Modification guide RNA
Modified gRNAs with a long upper stem and chemically modified nucleotides improve CRISPR-Cas9 system stability and specificity, addressing secondary structure inhibition and enhancing genome editing efficiency.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-04-26
- Publication Date
- 2026-05-27
AI Technical Summary
The formation of undesirable secondary structures within guide RNAs (gRNAs) can inhibit the CRISPR-Cas9 system, leading to reduced stability and on-target specificity in gene editing.
The development of modified gRNAs with a long upper stem and chemically modified nucleotides, particularly in the hairpin structures, to enhance stability and specificity, including sequences like GUUUUAGAmN x mN x mN x mN x mN x mN x mGmAmAmAmN y mN y mN y mN y mN y mN y mN y mN y mN y mN y mN y mU, where 'm' represents 2'-OMe modification, to improve genome editing precision.
The modified gRNAs exhibit reduced off-target activity while maintaining the ability to specifically target DNA sequences, enhancing genome editing efficiency by up to 1000 times.
Smart Images

Figure 2026516973000001_ABST
Abstract
Description
[Technical Field]
[0001] Cross-reference of related applications This application claims priority to U.S. Provisional Application No. 63 / 462,873, titled "Modified guide RNA," filed on 28 April 2023, the contents of which are incorporated herein by reference in their entirety.
[0002] Sequence listing cross-references This application is filed together with a sequence listing filed electronically in XML format. The sequence listing file, titled "BEM_020WO1_SL_xml", was created on April 26, 2024, and has a size of 63,829 bytes. The electronic information of the sequence listing is incorporated herein by reference in its entirety. [Background technology]
[0003] The nuclease Cas9 is directed to a specific DNA sequence, namely a target sequence by a small RNA molecule called a guide RNA (gRNA) for gene modification. CRISPR-Cas9 activity depends on the sequence and structure of the gRNA. Complete guide RNAs include tracrRNA (trRNA) and crsprRNA (crRNA). crRNA contains a guide region that can form a complete gRNA when associated with trRNA covalently or noncovalently. trRNA and crRNA can be contained within a single guide RNA (sgRNA) or within two separate RNA molecules.
[0004] Guide RNAs, either as a single guide RNA (sgRNA) or as two separate crRNA and tracRNA molecules, form a common secondary structure, particularly a guide RNA scaffold sequence. However, the formation of undesirable secondary structures within guide RNA (gRNA) can inhibit the CRISPR-Cas9 system.
[0005] Modifying guide RNAs to increase stability and on-target specificity would be useful. [Overview of the project]
[0006] This application provides, in particular, modified gRNA molecules, compositions, and methods for site-directed gene editing and genome modification, such as DNA cleavage and gene activation or repression. The modified guide RNA has a modified secondary structure (e.g., a long upper stem and a modified hairpin structure). All modified gRNAs provided herein exhibit reduced off-target activity while maintaining the ability to specifically target DNA sequences.
[0007] In one embodiment, the present invention involves using a modified single guide RNA (sgRNA) to enhance genome editing, for example, editing of a target nucleic acid in a target cell such as a primary cell (e.g., cultured in vitro for use in ex vivo therapy) or a human cell. The present invention also provides a method for treating a disease in a subject by enhancing precise genome editing to correct mutations in a disease-related target gene. The present invention can be used in any cell type and any gene locus compatible with nuclease-mediated genome editing technology.
[0008] In one embodiment, the present invention provides a modified guide RNA (gRNA) comprising a long (or elongated) upper stem containing more than four base pairs formed by complementary nucleotides, wherein one or more or all of the nucleotides of the upper stem are chemically modified nucleotides. In some embodiments, the long (or elongated) upper stem contains 4 to 8 base pairs formed by complementary nucleotides, and one or more or all of the nucleotides of the upper stem are modified nucleotides. In one embodiment, all nucleotides of the elongated upper stem are chemically modified.
[0009] In some embodiments, the modified gRNA includes a long upper stem region containing 5 to 15 base pairs formed by complementary nucleotides. In one embodiment, the long upper stem region contains 5 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region contains 6 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region contains 7 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region contains 8 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region contains 9 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region contains 10 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the region of the long upper stem contains 11 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the region of the long upper stem contains 12 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the region of the long upper stem contains 13 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the region of the long upper stem contains 14 base pairs formed by complementary nucleotides. In one embodiment, the region of the long upper stem contains 15 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the region of the long upper stem contains 15 to 20 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the region of the long upper stem contains 20 to 200 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides).In one embodiment, the region of the long upper stem contains 20-40, 40-80, 80-120, 120-160, or 160-200 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides).
[0010] In some embodiments, all nucleotides in the upper stem of the modified gRNA described herein are chemically modified nucleotides. In other embodiments, at least 80%, at least 85%, at least 90%, or at least 95% of the nucleotides in the upper stem of the modified gRNA are chemically modified nucleotides.
[0011] In some embodiments, the modified gRNA described herein further comprises one or more modified nucleotides within the hairpin 1 and hairpin 2 regions. In some embodiments, all nucleotides within the hairpin 1 and 2 regions are modified nucleotides. In other embodiments, at least 80%, at least 85%, at least 90%, or at least 95% of the nucleotides within the hairpin 1 and 2 regions of the modified gRNA are modified nucleotides.
[0012] In some embodiments, the modified gRNA described herein further comprises a modified stable hairpin 1 region, the modified stable hairpin 1 region comprising an extended stem region containing more than 4 base pairs, and the hairpin 1 loop comprising locked nucleic acid. In some embodiments, the extended stem region of the modified stable hairpin contains 8 base pairs.
[0013] In one embodiment, the present invention is GUUUUAGA N xn GAAA Ny n A single guide RNA (sgRNA) containing the sequence AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (Sequence ID 23), wherein in the sequence, N xn and N ynare nucleotides having the same number of nucleotides and being complementary nucleotides for forming base pairs, N xn and N yn nucleotides of are backbone-modified nucleotides, and n is an integer of 5 to 15, to provide a single-guide RNA (sgRNA). In some embodiments, GAAA is a GNRA tetraloop used to lock the structure of a hairpin. Other GNRA tetraloops include, but are not limited to, GUGA, GCAA, GAGA, GUAA, GGGA, GCGA, and GGAA. In some embodiments, another RNA tetraloop UNCG is incorporated into the sgRNA to lock the structure of the hairpin. Exemplary UNCG tetraloops include, but are not limited to, UUCG, UACG, UCCG, and UGCG. In some embodiments, the 5' and 3' terminal nucleotides of the sgRNA are backbone-modified nucleotides. As a non-limiting example, the sgRNA is GUUUUAGA m(N xn )mGmAmAmA m(Nyn)AAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU (SEQ ID NO: 24) contains the sequence of, in the sequence, "m" represents a 2'-OMe modification.
[0014] In some examples, Nx and Ny are complementary nucleotides respectively, and contain 5 nucleotides forming the region of the upper stem of the sgRNA, and the sgRNA is GUUUUAGAN x N x N x N x N x GAAAN y N y N y N y N yThe sequence AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (Sequence ID 2) is included. In some examples, each of the Nx and Ny nucleotides is skeletally modified. As a non-restrictive example, the sgRNA includes the sequence GUUUUAGAmNxmNxmNxmNxmNxmGmAmAmAmNymNymNymNymNyAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmGmGmCmAmCmGmGmUmGmCmUmUmUmU (Sequence ID 25), where "m" represents a 2'-OMe modification.
[0015] In some examples, Nx and Ny are complementary nucleotides, each containing six nucleotides that form the upper stem region of the sgRNA, and the sgRNA is GUUUUAGAN x N x N x N x N x N x GAAAN y N y N y N y N y N y The sequence AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (Sequence ID 3) is included. In some examples, each of the Nx and Ny nucleotides is skeletally modified. As a non-limiting example, the sgRNA is GUUUUAGAmN x mN x mN x mN x mN x mN x mGmAmAmAmN y mN y mN y mN y mN y mN yThe sequence AAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU (sequence code 26) is included, and in the sequence, "m" represents the 2'-OMe modification.
[0016] In some examples, Nx and Ny are complementary nucleotides, each containing seven nucleotides that form the upper stem region of the sgRNA, and the sgRNA is GUUUUAGAN x N x N x N x N x N x N x GAAAN y N y N y N y N y N y N y The sequence AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (Sequence ID 4) is included. In some examples, each of the Nx and Ny nucleotides is skeletally modified. As a non-limiting example, the sgRNA is GUUUUAGAmN x mN x mN x mN x mN x mN x mN x mGmAmAmAmN y mN y mN y mN y mN y mN y mN y The sequence AAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU (sequence code 27) is included, and in the sequence, "m" represents the 2'-OMe modification.
[0017] In some examples, Nx and Ny are complementary nucleotides, respectively, and include 8 nucleotides forming the region of the upper stem of the sgRNA, and the sgRNA is GUUUUAGAN x N x N x N x N x N x N x N x GAAAN y N y N y N y N y N y N y N y includes the sequence of AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 5). In some examples, each of the Nx and Ny nucleotides is backbone-modified. As a non-limiting example, the sgRNA is GUUUUAGAmN x mN x mN x mN x mN x mN x mN x mN x mGmAmAmAmN y mN y [[ID=x N x N x N x N x GAAAN y N y N y N y N y N y N y N y N y The sequence AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (Sequence ID 6) is included. In some examples, each of the Nx and Ny nucleotides is skeletally modified. As a non-limiting example, the sgRNA is GUUUUAGAmN x mN x mN x mN x mN x mN x mN x mN x mN x mGmAmAmAmN y mN y mN y mN y mN y mN y mN y mN y mN y The sequence AAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU (sequence code 29) is included, and in the sequence, "m" represents the 2'-OMe modification.
[0019] In some examples, Nx and Ny are complementary nucleotides, each containing 10 nucleotides that form the upper stem region of the sgRNA, and the sgRNA is GUUUUAGAN x N x N x N x N x N x N x N x N x N xGAAAN y N y N y N y N y N y N y N y N y N y The sequence AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (Sequence ID 7) is included. In some examples, each of the Nx and Ny nucleotides is skeletally modified. As a non-limiting example, the sgRNA is GUUUUAGAmN x mN x mN x mN x mN x mN x mN x mN x mN x mN x mGmAmAmAmN y mN y mN y mN y mN y mN y mN y mN y mN y mN y The sequence AAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU (sequence code 30) is included, and in the sequence, "m" represents the 2'-OMe modification.
[0020] In one embodiment, the present invention provides an sgRNA containing the sequence GUUUUAGAGCGCGGAAACGCGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (Sequence ID 8). In one embodiment, the present invention provides an sgRNA containing the sequence GUUUUAGAmGmCmGmCmGmGmAmAmAmCmGmCmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU (Sequence ID 31), where "m" represents a 2'-OMe modification.
[0021] In another embodiment, the sgRNA of the present invention includes the sequence GUUUUAGAGCCGGCGGAAACGCCGGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (Sequence ID 9). In another embodiment, the sgRNA of the present invention includes the sequence GUUUUAGAmGmCmCmGmGmCmGmGmAmAmAmCmGmCmCmGmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU (Sequence ID 32), where "m" represents a 2'-OMe modification.
[0022] In some embodiments, one or more nucleotides within the hairpin 1 and hairpin 2 regions of the sgRNA described herein are modified nucleotides. In other embodiments, all nucleotides within the hairpin 1 and hairpin 2 regions of the sgRNA described herein are modified nucleotides. In some embodiments, the hairpin 1 loop of the sgRNA described herein includes 2'-O-methyl modified nucleotides (e.g., 2'-O-methyl 3'-phosphorothioate (MS) nucleotides, 2'-O-methyl 3'-thioPACE (MSP) nucleotides), 2'-F modified nucleotides, locked nucleic acids, MOE (methoxyethyl), DNA nucleotides functionalized for conjugation, and combinations thereof.
[0023] In some embodiments, the present invention is GUUUUAGAN xn GAAAN yn A single guide RNA (sgRNA) containing the sequence AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGCACCGAGUCGGUGCUUUU (Sequence ID 10), wherein in the sequence, N xn and N yn However, they have the same number of nucleotides and are complementary nucleotides for forming base pairs, N xn and N yn We provide a single guide RNA (sgRNA) in which the nucleotides are cytoskeletal modification nucleotides, and n is an integer from 5 to 15, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, and 15. In some embodiments, N xn and N yn The nucleotide is a 2'-O-methyl modified nucleotide. For example, the sgRNA is GUUUUAGAm(N xn The sequence )mGmAmAmAm(Nyn)AAGUUAAAAUAAGGCUAGUCCGUUAUCmAmAmCmUmUmGmGmAmCmUmUmUmGmGmUmCmCmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU(Sequence ID 33) is included, and in the sequence, "m" represents the 2'-OMe modification.
[0024] In some examples, Nx and Ny are complementary nucleotides, each containing five nucleotides that form the upper stem region of the sgRNA, and the sgRNA is GUUUUAGAN x N x N x N x N x GAAAN y N y N y N y N y The sequence AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGCACCGAGUCGGUGCUUUU (Sequence ID 11) is included. In some embodiments, each of the Nx and Ny nucleotides is skeletally modified. As a non-limiting example, the sgRNA is GUUUUAGAmN x mN x mN x mN x mN x mGmAmAmAmN y mN y mN y mN y mN y The sequence AAGUUAAAAUAAGGCUAGUCCGUUAUCmAmAmCmUmUmGmGmAmCmUmUmUmGmGmUmCmCmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmU (Sequence ID 34) is included, and in the sequence, "m" represents a 2'-O-methyl modification.
[0025] In some examples, Nx and Ny are complementary nucleotides, each containing six nucleotides that form the upper stem region of the sgRNA, and the sgRNA is GUUUUAGAN x N x N x N x N x N x GAAAN y N y N y N y N y Ny The sequence AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGCACCGAGUCGGUGCUUUU (Sequence ID 12) is included. In some embodiments, each of the Nx and Ny nucleotides is skeletally modified. As a non-limiting example, the sgRNA is GUUUUAGAmN x mN x mN x mN x mN x mN x mGmAmAmAmN y mN y mN y mN y mN y mN y The sequence AAGUUAAAAUAAGGCUAGUCCGUUAUCmAmAmCmUmUmGmGmAmCmUmUmUmGmGmUmCmCmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmU (sequence code 35) is included, and in the sequence, "m" represents the 2'-OMe modification.
[0026] In some examples, Nx and Ny are complementary nucleotides, each containing seven nucleotides that form the upper stem region of the sgRNA, and the sgRNA is GUUUUAGAN x N x N x N x N x N x N x GAAAN y N y N y N y N y N y N y The sequence AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGCACCGAGUCGGUGCUUUU (Sequence ID 13) is included. In some embodiments, each of the Nx and Ny nucleotides is skeletally modified. As a non-limiting example, the sgRNA is GUUUUAGAmN x mN x mNx mN x mN x mN x mN x mGmAmAmAmN y mN y mN y mN y mN y mN y mN y The sequence AAGUUAAAAUAAGGCUAGUCCGUUAUCmAmAmCmUmUmGmGmAmCmUmUmUmGmGmUmCmCmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmU (sequence code 36) is included, and in the sequence, "m" represents the 2'-OMe modification.
[0027] In some examples, Nx and Ny are complementary nucleotides, each containing eight nucleotides that form the upper stem region of the sgRNA, and the sgRNA is GUUUUAGAN x N x N x N x N x N x N x N x GAAAN y N y N y N y N y N y N y N y The sequence AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 14) is included. In some embodiments, each of the Nx and Ny nucleotides is skeletally modified. As a non-limiting example, the sgRNA is GUUUUAGAmN x mN x mN x mN x mN x mN x mN x mN x mGmAmAmAmN y mN y mN ymN y mN y mN y mN y mN y The sequence AAGUUAAAAUAAGGCUAGUCCGUUAUCmAmAmCmUmUmGmGmAmCmUmUmUmGmGmUmCmCmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmU (sequence code 37) is included, and in the sequence, "m" represents the 2'-OMe modification.
[0028] In some examples, Nx and Ny are complementary nucleotides, each containing nine nucleotides that form the upper stem region of the sgRNA, and the sgRNA is GUUUUAGAN x N x N x N x N x N x N x N x N x GAAAN y N y N y N y N y N y N y N y N y The sequence AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGCACCGAGUCGGUGCUUUU (Sequence ID 15) is included. In some embodiments, each of the Nx and Ny nucleotides is skeletally modified. As a non-limiting example, the sgRNA is GUUUUAGAmN x mN x mN x mN x mN x mN x mN x mN x mN x mGmAmAmAmN y mN y mN y mN y mN y mN y mN y mNy mN y The sequence AAGUUAAAAUAAGGCUAGUCCGUUAUCmAmAmCmUmUmGmGmAmCmUmUmUmGmGmUmCmCmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU (sequence code 38) is included, and in the sequence, "m" represents the 2'-OMe modification.
[0029] In some examples, Nx and Ny are complementary nucleotides, each containing 10 nucleotides that form the upper stem region of the sgRNA, and the sgRNA is GUUUUAGAN x N x N x N x N x N x N x N x N x N x GAAAN y N y N y N y N y N y N y N y N y N y The sequence AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 16) is included. In some embodiments, each of the Nx and Ny nucleotides is skeletally modified. As a non-limiting example, the sgRNA is GUUUUAGAmN x mN x mN x mN x mN x mN x mN x mN x mN x mN x mGmAmAmAmN y mN y mN y mN y mN y mN y mN y mNy mN y AAGUUAAAAUAAGGCUAGUCCGUUAUCmAmmN y The sequence includes AmCmUmUmGmGmAmCmUmUmUmGmGmUmCmCmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmU (sequence code 39), where "m" represents the 2'-OMe modification.
[0030] In one embodiment, the sgRNA described herein comprises the sequence GUUUUAGAGCCGGCGGAAACGCCGGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUUUUU (Sequence ID 17). In some embodiments, the sgRNA comprises a skeletal modified nucleotide. As a non-limiting example, the sgRNA comprises GUUUUAGAmGmCmCmGmGmCmGmGmAmAmAmCmGmCmCmGmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCmAmAmCmUmUmGmGmAmCmUmUmUmGmGmUmCmCmAmAmGmUmUmUmUmU (Sequence ID 40) (m=2'-OMe modification).
[0031] In some embodiments, the present invention is GUUUUAGAN xn GAAAN yn AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGACN z N z N z N z A single guide RNA (sgRNA) containing the sequence GUCCAAGUGGCACCGAGUCGGUGCUUUU (Sequence ID 41), wherein in the sequence, N xn and N yn However, they have the same number of nucleotides and are complementary nucleotides for forming base pairs, N xn and N yn The nucleotides are modified nucleotides, n is an integer between 5 and 15, and the four nucleotides (N) in the hairpin 1 loop. z N z N z Nz ) provides single guide RNA (sgRNA) containing the sequences UUCG, CUUG, or GCAA.
[0032] In some embodiments, the sgRNA, which includes a longer upper stem and stable hairpins, contains one or more modified nucleotides within the hairpin 1 and hairpin 2 regions. In other examples, the sgRNA, which includes a longer upper stem and stable hairpins, contains modified nucleotides within the hairpin 1 and hairpin 2 regions. The modifications include 2'-O-methyl modified nucleotides (e.g., 2'-O-methyl3'-phosphorothioate (MS) nucleotides, 2'-O-methyl3'-thioPACE (MSP) nucleotides), 2'-F modified nucleotides, and combinations thereof.
[0033] In one example, at least one modification involves a 2'-O'-methyl (2'-O-Me) modified nucleotide.
[0034] In some embodiments, the loop of the hairpin 1 contains locked nucleic acid.
[0035] In some embodiments, the gRNA described herein further includes a spacer sequence at the 5''' end of the sgRNA, the spacer sequence containing a sequence complementary to the target sequence of interest. In some embodiments, the spacer sequence contains about 18–25, or 18–30, or 20–25, 20–30, 15–50, 20–50, or 20–40 nucleotides. As a non-limiting example, the spacer sequence contains 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, or 50 nucleotides.
[0036] In some embodiments, the 3' end of the sgRNA described herein is modified.
[0037] In some embodiments, the 5' end of the sgRNA described herein is modified.
[0038] In some embodiments, the 3' and 5' ends of the sgRNA described herein are modified.
[0039] In some embodiments, at least the first three nucleotides at the 5' end of the sgRNA described herein are modified nucleotides.
[0040] In one embodiment, the sgRNA described herein includes modifications at the 5' end of the sequence and modifications at the 3' end of the sequence.
[0041] In some embodiments, about 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 75%, 80%, 90%, or 100% of the nucleotides of the sgRNA described herein are modified nucleotides.
[0042] For example, the gRNA described herein includes the sequence described in SEQ ID NO: 20. For example, the gRNA described herein includes the sequence described in SEQ ID NO: 21. For example, the gRNA described herein includes the sequence described in SEQ ID NO: 51. For example, the gRNA described herein includes the sequence described in SEQ ID NO: 52.
[0043] In some embodiments, the sgRNA described herein further comprises a nuclear localization sequence (NLS).
[0044] In some embodiments, the sgRNA described herein contains about 102 to 150 nucleotides, about 102 to 120 nucleotides, or about 100 to 180 nucleotides.
[0045] In some embodiments, the sgRNAs of the present invention increase gene modification effectiveness by about 2 to 1000 times, or about 2 to 100 times, or about 2 to 10 times. As non-limiting examples, the sgRNAs described herein increase gene modification effectiveness by about 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 550, 600, 650, 700, 750, 800, 900, or 1000 times.
[0046] In another aspect of the present invention, the provision includes a gene modification system comprising (a) a CRISPR-related protein (Cas) polypeptide or a variant thereof, and (b) a single guide RNA (sgRNA) as described herein.
[0047] In some embodiments, the Cas polypeptide is a Cas9 protein that includes, but is not limited to, S. pyogenes Cas9 and S. aureus Cas9.
[0048] In some embodiments, the Cas9 polypeptide is nicasse or dCas9.
[0049] In some embodiments, the provided composition also includes a single guide RNA as described herein. The composition may further comprise a Cas9 polypeptide or a variant thereof. In some examples, the Cas polypeptide is a Cas9 protein, dCas9, or nickase.
[0050] In some embodiments, the compositions described herein are formulated into lipid nanoparticles.
[0051] In another aspect, the present invention provides a method for modifying a target gene in a cell, comprising introducing a gene editing system comprising a single guide RNA (sgRNA) of the present disclosure into the cell.
[0052] In some embodiments, the method involves introducing into a cell a modified single guide RNA (sgRNA) comprising a first nucleotide sequence complementary to a target nucleic acid and a second nucleotide sequence that interacts with a CRISPR-related protein (Cas) polypeptide, wherein one or more nucleotides in the first nucleotide sequence and / or the second nucleotide sequence are modified nucleotides, as well as a recombinant expression vector comprising a Cas polypeptide, mRNA encoding the Cas polypeptide, and / or a nucleotide sequence encoding the Cas polypeptide. [Brief explanation of the drawing]
[0053] [Figure 1A] The diagram shows an exemplary terminally modified sgRNA, a standard highly modified sgRNA, and a hairpin structure of the longest gRNA design containing five base pairs in the upper stem of the gRNA. Chemically modified sgRNAs (terminally modified and highly modified) contain only four base pairs in the upper stem.
[0054] [Figure 1B] This document presents exemplary ALAS1-targeted editing in the liver, demonstrating reduced editing efficacy when the gRNA hairpin is extended without nucleotide modification. Editing efficacy increases when extended in combination with nucleotide modification. gRNA9 contains an internally unmodified extended upper stem (up to 1) containing the upper stem of the extended hairpin. sgRNA10 contains another internally unmodified extended upper stem (up to 2) containing the upper stem of the extended hairpin. sgRNA3 contains a 2'OMe-modified nucleotide (the sequence described in SEQ ID NO: 51) up to 1. ALAS1 editing was performed with the base editor ABE8.8.
[0055] [Figure 2A]The hairpin structure of ALAS1-targeted gRNA (gRNA1) with terminal modifications, ALAS1-targeted gRNA (gRNA2) with standard advanced modifications, or ALAS1-targeted gRNA (gRNA3) with nucleotide modifications and a maximum length of 1 is shown.
[0056] [Figure 2B] This study demonstrates the efficacy of ALAS1-targeted gRNA editing in lipid 1 at different doses.
[0057] [Figure 2C] This study demonstrates the efficacy of ALAS1-targeted gRNA editing in lipid 2 at different doses.
[0058] [Figure 3A] This shows the hairpin structure of gRNA having terminal modifications (EM), longest modifications, GOLD modifications, or longest GOLD combination modifications.
[0059] [Figure 3B] This study demonstrates the in vitro editing efficacy of different gRNA modifications at three different target sites (TSBT×3228, TSBT×3215, and TSBT×3222).
[0060] [Figure 4A] The hairpin structures of gRNA4 (standard terminal modification), gRNA5 (GOLD modification), and gRNA6 (longest-GOLD modification) are shown.
[0061] [Figure 4B] The editing efficacy of gRNA4, gRNA5, and gRNA6 after 5 days is shown.
[0062] [Figure 5] This study demonstrates the editing efficacy of three novel hairpin extensions in ALAS1-targeted gRNAs: longest 3, longest 4, and unmodified longest 4, compared to the same gRNAs with standard advanced modifications (advanced modifications), terminal modifications, or longest modifications. [Modes for carrying out the invention]
[0063] definition To facilitate understanding of this invention, certain terms are first defined below. Further definitions of the following terms and other terms are provided throughout this specification.
[0064] The articles “a” and “an” are used herein to refer to one or more (i.e., at least one) grammatical objects of the articles. For example, “an element” means one or more elements.
[0065] The terms “approximately” or “about,” as used herein, when applied to one or more reference values, refer to a value similar to the reference value stated. In certain embodiments, unless otherwise stated or evident from the context, the terms “approximately” or “about” refer to a range of values that fall within 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) the reference value stated (except where such a number exceeds 100% of the possible value).
[0066] For the purposes of enumerating numerical ranges as defined herein, each number intervening between them is explicitly intended with the same degree of precision. For example, for the range 6–9, the digits 7 and 8 are intended in addition to 6 and 9, and for the range 6.0–7.0, the digits 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly intended.
[0067] Where used herein, when used to define products, compositions, and methods, the term “contains” is intended to mean that the product, composition, and method contains the referenced component or process but does not exclude others. The terms “comprise(s),” “include(s),” “have,” “possess,” “can have,” and “contain,” and their variations, where used herein, are intended to be open-ended transitional phrases, terms, or words that do not preclude the possibility of additional acts or structures. The term “essentially consists of” shall mean the exclusion of any other essentially important component or process. Thus, a composition essentially consisting of the listed components does not exclude trace amounts of contaminants and pharmaceutically acceptable carriers. “Consists of” shall mean the exclusion of elements of other components or processes that are not trace amounts.
[0068] Administration: As used herein, the term “administer” includes oral administration, topical contact, administration as a suppository, intravenous, intraperitoneal, intramuscular, intralesional, subarachnoid, intranasal, or subcutaneous administration to the subject. Administration is by any route, including parenteral and transmucosal (e.g., oral cavity, sublingual, palate, gingiva, nose, vagina, rectum, or percutaneous). Parenteral administrations include, for example, intravenous, intramuscular, intra-arterial, intradermal, subcutaneous, intraperitoneal, intraventricular, and intracranial. Other delivery methods include, but are not limited to, liposomal formulations, intravenous infusion, and transdermal patch use.
[0069] Binding region: As used herein, the term “binding region” refers to a region within a nuclease target region that is recognized and bound to by a nuclease such as Cas9.
[0070] Complementary: As used herein, the term “complementary” refers to the ability of a nucleic acid to form hydrogen bonds (or more) with another nucleic acid sequence by either the conventional Watson-Crick or other unconventional types. The complementarity percentage indicates the percentage of residues in a nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (for example, 5, 6, 7, 8, 9, and 10 out of 10 are 50%, 60%, 70%, 80%, 90%, and 100% complementarity, respectively). “Fully complementary” means that all consecutive residues in a nucleic acid sequence can form hydrogen bonds with the same number of consecutive residues in a second nucleic acid sequence. "Substantially complementary," as used herein, means a degree of complementarity of at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50 or more nucleotides, or two nucleic acids that hybridize under stringent conditions.
[0071] Effective dose: As used herein, the term "effective dose" refers to the amount of drug (e.g., Cas nuclease, modified single guide RNA, etc.) sufficient to produce a beneficial or desired result. The therapeutic effective dose may vary depending on one or more of the following: the subject and disease state being treated, the subject's weight and age, the severity of the disease state, and the mode of administration, which can be readily determined by those skilled in the art. The specific dose may vary depending on one or more of the following: the particular drug selected, the type of target cell, the location of the target cell in the subject, the drug regimen to be followed, whether it is administered in combination with other drugs, the timing of administration, and the physical delivery system through which it is carried.
[0072] Efficiency: As used herein, the term “efficiency” refers to editing efficiency, or editing percentage, which is the total number of sequence reads having nucleotide insertions or deletions within a target region of interest, relative to the total number of sequence reads after cleavage by the gene editing system of this disclosure.
[0073] Genome: As used herein, the term “genome” refers to the complete set of genes or genetic material present in a cell or organism. A genome includes DNA or RNA in RNA viruses. A genome includes genes, (coding regions), non-coding DNA, and both mitochondrial and chloroplast genomes.
[0074] Genome editing: As used herein, the term “genome editing” refers to the modification of a gene. Genome editing may include correcting or repairing a mutated gene. Genome editing may include knocking out a gene, such as a mutated gene or a normal gene. Genome editing may be used to treat a disease or enhance muscle repair by modifying a gene of interest.
[0075] Guide RNA or gRNA: As used herein, the terms “guide RNA” and “gRNA” are interchangeable. “Guide RNA,” “gRNA,” “single gRNA,” and “sgRNA” are interchangeable herein and refer to short synthetic RNAs consisting of a “scaffold” sequence required for Cas9 or Cpf1 binding, and a user-defined “spacer” or “targeting sequence” (also referred herein to as a protospacer targeting sequence or segment) that defines the genomic target to be modified. “Modified gRNA” is, as used herein, a gRNA having additional nucleotides or nucleotide modifications.
[0076] Hybridization: As used herein, “hybridization” means the pairing or annealing of complementary oligonucleotides and / or nucleic acids. The most common mechanism of hybridization, though not limited to a specific mechanism, involves hydrogen bonding, which may be Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonds between complementary nucleic acid bases.
[0077] crRNA: As used herein, the term “crRNA” refers to an RNA sequence that is complementary to and recognizes a target nucleic acid sequence, and includes a tracrRNA-recognizing sequence that is bound to or can bind to tracrRNA. The tracrRNA-recognizing portion of the crRNA may bind to tracrRNA via hybridization or covalent bonding.
[0078] tracRNA: As used herein, the term “tracrRNA” means a nucleic acid sequence that can non-covalently bind to the Cas9 protein and can bind to a crRNA sequence via hybridization or covalent bonding. In some embodiments, the tracrRNA and crRNA sequence can form a single guide RNA.
[0079] Hairpin: As used herein, the term “hairpin” refers to the double helix of a nucleic acid produced when a nucleic acid strand folds and forms base pairs with another section of the same strand. Hairpins can form structures including loops or U-shapes. In some embodiments, hairpins may consist of RNA loops. Hairpins can be formed by two complementary sequences in a single nucleic acid molecule bond, accompanied by molecular folding or wrinkling. In some embodiments, hairpins include stem or stem-loop structures. In the context of the modified gRNA described herein, “hairpin region” refers to hairpins 1 and 2 of the gRNA from the 5' end to the 3' end. The conserved portion of the gRNA is located between hairpins 1 and 2 of the gRNA.
[0080] Stem-loop: As used herein, the term “stem-loop” describes a secondary structure of nucleotides that forms a base-paired “stem” ending in a loop of non-paired nucleic acid. A stem can be formed if two regions of the same nucleic acid chain are at least partially complementary in sequence when read in opposite directions.
[0081] Loop: As used herein, the term “loop” describes a region of nucleotides that are not base-paired (i.e., not complementary) and can cap a stem. For example, a “tetraloop” describes a loop of four nucleotides. In some embodiments, the upper stem of a modified gRNA may contain a tetraloop. In some embodiments, GAAA is a GNRA tetraloop used to lock the hairpin structure. In some embodiments, the tetraloop is ANYA, CUYG, GNRA, UNAC, or UNCG.
[0082] Pharmacopoeia-acceptable carriers: The term “pharmacopoeia-acceptable carrier” refers to a substance that assists in the delivery of a drug (e.g., Cas nuclease, modified single guide RNA, etc.) to a cell, organism, or subject. A “pharmacopoeia-acceptable carrier” means a carrier or excipient that may be included in a composition or formulation and does not cause significant adverse toxic effects to the patient. Non-limiting examples of pharmacopoeia-acceptable carriers include water, NaCl, physiological saline, Ringer's lactate solution, ordinary sucrose, ordinary glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavorings, and colorants. Those skilled in the art will recognize that other pharmaceutical carriers may be useful in the present invention.
[0083] Modified or Modified: As used herein, the terms “modified” or “modified” in the context of guide RNA refer to various modifications, such as 2'-O-methyl modified nucleotides (e.g., 2'-O-methyl-3'-phosphorothioate (MS) nucleotides, 2'-O-methyl-3'-thioPACE (MSP) nucleotides), 2'-F modified nucleotides, locked nucleic acids, MOE (methoxyethyl), DNA nucleotides functionalized for conjugation, and combinations thereof.
[0084] Nucleic acids: As used herein, the terms “nucleic acid,” “oligonucleotide,” or “polynucleotide” mean, as used herein, at least two nucleotides covalently bonded to one another. A single-stranded description also defines the sequence of the complementary strand. Thus, a nucleic acid also encompasses the complementary strand of the single-stranded description. Many variants of a nucleic acid can be used for the same purposes as a given nucleic acid. Thus, a nucleic acid also encompasses substantially identical nucleic acids and their complements. A single strand provides a probe that can hybridize to a target sequence under stringent hybridization conditions. Thus, a nucleic acid also encompasses probes that hybridize under stringent hybridization conditions. A nucleic acid may be single-stranded or double-stranded, or may contain portions of both double-stranded and single-stranded sequences. Nucleic acids can be DNA, both genomic and cDNA, RNA, or hybrids, and may contain combinations of deoxyribonucleotides and ribonucleotides, as well as combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine, hypoxanthine, isocytosine, and isoguanine. Nucleic acids can be produced by chemical synthesis or by recombinant methods.
[0085] On-target site: The term "on-target site," as used herein, refers to a target region or sequence within the genome that a gRNA is intended to target. Ideally, an on-target site should have complete homology (100% identity or homology) with the target DNA sequence, without homology elsewhere in the genome.
[0086] Off-target sites: As used herein, the term "off-target sites" refers to regions of the genome that have partial homology or partial identity with an on-target site or target region of a gRNA, but which are not intended or designed to be targeted by the gRNA.
[0087] Subject: The terms “subject,” “patient,” and “individual” are used interchangeably herein to include humans or animals. For example, an animal subject may be a mammal, a primate (e.g., a monkey), a domestic animal (e.g., a horse, a cat, a sheep, a pig, or a goat), a companion animal (e.g., a dog, a cat), a laboratory animal (e.g., a mouse, a rat, a guinea pig, a bird), a veterinary important animal, or an economically important animal.
[0088] To treat: The term “to treat,” as used herein, refers to an approach to obtain beneficial or desired results, including but not limited to therapeutic and / or preventive benefits. Therapeutic benefit means any therapeutically related improvement or effect in one or more diseases, conditions, or symptoms during treatment. For preventive benefit, a composition may be administered to subjects at risk of developing a particular disease, condition, or symptom, or to subjects reporting one or more physiological symptoms of a disease, even if the disease, condition, or symptoms have not yet manifested.
[0089] Modification guide RNA (gRNA) Modified guide RNAs (gRNAs) for use in gene editing methods are provided herein. According to this disclosure, the modified gRNAs provided herein include a long or elongated upper stem structure. The modified guide RNAs provided herein may include an elongated upper stem and a stable locked hairpin structure. In some embodiments, the modified guide RNAs provided herein are single guide RNAs (sgRNAs). The modified sgRNAs of this disclosure are more stable and exhibit improved efficacy in gene editing compared to unmodified sgRNAs.
[0090] Long / extended upper stem In one embodiment, the modified gRNA provided herein is a modified single guide RNA (sgRNA) comprising a long (or elongated) upper stem containing more than four base pairs formed by complementary nucleotides, wherein one or more nucleotides of the upper stem are chemically modified. Exemplary modifications include 2'OMe modifications such as 2'-O-methyl (M) nucleotides, 2'-O-methyl 3'-phosphorothioate (MS) nucleotides, 2'-O-methyl 3'-thioPACE (MSP) nucleotides, or combinations thereof.
[0091] In some embodiments, the modified sgRNA described herein includes a long upper stem region containing 5 to 15 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region contains 5 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region contains 6 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region contains 7 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region contains 8 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region contains 9 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region contains 10 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the region of the long upper stem contains 11 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the region of the long upper stem contains 12 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the region of the long upper stem contains 13 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the region of the long upper stem contains 14 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the region of the long upper stem contains 15 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides).
[0092] In some embodiments, all nucleotides of the upper stem of the modified sgRNA described herein are modified nucleotides. In other embodiments, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of the nucleotides of the upper stem of the modified sgRNA are chemically modified nucleotides.
[0093] In some embodiments, the sgRNA described herein includes modifications to the upper stem, and the modifications to the upper stem include modifications to one or more nucleotides in the upper stem region.
[0094] In some embodiments, the sgRNA includes modifications to the upper stem, the modifications to the upper stem include modifications of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in the upper stem region.
[0095] In some embodiments, the gRNA includes modifications to the upper stem, the modifications to the upper stem include modifications of approximately 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 1-12, 1-14, 1-16, 2-4, 2-6, 2-8, 2-10, 2-12, 2-16, 2-18, 2-20, 4-8, 4-10, 6-12, 6-18, 6-20, 8-10, 8-18, 8-20, or 10-20 nucleotides in the upper stem region.
[0096] In some embodiments, the modified nucleotides within the upper stem region of the sgRNA contain the same chemical modification. In other embodiments, the modified nucleotides within the upper stem region of the sgRNA contain different chemical modifications.
[0097] In some embodiments, the sgRNA includes modifications to the upper stem, and these modifications include a 2'-OMe modified nucleotide. In some embodiments, the modifications to the upper stem include a 2'-O-MOE modified nucleotide. In some embodiments, the modifications to the upper stem include a 2'-F modified nucleotide. In some embodiments, the modifications to the upper stem include a 2'-Ome modified nucleotide, a 2'-O-MOE modified nucleotide, a 2'-F modified nucleotide, and / or combinations thereof.
[0098] Stable hairpin In some embodiments, the sgRNA described herein is further modified to include a highly stable hairpin structure. The modified sgRNA described herein further includes one or more modified nucleotides within the hairpin 1 and hairpin 2 regions. In some embodiments, all nucleotides within the hairpin 1 and 2 regions are modified nucleotides. In other embodiments, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the nucleotides within the hairpin 1 and 2 regions of the modified sgRNA are chemically modified nucleotides. In some embodiments, all nucleotides within hairpin 1 are 2 and are chemically modified.
[0099] In some embodiments, the modified sgRNA described herein further comprises a modified stable hairpin 1 region, the modified stable hairpin 1 region comprising an elongated stem region containing more than four base pairs, and the loop of hairpin 1 comprising locked nucleic acid. In some embodiments, the elongated stem region of the modified stable hairpin contains eight base pairs. In some embodiments, the elongated stem region of the modified stable hairpin contains eight base pairs formed by chemically modified nucleotides. As a non-limiting example, all nucleotides of the hairpin include 2'-O-methyl modifications.
[0100] The highly stable hairpin of sgRNA refers to a “locked” hairpin. A locked hairpin contains a locked backbone, for example, by incorporating one or more locked nucleic acids. As used herein, the term “locked nucleic acid” refers to a bicyclic RNA analog in which ribose is locked at the C3'-end conformation by the introduction of a 2'-O,4'-C methylene bridge. The desired LNA monomers and methods for their synthesis are also disclosed in U.S. Patent Nos. 6,043,060, 6,268,490, PCT Publications 01 / 07455, 01 / 00641, 98 / 39352, 00 / 56746, 00 / 56748, and 00 / 66604, as well as in the following publications: Morita et al., Bioorg. Med. Chem. Lett. 12(1):73-76, 2002, Hakansson et al., Bioorg. Med. Chem. Lett. 11(7):935-938, 2001, Koshkin et al., J. Org. Chem. 66(25):8504-8512, 2001, Kvaerno et al. al., J.Org.Chem.66(16):5498-5503,2001, Halkansson et al.,J.Org.Chem.65(17):5161-5166,2000, Kvaerno et al.,J.Org.Chem.65(17):5167-5176,2000, Pfundheller et al. al., Nucleosides Nucleotides 18(9):2017-2030,1999, and Kumar et al,Bioorg.Med.Chem.Lett.8(16):2219-2222,1998.
[0101] In some examples, the hairpin region contains locked nucleic acids or LNAs containing a 2'-O,4'-C-methyleneribonucleoside (structure A), where the ribose sugar moiety is within the “locked” conformation. The hairpin region contains at least one 2',4'-C-bridged 2'-deoxyribonucleoside (CDNA, structure B). See, for example, U.S. Patent No. 6,403,566 and Wang et al. (1999) Bioorganic and Medicinal Chemistry Letters, Vol. 9: 1147–1150, both of which are incorporated herein by reference in their entirety. Locked nucleic acids (LNAs) are a class of high-affinity RNA analogs in which the ribose ring is “locked” in a conformation ideal for Watson-Crick junctions. LNA oligonucleotides exhibit high thermal stability when hybridized to complementary DNA or RNA strands. In addition, LNA® oligonucleotides can be shorter than conventional DNA or RNA oligonucleotides while still retaining a high Tm. LNA® oligonucleotides may consist of a mixture of LNA® and DNA or RNA. Incorporation of LNA® into oligonucleotides has been shown to improve sensitivity and specificity for many hybridization-based techniques, including PCR, microarrays, and in situ hybridization.
[0102] chemical modification In some embodiments, the modified gRNA further comprises one or more chemically modified nucleotides. In some embodiments, such a modified nucleoside comprises a modified sugar moiety or a modified nucleic acid base, or both a modified sugar moiety and a modified nucleic acid base.
[0103] In some embodiments, the modified sgRNA comprises one or more modified nucleosides containing a modified sugar moiety. Such modified sgRNAs containing one or more sugar-modified nucleosides may have desired properties, such as improved nuclease stability or increased binding affinity to target nucleic acids, compared to guide RNA lacking such sugar-modified nucleosides. In certain embodiments, the modified sugar moiety is a linear modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar surrogate. Such a sugar surrogate may contain one or more substitutions corresponding to those of the substituted sugar moiety.
[0104] In certain embodiments, the modified sugar moiety is a linear modified sugar moiety comprising a furanosyl ring having one or more acyclic substituents, but not limited to substituents at the 2' and / or 5' positions. Suitable 2'- substituents for the linear modified sugar moiety include, but are not limited to, 2'-F, 2'-OCH3 ("Ome" or "O-methyl"), and 2'-O(CH2)2OCH3 ("MOE"). In certain embodiments, the 2'- substituents are halo, allyl, amino, azide, SH, CN, OCN, CF3, OCF3, O-C1-C 10 Alkoxy, O-C1-C 10 Substitutive alkoxy, O-C1-C 10 Alkyl, O-C1-C 10 Substitutive alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-Alkenyl, O-Alkinyl, S-Alkinyl, N(R m )-Alkynyl, O-Alkyrenyl-O-Alkyl, Alkynyl, Alkalyl, Aralkyl, O-Alkalyl, O-Aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ), or OCH2C(=O)-N(R m )(R n ) are selected from the above, and in the formula, each R m and R nThese are independently H, an amino protecting group, or substituted or unsubstituted C1-C 10 It is alkyl. Certain embodiments of these 2'-substituents may be further substituted with one or more substituents independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro(NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. Suitable 5'-substituents for the linearly modified sugar moiety include, but are not limited to, 5'-methyl(R or S), 5'-vinyl, and 5'-methoxy. In certain embodiments, the linearly modified sugar comprises more than one non-crosslinked sugar substituent, e.g., a 2'-F-5'-methyl sugar moiety (for further 2',5'-bis-substituted sugar moieties and nucleosides, see, for example, PCT International Application 2008 / 101157).
[0105] In certain embodiments, the 2'-substituted nucleoside or 2'-linearly modified nucleoside is F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamide (OCH2C(=O)-N(R m )(R n The formula includes a sugar moiety comprising a linear 2'- substituent selected from )), where each R m and R n These are independently H, an amino protecting group, or substituted or unsubstituted C1-C 10 It is alkyl.
[0106] In certain embodiments, the 2'-substituted nucleoside or 2'-linearly modified nucleoside is F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2) 20The sugar moiety includes a linear 2'-substituent selected from N(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 ("NMA").
[0107] In certain embodiments, the 2'-substituted nucleoside or 2'-linearly modified nucleoside comprises a sugar moiety containing a linear 2'-substituent selected from F, OCH3, and OCH2CH2OCH3.
[0108] Certain modified sugar moieties include bridging sugar substituents that form a second ring resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety includes a bridge between a 4'-position furanose ring atom and a 2'-position furanose ring atom. Examples of such 4'-to-2' bridging sugar substituents include 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (referred to as "restricted ethyl" or "cEt" in the S configuration), 4'-CH2-O-CH2-2', 4'-CH2-NI-2', 4'-CH(CH2OCH3)-O-2' ("restricted MOE" or "cMOE") 4'-C(CH3)(CH3)-O-2' and its analogues (see, for example, U.S. Patent No. 7,399,845), 4'-CH2-N(OCH3)-2' and its analogues (see, for example, WO2009 / 006478), 4'-CH2-N(OCH3)-2' and its analogues (see, for example, WO2008 / 150729), 4'-CH2-ON(CH3)-2' (see, for example, U.S. 2004 / 0171570), 4'-CH2-C(H)(CH3)-2' (see, for example, Chattopadhyaya, et See al., J. Org. Chem., 2009, 74, 118-134), 4'-CH2-C(=CH2)-2' and its analogues (see published PCT international application 2008 / 154401), 4'-C(R a R b I(R)-O-2',4'-C(R) a R ION(R)-2', 4IH2-ON(R)-2', I4'-CH2-N(R)-O-2' (in the formula, each R, R a , and R b These are independently H, protecting group, or C1-C 12 Examples include, but are not limited to, alkyl compounds (see, for example, U.S. Patent No. 7,427,672).
[0109] In a particular embodiment, such a 4' to 2' crosslink is -[C(R a )(R b )] n -,-[C(R a )(R b )] n -O-, -C(R a )=C(R b )-,-C(R a )=N-, -C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-, -S(=O) x -, and -N(R a )- independently contains 1 to 4 linking groups independently selected from, where X is 0, 1, or 2, and n is 1, 2, 3, or 4.
[0110] In some embodiments, the bicyclic sugar moiety and the nucleoside incorporating such a bicyclic sugar moiety are further defined by isomer configuration. For example, the LNA nucleoside (above) can be in an α-L or β-D configuration. In other embodiments, the modified sugar moiety is a sugar surrogate. In certain such embodiments, the oxygen atom of the sugar moiety is replaced with, for example, a sulfur, carbon, or nitrogen atom. In certain such embodiments, such a modified sugar moiety also includes bridging and / or non-bridging substituents as described above. For example, certain sugar surrogates include substitutions at the 4'-sulfur atom, as well as at the 2'-position (see, e.g., US2005 / 0130923) and / or 5' position.
[0111] In some embodiments, the modification at the sugar group may be a modification at the 2' position of the ribose group. In some cases, the modification at the 2' position of the ribose group is selected from the group consisting of 2'-O-methyl, 2'-fluoro, 2'-deoxy, and 2'-O-(2-methoxyethyl).
[0112] In one embodiment, one or more modifications in the modified gRNa include 2'OMe modifications such as 2'-O-methyl (M) nucleotide, 2'-O-methyl 3'-phosphorothioate (MS) nucleotide, 2'-O-methyl 3'-thioPACE (MSP) nucleotide, or a combination thereof.
[0113] In some embodiments, the modified sgRNA comprises one or more nucleosides containing modified nucleic acid bases. In certain embodiments, the modified sgRNA comprises one or more nucleosides that do not contain nucleic acid bases, referred to as debasalized nucleosides.
[0114] In some embodiments, the modified nucleic acid bases are selected from 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6, and O-6-substituted purines. In certain embodiments, the modified nucleic acid bases are 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl(-C≡C-CH3)uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azocymine, 5-ribosyluracil (pseudracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8 -Selected from substituted purines, 5-halos, especially 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl4-N-benzoylcytosine, 5-methyl4-N-benzoyluracil, common bases, hydrophobic bases, indiscriminate bases, size-extended bases, and fluorinated bases. Further modified nucleic acid bases include tricyclic pyrimidines such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleic acid bases may also include those in which the purine or pyrimidine base is replaced by other heterocycles, such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.
[0115] In some embodiments, the nucleosides of the modified sgRNA described herein may be linked together using any internucleoside bond. Two main classes of internucleoside bond groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside bonds include, but are not limited to, phosphodiester bonds ("P=O") (also referred to as unmodified or naturally occurring bonds), phosphotriesters, methylphosphonates, phosphoramidates, and phosphates including phosphorothioates ("P=S") and phosphorodithioates ("HS-P=S"). Representative phosphorus-free internucleoside bonds include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiesters (-OC(=O)-S-), thionocarbamates (-OC(=O)(NH)-S-), siloxanes (-O-SiH2-O-), and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Compared to naturally occurring phosphate bonds, modified internucleoside bonds can be used to alter (usually increase) the nuclease resistance of oligonucleotides. In certain embodiments, internucleoside bonds with chiral atoms can be prepared as racemic mixtures or as separate enantiomers. Representative chiral internucleoside bonds include, but are not limited to, alkylphosphonates and phosphorothioates. Methods for preparing nucleoside bonds containing phosphorus and nucleoside bonds not containing phosphorus are well known to those skilled in the art.
[0116] Examples of neutral nucleoside interbonding include, but are not limited to, phosphotriesters, methylphosphonates, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl, and thioformacetal (3'-S-CH2-O-5'). Further neutral nucleoside bonds include nonionic bonds involving siloxanes (dialkylsiloxanes), carboxylate esters, carboxamides, sulfides, sulfonate esters, and amides (see, for example, Carbohydrate Modifications in Antisense Research; YSSanghvi and PDCook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral nucleoside bonds include nonionic bonds involving mixed N, O, S, and CH2 constituent parts.
[0117] In some embodiments, one or more chemical modifications on the phosphate group may be phosphorothioate modifications.
[0118] In some embodiments, the modified sgRNA includes one modified nucleotide at the 5' end of the modified gRNA nucleotide sequence (e.g., the terminal nucleotide at the 5' end) or near the 5' end (e.g., within 1, 2, 3, 4, or 5 nucleotides of the terminal nucleotide at the 5' end), and / or one modified nucleotide at the 3' end of the modified gRNA nucleotide sequence (e.g., the terminal nucleotide at the 3' end) or near the 3' end (e.g., within 1, 2, 3, 4, or 5 nucleotides of the 3' end).
[0119] In some embodiments, the modified sgRNA includes two consecutive or discontinuous modified nucleotides starting from the 5' end of the modified gRNA nucleotide sequence (e.g., the terminal nucleotide at the 5' end) or near the 5' end (e.g., within 1, 2, 3, 4, or 5 nucleotides of the terminal nucleotide at the 5' end), and / or two consecutive or discontinuous modified nucleotides starting from the 3' end of the modified gRNA nucleotide sequence (e.g., the terminal nucleotide at the 3' end) or near the 3' end (e.g., within 1, 2, 3, 4, or 5 nucleotides of the 3' end).
[0120] Other areas and modifications In some embodiments, the modified gRNA contains a modified nucleotide at its 5' end. In some embodiments, the 5' end of the sgRNA contains a spacer or guide region that functions to guide a Cas protein, such as the Cas9 protein, to a target nucleotide sequence. In some embodiments, the 5' end does not contain a guide region. In some embodiments, the 5' end contains a spacer and additional nucleotides that do not function to guide the Cas protein to the target nucleotide region.
[0121] The sgRNA has a 3' end, which is the last nucleotide of the sgRNA. The 3' end region contains the last 1 to 7 nucleotides from the 3' end. In some embodiments, the 3' end is the end of hairpin 2. In some embodiments, the sgRNA contains nucleotides after the hairpin region(s). In some embodiments, the sgRNA includes a 3' end region, in which case the last nucleotide of the 3' end is the 3' end. In some embodiments, the 3' tail contains, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 or more nucleotides that do not associate with the secondary structure of the hairpin. In some embodiments, the 3' tail region contains 1, 2, 3, or 4 nucleotides that do not associate with the secondary structure of the hairpin. In some embodiments, the 3' tail region contains 4 nucleotides that do not associate with the secondary structure of the hairpin. In some embodiments, the 3' tail region contains 1, 2, or 3 nucleotides that do not associate with the secondary structure of the hairpin.
[0122] In some embodiments, the modified gRNA further comprises a targeting nucleic acid sequence complementary to the target nucleic acid sequence. The complementary sequence is approximately 20 nucleotides long. In some embodiments, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotides in the complementary nucleotide sequence are modified nucleotides. In certain cases, approximately 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in the complementary nucleotide sequence (e.g., a first nucleotide sequence of approximately 20 nucleotides long) are modified nucleotides. In other cases, all nucleotides in the complementary nucleotide sequence (e.g., a complementary nucleotide sequence of approximately 20 nucleotides long) are modified nucleotides. In some cases, modified nucleotides are located at the 5' end of the complementary nucleotide sequence (e.g., the terminal nucleotide at the 5' end) or near the 5' end (e.g., within 1, 2, 3, 4, or 5 nucleotides of the terminal nucleotide at the 5' end), and / or at internal positions within the complementary nucleotide sequence. In other cases, approximately 10% to 30% of the nucleotides in the first nucleotide sequence are modified nucleotides.
[0123] Exemplary gRNA sequence In some embodiments, this disclosure provides the longest gRNAs. Table 1 includes some exemplary longest gRNAs having chemical modifications. [Table 1] [Table 2] TIFF2026516973000004.tif24165
[0124] Synthesis of modification guide RNA Also described herein are methods for synthesizing the modified gRNAs described herein. In some embodiments, a first RNA sequence which is a trans-activating RNA (tracrRNA) and a second RNA sequence which includes clustered and regularly arranged short palindromic repeat (CRISPR) RNAs (crRNAs) that contain sequences complementary to the target sequence are provided for synthesizing the modified sgRNAs described herein.
[0125] In some embodiments, the first RNA sequence and the second RNA sequence are ligated together. The ligation strategies described herein differ from previously reported chemical ligation strategies used to synthesize synthetic RNA including guide RNA. The advantage of using this segmented synthetic approach is that shorter sections of RNA can be produced with higher purity after purification compared to full-length gRNA. In this approach, the 5' acceptor is the smallest RNA fragment (about 30-50 nt) and can therefore be purified to a high level before ligation. The 3' donor is terminated with the phosphate required for synthesis, and therefore only the full-length fragment is incorporated into the full-length product (i.e., the tip section is not a substrate).
[0126] In some embodiments, the modified gRNA is synthesized using a self-template approach. A method for synthesizing the modified gRNA comprises providing a complementary first RNA sequence and a second RNA sequence, wherein the complementarity allows for base pairing and stem-loop formation between the first RNA and the second RNA, and ligating the first RNA and the second RNA within the stem-loop using a ligation enzyme, thereby producing the modified gRNA. This makes it possible to template the enzymatic ligation of the two RNAs using a helix or other structure formed between the first RNA and the second RNA. In some embodiments, the length and sequence composition of the structure formed between the first RNA and the second RNA are modified to facilitate non-covalent assembly and create an optimal ligation site for an enzyme compatible with RNA ligation.
[0127] Complementarity can be some or all of the nucleotides between the first and second RNA sequences. Complementarity allows for base pairing between complementary nucleotides. In regions where partial complementarity exists, mismatched nucleotides will result in the formation of a bulge or loop structure between the first and second RNA sequences. Various structures of modified gRNA, such as the longest upper stem, stem-loop, lower stem, hairpin, overhang, blunt end, or bulge, can be formed between the first and second RNA sequences based on hybridization between them.
[0128] Various ligases can be used in the methods described herein. For example, one or more of the following can be used: T4 RNA ligase 1, T4 RNA ligase 2, RtcB ligase, heat-stable 5'App DNA / RNA ligase, ElectroLigase, T4 DNA ligase, T3 DNA ligase, T7 DNA ligase, Taq DNA ligase, SplintR ligase, E. coli DNA ligase, 9°N DNA ligase, CircLigase, CircLigase II, DNA ligase I, DNA ligase III, and DNA ligase IV. In some embodiments, T4 RNA ligase 1 is used to ligate a first RNA and a second RNA in a terminal loop. In some embodiments, T4 RNA ligase 2 is used to ligate a first RNA sequence and a second RNA sequence in a stem formed between the first RNA sequence and the second RNA sequence.
[0129] Various types of ligation, such as ligation within the terminal loop of a hairpin formed between a first RNA sequence and a second RNA sequence, are possible using this approach. Various ligases, such as T4 RNA ligase 1, are suitable for ligation within the terminal loop of the formed hairpin. Another type of ligation possible with this approach is ligation within the double helix formed between the first RNA and the second RNA. Various ligases, such as T4 RNA ligase 2 and DNA ligases, are suitable for ligation within the double helix formed between the two RNAs.
[0130] In some embodiments, the modified gRNAs of this disclosure may be synthesized using a sprint template approach. In some embodiments, the sprint is used for the production of synthetic RNA. The use of a sprint allows one or more RNA molecules to be brought into physical proximity for the reaction by using the sprint as a template. When more than two RNAs are joined, the use of a sprint facilitates the production of synthetic RNA, such as the modified sgRNA described herein. In some embodiments, the sprint may be any suitable polymer that can bring one or more RNA molecules into proximity, and such polymer may be used. For example, in some embodiments, the sprint may be an RNA molecule or a DNA molecule.
[0131] In some embodiments, the sprint is complementary to sections of a first RNA sequence and a second RNA sequence. The complementarity may be partial or complete. Accordingly, in some embodiments, a method is provided for producing a modified gRNA, comprising: providing a first RNA containing a 5' phosphate; providing a second RNA containing a free 3'-hydroxyl; providing an oligonucleotide having partial complementarity to the first RNA and the second RNA, wherein the complementarity of the oligonucleotide enables base pairing with the first RNA and the second RNA; and providing a ligase for catalyzing ligation between the first RNA and the second RNA, and thus producing the gRNA.
[0132] In some embodiments, a non-template approach is used to produce the modified sgRNA described herein. In some embodiments of the non-template approach, a first RNA having a 5' phosphate (e.g., a 5' monophosphate) is provided, and a second RNA containing a blocked 3' end (e.g., a blocked 3' OH) is provided. The purpose of blocking the 3' OH of the second RNA is to prevent the second RNA from cyclizing via a non-template mechanism when ligation occurs. For example, using this non-template approach may involve a second RNA containing a 3' hydroxyl at the 3' end of a donor molecule that is chemically blocked or removed (e.g., a dideoxynucleotide), and an enzyme (particularly by T4 RNA ligase 1) catalyzes the appropriate ligation between the first and second RNAs. In some embodiments, this ligation strategy is carried out at high concentrations.
[0133] In some embodiments, a non-template approach for producing synthetic RNA includes providing a first RNA containing a 5' monophosphate, providing a second RNA containing a blocked 3' end, and providing a ligase for catalyzing ligation between the first RNA and the second RNA, thereby producing the modified sgRNA described herein.
[0134] Gene editing systems This disclosure provides a gene editing system comprising one or more modified sgRNAs described herein. In some embodiments, the system comprises a CRISPR-Cas9 nuclease or a variant thereof.
[0135] Various Cas9 nuclease variants, both naturally occurring and genetically engineered, can be included within pre-configured gene editing systems.
[0136] In some embodiments, the present invention provides a gene editing system comprising one sgRNA or modified sgRNA described herein, and a CRISPR-Cas9 nuclease or a variant thereof.
[0137] In some embodiments, the present invention provides a gene editing system comprising one sgRNA or modified sgRNA described herein and a base editor. The base editor may comprise an adenosine deaminase domain or a cytidine deaminase domain. For example, one or more modified guide RNAs target the base editor to bring about a change from A>>T to G*C in a target polynucleotide (e.g., a target gene). In one embodiment, the base editor is a fusion protein comprising one or more domains having base editing activity.
[0138] In another embodiment, the protein domain having base-editing activity is bound to a guide RNA (e.g., via an RNA-binding motif on the guide RNA and an RNA-binding domain fused to a deaminase). In some embodiments, the domain having base-editing activity can deaminate bases within a nucleic acid molecule. In some embodiments, the base editor can deaminate one or more bases within a DNA molecule. In some embodiments, the base editor can deaminate cytosine (C) or adenosine (A) within DNA. In some embodiments, the base editor can deaminate both cytosine (C) and adenosine (A) within DNA. In some embodiments, the base editor is a cytidine base editor (CBE). In some embodiments, the base editor is an adenosine base editor (ABE). In some embodiments, the base editor is an adenosine base editor (ABE) or a variant thereof. For example, ABEs include, but are not limited to, ABE8.8, the editor variant ABEV1 (pNMG-B2000(ABE8.20 w / F149Y "v1") + S82T), or ABEV2 (pNMG-B2001(ABE8.20 w / Y147D, F149Y, T166I, D167N "v2") + S82T). In some embodiments, the base editor is a cytidine base editor (CBE). In some embodiments, the base editor is a nuclease-inactive Cas9 (dCas9) fused to an adenosine deaminase. In some cases, the base editor may be fused to a base excision repair inhibitor, such as a UGI domain or a dISN domain. In other embodiments, the base editor is an abasic base editor.
[0139] Detailed descriptions of base editors can be found in PCT Patent Application Publications 2018 / 027078, 2017 / 070632, 2022 / 204268, and 2023 / 114953, the contents of which are incorporated herein by reference for all purposes.
[0140] Formulations and Compositions The modified sgRNAs and gene editing systems of the present disclosure can be formulated in carriers for delivery and administration. In some embodiments, the pharmaceutical formulation comprises lipid nanoparticles (LNPs). In some embodiments, the pharmaceutical formulation comprises at least one modified gRNA of the present disclosure. In another embodiment, the pharmaceutical formulation comprises at least one modified gRNA and Cas9 protein, a polynucleotide encoding Cas9 protein, or mRNA encoding Cas9 protein.
[0141] Lipid nanoparticles (LNPs) are a well-known means for delivery of nucleotides and protein cargos and may be used for delivery of the gRNAs, gene editing systems, compositions, or pharmaceutical formulations disclosed herein. In some embodiments, the LNPs deliver nucleic acids, proteins, or nucleic acids together with proteins. Accordingly, the present disclosure provides a method for delivering any one of the gRNAs, gene editing systems, compositions, or pharmaceutical formulations disclosed herein, wherein the gRNA is associated with LNPs. In some embodiments, the gRNA / LNP also associates with Cas9 or mRNA encoding Cas9. In some embodiments, the gRNA / LNP also associates with a base editor or mRNA encoding a base editor.
[0142] In some embodiments, the invention comprises a composition comprising any one of the disclosed gRNAs and LNPs. In some embodiments, the composition further comprises a Cas9 protein or variant thereof, or mRNA encoding a Cas9 protein or variant thereof.
[0143] In some embodiments, the LNP comprises one or more cationic lipids, one or more helper lipids, one or more PEGylated lipids, and one or more cholesterol-derived lipids.
[0144] In some embodiments, compositions comprising the modified gRNAs and gene editing systems described herein are provided. In some embodiments, the composition is a pharmaceutical composition. In some embodiments, the pharmaceutical composition comprises one or more of the modified sgRNAs described herein.
[0145] Compositions comprising any of the gRNAs and / or gene editing systems described herein, as well as carriers, excipients, diluents, etc. are included.
[0146] In some embodiments, the modified gRNAs, gene editing systems, compositions, and formulations disclosed herein are for use in the preparation of a medicament for treating a disease or disorder.
[0147] Methods of Use The present disclosure further provides for the use of the modified gRNAs described herein to alter the genome of a target nucleic acid in vitro (e.g., cells cultured in vitro for use in ex vivo therapy or other uses of gene-edited cells) or in cells of a subject such as a human (e.g., for use in in vivo therapy).
[0148] In some embodiments, the invention includes a method or use for modifying a target nucleic acid molecule, comprising administering or delivering any one or more of the gRNA gene editing system compositions or pharmaceutical formulations described herein.
[0149] In some embodiments, the invention includes a method or use for modulating a target gene, comprising administering or delivering any one or more of the gRNAs, gene editing systems, compositions, or pharmaceutical formulations described herein. In some embodiments, the modulation is editing the target gene. In some embodiments, the modulation is a change in the expression of a protein encoded by the target gene.
[0150] In some embodiments, the method or use results in gene editing. In some embodiments, the method or use results in a double-strand break in a target gene. In some embodiments, the method or use results in a nucleotide insertion or deletion in a target gene. In some embodiments, a nucleotide insertion or deletion in a target gene results in a frameshift mutation or an immature stop codon resulting in a non-functional protein. In some embodiments, a nucleotide insertion or deletion in a target gene results in knockdown or removal of target gene expression. In some embodiments, the method or use further comprises delivering a template to a cell, where at least a portion of the template is incorporated into the target DNA at or near a double-strand break site induced by a nuclease. In some embodiments, the method or use results in substitution. In some embodiments, gene regulation is an increase or decrease in gene expression, a change in the methylation state of DNA, or modification of a histone subunit. In some embodiments, the method or use results in an increase or decrease in the expression of a protein encoded by a target gene.
[0151] The efficacy of gRNAs and / or gene editing systems can be tested in vitro and in vivo. In some embodiments, the present invention comprises one or more of the gRNAs, gene editing systems, compositions, or pharmaceutical formulations described herein, wherein the gRNA results in gene regulation when provided to cells together with Cas9 or a Cas9-encoding mRNA. In some embodiments, the efficacy of the gRNA can be measured in vitro or in vivo.
[0152] In some embodiments, the efficiency of gRNA in increasing or decreasing target protein expression is determined by measuring the amount of target protein.
[0153] In some embodiments, the editing efficiency of a particular gRNA is determined by the edits present at the target site in the genome after delivery of Cas9 and the gRNA. In some embodiments, the editing efficiency of a particular gRNA is measured by next-generation sequencing. In some embodiments, the percentage of editing in the target region of interest is determined. In some embodiments, the total number of sequence reads with nucleotide insertions or deletions within the target region of interest, relative to the total number of sequence reads, is measured after delivery of the modified gRNA and / or the system or composition containing the modified gRNA.
[0154] In some embodiments, the activity of the modified gRNA is measured after in vivo administration of the LNP containing the modified gRNA.
[0155] In some embodiments, the in vivo efficacy of the gRNA or composition provided herein is determined by the effectiveness of editing measured in DNA extracted from a tissue (e.g., liver tissue) after administration of the gRNA.
[0156] In some embodiments, a method for modulating a target nucleic acid sequence within a cell includes contacting the cell with a composition comprising the modified sgRNA described herein.
[0157] Method of therapeutic use In some embodiments, one or more of the gRNAs, gene editing systems, compositions, or pharmaceutical formulations described herein are intended for use in preparing pharmaceuticals for the treatment or prevention of disease or disorder in a subject.
[0158] In some embodiments, the present invention includes a method for treating or preventing a disease or disorder in a subject, comprising administering one or more of the gRNAs, gene editing systems, compositions, or pharmaceutical formulations described herein.
[0159] In some embodiments, the gRNA, gene editing system, and composition increase the editing efficacy at the target site. In some embodiments, the editing efficacy is increased by about 10% to 100% compared to unmodified gRNA. In some embodiments, the editing efficacy is increased by 2 to 1000 times compared to unmodified gRNA. In some embodiments, the sgRNA of the present invention increases the gene modification efficacy by about 2 to 1000 times, or about 2 to 100 times, or about 2 to 50 times, or about 10 to 50 times, or about 10 to 20 times, or about 2 to 10 times, or about 2 to 5 times, or about 3 to 8 times, or about 2 to 5 times. As a non-limiting example, the sgRNAs described herein increase the effectiveness of gene modification by approximately 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 550, 600, 650, 700, 750, 800, 900, or 1000 times.
[0160] kit In another aspect of this disclosure, a kit comprising one or more gRNAs, compositions, or pharmaceutical formulations described herein is provided. In some embodiments, the kit further comprises one or more solvents, solutions, or buffers, each separate from the compositions or pharmaceutical formulations, instructions, or desiccants. [Examples]
[0161] The following examples illustrate, but do not limit, certain embodiments of the present invention.
[0162] Example 1: Editing efficacy of modified gRNA In this example, the ALAS1 (delta-aminolevulinic acid synthase 1) gene region was used to evaluate the effect of different hairpin designs on the editing efficacy of guide RNA.
[0163] When measured for in vivo liver editing (Figure 1A), when extended without modifying the hairpin, the editing efficacy decreased. However, when the hairpin was modified, i.e., extended with a high-level modification including all nucleotides, the editing efficacy increased.
[0164] Three different gRNAs targeting ALAS1: gRNA1 (end-modified), gRNA2 (standard high-level modification), and gRNA3 (highly modified longest hairpin design) were synthesized (Figure 2A). The editing efficacy of each gRNA in the liver was measured with both Lipid 1 (Figure 2B) and Lipid 2 (Figure 2C). gRNA3 with the longest design was found to be 2 - 5 times more potent at sub-saturating doses (8% editing at 0.005 mpk) than gRNA2 with a standard high-level modification design for ALAS1. The targeting sequence for ALAS1: CAGGATCCGCACAGACTCCAGGG (SEQ ID NO: 59), and the protospacer sequence: CAGGAUCCGCACAGACUCCA (SEQ ID NO: 60) were used in the study.
Table 3
[0165] The end-modified gRNA is the standard design of the gRNAs used in the prior art (Hendel, Ayal, et al. Nature biotechnology 33.9 (2015): -3290). A standard highly modified gRNA without extension in the region of the upper stem was also used for comparison (Finn, Jonathan D., et al. Cell reports 22.9 (2018): 2227 - 2235). Both the end-modified gRNA and the highly modified gRNA contain 100 nucleotide lengths. In the longest 1 design, the hairpin was extended with an additional three base pairs compared to the end-modified gRNA. The unmodified longest 1 has the same sequence as longest 1 (SEQ ID NO: 51) but is not internally modified with 2’OME. It has a length of 106 nt.
[0166] Riesenberg, et al. ("Improved gRNA secondary structures allow editing of target sites resistant to CRISPR-Cas9 cleavage." Nature Communications 13.1(2022):1-8) recently reported that engineered gRNAs with “locked” hairpins can increase the stability and editing efficacy of the engineered gRNAs. We compared the longest hairpins with Riesenberg’s GOLD (genome-edited locked design) hairpins. The in vitro editing efficacy of each gRNA design (normal terminal modification (EM), longest, GOLD, and combinations of longest and GOLD) was measured at three different target sites (TSBT×3288, TSBT×3215, and TSBT×3222) (see Figure 3A). Bold nucleotides in each design indicate skeletal modification nucleotides (Figure 3A). Figure 3B shows that both the longest and GOLD designs outperformed gRNAs with terminal modifications (EM shown in Figure 3A). An increase of approximately 7 times was observed in the GOLD design compared to the end-modified design. An increase of approximately 3 times was observed in the longest design compared to the end-modified design.
[0167] gRNAs with both the longest and GOLD designs (longest-GOLD) were synthesized and their editing efficacy was evaluated (gRNA6 in Figure 4A). The GOLD-longest design and the GOLD design were evaluated using three different adenine base editors (ABEs) (ABE8.8, ABE9V1, and ABE9V2) [according to the current read guide of the 102 Compatibility C-Kit Conditioning Program]. As used herein, ABEV1 is the editor variant pNMG-B2000 (ABE8.20 w / F149Y "v1") + S82T. ABEV2 is the editor variant pNMG-B2001 (ABE8.20 w / Y147D, F149Y, T166I, D167N "v2") + S82T.
[0168] Editing effectiveness after 5 days indicates that hairpin extension increases overall gRNA editing under saturated conditions (Figure 4B).
[0169] Example 2: New extension design This study further tested different hairpin extensions in gRNA. Three novel hairpin extensions with lower GC content than the longest modification promote hairpin stability. The sequences and modifications of the three gRNA designs are shown in Table 4. Longest 3 has three additional base pairs with complete modification of the upper stem loop. Longest 4 has five additional base pairs with complete modification. Unmodified longest 4 has the same extension as longest 4 but is unmodified. [Table 4]
[0170] Three novel hairpin designs were tested in vivo for editing potency against standard highly modified and terminally modified designs, as well as the longest design targeting ALAS1, using the base editor ABE8.8. The results showed that the longest 4 demonstrated higher potency than the standard highly modified and terminally modified designs (Figure 5). The unmodified longest 4 showed lower potency, demonstrating that extension alone is sufficient, and modification is necessary to increase potency. Similar findings were observed for the longest design.
[0171] Equivalents and range Those skilled in the art will be able to recognize or determine, through routine experiments, many equivalents to the specific embodiments of the invention described herein. The scope of the invention is not intended to be limited to the above description, but rather as described in the following claims.
Claims
1. A single guide RNA (sgRNA) comprising a long (or elongated) upper stem containing more than four base pairs formed by complementary nucleotides, wherein one or more nucleotides of the upper stem are modified nucleotides.
2. The sgRNA according to claim 1, wherein the region of the long upper stem contains 5 to 15 base pairs formed by complementary nucleotides.
3. The sgRNA according to claim 2, wherein the region of the long upper stem contains five base pairs formed by complementary nucleotides.
4. The sgRNA according to claim 2, wherein the region of the long upper stem contains six base pairs formed by complementary nucleotides.
5. The sgRNA according to claim 2, wherein the region of the long upper stem contains seven base pairs formed by complementary nucleotides.
6. The sgRNA according to claim 2, wherein the region of the long upper stem contains eight base pairs formed by complementary nucleotides.
7. The sgRNA according to claim 2, wherein the region of the long upper stem contains nine base pairs formed by complementary nucleotides.
8. The sgRNA according to claim 2, wherein the region of the long upper stem contains 10 base pairs formed by complementary nucleotides.
9. The sgRNA according to any one of the prior claims, wherein all of the nucleotides of the upper stem are modified nucleotides.
10. The sgRNA according to any one of the prior claims, wherein one or more nucleotides within the regions of hairpin 1 and hairpin 2 are modified nucleotides.
11. The sgRNA according to claim 10, wherein all of the nucleotides within the regions of the hairpins 1 and 2 are modified nucleotides.
12. The sgRNA according to any one of the prior claims, wherein the sgRNA further comprises a modified stable hairpin 1 region.
13. The sgRNA according to claim 12, wherein the modified stable hairpin 1 region includes an extended stem region containing more than four base pairs, and the loop of the hairpin 1 contains locked nucleic acid.
14. A guide RNA comprising an extended upper stem containing more than four base pairs formed by complementary nucleotides, wherein the nucleotides in the upper stem contain a 2'-O-methyl modification.
15. 755555178 xn 7222 81 n AAG!!AAA!!AA,997647666 !!!!!6 2355712222221717112 A single guide RNA (sgRNA) containing the sequence UUU (sequence number 1), In the array, N xn and N yn However, they have the same number of nucleotides and are complementary nucleotides for forming base pairs, N xn and N yn The aforementioned nucleotide is a modified nucleotide, and n is an integer between 5 and 15, in which case it is a single guide RNA (sgRNA).
16. Nx and Ny are each complementary nucleotides and include five nucleotides forming the region of the upper stem of the sgRNA, and the sgRNA is GUUUUAGAN x N x N x N x N x GAAAA N y N y N y N y N y AAGUUAAAAUAACGGUAGUCCGUUAUCAACUUAAAAAGUGGCACCGAGUCGGUCG The sgRNA according to claim 15, comprising the sequence UUUU (sequence number 2).
17. Nx and Ny are complementary nucleotides, each comprising six nucleotides that form the upper stem region of the sgRNA, and the sgRNA is GUUUUAGAN x N x N x N x N x N x GAAAN y N y N y N y N y N y AAGUUAAAAAAAGGCUAGUCCGUUAUCAACUUGAAAAAAGUGGCACCGAGUCGGUGC The sgRNA according to claim 15, comprising the sequence UUUU (sequence number 3).
18. Nx and Ny are complementary nucleotides, each comprising seven nucleotides that form the upper stem region of the sgRNA, and the sgRNA is GUUUUAGAN x N x N x N x N x N x N x GAAAN y N y N y N y N y N y N y AAGUUAAAAAAAGGCUAGUCCGUUAUCAACUUGAAAAAAGUGGGCACCGAGUCGGUGCU The sgRNA according to claim 15, comprising the sequence UUU (sequence number 4).
19. Nx and Ny are complementary nucleotides, each comprising eight nucleotides that form the upper stem region of the sgRNA, and the sgRNA is GUUUUAGAN x N x N x N x N x N x N x N x GAAAN y N y N y N y N y N y N y N y AAGUUAAAAAAAGGCUAGUCCGUUAUCAACUUGAAAAAAGUGGGCACCGAGUCGGUGCU The sgRNA according to claim 15, comprising the sequence UUU (sequence number 5).
20. Nx and Ny are complementary nucleotides, each comprising nine nucleotides that form the upper stem region of the sgRNA, and the sgRNA is GUUUUAGAN x N x N x N x N x N x N x N x N x GAAAN y N y N y N y N y N y N y N y N y AAGUUAAAAAAAGGCUAGUCCGUUAUCAACUUGAAAAAAGUGGCACCGAGUCGGUGC The sgRNA according to claim 15, comprising the sequence UUUU (sequence number 6).
21. Nx and Ny are each complementary nucleotides and include 10 nucleotides forming the region of the upper stem of the sgRNA, and the sgRNA is GUUUUAGAN x N x N x N x N x N x N x N x N x N x GAAAA N y N y N y N y N y N y N y N y N y N y AAGUUAAAAUAACGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUUGCU The sgRNA according to claim 15, comprising the sequence UUU (sequence number 7).
22. The aforementioned sgUL is GUUUUAGAGGCCGGAAAAACGCGCCAAGUUAAAAAUAAGGCCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUGGUCU The sgRNA according to claim 15, comprising the sequence UUU (sequence number 8).
23. The aforementioned sgUL is GUUUUAGAGCCGCGGGAAAAACGCCCGGCAAGUUAAAAAUAAGGCCUAGUUAUCAACUUGAAAAAGUGGCACAGUCGGUGCU The sgRNA according to claim 14, comprising the sequence UUU (sequence number 9).
24. The sgRNA according to any one of claims 14 to 23, wherein all of the nucleotides in the upper stem include a 2'O-methyl modification.
25. The sgRNA according to claim 24, wherein the sgRNA includes the sequence described in any one of SEQ ID NOs. 20-32 and 51-52.
26. The sgRNA according to any one of claims 14 to 25, wherein one or more nucleotides in the regions of hairpin 1 and hairpin 2 are modified nucleotides.
27. The sgRNA according to claim 26, wherein all of the nucleotides within the regions of hairpin 1 and hairpin 2 are modified nucleotides.
28. The sgRNA according to any one of claims 14 to 27, wherein the loop of hairpin 1 comprises 2'-O-methyl modified nucleotides (e.g., 2'-O-methyl 3'-phosphorothioate (MS) nucleotide, 2'-O-methyl 3'-thioPACE (MSP) nucleotide), 2'-F modified nucleotides, locked nucleic acids, MOE (methoxyethyl), DNA nucleotides functionalized for conjugation, and combinations thereof.
29. GUUUUAGAN xn GAAAN yn AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGCACCGAGUCGGUGCU A single guide RNA (sgRNA) containing the sequence UUU (sequence number 10), In the array, N xn and N yn However, they have the same number of nucleotides and are complementary nucleotides for forming base pairs, N xn and N yn The aforementioned nucleotide is a modified nucleotide, and n is an integer between 5 and 15, in which case it is a single guide RNA (sgRNA).
30. Nx and Ny are complementary nucleotides, each comprising five nucleotides that form the upper stem region of the sgRNA, and the sgRNA is GUUUUAGAN x N x N x N x N x GAAAN y N y N y N y N y AAGUUAAAAAAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGGCACCGAGUCGGUGCU The sgRNA according to claim 29, comprising the sequence UUU (sequence number 11).
31. Nx and Ny are complementary nucleotides, each comprising six nucleotides that form the upper stem region of the sgRNA, and the sgRNA is GUUUUAGAN x N x N x N x N x N x GAAAN y N y N y N y N y N y AAGUUAAAAAAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGGCACCGAGUCGGUGCU The sgRNA according to claim 29, comprising the sequence UUU (sequence number 12).
32. Nx and Ny are complementary nucleotides, each comprising seven nucleotides that form the upper stem region of the sgRNA, and the sgRNA is GUUUUAGAN x N x N x N x N x N x N x GAAAN y N y N y N y N y N y N y AAGUUAAAAAAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGGCACCGAGUCGGUGCU The sgRNA according to claim 29, comprising the sequence UUU (sequence number 13).
33. Nx and Ny are complementary nucleotides, each comprising eight nucleotides that form the upper stem region of the sgRNA, and the sgRNA is GUUUUAGAN x N x N x N x N x N x N x N x GAAAN y N y N y N y N y N y N y N y AAGUUAAAAAAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGGCACCGAGUCGGUGC The sgRNA according to claim 29, comprising the sequence UUUU (sequence number 14).
34. Nx and Ny are complementary nucleotides, each comprising nine nucleotides that form the upper stem region of the sgRNA, and the sgRNA is GUUUUAGAN x N x N x N x N x N x N x N x N x GAAAN y N y N y N y N y N y N y N y N y AAGUUAAAAAAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGGCACCGAGUCGGUGC The sgRNA according to claim 29, comprising the sequence UUUU (sequence number 15).
35. Nx and Ny are complementary nucleotides, each comprising 10 nucleotides that form the upper stem region of the sgRNA, and the sgRNA is GUUUUAGAN x N x N x N x N x N x N x N x N x N x GAAAN y N y N y N y N y N y N y N y N y N y AAGUUAAAAAAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGGCACCGAGUCGGUGCU The sgRNA according to claim 29, comprising the sequence UUU (sequence number 16).
36. The aforementioned sgUL is GUUUUAGAGCCGCGGGAAAAACGCCCGGCAAGUUAAAAAUAAGGCCUAGUCCGUUAUCAACUUGGAACUUCGGUCCAAGUU The sgRNA according to claim 29, comprising the sequence UUU (sequence number 17).
37. 755555278 xn 72228 yn 2.2552.2.11153.1533.1555.
250. z 8. z 8. z 8. z 753322171111132317112 A single guide RNA (sgRNA) containing the sequence UUU (sequence number 18), In the array, N xn and N yn However, they have the same number of nucleotides and are complementary nucleotides for forming base pairs, N xn and N yn The aforementioned nucleotide is a modified nucleotide, n is an integer from 5 to 15, and the four nucleotides (N) of the hairpin 1 loop z N z N z N z ) is a single guide RNA (sgRNA) containing the sequence of UUCG, CUUG, or GCAA.
38. The sgRNA according to any one of claims 29 to 37, wherein one or more nucleotides within the regions of hairpin 1 and hairpin 2 are chemically modified nucleotides.
39. The sgRNA according to claim 38, wherein all of the nucleotides within the regions of hairpin 1 and hairpin 2 are modified nucleotides.
40. The sgRNA according to any one of claims 29 to 39, wherein the loop of the hairpin 1 contains locked nucleic acid.
41. The sgRNA according to any one of the prior claims, wherein the modification includes 2'-O-methyl modified nucleotides (e.g., 2'-O-methyl 3'-phosphorothioate (MS) nucleotide, 2'-O-methyl 3'-thioPACE (MSP) nucleotide), 2'-F modified nucleotides, locked nucleic acids, MOE (methoxyethyl), DNA nucleotides functionalized for conjugation, and combinations thereof.
42. The sgRNA according to any one of the prior claims, wherein at least one modification comprises a 2'-O'methyl (2'-O-Me) modified nucleotide.
43. The sgRNA according to any one of claims 29 to 42, wherein all of the nucleotides in the upper stem include a 2'O-methyl modification.
44. The sgRNA according to claim 43, wherein the sgRNA includes the sequence described in any one of sequence numbers 33 to 40.
45. The sgRNA according to any one of the prior claims, wherein the gRNA further comprises a spacer sequence at the 5' end of the sgRNA, and the spacer sequence comprises a sequence complementary to the target sequence of interest.
46. The sgRNA according to claim 45, wherein the spacer sequence comprises approximately 18 to 25 nucleotides, or 18 to 30 nucleotides, or 20 to 25 nucleotides, or 20 to 30 nucleotides.
47. The sgRNA according to any one of the prior claims, wherein the 3' end of the sgRNA is modified.
48. The sgRNA according to any one of the prior claims, wherein the 5' end of the sgRNA is modified.
49. The sgRNA according to claim 48, wherein at least the first three nucleotides at the 5' end of the sgRNA are modified nucleotides.
50. The sgRNA according to any one of claims 1 to 46, wherein the sgRNA includes a modification at the 5' end of the sequence and a modification at the 3' end of the sequence.
51. The sgRNA according to any one of the prior claims, wherein about 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 75%, 80%, 90%, or 100% of the nucleotides of the sgRNA are modified nucleotides.
52. The sgRNA according to any one of the prior claims, wherein the sgRNA further comprises a nuclear localization sequence (NLS).
53. The sgRNA according to any one of the prior claims, wherein the sgRNA comprises about 102 to 150 nucleotides.
54. The sgRNA according to claim 53, wherein the sgRNA contains about 102 to 120 nucleotides.
55. The sgRNA according to any one of the prior claims, wherein the sgRNA increases the gene modification effectiveness by approximately 2 to 1000 times.
56. The sgRNA according to claim 55, wherein the sgRNA increases the gene modification effectiveness by approximately 2 to 100 times, 2 to 50 times, 2 to 20 times, or 10 to 50 times.
57. The sgRNA according to claim 56, wherein the sgRNA increases the gene modification effectiveness by approximately 2 to 10 times, 2 to 5 times, 3 to 8 times, or 5 to 10 times.
58. (a) CRISPR-related protein (Cas) polypeptides, or variants thereof, and (b) A gene modification system comprising a single guide RNA (sgRNA) as described in any one of the prior claims.
59. The gene modification system according to claim 58, wherein the Cas polypeptide is a Cas9 protein.
60. The gene modification system according to claim 59, wherein the Cas9 is S. pyogenes Cas9 or S. aureus Cas9.
61. The gene modification system according to claim 60, wherein the Cas9 polypeptide is nickase or dCas9.
62. The gene modification system according to any one of claims 58 to 61, wherein the effectiveness of the gene modification is increased by approximately 2 to 1000 times.
63. The gene modification system according to claim 62, wherein the effectiveness of the gene modification is increased by approximately 2 to 100 times, or 2 to 50 times, or 2 to 20 times, or 10 to 50 times.
64. The gene modification system according to claim 63, wherein the effectiveness of the gene modification is increased by approximately 2 to 10 times, or 2 to 5 times, or 3 to 8 times, or 5 to 10 times.
65. A composition comprising a single guide RNA as described in any one of claims 1 to 59.
66. The composition according to claim 65, further comprising a Cas9 polypeptide or a variant thereof.
67. The composition according to claim 66, wherein the Cas polypeptide is Cas9 protein, dCas9, or nicasse.
68. The composition according to any one of claims 65 to 67, formulated in lipid nanoparticles.
69. A method for modifying a target gene within a cell, comprising introducing a gene editing system containing a single guide RNA (sgRNA) according to any one of claims 1 to 59 into the cell.
70. The method according to claim 66, further comprising introducing a CRISPR-related protein (Cas) polypeptide or a variant thereof into a cell. The sgRNA induces the Cas polypeptide in the target gene, and the sgRNA then generates 5'GUUUUAGCUAGAAAUAGCAAGUUAAAAUGCUAGUCCGUUAUCAACUUGAAAAAGUGGCAACCGAGUCGGUGCU Compared to the corresponding unmodified sgRNA containing UUU3' (SEQ ID NO: 19), it induces modification of the target gene with improved activity.
71. The method according to claim 70, wherein the cells are Cas9-expressing cells.
72. The method according to claim 70 or 71, wherein the cells are mammalian cells.
73. The method according to any one of claims 70 to 72, wherein the cells are immune cells.
74. A kit comprising an sgRNA according to any one of claims 1 to 57, a gene modification system according to any one of claims 58 to 64, or a composition according to any one of claims 65 to 68.
75. A single guide RNA containing the sequence described in any one of sequence numbers 20-21 and 51-52.