p=1.000), 81.97 x 10⁸ photons / sec (T / C=51.36%, TGI=50.84%, p=0.249), 73.95 x 10⁸ photons / sec (T / C=33.80%, TGI=55.68%, p=0.327), 86.96 x 10⁸ photons / sec (T / C=46.38%, TGI=47.84%, p=0.392), and 56.74 x 10⁸ photons / sec (T / C=33.59%, TGI=66.05%, p=0.064). Based on T / C and TGI data, the antitumor effects of the combination therapy groups WGI-0301 + lenvatinib 8 + 10 mg / kg (TGI=66.05%), WGI-0301 + sorafenib 8 + 20 mg / kg (TGI=86.81%), and WGI-0301 + cabozantinib 8 + 20 mg / kg (TGI=75.89%) were superior to those of the monotherapy groups lenvatinib 10 mg / kg (TGI=50.84%), sorafenib 20 mg / kg (TGI=55.68%), and cabozantinib 20 mg / kg (TGI=47.84%), respectively.

[0439] After 28 days of treatment, the animals were observed to have a survival time of 42 days. Animals died or were euthanized according to the IACUC protocol due to significant weight loss or deterioration in health. The mean survival time and median survival time for the carrier group were 37.63 days and 35 days, respectively. The mean and median animal survival times for WGI-0301 8 mg / kg, lenvatinib 10 mg / kg, sorafenib 20 mg / kg, cabozantinib 20 mg / kg, WGI-0301 + lenvatinib 8 + 10 mg / kg, WGI-031 + sorafenib (8 + 20 mg / kg), and WGI-0301 + cabozantinib (8 + 20 mg / kg) were 35.88 and 35.50 days, 47.00 and 46.00 days, 53.25 and 55.50 days, 52.25 and 51.50 days, 53.00 and 55.50 days, 58.88 and 58.00 days, 53.75 days, and 53.50 days, respectively. Compared to the carrier group, sorafenib 20 mg / kg, WGI-0301 + lenvatinib 8 + 10 mg / kg, WGI-0301 + sorafenib 8 + 20 mg / kg, and WGI-0301 + cabozantinib 8 + 20 mg / kg significantly extended the survival time of Hep3B-luc situ tumor model mice. Compared to monotherapy, combination therapy showed slightly longer survival time in mice.

[0440] In summary, mice treated with WGI-0301 in combination with sorafenib (8+20 mg / kg) and WGI-0301 in combination with cabozantinib (8+20 mg / kg) showed significant antitumor activity against mice carrying in-situ tumors of Hep3B-luc, and their survival time was extended. Sorafenib 20 mg / kg and WGI-0301 + lenvatinib 8+10 mg / kg showed mild tumor suppression effects and could also extend the survival time of mice. Compared to monotherapy, the combination of WGI-0301 with lenvatinib / sorafenib / cabozantinib showed better suppression of tumor growth in mice carrying in-situ tumors of Hep3B-luc and could better extend the survival time of mice without a significant increase in toxicity.

[0441] The scope of compositions and methods described in the attached claims is not limited by any specific compositions and methods described herein, and any specific compositions and methods described herein are intended to illustrate some aspects of the claims, and any functionally equivalent compositions and methods are intended to be included in the claims. In addition to the compositions and methods shown and described herein, various modifications to the methods are intended to be included in the claims. Furthermore, although only certain representative compositions and method steps disclosed herein are specifically described, other combinations of these compositions and method steps, even if not specifically described, are intended to be included in the claims. Thus, while combinations of steps, elements, compositions or components may be explicitly or implicitly referred to herein, other combinations of steps, elements, compositions or components are also included, even if not explicitly described. The terms “includes” and its variations as used herein are synonymous with the terms “inclusion” and its variations, and are open and non-restrictive terms. While the terms “including” and “incorporating” are used herein to describe various embodiments, the terms “substantially consisting of” and “consisting of” may be used in place of “including” and “incorporating” to provide more specific embodiments of the invention, which are also disclosed. Unless otherwise specified in the examples or specifically stated, all figures used in the specification and claims to represent amounts of components, reaction conditions, etc., should be understood to be at least as such, and should not attempt to limit the application of the doctrine of equivalents to the claims, but should be interpreted according to the number of significant figures and ordinary rounding.

Claims

1. A pharmaceutical composition comprising lipid nanoparticles encapsulating an activator, wherein the lipid nanoparticles are 2.5 mol% to 15 mol% of one or more cationic lipids, 30 mol% to 50 mol% of one or more types of ionized lipids, One or more types of neutral lipids in an amount of 30 mol% to 65 mol%, and A pharmaceutical composition comprising 2.5 mol% to 15 mol% of one or more types of PEG-modified lipids.

2. The composition according to claim 1, wherein the activator comprises RX-0201,5'gctgcatgatctccttgggcg 3',SEQ ID NO:

1.

3. The composition according to claim 2, wherein RX-0201 is an antisense oligonucleotide.

4. The composition according to any one of claims 2 to 3, wherein RX-0201 has at least one modified nucleoside bond which is a phosphorothioate bond.

5. The composition according to any one of claims 1 to 4, wherein the one or more cationic lipids are present in the lipid nanoparticles in an amount of 2.5 mol% to 12.5 mol%, or 2.5 mol% to 10 mol%.

6. The one or more cationic lipids mentioned above are DOTMA:[1-(2,3-silyloxy)propyl]-N,N,N-trimethylammonium chloride, DMRIE, di-C14-amidine, DOTIM, SAINT, DC-Chol, BGTC, CTAP, DODAP, DOSPA (2,3-dioleoyloxy-N-[2-(spermidinecarboxamide)ethyl]-N,N-dimethyl-1-propanaminonium trifluoroacetate), DORIE (N-[1-(2,3-dioleoyl) [Dimyristoyloxypropyl]-N,N-dimethyl-N-hydroxyethylammonium bromide), DODAB, DOIC, DMEPC, DOGS: Dioctadecylamide glycidylamine, DIMRI: Dimyristoyloxypropyl dimethylhydroxyethylammonium bromide, DOTAP: Dioleoyloxy-3-(trimethylammonium)propane, DC-6-14: O,O-ditetradecanoyl-N-α-trimethylaminoacetyl)diethanolamine chloride, CLIP 1: Racemy-[(2,3-dioctadecyloxypropyl)(2-hydroxyethyl)]-dimethylammonium chloride, CLIP6: Racemy-[2(2,3-dihexadecyloxypropoxymethoxy)ethyl]-trimethylammonium, CLIP9: Racemy-[2(2,3-dihexadecyloxypropoxysuccinoyloxy)ethyl]-trimethylammonium, oligofectamine, lipids described in U.S. Patent No. 5,049,386, N-[1-(2,3-dioleoyloxypropyl)]-N, disclosed in International Publication Nos. WO91 / 16024 and WO97 / 019675 The composition according to any one of claims 1 to 5, comprising N-dimethyl-N-hydroxyethylammonium bromide (DORIE), 2,3-dioleoyloxy-N-[2-(spermidinecarboxamide)ethyl]-N,N-dimethyl-1-propanaminonium trifluoroacetate (DOSPA), and (3R,4R)-3,4-bis((Z)-hexadeca-9-enoxy)-1-methylpyrrolidine and N-methyl-N,N-bis(2-((Z)-octadeca-6-enoxy)ethyl)amine disclosed in International Publication No. WO2011 / 13636, or any combination thereof.

7. The composition according to any one of claims 1 to 6, wherein the one or more types of neutral lipids are present in the lipid nanoparticles in an amount of 40 mol% to 55 mol%.

8. The composition according to any one of claims 1 to 7, wherein the one or more neutral lipids include dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylethanolamine (DOPE), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), palmitoyloleoylphosphatidylcholine (POPC), phosphatidylcholine (EPC), distearoylphosphatidylcholine (DSPC), cholesterol, or any combination thereof.

9. The composition according to any one of claims 1 to 8, wherein the one or more types of neutral lipids include cholesterol.

10. The composition according to any one of claims 1 to 9, wherein the one or more types of PEG-modified lipids are present in the lipid nanoparticles in an amount of 2.5 mol% to 10 mol%, or 5 mol% to 10 mol%.

11. The composition according to any one of claims 1 to 10, wherein the one or more PEG-modified lipids include PEG-ditetradecylacetamide, PEG-myristoylglycerol diester, PEG-diacylglycerol, PEG-dialkoxypropyl, PEG-phospholipid, PEG-ceramide, PEG-DMG, PEG-DSPE, or any combination thereof.

12. The composition according to any one of claims 1 to 11, wherein the one or more PEG-modified lipids include 1,2-dimiristoyl-sn-glycero(DMG-PEG).

13. The composition according to any one of claims 1 to 12, wherein the one or more ionized lipids are present in the lipid nanoparticles in an amount of 35 mol% to 45 mol%.

14. The aforementioned one or more ionized lipids are N,N-dimethyl-2,3-dioleoyloxypropylamine (DODMA), [(4-hydroxybutyl)azadiyl]bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315), 8-{(2-hydroxyethyl)[6-oxo-6-(undecyloxy)hexyl]amino}octanoic acid 9-heptadecyl ester (SM-102), International Publication No. WO2 The composition according to any one of claims 1 to 13, comprising DLin-MC3-DMA, DLin-KC2-DMA, DLinDMA, etc. disclosed in International Publication No. 005 / 121348, DLin-K-DMA, etc. disclosed in International Publication No. WO2009 / 086558, 1-(2,3-bis(((9Z,12Z)-octadecenyl-9,12-dien-1-yl)oxy)propyl)pyrrolidine (A066), or any combination thereof.

15. The composition according to any one of claims 1 to 14, wherein the one or more ionized lipids include N,N-dimethyl-2,3-dioleoyloxypropylamine (DODMA).

16. The composition according to any one of claims 1 to 15, wherein the lipid nanoparticles include DOTAP, DODMA, DOPC, cholesterol, and DMG-PEG.

17. The composition according to claim 16, wherein the DOTAP, DODMA, DOPC, cholesterol, and DMG-PEG are present in a molar ratio of 5:40:25:20:10 for DOTAP:DODMA:DOPC:cholesterol:DMG-PEG.

18. The composition according to claim 16, wherein the DOTAP, DODMA, DOPC, cholesterol, and DMG-PEG are present in a molar ratio of 5:40:27.5:20:7.5 for DOTAP:DODMA:DOPC:cholesterol:DMG-PEG.

19. The composition according to claim 16, wherein the DOTAP, DODMA, DOPC, cholesterol, and DMG-PEG are present in a molar ratio of 5:40:30:20:5 for DOTAP:DODMA:DOPC:cholesterol:DMG-PEG.

20. The composition according to any one of claims 1 to 19, wherein the lipid nanoparticles and the activator are present in a weight ratio of lipid nanoparticles to activator of 5:1 to 20:1, 7.5:1 to 15:1, 7.51:1 to 10:1, 7.5:1 to 12:1, 10:1 to 12:1, 10.1 to 15:1, or 12:1 to 15:

1.

21. The composition according to any one of claims 1 to 20, wherein the lipid nanoparticles and the activator are present in a weight ratio of lipid nanoparticles to activator of 15:1, 12:1, 10:1, or 7.5:

1.

22. The composition according to any one of claims 1 to 21, wherein the composition comprises a group of lipid nanoparticles, and the group of lipid nanoparticles has an average particle size of 50 nm to 80 nm, 55 nm to 75 nm, or 55 nm to 60 nm as measured by dynamic light scattering.

23. The composition according to any one of claims 1 to 22, wherein the composition comprises a group of lipid nanoparticles, and the group of lipid nanoparticles has an average particle size of about 55 nm as measured by dynamic light scattering.

24. The composition according to any one of claims 1 to 23, wherein the composition comprises a group of lipid nanoparticles, and the group of lipid nanoparticles has an average zeta potential of -06 mV to 2.5 mV.

25. The composition according to any one of claims 1 to 24, wherein the composition comprises a group of lipid nanoparticles, and the group of lipid nanoparticles has an average zeta potential of -5.5 mV.

26. The composition according to any one of claims 1 to 25, wherein the composition comprises a group of lipid nanoparticles, and the group of lipid nanoparticles has a polydispersity index (PDI) of 0.15 to 0.5, 0.15 to 0.4, 0.15 to 0.3, 0.15 to 0.2, 0.2 to 0.3, 0.2 to 0.5, 0.2 to 0.4, 0.2 to 0.3, 0.3 to 0.4, 0.3 to 0.5, or 0.4 to 0.

5.

27. The composition according to any one of claims 1 to 26, wherein the lipid nanoparticles are dispersed in a pharmaceutically acceptable carrier.

28. A method for treating cancer, preventing cancer, preventing cancer metastasis, preventing cancer recurrence, or preventing angiogenesis, comprising the step of administering a pharmaceutical composition according to any one of claims 1 to 27 to a subject who requires it.

29. The method according to claim 28, wherein the subject is a human.

30. The method according to any one of claims 28 to 29, wherein the cancer is hepatocellular carcinoma.

31. The method according to any one of claims 28 to 30, wherein the administration includes oral administration, local administration, transdermal administration, transdermal absorption administration, intra-articular administration, intra-arterial administration, intradermal administration, intraventricular administration, intrafocal administration, intranasal administration, rectal administration, intravaginal administration, administration by inhalation, administration via an implantable storage device, subcutaneous injection, intravenous injection, intramuscular injection, intra-articular injection, intrasynovial injection, intrasternal injection, intrathecal injection, intraperitoneal injection, intrahepatic injection, intrafocal injection, intracranial injection, or administration by infusion techniques.

32. The method according to any one of claims 28 to 31, wherein the composition is administered in combination with other activators or therapies.

33. The method according to claim 32, wherein the additional activator or therapy includes radiotherapy, chemotherapy agents, immunomodulators, antigens, or any combination thereof.

34. The method according to any one of claims 28 to 33, wherein the composition is administered in combination with a tyrosine kinase inhibitor.

35. The method according to any one of claims 28 to 34, wherein the composition is administered in combination with a vascular endothelial growth factor (VEGF) inhibitor.

36. The method according to any one of claims 28 to 35, wherein the composition is administered in combination to the subject with sorafenib or a pharmaceutically acceptable salt, prodrug or derivative thereof, lenvatinib or a pharmaceutically acceptable salt, prodrug or derivative thereof, cabozantinib or a pharmaceutically acceptable salt, prodrug or derivative thereof, or any combination thereof.

37. The method according to any one of claims 28 to 35, wherein the composition is administered in combination to the subject with sorafenib or a pharmaceutically acceptable salt, prodrug or derivative thereof, and lenvatinib or a pharmaceutically acceptable salt, prodrug or derivative thereof.

38. The method according to any one of claims 28 to 35, wherein the composition is administered in combination to the subject with sorafenib or a pharmaceutically acceptable salt, prodrug or derivative thereof, and cabozantinib or a pharmaceutically acceptable salt, prodrug or derivative thereof.

39. The method according to any one of claims 28 to 35, wherein the composition is administered in combination to the subject with lenvatinib or a pharmaceutically acceptable salt, prodrug or derivative thereof, and cabozantinib or a pharmaceutically acceptable salt, prodrug or derivative thereof.

40. The method according to any one of claims 28 to 35, wherein the composition is administered in combination to the subject with sorafenib or a pharmaceutically acceptable salt, prodrug, or derivative thereof.

41. The method according to any one of claims 28 to 35, wherein the composition is administered in combination to the subject with lenvatinib or a pharmaceutically acceptable salt, prodrug, or derivative thereof.

42. The method according to any one of claims 28 to 35, wherein the composition is administered in combination to the subject with cabozantinib or a pharmaceutically acceptable salt, prodrug, or derivative thereof.

43. The method according to any one of claims 28 to 35, wherein the composition is administered in combination to the subject with sorafenib or a pharmaceutically acceptable salt, prodrug or derivative thereof, lenvatinib or a pharmaceutically acceptable salt, prodrug or derivative thereof, and cabozantinib or a pharmaceutically acceptable salt, prodrug or derivative thereof.

44. A method for inducing cytotoxicity in a subject's cancer cells, comprising the step of contacting the cells with a pharmaceutical composition according to any one of claims 1 to 27.

45. A method for producing a group of lipid nanoparticles containing an activator, (a) A step of mixing one or more ethanol solutions containing a lipid mixture with an aqueous solution and oxidizing them to induce the formation of empty lipid nanoparticles, (b) A step of generating a group of lipid nanoparticles containing an activator by contacting the empty lipid nanoparticles with an aqueous solution containing an activator, (c) The lipid nanoparticles containing the activator are subjected to tangential flow filtration to replace the buffer solution and remove any remaining ethanol, A method for producing a group of lipid nanoparticles containing an activator, wherein the lipid mixture comprises 2.5 mol% to 15 mol% of one or more cationic lipids, 30 mol% to 50 mol% of one or more ionized lipids, 30 mol% to 65 mol% of one or more neutral lipids, and 2.5 mol% to 15 mol% of one or more PEGylated lipids.

Images