Cas9 retroviral integrase and Cas9 recombinase systems for targeted integration of DNA sequences into the genome of cells or organisms

Abstract

To provide Cas9 retroviral integrase and Cas9 recombinase systems for targeted integration of DNA sequences into genomes of cells or organisms.SOLUTION: Provided herein is a nucleic acid construct comprising: a) a first polynucleotide sequence encoding a Cas9, an inactive Cas9, or a Cpf1, or a portion thereof: b) a second polynucleotide sequence encoding an integrase, a recombinase, or a transposase, or a portion thereof; and c) a third polynucleotide sequence encoding a nucleic acid linker; where the first polynucleotide sequence and the second polynucleotide sequence each comprise a 5' end and a 3' end, and the 3' end of the first polynucleotide is connected to the 5' end of the second polynucleotide by the nucleic acid linker, and the first and second polynucleotides are able to be expressed as a fusion protein in a cell or an organism.SELECTED DRAWING: Figure 1

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 62,140,454, filed March 31, 2015, U.S. Provisional Patent Application No. 62,210,451, filed August 27, 2015, and U.S. Provisional Patent Application No. 62,240,359, filed October 12, 2015, the contents of each of which are incorporated by reference in their entirety for all purposes.

[0002] The present disclosure relates to the use of engineered proteins with DNA binding proteins that exhibit genome specificity, such as Cas9 (CRISPR (clustered regularly interspaced short palindromic repeats) protein), TALEs and zinc finger proteins, linked by a linker to a viral integrase (e.g., HIV or MMTV integrase) or recombinase to deliver a DNA sequence of interest (or a gene of interest) to a targeted site in the genome of a cell or organism. The use of Cas9, which is inactive for its function in DNA cleavage, allows the use of the DNA targeting ability of Cas9 protein by the use of RNA guides (gRNAs) without causing DNA destruction as intended in other systems for homologous recombination. The use of zinc finger proteins or TALEs (engineered proteins that bind to specific sequences of DNA) linked to a viral integrase or recombinase is also disclosed. This system can be used for research and therapeutic purposes. For example, donor DNA containing a gene of interest can be easily introduced into the host genome without the possibility of off-target cleavage through conventional methods. Donor DNA can also be modified to facilitate "knock-out" strategies. We also discuss a new strategy to improve the specificity of Cas9 targeting. This strategy uses surface-bound dCas9 (Cas9 that is inactive in terms of its DNA cleavage ability) along with guide RNA and genomic DNA in an assay to find which guide RNA results in specific targeting of Cas9. This is particularly important for in vivo applications of CRISPR / Cas9 and overcomes the limitations of current in silico predictive models, but can also be used in combination with in silico predictive models to make an educated decision on which gRNA to use in an assay. [Background technology]

[0003] Recent advances in genome sequencing technologies and analytical methods have significantly accelerated the ability to classify and map genetic / genomic factors associated with a wide variety of biological functions and diseases. Precise genome targeting technologies are needed to allow selective disruption of individual genetic elements and to allow systematic reverse modification of causative genetic mutations by advancing synthetic biology, biotechnology and medical applications. Genome editing technologies such as designer zinc fingers, transcription activator-like effectors (TALEs), CRISPR / Cas9 or meganucleases are available to generate targeted genome disruption, and there remains a need for new genome modification technologies that allow the integration of DNA sequences (including full-length gene sequences) into specific locations in a given genome. This would allow the creation of cell lines or transgenic organisms expressing modified genes or replacement of dysfunctional genes in subjects in need thereof.

[0004] Integrase is a viral protein that allows the insertion of viral nucleic acid into the host genome (mammals, humans, mice, rats, monkeys, frogs, fish, plants (including crops and laboratory plants such as Arabidopsis), laboratory or medical biological cell lines or primary cell cultures, C. elegans, flies (Drosophila, etc.). Integrase uses the host's DNA binding proteins to link it to the host genome in order to integrate the viral nucleic acid sequence into the host genome. Integrase is found in retroviruses such as HIV (human immunodeficiency virus). Integrase relies on sequences on viral genes to insert its genome into the host DNA. Leavitt et al (Journal of Biological Chemistry,1993,volume 268,pages 2113-2119) investigated the function of HIV1 integrase by using site-directed mutagenesis and in vitro studies. Leavitt also demonstrated that HIV1 integrase is involved in the insertion of viral nucleic acid into the host genome by viral integrase. The sequences of the U5 and U3 HIV1 att sites, which are important for integration of DNA (generated after reverse transcription), are also shown.

[0005] The present disclosure improves upon current genome editing technology by allowing for the specific insertion of a desired nucleic acid (DNA) sequence into a genome at a designated location in the genome. A recombinant modified integrase (or recombinase) with DNA binding ability binds to a given DNA sequence in the genome, recognizes a provided DNA sequence and / or homology arms with an integrase recognition domain (such as an HIV1 (or other retrovirus) att site), and inserts the given nucleic acid sequence into the genome in a site-specific manner. Certain aspects of the present disclosure include inserting a DNA sequence of a stop codon (UAA, UAG, and / or UGA) immediately after the transcription start site of a gene. This allows for the effective inhibition of gene transcription in the genome of a cell or organism. Summary of the Invention

[0006] The present disclosure combines DNA targeting technology, including zinc finger protein, TALEN and CRISPR / Cas9 or other CRISPR protein like Cpf1, with retroviral integrase to form DNA targeting integrase.Then, gene of interest (GOI) can be provided with DNA targeting integrase so that it can be integrated into genome in a targeted manner.The GOI is designed with homology arms to provide another level of specificity for its insertion in genome.

[0007] The present disclosure particularly relates to the use of mutant Cas9 lacking DNA cleavage ability for linkage with retroviral integrase.

[0008] The present disclosure includes a system that includes A) a viral integrase (or bacterial recombinase) that is covalently linked to a Cas protein (e.g., Cas9) that is not capable of DNA cleavage. Alternatively, the viral integrase (or recombinase) is covalently linked to a TALE protein or zinc finger protein, which are designed to target a specific sequence of DNA in the genome. This can be provided in an expression vector or as a purified protein; B) a gene of interest (or DNA sequence of interest) with or without homologous arms that are integrated into the desired genome. The GOI or DNA sequence of interest can be modified as necessary to be recognized by the viral integrase. Other reagents required for polynucleotide transfection and / or protein introduction into cells. Assays are performed for off-target integration of DNA sequences. In some embodiments, modified marker sequences are used in the DNA sequence to be inserted.

[0009] Provided herein is a nucleic acid construct comprising: a) a first polynucleotide sequence encoding Cas9, inactive Cas9 or Cpf1, or a portion thereof; b) a second polynucleotide sequence encoding an integrase, recombinase or transposase, or a portion thereof; and c) a third polynucleotide sequence encoding a nucleic acid linker, in operable linkage, the first polynucleotide sequence comprising a 5' and a 3' end, and the second polynucleotide sequence comprising a 5' and a 3' end, and the 3' end of the first polynucleotide is linked to the 5' end of the second polynucleotide by the nucleic acid linker, and the first and second polynucleotides are capable of being expressed as a fusion protein in a cell or organism. In some embodiments, the first polynucleotide sequence comprises any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 27-46, 49, 56, or 68, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity thereto. In some embodiments, the Cas9, inactive Cas9 or Cpf1 comprises any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 50, 52, 69, 72-78 or 86-92, or a sequence having at least 80%, at least 85%, at least 90%, at least 95% or at least 99% identity thereto. In some embodiments, the second polynucleotide sequence comprises any one of SEQ ID NOs: 15, 17, 19, 21, 23, 47, 55, 62, 64, 66, 70 or 79, or a sequence having at least 80%, at least 85%, at least 90%, at least 95% or at least 99% identity thereto. In some embodiments, the integrase, recombinase or transposase comprises any one of SEQ ID NOs: 16, 18, 20, 22, 24, 25, 26, 48, 63, 65, 67, 71 or 80, or a sequence having at least 80%, at least 85%, at least 90%, at least 95% or at least 99% identity thereto. Also described herein are organisms comprising the nucleic acid constructs.Also described herein are organisms having modified genomes, including the fusion proteins.

[0010] Provided herein is an organism comprising a) a first polynucleotide sequence encoding Cas9, inactive Cas9 or Cpf1, or a portion thereof; b) a second polynucleotide sequence encoding an integrase, recombinase or transposase, or a portion thereof; and c) a third polynucleotide sequence encoding a nucleic acid linker, wherein the first polynucleotide sequence comprises a 5' and a 3' end, and the second polynucleotide sequence comprises a 5' and a 3' end, and the 3' end of the first polynucleotide is linked to the 5' end of the second polynucleotide by the nucleic acid linker, and wherein the first and second polynucleotides are capable of being expressed as a fusion protein in a cell or organism.

[0011] Also provided herein is a fusion protein comprising: a) a first protein that is a catalytically inactive Cas9, Cas9, a TALE protein, a zinc finger protein, or a Cpf1 protein, the first protein targeting a target DNA sequence; b) a second protein that is an integrase, a recombinase, or a transposase; and c) a linker linking the first protein to the second protein. In some embodiments, the second protein is an integrase, the integrase being an HIV1 integrase or a lentiviral integrase, and the linker sequence is one or more amino acids in length, or the first protein is a catalytically inactive Cas9. In some embodiments, the linker sequence is 4-8 amino acids in length, and the first protein is a TALE protein, or the first protein is a zinc finger protein. In some embodiments, when the fusion protein comprises a TALE or zinc finger protein, the target DNA sequence is about 16 to about 24 base pairs in length. In some embodiments, the first protein is Cas9 or a catalytically inactive Cas9, and one or more guide RNAs are used to target a target DNA sequence of about 16 to about 24 base pairs.

[0012] Also provided herein is a method of inserting a DNA sequence into genomic DNA comprising: a) identifying a target sequence in genomic DNA; b) designing a fusion protein according to claim 1 to bind the target sequence in the genomic DNA; 3) designing a DNA sequence of interest for integration into the genomic DNA; and d) providing the fusion protein and the DNA sequence of interest to a cell or organism by a technique that allows for the transfer of the fusion protein and the DNA sequence of interest into the cell or organism, such that the DNA sequence of interest becomes integrated at the target sequence in the genomic DNA.

[0013] Also provided herein is a nucleotide vector comprising: a) a first coding sequence for a first protein, which is Cas9, catalytically inactive Cas9, a TALE protein, a zinc finger protein, or a Cpf1 protein, modified to bind to a target DNA sequence; b) a second coding sequence for a second protein, which is an integrase, a recombinase, or a transposase; c) a DNA sequence between the first and second coding sequences that forms an amino acid linker between the first and second proteins; and d) optionally an expressed DNA sequence of interest surrounded by att sites recognized by the integrase and optionally one or more guide RNAs, wherein the first protein targets a predetermined DNA sequence and the first protein is linked to the second protein by an amino acid linker sequence.

[0014] A method of inhibiting gene transcription in a cell or organism is provided herein, the method comprising: a) identifying an ATG start codon in a gene; b) designing a fusion protein system using the fusion protein of claim 1 to bind to a target sequence immediately following the ATG start codon of the gene; c) designing a DNA sequence of interest that is one or more consecutive stop codons; and d) providing the fusion protein and the DNA sequence of interest to a cell or organism by a technique that allows the transfer of the fusion protein and the DNA sequence of interest to the cell or organism, such that the DNA sequence of interest becomes integrated at the target sequence in genomic DNA and transcription of the gene is inhibited. In some embodiments, the second protein is a recombinase, and the recombinase is Cre recombinase or a modified version thereof, and the modified Cre recombinase has constitutive recombinase activity. In some embodiments, the vector further comprises a reverse transcriptase gene that is expressed in the cell.

[0015] Also provided herein are compositions comprising purified protein of a DNA binding protein / integrase fusion and RNA of about 15 to about 100 base pairs in length, where the DNA binding protein is selected from Cas9, Cpf1, TALEN and zinc finger proteins that have been modified to a targeted DNA sequence in a genome, and the integrase is HIV integrase, lentiviral integrase, adenoviral integrase, retroviral integrase or MMTV integrase. [Brief description of the drawings]

[0016] These and other features, aspects and advantages of the present disclosure will become more fully understood with regard to the following description, the appended claims and the accompanying drawings.

[0017] [Figure 1]FIG. 1 shows a) a representative catalytically incompetent Cas9 / HIV1 integrase fusion protein, b) a representative TALE / HIV1 integrase fusion protein, c) a representative zinc finger protein / HIV1 integrase fusion protein, and d) a representative Cas9 / HIV1 integrase fusion protein designed on opposite sides of DNA at the targeting site. Each fusion protein binds to a specific target sequence of DNA. "ZnFn" is a zinc finger protein. "Integrase" corresponds to one integrase unit or two integrase units linked by, for example, a short amino acid linker. In some embodiments, the integrase can be replaced by a recombinase. Cas9 can be catalytically incompetent or incompetent. [Diagram 2] Figure 2 shows a DNA plasmid system that includes a vector containing a catalytically incompetent Cas9 / integrase fusion protein, a vector containing a DNA sequence of interest, and a vector containing a reverse transcriptase. Guide RNA (gRNA) or RNA can be provided separately. A separate vector can be used to express gRNA. "1 or 2" refers to one integrase or two integrases linked by, for example, an amino acid linker. [Diagram 3] Figure 3 shows a representative DNA plasmid containing a nucleiotide sequence, a catalytically inactive Cas9 / integrase fusion protein, a guide RNA, a DNA (gene) sequence of interest, and a reverse transcriptase. A viral att site can be provided at the DNA sequence of interest, allowing the integrase to integrate into the genomic DNA of the cell. A guide RNA (gRNA) or RNA can be provided separately. A separate vector can be used to express the gRNA. "1 or 2" refers to one integrase or two integrases linked by, for example, an amino acid linker. [Figure 4]Figure 4 shows a flow diagram. One representative method using the vectors shown in Figures 2 and 3 is shown in Figure 4, which is as follows: 1) reverse transcriptase reverse transcribes the DNA sequence of interest with att sites expressed from the vector (or uses linear DNA with att sites), 2) fusion Cas9 / integrase targets a site on the genomic DNA based on the guide RNA, 3) integrase recognizes the att(LTR) site on the DNA sequence of interest and integrates the DNA into the genome at the targeted site, 4) assay (e.g., PCR (polymerase chain reaction) is performed to check for correct insertion of the DNA sequence of interest. Assays can also be performed to check for non-specific integration. [Diagram 5] Figure 5 shows Abbie1 gene editing targeting exon 2 of Nrf2 using guide NrF2-sgRNA2 and sgRNA3. [Figure 6] FIG. 6 shows theoretical data generated by Abbie1 gene editing. [Figure 7] FIG. 7 shows Abbie1 gene editing targeting exon 2 of Nrf2 using guide Nrf2-sgRNA3. [Figure 8] FIG. 8 shows Abbie1 knockout of Nrf2 in pooled Hek293T-cells. [Figure 9] FIG. 9 shows Abbie1 knockout of Nrf2 in pooled Hek293T-cells. [Figure 10] FIG. 10 shows Abbie1 gene editing targeting CXCR4 exon 2. [Figure 11] FIG. 11 shows detection of ABBIE1 protein after isolation and purification from an E. coli Coomassie stained gel. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0018] The following detailed description is provided to aid those skilled in the art in practicing the present disclosure, but should not be construed as unduly limiting the present disclosure, since modifications and variations in the embodiments discussed herein may be made by those skilled in the art without departing from the spirit or scope of the present discovery.

[0019] As used in this disclosure and the appended claims, the singular forms "a," "an," and "the" include plural references unless the content clearly dictates otherwise. As used in this disclosure and the appended claims, the word "or" may be singular or inclusive. For example, A or B may be A and B.

[0020] endogenous As described herein, an endogenous nucleic acid, nucleotide, polypeptide, or protein is defined in the context of a host organism. An endogenous nucleic acid, nucleotide, polypeptide, or protein is one that occurs naturally in the host organism.

[0021] foreignness As described herein, an exogenous nucleic acid, nucleotide, polypeptide, or protein is defined in relation to the host organism. An exogenous nucleic acid, nucleotide, polypeptide, or protein is one that does not naturally occur in the host organism or is in a different location in the host organism.

[0022] knock out A gene is considered to be knocked out when an exogenous nucleic acid is transformed into a host organism (e.g., by random insertion or homologous recombination) such that the gene is disrupted (e.g., by deletion, insertion).

[0023] Knocking out a gene can reduce the activity of the corresponding protein, for example by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% compared to the activity of the same protein without the gene being knocked out.

[0024] Knocking out a gene can reduce transcription of the gene by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% compared to when the gene is not knocked out.

[0025] qualification A modified organism is an organism that is different from an unmodified organism. For example, a modified organism may contain a fusion protein of the present disclosure that causes a knockout of a target gene sequence. A modified organism may have a modified genome.

[0026] A modified nucleic acid sequence or amino acid sequence is different from an unmodified nucleic acid sequence or amino acid sequence. For example, a nucleic acid sequence may have one or more nucleic acids inserted, deleted, or added. For example, an amino acid sequence may have one or more amino acids inserted, deleted, or added.

[0027] Operable Linkage In some embodiments, a vector comprises a polynucleotide operably linked to one or more regulatory elements, such as a promoter and / or a transcription terminator. A nucleic acid sequence is operably linked when it is placed into a functional relationship with another nucleic acid sequence. For example, a promoter is operably linked to a coding sequence if it is expressed as a preprotein involved in the secretion of the polypeptide, DNA for a presequence or secretory leader is operably linked to DNA for the polypeptide and affects the transcription of the sequence, or a ribosome binding site is operably linked to a coding sequence if it is positioned to facilitate translation. Operably linked sequences may be contiguous, and in the case of a secretory leader, may be contiguous and in reading phase.

[0028] Host Cell or Host Organism The host cell may contain a polynucleotide encoding a polypeptide of the present disclosure. In some embodiments, the host cell is part of a multicellular organism. In other embodiments, the host cell is cultured as a unicellular organism.

[0029] The host organism may include any suitable host, such as a microorganism. Microorganisms useful in the methods described herein include, for example, bacteria (e.g., E. coli), yeast (e.g., Saccharomyces cerevisiae), and plants. The organism may be prokaryotic or eukaryotic. The organism may be unicellular or multicellular.

[0030] The host cell may be prokaryotic. Suitable prokaryotic cells include, but are not limited to, Escherichia coli, Lactobacillus sp., Salmonella sp., and any of the various laboratory strains of Shigella sp. (e.g., as described in Carrier et al. (1992) J. Immunol. 148:1176-1181; U.S. Patent No. 6,447,784; and Sizemore et al. (1995) Science 270:299-302). Examples of Salmonella species that may be used in the present disclosure include, but are not limited to, Salmonella typhi and S. typhimurium. Suitable Shigella species include, but are not limited to, Shigella flexneri, Shigella sonnei, and Shigella disenteriae. Generally, research species are non-pathogenic. Non-limiting examples of other suitable bacteria include, but are not limited to, Pseudomonas pudita, Pseudomonas aeruginosa, Pseudomonas mevalonii, Rhodobacter sphaeroides, Rhodobacter capsulatus, Rhodospirillum rubrum, and Rhodococcus sp.

[0031] In some embodiments, the host organism is eukaryotic. Suitable eukaryotic host cells include, but are not limited to, yeast cells, insect cells, plant cells, fungal cells, and algae cells.

[0032] Polynucleotides and Polypeptides [Nucleic Acids and Proteins] The protein of the present disclosure can be produced by any method known in the art. Proteins can be synthesized either by using solid-phase peptide synthesis or by classical solution peptide synthesis, also known as liquid-phase peptide synthesis. Using Val-Pro-Pro, enalapril and lisinopril as starting templates, several series of peptide analogs, such as X-Pro-Pro, X-Ala-Pro and X-Lys-Pro, where X corresponds to any amino acid residue, can be synthesized using solid-phase or liquid-phase peptide synthesis. Methods for carrying out liquid-phase synthesis of peptide and oligonucleotide libraries coupled to soluble oligomeric supports have been described. Bayer, Ernst and Mutter, Manfred, Nature 237:512-513 (1972); Bayer, Ernst, et al., J. Am. Chem. Soc. 96:7333-7336 (1974); Bonora, Gian Maria, et al., Nucleic Acids Res. 18:3155-3159 (1990). Liquid phase synthesis has the advantage over solid phase synthesis in that it does not require a structure present on the first reactant suitable for linking the reactant to the solid phase. Also, liquid phase synthesis does not require avoiding chemical conditions that may break the bond between the solid phase and the first reactant (or intermediate product). Furthermore, reactions in homogeneous solution may give better yields and more complete reactions than those obtained in heterogeneous solid / liquid phase systems, such as those present in solid phase synthesis.

[0033] In oligomer-supported liquid-phase synthesis, the extension products are linked to large, soluble polymeric groups. The products from each step of the synthesis can then be separated from the unreacted reactants based on the large size difference between the relatively large polymer-linked products and the unreacted reactants. This allows the reactions to be carried out in homogeneous solution, eliminating the tedious purification steps associated with traditional liquid-phase synthesis. Oligomer-supported liquid-phase synthesis has also been adapted for automated liquid-phase synthesis of peptides. Bayer, Ernst, et al., Peptides: Chemistry, Structure, Biology, 426-432.

[0034] In solid-phase peptide synthesis, the procedure involves linking the termini of a growing peptide to an insoluble support while simultaneously sequentially assembling the appropriate amino acids for a peptide of the desired sequence. Usually, the carboxyl terminus of the peptide is linked to a polymer, which can be released from the polymer upon treatment with a cleavage reagent. In a common method, amino acids are attached to resin particles, and the peptide is generated stepwise by successive addition of protected amino acids to generate a chain of amino acids. A modification of the technique described by Merrifield is commonly used. See, for example, Merrifield, J. Am. Chem. Soc. 96:2989-93 (1964). In the automated solid-phase method, peptides are synthesized by loading the carboxy-terminal amino acid onto an organic linker (e.g., PAM, 4-oxymethylphenylacetamidomethyl) and covalently attaching it to an insoluble polystyrene resin cross-linked with divinylbenzene. The terminal amine can be protected by blocking with t-butyloxycarbonyl. Hydroxyl and carboxyl groups are typically protected by blocking with O-benzyl groups. Synthesis is performed in an automated peptide synthesizer, such as that available from Applied Biosystems (Foster City, Calif.). After synthesis, the product may be removed from the resin. Blocking groups are removed by using hydrofluoric acid or trifluoromethylsulfonic acid according to established methods. A typical synthesis may yield 0.5 mmole of peptide resin. After cleavage and purification, yields of approximately 60-70% are typically obtained. Purification of the product peptide may be accomplished by, for example, crystallizing the peptide from an organic solvent such as methyl-butyl ether, followed by dissolving in distilled water, and dialysis (if the molecular weight of the peptide of interest is greater than about 500 daltons) or by inverse high pressure liquid chromatography (e.g., C 2000 with 0.1% trifluoroacetic acid and acetonitrile as solvent) if the molecular weight of the peptide is less than 500 daltons. 18This is accomplished by using a column (using a column). The purified peptides can be lyophilized and stored dry until use. Analysis of the resulting peptides can be accomplished using common methods of analytical high pressure liquid chromatography (HPLC) and electrospray mass spectrometry (ES-MS).

[0035] In other cases, proteins, e.g., proteins, are produced by recombinant methods. For the production of any of the proteins described herein, a host cell transformed with an expression vector containing a polynucleotide encoding such a protein may be used. The host cell may be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast, or the host may be a prokaryotic cell, such as a bacterial cell. Introduction of the expression vector into the host cell may be accomplished by a variety of methods, including calcium phosphate transfection, DEAE-dextran mediated transfection, polybrene, protoplast fusion, liposomes, direct microinjection into the nucleus, scrape loading, biolistic transformation, and electroporation. Large-scale production of proteins from recombinant organisms is a well-established process carried out on a commercial scale and is well within the capabilities of one of ordinary skill in the art.

[0036] Codon optimization One or more codons of the coding polynucleotide may be "biased" or "optimized" to reflect the codon usage of the host organism. For example, one or more codons of the coding polynucleotide may be "biased" or "optimized" to reflect chloroplast codon usage or nuclear codon usage. It is well recognized that most amino acids are encoded by two or more different (degenerate) codons, and different organisms utilize certain codons in preference to others. "Biased" or "optimized" codons may be used interchangeably throughout this application. Codon bias may be distorted differently in different plants, including, for example, algae, when compared to tobacco. In general, the codon bias selected reflects the codon usage of the plant (or organelles therein) being transformed with the nucleic acid of the present disclosure.

[0037] Polynucleotides biased towards particular codon usage can be synthesized de novo or can be genetically modified using conventional recombinant DNA techniques, for example by site-directed mutagenesis, to change one or more codons so as to be biased towards chloroplast codon usage.

[0038] Percent sequence identity One example of an algorithm that is suitable for determining percent sequence identity or sequence similarity between nucleic acid or polypeptide sequences is the BLAST algorithm, which is described, for example, in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analysis is publicly available through the National Center for Biotechnology Information. The BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a word length (W) of 11, an expectation (E) of 10, a cutoff of 100, M=5, N=4 and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a word length (W) of 3, an expectation (E) of 10 and the BLOSUM62 scoring matrix (e.g., as described in Henikoff & Henikoff (1989) Proc. Natl. Acad. Sci. USA, 89:10915). In addition to calculating percent sequence identity, the BLAST algorithm can also perform a statistical analysis of the similarity between two sequences (e.g., as described in Karlin & Altschul, Proc. Nat'l. Acad. Sci. USA, 90:5873-5787 (1993)). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability that a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in the comparison of the test nucleic acid to the reference nucleic acid is less than about 0.1, less than about 0.01, and less than about 0.001.

[0039] The present disclosure includes a system comprising A) a viral integrase (or recombinase) covalently linked to a Cas protein (e.g., Cas9) that is inactive, for example with respect to DNA cleavage ability. Alternatively, a viral integrase (or bacterial or phage recombinase) is covalently linked to a TALE protein or zinc finger protein where the TALE protein or zinc finger protein is designed to target a specific sequence of DNA in a genome.

[0040] This can be provided in an expression vector or as a purified protein. B) The gene of interest (or DNA sequence of interest) with or without homology arms to be integrated into the desired genome. If necessary, the GOI or DNA sequence of interest can be modified for recognition by viral integrase. For example, viral att sites can be added to the ends of the DNA sequence. C) Other reagents required for polynucleotide transfection and / or protein introduction into cells.

[0041] nucleic acid The terms "polynucleotide", "nucleotide", "nucleotide sequence", "nucleic acid" and "oligonucleotide" are used interchangeably in this disclosure. They refer to polymeric forms of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or their analogs. Polynucleotides may have any three-dimensional structure and may perform any function, known or unknown. The following are non-limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, locus(s) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes and primers. Polynucleotides may contain one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide can be further modified after polymerization, such as by conjugation with a labeling component.

[0042] Guide RNA In the present disclosure, the terms "chimeric RNA", "chimeric guide RNA", "guide RNA", "single guide RNA" and "synthetic guide RNA" are used interchangeably and refer to a polynucleotide sequence that includes a guide sequence, a tracr sequence and a tracr mate sequence. The term "guide sequence" refers to an approximately 20 bp (12-30 bp) sequence within a guide RNA that defines a target site and may be used interchangeably with the terms "guide" or "spacer". The term "tracr mate sequence" may also be used interchangeably with the term "direct repeat".

[0043] Wild type As used herein, the term "wild-type" is a term of the art understood by those of skill in the art and means the typical form of an organism, strain, gene or characteristic as occurring in nature, as distinguished from mutant or variant forms.

[0044] Mutants As used herein, the term "variant" or "mutant" should be taken to mean a display of a quality having a pattern that deviates from that which occurs in nature. In relation to genes, these terms refer to many changes in a gene that make it different from the wild-type gene, including, inter alia, single nucleotide polymorphisms (SNPs), insertions, deletions, gene shifts.

[0045] Modifications The terms "non-natural" or "modified" are used interchangeably and refer to the involvement of human technology. These terms, when referring to a nucleic acid molecule or polypeptide, mean that the nucleic acid molecule or polypeptide is at least substantially free from at least one other component with which they are naturally associated and found in nature in nature.

[0046] Complementarity "Complementarity" refers to the ability of a nucleic acid to form hydrogen bonds with another nucleic acid sequence, either by classical Watson-Crick or other non-classical types. Percent complementarity refers to the percentage of residues in a nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairs) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 are 50%, 60%, 70%, 80%, 90% and 100% complementary). "Fully complementary" means that all contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence. "Substantially complementary," as used herein, refers to a degree of complementarity that is a percentage between over a region of at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% or more 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50 or more nucleotides, or two nucleic acids that hybridize under stringent conditions.

[0047] amino acid Formal name, 3-letter code, 1-letter code Aspartic Acid Asp D Glutamic Acid Glu E Lysine Lys K Arginine Arg R Histidine Tyrosine Tyr Y Cysteine ​​Cys C Asparagine Asn N Glutamine Gln Q Serine Ser S Threonine Thr T Glycine Gly G Alanine Ala A Val V Leucine Leu L Isoleucine Ile I Methionine Met M Proline Pro P Phenylalanine Phe F Tryptophan Trp W

[0048] The term "amino acid" as used herein includes both natural and synthetic amino acids and both D and L amino acids. "Standard amino acid" refers to any of the 20 standard L-amino acids commonly found in natural proteins / peptides. "Non-standard amino acid residue" refers to any amino acid other than the standard amino acids, whether synthetically prepared or naturally occurring. As used herein, "synthetic amino acid" encompasses chemically modified amino acids, including but not limited to salts, amino acid derivatives (such as amides) and substitutions. Amino acids contained within the peptides of the present disclosure, and particularly at the carboxy or amino termini, may be modified by methylation, amidation, acetylation or substitution with other chemical groups that may alter the circulating half-life of the peptide without adversely affecting activity. Additionally, disulfide bonds may or may not be present in the peptide.

[0049] Amino acids can be classified into seven groups based on the side chain R: (1) aliphatic side chains; (2) side chains containing a hydroxyl (OH) group; (3) side chains containing a sulfur atom; (4) side chains containing an acidic or amide group; (5) side chains containing a basic group; (6) side chains containing an aromatic ring; and (7) proline, an imino acid in which the side chain is fused to the amino group.

[0050] As used herein, the term "conservative amino acid substitution" is defined herein as an exchange within one of the following five groups: I. Small aliphatic, non-polar or slightly polar residues: Ala, Ser, Thr, Pro, Gly; II. Polar, negatively charged residues and their amides: Asp, Asn, Glu, Gin; III. Polar, positively charged residues: His, Arg, Lys; IV. Large aliphatic, non-polar residues: Met, Leu, He, Val, Cys (Ile; autocorrect does not literate) V. Large aromatic residues: Phe, Tyr, Tip (also Trp)

[0051] The present disclosure employs, unless otherwise provided, conventional techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics and recombinant DNA, which are within the skill of the art. Sambrook, Fritsch and Maniatis, MOLECULAR CLONING: A LABORATORY MANUAL, 2nd edition (1989); CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (FMAusubel, et al. eds. (1987)); Series METHODS IN ENZYMOLOGY (Academic Press, Inc.): PCR 2: A PRACTICAL See APPROACH (MJ MacPherson, BD Hames and GRTaylor eds. (1995)), Harlow and Lane, eds. (1988) ANTIBODIES, A LABORATORY MANUAL, and ANIMAL CELL CULTURE (RIFreshney, ed. (1987)).

[0052] vector A gene expression vector (DNA-based or viral) is used to express the fusion integrase in cells or tissues and provide the DNA sequence (or gene) of interest with the appropriate site required for the integrase or recombinase to integrate the DNA (or gene) of interest into the genome of the host species or cell. Many gene expression vectors are known in the art. The vector is used for the gene (or DNA sequence) of interest. Many restriction enzymes known in the art can be used to cut the vector.

[0053] CRISPR / CAS9 CRISPR / Cas9 is described in US Pat. Nos. 8,697,359, 8,889,356 and Ran et al (Nature Protocols, 2013, volume 8, pages 2281-2308). The Cas9 protein utilizes an RNA guide to bind to a specific sequence of DNA in the genome. The RNA guide (guide RNA) can be designed to be 10-40, 12-35, 15-30 or e.g. 18-22 or 20 nucleotides long. See Hsu et al, Nature Biotechnology, September 2013, volume 31, pages 827-832, which uses Cas9 from Streptococcus pyogenes. Another important Cas9 is from Staphylococcus Aureus (a smaller Cas9 than S. pyogenes). The Cas9 protein uses a guide RNA to bind to a specific region of a DNA sequence.

[0054] A catalytically inactive form of Cas9 is described in Guilinger et al, Fusion of catalytically inactive Cas9 to FokI nuclease improves the specificity of genome modification, Nature Biotechnology, April 25, 2014, volume 32, pages 577-582. Guilinger et al. linked catalytically inactive Cas9 to the FokI enzyme to achieve greater specificity in cleaving in genomic DNA. This catalytically inactive Cas9 allows Cas9 to use RNA guides for binding to genomic DNA while at the same time it is unable to cleave this DNA.

[0055] Cas9 is available in its native wt form and also in a human optimized codon form for better expression of Cas9 constructs in cells (see Mali et al, Science, 2013, volume 339, pages 823-826). Codon optimization of Cas9 can be performed depending on the species for its expression. Depending on whether a protein form or a nucleotide expression vector form of the integrase / Cas9 fusion protein (also known as ABBIE1) is being generated, an optimized or non-optimized (wt) form can be used.

[0056] RNA guides to specific DNA sequences can be designed by a variety of computer-based tools.

[0057] CRISPR / CPF1 Cpf1 is another protein that uses guide RNA to bind to specific sequences in genomic DNA. Cpf1 also cleaves DNA into staggered cuts. Cpf1 can be made catalytically inactive for cleavage.

[0058] Other CRISPR proteins These are proteins that utilize guide RNAs to target specific DNA sequences and whether they have DNA cleavage capacity or not. Some of these proteins may naturally have other enzymatic / catalytic functions.

[0059] TALEN Transcription activator-like effector nucleases (TALENs) are fusion proteins with restriction enzymes that are created by fusing TAL effector DNA binding domains to DNA cleavage domains. These reagents are efficient and programmable, allowing specific DNA cleavage, making them powerful tools for in situ genome editing. Transcription activator-like effectors (TALEs) can be rapidly modified to actually bind to any DNA sequence. The term TALEN as used herein broadly includes monomeric TALENs that can cleave double-stranded DNA without assistance from another TALEN. The term TALEN is also used to refer to one or both members of a pair of TALENs that are modified to act together to cleave DNA at the same site. TALENs that act together can be called left-TALENs and right-TALENs, which refers to the stiffness of the DNA. See U.S. Patent No. 8,440,432.

[0060] TAL effectors are proteins secreted by Xanthomonas bacteria. The DNA-binding domain contains a 33-34 amino acid sequence that is highly conserved, except for the 12th and 13th amino acids. These two positions are highly variable (Repeat Variable Diresidues (RVD)) and show a strong correlation with specific nucleotide recognition. This simple relationship between amino acid sequence and DNA recognition allows the engineering of specific DNA-binding domains by selecting combinations of repeat segments containing appropriate RVDs.

[0061] Integrases or recombinases may be used to construct hybrid integrases or recombinases that are active in yeast or cell assays. These reagents are also active in plant and animal cells. TALEN studies used wild-type Fok1 cleavage domains, but some subsequent TALEN studies have also used Fok1 cleavage domain mutants with mutations designed to improve cleavage specificity and cleavage activity. Both the number of amino acid residues between the TALEN DNA binding domain and the integrase or recombinase domain and the number of bases between two individual TALEN binding sites are parameters for achieving high levels of activity. The number of amino acid residues between the TALEN DNA binding domain and the integrase or recombinase domain can be modified by the introduction of a spacer (separate from the spacer sequence) between the multiple TAL effector repeat sequences and the integrase or recombinase domain. The spacer sequence can be 6-102 or 9-30 nucleotides or 15-21 nucleotides. These spacers usually provide no other activity to the hybrid protein other than providing a link between the DNA targeting protein (Cas9, TALE or zinc finger protein) and the integrase or recombinase. Spacer amino acids for this disclosure and other uses.

[0062] The relationship between the amino acid sequence of the TALEN binding domain and DNA recognition allows for proteins that can be expressed. In this case, artificial gene synthesis is problematic due to the inappropriate annealing of the repeated sequences found in the TALE binding domain. One solution to this is to use a public software program named DNAWorks to find suitable oligonucleotides for assembly in a two-step PCR; oligonucleotide assembly and subsequent whole gene amplification. Many modular assembly methods for generating modified TALE constructs have also been reported in the art.

[0063] Once TALEN genes are assembled together, they are inserted into a plasmid, and then the plasmid is used to transfect target cells, which express the gene product, and then the target cells are translocated to the nucleus and reach the genome.TALEN can be used to edit genomes by inducing double-strand breaks (DSBs), and the cells respond to DNA repair, but this disclosure aims to use the power of viral integrase or bacterial or phage recombinase to insert DNA sequences of interest into targeted sites in genomes.See the disclosures of WO2014134412 and US8748134.

[0064] Zinc Finger Proteins Zinc finger proteins and their design for DNA binding are described in U.S. Patent No. 7,928,195, U.S. Patent Application Publication No. 2009 / 0111188 and U.S. Patent No. 7,951,925. Zinc finger proteins utilize several linked zinc finger domains in a specified order to bind to a specific sequence of DNA. Zinc finger protein endonucleases are well established.

[0065] Zinc finger proteins (ZFPs) are proteins that can bind to DNA in a sequence-specific manner. Zinc fingers were first identified in the transcription factor TFIIIA from oocytes of the African clawed frog, Xenopus laevis. The single zinc finger domain of this class of ZFPs is approximately 30 amino acids long, and several structural studies have revealed that it contains a beta turn (containing two conserved cysteine ​​residues) and an alpha helix (containing two conserved histidine residues) that is held in a specific conformation through the coordination of a zinc atom by the two cysteines and two histidines. This class of ZFPs is also known as C2H2 ZFPs. Additional classes of ZFPs have also been suggested. See, for example, Jiang et al. (1996) J. Biol. Chem. 271:10723-10730 for a discussion of Cys-Cys-His-Cys (C3H) ZFPs. To date, over 10,000 zinc finger sequences have been identified in thousands of known or putative transcription factors. Zinc finger domains are involved not only in DNA recognition but also in RNA binding and protein-protein binding. It is currently estimated that this class of molecules represents approximately 2% of all human genes.

[0066] Many zinc finger proteins have conserved cysteine ​​and histidine residues that tetrahedral coordinate one zinc atom in each finger domain. In particular, most ZFPs feature a finger component with the general sequence: -Cys-(X)2-4-Cys-(X)12-His-(X)3-5-His- (SEQ ID NO: 49, where X corresponds to any amino acid (C2H2 ZFP)). This most widely represented zinc-coordinating sequence contains two cysteines and two histidines with specific spacing. The folded structure of each finger contains an antiparallel β-turn, a fingertip region and a short amphipathic α-helix. The metal-coordinating ligand binds to the zinc ion, and in the case of zif268-type zinc fingers, the short amphipathic α-helix binds to the major groove of DNA. Furthermore, the structure of a zinc finger is stabilized by certain conserved hydrophobic amino acid residues (e.g., the residue immediately preceding the first conserved Cys and the residue at position +4 of the helical segment of the finger) and by zinc coordination through conserved cysteine ​​and histidine residues.

[0067] Other DNA-binding proteins capable of binding to specific target sequences in genomic DNA The proteins include zinc finger proteins, TALEN and CRISPR proteins that can bind to specific sequences in the genomic DNA of various organisms. These can include transcription factors, transcription repressors, meganucleases, endonuclease DNA binding domains, etc.

[0068] Integrase Integrases and their endonuclease fusion proteins are described in US Patent Application Publication No. 2009 / 0011509. The integrases introduced are lentiviral integrase and HIV1 (human immunodeficiency virus 1) integrase. The present disclosure fuses catalytically incompetent (or catalytically active) Cas9, TALE or zinc finger proteins to the integrase to target the integrase to a specific region of DNA in the genome selected by the user.

[0069] Like other retroviral integrases, HIV-1 integrase is able to recognize special properties of the viral DNA ends located in the U3 and U5 regions of the long terminal repeat (LTR) (Brown, 1997). The LTR ends are the only viral sequences that appear to be required in cis for recognition by the retroviral integration machinery. Short imperfect inverted repeats are present at the outer edges of the LTR in both murine and avian retroviruses (reviewed by Reicin et al., 1995). Together with the subterminal CA located at positions 3 and 4 on the outermost retroviral DNA ends (positions 1 and 2 are the 3'-end processing nucleotides), these sequences are necessary and sufficient for accurate proviral integration in vitro and in vivo. Sequences internal to the CA dinucleotide appear to be important for optimal integrase activity (Brin & Leis, 2002a; Brin & Leis, 2002b; Brown, 1997). The terminal 15 bp of the HIV-1 LTR have been shown to be critical for accurate 3'-end processing and strand transfer reactions in vitro (Reicin et al., 1995; Brown, 1997). Longer substrates are used more efficiently than shorter ones by HIV-1 IN showing that the binding interaction extends inward from the viral DNA ends by at least 14-21 bp. Brin & Leis (2002a) analyzed the specific properties of the HIV-1 LTR and found that U5 We conclude that both the U3 and U5 LTR recognition sequences are required for IN-catalyzed coordinated DNA integration, even though the LTR is a more efficient substrate for IN processing in vitro (Bushman & Craigie, 1991; Sherman et al., 1992). Although positions 17-20 of the IN recognition sequence are required for the coordinated DNA integration mechanism, HIV-1 IN tolerates considerable variation in both the U3 and U5 ends extending from an invariant subterminal CA dinucleotide (Brin & Leis, 2002b).The present disclosure includes DNA vectors that contain viral (retroviral or HIV) LTR regions at the 5' and 3' ends in positions to accommodate the DNA sequence or gene of interest to be integrated into the genome. The LTR regions do not need to be full-length LTRs, as long as they function to interact with integrase for accurate integration. The LTR regions can be modified to contain detectable (e.g., fluorescent) PCR detection or selectable markers (e.g., antibiotic resistance). The vectors are designed to be cut and linearized (via engineered restriction sites for restriction endonucleases) so that the LTR regions are the 5' and 3' ends of the DNA fragment.

[0070] Integrase consists of three domains linked by a flexible linker. These domains are the N-terminal HH-CC zinc-binding domain, the catalytic core domain and the C-terminal DNA-binding domain (Lodi et al, Biochemistry, 1995, volume 34, pages 9826-9833). In some embodiments of the present disclosure, the integrase bound to Cas9 (or other DNA-binding molecule) does not have a C-terminal binding domain. In some embodiments of the present disclosure, two different fusion proteins are made, one with a catalytically inactive Cas9 (or a TALE or zinc finger protein) fused to the N-terminal zinc-binding domain of integrase, and the other with a catalytically inactive Cas9 (or a TALE or zinc finger protein) fused to the catalytic core domain of integrase. The two different fusion proteins are designed to bind to opposite strands of genomic DNA, as seen in the TALE-Fok1 or zinc finger-Fok1 systems. Thus, when the N-terminal domain and the catalytic core contact at a site on genomic DNA, it exhibits integrase activity. It has also been observed that full integrase activity involves a tetramer of integrase, so fusion proteins can be designed with one, two, three, or four integrase proteins linked by flexible linkers that can be 1-20 amino acids or 4-12 amino acids long.

[0071] Recombinase Recombinases, including Cre, Flp, R, Dre, Kw and Gin recombinase, are described in US Patent No. 8816153 and US Patent Publication No. 2004 / 0003420. Recombinases, such as Cre recombinase, use LoxP sites to excise sequences from genomes. Recombinases can be modified to be constitutively active and also less site specific for their recombination activity. Thus, it is possible to target such constitutively active recombinase proteins that have no sequence specificity for specific sequences of DNA in genomes by incorporating them into the fusion proteins of the present disclosure. Thus, the CRISPR / Cas9, TALE or zinc finger protein domains specify the DNA sequence that the recombinase contributes to its recombination activity. Such recombinase proteins can be wild type, constitutively active, or inactive for recombinase activity. Cas9-recombinases such as Cas9-Gin or Cas9-Cre can be generated using linker sequences or by direct fusion.

[0072] Nuclear localization signal sequence (NLS) for the fusion protein Signal peptide domains (also referred to as "NLS") are derived, for example, from yeast GAL4, SKI3, L29 or histone H2B proteins, polyomavirus large T protein, VP1 or VP2 capsid protein, SV40 VP1 or VP2 capsid protein, adenovirus E1a or DBP protein, influenza virus NS1 protein, hepatitis virus core antigen or mammalian lamins, c-myc, max, c-myb, p53, c-erbA, jun, Tax, steroid receptor or Mx proteins (see Boulikas, Crit. Rev. Eucar. Gene Expression, 3, 193-227 (1993)), simian virus 40 ("SV40") T-antigen (Kalderon et al, Cell, 39, 499-509 (1984)), or other proteins with known nuclear localization. The NLS can be, for example, from the SV40 T-antigen, but can be other NLS sequences known in the art. Tandem NLS sequences can be used.

[0073] Linker Region The various linkers used between the synthesized fusion proteins / peptides are composed of amino acids. At the DNA level, they are represented by 3 base pair (bp) codons as known in the genetic code. The linkers can be 1-1000 amino acids long and any integer in between. For example, the linker is 1-200 amino acids long or the linker is 1-20 amino acids long.

[0074] Expression vector Many nucleic acids can be introduced into cells to effect expression of genes. As used herein, the term nucleic acid includes DNA, RNA, and nucleic acid analogs and nucleic acids that are double-stranded or single-stranded (i.e., sense or antisense single stranded). For example, nucleic acid analogs can be modified at the base moiety, sugar moiety, or phosphate backbone to improve the stability, hybridization, or solubility of the nucleic acid. Modifications at the base moiety include deoxyuridine for deoxythymidine and 5-methyl-2'deoxycytidine and 5-bromo-2'-doxycytidine for deoxycytidine. Modifications at the sugar moiety include modification of the 2' hydroxyl of the ribose sugar to form 2'-O-methyl or 2'-O-allyl sugars. The deoxyribose phosphate backbone can be modified to generate morpholino nucleic acids in which each base moiety is linked to a six-membered morpholino ring, or peptide nucleic acids in which the deoxyphosphate backbone is replaced by a pseudopeptide backbone and four bases are retained. See Summerton and Weller (1997) Antisense Nucleic Acid Drug Dev. 7(3):187; and Hyrup et al. (1996) Bioorgan. Med. Chem. 4:5. In addition, the deoxyphosphate backbone can be replaced with, for example, a phosphorothioate or phosphorodithioate backbone, a phosphoramidite or an alkyl phosphotriester backbone. The nucleic acid sequence can be operably linked to a control region, such as a promoter. The control region can be from any species. As used herein, operably linked refers to the placement of the control region relative to the nucleic acid sequence to allow or promote the transcription of the target nucleic acid. Any type of promoter can be operably linked to the nucleic acid sequence. Examples of promoters include, but are not limited to, tissue-specific promoters, constitutive promoters, and promoters that are responsive or unresponsive to a particular stimulus (e.g., inducible promoters).

[0075] Additional regions that may be useful in nucleic acid constructs include, but are not limited to, polyadenylation sequences, translational regulatory sequences (e.g., internal ribosome entry segments, IRES), enhancers, inducible elements, or introns. Such control regions may not be necessary, but they may increase expression by affecting mRNA transcription, stability, translation efficiency, etc. Such control regions may be included in nucleic acid constructs as necessary to obtain optimal expression of nucleic acid in cells. Sufficient expression may be obtained without such additional elements.

[0076] Nucleic acid constructs encoding signal peptides or selectable markers may be used. Signaling (marker) peptides may be used to direct the encoded polypeptide to a specific cellular location (e.g., cell surface). Non-limiting examples of such selectable markers include puromycin, ganciclovir, adenosine deaminase (ADA), aminoglycoside phosphotransferase (neo, G418, APH), dihydrofolate reductase (DHFR), hygromycin-B-phosphotransferase, thymidine kinase (TK) and xanthine-guanine phosphoribosyltransferase (XGPRT). These markers are useful for selecting stable transformants in culture. Other selectable markers include fluorescent polypeptides, such as green fluorescent protein, red fluorescent protein or yellow fluorescent protein.

[0077] Nucleic acid constructs can be introduced into any type of cell using various biological techniques known in the art.Non-limiting examples of these techniques include the use of transposon systems, recombinant viruses or liposomes that can infect cells, or other non-viral methods that can deliver nucleic acid to cells, such as electroporation, microinjection, or calcium phosphate precipitation.A system called Nucleofection™ can also be used.

[0078] Nucleic acid can be incorporated into vector.Vector is a broad term that includes any specific DNA segment that is designed to move from carrier to target DNA.Vector can be called expression vector or vector system, which is a set of components required to insert DNA into genome or other targeting DNA sequence, such as episome, plasmid or even virus / phage DNA segment.Vector contains one or more expression cassettes that contain one or more expression control sequences, where expression control sequences are DNA sequences that regulate and control the transcription and / or translation of another DNA sequence or mRNA, respectively.

[0079] Many different types of vectors are known in the art. For example, plasmids and viral vectors, including retroviral vectors, are known. Mammalian expression plasmids generally have a replication origin, a suitable promoter and any enhancer, and also any necessary ribosome binding site, polyadenylation site, splice donor and acceptor sites, transcription termination sequence and 5' flanking non-transcriptional sequence. Such vectors include plasmids (which can also be carriers of other types of vectors), adenoviruses, adeno-associated viruses (AAV), lentiviruses (e.g., modified HIV-1, SIV or FIV), retroviruses (e.g., ASV, ALV or MoMLV) and transposons (P-element, Tol-2, Frog Prince, piggyBac, etc.).

[0080] Bacterial and viral genes and proteins for use in this disclosure are listed below in the section entitled "Sequences of the Disclosure." Other viral integrases, such as those from mouse mammary tumor virus (MMTV) and adenovirus, may also be used in the methods and compositions disclosed herein.

[0081] The pooled population of edited cells can be thought of as a mixture of cells that have undergone gene editing and cells that have not.

[0082] Representative ABBIE1 in vitro assay 1) incubating ABBIE1 protein with guide RNA; 2) incubating ABBIE1 / guide RNA with donor DNA having a partial LTR to form a preinitiation complex; 3) incubating the preinitiation complex with a plasmid containing the gene to be edited (e.g., CXCR4); and 4) Confirm donor DNA integration by PCR and DNA sequencing.

[0083] Cas9 protocols are described, for example, in Gagnon et al., 2014, http: / / labs.mcb.harvard.edu / schier / VertEmbryo / Cas9_Protocols.pdf.

[0084] Assays for integrase activity are described, for example, in Merkel et al., Methods, 2009, volume 47, pages 243-248. EXAMPLES

[0085] The following examples are intended to provide illustrations of the application of the present disclosure.The following examples do not completely define or limit the scope of the present disclosure.It is obvious to those skilled in the art that many other methods known in the art can be substituted for those specifically described or referenced herein.

[0086] Example 1: DNA vector for expressing Cas9-integrase fusion protein The DNA sequence of catalytically inactive Cas9 is incorporated into the expression vector using a 12, 15, 18, 21, 24, 27 or 30 bp spacer (encoding 4, 5, 6, 7, 8, 9 or 10 amino acids as a linker between Cas9 and integrase) and HIV1 integrase. In other experiments, recombinases of bacterial or phage origin are used rather than integrase. These include Hin recombinase (SEQ ID NO: 25) and Cre recombinase (SEQ ID NO: 26) with or without mutations that allow DNA recombination at any other site. His or cMyc tags (or other sequences useful for protein purification) may be included to isolate the fusion protein. The expression vector uses a promoter that is activated in the cells provided with the vector. The CMV (cytomegalovirus promoter) is commonly used for expression vectors for mammalian cells. The U6 promoter is also commonly used. The T7 promoter may be used for in vitro transcription in certain embodiments.

[0087] Example 2: DNA Vectors for the Expression of a DNA Sequence of Interest (Gene of Interest) The DNA sequence of interest is inserted into a suitable expression vector, and a site is appropriately added to the DNA sequence of interest, which HIV1 integrase recognizes for integration into the genome. These sites are called att sites (U5 and U3 att sites) (see Masuda et al, Journal of Virology, 1998, volume 72, pages 8396-8402). Homologous arms to target sites in the genome can be included in the regions adjacent to the 5' and 3' ends of the DNA (gene) sequence of interest (see Ishii et al, PLOS ONE, September 24, 2014, DOI: 10.1371 / journal.pone.0108236). When using recombinase, integrase recognition sites may not be included. Markers such as drug resistance markers (e.g., blasticidin or puromycin) are included to check for insertion of the DNA sequence of interest and to aid in assaying for random insertion in the genome. These resistance markers can be modified to remove them from the targeted genome landing pad, for example flanking the puromycin resistance gene with LoxP sites and introduction of an exogenously expressed CRE removes the scarring internal sequence containing the LoxP sites.

[0088] Example 3: DNA vector for expression of reverse transcriptase Reverse transcriptase can also be co-expressed in systems where a designed DNA sequence (gene) of interest in a vector is expressed as RNA and must be converted back into DNA for integration by the integrase enzyme. The reverse transcriptase can be of viral origin (e.g., retrovirus, such as HIV1). It can be integrated into the same vector as the DNA sequence of interest.

[0089] Example 4: Co-expression of a DNA-targeted integrase (or recombinase) with a DNA sequence of interest Cells were electroporated with the above vectors together with the required Cas9 RNA guide for the target site in the genome. In some experiments, vectors were made that express all of the components (fusion Cas9 / integrase (or recombinase), Cas9 RNA guide and DNA sequence of interest with integrase recognition site and with or without homology arms). Reverse transcriptase can also be co-expressed in systems where the designed DNA sequence of interest (gene) in the vector becomes expressed as RNA and must be converted back to DNA for integration by integrase enzyme. Reverse transcriptase can be of viral origin (e.g., retrovirus such as HIV1). In other experiments, DNA sequence of interest is linearized before introduction into cells. Cas9 RNA guide sequence and DNA sequence of interest must be designed and inserted into vector before use by standard molecular biology protocols.

[0090] Example 5: Pilot experiments and assays for off-target insertions The vector containing the gene of interest is used to transfect or electroporate cells in which expression of a particular gene is lost, such as mouse embryonic fibroblasts from a knockout mouse model or cells that have been genetically engineered to have a knockout on a certain gene. The first pool of edited cells is screened using a chimeric primer set designed to encompass the gene to be inserted and adjacent genomic sequences. Limiting dilution cloning (LDC) and or FACS analysis are then performed to ensure monoclonality. Next generation sequencing (NGS) or single nucleotide polymorphism (SNP) analysis is performed as a final quality control step to ensure that the isolated clones are uniform to the edit designed. Other mechanisms for screening may include, but are not limited to, qRT-PCR and Western blotting with appropriate antibodies. If the protein is associated with a certain phenotype of the cells, the cells may be examined for rescue of that phenotype. The genome of the cells is assayed for the specificity of the DNA insertion and to find the relative number of off-target insertions, if any.

[0091] Example 6: Cas9-linked integrase protein expression and isolation A vector designed for gene expression in E. coli or insect cells is introduced into E. coli or insect cells and expressed for a given time. Several designs are utilized to generate Cas9 (or inactive Cas9)-linked integrase protein. The vector also incorporates tags, including but not limited to His or cMyc tags, for the final isolation of the protein with high purity and yield. Preparation of chimeric proteins includes but is not limited to standard chromatographic techniques. Proteins can also be designed with one or more NLS (nuclear localization signal sequences) and / or TAT sequences. Nuclear localization signals allow the protein to be translocated to the nucleus. TAT sequences allow the protein to be more easily translocated into the cell (this is a cell-penetrating peptide). Other cell-penetrating peptides in the art can also be considered. After a sufficient time for expression, protein lysates are harvested from the cells and purified on an appropriate column, depending on the tag used. The purified protein is then placed in an appropriate buffer solution and stored at either -20 or -80°C.

[0092] Example 7: Use of Cas9-integrase to incorporate a stop codon directly upstream of the transcription start site The present disclosure includes a method for making knockout cell lines or organisms. The above system is used with the DNA sequence of interest, in which 1, 3, 6, 10, 15 or 20 consecutive stop codons are placed immediately after the ATG start site for the target gene. This creates an effective gene knockout, since transcription / translation stops when the stop codon immediately after the ATG start site is reached. The additional stop codons help prevent possible run-through of transcriptase (when transcriptase bypasses the first stop codon).

[0093] Example 8: Use of ABBIE1 (or other variants with specific DNA-binding domains) as purified proteins to edit the genome of cells Incubate Abbie1 isolated protein (or other specific DNA sequence binding protein linked to retroviral integrase) with insertable / integrable DNA with viral LTR region in appropriate buffer (for the formation of tetramer or other multimer depending on the case). Alternatively, a pre-made composition of isolated Abbie1 protein with guide RNA can be combined with insertable DNA sequence. Include guide RNA and incubate to integrate guide RNA. Transfect or electroporate Abbie1 / DNA preparation into cells (or other technique to provide protein to cells). Take into account the time that genome / DNA editing will be performed. Check for insertion of designed insertable DNA sequence into specific site of genomic DNA of cells. Check for non-specific insertion by PCR and DNA sequencing.

[0094] In the current plan, the bacterial expression vector is pMAL-c5e, a discontinued product from NEB and one of the in-house cloning options for Genscript. We will clone the codon-optimized Spy Cas9 with a his-tag and TEV protease cleavage site in frame with a maltose-binding protein (MBP) tag. The ORF is under an inducible Tac promoter, and the vector also encodes a lac repressor (LacI) for tighter control. We will only use MBP as a stabilization tag, not a purification tag, because amylose resin is very expensive. We will purify the soluble expressed material on Ni-affinity chromatography, then release Cas9 by TEV protease from MBP, purify by cation exchange chromatography, and further purify by gel filtration.

[0095] Example 9: Design of constructs for fusion proteins Design sequence-specific zinc finger domains, TALEs or guide RNAs for CRISPR-based approaches to target DNA sequences. Use online design software of choice.

[0096] DNA constructs are made with coding sequences for an integrase, transposase or recombinase to form a site-specific fusion integrase protein; a suitable amino acid linker; a suitable zinc finger, TALE or CRISPR protein (e.g., Cas9, Cpf1); and a nuclear localization signal (or mitochondrial localization signal). These are envisioned in multiple configurations. If necessary, suitable tags can be included for protein isolation and purification (e.g., maltose binding protein (MBP) or His tag).

[0097] The DNA constructs may utilize mammalian or bacterial promoters common in the art (eg, CMV, T7, etc.).

[0098] Recombinant fusion proteins can be produced using E. coli as a source. Proteins are isolated by standard means in the art (e.g., MBP columns, nickel-sepharose columns, etc.).

[0099] Assemble the donor-RNP complex (double strand the RNA oligo and mix with the fusion protein of the invention (if the fusion protein has an endonuclease-inactive CRISPR associated protein for its DNA binding ability, e.g. ABBIE1) - these steps of RNP formation are not required in the case of zinc finger domains and TALEs. 1. Mix donor DNA with the appropriate LTR domain and insertable sequence and fusion protein and incubate for 10 minutes (alternatively, add donor DNA after RNP complex formation). 2. Suspend each RNA oligo (crRNA and tracrRNA) in nuclease-free IDTE buffer. For example, use a final concentration of 100 μM. 3. Mix the two RNA oligos in equimolar concentrations in a sterile microcentrifuge tube for a final duplex concentration of 3 μM, for example using the following table: component amounts 3 μL 100 μM crRNA, 3 μL 100 μM tracrRNA, 94 μL Nuclease-free duplex buffer, final volume 100 μL. 4. Heat at 95°C for 5 minutes. 5. Remove from heat and cool on tabletop to room temperature (15-25°C). 6. If necessary, dilute the double-stranded RNA to a working concentration (e.g., 3 μM) in nuclease-free duplex buffer. 7. Dilute the fusion protein to a working concentration (e.g., 5 µM) in working buffer (20 mM HEPES, 150 mM KCl, 5% glycerol, 1 mM DTT, pH 7.5). 8. For each transfection, combine 1.5 pmol of double-stranded RNA oligo (step A5) with 1.5 pmol of fusion protein (step A6) in Opti-MEM medium to a final volume of 12.5 μL. 9. Incubate at room temperature for 5 minutes to allow the RNP complex to assemble.

[0100] Example 10: Reverse transfection of GRNA-fusion proteins in 96-well plates. 1. Incubate the following for 20 minutes at room temperature to form transfection complexes: Component quantities RNP (Step A8) 12.5 μL Lipofectamine® RNAiMAX Transfection Reagent, 1.2 μL Opti-MEM® Medium 11.3 μL Total volume 25.0 μL. 2. During incubation (step B1), the cultured cells are diluted to 400,000 cells / mL using complete medium without antibiotics. 3. Once incubation is complete, add 25 μL of transfection complex (from step B1) to a 96-well tissue culture plate. 4. Add 125 μL of diluted cells (from step B2) to 96-well tissue culture plates (50,000 cells / well, final RNP concentration will be 10 nM). 5. Incubate the plates containing the transfection complexes and cells for 48 hours in a tissue culture incubator (37° C., 5% CO2). To detect on-target mutations, PCR is used with appropriate primers (primers within the donor sequence and primers surrounding the target insertion site).

[0101] Example 11: Protocol for testing the specificity of CRISPR / CAS9 Create dCas9 (DNA-cleaving inactive Cas9) linked to biotin (dCas9-biotin). Cas9 (S. pyogenes, S. aureus, etc.). Biotinylation methods are described below.

[0102] Biotinylation Method #1: Engineer an avi tag (approximately 15 residues) at the N- or C-terminus and express and purify as WT (untagged) protein. Use E. coli biotin ligase (BirA) and biotin to biotinylate the avi-tagged Cas9. We have used this scheme to biotinylate chemokines. We believe that the IP on avi-tag technology expired several years ago.

[0103] Biotinylation method #2.1: Biotin functionality with succinimidyl-ester can be incorporated at surface-exposed lysine residues (no enzymatic reaction required). This may be a viable option for proteins as large as Cas9.

[0104] Biotinylation Method #2.2: Similarly, biotin-maleimides are commercially available and these can be conjugated at surface exposed cysteines (without enzyme).

[0105] Studies are performed to characterize what biotinylated Cas9 does with respect to DNA-binding and cleavage.

[0106] Streptavidin coated 96 well plates are commercially available or can be made in-house.

[0107] Bind dCas9-biotin to a plastic plate (96-well, 24-well, 384-well, etc.).

[0108] Provide each well with a designed guide RNA, allowing time for the guide RNA to interact with the Cas9 protein.

[0109] Provide genomic DNA or DNA with the sequence to be targeted to each well. Allow time for Cas9 binding to the DNA.

[0110] The wells are washed with an appropriate buffer.

[0111] Provide the adaptor (DNA oligomer). Allow time for binding.

[0112] The genomic DNA is restriction digested to make it easier to handle and to ligate adapters.

[0113] Washing the wells Perform DNA sequencing to identify binding sites (on-target vs. off-target).

[0114] Example 12: ABBIE1-mediated NRF2 editing Figure 5 shows Abbie1 gene editing targeting exon 2 of Nrf2 with guide NrF2-sgRNA2 and sgRNA3. PCR screening for Abbie1 editing-mediated knockout against exon 2 targeted Nrf2 locus. Abbie1 transfection targeting exon 2 of Nrf2 with guide NrF2-sgRNA2 and 3 showed donor integration at the targeted region. Unique bands are labeled 1-8.

[0115] Figure 6 shows theoretical data generated by Abbie1 gene editing. Representative example of DNA gel electrophoresis visualizing donor DNA insertion via the Abbie1 system for targeting genomic material with sgRNA1-3. Black bands correspond to background products resulting from PCR. Red bands correspond to unique products generated by amplifying the insert and genetic material flanking the inserted region. Multiple bands correspond to possible multiple insertions in the targeted region.

[0116] Figure 7 shows Abbie1 gene editing targeting exon 2 of Nrf2 using guide Nrf2-sgRNA3. PCR screening for Abbie1 editing mediated knockout against exon 2 targeted Nrf2 locus. Exon 2 targeting of Nrf2 using guide NrF2-sgRNA3 suggested donor insertion as indicated by PCR primers designed against the donor sequence and adjacent sites of the expected insertion. Unique bands are labeled 1-4.

[0117] Figure 8 shows Abbie1 knockout of Nrf2 in pooled Hek293T-cells. (A) Western blot analysis using a polyclonal antibody against the 55 kD isoform (Santa Cruz Bio) showing knockout of Nrf2 in pooled HEK293T populations. (B) GAPDH (Santa Cruz Bio) loading control.

[0118] Figure 9 shows Abbie1 knockout of Nrf2 in pooled Hek293T-cells. (A) Western blot analysis using a monoclonal antibody against Nrf2 (Abcam) showing knockout of Nrf2 pooled population in HEK293T-cells. (B) GAPDH loading control. (C) Mean densitometric analysis showing reduced expression ratio compared to control.

[0119] Abbie1-treated cells give rise to a unique PCR band indicative of integration of donor DNA. Phenotypic confirmation of the knockout in pooled HEK293T cell lines was confirmed via Western blot analysis probing the two isoforms with specific and distinct antibodies. Approximately 80% knockout by integration was observed in the pooled population in less than 2 weeks.

[0120] Example 13: ABBIE1-mediated CXCR4 editing Figure 10 shows Abbie1 gene editing targeting CXCR4 exon 2. PCR screens for targeting of exon 2 of CXCR4 edited via Abbie1. Four sets of primers were designed for the region of interest. Sets 2 and 4 would generate unique bands suggesting integration of donor DNA in the region of interest.

[0121] Example 14: Transfection for knock-in experiments at the NRF2 locus with ABBIE1 NOTE: Use 500ng protein and 120ng sgRNA per reaction. The amount of DNA depends on the size of the donor construct. Donor DNA (DNA with LTR sequences) can be incubated with ABBIE1 before, during or after donation / transfection / electroporation into cells. All reactions are prepared in a sterile biosafety cabinet.

[0122] Day 1: Human Embryonic Kidney (HEK293T) cells were seeded in 24-well culture plates (Corning) at 200,000 HEK293T-cells (ATCC) / well in 500 μL DMEM (Gibco) supplemented with 10% fetal sheep serum (Omega Scientific). Cells were allowed to recover for 24 h.

[0123] Day 2: ABBIE1 preparation: Tube 1: Purified ABBIE1 protein (SEQ ID NO:58) and donor DNA (SEQ ID NO:101) in serum-reduced transfection medium (OptiMEM, Life Technologies) at a 1:1 molar ratio for 10 minutes at room temperature. sgRNA is added to the protein / DNA complex to a 1.3-fold molar excess (approximately 120 ng) and incubation is continued for another 10 minutes at room temperature. The volume of this mixture is 25 μL.

[0124] Tube 2: 2 μL of transfection reagent (RNAiMAX, Life Technologies) was added to 23 μL of OptiMEM. Incubated at room temperature for 10 minutes.

[0125] Tube 1 and tube 2 (50 mL final volume) were combined and incubated at room temperature for 15 minutes.

[0126] A total of 50 μL transfection mixture was added to the wells.

[0127] To verify genome DNA editing in the pooled population, half of the pooled edited cells were harvested 48 hours after transfection.Verification of edited genome was performed by polymerase chain reaction (PCR).We performed PCR on the targeted region as described below (see PCR protocol), and the remainder was seeded on a 6 cm culture dish (Corning) and allowed to recover for 48 hours.

[0128] Day 5: Screening for phenotypic changes via Western blotting Standard Western blot analysis was performed using primary antibodies targeting the 55 kD and 98 kD isoforms (Santa Cruz Biotechnology, sc-722 for the 55 kD isoform) (Abcam, ab-62352 for the 98 kD isoform) for NrF2 isoforms and GAPDH (Santa Cruz Biotechnology, sc-51907).

[0129] Example 15: PCR conditions for detection of gene editing using Abbie1 at the NRF2 and CXCR4 loci Accession number for human Nrf2 Uniprot:Q16236 Ensembl gene ID: ENSG00000116044

[0130] Editing the target sequence and PAM for Nrf2 (exon 2): Designs 1 to 3 were used for the sgRNA. GCGACGGAAAGAGTATGAGC TGG TATTTGACTTCAGTCAGCGA CGG TGGAGGCAAGATATAGATCTGG

[0131] Primer keys for detection of integration in Nrf2 targets Primer set 1: primer 1: 5'-GTGTTAATTTCAAACATCAGCAGC-3', primer 2: 5'-GACAAGACATCCTTGATTTG-3' Primer set 2: primer 1: 5'-GAGGTTGACTGTGTAAATG-3', primer 2: 5'-GATACCAGAGTCACACAACAG-3' Primer set 3: primer 1: 5'-TCTACATTAATTCTCTTGTGC-3', primer 2: 5'-GATACCAGAGTCACACAACAG-3'

[0132] Accession number for human CXCR4 Uniprot P61073 Ensembl gene ID: ENSG00000121966

[0133] Editing the target sequence and PAM for CXCR4 (exon 2): Design 1 was used for the sgRNA. GGGCAATGGATTGGTCATCC TGG

[0134] Primer key for detection of integration in CXCR4 target Primer set 1: primer 1: 5'-TCTACATTAATTCTCTTGTGC-3', primer 2: 5'-GACAAGACATCCTTGATTTG-3' Primer set 2: primer 1: 5'-TCTACATTAATTCTCTTGTGC-3', primer 2: 5'-GATACCAGAGTCACACAACAG-3' Primer set 3: primer 1: 5'-GAGGTTGACTGTGTAAATG-3', primer 2: 5'-GACAAGACATCCTTGATTTG-3' Primer set 4: primer 1: 5'-GAGGTTGACTGTGTAAATG-3', primer 2: 5'-GATACCAGAGTCACACAACAG-3' TIFF0007599740000001.tif81170

[0135] Avi-tagged Cas9 for biotinylation Sequence of the avi tag used for Cas9 biotinylation Amino acid sequence: TIFF0007599740000002.tif9170

[0136] Nucleic acid sequence: TIFF0007599740000003.tif17170

[0137] First underlined section = Cas9 C-terminus Italicized sections = restriction sites / linkers Second underlined section = avi tag (highlighting biotinylation site)

[0138] Example 16: Expression protocol for ABBIE1 fusion proteins Transformation of an expression construct containing the full-length fusion protein (SEQ ID NO:57). Remove competent E. coli cells from the -80°C freezer. Turn on the water bath and bring it to 42°C. Place the competent cells in a 1.5 mL tube (Eppendorf or similar). Use 50 μL of competent cells to carry out transformation of the DNA construct. Keep the tube on ice. Add 50 ng of circular DNA to E. coli cells. Incubate on ice for 10 minutes and freeze-thaw competent cells. Place the tube with DNA and E. coli in a 42°C water bath for 45 seconds. Place the tube back on ice for 2 minutes to reduce damage to the E. coli cells. Add 1 mL of LB (no antibiotics added). Incubate tubes at 37° C. for 1 hour (tubes can be incubated for 30 minutes). Spread approximately 100 µL of the resulting culture onto LB plates with the appropriate antibiotic. Pick colonies after approximately 12-16 h.

[0139] Inoculation and propagation Inoculate a 1 L flask containing LB and antibiotics. The bacterial culture is grown until it reaches 0.6 OD and then induced with isopropyl β-D-1-thiogalactopyranoside (IPTG) at 1 mM final concentration. Grow the culture for 6-8 hours and then centrifuge the suspension bacterial culture at a minimum of 2000 G force for 10 minutes. The pellets are frozen at -80°C for further processing later.

[0140] Protein preparation and purification All steps are carried out at room temperature.

[0141] Cells are lysed by two cycles of freeze-thaw in 20 mM Tris pH 8.0, 300 mM NaCl, 0.1 mg / ml hen egg white lysozyme. Centrifuge at 6,000 g for 15 minutes and retain the supernatant.

[0142] Load the supernatant onto a Ni-IDA agarose column equilibrated in 20 mM Tris pH 8.0, 300 mM sodium chloride. Elute the protein with a 0-200 mM gradient of imidazole. Identify fractions containing the fusion protein by 7% SDS-PAGE.

[0143] Fractions are pooled and diluted with 20 mM Tris pH 8.0 to a final NaCl concentration of 50 mM. Load onto a Q-Sepharose column and elute with a 0-500 mM gradient of sodium chloride. Identify fractions containing the fusion protein by 7% SDS-PAGE.

[0144] Fractions are pooled and diluted with 20 mM Tris pH 8.0 to a final NaCl concentration of 100 mM. Load onto an SP-Sepharose column and elute with a 0-500 mM gradient of sodium chloride. Identify fractions containing the fusion protein by 7% SDS-PAGE.

[0145] The fractions are pooled, the concentration is determined by its UV absorbance at 280 nm, and concentrated by centrifugal filters to a final concentration of 400 μg / ml. Glycerol is added to a final concentration of 50%. Store at -20°C.

[0146] While certain embodiments have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will occur to those skilled in the art without departing from the present disclosure. It is understood that various alternatives to the disclosed embodiments described herein may be used in the practice of the present disclosure. The following claims define the scope of the present disclosure, and it is intended that methods and structures within the scope of these claims and their equivalents be covered thereby.

[0147] Sequences of the present disclosure The following information is provided for each sequence provided below: sequence type (nucleic acid or amino acid), origin (eg, E. coli), length and identification number (where available).

[0148] The first polynucleotide of the present disclosure may code, for example, Cas9, Cpf1, TALE or ZnFn protein. The second polynucleotide of the present disclosure may code, for example, integrase, transposase or recombinase. Listed below are representative first and second polynucleotide sequences and protein sequences that can be used in the compositions (constructs, fusion proteins) and methods described herein, along with representative linker sequences. In the present disclosure, other polynucleotide sequences, protein sequences or linker sequences that are not listed in Table 1 below may be provided, but can be used in the compositions (constructs, fusion proteins) and methods described herein. For example, SEQ ID NO: 49, SEQ ID NO: 57, SEQ ID NO: 58 and / or parts thereof.

[0149] The linker can be of any length, for example, 3-300 nucleotides, 6-60 nucleotides, or any length that allows the first and second polynucleotides to be fused. The polypeptide can be produced by an organism, such as E. coli, or can be made synthetically, or a combination of both.

[0150] Representative nucleic acid sequences: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 27-47, 49, 55, 56, 57, 62, 64, 66, 68, 70, 79, 82 and 83.

[0151] Representative amino acid sequences: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 25, 26, 48, 50, 52, 58, 63, 65, 67, 69, 71, 72-78 and 80. TIFF0007599740000004.tif69170 TIFF0007599740000005.tif181170

[0152] Further sequences SEQ ID NO:1 Name: S. thermophilus Csn1 cds HQ712120.1 array: TIFF0007599740000006.tif151170 TIFF0007599740000007.tif233170 TIFF0007599740000008.tif216170

[0153] SEQ ID NO:2 array: TIFF0007599740000009.tif195170

[0154] SEQ ID NO:3 Name: P. multocida Cas9 array: TIFF0007599740000010.tif20170 TIFF0007599740000011.tif234170 TIFF0007599740000012.tif211170

[0155] SEQ ID NO:4 array: TIFF0007599740000013.tif149170

[0156] SEQ ID NO:5 Name: S. mutans Cas9 array: TIFF0007599740000014.tif64170 TIFF0007599740000015.tif234170 TIFF0007599740000016.tif234170 TIFF0007599740000017.tif60170

[0157] SEQ ID NO:6 array: TIFF0007599740000018.tif190170

[0158] SEQ ID NO:7 Name: N. meningitides Cas9 array: TIFF0007599740000019.tif179170 TIFF0007599740000020.tif234170 TIFF0007599740000021.tif60170

[0159] SEQ ID NO:8 array: TIFF0007599740000022.tif147170

[0160] SEQ ID NO:9 array: TIFF0007599740000023.tif223170 TIFF0007599740000024.tif237170 TIFF0007599740000025.tif142170

[0161] SEQ ID NO:10 Name: gi|777888062|gb|KJQ69483.1|CRISPR-associated endonuclease Cas9 [Streptococcus mitis] array: TIFF0007599740000026.tif195170

[0162] SEQ ID NO:11 array: TIFF0007599740000027.tif84170 TIFF0007599740000028.tif235170 TIFF0007599740000029.tif237170 TIFF0007599740000030.tif33170

[0163] SEQ ID NO:12 Name: gi|357584860|gb|EHJ52063.1|CRISPR-associated protein Cas9 / Csn1, subtype II / NMEMI [Streptococcus macacae NCTC11558] array: TIFF0007599740000031.tif188170

[0164] SEQ ID NO:13 array: TIFF0007599740000032.tif201170 TIFF0007599740000033.tif234170 TIFF0007599740000034.tif157170

[0165] SEQ ID NO:14 Name: gi|409693032|gb|AFV37892.1|CRISPR-associated protein, Csn1 family [Streptococcus pyogenes A20] array: TIFF0007599740000035.tif187170

[0166] SEQ ID NO:15 Name: gi|150381361|gb|EF472760.1|HIV-1 clone 39B from the USA integrase (pol) gene, partial cds array: TIFF0007599740000036.tif128170

[0167] SEQ ID NO:16 Name: gi|150381362|gb|ABR68182.1|Integrase, partial [human immunodeficiency virus 1] array: TIFF0007599740000037.tif46170

[0168] SEQ ID NO:17 Name: gi|459980|gb|L20651.1|STLKIAPOL simian T-cell lymphotropic virus type I integrase (pol) gene, partial cds array: TIFF0007599740000038.tif30170

[0169] SEQ ID NO:18 Name: gi|459981|gb|AAA47841.1|Integrase, partial [simian T-lymphotropic virus 1] array: LVERSNGILKTLLYKYFTDKPDLPMDNALSIALWTINHLNVLTHCH

[0170] SEQ ID NO:19 Name: gi|321156784:1-1509 Streptococcus pneumoniae integrative and conjugative element ICESpn11930, strain 11930 array: TIFF0007599740000039.tif194170 TIFF0007599740000040.tif127170

[0171] SEQ ID NO:20 Name: gi|321156785|emb|CBW38769.1|Integrase [Streptococcus pneumoniae] array: TIFF0007599740000041.tif113170

[0172] SEQ ID NO:21 Name: gi|43090: 1-436 E. coli (Tn5086) dhfr VII gene and sul I gene, 5' end for type VII dihydrofolate reductase (integrase) array: TIFF0007599740000042.tif95170

[0173] SEQ ID NO:22 Name: gi|43091|emb|CAA41325.1|Integrase, partial (plasmid) [Escherichia coli] array: TIFF0007599740000043.tif38170

[0174] SEQ ID NO:23 >gi|397912605:40372-41898 Thermoanaerobacterium phage THSA-485A, complete genome-recombinase TIFF0007599740000044.tif210170 TIFF0007599740000045.tif120170

[0175] SEQ ID NO:24 >gi|397912662|ref|YP_006546326.1|Recombinase [Thermoanaerobacterium phage THSA-485A] TIFF0007599740000046.tif115170

[0176] SEQ ID NO:25 Gin recombinase >gi|657193240|sp|Q38199.2|GIN_BPD10 RecName:Full=Serine recombinase gin;Also known as:Full=G-segment invertase;Abbreviation=Gin TIFF0007599740000047.tif46170

[0177] SEQ ID NO:26 Cre recombinase >gi|375331813|dbj|BAL61207.1|Cre recombinase [Cre-expression vector pHVX2-cre] TIFF0007599740000048.tif75170

[0178] SEQ ID NO:27-46 These are representative sequences of polynucleotides encoding TALE repeat modules for use in linking to an integrase or recombinase as described in the present invention.

[0179] SEQ ID NO:27 Name:NI array: TIFF0007599740000049.tif23170

[0180] SEQ ID NO:28 Name:NG array: TIFF0007599740000050.tif23170

[0181] SEQ ID NO:29 Name:HD array: TIFF0007599740000051.tif23170

[0182] SEQ ID NO:30 Name:NN array: TIFF0007599740000052.tif23170

[0183] SEQ ID NO:31 Name: NI-NI array: TIFF0007599740000053.tif37170

[0184] SEQ ID NO:32 Name:NI-NG array: TIFF0007599740000054.tif38170

[0185] SEQ ID NO:33 Name:NI-HD array: TIFF0007599740000055.tif37170

[0186] SEQ ID NO:34 Name:NI-NN array: TIFF0007599740000056.tif37170

[0187] SEQ ID NO:35 Name:NG-NI array: TIFF0007599740000057.tif42170

[0188] SEQ ID NO:36 Name:NG-NG array: TIFF0007599740000058.tif37170

[0189] SEQ ID NO:37 Name:NG-HD array: TIFF0007599740000059.tif31170

[0190] SEQ ID NO:38 Name:NG-NN array: TIFF0007599740000060.tif38170

[0191] SEQ ID NO:39 Name:HD-NI array: TIFF0007599740000061.tif40170

[0192] SEQ ID NO:40 Name:HD-NG array: TIFF0007599740000062.tif30170

[0193] SEQ ID NO:41 Name:HD-HD array: TIFF0007599740000063.tif38170

[0194] SEQ ID NO:42 Name:HD-NN array: TIFF0007599740000064.tif39170

[0195] SEQ ID NO:43 Name: NN-NI array: TIFF0007599740000065.tif39170

[0196] SEQ ID NO:44 Name: NN-NG array: TIFF0007599740000066.tif38170

[0197] SEQ ID NO:45 Name: NN-HD array: TIFF0007599740000067.tif38170

[0198] SEQ ID NO:46 Name: NN-NN array: TIFF0007599740000068.tif30170

[0199] SEQ ID NO:47 Name: gi|71796612|gb|DQ084353.1|Sheep lentivirus isolate Ov10 integrase (pol) gene, partial cds array: TIFF0007599740000069.tif55170

[0200] SEQ ID NO:48 Name: gi|71796613|gb|AAZ41325.1|Integrase, partial [ovine lentivirus] array: TIFF0007599740000070.tif24170

[0201] SEQ ID NO:49 >gb|AYLT01000127.1|:11804-12046 Staphylococcus aureus subsp. aureus SK1585 contig 000127, whole genome shotgun sequence TIFF0007599740000071.tif53170

[0202] SEQ ID NO:50 >gi|669035130|gb|KFD30483.1|Hypothetical protein D484_02234 [Staphylococcus aureus subsp. aureus SK1585] - S. aureus cas9 TIFF0007599740000072.tif23170

[0203] SEQ ID NO:51 Name: Linker 2 DNA array: agcggcagcgaaaccccgggcaccagcgaaagcgcgaccccggaaagc

[0204] SEQ ID NO:52 Name: dCas9 protein array: TIFF0007599740000073.tif220170 TIFF0007599740000074.tif90170

[0205] SEQ ID NO:53 Name: NLS nucleotides with ATG array: TIFF0007599740000075.tif31170

[0206] SEQ ID NO:54 Name: GGS linker nucleotide array: GGGGGAAGT

[0207] SEQ ID NO:55 Name: Synthetic integrase array: TIFF0007599740000076.tif187170

[0208] SEQ ID NO:56 Name: dCas9 nucleotide with ATG array: TIFF0007599740000077.tif58170 TIFF0007599740000078.tif233170 TIFF0007599740000079.tif233170 TIFF0007599740000080.tif232170 TIFF0007599740000081.tif234170 TIFF0007599740000082.tif37170

[0209] SEQ ID NO:57 Name: ABBIE1 (NLS-Linker 1-Integrase-Linker 2-dCas9)-DNA sequence array: TIFF0007599740000083.tif170170 TIFF0007599740000084.tif235170 TIFF0007599740000085.tif233170 TIFF0007599740000086.tif234170 TIFF0007599740000087.tif233170 TIFF0007599740000088.tif134170

[0210] SEQ ID NO:58 Name: Translation of ABBIE1 (Conjugation-Based Integrase Editor) array: TIFF0007599740000089.tif76170 TIFF0007599740000090.tif235170 TIFF0007599740000091.tif25170 Stop (att site in the LTR region for integrase recognition) to the donor DNA.

[0211] SEQ ID NO:59 Name: U3att array: ACTGGAAGGGCTAATTCACTCCCAAAGAA

[0212] SEQ ID NO:60 Name: U5att array: GACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGT NLS-linker1-integrase-linker2-dCas9 or integrase-linker1-NLS-linker2-dCas9 or integrase-linker2-dCas9-linker1-NLS or integrase-linker2-dCas9-NLS Linker 1=GGS

[0213] SEQ ID NO:61 Name: Linker 2 array: SGSETPGTSESATPES

[0214] SEQ ID NO:62 Name: MMTV integrase cDNA, gb|AF071010.1|:16-1113 Mouse mammary tumor virus putative integrase, env polyprotein and superantigen mRNA, complete cds array: TIFF0007599740000092.tif230170

[0215] SEQ ID NO:63 Name: gi|3273866|gb|AAC24859.1|Putative integrase [Mouse mammary tumor virus] array: TIFF0007599740000093.tif85170

[0216] SEQ ID NO:64 Name: gb|AXUN02000059.1|:5116-8850 Youngiibacter fragilis 232.1 contig_151, whole genome shotgun sequence-recombinase array: TIFF0007599740000094.tif137170 TIFF0007599740000095.tif227170 TIFF0007599740000096.tif228170 TIFF0007599740000097.tif216170

[0217] SEQ ID NO:65 Name: gi|564135645|gb|ETA81829.1|Recombinase [Youngiibacter fragilis 232.1] array: TIFF0007599740000098.tif222170 TIFF0007599740000099.tif38170

[0218] SEQ ID NO:66 Name: gi|571264543:16423-16770 Clostridium difficile transposon Tn6218, strain Ox42 transposase array: TIFF0007599740000100.tif75170

[0219] SEQ ID NO:67 Name: gi|571264559|emb|CDF47133.1|Transposase [Peptoclostridium difficile] array: TIFF0007599740000101.tif23170

[0220] SEQ ID NO:68 Name: gb|CP009444.1|:1317724-1320543 Francisella philomiragia strain GA01-2801, complete genome Cpf1 array: TIFF0007599740000102.tif19170 TIFF0007599740000103.tif229170 TIFF0007599740000104.tif228170 TIFF0007599740000105.tif144170

[0221] SEQ ID NO:69 Name: gi|754264888|gb|AJI57252.1|CRISPR-associated protein Cpf1, subtype PREFRAN [Francisella philomiragia] array: TIFF0007599740000106.tif86170

[0222] SEQ ID NO:70 Name: gi|438609|gb|L21188.1|HIV1NY5A Human immunodeficiency virus type 1 integrase gene, 3' end array: TIFF0007599740000107.tif187170

[0223] SEQ ID NO:71 Name: gi|438610|gb|AAC37875.1|Integrase, partial [human immunodeficiency virus 1] array: TIFF0007599740000108.tif67170

[0224] SEQ ID NO:72 Name: gi|545612232|ref|WP_021736722.1|V-type CRISPR-associated protein Cpf1 [Acidaminococcus sp. BV3L6] array: TIFF0007599740000109.tif105170 TIFF0007599740000110.tif172170

[0225] SEQ ID NO:73 Name: gi|769142322|ref|WP_044919442.1|V-type CRISPR-associated protein Cpf1 [Lachnospiraceae bacteria MA2020] array: TIFF0007599740000111.tif33170 TIFF0007599740000112.tif234170

[0226] SEQ ID NO:74 Name: gi|489130501|ref|WP_003040289.1|V-type CRISPR-associated protein Cpf1 [Francisella tularensis] array: TIFF0007599740000113.tif194170 TIFF0007599740000114.tif83170

[0227] SEQ ID NO:75 Name: gi|502240446|ref|WP_012739647.1|V-type CRISPR-associated protein Cpf1 [[Eubacterium eligens]] array: TIFF0007599740000115.tif119170 TIFF0007599740000116.tif157170

[0228] SEQ ID NO:76 Name: gi|537834683|ref|WP_020988726.1|V-type CRISPR-associated protein Cpf1 [Leptospira inadai] array: TIFF0007599740000117.tif49170 TIFF0007599740000118.tif230170

[0229] SEQ ID NO:77 Name: gi|739008549|ref|WP_036890108.1|V-type CRISPR-associated protein Cpf1 [Porphyromonas crevioricanis] array: TIFF0007599740000119.tif194170 TIFF0007599740000120.tif77170

[0230] SEQ ID NO:78 Name: gi|517171043|ref|WP_018359861.1|V-type CRISPR-associated protein Cpf1 [Porphyromonas macacae] array: TIFF0007599740000121.tif120170 TIFF0007599740000122.tif149170

[0231] SEQ ID NO:79 Name: Integrase protein sequence found at Uniprot site. DNA sequence obtained from GenBank. array: TIFF0007599740000123.tif128170

[0232] SEQ ID NO:80 Name:sp|P04585|1148-1435 array: TIFF0007599740000124.tif45170

[0233] SEQ ID NO:81 Protein domains that characterize zinc finger proteins CX(2-4)CX(12)HX(3-5)H (X(2-4) means, for example, XX or XXX or XXXX)

[0234] SEQ ID NO:82 >gi|1616606|emb|X97044.1|Mouse mammary tumor virus 5'LTR DNA TIFF0007599740000125.tif48170 TIFF0007599740000126.tif241170

[0235] SEQ ID NO:83 >gi|1403387|emb|X98457.1|Mouse mammary tumor virus 3'LTR TIFF0007599740000127.tif192170 TIFF0007599740000128.tif40170

[0236] SEQ ID NO:84 >gi|119662099|emb|AM076881.1|Human immunodeficiency virus 1 proviral 5'LTR, TAR element and U3, U5 and R repeat regions, clone PG232.14 TIFF0007599740000129.tif171170

[0237] SEQ ID NO:85 >gi|1072081|gb|U37267.1|HIV1U37267 Human immunodeficiency virus type 1 3' LTR region TIFF0007599740000130.tif110170

[0238] There are no sequences 86 to 99.

[0239] SEQ ID NO:100 Oligos for insertion of neo into the cell genome (uses the entire sequence of the 5' and 3' HIV LTR) TIFF0007599740000131.tif63170 TIFF0007599740000132.tif186170 The first 5'LTR is underlined, in standard text neo, and the 3'LTR is in bold (1179 bp).

[0240] SEQ ID NO:101 A truncated version of the 5'LTR and 3'LTR with neo sequences within (224 bp) The first 5'LTR is underlined, the standard text is neo, and the 3'LTR is in bold. TIFF0007599740000133.tif49170

[0241] Regarding SEQ ID NO: 72 Genbank Protein ID: WP_021736722.1 NCBI protein GI from NR database or local GI (for proteins from WGS database): 545612232 Contig ID in WGS database: AWUR01000016.1 Contig description: Acidaminococcus sp. BV3L6 contig 00028, whole genome shotgun sequence Protein Integrity: Complete Experimentally analyzed proteins: 8 Non-overlapping set:nr Organism: Acidaminococcus sp. BV3L6 Classification: Bacteria, Firmicutes, Negativicutes, Selenomonadales, Acidaminococcaceae, Acidaminococcus, Acidaminococcus sp. BV3L6

[0242] Regarding SEQ ID NO: 73 Genbank Protein ID: WP_044919442.1 NCBI protein from NR database or local GI (for proteins from WGS database): 769142322 Contig ID in the WGS database: JQKK01000008.1 Contig description: Lachnospiraceae bacterium MA2020 T348DRAFT_scaffold00007.7_C, whole genome shotgun sequence Protein Integrity: Complete Experimentally analyzed proteins: 9 Non-overlapping set:nr Organism: Lachnospiraceae_Bacteria_MA2020 Classification: Bacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, Unclassified Lachnospiraceae, Lachnospiraceae Bacteria MA2020

[0243] Additional nucleic acid and protein sequences that can be used in the disclosed compositions and methods - CPF1 alignment. SEQ ID NOs: 86-92; order from top to bottom of chart. TIFF0007599740000134.tif193170 TIFF0007599740000135.tif192170 TIFF0007599740000136.tif192170 TIFF0007599740000137.tif98170

[0244] Additional nucleic acid and protein sequences that can be used in the disclosed compositions and methods - Cfp1 human truncated protein alignment. SEQ ID NO:86 (column 1) and SEQ ID NO:90 (column 2). TIFF0007599740000138.tif203170 TIFF0007599740000139.tif80170

[0245] Additional nucleic acid and protein sequences that can be used in the disclosed compositions and methods. Table taken from Haft, D., et al. PLoS Computational Biology, November 2005, Vol. 1, Issue 6, pp. 474-483. SEQ ID NOs: 200-253; order from top to bottom of chart. TIFF0007599740000140.tif157170 TIFF0007599740000141.tif60170

[0246] Editing the target sequence and PAM for Nrf2 (exon 2): Designs 1 to 3 were used for the sgRNA. SEQ ID NO:254 GCGACGGAAAGAGTATGAGC TGG SEQ ID NO:255 TATTTGACTTCAGTCAGCGA CGG SEQ ID NO:256 TGGAGGCAAGATATAGATCTGG

[0247] Primer keys for detection of integration in Nrf2 targets Primer set 1: SEQ ID NO:257 Primer 1: 5'-GTGTTAATTTCAAACATCAGCAGC-3', SEQ ID NO:258 Primer 2: 5'-GACAAGACATCCTTGATTTG-3' Primer set 2: SEQ ID NO:259 Primer 1: 5'-GAGGTTGACTGTGTAAATG-3', SEQ ID NO:260 Primer 2: 5'-GATACCAGAGTCACACAACAG-3' Primer set 3: SEQ ID NO:261 Primer 1: 5'-TCTACATTAATTCTCTTGTGC-3', SEQ ID NO:262 Primer 2: 5'-GATACCAGAGTCACACAACAG-3'

[0248] Accession number for human CXCR4 Uniprot P61073 Ensembl gene ID: ENSG00000121966

[0249] Editing the target sequence and PAM for CXCR4 (exon 2): Design 1 was used for the sgRNA. SEQ ID NO:263 GGGCAATGGATTGGTCATCC TGG

[0250] Primer key for detection of integration in CXCR4 target Primer set 1: SEQ ID NO:264 Primer 1: 5'-TCTACATTAATTCTCTTGTGC-3', SEQ ID NO:265 Primer 2: 5'-GACAAGACATCCTTGATTTG-3' Primer set 2: SEQ ID NO:266 Primer 1: 5'-TCTACATTAATTCTCTTGTGC-3', SEQ ID NO:267 Primer 2: 5'-GATACCAGAGTCACACAACAG-3' Primer set 3: SEQ ID NO:268 Primer 1: 5'-GAGGTTGACTGTGTAAATG-3', SEQ ID NO:269 Primer 2: 5'-GACAAGACATCCTTGATTTG-3' Primer set 4: SEQ ID NO:270 Primer 1: 5'-GAGGTTGACTGTGTAAATG-3', SEQ ID NO:271 Primer 2: 5'-GATACCAGAGTCACACAACAG-3'

[0251] Avi-tagged Cas9 for biotinylation Sequence of the avi-tag used for Cas9 biotinylation Amino acid sequence: SEQ ID NO:272 GGDLEGSGLNDIFEAQKIEWHE * Nucleic acid sequence: SEQ ID NO:273 TIFF0007599740000142.tif17170

Claims

1. A first polynucleotide encoding a catalytically inactive Cas9; a second polynucleotide encoding a viral integrase; a third polynucleotide which is a nucleic acid linker; A nucleic acid construct comprising: the first polynucleotide comprises a 5' and a 3' end, the second polynucleotide comprises a 5' and a 3' end, the 3' end of the first polynucleotide is linked to the 5' end of the second polynucleotide by the nucleic acid linker, and the first polynucleotide and the second polynucleotide are capable of being expressed as a fusion protein in a cell or an organism; the first polynucleotide comprises the nucleotide sequence of SEQ ID NO:56; The catalytically inactive Cas9 comprises the amino acid sequence of SEQ ID NO:52, the second polynucleotide comprises SEQ ID NO: 70, or a nucleotide sequence having at least 99% identity thereto; The viral integrase comprises an amino acid sequence of SEQ ID NO: 71 or having at least 99% identity thereto. A nucleic acid construct comprising:

2. The nucleic acid construct described in claim 1, characterized in that the nucleic acid linker encodes a linker polypeptide comprising one or more amino acids.

3. The nucleic acid construct described in claim 2, characterized in that the linker polypeptide is 4 to 8 amino acids in length.

4. A nucleic acid construct described in any one of claims 1 to 3, further comprising a polynucleotide encoding a nuclear localization signal.

5. A fusion protein encoded by a nucleic acid construct described in any one of claims 1 to 4.

6. A vector comprising a nucleic acid construct described in any one of claims 1 to 4.

7. The vector described in claim 6, characterized in that the vector is a viral vector.

8. The vector described in claim 6 or 7, characterized in that the vector is a viral vector selected from an adeno-associated virus (AAV) vector or a lentivirus vector.

9. A vector described in any one of claims 6 to 8, further comprising a polynucleotide encoding a reverse transcriptase.

10. An ex vivo or in vitro cell comprising a nucleic acid construct described in any one of claims 1 to 4.

11. A non-human organism comprising a nucleic acid construct described in any one of claims 1 to 4.

12. A system for inserting a donor nucleic acid into a genome, comprising: (a) a nucleic acid construct according to any one of claims 1 to 4, or a fusion protein encoded by said nucleic acid construct; (b) a guide RNA (gRNA); and (c) a template polynucleotide comprising a donor nucleic acid, a first long terminal repeat (LTR) and a second LTR, wherein the donor nucleic acid is located between the first LTR and the second LTR; A system including:

13. The system described in claim 12, characterized in that the guide RNA has a length of 12 to 30 consecutive base pairs.

14. The system described in claim 12 or 13, characterized in that the first or second LTR comprises a nucleotide sequence selected from SEQ ID NOs: 59 and 60.

15. An in vitro method for genetically modifying a cell by inserting a DNA sequence into target genomic DNA of the cell, the in vitro method comprising the step of introducing into the cell a system described in any one of claims 12 to 14.

Images