Nucleic acid scaffolds, related devices, and methods

Abstract

A nucleic acid scaffold is provided. In some embodiments, the nucleic acid scaffold includes a fixed-tolerant or variable-tolerant structure operably linked to site-specific metallized nucleic acid regions within the nucleic acid scaffold. The fixed-tolerant or variable-tolerant structure includes an opening formed by one or more non-metallized nucleic acid regions of the nucleic acid scaffold, and at use, the conductance between two or more of the site-specific metallized nucleic acid regions is conditional on the state of the fixed-tolerant or variable-tolerant structure. In some cases, the state of the structure is the presence or absence of an analyte in the opening, for example, the presence or absence of a polymer (e.g., nucleic acid or protein) translocating through the opening. Also provided are devices and methods using the nucleic acid scaffold of this disclosure for, for example, detection and / or analysis of an analyte of interest.

Description

[Technical Field]

[0001] Cross-reference of related applications This application claims the interests of U.S. Provisional Patent Application No. 63 / 465,790, filed on 11 May 2023, which is incorporated herein by reference in its entirety. [Overview of the Initiative]

[0002] A nucleic acid scaffold is provided. In some embodiments, the nucleic acid scaffold includes a fixed-tolerant or variable-tolerant structure operably linked to site-specific metallized nucleic acid regions within the nucleic acid scaffold. The fixed-tolerant or variable-tolerant structure includes an opening formed by one or more non-metallized nucleic acid regions of the nucleic acid scaffold, and at use, the conductance between two or more of the site-specific metallized nucleic acid regions is conditional on the state of the fixed-tolerant or variable-tolerant structure. In some cases, the state of the structure is the presence or absence of an analyte in the opening, for example, the presence or absence of a polymer (e.g., nucleic acid or protein) translocating through the opening. Also provided are devices and methods using the nucleic acid scaffold of this disclosure for, for example, detection and / or analysis of an analyte of interest. [Brief explanation of the drawing]

[0003] [Figure 1] A schematic diagram of a nucleic acid scaffold operably connected to an electrode according to an embodiment of the present disclosure. [Figure 2] A schematic diagram of a site-specifically metallized nucleic acid scaffold according to an embodiment of the present disclosure. [Figure 3] A schematic diagram of an additional site-specifically metallized nucleic acid scaffold operably connected to an electrode according to an embodiment of the present disclosure. [Figure 4] A schematic diagram of one embodiment of the present disclosure, in which a site-specifically metallized nucleic acid scaffold is inserted into a nanopore. [Figure 5] Schematic diagram of a non-restrictive approach to site-specific metallization of nucleic acid scaffolds. [Figure 6A] Description of a nucleic acid scaffold with 4nm pores. [Figure 6B] Description of a nucleic acid scaffold with 4nm pores. [Figure 7A] Further depiction of nucleic acid scaffolds with 4 nm pores, as shown in Figures 6A-6B. [Figure 7B] Further depiction of nucleic acid scaffolds with 4 nm pores, as shown in Figures 6A-6B. [Figure 8A] An image of a triangular design outlining the scaffold and staple DNA with a protruding oligodendrome density field. [Figure 8B] An image of a triangular design outlining the scaffold and staple DNA with a protruding oligodendrome density field. [Figure 9A] TEM image showing selective metallization (dark contrast) of a triangle. [Figure 9B] TEM image showing selective metallization (dark contrast) of a triangle. [Figure 10] Atomic force microscope (AFM) image of thiolated DNA origami triangles selectively bound to gold electrodes patterned on silicon nitride by lithography. [Figure 11A] AFM image showing the selective bonding of thiolated triangular origami to Au after ultrasonic treatment during the tip cleaning process. [Figure 11B] AFM image showing the selective bonding of thiolated triangular origami to Au after ultrasonic treatment during the tip cleaning process. [Figure 11C] AFM image showing the selective bonding of thiolated triangular origami to Au after ultrasonic treatment during the tip cleaning process. [Figure 12A] AFM image showing the selective binding of thiolated triangular origami to Au after gentler washing following deposition. [Figure 12B] AFM image showing the selective binding of thiolated triangular origami to Au after gentler washing following deposition. [Figure 12C] AFM image showing the selective binding of thiolated triangular origami to Au after gentler washing following deposition. [Figure 13A]AFM image showing selective binding of thiolated triangular oligomers to Au after UV-ozone cleaning. [Figure 13B] AFM image showing selective binding of thiolated triangular oligomers to Au after UV-ozone cleaning. [Figure 13C] AFM image showing selective binding of thiolated triangular oligomers to Au after UV-ozone cleaning. [Figure 14A] AFM image of the reference triangular oligomer. [Figure 14B] AFM image of the reference triangular oligomer. [Figure 15A] AFM image of the reference triangular oligomer. [Figure 15B] AFM image of the reference triangular oligomer. [Figure 16A] TEM images of dimers and clusters of DNA origami triangles connected by cytosine-cytosine mismatches mediated by silver ions in overhang-type single-stranded polycytosine oligonucleotides. [Figure 16B] TEM images of dimers and clusters of DNA origami triangles connected by cytosine-cytosine mismatches mediated by silver ions in overhang-type single-stranded polycytosine oligonucleotides. [Figure 17] Devices according to embodiments of the present disclosure.

Mode for Carrying Out the Invention

[0004] Before describing the scaffolds, devices and methods of the present disclosure in more detail, it should be understood that the scaffolds, devices and methods are not limited to the specific embodiments described, and thus, of course, such things can vary. Also, since the scope of the scaffolds, devices and methods is limited only by the appended claims, it should be understood that the terms used herein are for the purpose of describing specific embodiments only and are not intended to be limiting.

[0005] Where a range of values ​​is provided, it should be understood that, unless the context clearly indicates otherwise, each intervening value up to one-tenth of the lower limit unit between the upper and lower limits of that range, and any other values ​​or intervening values ​​in the range of that description, are included within the scaffold, device, and method. The upper and lower limits of these smaller ranges may independently be included within the smaller range, and are also included within the scaffold, device, and method according to any specifically excluded limits in the scope of the description. If the scope of the description includes one or both limits, the range excluding one or both of those included limits is also included within the scaffold, device, and method.

[0006] In this specification, certain ranges are presented preceded by the term “approximately.” In this specification, the term “approximately” is used to provide literal support for the exact number it precedes, as well as for any number that is close to or approximates the number it precedes. When determining whether a number is close to or approximately close to a specifically listed number, an unlisted number that is close to or approximately close to that number may, in the context in which it is presented, provide a substantial equivalence to the specifically listed number.

[0007] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art in the field to which the scaffolding, devices, and methods belong. Any scaffolding, devices, and methods similar or equivalent to those described herein may also be used in the implementation or testing of the scaffolding, devices, and methods, but representative exemplary scaffolding, devices, and methods are described herein.

[0008] All publications and patents cited herein are incorporated herein by reference in the same way that each individual publication or patent is specifically and individually indicated to be incorporated by reference, and are incorporated herein by reference to disclose and describe in relation to the materials and / or methods cited by the publications. No citation of any publication is made to its disclosure prior to the filing date, and the date of the publication provided may differ from the actual publication date which may need to be verified independently; therefore, this should not be construed as acknowledging that the scaffolds, devices and methods do not have prior rights to such publications.

[0009] It should be noted that, as used herein and in the appended claims, the singular forms "a," "an," and "the" refer to multiple subjects unless the context clearly indicates otherwise. It should also be noted that the claims may be drafted to exclude any optional elements. Therefore, this statement is intended to function as an antecedent to the use of such exclusive terms as "alone," "only," or "negative" limitation relating to the enumeration of elements of the claims.

[0010] For clarity, it is understood that specific features of scaffolding, devices, and methods described in the context of separate embodiments may also be provided in combination in a single embodiment. Conversely, for brevity, various features of scaffolding, devices, and methods described in the context of a single embodiment may also be provided separately or in any preferred subcombination. All combinations of embodiments are specifically encompassed by this disclosure, and to the extent that such combinations encompass operable processes and / or compositions, each and all combinations are disclosed herein as if they were individually and expressly disclosed. In addition, all subcombinations listed in embodiments describing such variable parts are also specifically encompassed by the scaffolding, devices, and methods, and each and all such subcombinations are disclosed herein as if they were individually and expressly disclosed herein.

[0011] As will be apparent to those skilled in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has individual elements and features that can be readily separated from or combined with features of any of several other embodiments without departing from the scope or spirit of the Method. Any listed method may be carried out in the order of the enumerated events, or in any other logically possible order.

[0012] definition The terms “nucleic acid,” “polynucleotide,” and “oligonucleotide” (or “oligo”) are used interchangeably herein and refer to any length of nucleotides, e.g., deoxyribonucleotides or ribonucleotides, e.g., more than about 2 bases, more than about 10 bases, more than about 100 bases, more than about 500 bases, more than 1,000 bases, more than 10,000 bases, more than 100,000 bases, more than about 1,000,000 bases, up to about 10 10This describes polymers of more than one base, which may be produced enzymatically or synthetically (e.g., PNA as described in U.S. Patent No. 5,948,902 and the literature cited therein), and which can hybridize with naturally occurring nucleic acids in a sequence-specific manner similar to that of two naturally occurring nucleic acids, and can, for example, participate in Watson-Crick base-pair interactions. Naturally occurring nucleotides include guanine, cytosine, adenine, thymine, and uracil (G, C, A, T, and U, respectively). While DNA and RNA have deoxyribose and ribose sugar backbones, respectively, the backbone of PNA consists of repeating N-(2-aminoethyl)-glycine units linked by peptide bonds. In PNA, various purine and pyrimidine bases are linked to the backbone by methylene carbonyl bonds. Locked nucleic acids (LNA), often referred to as inaccessible RNA, are modified RNA nucleotides. The ribose portion of an LNA nucleotide is modified with an extra crosslink connecting the 2' oxygen and 4' carbon. Crosslinking often "locks" ribose in the 3'-endo(North) conformation found in type A double helix. LNA nucleotides can be mixed with DNA or RNA residues in oligonucleotides whenever desired. The terms "unstructured nucleic acid" or "UNA" refer to nucleic acids containing non-natural nucleotides that bind to each other with reduced stability. For example, an unstructured nucleic acid may contain G' and C' residues, which correspond to G and C analogs that do not exist in nature, i.e., they base-pair to each other with reduced stability but retain the ability to base-pair to naturally occurring C and G residues, respectively. Unstructured nucleic acids are described in US2005 / 0233340, which is incorporated herein by reference for the disclosure of UNAs.

[0013] In some embodiments, the "oligonucleotide" has a length of 5 to 200 nucleotides, for example, 10 to 100 nucleotides.

[0014] According to some embodiments, the nucleic acid scaffold of the present disclosure comprises one or more nucleotides that increase thermal stability, non-limiting examples of which include 2-amino-2'-deoxyadenosine-5'-triphosphate (2-amino-dATP), 5-methyl-2'-deoxycytidine-5'-triphosphate (5-Me-dCTP), 5-propynyl-2'-deoxycytidine-5'-triphosphate (5-Pr-dCTP), 5-propynyl-2'-deoxyuridine-5'-triphosphate (5-Pr-dUTP), and / or halogenated deoxyuridine (XdU), e.g., 5-chloro-2'-deoxyuridine-5'-triphosphate (5-Cl-dUTP), 5-bromo-2'-deoxyuridine-5'-triphosphate (5-Br-dUTP), or any combination thereof.

[0015] As used herein, the terms “complementary” or “complementarity” refer to a nucleotide sequence of a first nucleic acid that non-covalently base-pairs with a region of a second nucleic acid, or a nucleotide sequence of a region of a first nucleic acid that non-covalently base-pairs with a second region of the nucleic acid (e.g., the stem region). In canonical Watson-Crick base pairing, adenine (A) base-pairs with thymine (T), as does guanine (G) base-pairs with cytosine (C) in DNA. In RNA, thymine is replaced by uracil (U). Thus, A is complementary to T, and G is complementary to C. In RNA, A is complementary to U, and vice versa. Typically, “complementary” or “complementarity” refers to nucleotide sequences that are at least partially complementary. These terms may also encompass double helix sequences that are fully complementary, such that all nucleotides in one strand are complementary to all nucleotides in the other strand at their corresponding positions. In certain cases, a nucleotide sequence may be partially complementary to the target, meaning that not all nucleotides are complementary to all nucleotides in the target nucleic acid at all corresponding positions. For example, a region of the first nucleic acid may be perfectly (i.e., 100%) complementary to a region of the second nucleic acid, or the region of the first nucleic acid may share some degree of complementaryity less than perfect (e.g., 70%, 75%, 85%, 90%, 95%, 99%). The percentage of identity between two nucleotide sequences can be determined by aligning the sequences for optimal comparison purposes (e.g., gaps can be introduced in the sequence of the first sequence for optimal alignment). Then, comparing the nucleotides at corresponding positions, the percentage of identity between the two sequences is a function of the number of identical positions they share (i.e., identity % = number of identical positions / total number of positions × 100). If a position in one sequence is occupied by the same nucleotide as a corresponding position in another sequence, then the molecules are identical at that position. For non-restrictive examples of such mathematical algorithms, see Karlin et al., Proc.Natl.Acad.Sci.USA 90:5873-5877(1993).Such algorithms are incorporated into NBLAST and XBLAST programs (version 2.0) as described in Altschul et al., Nucleic Acids Res. 25:389-3402 (1997). When using the BLAST and Gapped BLAST programs, the initial settings parameters of each program (e.g., NBLAST) can be used. In some embodiments, the parameters for sequence comparison can be set to score = 100 and word length = 12, or can be varied (e.g., word length = 5 or word length = 20).

[0016] The terms “polypeptide,” “peptide,” and “protein,” as used interchangeably herein, refer to polymeric forms of amino acids of any length and may include genetically encoded and non-genetically encoded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having a modified peptide backbone.

[0017] As used herein, "conductance" refers to the flow of charge in a circuit that may be influenced and defined by its impedance, resistance, and / or reactance.

[0018] Nucleic acid scaffold This disclosure provides nucleic acid scaffolds (which may also be referred to herein as “origami”). In certain embodiments, the nucleic acid scaffold includes a fixed-tolerance or variable-tolerance structure operably linked to site-specific metallized nucleic acid regions within the nucleic acid scaffold. The fixed-tolerance or variable-tolerance structure includes an opening formed by one or more non-metallized nucleic acid regions of the nucleic acid scaffold, and at use, the conductance between two or more of the site-specific metallized nucleic acid regions is conditional on the state of the fixed-tolerance or variable-tolerance structure. In some cases, the state of the structure is the presence or absence of an analyte in the opening, for example, the presence or absence of a polymer (e.g., nucleic acid or protein) translocating through the opening.

[0019] A nucleic acid scaffold can be any convenient nucleic acid configured in such a manner that it forms at least partially an opening. In several embodiments, the nucleic acid scaffold comprises at least a nucleic acid base that pairs with adenine, a nucleic acid base that pairs with thymine or uracil, a nucleic acid base that pairs with guanine, and a nucleic acid base that pairs with cytosine. In certain cases, the nucleic acid scaffold comprises one or more debasalized nucleotides. The nucleic acid scaffold may optionally be a single-stranded nucleic acid. The nucleic acid scaffold may optionally be electrolyzed. As discussed herein, an "electrolyzed" nucleic acid refers to a nucleic acid through which an electric current has passed. Without being constrained by theory, the DNA backbone is thought to be able to support multiple charge transfer mechanisms arising from small activation gaps induced by water and counterions. Any preferred number of nucleic acids may be used for the scaffold. In some cases, the number of nucleic acids ranges from 1 to 50, for example, from 1 to 15 and from 1 to 10. In some embodiments, the scaffold of the present invention comprises two or more nucleic acids. In other embodiments, the scaffold of the present invention comprises three or more electrolyzed nucleic acids. Each of the multiple nucleic acids may have the same or different configurations.

[0020] Structures containing openings separate two or more site-specific metallized nucleic acid regions, for example, a separated first site-specific metallized nucleic acid region and a second site-specific metallized nucleic acid region. Metallization is described herein in its conventional sense to describe the application of metals to nucleic acids. For example, the conductivity of nucleic acids can be modified with dopants such as conductive metal nanoparticles. Metal nanoparticles of interest include, but are not limited to, gold, lead sulfide, lead selenide, germanium, and silver. In some embodiments, the conductivity of nucleic acids can be modified with dopants such as conductive carbon, such as carbon nanotubes, carbon nanorods, carbon black, graphene sheets, graphene nanoribbons, and carbon nanofibers. In additional cases, the conductivity of a scaffold is modified by molecular doping with intercalators such as anthraquinone, ferrocene, norbornadiene, methylene blue, ethidium, coralyne, and cryptolepin. Nucleic acid intercalation involves the insertion of one intercalation moiety (monointercalator), two intercalation moieties (bisintercalator), or multiple intercalation moieties into a nucleic acid structure. Intercalation alters the conductivity / resistance of the complex, affecting the overall conductive properties of the nucleic acid chain. In one embodiment, the dopant can be reduced or oxidized by an applied current.

[0021] As discussed herein, “site-specific” metallization refers to the metallization of only specific regions (or fields of nucleic acids—e.g., as in Figures 3, 5, and 9) of a nucleic acid, leaving others unmetallized. To be understood, the term “metallized region” or “metallized nucleic acid region” does not require complete metallization, and similarly, the term “non-metallized region” or “non-metallized nucleic acid region” does not require the complete absence of metallization, nor is such a requirement necessary for the scaffolds and devices of this disclosure to function as intended. In some cases, the nucleic acids of this disclosure may be considered site-specifically metallized if less than 5% of unintended sites (i.e., those not corresponding to the region of interest) are metallized, for example, if sites containing less than 4%, less than 3%, less than 2%, less than 1%, and 0% are metallized. In some embodiments, the metallized sites are determined by nucleic acid density. In some such embodiments, the metallized sites are determined based on the number of nucleic acid strands. For example, in some embodiments, the metallization conditions are such that double-stranded nucleic acids, which have a higher density compared to single-stranded nucleic acid regions, are preferentially metallized. In some cases, the nucleic acid scaffold region includes protruding oligos, such as double-stranded oligos, which increase the nucleic acid density for metallization. The length of the oligos may vary, sometimes ranging from 10 bp to 50 bp (e.g., 15 bp to 25 bp), and including 18 bp to 22 bp. Modifications to the length or density of these oligos can enable distinct metallization due to the preference for longer, higher-density oligo arrays for metal ions, as well as differences in the three-dimensional structure of double-stranded and single-stranded DNA in solution. See Dai et al. (2022) DNA Origami-Encoded Integration of Heterostructures. Angew.Chem.Int.Ed.61(11):e202114190.doi:10.1002 / anie.202114190.Epub 2022 Jan 27.PMID:34962699. The chemicals used for site-specific metallization may depend on the properties of the metal.

[0022] The nucleic acid scaffolds of this disclosure utilize the base-pairing properties of nucleic acids to enable modular design and self-assembly of scaffolds including nanometer-scale openings (or, in any embodiment, “gaps,” “spaces,” or “gates”) having precisely defined size and shape. For example, the sequence and length of nucleic acids may be selected to provide a scaffold having openings of a selected nanometer scale size for use as a detection region for one or more analytes of interest, e.g., small molecules, nucleic acids, proteins. Structures having fixation resistance or variability resistance include openings formed by one or more non-metallated nucleic acid regions of the nucleic acid scaffold. In certain embodiments, the maximum dimensions of the openings are 1 to 1000 nanometers (nm), e.g., 1 to 750 nm, 1 to 500 nm, 1 to 250 nm, or 1 to 100 nm. In certain embodiments, the openings have a maximum dimension of 2 to 20 nm, 2 to 15 nm, or 2 to 10 nm, e.g., 2 to 5 nm.

[0023] As discussed above, structures with fixation resistance or variability resistance include an opening formed by one or more non-metallated nucleic acid regions of a nucleic acid scaffold. In other words, the nucleic acid regions forming the opening are either non-metallated or negligibly metallated. In selected embodiments, the one or more non-metallated nucleic acid regions forming the opening share one or more nucleic acids with two or more site-specifically metallated nucleic acid regions. In other words, the metallated and non-metallated regions do not need to be on completely different strands. Instead, these regions can reside on one or more strands of the scaffold. As discussed above, nucleic acid density (e.g., whether a given strand exists as a double-stranded polynucleotide) may determine metallation at least partially. In certain embodiments, the one or more non-metallated nucleic acid regions forming the opening include nucleic acids hybridized with the nucleic acids of two or more site-specifically metallated nucleic acid regions. In other words, the one or more non-metallated nucleic acid regions forming the opening are on a different strand from the strand containing the one or more metallated regions, but are connected.

[0024] In some cases, the nucleic acid scaffold adheres to a surface. The nucleic acid may stably associate with the surface in any preferred manner. "Stable association" means that the nucleic acid scaffold does not readily dissociate from the surface. In certain cases, the nucleic acid scaffold includes first and second discontinuous regions attached to the surface. "Discontinuous" regions mean that the first and second regions are not the same region (i.e., they do not overlap). The discontinuous regions of the nucleic acid scaffold may adhere to the same or different surfaces. Each surface may contain any convenient material. In certain cases, the surface is a metallic surface (e.g., a gold surface). In some embodiments, the nucleic acid scaffold stably associates with the surface via thiol bonding chemistry. For example, in embodiments where the surface is a gold surface, the thiols may react directly with the gold surface to form Au-S bonds via a redox reaction. In additional embodiments, stably associating the scaffold with the surface involves dip-pen nanolithography. In such embodiments, an atomic force microscope may be used to imprint the thiolate onto the surface. Dip-pen nanolithography is described, for example, in U.S. Patents 8,261,662 and 9,403,180, the disclosures of which are incorporated herein by reference in their entirety. In other embodiments, the nucleic acid scaffold stably associates with a surface via biotin-streptavidin interactions. In a selective case, the nucleic acid scaffold is in contact with multiple surfaces. In other words, one end of the nucleic acid scaffold may be in contact with a first surface, and the other end of the nucleic acid scaffold may be in contact with a second surface different from the first surface.

[0025] If selected, the nucleic acid scaffold is attached by coating the surface with a biocompatible layer. The biocompatible layer may vary and may include, for example, a polymer matrix, a gel, or a self-assembled monolayer (SAM). In certain embodiments, the alkanethiol SAM is produced on one or more of the surfaces. In such cases, the surface (e.g., a gold surface) is incubated with thiol-functionalized blocking molecules. Thiol-functionalized blocking molecules include, but are not limited to, 1-mercapto-11-undecanol, 1-mercapto-6-hexanol, hexadecanethiol, and combinations thereof. SAM formation is described, for example, in Szymonik et al. Nanotechnology, 27(39), 395301, which is incorporated in whole herein by reference. Coating may include applying a negative voltage to the surface in solution, thereby breaking the thiol bonds and releasing the blocking molecules. A suitable method for such electrochemical desorption can be found, for example, in Widrig et al., Journal of electroanalytical chemistry and interfacial electrochemistry, 310(1-2), 335-359, which is incorporated herein by reference in its entirety. Following the release of the blocking molecule, adhesion may involve incubating a mixture of the desired 5'- or 3'-thiol-functionalized nucleic acid (e.g., oligonucleotide) and the thiol-containing blocking molecule to form a new electrode-bound monolayer in which the desired nucleic acid is dotted. A method that may be employed for use in surface functionalization is described, for example, in Walti et al., Langmuir, 19(4), 981-984, which is incorporated herein by reference in its entirety.

[0026] In some cases, the surface to which the nucleic acid scaffold binds is an electrode. In other words, the 5' and / or 3' ends of the nucleic acid may optionally be in contact with at least one electrode in order to conduct current on at least a portion of the scaffold. In a selective embodiment, one end of the scaffold stably associates with an electrode, while the other end stably associates with a non-electrode surface. In other cases, both ends of the scaffold stably associate with different electrodes. The electrode may include any convenient material. In some embodiments, the electrode is a metallic electrode. Materials for use in metallic electrodes include, but are not limited to, platinum, gold, titanium nitride, silver, and graphite. In a particular embodiment, the electrode is a gold electrode.

[0027] In a selective embodiment, the surface (e.g., electrode surface) is functionalized with oligonucleotides containing sequences complementary to the first and second discontinuous regions, the first and second discontinuous regions being attached to the surface via hybridization to the oligonucleotides. The oligonucleotides may be any suitable short (e.g., 5-100 nucleotides) single-stranded DNA or RNA molecules. In a particular case, each oligonucleotide has a sequence complementary to the scaffold sequence, i.e., a sequence that allows the two molecules to hybridize. Because the oligonucleotides are immobilized on the surface (e.g., electrode surface), the nucleic acid scaffold hybridized to the oligonucleotides can stably associate with at least one surface.

[0028] In selected embodiments, two or more site-specific metallized nucleic acid regions include a first metallized field adjacent to an opening at a first location of the opening and a second metallized field adjacent to an opening at a second location of the opening. As considered herein, a “metallized field” (also referred herein as a “density field”) is a region of scaffold adjacent to an opening that is metallized in a site-specific manner (e.g., as considered above). In particular, the first and second locations of the opening are on opposite sides of each other. In some embodiments, the site-specific metallized oligodensity field is operably coupled to an electrode (e.g., one described above). In some such cases, the site-specific metallized field is operably coupled to the electrode via an attached nucleic acid (e.g., “attached oligo”). In selective cases, the attached nucleic acid is also metallized. The electrode may then be operably coupled to a power source to allow the application of bias between site-specific metallized oligodensity fields.

[0029] A sample (e.g., a biological sample) may be examined for the presence or concentration of one or more analytes of interest, and / or the identity of monomers (including their sequence) within a polymer may be determined based on qualitative or quantitative changes and / or fluctuations in conductance resulting from the presence of the analyte in the opening (e.g., translocating it). The scaffold enables improved analyte detection and / or analysis of the analyte of interest for precise sizing of the opening (or “detection region”), for example, using the nucleic acid-based approach described herein.

[0030] When an electrical bias is introduced between two or more site-specific metallized nucleic acid regions, the structure acquires fixation resistance or variability resistance between the two or more site-specific metallized nucleic acid regions. The resistance of the structure, and consequently the conductance between two or more site-specific metallized nucleic acid regions, depends on the state of the structure, which may be the presence or absence of an analyte (e.g., translocating it) within the openings of the structure. In other words, it is the presence of the analyte that causes fixation resistance or variability resistance. In some such embodiments, where the analyte is a polymer (e.g., nucleic acid, protein), the state of the structure having fixation resistance or variability resistance is the presence or absence of the polymer translocating through the openings. In certain embodiments, the conductance between two or more site-specific metallized nucleic acid regions changes, or occurs only in the presence of nucleic acids translocating through the openings. In selected cases, the conductance between two or more site-specific metallized nucleic acid regions increases in the presence of an analyte translocating through the openings. For example, a scaffold may be configured for the detection of changing conductance, which indicates a continuous interaction with an analyte (e.g., a nucleic acid or protein to be sequenced). Without being constrained by theory, it should be understood that the interactions between a given nucleic acid base are characterized by a specific conductance fingerprint. In other words, DNA base pairs behave as biological Aviram-Ratner electrical rectifiers due to spatial separation and weak binding between nucleic acid bases, and because the current flowing across these base pairs changes based on the specific properties of the binding. In the exemplary use of the scaffold described in the claims, such a conductance fingerprint may be identified as the nucleic acid, which is the analyte, passes through the opening, thereby identifying features of the nucleic acid, including but not limited to the sequence of the nucleic acid. Further details relating to conductance fingerprints may be found in International Patent Publication No. 2023 / 086416, the disclosure of which is incorporated herein by reference.In several embodiments, the interaction between the sequenced base and the scaffold base leads to a changing conductance fingerprint that allows for the identification of the sequenced base. Measuring electrons moving across the nucleic acid allows for the evaluation of this conductance fingerprint.

[0031] The conductance along the analyte may be measured via any convenient approach. In some embodiments, a potentiometer is used to provide a bias current and analyze the resulting current. Commercially available potentiometers that may be suitable for use in the method of the subject include, for example, Keithley® instruments. In some embodiments, detecting the changing conductance involves an impedance-based approach. In certain embodiments, the method includes identifying nucleic acid bases based on their characteristic energy levels. The characteristic energy levels of interest include, but are not limited to, the highest occupied molecular orbital (HOMO) energy. Measurement techniques that may be employed for use in the method of the subject can be found, for example, in Pedersen et al., Nanotechnology, 28(1), 015502, and Ohshiro et al., 2012, 12th IEEE International Conference on Nanotechnology (IEEE-NANO) (pp. 1-2), IEEE, which are incorporated herein in their entirety by reference. Details relating to embodiments of the scaffold of this disclosure are described here.

[0032] A non-limiting example of a nucleic acid scaffold of this disclosure is schematically shown in Figure 1. In this example, the nucleic acid scaffold 100 includes a first nucleic acid 101 and a second nucleic acid 102. The sequences of the first nucleic acid 101 and the second nucleic acid 102 are designed to provide a first stem region 103, a second stem region 104, and a “loop” structure 105. Figure 1B shows the site-specific metallized form of the scaffold of Figure 1A, where, under the conditions of this example, double-stranded DNA is preferentially metallized, resulting in site-specific metallization of the stem region and generating a first site-specific metallized nucleic acid region 106 and a second site-specific metallized nucleic acid region 107. Thus, in this example, the non-metallized nucleic acid region forming the opening shares two nucleic acids with the first and second site-specific metallized nucleic acid regions.

[0033] In Figure 1, the first and second site-specifically metallized nucleic acid regions are operably coupled to electrodes 108 and 109, respectively. When an electrical bias is applied between the first and second site-specifically metallized nucleic acid regions, structure 105 (including the opening formed by the non-metallized nucleic acid regions of the first and second nucleic acids 101 and 102) exhibits fixed or variable resistance, and the conductance between the first and second site-specifically metallized nucleic acid regions is conditional on the state of structure 105 (e.g., the presence or absence of an analyte translocating within or through the opening).

[0034] Figure 1C shows a site-specifically metallized scaffold of Figure 1B in the context of a device including a nanopore 110, where the nanopore is aligned with the opening of structure 105. The device may be adapted to translocate analytes through the nanopore, thereby translocating analytes through the opening. In this way, the nanopore has been found to have applications in facilitating the translocation of analytes through the opening (for purposes such as detecting, quantifying, and determining the arrangement of analytes). For example, the nanopore may provide a single passage through which an ionic solution on a first side of the membrane comes into contact with an ionic solution on a second side of the membrane. Using a constant voltage bias, an ionic current through the nanopore may be generated that drives an analyte (e.g., a negatively charged analyte such as DNA or RNA) initially present in the chamber on the first side through the pore to the chamber on the second side.

[0035] Further non-limiting examples of site-specific metallized nucleic acid scaffolds of this disclosure are schematically shown in Figures 2A and 2B. Figure 2A shows a scaffold 200 containing site-specific metallized regions 202 and 204 separated by a structure 206 containing an opening formed by a non-metallized nucleic acid region. In this example, the non-metallized nucleic acid region contains first and second nucleic acids designed to associate with the site-specific metallized region via hybridization. Figure 2B shows a configuration in which four site-specific metallized regions are separated by a structure containing an opening formed by a non-metallized nucleic acid region.

[0036] Further non-limiting examples of site-specific metallized nucleic acid scaffolds in the context of devices using them are schematically shown in Figure 3. In these examples, site-specific metallized nucleic acid density fields (here, oligonucleotide (or "oligo") density fields) are located adjacent to the opening at different locations. Referring to Figure 3B, scaffold 300 includes structure 302 (containing an opening formed by a non-metallized nucleic acid region) and site-specific metallized oligo density fields 304 and 306 adjacent to the opening at first and second substantially opposite locations, respectively. The site-specific metallized oligo density fields are operably coupled to electrodes. In this example, the site-specific metallized oligo density fields are operably coupled to electrodes via attached nucleic acids (here, "attached oligos"), which are also later metallized. The electrodes may then be operably coupled to a power source to allow the application of bias between the site-specific metallized oligo density fields. The device may include nanopores, and the openings may be aligned with the nanopores. For example, Figure 3C shows a side view of the arrangement in Figure 3B, illustrating the alignment of the nanopore 308 formed in the film (or substrate) 310 with the opening. The device may be adapted to translocate analytes through the nanopore and thereby through the opening, as described elsewhere in this specification.

[0037] As can be understood by the interests of this disclosure, a nucleic acid scaffold may include a single nucleic acid scaffold unit, or it may include two or more nucleic acid scaffold subunits (e.g., scaffold monomers) operably connected to one another. For example, the nucleic acid scaffolds shown in Figure 3 may each include one nucleic acid scaffold unit, or they may be generated from two or more scaffold subunits. A non-limiting exemplary approach for generating a scaffold containing two or more subunits is described in detail in Example 4 below.

[0038] A further non-limiting example of a site-specific metallized nucleic acid scaffold in the context of a device including a nanopore is schematically shown in Figure 4. In this example, the site-specific metallized nucleic acid scaffold is inserted into the nanopore rather than placed on top of it. As illustrated, the nanopore is formed on a film or substrate including an electrolytic surface on each side. The electrolytic surface is operably connected to the site-specific metallized oligodendrocyte density field of the scaffold via attached oligodendrocytes. Here, the scaffold has a three-dimensional shape that is substantially cylindrical or conical and sized for insertion into the nanopore. The opening 400 is formed or substantially formed by the non-metallized nucleic acid region of the nucleic acid scaffold, and the conductance between the oligodendrocyte density fields is conditioned on the state of the opening, e.g., the presence or absence of an analyte in (or translocating thereto) the opening.

[0039] Site-directed metallization of nucleic acid scaffolds may be achieved using various approaches. A non-limiting example is schematically shown in Figure 5. In this example, the metallization conditions are such that double-stranded nucleic acids, which are denser than single-stranded nucleic acid regions, are preferentially metallized. Figure 5A shows an example of how such double-stranded nucleic acids may be provided within the scaffold, where the "base" strand 501. Against this, an oligonucleotide containing a domain complementary to the base strand is hybridized. The third nucleic acid species hybridizes to a domain of the second species that does not hybridize to the base strand, thereby providing a metallization target within the scaffold (top). In Figure 5A, the base strand is completely or substantially completely occupied by the metallization target, and as a result, at metallization (bottom), the base strand does not contain any non-metallized regions. In contrast, and as shown in Figure 5B, the nucleic acid double strand may be discontinuous along the base chain (for example, by designing a base chain having one or more domains containing nucleotide sequences that are not complementary to others used in the scaffold, and / or by masking one or more domains with proteins that bind thereto during the hybridization step), and as a result, during metallization, the site-specifically metallized portion of the scaffold is formed to include a first metallized region and a second metallized region separated by a non-metallized region.

[0040] According to one non-restrictive approach to site-directed metallization, a planar DNA origami triangle was designed to have oligonucleotides protruding from the plane. One side of the triangle is 7.79 × 10⁻⁶. -2 chain / nm 2 It has oligonucleotides with a density of 20 base pairs and a double strand protruding. Another side is 7.79 × 10 -2 chain / nm 2The oligo has a single strand of 20 bases protruding at a density. The third side does not have a protruding oligo. Modifications to the length or density of these oligos may enable distinct metallization due to the preference for longer, higher-density oligo arrays for metal ions, as well as differences in the three-dimensional structure of double-stranded and single-stranded DNA in solution. See Dai et al. (2022) DNA Origami-Encoded Integration of Heterostructures. Angew. Chem. Int. Ed. 61(11):e202114190.doi:10.1002 / anie.202114190.Epub 2022 Jan 27.PMID:34962699.

[0041] In certain embodiments, partial silver metallization is performed. According to one particular approach, 180 femtomoles of DNA origami triangles are combined with 1.25 μL of freshly prepared Tollen reagent (formed by the reaction of 20 μL of 147 mM AgNO3 with 8 μL of NH4OH (immediately after the solution becomes clear)), and then 1.4 μL of nuclease-free water is added. To this mixture, 1.25 μL of 200 mM glucose is added as a reducing agent to bring the total metallization reaction volume to 62.5 μL. Metallization is carried out at room temperature in complete darkness without shaking for 15 minutes. See Zhang et al. (2021) Prescribing Silver Chirality with DNA Origami. J.Am.Chem.Soc. 143(23), 8639-8646.

[0042] In some cases, partial gold metallization occurs. For example, 180 femtomoles of DNA origami triangles may be combined with 1.25 μL of 300 mM H(AuCl4) to a total volume of 61.25 μL. The reaction mixture is incubated at room temperature in complete darkness for 3 hours without shaking. Next, 1.25 μL of 600 mM glucose is added as a reducing agent. See Dai et al. (above).

[0043] As can be understood by the interests of this disclosure, the nucleic acid scaffolds of this disclosure (e.g., those shown in Figures 6–8) may contain a single nucleic acid skeleton or may contain two or more nucleic acid skeletons. In some cases, a nucleic acid scaffold containing one or more nucleic acid skeletons may be stabilized using “staple” oligonucleotides, for example, as shown in Figures 6–8.

[0044] The conditions under which the scaffold may be used may vary. In some cases, the scaffold is present in a vacuum. In other cases, the scaffold is immersed in a fluid. In some cases, the fluid is a gas. In other cases, the fluid is a liquid. In some cases, the fluid contains an ion concentration selected to achieve a desired conductance between two or more site-specifically metallized nucleic acid regions. In some embodiments, the conductance is the baseline conductance when the analyte is not present in the opening. For example, in some embodiments, the scaffold is used in the presence of a suitable charge carrier, such as a metal salt, e.g., alkali metal salt, halide salt, e.g., chloride salt, e.g., alkali metal chloride salt. The charge carrier may include an ionic liquid or an organic salt, e.g., tetramethylammonium chloride, trimethylphenylammonium chloride, phenyltrimethylammonium chloride, or l-ethyl-3-methylimidazolium chloride. Generally, the salt is present in an aqueous solution in the chamber. For example, potassium chloride (KCl), sodium chloride (NaCl), or cesium chloride (CsCl) may be used. The salt concentration may be saturated. The salt concentration may be 3M or less, typically 0.1–2.5M, 0.3–1.9M, 0.5–1.8M, 0.7–1.7M, 0.9–1.6M, or 1M–1.4M. The salt concentration may also be 150mM–1M. This method is preferably carried out using salt concentrations of at least 0.3M, for example, at least 0.4M, at least 0.5M, at least 0.6M, at least 0.8M, at least 1.0M, at least 1.5M, at least 2.0M, at least 2.5M, or at least 3.0M. Higher salt concentrations provide a high signal-to-noise ratio, allowing for the identification of currents indicating the presence of nucleotides against a background of normal current fluctuations.

[0045] Once the nucleic acid sequence, length, and species ratio are selected to generate a scaffold with desired characteristics (e.g., opening size, opening shape, metallization target (e.g., oligo density field)), the scaffold is typically assembled under conditions for specific hybridization. Whether specific hybridization occurs depends on the degree of complementarity between the relevant nucleic acids, their lengths, and the temperature at which hybridization occurs (the melting temperature (T) of the relevant parts of the nucleic acids). M It is determined by factors such as (which can be determined by ). The melting temperature is the temperature at which half of the nucleic acids remain hybridized and the other half dissociate into single strands. The Tm of a double strand is given by the following formula: Tm = 81.5 + 16.6 (log10[Na + [Na]) + 0.41 (fraction G + C) - (600 / N) may be experimentally determined or predicted using this formula, where N is the chain length. + The Tm is less than 1M. See Sambrook and Russell (2001; Molecular Cloning: A Laboratory Manual, 3rd ed. Cold Spring Harbor Press, Cold Spring Harbor NY, Ch.10). Alternatively, other more advanced models that depend on various parameters may be used to predict the Tm of the target captured nucleic acid / target nucleic acid double strand depending on various hybridization conditions. Approaches for achieving specific nucleic acid hybridization can be found, for example, in Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology—Hybridization with Nucleic Acid Probes, part I, chapter 2, “Overview of principles of hybridization and the strategy of nucleic acid probe assays,” Elsevier (1993).

[0046] Devices and computer control systems Aspects of the present disclosure further include devices. In certain embodiments, a device of the present disclosure includes any of the nucleic acid scaffolds of the present disclosure, electrodes operably coupled to two or more site-specific metallized nucleic acid regions, and one or more power supplies operably coupled to the electrodes. Such a device may further include one or more processors, and one or more computer-readable media containing stored instructions, which, when executed by one or more processors, causes the device to introduce an electrical bias between two or more site-specific metallized nucleic acid regions and measure the conductance between two or more site-specific metallized nucleic acid regions.

[0047] Various approaches may be used to operably link an electrode to two or more site-specific metallized nucleic acid regions. For example, in some embodiments, the electrode is operably linked to two or more site-specific metallized nucleic acid regions via attached nucleic acids, which are subsequently metallized. The attached nucleic acids may include docking nucleic acids immobilized on the electrode surface, and the nucleic acids of the nucleic acid scaffold hybridize to the docking nucleic acids. The surface may be a metallic surface (e.g., a gold surface). In some embodiments, the docking nucleic acids stably associate with the surface via thiol-binding chemistry. For example, in embodiments where the surface is a gold surface, thiols may react directly with the gold surface to form Au-S bonds via redox reactions.

[0048] The surface may be functionalized with any useful / convenient reactive groups, including but not limited to thiol groups (-SH), amine groups (-NH2), and carboxyl groups (-COOH). Bioconjugation strategies for which applications have been found in conjugating any desired components of this disclosure are described in Hermanson, “Bioconjugate Techniques,” Academic Press, 2nd edition, April 1, 2008; Haugland, 1995, Methods Mol. Biol. 45:205-21; Brinkley, 1992, Bioconjugate Chemistry 3:2, and others.

[0049] Functional groups that may be used to bind to components include, but are not limited to, active esters, isocyanates, imido esters, hydrazides, amino groups, aldehydes, ketones, photoreactive groups, maleimide groups, alpha-halo-acetyl groups, epoxides, aziridines, etc. Reagents such as iodoacetamide, maleimide, benzyl halide, and bromomethyl ketone react by S-alkylation of thiols to produce stable thioether products. For example, at pH 6.5 - 7.5, the maleimide group reacts with sulfhydryl groups to form stable thioether bonds. Arylation reagents such as NBD halides react with thiols or amines by a similar substitution of aromatic halides by nucleophiles. Since the thiolate anion is a better nucleophile than neutral thiol, cysteine is more reactive than its pK a (about 8.3 depending on the structural content of the protein). Thiols also react with certain amine-reactive reagents including isothiocyanates and succinimidyl esters. Reagents of the TS-Link series are available for reversible thiol modification.

[0050] Regarding amine-reactive groups, primary amines are present at the N-terminus of polypeptide chains and in the side chains of lysine (Lys,K) amino acid residues. Among the available functional groups in typical biological or protein samples, primary amines are particularly nucleophilic and serve as ready targets for conjugation with several reactive groups. For example, NHS esters are reactive groups formed by carbodiimide activation of carboxylate molecules. NHS ester-activated crosslinkers and labeled compounds react with primary amines under physiologically slightly alkaline conditions (pH 7.2-9) to obtain stable amide bonds. The reaction releases N-hydroxysuccinimide (NHS). As another example, imide ester crosslinkers react with primary amines to form amidine bonds. Imide ester crosslinkers react rapidly with amines at alkaline pH but have a short half-life. As the pH becomes more alkaline, the half-life and reactivity with amines increase. Therefore, crosslinking is more efficient when performed at pH 10 than at pH 8. Reaction conditions below pH 10 may cause side reactions, but amidine formation is preferable between pH 8 and 10.

[0051] Numerous other synthetic chemical groups, including but not limited to isothiocyanates, isocyanates, acyl azides, sulfonyl chlorides, aldehydes, glyoxals, epoxides, oxiranes, carbonates, aryl halides, carbodiimides, anhydrides, and fluorophenyl esters, form chemical bonds with primary amines. Such groups conjugate to amines by either acylation or alkylation.

[0052] Approaches for adhesion also include click chemistry-based approaches. Click chemical reactions that may be used include (i) nucleophilic substitution, (ii) addition to CC multiple bonds (e.g., Michael addition, epoxidation, dihydroxylation, aziridation), (iii) non-aldol-like chemistry (e.g., N-hydroxysuccinimide active ester coupling), and (iv) cycloaddition (e.g., Diels-Alder reaction, cycloaddition of hysgene). Cycloaddition of hysgene has been applied in various fields of chemistry. Cycloaddition of hysgene consists of the condensation of an organic azide and an alkyne group, forming a 1,2,3-triazole bond. The azide and alkyne functional groups can be readily introduced into scaffolds for large organic constructs of biological relevance. The reaction may be catalyzed by the introduction of copper(I). The Cu(I) core activates the slowly reacting alkyne group, thus increasing the azide-alkyne condensation rate to about 10⁻¹⁰ 7 ~10 8 This reaction has a dual effect: it doubles the acceleration and organizes the reactive groups through "template formation" so that only region-specific 1,4-disubstituted adducts are formed. This reaction is known as copper-catalyzed azido-alkyne cycloaddition (CuAAC), and due to its compatibility with a wide range of biological substrates and synthetic conditions, CuAAC has become a leading force among click bonds. Since its discovery, Cu(I)-catalyzed azido-alkyne cycloaddition has been widely used in the fields of biology, biochemistry, and biotechnology. Click chemical reactions that may be used to attach nucleotides or polynucleotides to particles include, but are not limited to, hysgen azido-alkyne 1,3-dipolar cycloaddition, copper-catalyzed azido-alkyne cycloaddition (CuAAC), and ruthenium-catalyzed azido-alkyne cycloaddition (RuAAC). Further details on click chemistry using nucleic acids can be found, for example, in Fantoni et al. (2021) Chem. Rev. 121(12):7122-7154.

[0053] A variety of power sources may be used in conjunction with the method described in the subject. In some cases, the power source is a battery. Alternatively, the device may be configured for use with an AC current wall outlet power supply. However, the device may also be configured for use with any suitable power source, including a DC power supply. In some cases, the power supply is configured to intermittently provide an electrical bias between two or more site-specific metallized nucleic acid regions when the device is in use. In other cases, the power supply is configured to provide a continuous electrical bias between two or more site-specific metallized nucleic acid regions when the device is in use. In some cases, one or more power supplies provide an electrical bias between two or more site-specific metallized nucleic acid regions using a fixed voltage. Alternatively, one or more power supplies may provide an electrical bias between two or more site-specific metallized nucleic acid regions using a variable voltage.

[0054] In some cases, the scaffold is used in conjunction with a nanopore. For example, in some cases, the analyte may be translocated through the nanopore, thereby causing the analyte to be translocated through the opening. In certain cases, the nucleic acid scaffold and nanopore are arranged so that the analyte is translocated through the opening before it is translocated through the nanopore. Alternatively, the nucleic acid scaffold and nanopore may be arranged so that the analyte is translocated through the nanopore before it is translocated through the opening.

[0055] A suitable nanopore device may include a chamber containing an aqueous solution and a membrane separating the chamber into two sections, the membrane containing nanopores formed therein. Electrical measurements may be performed using a single-channel recording device, for example, as described in Lieberman et al. (2010) J.Am.Chem.Soc. 132(50):17961-72; Stoddart et al. (2009) PNAS 106(19):7702-7, U.S. Patent No. 9,481,908, and U.S. Patent Application Publication No. 2014 / 0051068, the disclosures thereof are incorporated herein by reference in their entirety for all purposes. Alternatively, electrical measurements may be performed using a multi-channel system, for example, as described in U.S. Patent Application Publication No. 2015 / 346149, the disclosures thereof are incorporated herein by reference in their entirety for all purposes.

[0056] In nanopore-based analysis (e.g., sequencing), the nanopore provides a single pathway through which the ionic solution on the cis side of the membrane comes into contact with the ionic solution on the trans side. A constant voltage bias (positive on the trans side) generates an ionic current through the nanopore, driving the polynucleotides in the cis chamber through the pore to the trans chamber. Processive enzymes (e.g., helicases, polymerases, nucleases, etc.) may be bound to the polynucleotides so that their stepwise movement controls the nucleotides and ratches each nucleic acid base through the small-diameter nanopore.

[0057] Suitable conditions for nanopore-assisted analysis (e.g., protein pores, solid-state pores, etc.) are known in the art. Typically, a voltage is applied across the membrane and pore. The voltage used may be in the range of +2V to -2V, for example, -400mV to +400mV. The voltage used may be within a range having a lower limit selected from -400mV, -300mV, -200mV, -150mV, -100mV, -50mV, -20mV, and 0mV, and an upper limit independently selected from +10mV, +20mV, +50mV, +100mV, +150mV, +200mV, +300mV, and +400mV. The voltage may also be in the range of 100mV to 240mV, for example, 120mV to 220mV.

[0058] In some embodiments, the rate at which the analyte is exposed to the opening is controlled using a processive enzyme. Non-limiting examples of processive enzymes that may be used include polymerases (e.g., phi29 or other suitable polymerases) and helicases, such as Hel308 helicase, RecD helicase, Tral helicase, Tral subgroup helicase, XPD helicase, etc. The processive enzyme may, for example, bind to the analyte, and the resulting complex may then be attracted to the nanopore by, for example, a potential difference applied across the nanopore. In other embodiments, the processive enzyme may be located in the nanopore (e.g., attached to or adjacent to the nanopore) such that the processive enzyme binds to the nucleic acid upon reaching the nanopore.

[0059] Nanopores may exist in solid-state films, biological membranes, and the like. In some embodiments, the nanopores are solid-state nanopores. In other embodiments, the nanopores are biological nanopores. Biological nanopores may be, for example, alpha-hemolysin-based nanopores, Mycobacterium smegmatis porin A (MspA)-based nanopores, and the like.

[0060] A device of the present disclosure is schematically shown in Figure 17. In this example, the device comprises an input signal controller operably coupled to a plurality of sensors, an optional amplifier, and a multiplexer (DeMUX). Each sensor includes a nucleic acid scaffold of the present disclosure. Each sensor may or may not include nanopores aligned with the openings of the nucleic acid scaffold. During use, the conductance between two or more site-specific metallized nucleic acid regions is subject to a structural state having fixed or variable resistance. As shown, the sensors are further operably coupled to a multiplexer (MUX), which is operably coupled to an output signal converter, which is operably coupled to a memory device.

[0061] Various processor-based systems may be used to implement embodiments of the present disclosure. Such systems may include a system architecture in which the components of the system communicate with one another using a bus. The system architecture may include processing units (CPUs or processors) and caches, which are variously coupled to the system bus. The bus connects various system components to the processor, including system memory (e.g., read-only memory (ROM) and random-access memory (RAM)).

[0062] The system architecture may include a cache of high-speed memory directly connected to the processor, located very close to the processor, or integrated as part of the processor. The system architecture may copy data from memory and / or storage devices to the cache for rapid access by the processor. In this way, the cache can provide performance improvements by avoiding processor delays while waiting for data. These and other modules may control or be configured to control the processor to perform various actions. Other system memories may also be available. Memory may include multiple different types of memory with different performance characteristics. The processor may include any general-purpose processor, as well as hardware or software modules such as first, second, and third modules stored in storage devices, configured to control the processor, and special-purpose processors in which software instructions are incorporated into the actual processor design. The processor may be a completely self-contained computing system, essentially including multiple cores or processors, buses, memory controllers, caches, etc. A multicore processor may be symmetric or asymmetric.

[0063] Aspects of the present invention also include non-transient computer-readable media. The subject non-transient computer-readable media includes instructions stored thereon that cause the system to monitor a changing conductance along the analyte, or a changing conductance between the analyte and an electrode adjacent to the analyte. As described above, the changing conductance indicates a continuous interaction between the nucleic acid bases of the analyte and one or more nucleic acid bases of the scaffold. In the selective case, the changing conductance includes conductance fingerprints for different nucleic acid bases in the analyte, and one or more non-transient computer-readable media include instructions stored thereon that cause the system to determine the identity of one or more nucleotides of the analyte based on the changing conductance. In the additional case, the changing conductance includes conductance fingerprints for different nucleic acid bases in the analyte, and one or more non-transient computer-readable media include instructions stored thereon that cause the system to determine the nucleotide sequence of the analyte based on the changing conductance.

[0064] To enable user interaction with the computing system architecture, input devices can represent any number of input mechanisms, such as a microphone for voice, a touch-sensitive screen for gesture or graphical input, a keyboard, a mouse, motion input, or voice. Output devices can also be one or more of several output mechanisms. In some examples, a multimodal system can allow the user to provide multiple types of inputs to communicate with the computing system architecture. The communication interface can generally control and manage user inputs and system outputs. There are no restrictions on operating on any particular hardware configuration, and therefore the basic features here may be easily replaced by improved hardware or firmware configurations as they are developed.

[0065] Storage devices are typically non-volatile memory and can be hard disks or other types of computer-readable media capable of storing computer-accessible data, such as magnetic cassettes, flash memory cards, solid-state memory devices, digital versatile disks, cartridges, random-access memory (RAM), read-only memory (ROM), and hybrids thereof.

[0066] The storage device may include software modules for controlling the processor. Other hardware or software modules are intended. The storage device may be connected to a system bus. In one embodiment, a hardware module performing a particular function may include software components stored on a computer-readable medium in relation to necessary hardware components such as a processor, bus, or output device, in order to perform various functions of the disclosed technology.

[0067] Embodiments within the scope of this disclosure may also include tangible and / or non-temporary computer-readable storage media or devices for carrying or having computer-executable instructions or data structures stored thereon. Such tangible computer-readable storage devices may be any available device accessible by a general-purpose or special-purpose computer, including any special-purpose processor functional design as described above. Such tangible computer-readable devices may include, but are not limited to, RAM, ROM, EEPROM, CD-ROM, or other optical disk storage devices, magnetic disk storage devices, or other magnetic storage devices, or any other device that can be used to carry or store desired program code in the form of computer-executable instructions, data structures, or processor chip designs. When information or instructions are provided to a computer via a network or another communication connection (either hardwired, wireless, or a combination thereof), the computer appropriately views the connection as computer-readable media. Therefore, any such connection is appropriately referred to as computer-readable media. The above combinations should also be included within the scope of computer-readable storage devices.

[0068] Computer executable instructions include, for example, instructions and data that cause a general-purpose computer, a special-purpose computer, or a special-purpose processing device to perform a particular function or set of functions. Computer executable instructions also include program modules that are executed by a computer in a standalone or networked environment. Generally, program modules include design-specific functions such as routines, programs, components, data structures, objects, and special-purpose processors that perform tasks or implement abstract data types. Computer executable instructions, associated data structures, and program modules represent examples of program code means for performing steps of the methods disclosed herein. A particular sequence of such executable instructions or associated data structures represents an example of corresponding behavior for implementing the functionality described in such steps.

[0069] Other embodiments of this disclosure may be practiced in network computing environments having many types of computer system configurations, including personal computers, handheld devices, multiprocessor systems, microprocessor-based or programmable home electronic devices, network PCs, minicomputers, and mainframe computers. Embodiments may also be practiced in distributed computing environments in which tasks are performed by local and remote processing devices connected through a communication network (either by hardwired, wireless links, or a combination thereof). In a distributed computing environment, program modules may reside in both local and remote memory storage devices.

[0070] In certain embodiments, one or more computer-readable media are provided that store instructions thereon for performing any of the steps of the method of the method of the present disclosure using any of the synthetic strands of the present disclosure. According to some embodiments, one or more computer-readable media are provided that contain instructions stored thereon, which, when executed by one or more processors, cause one or more processors to use one or more position indicator readers to determine the sequence of nucleic acids by reading position indicators of the synthetic strands of the present disclosure during or after the hybridization of the synthetic strands into nucleic acids.

[0071] method Furthermore, methods are provided by this disclosure. In certain embodiments, methods are provided that are implemented using any of the devices of this disclosure, the methods comprising: introducing an electrical bias between two or more site-specifically metallized nucleic acid regions; and measuring the conductance between two or more site-specifically metallized nucleic acid regions.

[0072] According to some embodiments, the method involves causing relative movement of the analyte (e.g., a nucleic acid, protein to be sequenced) and an opening in the scaffold. “Causing relative movement” means that at least one of the scaffold and the analyte changes position relative to the other. In some embodiments of the method of the subject, the scaffold moves while the analyte remains stationary. In other embodiments, the analyte moves while the scaffold remains stationary. In other embodiments, both the analyte and the scaffold move. Where the method involves causing relative movement of the analyte to the scaffold, the movement may be achieved using any convenient approach. For example, the method may involve pulling the analyte through the opening. “Pulling” means applying a force to the analyte sufficient to cause it to change position. The required force may be available in any convenient form. For example, in some cases, the analyte may be attached to an elongation structure that can be used to pull (i.e., physically pull) the nucleic acid. The force may be driven using any convenient approach, including but not limited to chemical propulsion, magnetic propulsion, ultrasonic propulsion, optical propulsion, electrical propulsion, and combinations thereof. Nanoscale methods of propulsion are described, for example, in Wang et al. Chemical Reviews, 115(16), 8704-8735, which are incorporated herein by reference in their entirety. The relative velocity of transport may vary. In some examples, the relative velocity of transport is in the range of 1 to 100,000 nucleotides / second.

[0073] In certain embodiments, the extended structure is a nanowire. The nanowire may have any convenient diameter, such as a range of 0.5 nm to 500 nm, for example, including 1 nm to 200 nm and 5 nm to 100 nm. The nanowire may contain any convenient material. Exemplary nanowire materials include, but are not limited to, carbon, germanium, silicon, gold, copper, yttrium barium copper oxide (YBCO), indium phosphide, gallium nitride, nickel, platinum, and combinations thereof.

[0074] In additional embodiments, the extended structure is a nanotube. Nanotubes are generally tubular structures containing carbon (e.g., fullerenes, graphene). Various techniques have been developed for fabricating carbon nanotubes. For example, methods for forming carbon nanotubes are described in U.S. Patents 5,753,088 and 5,482,601, which are incorporated herein by reference. Non-limiting techniques for fabricating nanotubes include laser evaporation techniques, electric arc techniques, and vapor phase techniques.

[0075] In further embodiments, the elongated structure is a biopolymer. In some examples, the biopolymer is a protein. In other examples, the biopolymer is a nucleic acid. In other words, the biopolymer elongated structure may be used to pull the analyte in the same manner as the nanotubes or nanowires described above. The biopolymer elongated structure may, if desired, have any convenient amino acid or nucleotide structure.

[0076] If the method involves pulling the analyte through an extension structure, the extension structure may be attached to the analyte via any convenient approach. In some cases, the analyte may be bound (e.g., covalently) to the ends of the extension structure. In a selective case, the adapter may be associated with one end of the analyte (e.g., the 5' or 3' end of the nucleic acid). Any convenient adapter may be used. In a selective embodiment, the extension structure may hybridize when the two molecules are positioned close to each other, thereby having a nucleic acid sequence complementary to the adapter associated with the analyte so as to attach the extension structure to the analyte. If the extension structure is a nucleic acid, the selective nucleic acid bases at the ends of the extension structure (e.g., the 5' or 3' end) may be complementary to the adapter associated with the analyte so as to hybridize when the two molecules are positioned close to each other.

[0077] In other cases, the force causing the movement of the analyte relative to the scaffold is an electromagnetic force. In such cases, the method involves applying a voltage to an opening so that the analyte moves relative to the scaffold. In some cases, the speed at which the analyte is pulled can be adjusted by adjusting the applied voltage. The voltage for use in the method of the subject may vary and in some examples may be in the range of 25mV to 500mV, e.g., 50mV to 400mV, e.g., 75mV to 300mV, and 100mV to 200mV. In additional cases, the force causing the movement of the analyte relative to the scaffold is a magnetic force. In some such cases, the analyte includes magnetic particles (e.g., magnetic beads) attached to it. The type of magnetic particles used may vary and may include, for example, iron nanoparticles, nickel nanoparticles, cobalt nanoparticles, etc. In some embodiments, applying a magnetic field to the magnetic particles attached to the analyte is sufficient to provide a tensile force to the analyte.

[0078] According to some embodiments, the methods of the Disclosure are computer implementations. "Computer implementation" means that at least one step of the Method is implemented using one or more processors and one or more non-temporary computer-readable media. Computer implementations of the Disclosure may further include one or more steps that are not computer implementations, such as obtaining a sample from a subject, isolating nucleic acids for sequencing, and performing contact and / or combination steps by the Method of the Disclosure.

[0079] The nucleic acids sequenced by the methods of this disclosure may be deoxyribonucleic acid (DNA). The DNA of interest includes, but is not limited to, genomic DNA or fragments thereof, complementary DNA (or “cDNA” synthesized from any RNA or DNA of interest) or fragments thereof, recombinant DNA (e.g., plasmid DNA) or fragments thereof, etc. The nucleic acids to be sequenced may consist of nucleotides, such as deoxyribonucleotides or ribonucleotides, with a range of about 2, about 10, about 100, about 500, about 1,000, about 10,000, about 100,000, about 1,000,000, and up to about 10 10 It may be more than one base and may be produced enzymatically or synthetically (e.g., PNA as described in U.S. Patent No. 5,948,902 and the literature cited herein), which can hybridize with naturally occurring nucleic acids in a sequence-specific manner similar to that of two naturally occurring nucleic acids, and can, for example, participate in Watson-Crick base pair interactions.

[0080] The nucleic acid sequenced by the method disclosed herein may be ribonucleic acid (RNA). RNA may include, but is not limited to, messenger RNA (mRNA), microRNA (miRNA), small interfering RNA (siRNA), trans-acting small interfering RNA (ta-siRNA), native small interfering RNA (nat-siRNA), ribosomal RNA (rRNA), transfer RNA (tRNA), small nucleolar RNA (snoRNA), small nuclear RNA (snRNA), long non-coding RNA (lncRNA), non-coding RNA (ncRNA), transfer messenger RNA (tmRNA), precursor messenger RNA (premRNA), small Cajal-specific RNA (scaRNA), piwi-interacting RNA (piRNA), endoribonuclease-prepared siRNA (esiRNA), small temporal RNA (stRNA), signal recognition RNA, telomere RNA, ribozymes, or any combination of these RNA types or their subtypes, and may be any type of RNA (or its subtype).

[0081] In certain embodiments, the nucleic acid portion to be sequenced includes “non-natural nucleosides” or “non-natural nucleotides,” which refer to nucleosides or nucleotides containing modified nucleic acid bases and / or other chemical modifications such as modified sugars. In some cases, non-natural nucleotides / nucleosides have a distinctive conductance fingerprint that may be recognized by the method of the subject. According to some embodiments, the nucleic acid to be analyzed includes non-natural nucleic acid bases and / or melting temperature (T m This includes parts containing non-natural nucleotides that modify () the ). Non-limiting examples include modified pyrimidines, e.g., methyl-dC or propynyl-dU; modified purines, e.g., G-clamp; 2-amino-2'-deoxyadenosine-5'-triphosphate (2-amino-dATP), 5-methyl-2'-deoxycytidine-5'-triphosphate (5-Me-dCTP), 5-propynyl-2'-deoxycytidine-5'-triphosphate (5-Pr-dCTP), 5-propynyl-2'-deoxyuridine-5'-triphosphate (5-Pr-dUTP), halogenated deoxyuridine (XdU), e.g., 5-chloro-2'-deoxyuridine-5'-triphosphate (5-Cl-dUTP), 5-bromo-2'-deoxyuridine-5'-triphosphate (5-Br-dUTP), or any combination thereof.

[0082] The nucleic acid sequenced by the method of this disclosure may be a nucleic acid from one or more immune cells. The immune cells of interest include, but are not limited to, T cells, B cells, natural killer (NK) cells, macrophages, monocytes, neutrophils, dendritic cells, mast cells, basophils, and eosinophils. In certain embodiments, the nucleic acid sequenced is from a T cell. The T cell of interest may be a naive T cell (T N ), cytotoxic T cells (T CTL ), memory T cells (T MEM ), T memory stem cells (T SCM ), central memory T cells (T CM ), effector memory T cells (T EM ), tissue-resident memory T cells (TRM ), effector T cells (T EFF ), regulatory T cells (T REG ), helper T cells (T H , T H 1. T H 2, T H 17) CD4+ T cells, CD8+ T cells, virus-specific T cells, alpha-beta T cells (T αβ ), and gamma delta T cells (T γδ ) is included.

[0083] In certain embodiments, the nucleic acid sequenced by the method of the Disclosure is a nucleic acid encoding an immune cell receptor (e.g., a T cell receptor (TCR), a B cell receptor (BCR)) or a portion thereof. For example, in certain embodiments, a method is provided that includes sequencing a nucleic acid encoding one or more CDRs of the alpha or beta chain of a TCR. According to some embodiments, the method includes sequencing the CDR3 coding portion of a nucleic acid encoding all or part of the alpha or beta chain of a TCR.

[0084] Nucleic acids sequenced by the methods of this disclosure may be present in any nucleic acid sample of interest. In certain embodiments, nucleic acids are present in a nucleic acid sample isolated from a single cell, multiple cells (e.g., cultured cells), tissue, organ, or organism (e.g., bacteria, yeast, etc.). According to some embodiments, nucleic acid samples are isolated from animal cells, tissues, organs, etc. In some embodiments, the animal is a mammal, e.g., Homo (e.g., human), rodent (e.g., mouse or rat), dog, cat, horse, cattle, or any other mammal of interest. In certain embodiments, nucleic acid samples are isolated / obtained from non-mammalian sources, e.g., bacteria, yeast, insects (e.g., fruit flies), amphibians (e.g., frogs (e.g., African clawed frogs)), viruses, plants, or any other non-mammalian nucleic acid sample source.

[0085] Nucleic acids that may be sequenced by the methods of this disclosure include cell-free nucleic acids, such as cell-free DNA, cell-free RNA, or both. Such cell-free nucleic acids may be obtained from any suitable source. In certain embodiments, the cell-free nucleic acid is from a fluid sample selected from the group consisting of whole blood, plasma, serum, amniotic fluid, saliva, urine, pleural fluid, bronchial lavage fluid, bronchial aspirate, breast milk, colostrum, tears, semen, peritoneal fluid, pleural fluid, and feces. In certain embodiments, the cell-free nucleic acid is cell-free fetal DNA. According to some embodiments, the cell-free nucleic acid is circulating tumor DNA. In certain embodiments, the cell-free nucleic acid includes infectious agent DNA. According to some embodiments, the cell-free nucleic acid includes DNA from a transplant.

[0086] As used herein, the term “cell-free nucleic acid” may refer to nucleic acids isolated from a substantially cell-free source. Cell-free nucleic acids may also be referred to as “extracellular” nucleic acids, “circulating cell-free” nucleic acids (e.g., CCF fragments, CCF DNA) and / or “circulating cell-free” nucleic acids. Cell-free nucleic acids are present in blood and can be obtained from blood (e.g., from animal blood, from human subject blood). Cell-free nucleic acids often do not contain detectable cells and may contain cellular elements or cellular residues. Non-limiting examples of non-cellular sources for cell-free nucleic acids are described above. Obtaining cell-free nucleic acids may involve obtaining a sample directly (e.g., collecting a sample, e.g., a test sample) or obtaining a sample from another person who is collecting samples. According to some embodiments, cell-free nucleic acids may often be products of cell apoptosis and cytodegradation, providing a basis for cell-free nucleic acids having a series of lengths across a spectrum (e.g., a “ladder”). In some embodiments, the sample nucleic acid from the test subject is circulating cell-free nucleic acid. In some embodiments, the circulating cell-free nucleic acid is from plasma or serum from the test subject.

[0087] Cell-free nucleic acids can contain different types of nucleic acids, and therefore, in certain embodiments herein, they are referred to as “heterogeneous.” For example, a sample from a subject with cancer may contain nucleic acids from cancer cells (e.g., tumors, neoplasms) and nucleic acids from non-cancerous cells. In another example, a sample from a pregnant woman may contain maternal nucleic acids and fetal nucleic acids. In yet another example, a sample from a subject with an infection or infectious disease may contain host nucleic acids and nucleic acids from infectious agents (e.g., bacteria, fungi, protozoa). In yet another example, a sample from a subject undergoing transplantation may contain host nucleic acids and nucleic acids from donor organs or tissues. In some cases, cancer, fetus, infectious agents, or transplanted nucleic acids sometimes account for about 5% to 50% of the total nucleic acids (for example, about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49% of the total nucleic acids are cancer, fetus, infectious agents, or transplanted nucleic acids). In other cases, heterologous cell-free nucleic acids may contain nucleic acids from two or more subjects.

[0088] Nucleic acids that may be sequenced by the methods of this disclosure include tumor nucleic acids (e.g., nucleic acid samples isolated from tumors, e.g., those present in tumor biopsy samples). As used herein, “tumor” refers to the growth and proliferation of all neoplastic cells, whether malignant or benign, and all precancerous and cancerous cells and tissues. The terms “cancer” and “cancerous” refer to or describe a physiological condition in mammals typically characterized by uncontrolled cell growth / proliferation. Examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia. More specific examples of such cancers include squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, lung adenocarcinoma, lung squamous cell carcinoma, peritoneal cancer, hepatocellular carcinoma, gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, breast cancer, colon cancer, colorectal cancer, endometrial or uterine cancer, salivary gland cancer, kidney cancer, prostate cancer, vulvar cancer, thyroid cancer, liver cancer, and various types of head and neck cancers.

[0089] Approaches, reagents, and kits for isolating, purifying, and / or concentrating DNA and RNA from a source of interest are known in the art and commercially available. For example, kits for isolating DNA from a source of interest include the DNeasy®, RNeasy®, QIAamp®, QIAprep®, and QIAquick® nucleic acid isolation / purification kits by Qiagen, Inc. (Germantown, Md); the DNAzol®, ChargeSwitch®, Purelink®, and GeneCatcher® nucleic acid isolation / purification kits by Life Technologies, Inc. (Carlsbad, CA); and the NucleoMag®, NucleoSpin®, and NucleoBond® nucleic acid isolation / purification kits by Clontech Laboratories, Inc. (Mountain View, CA). In certain embodiments, nucleic acids are isolated from fixed biological specimens, such as formalin-fixed, paraffin-embedded (FFPE) tissues. Genomic DNA from FFPE tissue may be isolated using commercially available kits, such as the AllPrep® DNA / RNA FFPE kit from Qiagen, Inc. (Germantown, Md), the RecoverAll® Total Nucleic Acid Isolation Kit for FFPE from Life Technologies, Inc. (Carlsbad, CA), and the NucleoSpin® FFPE kit from Clontech Laboratories, Inc. (Mountain View, CA).

[0090] The nucleic acid sequences determined by the method disclosed herein may be analyzed (e.g., constructed) using available sequence analysis software.

[0091] In selected embodiments, the methods of the Disclosure include analyzing (e.g., sequencing) a polypeptide. Amino acids may have conductance fingerprints in a manner similar to nucleotides. Thus, embodiments in which the molecule analyzed (e.g., sequenced) is a polypeptide are encompassed by the Disclosure. The polypeptide analyzed may be any polypeptide, which may include genetically encoded and non-genetically encoded amino acids, chemically or biochemically modified or induced amino acids, and polypeptides having a modified peptide backbone. The term includes, but is not limited to, fusion proteins having heterologous amino acid sequences, fusions having heterologous and homologous leader sequences with or without an N-terminal methionine residue, immunotagged proteins, and so on.

[0092] The term "amino acid" generally refers to any monomeric unit comprising a substituted or unsubstituted amino group, a substituted or unsubstituted carboxyl group, and one or more side chains or groups, or analogs of any of these groups. Exemplary side chains include, for example, thiols, selenos, sulfonyls, alkyls, aryls, acyls, ketos, azides, hydroxyls, hydrazines, cyanos, halos, hydrazides, alkenyls, alkyns, ethers, borates, boronates, phosphos, phosphonos, phosphines, heterocyclics, enones, imines, aldehydes, esters, thioacids, hydroxylamines, or any combination of these groups. Other representative amino acids include, but are not limited to, photoactivatable crosslinking agents, metal-linked amino acids, spin-labeled amino acids, fluorescent amino acids, metal-containing amino acids, amino acids with novel functional groups, amino acids that interact covalently or acovalently with other molecules, photocageable and / or photoisomerizable amino acids, radioactive amino acids, amino acids containing biotin or biotin analogs, glycosylated amino acids, other carbohydrate-modified amino acids, amino acids containing polyethylene glycol or polyether, heavy atom-substituted amino acids, chemically cleavable and / or photocleavable amino acids, carbon-linked sugar-containing amino acids, redox-active amino acids, aminothio acid-containing amino acids, and amino acids containing one or more toxic moieties.

[0093] The term "amino acid" includes, but is not limited to, naturally occurring α-amino acids and their stereoisomers. "Stereoisomers" of amino acids refer to enantiomers of amino acids, such as L-amino acids or D-amino acids. For example, the stereoisomers of naturally occurring amino acids refer to enantiomers of naturally occurring amino acids (i.e., D-amino acids).

[0094] Naturally occurring α-amino acids include those encoded by the genetic code and those that are later modified (e.g., hydroxyproline, γ-carboxyglutamate, and O-phosphoserine). Naturally occurring α-amino acids include, but are not limited to, alanine (Ala), cysteine ​​(Cys), aspartic acid (Asp), glutamic acid (Glu), phenylalanine (Phe), glycine (Gly), histidine (His), isoleucine (Ile), arginine (Arg), lysine (Lys), leucine (Leu), methionine (Met), asparagine (Asn), proline (Pro), glutamine (Gln), serine (Ser), threonine (Thr), valine (Val), tryptophan (Trp), tyrosine (Tyr), and combinations thereof. Stereoimers of naturally occurring α-amino acids include, but are not limited to, D-alanine (D-Ala), D-cysteine ​​(D-Cys), D-aspartic acid (D-Asp), D-glutamic acid (D-Glu), D-phenylalanine (D-Phe), D-histidine (D-His), D-isoleucine (D-Ile), D-arginine (D-Arg), D-lysine (D-Lys), D-leucine (D-Leu), D-methionine (D-Met), D-asparagine (D-Asn), D-proline (D-Pro), D-glutamine (D-Gln), D-serine (D-Ser), D-threonine (D-Thr), D-valine (D-Val), D-tryptophan (D-Trp), D-tyrosine (D-Tyr), and combinations thereof.

[0095] kit Aspects of the present disclosure further include kits. In certain embodiments, the kits have been found to have applications in, for example, any implementation of any of the methods of the present disclosure. According to some embodiments, the kits of the present disclosure include, for example, one or more nucleic acid scaffolds of the present disclosure having fixed-tolerance or variable-tolerance structures operably linked to site-specifically metallized nucleic acid regions within the nucleic acid scaffold.

[0096] The kits of this disclosure may include one or more reagents for which applications have been found in the analysis of an analyte of interest, such as nucleic acids, polypeptides, etc. For example, the kits of this disclosure may include a solution (e.g., a buffer solution) having pH, salt concentration, one or more components (e.g., a chelating agent), etc., which is useful in providing suitable conditions for preparing an analyte for analysis using the nucleic acid scaffold of this disclosure.

[0097] The kits of the present disclosure may further include instructions for carrying out any of the methods of the present disclosure, for example, instructions for sequencing nucleic acids. The instructions may be recorded on a suitable recording medium. For example, the instructions may be printed on a substrate such as paper or plastic. Thus, the instructions may be present in the kit as an accompanying document, such as on the labeling of the kit or the container of its components (i.e., associated with the packaging or subpackaging). In other embodiments, the instructions may be present as an electronic storage data file on a suitable computer-readable storage medium, such as a portable flash drive, DVD, CD-ROM, diskette, etc. In yet another embodiment, the actual instructions are not present in the kit, but means for obtaining the instructions from a remote source, for example, via the Internet, are provided. An example of this embodiment is a kit that includes a web address from which the instructions can be viewed and / or downloaded. Similar to the instructions, means for obtaining the instructions are recorded on a suitable substrate.

[0098] For completeness, non-limiting aspects and embodiments of this disclosure are further defined in the following numbered clauses. 1. A nucleic acid scaffold, It includes a structure having fixed resistance or variable resistance that is operably linked to a site-specifically metallized nucleic acid region within a nucleic acid scaffold, A structure having fixed resistance or variable resistance includes an opening formed by one or more nonmetallated nucleic acid regions of a nucleic acid scaffold, A nucleic acid scaffold in which, when used, the conductance between two or more site-specifically metallized nucleic acid regions is in a state of structure that exhibits fixation resistance or variable resistance. 2. The nucleic acid scaffold according to Clause 1, wherein one or more nonmetallated nucleic acid regions forming an opening share one or more nucleic acids with two or more site-specifically metallized nucleic acid regions. 3. The nucleic acid scaffold according to Clause 1 or Clause 2, wherein one or more nonmetallated nucleic acid regions forming an opening comprises nucleic acids hybridized with nucleic acids of two or more site-specifically metallated nucleic acid regions. 4. Two or more site-specifically metallized nucleic acid regions A first metallized field adjacent to the opening at a first position of the opening, A nucleic acid scaffold according to any one of the clauses 1 to 3, comprising a second metallized field adjacent to the opening at a second position of the opening. 5. The nucleic acid scaffold described in Clause 4, wherein the first and second positions are substantially opposite the opening. 6. A nucleic acid scaffold according to any one of clauses 1 to 5, wherein the site-specific metallized nucleic acid region within the nucleic acid scaffold includes a metallized double helix. 7. The nucleic acid scaffold according to Clause 6, wherein site-specific metallization of the double strand is achieved by a provided density of double strands that are site-specifically metallized. 8. A nucleic acid scaffold according to any one of the clauses 1 to 7, wherein the opening has a maximum dimension of 1 to 100 nanometers (nm). 9. A nucleic acid scaffold according to Clause 8, wherein the opening has a maximum dimension of 2 to 10 nm. 10. A nucleic acid scaffold according to any one of clauses 1 to 9, wherein the state of the structure having fixation resistance or variable resistance is the presence or absence of the analyte in the opening. 11. A nucleic acid scaffold according to Clause 10, wherein the state of the structure having fixation resistance or variable resistance is the presence or absence of the analyte in the opening. 12. A nucleic acid scaffold according to Clause 10 or 11, wherein the analyte is a polymer. 13. A nucleic acid scaffold as described in Clause 12, wherein the opening is adapted to the translocation of a polymer passing through it. 14. A nucleic acid scaffold as described in Clause 13, wherein the polymer is a nucleic acid or protein. 15. A nucleic acid scaffold as described in Clause 14, wherein the polymer is a nucleic acid, and the openings are adapted to hydrogen bonds to bases of nucleic acids through which translocation occurs. 16. A nucleic acid scaffold according to any one of the clauses 1 to 15, wherein the structural state having fixed resistance or variable resistance is the presence or absence of a polymer that translocates through the opening. 17. The nucleic acid scaffold according to Clause 16, wherein the conductance between two or more site-specifically metallized nucleic acid regions changes, or occurs only in the presence of nucleic acids translocating through the opening. 18. A nucleic acid scaffold as described in any one of clauses 1 to 17, wherein the scaffold exists in a vacuum. 19. A nucleic acid scaffold as described in any one of clauses 1 to 17, wherein the scaffold is immersed in a fluid. 20. A nucleic acid scaffold as described in Clause 19, wherein the fluid is a gas. 21. The nucleic acid scaffold described in Clause 19, wherein the fluid is a liquid. 22. A nucleic acid scaffold as described in any one of clauses 19 to 21, wherein the temperature of the fluid is selected to affect the conductance. 23. A device, A nucleic acid scaffold as described in any one of clauses 1 to 17, Electrodes operably linked to two or more site-specifically metallized nucleic acid regions, One or more power sources operably connected to the electrodes, One or more processors, One or more computer-readable media containing stored instructions, which, when executed by one or more processors, are transmitted to the device. By introducing an electrical bias between two or more site-specifically metallized nucleic acid regions, A device comprising a computer-readable medium for measuring conductance between two or more site-specifically metallized nucleic acid regions. 24. The device according to Clause 23, wherein when an instruction is executed by one or more processors, it intermittently brings an electrical bias to one or more power supplies between two or more site-specific metallized nucleic acid regions during use of the device. 25. The device according to Clause 23, wherein when an instruction is executed by one or more processors, it continuously brings an electrical bias to one or more power supplies between two or more site-specific metallized nucleic acid regions during use of the device. 26. The device according to any one of the clauses 23 to 25, wherein one or more power sources, using a fixed voltage, provide an electrical bias between two or more site-specifically metallized nucleic acid regions. 27. The device according to any one of clauses 23 to 25, wherein one or more power sources, using a variable voltage, provide an electrical bias between two or more site-specifically metallized nucleic acid regions. 28. The device according to any one of the clauses 23 to 27, wherein the electrodes are operably linked to two or more site-specifically metallized nucleic acid regions via attached nucleic acids. 29. The device according to Clause 28, wherein the attached nucleic acid includes a docking nucleic acid immobilized on the surface of an electrode, and the nucleic acid of the nucleic acid scaffold hybridizes to the docking nucleic acid. 30. A device according to any one of clauses 23 to 29, wherein the aperture has a maximum dimension of 1 to 100 nanometers (nm). 31. The nucleic acid scaffold according to clause 30, wherein the opening has a maximum dimension of 2 to 10 nm. 32. A device according to any one of the clauses 23 to 31, wherein the device includes an opening and a nanopore aligned with it. 33. The device according to Clause 32, wherein a nucleic acid scaffold is inserted into a nanopore. 34. The device according to Clause 32 or 33, wherein the device is adapted to translocate analytes through a nanopore, thereby translocating analytes through an opening. 35. The device according to Clause 34, wherein the analyte is a polymer. 36. The device according to Clause 35, wherein the polymer is nucleic acid or protein. 37. The device according to any one of the clauses 34 to 36, wherein the nucleic acid scaffold and nanopore are arranged so that the analyte is translocated through the opening before it is translocated through the nanopore. 38. The device according to any one of the clauses 34 to 36, wherein the nucleic acid scaffold and nanopore are arranged to translocate through the nanopore before the analyte is translocated through the opening. 39. The device according to any one of the clauses 34 to 38, wherein the conductance between two or more site-specifically metallized nucleic acid regions changes, or occurs only in the presence of an analyte translocating through the opening. 40. The device according to any one of the clauses 34 to 39, wherein the conductance between two or more site-specifically metallized nucleic acid regions increases in the presence of an analyte translocating through the opening. 41. The device according to any one of the clauses 34 to 40, wherein the instruction causes the device to measure conductance between two or more site-specifically metallized nucleic acid regions during the translocation of an analyte through an opening. 42. The device according to Clause 41, wherein the analyte is a polymer, and the conductance is a changing conductance indicating monomers of the polymer sequentially translocating through the opening. 43. The device according to Clause 41, wherein the polymer is nucleic acid. 44. The device according to Clause 43, wherein the conductance is a changing conductance indicating the bases of nucleic acids that sequentially translocate through the opening. 45. A device as described in any one of the clauses 41 to 44, wherein the instruction causes the device to determine the arrangement of polymers based on the measured changing conductance. 46. ​​A device described in any one of clauses 23 to 45, wherein the scaffolding is present in a vacuum. 47. A device according to any one of clauses 23 to 45, wherein the scaffolding is immersed in a fluid. 48. The device described in Clause 47, wherein the fluid is a gas. 49. The device described in Clause 47, wherein the fluid is a liquid. 50. The device according to any one of clauses 47 to 49, wherein the temperature of the fluid is selected to achieve a desired conductance between two or more site-specifically metallized nucleic acid regions, and optionally, the conductance is the baseline conductance when the analyte is not present in the opening. 51. A device according to any one of the clauses 47 to 50, wherein the fluid contains ions. 52. The device described in Clause 53, which is adapted to allow the flow of ion current through an opening. 53. The device according to any one of the clauses 47 to 52, wherein the fluid comprises an ion concentration selected to achieve a desired conductance between two or more site-specifically metallized nucleic acid regions, and optionally, the conductance is the baseline conductance when the analyte is not present in the opening. 54. A method implemented using a device described in any one of the clauses 23 to 45, wherein the method This involves introducing an electrical bias between two or more site-specifically metallized nucleic acid regions, A method comprising measuring the conductance between two or more site-specifically metallized nucleic acid regions. 55. The method according to clause 54, wherein the aperture has a maximum dimension of 1 to 100 nanometers (nm). 56. The method according to clause 55, wherein the aperture has a maximum dimension of 2 to 10 nm. 57. The method according to any one of the clauses 54 to 56, wherein the device includes an opening and a nanopore aligned with it. 58. The method according to clause 57, wherein a nucleic acid scaffold is inserted into a nanopore. 59. The method of Clause 57 or 58, comprising translocating an analyte through a nanopore, thereby translocating an analyte through an opening. 60. The method according to Clause 59, wherein the analyte is translocated through the opening before translocating through the nanopore. 61. The method according to Clause 59, wherein the analyte is translocated through a nanopore before translocating through an opening. 62. The method according to any one of the clauses 57 to 61, wherein the analyte is a polymer. 63. The method according to clause 62, wherein the polymer is a nucleic acid or a protein. 64. The method according to clause 63, wherein the polymer is a nucleic acid, and the openings are adapted to hydrogen bonds to bases of the nucleic acid that translocate through it. 65. The method according to clause 64, wherein hydrogen bonding reduces the translocation rate of nucleic acids compared to the translocation rate in the absence of hydrogen bonding. 66. The method according to clause 64 or 65, wherein hydrogen bonds position nucleic acids to facilitate nucleic acid analysis. 67. The method according to any one of the claims 59 to 66, wherein the conductance between two or more site-specifically metallized nucleic acid regions changes, or occurs only in the presence of an analyte translocating through an opening. 68. The method according to any one of the clauses 59 to 67, wherein the instruction causes the device to measure conductance between two or more site-specifically metallized nucleic acid regions during the translocation of an analyte through an opening. 69. The method according to Clause 68, wherein the analyte is a polymer, and the conductance is a changing conductance indicating monomers of the polymer sequentially translocating through the opening. 70. The method according to Clause 69, wherein the polymer is a nucleic acid and the conductance is a changing conductance indicating the bases of the nucleic acid that sequentially translocate through the opening. 71. The method according to Clause 69 or 70, wherein the instruction causes the device to determine the arrangement of polymers based on the measured changing conductance. 72. The method described in any one of the clauses 59 to 71, wherein the scaffolding is in a vacuum. 73. The method according to any one of the clauses 59 to 71, wherein the scaffolding is immersed in a fluid. 74. The method according to clause 73, wherein the fluid is a gas. 75. The method according to clause 73, wherein the fluid is a liquid. 76. The method according to any one of the clauses 73 to 75, wherein the temperature of the fluid is selected to achieve a desired conductance between two or more site-specifically metallized nucleic acid regions, and optionally the conductance is the baseline conductance when the analyte is not present in the opening. 77. The method according to any one of the clauses 73 to 76, wherein the fluid contains ions. 78. The method according to Clause 77, wherein the device is adapted to allow a flow of ionic current through an opening. 79. The method according to any one of the claims 73 to 78, wherein the fluid comprises an ion concentration selected to achieve a desired conductance between two or more site-specifically metallized nucleic acid regions, and optionally the conductance is the baseline conductance when the analyte is not present in the opening. [Examples]

[0099] The following examples are presented as illustrations only and not as limitations.

[0100] experiment Example 1 - Design of a nucleic acid scaffold Depictions of ENSnano and caDNAno nucleic acid scaffolds with 4nm pores are provided in Figures 6A-6B and 7A-7B, respectively. Here, the planar DNA origami structure is designed on a "grid," with each helix (shown horizontally) assigned a number, and each nucleotide position assigned an index number according to its vertical position in the design. The following table of oligonucleotides includes the start position (5' end of the oligonucleotide), where the helix number is listed first and the index position second, listed in parentheses. Similarly, the end position (3' end of the oligonucleotide) is listed, where the helix number is listed first and the index position second, listed in parentheses. The oligonucleotides are shown in 2D maps and 3D renderings (Figures 6A-6B, 7A-7B), which coincide between the two figures, and the scaffolds are also shown. Each sphere in Figures 6A-6B represents a nucleotide. The black lines in Figures 6A-6B indicate the locations where scaffolding or oligonucleotides must be extended to accommodate the design.

[0101] Details regarding the oligonucleotides used in this design are provided in the table below. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6]

[0102] Example 2 - Selective Metallization Preparation of DNA origami Oligonucleotide sequences for constructing planar triangular DNA origami with high-density 20-base-pair overhanging oligonucleotides on two sides (regions A and B) have been reported in PMID:34962699 (Dai et al (2022) Angew Chem Int Ed Engl. 61(11)). Constructs were prepared using circular single-stranded M13mp18 DNA (N4040S, New England Biolabs) and the synthesized oligonucleotides, and transported to a pool (oPools, Integrated DNA Technologies). The oligonucleotides were rehydrated in DNA suspension buffer (T0221, Teknova) at pH 8.0 to 500 nM.

[0103] The following components were combined for origami formation: 5 μL of M13mp18 ssDNA (250 ng / μL), 10 μL of pooled oligonucleotide (500 nM), 25 μL of origami buffer (40 mM Tris, 2 mM EDTA-2Na, 12.5 mM Mg(OAc)2, pH 8 (Dai, et al.)), and 10 μL of PCR-certified water (W3330, Teknova). The reaction mixture was vortex-mixed, briefly centrifuged, and cooled using a thermal cycle at 0.2°C / min from 85 to 25°C.

[0104] At the end of cooling, the reaction mixture was filtered through an Amicon Ultra-0.5 100 kD MWCO filter (UFC510008, Millipore Sigma). A filter was prepared by adding 500 μL of origami buffer and centrifuging at 14,000 × g for 10 minutes. The sample was diluted to 300 μL by adding 250 μL of origami buffer. This diluted origami was loaded onto the prepared filter and centrifuged at 3,000 × g for 5 minutes. The filter was washed three times with 300 μL of origami buffer, centrifuged at 3,000 × g for 5 minutes after each wash. Finally, the filter was inverted in the collection tube and centrifuged at 1,000 × g for 2 minutes.

[0105] Quantification DNA origami was quantified using a nanophotometer (NP80-Touch, Implen) with DNA origami buffer as a blank. The DNA origami molar concentration was determined as follows: concentration (in ng / μL), average molar mass of each base (330 g per mole of base), total number of DNA bases present in each individual triangular origami structure with overhanging oligonucleotides (15883 bases), and Avogadro's number (6.02 × 10⁻¹⁶ per mole). 23 The calculation was performed using individual origami structures.

[0106] Selective metal ion seeding DNA origami was diluted to 1 nM in origami buffer to a final volume of 60 μL. Rhodium chloride hydrate (520772, Millipore Sigma) was rehydrated in PCR-certified water to 500 mM, and then diluted to 300 mM. 1.25 μL of rhodium chloride hydrate solution (300 mM) was added to the diluted DNA origami. The vial was gently vortexed and briefly centrifuged. Metal ion seeding was performed in the dark for 24 hours without stirring.

[0107] Metal ion reduction Sodium borohydride was prepared by weighing 20-100 mg of sodium borohydride granules (452874, Millipore Sigma) into a 50 mL conical vial using an analytical balance pre-treated with an antistatic gun (Zerostat3 Milty). The vial was transferred to an ice bucket, and ice-cooled deionized ultrapure water (BP2819100, Fisher Scientific) was slowly added while stirring until a final concentration of 500 mM was reached. After complete dissolution, the sodium borohydride solution was successively diluted to 50 μM in deionized ultrapure water, and 1.25 μL of this solution was added to each metallation reaction. Immediately after adding the sodium borohydride solution, the reactants were mixed by repeated pipetting with a P200. Reduction was carried out in the dark for 15 minutes.

[0108] Confirmation by TEM imaging A 300-mesh copper TEM grid (Cu-300LD, Pacific Grid-Tech) with a layer of approximately 5 nm carbon film on top of a lace-like carbon layer was glow discharged at 10 mA for 30 seconds (PELCO easiGlow91000). 5 μL of each metallization reaction was pipetteed onto the grid and incubated for 2 minutes. The solution was then absorbed by contact with filter paper (1002055, Cytiva). The grid was washed by adding 5 μL of PCR-certified water, which was immediately absorbed by the filter paper. The plated grid was dried at ambient temperature for at least 30 minutes and imaged with a low-voltage electron microscope (LVEM5, Delong America). The resulting TEM images showing triangular selective metallization (dark contrast) are shown in Figures 9A-9B.

[0109] Example 3 - Selective binding Tip cleaning, pretreatment, and DNA origami plating approaches were developed to selectively bind triangular origami to Au electrodes. Various DNA origami were tested for selective binding to Au electrodes. First, origami triangles functionalized with thiolated overhangs were tested. Selective binding of origami triangles to Au electrodes was achieved, as shown in Figure 10. Binding to either Au or SiN was not observed. When origami triangles functionalized with ss-overhangs were tested, it was observed that the origami bound to both Au and SiN. When origami triangles functionalized with poly(A) overhangs were tested, it was observed that the origami bound to both Au and SiN.

[0110] We explored the selective bonding of thiolated triangular origami to Au by adding sonication to the tip cleaning approach. Tip preparation included backside SiN removal, acetone / IPA resist stripping, 10 minutes of sonication with IPA (80 kHz), UV-ozone (15 minutes of treatment, 45 minutes of immersion), 20 minutes of sonication with EtOH (80 kHz), and EtOH washing. Plating included 1 hour of TCEP (1 mM) activation and 2 hours of incubation in a solution cell on the tip with 1.41 ng / μL origami in DSB-Mg (10 mM Tris-HCl, 0.1 mM EDTA, 12.5 mM MgCl2). After washing the deposition area with 8 × 15 DSB-Mg, the tips were immersed in 25%, 50%, 70%, 80%, and 90% ethanol for 10 seconds each (in that order). The tips were dried in air. All operations were performed at room temperature. The resulting images, showing the selective bonding of thiolated triangular origami to Au, are shown in Figures 11A-11C.

[0111] Next, we explored the selective binding of thiolated triangular origami to Au after more gentle washing following deposition. Chip preparation included removal of SiN from the back, acetone / IPA resist stripping, UV ozone washing (15 minutes treatment, 45 minutes immersion), and 20 minutes of EtOH immersion. Plating involved 1 hour of TCEP (1 mM) activation and 2 hours of incubation with 1.41 ng / μL origami in DSB-Mg in a solution cell on the chip. The deposition area was washed with 2 × 5 μL DSB-Mg and 2 × 5 μL NFW. The chips were dried in air. All operations were performed at room temperature. The resulting images are shown in Figures 12A-12C.

[0112] Selective bonding of thiolated triangular origami to Au, accompanied by thermal UV-ozone cleaning, was also investigated. Tip preparation included removal of SiN from the back, acetone / IPA resist stripping, UV-ozone cleaning (treatment at 150°C for 15 minutes, immersion for 45 minutes), and 20 minutes of EtOH immersion. UV-ozone cleaning was also performed ultrasonically as follows: removal of SiN from the back, acetone / IPA resist stripping, ultrasonic 5 minutes IPA (37kHz), ultrasonic 10 minutes IPA (80kHz), UV-ozone (treatment at 150°C for 15 minutes, immersion for 45 minutes), ultrasonic 5 minutes EtOH (37kHz), ultrasonic 20 minutes EtOH (80kHz), and EtOH cleaning. The plating process involved 1 hour of TCEP (1 mM) activation, followed by 2 hours of incubation in a solution cell-on-tip with 1.41 ng / μL origami in DSB-Mg (10 mM Tris-HCl, 0.1 mM EDTA, 12.5 mM MgCl2). After washing the deposition area with 8 × 15 DSB-Mg, the tip was immersed in 25%, 50%, 70%, 80%, and 90% ethanol for 10 seconds each (in that order). The tip was dried in air. All operations were performed at room temperature. Images generated under UV ozone cleaning and sonication conditions are shown in Figures 13A-13B, while Figure 13C does not include sonication. Images of the reference triangular origami are shown in Figures 14A-14B and 15A-15B.

[0113] Example 4 - DNA origami dimer In this example, oligonucleotides (oligonucleotides) partially complementary to the M13mp18 single-stranded DNA (ssDNA) scaffold (New England Biolabs, N4040S) were modified from Dai, et al. (2022) Angew Chem Int Ed Engl. 2022 Mar 7;61(11):e202114190.doi:10.1002 / anie.202114190.Epub 2022 Jan 27.PMID:34962699, making it possible to assume a triangular shape from the annealed scaffold and oligonucleotides having a single-stranded overhang (AGACTAGACTAGACTAGACT, SEQ ID NO: 229) protruding from one side of the triangle and a single-stranded cytosine overhang (CCCCCCCCCCCCCCCC, SEQ ID NO: 230) protruding from the outer edge of the other side of the triangle. The oligonucleotides were synthesized in a pool (oPools, Integrated DNA Technologies) and rehydrated with 10 mM Tris-HCl, 0.1 mM EDTA, and pH 8.0 (Teknova, T0258).

[0114] To fold the origami, 5 microliters (μL) of M13mp18 ssDNA (250 ng / μL) was combined with 10 μL of pooled oligonucleotides (500 nM). The reaction volume was increased to 50 μL using 25 μL of origami buffer (10 mM 3-(N-morpholino)propanesulfonic acid (MOPS, Millipore-Sigma, M1442), 100 mM sodium nitrate (NaNO3, Millipore-Sigma, S8170), 12.5 mM magnesium acetate (Sigma-Aldrich, 63052), pH 7.0) and 10 μL of nuclease-free water (NFW, Teknova, W3332). The reaction mixture was heated to 85°C, cooled to 25°C at a rate of 0.2°C per minute, and then held at 10°C. The volume of folded origami was increased to 250 μL with origami buffer, and the solution was applied to an Amicon Ultra-0.5 100kD molecular weight cutoff (MWCO) filter (Amicon, UFC510008). The filter was washed three times with 300 μL of origami buffer. The filtered DNA origami was quantified using a 260 nm nanophotometer (Implen, NP80).

[0115] Based on the expected intercalation of silver ions at the N3 site of mismatched cytosine pairs, the number of potential cytosine-silver-cytosine (C-Ag+-C) mismatches was calculated from the molar concentration of DNA origami (OD260, 330 grams per mole of single-stranded bases, and calculated from 15,313 single-stranded bases per origami) and the number of overhanging C bases (10 overhangs per triangle, 15 Cs per overhang). Silver nitrate (Sigma-Aldrich, 85193) was added to the folded DNA origami at a molar ratio of 1.5 silver ions (Ag+) per C-Ag+-C mismatch. Toomey et al. (2016) The Journal of Physical Chemistry 120(14):7804-7809 DOI:10.1021 / acs.jpcc.5b11968. The reaction mixture was cooled from 45°C to 25°C at a rate of 1°C per 6 minutes.

[0116] For plating and imaging, a copper TEM grid (300 mesh) (Grid-Tech, Cu-300LD) having a lace-like carbon layer and a thin carbon layer of approximately 5 nm was glow discharged at 10 mA for 30 seconds. 5 μL of silver-mediated origami dimer was plated onto each grid for 2 minutes, absorbed onto Whatman filter paper (Cytiva Life Sciences, 1002-055), washed with 5 μL of NFW, and absorbed onto Whatman filter paper. The plated origami was imaged using LVEM5 TEM (DeLong America).

[0117] TEM images of DNA origami triangle dimers and clusters linked by silver ion-mediated cytosine-cytosine mismatches in overhang-type single-stranded polycytosine oligonucleotides are shown in Figures 16A-16B.

[0118] Therefore, the above description merely illustrates the principles of the present disclosure. Those skilled in the art will understand that various arrangements embodying the principles of the present invention and falling within its spirit and scope can be devised, although not expressly described or shown herein. Furthermore, all examples and conditional language enumerated herein are primarily intended to help the reader understand the principles of the present invention and the concepts to which the inventors contribute to further the art, and should be construed as not being limited to such specifically enumerated examples and conditions. Moreover, all descriptions herein describing the principles, aspects and embodiments of the present invention, as well as their specific examples, are intended to encompass both their structural and functional equivalents. In addition, such equivalents are intended to include both currently known equivalents and future-developed equivalents, i.e., any elements developed to perform the same function, regardless of structure. Therefore, the scope of the present invention is not intended to be limited to the exemplary embodiments illustrated and described herein.

Claims

1. It is a nucleic acid scaffold, The structure includes a fixed-resistance or variable-resistance structure operably linked to a site-specifically metallized nucleic acid region within the nucleic acid scaffold, The structure having fixed resistance or variable resistance includes an opening formed by one or more nonmetallated nucleic acid regions of the nucleic acid scaffold, A nucleic acid scaffold in which, when used, the conductance between two or more of the site-specifically metallized nucleic acid regions is conditional on the structure having the fixation resistance or variable resistance.

2. The nucleic acid scaffold according to claim 1, wherein the one or more non-metallated nucleic acid regions forming the opening share one or more nucleic acids with two or more site-specifically metallated nucleic acid regions.

3. The nucleic acid scaffold according to claim 1 or 2, wherein the one or more non-metallated nucleic acid regions forming the opening include nucleic acids hybridized to the nucleic acids of the two or more site-specifically metallated nucleic acid regions.

4. The two or more site-specifically metallized nucleic acid regions A first metallized field adjacent to the opening at the first position of the opening, A nucleic acid scaffold according to any one of claims 1 to 3, comprising a second metallized field adjacent to the opening at a second position of the opening.

5. The nucleic acid scaffold according to claim 4, wherein the first and second positions are substantially opposite to the opening.

6. The nucleic acid scaffold according to any one of claims 1 to 5, wherein the site-specifically metallized nucleic acid region within the nucleic acid scaffold includes a metallized double helix.

7. The nucleic acid scaffold according to claim 6, wherein the site-specific metallization of the double strand is achieved by a provided density of double strands that are site-specifically metallized.

8. The nucleic acid scaffold according to any one of claims 1 to 7, wherein the opening has a maximum dimension of 1 to 100 nanometers (nm).

9. The nucleic acid scaffold according to claim 8, wherein the opening has a maximum dimension of 2 to 10 nm.

10. The nucleic acid scaffold according to any one of claims 1 to 9, wherein the state of the structure having fixed resistance or variable resistance is the presence or absence of the analyte in the opening.

11. The nucleic acid scaffold according to claim 10, wherein the state of the structure having fixed resistance or variable resistance is the presence or absence of the analyte in the opening.

12. The nucleic acid scaffold according to claim 10 or 11, wherein the analyte is a polymer.

13. The nucleic acid scaffold according to claim 12, wherein the opening is adapted to the translocation of the polymer passing through it.

14. The nucleic acid scaffold according to claim 13, wherein the polymer is a nucleic acid or a protein.

15. The nucleic acid scaffold according to claim 14, wherein the polymer is a nucleic acid, and the opening is adapted to a hydrogen bond to a base of the nucleic acid through which it translocates.

16. The nucleic acid scaffold according to any one of claims 1 to 15, wherein the state of the structure having fixed resistance or variable resistance is the presence or absence of a polymer that translocates through the opening.

17. The nucleic acid scaffold according to claim 16, wherein the conductance between the two or more site-specifically metallized nucleic acid regions changes, or occurs only in the presence of nucleic acids translocating through the opening.

18. The nucleic acid scaffold according to any one of claims 1 to 17, wherein the scaffold exists in a vacuum.

19. The nucleic acid scaffold according to any one of claims 1 to 17, wherein the scaffold is immersed in a fluid.

20. The nucleic acid scaffold according to claim 19, wherein the fluid is a gas.

21. The nucleic acid scaffold according to claim 19, wherein the fluid is a liquid.

22. It is a device, A nucleic acid scaffold according to any one of claims 1 to 21, Electrodes operably connected to two or more site-specifically metallized nucleic acid regions, One or more power sources operably connected to the electrode, One or more processors, One or more computer-readable media containing stored instructions, which, when executed by the one or more processors, the device An electrical bias is introduced between the two or more site-specifically metallized nucleic acid regions. A device comprising a computer-readable medium for measuring conductance between two or more site-specifically metallized nucleic acid regions.

23. The device according to claim 22, wherein when the instruction is executed by the one or more processors, it intermittently provides the one or more power supplies with an electrical bias between the two or more site-specifically metallized nucleic acid regions when the device is in use.

24. The device according to claim 22, wherein when the instruction is executed by the one or more processors, the one or more power supplies continuously provide an electrical bias between the two or more site-specifically metallized nucleic acid regions when the device is in use.

25. The device according to any one of claims 22 to 24, wherein one or more power sources use a fixed voltage to introduce an electrical bias between the two or more site-specifically metallized nucleic acid regions.

26. The device according to any one of claims 22 to 24, wherein one or more power sources use a variable voltage to introduce an electrical bias between the two or more site-specifically metallized nucleic acid regions.

27. The device according to any one of claims 22 to 26, wherein the electrode is operably connected to two or more site-specifically metallized nucleic acid regions via attached nucleic acids.

28. The device according to claim 27, wherein the attached nucleic acid includes a docking nucleic acid immobilized on the surface of the electrode, and the nucleic acid of the nucleic acid scaffold hybridizes with the docking nucleic acid.

29. The device according to any one of claims 22 to 28, wherein the opening has a maximum dimension of 1 to 100 nanometers (nm).

30. The nucleic acid scaffold according to claim 29, wherein the opening has a maximum dimension of 2 to 10 nm.

31. The device according to any one of claims 22 to 30, wherein the device includes a nanopore aligned with the opening.

32. The device according to claim 31, wherein the nucleic acid scaffold is inserted into the nanopore.

33. The device according to claim 31 or 32, wherein the device is adapted to translocate an analyte through the nanopore, thereby translocating the analyte through the opening.

34. The device according to claim 33, wherein the analyte is a polymer.

35. The device according to claim 34, wherein the polymer is nucleic acid or protein.

36. The device according to any one of claims 33 to 35, wherein the nucleic acid scaffold and the nanopore are arranged so that the analyte is translocated through the opening before it is translocated through the nanopore.

37. The device according to any one of claims 33 to 35, wherein the nucleic acid scaffold and the nanopore are arranged so that the analyte is translocated through the nanopore before it is translocated through the opening.

38. The device according to any one of claims 33 to 37, wherein the conductance between the two or more site-specifically metallized nucleic acid regions changes, or occurs only in the presence of the analyte translocating through the opening.

39. The device according to any one of claims 33 to 38, wherein the conductance between the two or more site-specifically metallized nucleic acid regions increases in the presence of the analyte translocating through the opening.

40. The device according to any one of claims 33 to 39, wherein the instruction causes the device to measure the conductance between the two or more site-specifically metallized nucleic acid regions during the translocation of the analyte through the opening.

41. The device according to claim 40, wherein the analyte is a polymer, and the conductance is a changing conductance indicating monomers of the polymer that sequentially translocate through the opening.

42. The device according to claim 40, wherein the polymer is a nucleic acid.

43. The device according to claim 42, wherein the conductance is a changing conductance that indicates the bases of the nucleic acid that are sequentially translocated through the opening.

44. The device according to any one of claims 40 to 43, wherein the instruction causes the device to determine the arrangement of the polymer based on the measured changing conductance.

45. The device according to any one of claims 22 to 44, wherein the scaffold and electrodes are located in a vacuum.

46. The device according to any one of claims 22 to 44, wherein the scaffold and electrodes are immersed in a fluid.

47. The device according to claim 46, wherein the fluid is a gas.

48. The device according to claim 46, wherein the fluid is a liquid.

49. The device according to any one of claims 46 to 48, wherein the temperature of the fluid is selected to achieve a desired conductance between the two or more site-specifically metallized nucleic acid regions, and optionally the conductance is the baseline conductance when no analyte is present in the opening.

50. The device according to any one of claims 46 to 49, wherein the fluid contains ions.

51. The device according to claim 52, wherein the device is adapted to provide a flow of ion current through the opening.

52. The device according to any one of claims 46 to 51, wherein the fluid comprises an ion concentration selected to achieve a desired and / or variable conductance between the two or more site-specifically metallized nucleic acid regions based on ion concentration / flow, and optionally the conductance is the baseline conductance when no analyte is present in the opening.

53. The device according to any one of claims 46 to 52, wherein when the instruction is executed by the one or more processors, the device causes the device to determine the temperature of the fluid based on the conductance.

54. A method implemented using the device described in any one of claims 22 to 53, wherein the method is To introduce an electrical bias between the two or more site-specifically metallized nucleic acid regions, A method comprising measuring the conductance between two or more site-specifically metallized nucleic acid regions.

55. The method according to claim 54, wherein the opening has a maximum dimension of 1 to 100 nanometers (nm).

56. The method according to claim 55, wherein the opening has a maximum dimension of 2 to 10 nm.

57. The method according to any one of claims 54 to 56, wherein the device includes a nanopore aligned with the opening.

58. The method according to claim 57, wherein the nucleic acid scaffold is inserted into the nanopore.

59. The method according to claim 57 or 58, comprising translocating an analyte through the nanopore, thereby translocating the analyte through the opening.

60. The method according to claim 59, wherein the analyte is translocated through the opening before it is translocated through the nanopore.

61. The method according to claim 59, wherein the analyte is translocated through the nanopore before it is translocated through the opening.

62. The method according to any one of claims 57 to 61, wherein the analyte is a polymer.

63. The method according to claim 62, wherein the polymer is a nucleic acid or a protein.

64. The method according to claim 63, wherein the polymer is a nucleic acid, and the opening is adapted to a hydrogen bond to a base of the nucleic acid through which it translocates.

65. The method according to claim 64, wherein the hydrogen bond reduces the translocation rate of the nucleic acid compared to the translocation rate in the absence of the hydrogen bond.

66. The method according to claim 64 or 65, wherein the hydrogen bond positions the nucleic acid to facilitate analysis of the nucleic acid.

67. The method according to any one of claims 59 to 66, wherein the conductance between the two or more site-specifically metallized nucleic acid regions changes, or occurs only in the presence of the analyte translocating through the opening.

68. The method according to any one of claims 59 to 67, wherein the instruction causes the device to measure the conductance between the two or more site-specifically metallized nucleic acid regions during the translocation of the analyte through the opening.

69. The method according to claim 68, wherein the analyte is a polymer, and the conductance is a changing conductance indicating monomers of the polymer that sequentially translocate through the opening.

70. The method according to claim 69, wherein the polymer is a nucleic acid, and the conductance is a changing conductance that indicates the bases of the nucleic acid that are sequentially translocated through the opening.

71. The method according to claim 69 or 70, wherein the instruction causes the device to determine the arrangement of the polymer based on the measured changing conductance.

72. The method according to any one of claims 59 to 71, wherein the scaffold and electrodes are present in a vacuum.

73. The method according to any one of claims 59 to 71, wherein the scaffold and electrodes are immersed in a fluid.

74. The method according to claim 73, wherein the fluid is a gas.

75. The method according to claim 73, wherein the fluid is a liquid.

76. The method according to any one of claims 73 to 75, wherein the temperature of the fluid is selected to achieve a desired conductance between the two or more site-specifically metallized nucleic acid regions, and optionally the conductance is the baseline conductance when the analyte is not present in the opening.

77. The method according to any one of claims 73 to 76, wherein the fluid contains ions.

78. The method according to claim 77, wherein the device is adapted to bring about a flow of ion current through the opening.

79. The method according to any one of claims 73 to 78, wherein the fluid comprises an ion concentration selected to achieve a desired and / or variable conductance between the two or more site-specifically metallized nucleic acid regions based on ion concentration / flow, and optionally the conductance is the baseline conductance when no analyte is present in the opening.

80. The method according to any one of claims 73 to 79, comprising determining the temperature of the fluid based on the conductance.

Images