Trichoderma longibrachiatum NT241 and application thereof

Abstract

The invention discloses Trichoderma longibrachiatum NT241 and application thereof, the microbiological classification name of the Trichoderma longibrachiatum NT241 is Trichoderma longibrachiatum NT241, the Latin literature name of the Trichoderma longibrachiatum NT241 is Trichoderma longibrachiatum NT241, the preservation number of the Trichoderma longibrachiatum NT241 is CGMCC (China General Microbiological Culture Collection Center) No.41139, and the preservation address of the Trichoderma longibrachiatum NT241 is No.3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The trichoderma longibrachiatum NT241 disclosed by the invention grows quickly, the generated endo-beta-glucanase and manganese peroxidase are relatively high in activity, the degradation of straws of crops such as oilseed rape and wheat is promoted by adding the liquid fungicide, and an efficient microbial resource can be provided for straw returning utilization.

Description

Technical Field

[0001] The invention relates to Trichoderma longibrachiatum NT241 and application thereof, belonging to the technical field of microorganisms. Background Art

[0002] In recent years, straw treatment has been a difficult problem in rural environmental governance. With the improvement of environmental protection requirements and the implementation of straw utilization policies, my country has gradually formed a pattern of comprehensive utilization of straw as "five materials", among which straw fertilizer can increase soil nutrients, increase crop yields, and reduce the application of chemical fertilizers, so the proportion of straw returned to the field has gradually increased. However, the lignocellulose structure in the straw hinders the degradation of enzymes, resulting in a long straw composting cycle and incomplete composting.

[0003] Microbial agents can help straw to mature quickly and effectively alleviate the adverse effects of returning straw directly to the field. Among the cellulose-degrading strains in nature, fungi have more advantages than bacteria and actinomycetes. The various oxidoreductases and a large number of hyphae produced can effectively break down the complex structure of lignin and further promote cellulose degradation. Among them, Trichoderma fungi have become the most widely studied filamentous fungi due to their strong survival ability, diverse cellulase system and good degradation efficiency. Zhang Yanping et al. [1] Mutant strain 5 obtained by UV mutagenesis of cellulose-degrading fungus Trichoderma longibrachiatum M-1 # , strain 5 was identified # It is also a long-branched Trichoderma, and its filter paper enzyme activity increased by 30.06U / mL, and the endonuclease activity increased by 19.01U / mL. Wanyun Li et al. [2] A long-branched Trichoderma MK 878447 was isolated from the rhizosphere soil of Scutellaria baicalensis. Under its optimal fermentation conditions, the crude fiber degradation rate of corn stalks can be increased to 23.5% within 5 to 6 days. Even in a dark environment at 16°C, Huang Yali et al. [3] The developed composite bacterial agent (containing Trichoderma longifolia) can also increase the degradation rate of corn straw to 41.67% on the 45th day.

[0004] Based on the above, the addition of microbial agents provides effective technical support for the rapid decomposition of straw, especially microorganisms dominated by Trichoderma fungi have significant performance in conversion efficiency. Further exploration of the enzyme activity of Trichoderma longifolia and its degradation performance on rape straw and wheat straw can provide an efficient microbial resource for the utilization of straw in the field. Summary of the invention

[0005] The first purpose of the present invention is to provide a long-branch Trichoderma (Trichoderma longibrachiatum) NT241, which is named as long-branch Trichoderma (Trichoderma longibrachiatum) NT241 in microbiological classification, and its Latin name is Trichoderma longibrachiatum NT241, with a preservation number of CGMCC No.41139, a preservation date of 2024-04-07, and a preservation unit of the General Microbiological Center of the China Microbiological Culture Collection Administration Committee, and a preservation address of No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing. The long-branch Trichoderma (Trichoderma longibrachiatum) NT241 was obtained by separation and screening from humus soil in Inner Mongolia. The ratio of the hydrolysis zone diameter to the strain diameter on the Congo red-stained plate is 2.55. It is preliminarily determined that the strain can produce cellulase and has a strong cellulose degradation ability. Long-branch Trichoderma NT241 grows faster on PDA culture medium and can cover the entire plate in 3 days. The colony morphology of the strain was observed. The colonies were white flocculent hyphae, which then gradually turned green and formed a small amount of white-yellow spore-producing clusters. After 5 days of cultivation, the hyphae turned dark green.

[0006] The ITSrDNA sequence of the above-mentioned Trichoderma longibrachiatum NT241 is shown in SEQ ID NO.1.

[0007] The Trichoderma longibrachiatum NT241 has the activities of laccase, manganese peroxidase, lignin peroxidase, filter paper enzyme and endo-β-glucanase.

[0008] The second object of the present invention is to provide a method for preparing a liquid bacterial agent of Trichoderma longibrachiatum NT241, wherein the above-mentioned Trichoderma longibrachiatum NT241 strain is inoculated into a potato dextrose agar (PDA) liquid culture medium, and cultured in a constant temperature oscillator at 30° C. and 180 r / min for 3 to 4 days to obtain a liquid bacterial agent.

[0009] The third object of the present invention is to provide a use of the above-mentioned Trichoderma longibrachiatum NT241 liquid bacterial agent in degrading rape straw and wheat straw.

[0010] The above-mentioned Trichoderma longibrachiatum NT241 liquid bacterial agent is used in the degradation of rape straw and wheat straw. First, the straw is harvested and naturally air-dried, then mechanically processed into 5-10 cm, and then sterilized. Sterile water is sprayed on the sterilized straw to keep the moisture content at 60-70%, and finally 5-15% of Trichoderma longibrachiatum NT241 liquid bacterial agent is added to the straw, mixed evenly, and then composted at 30°C for 14 days.

[0011] Compared with the prior art, the invention has the following advantages: the strain Trichoderma longibrachiatum NT241 grows and reproduces rapidly, and can reach the peak of enzyme production after 3 to 5 days of shaking culture; it can produce laccase, manganese peroxidase, lignin peroxidase, filter paper enzyme and endo-β-glucanase, among which the endo-β-glucanase and manganese peroxidase have relatively high activities; at the same time, the invention adds 15% of Trichoderma longibrachiatum NT241 liquid bacterial agent, which is helpful for the degradation of rape straw and wheat straw lignocellulose, and improves the humus content, thereby providing efficient microbial resources for subsequent straw biodegradation, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 This is a schematic diagram of the Congo red decolorization results of Trichoderma longibrachiatum NT241;

[0013] Figure 2 a is a schematic diagram of the morphological characteristics of Trichoderma longibrachiatum NT241;

[0014] Figure 2 b is the phylogenetic tree analysis diagram of Trichoderma longibrachiata NT241;

[0015] Figure 3 is the glucose standard curve;

[0016] Figure 4 is the growth curve of Trichoderma longibrachiatum NT241;

[0017] Figure 5 Schematic diagram of cellulase activity of Trichoderma longibrachiatum NT241;

[0018] Figure 6 Schematic diagram of the lignin degradation enzyme activity of Trichoderma longibrachiatum NT241;

[0019] Figure 7a This is a diagram showing the hemicellulose degradation effect of Trichoderma longifolia NT241;

[0020] Figure 7b This is a diagram showing the cellulose degradation effect of Trichoderma longifolia NT241;

[0021] Figure 7c This is a diagram showing the lignin degradation effect of Trichoderma longifolia NT241;

[0022] Figure 8 This is a schematic diagram of the changes in rape straw humus after being treated with Trichoderma longifolia NT241;

[0023] Fig. 9 Schematic diagram of the changes in humus in wheat straw after treatment with Trichoderma longifolia NT241. DETAILED DESCRIPTION

[0024] In order to make the purpose, technical solutions and advantages of the present invention more clear, the present invention is further described in detail below in conjunction with embodiments and drawings.

[0025] The main culture medium involved in the present invention comprises:

[0026] 1. Sodium carboxymethyl cellulose liquid culture medium: sodium carboxymethyl cellulose 10.0 g, potassium dihydrogen phosphate 2.0 g, ammonium sulfate 4.0 g, magnesium sulfate 0.244 g, peptone 1.0 g, ultrapure water 1.0 L, pH 7.0-7.5, sterilize at 121°C for 20 min.

[0027] 2. Sodium carboxymethyl cellulose solid culture medium: 10.0 g sodium carboxymethyl cellulose, 2.0 g potassium dihydrogen phosphate, 4.0 g ammonium sulfate, 0.244 g magnesium sulfate, 1.0 g peptone, 20.0 g agar, 1.0 L ultrapure water, pH 7.0-7.5, sterilize at 121°C for 20 min.

[0028] 3. Potato dextrose agar (PDA) solid culture medium: 200.0 g fresh potato extract, 20.0 g glucose, 1.0 L ultrapure water, natural pH, sterilized at 121°C for 20 min.

[0029] 4. Potato dextrose agar (PDA) liquid medium: 200.0 g fresh potato extract, 20.0 g glucose, 1.0 L ultrapure water, 20.0 g agar, natural pH, sterilized at 121°C for 20 min

[0030] 5. Lignin fermentation enzyme production medium: lignin 4g, ammonium sulfate 4g, potassium dihydrogen phosphate 1g, dipotassium hydrogen phosphate 1g, sodium chloride 0.1g, magnesium sulfate 0.3g, manganese sulfate 0.05g, ferrous sulfate 0.01g, copper sulfate 0.01g, zinc sulfate 0.01g, cobalt chloride 0.005g, sodium molybdate 0.001g, aluminum potassium alum 0.001g, boric acid 0.01g, pH 7.0-7.2, sterilization at 121℃ for 20min.

[0031] Example 1: Isolation and purification of Trichoderma longibrachiatum NT241 strain

[0032] 1. Preparation of bacterial suspension: Weigh 2 g of sample from the humified soil in Inner Mongolia, add it into a 100 mL Erlenmeyer flask containing 40 mL of sterile water, and culture it at 30 °C and 180 r / min for 30 min to obtain a bacterial suspension.

[0033] 2. Acclimation and enrichment: Inoculate the bacterial suspension into the straw acclimation medium at 5% (v / v), culture at 30°C and 180 r / min with shaking for 4 to 5 days, and repeat this operation twice.

[0034] 3. Separation and purification: The separation was carried out by dilution plate method. The culture medium was diluted with sterile water to 10 -4 ~10 -7 Concentration, each 200 μL dilution was applied on PDA solid medium, and then placed in a 30°C constant temperature incubator for inversion. The colonies grown on the medium were observed, and according to the size, color, surface patterns and other characteristics of the colonies, larger single colonies were selected, and they were streaked on PDA solid medium for multiple times, and purified repeatedly for 2 to 3 generations until single colonies appeared.

[0035] Example 2: Screening of Trichoderma longibrachiatum NT241 strain

[0036] The isolated and purified strains were inoculated on sodium carboxymethyl cellulose solid culture medium, cultured at 30°C for 3 days, stained with 1g / L Congo red solution for 30 minutes, decolorized with 1mol / L sodium chloride solution for 30 minutes, and the colony diameter (d) and hydrolysis zone diameter (D) were measured and recorded to preliminarily determine the lignocellulose degradation ability of the strains. Figure 1 As shown: The Congo red stained hydrolysis zone diameter of strain NT241 is 11.4, the colony diameter is 4.5, and the ratio is 2.55.

[0037] Example 3: Identification of Trichoderma longibrachiatum NT241 strain

[0038] (1) Strain morphological analysis

[0039] The strain NT241 was inoculated onto a PDA solid culture medium and inverted in a 30°C constant temperature incubator to observe and record the growth morphological characteristics of the strain. Figure 2As shown in a: The strain grows rapidly, and white flocculent hyphae appear after 3 days and cover the entire culture dish. As the hyphae grow, they gradually change from the initial white to grayish yellow, producing subspherical granular or powdery spores that are translucent to light green. After 5 days of cultivation, the central part of the strain gradually becomes thicker and darker, the hyphae turn dark green, and form dense white-yellow spore clusters. The strain was observed to have no obvious odor, and the colony morphology is basically the same as that of the long-branched Trichoderma strain.

[0040] (2) Phylogenetic tree analysis of strains

[0041] The DNA of Trichoderma longifolia NT241 was extracted using the bacterial / fungal genomic DNA extraction kit from Solarbio. Using this as a template, PCR gene amplification was performed using the fungal ITS universal primers ITS1 (TCCGTAGGTGAACCTGCC) and ITS4 (TCCTCCGCTTATTGATATGC). The PCR products were identified by 1% agarose gel electrophoresis and directly sequenced using PCR primers. The measured sequences were aligned and homology analyzed using the Basic Local Alignment Search Tool (BLAST) on the National Center for Biotechnology Information (NCBI) to determine the accuracy of the sequencing results. After confirming that the sequence was correct, the reference strain sequence was downloaded and multiple alignments were performed with the sequenced strain sequence using BioEdit. The phylogenetic tree was constructed using the Maximum Likelihood method using MEGA7.0 software, and 1000 Bootstrap tests were performed to complete the strain clustering analysis. The results are as follows. Figure 2 As shown in b: NT241 and Trichoderma longibrachiatum formed a distinct branch. ITS rDNA sequence alignment and results further verified that NT241 was Trichoderma longibrachiatum at the molecular biology level.

[0042] Example 4: Determination of cellulase activity of Trichoderma longibrachiatum NT241

[0043] (1) Drawing of glucose standard curve

[0044] Accurately measure 0mL, 0.2mL, 0.4mL, 0.6mL, 0.8mL, 1.0mL, 1.2mL, 1.4mL, 1.6mL and 1.8mL of 1mg / mL glucose standard solution into 25mL colorimetric tubes, dilute to 2mL with ultrapure water, mix the two thoroughly, add 3mL DNS reagent to each colorimetric tube, boil in boiling water for 5min, cool quickly and dilute to 25mL with ultrapure water, measure the absorbance of the sample in a 540nm wavelength ultraviolet spectrophotometer, and draw a standard curve based on the recorded data with glucose content as the horizontal coordinate and absorbance as the vertical coordinate. The results are as follows: Figure 3 shown.

[0045] (2) Plotting of strain growth curve

[0046] The growth characteristics and growth law of the strain can be understood from the growth curve of the strain, and the growth curve of the fungus strain NT241 was determined by gravimetric method. The long-branch Trichoderma NT241 of Example 1 was inoculated into 250 mL of high-temperature sterilized PDA liquid culture medium for activation, and cultured in a constant temperature oscillator at 30°C and 180 r / min for 48 hours to obtain a seed solution with a bacterial concentration of 173 mg / L.

[0047] The seed liquid of Trichoderma longifolia NT241 was inoculated into the lignin fermentation enzyme production medium at a 5% (v / v) inoculation rate, and cultured at 30°C and 180r / min for 11 days. Starting from the first day of culture, samples were taken every 24 hours. After the samples were centrifuged at 12000r / min and 4°C for 10 minutes, the supernatant was removed to obtain the water-containing mycelial ball, which was further filtered, placed in a 50°C oven to dry to constant weight and weighed. The growth curve of strain NT241 was drawn with time-weight as the horizontal and vertical coordinates. The results are shown in the figure. Figure 4 As shown: the bacterial biomass kept increasing in the early stage of culture until it reached the maximum growth value on the 4th day, at which time the bacterial biomass was 872 mg / L, and then began to decline and entered a stable period.

[0048] (3) Preparation of crude enzyme solution

[0049] The strain NT241 was inoculated into 250 mL of high temperature sterilized PDA liquid medium and cultured to the logarithmic growth phase as the seed solution for the next step of enzyme production culture. The seed solution was inoculated into the lignin fermentation enzyme production medium at a 5% (v / v) inoculation amount and cultured continuously for 7 days at 30°C and 180r / min. 5 mL of the fermentation liquid was taken daily and centrifuged at 12000r / min and 4°C for 10 minutes, and the supernatant was the crude enzyme solution.

[0050] (4) Filter paper enzyme activity assay

[0051] Take 4 colorimetric tubes, 1 as a blank control, and the other 3 as experimental parallel tubes. Add 0.5mL crude enzyme solution, 1×6cm filter paper strip and 1.5mL sodium citrate buffer to the experimental tube; the blank tube uses the enzyme solution inactivated by boiling for 10min as a control. After 1h in a 50℃ water bath, add 3mL DNS reagent to both colorimetric tubes, then place them in a boiling water bath and heat for 5min, then immediately cool to room temperature with running water and dilute to 20mL. Use an ultraviolet spectrophotometer at a wavelength of 540nm to measure the absorbance, find the reducing sugar content through the glucose standard curve, and calculate the enzyme activity according to the formula.

[0052] (5) Determination of endo-β-glucanase activity

[0053] Endo-β-glucanase plays a key role in cellulose degradation. It promotes other enzymes to further degrade cellulose by cutting the molecular chain to produce simple sugars such as glucose. The enzyme activity is usually determined by analyzing the amount of reducing sugar generated. After obtaining the crude enzyme solution, add 1 mL of 1% sodium carboxymethyl cellulose. The subsequent steps are the same as "filter paper enzyme activity determination".

[0054] (6) Calculation of cellulase activity

[0055] 1 mL of crude enzyme solution hydrolyzes the substrate to generate 1 μg of glucose within 1 minute as an enzyme activity unit, and the result is expressed in U / mL. The calculation formula is as follows:

[0056]

[0057] Where: X represents enzyme activity (U / mL), A is the glucose content corresponding to the absorbance (μg), N is the dilution factor of the enzyme solution, V is the amount of enzyme solution added (i.e. 0.5 mL), and T is the enzymatic reaction time (i.e. 60 min).

[0058] The results are as follows Figure 5 The results showed that during the filter paper enzyme assay, the filter paper enzyme activity of Trichoderma longifolia NT241 reached a peak of 33.14±0.34U / mL on the third day, indicating that the induced complex enzyme system composed of three enzymes of this strain under this condition had a strong synergistic effect, but then gradually decreased and stabilized at around 8.23U / mL. Endo-β-glucanase is an important component of cellulase, and its activity is usually higher than that of other cellulases. The endo-β-glucanase activity of Trichoderma longifolia NT241 reached a peak of 46.60±0.93U / mL on the fourth day, and then decreased and stabilized at around 23.73U / mL. Obviously, the endo-β-glucanase activity of this strain (6.54~46.6U / mL) is generally higher than the filter paper enzyme activity (5.37~33.14U / mL).

[0059] Example 5: Lignin-degrading enzyme activity of Trichoderma longibrachiatum NT241

[0060] After obtaining the crude enzyme solution according to the "Preparation of crude enzyme solution" described in Example 3, the lignin degradation enzyme activity of the strain was measured, which is usually expressed in enzyme activity units (U).

[0061] (1) Laccase activity assay

[0062] Refers to the amount of enzyme required to catalyze the oxidation of 1 μmol ABTS per minute, using the ABTS method. The specific operation is as follows: Take 2 mL of 0.1 mol / L acetic acid-sodium acetate buffer, add 0.5 mL of 0.5 mmol / L ABTS solution and 200 μL of crude enzyme solution, mix well, place in a 30°C water bath for 3 minutes, and measure the absorbance change at 420 nm.

[0063] (2) Determination of manganese peroxidase activity

[0064] Refers to 1 μmol Mn per minute 2+ Oxidized to Mn 3+ The required amount of enzyme is determined by the MnSO4 method. The specific operation is as follows: take 2.5 mL of 50 mmol / L succinic acid-sodium succinate buffer, add 0.4 mL of 1.6 mmol / L MnSO4 solution and 1 mL of crude enzyme solution, and then add 100 μL of 10 mmol / L H2O2 solution to start the reaction. After mixing evenly, place in a 37°C water bath for 3 minutes and measure the absorbance change at 240 nm.

[0065] (3) Determination of lignin peroxidase activity

[0066] Refers to the amount of enzyme required to catalyze the oxidation of 1umol of resveratrol per minute, using the VA (resveratrol) method. The specific operation is: take 2.5mL of 250mmol / L tartaric acid-sodium tartrate buffer, add 0.4mL of 10mmol / L resveratrol and 1mL of crude enzyme solution, then add 100μL of 10mmol / L H2O2 solution to start the reaction. After mixing evenly, place in a 30℃ water bath for 3min, and measure the absorbance change at 310nm.

[0067] (4) Calculation of lignin degradation enzyme activity

[0068]

[0069] Where: ΔOD represents the absorbance change within time t, b is the cuvette thickness (cm), Δt is the reaction time (min), V 总 is the volume of the reaction system (mL), V 酶 is the volume of the enzyme solution in the reaction (mL); ε is the molar extinction number (M -1 cm -1 ), ABTS: ε 420=36000M -1 cm -1 , ε 240 =6500M -1 cm -1 , ε 310 =9300M -1 cm -1 .

[0070] In nature, microorganisms mainly catalyze the decomposition of lignin by producing laccase, lignin peroxidase and manganese peroxidase. Figure 6 The results showed that most of the enzyme activities of the long-branch Trichoderma NT241 strain showed a trend of increasing first and then decreasing over time. Among them, the activity of laccase gradually increased with the progress of cultivation, reaching the first peak of 3.95±0.13U / mL on the third day, and then rapidly decreased and then rose rapidly, reaching the second peak of 10.63±1.72U / mL on the seventh day of cultivation; lignin peroxidase was significantly higher than laccase, and it rose rapidly in the early stage of cultivation, reaching a maximum of 12.62±1.59U / mL on the third day, and then the enzyme activity gradually decreased; manganese peroxidase activity changed the most, rising to a maximum of 80.95±5.93U / mL in the first 6 days, and then began to decrease with time.

[0071] Although Examples 4 and 5 have proved to some extent that the strain has a certain ability to degrade lignocellulose, its actual degradation effect on straw needs further study. Subsequent Examples 7 and 8 will actually apply the strain to the composting of rapeseed and wheat straw.

[0072] Example 6: Preparation of Trichoderma longibrachiatum NT241 bacterial solution

[0073] The growth curve was used to determine the logarithmic phase of the growth of Trichoderma longifolia NT241. At this time, the strain grew well and it was also the best time to prepare the liquid bacterial agent. On the clean bench, the seed liquid was inoculated into 250 mL of PDA liquid culture medium after high temperature sterilization at a 5% (v / v) inoculation amount, and the liquid bacterial agent was obtained after culturing in a constant temperature oscillator at 30°C and 180r / min for 3 to 4 days.

[0074] Example 7: Degradation effect of Trichoderma longibrachiatum NT241 on rape straw and wheat straw

[0075] The long-branch Trichoderma NT241 strain was applied to the degradation of rape straw and wheat straw lignocellulose, and the steps were as follows: the harvested straw was naturally air-dried and mechanically treated to 5-10 cm, and 30 g was weighed and placed in a nylon mesh bag and sterilized at 121°C for 20 minutes for use. After sterilization and cooling, sterile water was sprayed to keep its moisture content at 60%-70%. Four groups were designed in the experiment: 5%, 10%, and 15% of three different bacterial agents were added as test groups, and sterile PDA liquid culture medium was set as a blank group. After mixing evenly, it was cultured at 30°C for 14 days. By observing the changes in the morphological characteristics of the straw during the degradation process and the changes in the quality of lignocellulose before and after degradation, the degradation effect of long-branch Trichoderma NT241 on the two crop straws was comprehensively evaluated.

[0076] (1) Physical changes during straw degradation

[0077] Table 1 Physical changes of straw composting

[0078]

[0079] During the composting process, the change in the physical state of the straw is a direct reflection of the decomposition activity of microorganisms in the composting agent. By observing the changes in color, smell, hardness, etc., we can understand the progress and quality of straw composting. The above table records the physical changes of the straw of two crops during the entire composting process. As can be seen from Table 1, on the 7th day, the straw in the bacterial solution treatment group was attached with bacteria, and even the hyphae were entangled and aggregated. The color gradually deepened, accompanied by a different smell and feel from the control group. As the composting time increased, the color of the straw in the bacterial solution treatment group gradually deepened from yellow-brown to dark brown or dark yellow, and the ammonia smell and slight mud smell changed to the smell of spoiled milk or wine, and the feel gradually softened.

[0080] (2) Degradation effect of lignocellulose

[0081] The components of straw biomass mainly include cellulose, hemicellulose and lignin, which are determined by the ANKOM DELTA automatic fiber analyzer through the improved Van Soest washing method. During the analysis, the sample in the filter bag is washed with an acidic detergent or a neutral detergent, and the cell contents in the sample are removed, leaving the fiber part, which is further weighed and calculated to obtain the result. The specific operation process is as follows:

[0082] (I) Neutral detergent fiber (NDF) determination

[0083] Use a marker to number the filter bags and weigh the bag weight (W1) without pre-drying. Then weigh 0.45-0.55g of sample (W2) into the filter bag, seal the bag 4mm from the bag opening and make sure it is secure. Next, accurately weigh a blank filter bag (C1). If the sample fat content exceeds 5%, it must be defatted first: soak the filter bag in acetone for 10 minutes, wash it repeatedly, remove the filter bag and air dry it. Place the holder with the filter bag in the analyzer, place a metal pressure hammer on the top to ensure that the tray is completely immersed in the liquid surface, and then perform the experiment according to the ANKOM instrument operating method.

[0084] (II) Determination of Acid Detergent Fiber (ADF)

[0085] When measuring NDF and ADF at the same time, you can measure NDF first, then put the filter bag with residue after the measurement on the sample rack, add acid washing solution directly and measure according to the ADF measurement procedure. The subsequent steps are the same as the "NDF measurement" steps, and weigh after drying (W4).

[0086] (III) Determination of acid detergent lignin (ADL)

[0087] After determining the ADF, place the dry filter bag in a beaker and add 72% sulfuric acid to soak the sample. Follow the same steps as the "NDF determination" step, weigh M1 after drying, and record the weight of the blank filter bag as C1. Place the dried and weighed sample in a pre-weighed crucible (M2), and the weight of the blank crucible is C2. After ashing in the muffle furnace, quickly move the crucible to a dryer and cool to a room temperature and weigh M3. The weight of the crucible and ash containing the blank sample is recorded as C3.

[0088] (IV) Calculation

[0089]

[0090] Where: W1 is the mass of the empty bag (g), W2 is the mass of the sample (g), W3 is the sample residue after intermediate washing + the mass of the filter bag (g), W4 is the sample residue after acid washing + the mass of the filter bag (g), and C1 is the correction coefficient of the blank bag (mass after drying / original mass).

[0091] Cellulose, hemicellulose and lignin were calculated according to the following formula:

[0092] Hemicellulose%=NDF%-ADF%

[0093] Cellulose % = ADF % - (ADL % + ash)

[0094]

[0095] In the formula: M1 is the mass of the filter bag dried after acid soaking + sample residue (g), M2 is the constant weight of the crucible (g), M3 is the crucible after ashing + ash (g); C1 is the mass of the blank filter bag dried after acid soaking (g), C2 is the crucible containing the blank sample (g), and C3 is the crucible containing the blank sample after ashing + ash (g).

[0096] After measurement, it can be found that the initial contents of the three components in the straw used in the experiment are: hemicellulose 19.66%, cellulose 42.73%, lignin 20.83%; the initial contents of wheat are: hemicellulose 25.6%, cellulose 32.12%, lignin 18.31%. Figure 7a , Figure 7b as well as Figure 7c As shown in the figure, during the composting process, lignocellulose is continuously consumed and decomposed due to the activity of microorganisms, so the degradation rates of hemicellulose, cellulose and lignin gradually increase.

[0097] As for rape straw, on the 14th day, the hemicellulose degradation rate of the control group was 10.92%, the cellulose degradation rate was 9.50%, and the lignin degradation rate was 23.19%. In contrast, the degradation rate of the bacterial solution treatment group changed more significantly. Overall, the degradation rate of the bacterial solution treatment group increased rapidly from 0 to 7 days, and the increase rate slowed down slightly from 7 to 14 days. At the end of the late degradation, the hemicellulose degradation rate and cellulose degradation rate of the 15% bacterial solution treatment group were 21.58% and 22.16%, respectively, and the lignin degradation rate reached 39.43%.

[0098] As for wheat straw, on the 14th day, the hemicellulose degradation rate of the control group was 15.59%, the cellulose degradation rate was 15.2%, and the lignin degradation rate was 25.20%, and the overall degradation rate was slightly higher than that of the rapeseed control group. During the composting process, there were large differences between the bacterial solution treatment group and the control group, and the action rates were different for different straws. Among them, the degradation rate of the 15% bacterial solution treatment group increased significantly over time, and the final hemicellulose degradation rate and cellulose degradation rate were 38.04% and 33.38% respectively, and the lignin degradation rate was as high as 55.55%.

[0099] Obviously, compared with the two control groups, the addition of bacterial solution can significantly improve the degradation efficiency, and the whole process basically presents 15%>>10%>5%>CK.

[0100] Example 8: Effect of Trichoderma longibrachiatum NT241 on the humus composition of rape straw and wheat straw

[0101] After the cultivation in Example 7 is completed, the humus before and after degradation is determined by sodium pyrophosphate extraction-potassium dichromate oxidation method. The humus in the sample is extracted by a mixture of sodium pyrophosphate and sodium hydroxide, and a part of the extract is used to determine the carbon content to determine the total amount of humic acid and fulvic acid, and the other part is acidified and used to determine the humin content. The fulvic acid content is calculated by the difference between the total amount and the humin content, and the humin content is calculated by the difference between the total carbon content of humus and the carbon content of humic acid. The humification index is the ratio of humic acid to fulvic acid. The higher the value, the higher the degree of decomposition and conversion of organic matter.

[0102] Changes of rape straw humus Figure 8 As shown in the figure, although there were fluctuations in the changes of total humus carbon and humification index in each treatment group, the trends were generally similar and gradually increased over time. Compared with the control group, the total humus carbon and humification index of the bacterial solution treatment group were higher at each sampling period. Under the action of 15% bacterial solution treatment, the total humus carbon of rapeseed straw reached 370.30±7.68g / kg at the end of degradation, and the humification index was 0.92.

[0103] Changes of wheat straw humus Fig. 9 As shown in the figure, the change trend of the indicators in each treatment group is generally similar to the above-mentioned "Changes in rape straw humus", with a certain increase. Under the treatment of 15% bacterial solution, the total carbon of wheat straw humus reached 355.90±8.93g / kg at the end of degradation, and the humification index was 0.98.

[0104] According to Examples 7 and 8, it is proved that the Trichoderma longibrachiatum obtained in this example can degrade the lignocellulose components of rape straw and wheat straw, and has the potential to be applied to straw biodegradation.

[0105] The long-branch Trichoderma NT241 involved in the present invention has a high enzyme production efficiency. When liquid enzyme production is carried out with lignin as the carbon source, the filter paper enzyme is 33.14U / mL on the third day, the incisional β-glucanase is as high as 46.60U / mL on the fourth day, and the manganese peroxidase activity produced on the sixth day is the highest, which is 80.95U / mL. When applied to the degradation of rapeseed and wheat straw lignocellulose, the straw color of the bacterial liquid treatment group on the 14th day is close to dark brown or dark yellow, and the hand feel is soft, and the wheat lignin degradation rate is as high as 55.55%. In addition, in the preparation method of the Trichoderma agent provided by the existing invention, the time is mostly 2 to 7 days of shaking culture or 3 to 14 days of static culture. The preparation of the long-branch Trichoderma NT241 liquid agent provided by the present invention only requires constant temperature shaking culture for 3 to 4 days.

[0106] References

[0107] [1] Zhang Yanping, Zhao Ying, Zhang Yunhui. Screening of mutant strains of Trichoderma longifolia M-1 and study of its fiber degradation characteristics[J]. China Feed, 2023(17): 22-27.

[0108] [2]Wanyun L, Lili Z, Xueli H. Degradation potential of different lignocellulosic residues by Trichoderma longibrachiatum and Trichodermaafroharzianum under solid state fermentation[J]. Process Biochemistry, 2022,112:6-17.

[0109] [3] Huang Yuanyuan, Huang Yali, Ma Huiyuan, et al. A long-branched Trichoderma, its solid microbial agent and application [P]. Chinese Patent: CN201811300671.4, 2020-05-12.

[0110] SEQUENCE LISTING

[0111] Sequence Listing

[0112] <110> Guizhou University

[0113] <120> A kind of long-branched Trichoderma (Trichoderma longibrachiatum) and its application

[0114] <130> 2024

[0115] <160> 1

[0116] <170> PatentIn version 3.5

[0117] <210> 1

[0118] <211> 628

[0119] <212> DNA

[0120] <213> Trichoderma longifolia NT241

[0121] <400> 1

[0122] gcctgcggag ggatcattac cgagtttaca actcccaaac cccaatgtga acgttaccaa 60 tctgttgcct cggcgggatt ctcttgcccc gggcgcgtcg cagccccgga tcccatggcg 120 cccgccggag gaccaactcc aaactctttt ttctctccgt cgcggctccc gtcgcggctc 180 tgttttttt ttgctctgag cctttctcgg cgaccctagc gggcgtctcg aaaatgaatc 240 aaaactttca aaacggatc tcttggttct ggcatcgatg aagaacgcag cgaaatgcga 300 tagtaatgt gaattgcaga attcagtgaa tcatcgaatc tttgaacgca cattgcgccc 360 gccagtattc tggcgggcat gcctgtccga gcgtcatttc aaccctcgaa cccctccggg 420 gggtcggcgt tggggatcgg cccctcaccg ggccgccccc gaaatacagt ggcggtctcg 480 ccgcagcctc tcctgcgcag tagtttgcac actcgcaccg ggagcgcggc gcggccacag 540 ccgtaaaaca ccccaaactt ctgaaatgtt gacctcggat caggtaggaa tacccgctga 600 acttaagcat atcaataagc cggaggaa 628

Claims

1. A Trichoderma longibrachiatum NT241, characterized in that: The deposit number is CGMCC No.41139, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

2. The Trichoderma longibrachiatum NT241 of claim 1, characterized in that: The ITS sequence of the strain is shown in SEQ ID NO.

1.

3. The Trichoderma longibrachiatum NT241 of claim 1, characterized in that: The strain has the activities of laccase, manganese peroxidase, lignin peroxidase, filter paper enzyme and endo-β-glucanase.

4. A method for preparing a liquid bacterial agent of Trichoderma longibrachiatum NT241, characterized in that: The Trichoderma longibrachiatum NT241 strain according to claim 1 is inoculated into a potato dextrose agar (PDA) liquid culture medium, and cultured in a constant temperature oscillator at 30° C. and 180 r / min for 3 to 4 days to obtain a liquid bacterial agent.

5. Use of the liquid bacterial agent Trichoderma longibrachiatum NT241 as claimed in claim 4 in degrading rape straw and wheat straw.

6. The use of the liquid bacterial agent Trichoderma longibrachiatum NT241 according to claim 5 in degrading rape straw and wheat straw, characterized in that: First, the straw is harvested and naturally air-dried, then mechanically processed into 5-10 cm, and then sterilized. Sterile water is sprayed on the sterilized straw to keep the moisture content at 60-70%. Finally, 5-15% of Trichoderma longibrachiatum NT241 liquid fungus agent is added to the straw, mixed evenly, and then composted at 30°C for 14 days.

Images