Hydrogel beads for nucleotide sequencing

Abstract

To provide beads for performing nucleic acid reactions, and a method of encapsulating a genetic material within a hydrogel bead.SOLUTION: A bead for performing nucleic acid reactions comprises: a hydrogel polymer; and a genetic material disposed within the hydrogel, where the bead comprises pores that allow diffusion of a reagent through the bead while retaining the genetic material.SELECTED DRAWING: None

Description

[Technical field]

[0001] (Related Applications) This application claims priority to U.S. Provisional Patent Application No. 62 / 539,956, filed Aug. 1, 2017, entitled "HYDROGEL BEADS FOR NUCLEOTIDE SEQUENCE DETERMINATION," which is incorporated by reference in its entirety.

[0002] The systems, methods, and compositions provided herein relate to hydrogel beads and methods of encapsulating materials within hydrogel beads for use in spatial index sequencing and nucleic acid library generation. [Background technology]

[0003] Next-generation sequencers are powerful tools that generate large amounts of genomic data per sequencing run. Interpreting and analyzing this large amount of data is challenging. Single-cell DNA sequencing has emerged as one tool to study genomic heterogeneity. Specifically, by obtaining DNA sequences from single cells, microbiomes carrying multiple repeated genomic regions can be sequenced. This can greatly simplify downstream sequencing data alignment methods. Summary of the Invention

[0004] Some embodiments provided herein relate to beads for performing nucleic acid reactions. In some embodiments, the beads include a hydrogel polymer and genetic material disposed within the hydrogel polymer. In some embodiments, the beads include pores that allow diffusion of reagents through the beads while retaining the genetic material. In some embodiments, the beads have a diameter of about 2 μm to about 120 μm, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 110, or 120 μm, or a diameter within a range defined by any two of the above values. In some embodiments, the hydrogel polymer is polyethylene glycol (PEG)-thiol, PEG-acrylate, acrylamide, N,N'-bis(acryloyl)cystamine (BACy), PEG, polypropylene oxide (PPO), polyacrylic acid, poly(hydroxyethyl methacrylate) (PHEMA), poly(methyl methacrylate) (PMMA), poly(N-isopropylacrylamide) (PNIPAAm), poly(lactic acid) (PLA), poly(lactic-co-glycolic acid) (PLGA), polycaprolactone (PCL), poly(vinylsulfonic acid) (PVSA), poly(L-aspartic acid), poly(L-glutamic acid), poly(lysine), poly(aminopropylamino)phenyl, ... The hydrogel polymer may be selected from the group consisting of glycerin, agar, agarose, alginate, heparin, sulfated alginate, dextran sulfate, hyaluronan, pectin, carrageenan, gelatin, chitosan, cellulose, collagen, acrylamide, diacrylate, diallylamine, triallylamine, divinylsulfone, diethylene glycol diallyl ether, ethylene glycol diacrylate, polymethyl glycol diacrylate, polyethylene glycol diacrylate, trimethyloleate trimethacrylate, ethoxylated trimethylolpropane triacrylate, or ethoxylated pentaerythritol tetra(meth)acrylate, or combinations thereof. In some embodiments, the hydrogel polymer comprises polyethylene glycol (PEG)-thiol / PEG-acrylate. In some embodiments, the hydrogel polymer comprises acrylamide / N,N'-bis(acryloyl)cystamine (BACy).In some embodiments, the hydrogel polymer comprises PEG / polypropylene oxide (PPO). In some embodiments, the genetic material is a cell, a nucleic acid, or a microbiome. In some embodiments, the cell is a mammalian cell or a bacterial cell. In some embodiments, the cell is an Escherichia coli cell, a Bacillus subtilis cell, an Aeromonas hydrophila cell, or a fibroblast cell. In some embodiments, the nucleic acid is a DNA or RNA of 300 base pairs or more. In some embodiments, the reagent comprises an enzyme, a chemical, and a primer having a size of less than 50 base pairs. In some embodiments, the reagent comprises lysozyme, proteinase K, random hexamers, a polymerase (e.g., Φ29 DNA polymerase, Taq polymerase, Bsu polymerase), a transposase (e.g., Tn5), a primer (P5 and P7 adaptor sequences), a ligase, a catalytic enzyme, a deoxynucleotide triphosphate, a buffer, or a divalent cation.

[0005] Some embodiments provided herein relate to a method of encapsulating genetic material within hydrogel beads. In some embodiments, the method includes mixing a hydrogel polymer and genetic material in a solution, and mixing the solution with an immiscible fluid to form hydrogel beads that encapsulate the genetic material. In some embodiments, the hydrogel beads include pores that allow diffusion of reagents through the hydrogel beads while retaining the genetic material. In some embodiments, the hydrogel beads have a diameter of about 2 μm to about 120 μm, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 110, or 120 μm, or a diameter within a range defined by any two of the above values. In some embodiments, the hydrogel polymer is polyethylene glycol (PEG)-thiol, PEG-acrylate, acrylamide, N,N'-bis(acryloyl)cystamine (BACy), PEG, polypropylene oxide (PPO), polyacrylic acid, poly(hydroxyethyl methacrylate) (PHEMA), poly(methyl methacrylate) (PMMA), poly(N-isopropylacrylamide) (PNIPAAm), poly(lactic acid) (PLA), poly(lactic-co-glycolic acid) (PLGA), polycaprolactone (PCL), poly(vinyl sulfonic acid) (PVSA), poly(L-aspartic acid), poly(L-glutamic acid), poly(aminopropylaminopropylamino)aminopropyl ... The hydrogel polymer may be selected from the group consisting of lysine, agar, agarose, alginate, heparin, sulfated alginate, dextran sulfate, hyaluronan, pectin, carrageenan, gelatin, chitosan, cellulose, collagen, bisacrylamide, diacrylate, diallylamine, triallylamine, divinylsulfone, diethylene glycol diallyl ether, ethylene glycol diacrylate, polymethylene glycol diacrylate, polyethylene glycol diacrylate, trimethylolpropane trimethacrylate, ethoxylated trimethylol triacrylate, or ethoxylated pentaerythritol tetraacrylate, or combinations thereof. In some embodiments, the hydrogel polymer comprises polyethylene glycol (PEG)-thiol / PEG-acrylate.In some embodiments, the hydrogel polymer comprises acrylamide / N,N'-bis(acryloyl)cystamine (BACy). In some embodiments, the hydrogel polymer comprises PEG / polypropylene oxide (PPO). In some embodiments, the genetic material is a cell, a nucleic acid, or a microbiome. In some embodiments, the cell is a mammalian cell or a bacterial cell. In some embodiments, the cell is an Escherichia coli cell, a Bacillus subtilis cell, an Aeromonas hydrophila cell, or a fibroblast cell. In some embodiments, the nucleic acid is DNA or RNA of 300 base pairs or more. In some embodiments, the reagents include enzymes, chemicals, and primers having a size of less than 50 base pairs. In some embodiments, the reagents include lysozyme, proteinase K, random hexamers, polymerases (e.g., Φ29 DNA polymerase, Taq polymerase, Bsu polymerase), transposases (e.g., Tn5), primers (P5 and P7 adapter sequences), ligases, catalytic enzymes, deoxynucleotide triphosphates, buffers, or divalent cations.

[0006] Some embodiments provided herein relate to a method of encapsulating genetic material within hydrogel beads. In some embodiments, the method includes mixing an aqueous solution containing a hydrogel polymer and genetic material with an immiscible fluid, feeding the aqueous solution into a droplet generator, and generating hydrogel beads that encapsulate the genetic material. In some embodiments, the hydrogel beads include pores that allow diffusion of reagents through the hydrogel beads while retaining the genetic material. In some embodiments, the hydrogel beads have a diameter of about 2 μm to about 120 μm, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 110, or 120 μm, or a diameter within a range defined by any two of the above values. In some embodiments, the hydrogel polymer is polyethylene glycol (PEG)-thiol, PEG-acrylate, acrylamide, N,N'-bis(acryloyl)cystamine (BACy), PEG, polypropylene oxide (PPO), polyacrylic acid, poly(hydroxyethyl methacrylate) (PHEMA), poly(methyl methacrylate) (PMMA), poly(N-isopropylacrylamide) (PNIPAAm), poly(lactic acid) (PLA), poly(lactic-co-glycolic acid) (PLGA), polycaprolactone (PCL), poly(vinylsulfonic acid) (PVSA), poly(L-aspartic acid), poly(L-glutamic acid), polylysine, agar, , agarose, alginate, heparin, sulfated alginate, dextran sulfate, hyaluronan, pectin, carrageenan, gelatin, chitosan, cellulose, collagen, bisacrylamide, diacrylate, diallylamine, triallylamine, divinyl sulfone, diethylene glycol diallyl ether, ethylene glycol diacrylate, polymethylene glycol diacrylate, polyethylene glycol diacrylate, trimethylolpropane trimethacrylate, ethoxylated trimethylol triacrylate, or ethoxylated pentaerythritol tetraacrylate, or combinations thereof.In some embodiments, the hydrogel polymer comprises polyethylene glycol (PEG)-thiol / PEG-acrylate. In some embodiments, the hydrogel polymer comprises acrylamide / N,N'-bis(acryloyl)cystamine (BACy). In some embodiments, the hydrogel polymer comprises PEG / polypropylene oxide (PPO). In some embodiments, the genetic material is a cell, a nucleic acid, or a microbiome. In some embodiments, the cell is a mammalian cell or a bacterial cell. In some embodiments, the cell is an Escherichia coli cell, a Bacillus subtilis cell, an Aeromonas hydrophila cell, or a fibroblast cell. In some embodiments, the nucleic acid is DNA or RNA of 300 base pairs or more. In some embodiments, the reagents include enzymes, chemicals, and primers having a size of less than 50 base pairs. In some embodiments, the reagents include lysozyme, proteinase K, random hexamers, a polymerase (e.g., Φ29 DNA polymerase, Taq polymerase, Bsu polymerase), a transposase (e.g., Tn5), primers (P5 and P7 adapter sequences), a ligase, a catalytic enzyme, deoxynucleotide triphosphates, a buffer, or a divalent cation.

[0007] Some embodiments provided herein relate to a method of preparing a nucleic acid library from genetic material encapsulated in beads. In some embodiments, the method includes obtaining beads having genetic material disposed therein, amplifying the genetic material encapsulated in the beads, performing a tagmentation reaction on the genetic material encapsulated in the beads, and sequencing the genetic material, thereby generating a nucleic acid library encapsulated in the beads, as described herein. In some embodiments, the genetic material is cells, and the method further includes lysing the cells to extract nucleic acids. In some embodiments, the cells are lysed with lysozyme and treated with proteinase K to extract nucleic acids. In some embodiments, the tagmentation reaction includes contacting the genetic material with a transposase mixture comprising adapter sequences and transposomes. In some embodiments, the method further includes seeding the nucleic acid library on a solid support. In some embodiments, seeding includes disintegrating the beads to release the nucleic acid library from the beads. In some embodiments, the beads are disintegrated by contacting the beads with a cleavage mixture or by heating the beads to about 90° C. to release the nucleic acid library. In some embodiments, the cleavage mixture comprises dithiothreitol (DTT), tris(2-carboxyethyl)phosphine (TCEP), or tris(3-hydroxypropyl)phosphine (THP). In some embodiments, the solid support is a flow cell device. [Brief description of the drawings]

[0008] [Figure 1A] FIG. 1 is a schematic diagram illustrating an embodiment of preparation of hydrogel beads by manual stirring. [Figure 1B] 1 is a photomicrograph image showing beads formed by this method, which were found to range in diameter from about 2 μm to about 100 μm. [Figure 2A] FIG. 1 is a schematic diagram illustrating an embodiment for preparing hydrogel beads using a microfluidic droplet generator. [Figure 2B]1 is a micrograph image showing beads formed by this method, the beads having a uniform size based on the dimensions of the microfluidic droplet generator. [Diagram 3] 2B includes a line graph showing the effect of adding various concentrations of isopropyl alcohol to the hydrogel polymer using a similar microfluidic droplet generator as described in FIG. 2A, and shows some micrographs of hydrogel polymers of different sizes. [Figure 4] Micrographs of fluorescent dye-stained bacterial cells trapped in hydrogels of different sizes. FIG. 4A shows hydrogel beads of about 100 μm diameter encapsulating many bacterial cells, and FIG. 4B shows hydrogel beads of about 10 μm diameter encapsulating one or two bacterial cells. [Figure 5A] 1 illustrates an embodiment for functionalizing hydrogel beads with oligonucleotides. [Figure 5B] 1 shows micrographs of oligonucleotide-functionalized hydrogel beads with and without azidation. [Figure 5C] FIG. 1 shows a micrograph of poly-T functionalized hydrogel beads capturing SeqB sequences. [Figure 5D] Electrochromatograms of DNA after second strand synthesis (right curve) and after tagmentation (left curve) are shown. [Figure 6] 6A and 6B are micrographs showing mouse fibroblast cells (NIH-3T3) encapsulated within hydrogel beads: Figure 6A shows a single cell being encapsulated under fast gelling conditions, and Figure 6B shows multiple cells being encapsulated by the hydrogel under slow gelling conditions. [Figure 7A] An embodiment of a method for producing a hydrogel polymer having disulfide bonds that are cleavable in the presence of a reducing agent such as dithiothreitol (DTT), tris(2-carboxyethyl)phosphine (TCEP), or tris(3-hydroxypropyl)phosphine (TUP) is provided. [Figure 7B]FIG. 1 shows a micrograph of chemically cleaved hydrogel beads, allowing for the release of encapsulated genetic material. [Figure 7C] 1 is a micrograph illustrating the release of encapsulated genetic material from hydrogel beads. [Figure 8A] The steps for one embodiment of using encapsulated genetic material for in-gel barcoding using combinatorial indexing are described. [Figure 8B] The steps for one embodiment of using encapsulated genetic material to sequence single bacterial cells encapsulated within hydrogel beads are described. [Figure 8C] We describe the steps for one embodiment of using encapsulated genetic material for in-gel barcoding using barcoded transposome complexes assembled thereon, or beads containing barcoded oligonucleotides inserted into tagged fragmented DNA by polymerase chain reaction (PCR). [Figure 9] FIG. 1 illustrates the steps for DNA amplification in hydrogel beads: bacterial cells are encapsulated in hydrogel beads, the captured cells are lysed with lysozyme and proteins are denatured using proteinase K, in panel a) gDNA in the encapsulated beads is amplified using multiple displacement amplification (MDA), in panel b) the DNA is tagged, fragmented and amplified by PCR, in panel c) the tagged, fragmented DNA is eluted from the hydrogel beads by heating the hydrogel beads to 90° C. Images show the fluorescence intensity of DNA stained with SYTOX intercalator dye. [Figure 10]FIG. 1 shows micrographs illustrating the release of a DNA library onto a solid surface for seeding and clustering processing. Panel a) shows a single hydrogel bead with tagged fragmented bacterial genomes, which is loaded onto a solid surface with P5 and P7 primers immobilized thereon; panel b) shows the eluted, seeded, and isothermally bridge amplified single-stranded DNA; panel c) shows the gradient cluster density of the seeded amplified DNA, where the DNA is stained with SYTOX intercalator dye. [Figure 11A] 1 is a line graph showing a bioanalyzer trace of a DNA library obtained from a 12-cycle PCR of the supernatant containing the genetic material released from the hydrogel beads by heating to 90° C. [Figure 11B] The hydrogel beads are not heated, therefore the DNA library is not released from the hydrogel beads and the library is not visible. [Figure 12] FIG. 1 shows spatial confinement of DNA sequencing clusters. Panel (a) shows the first sequence readout of two uniquely indexed DNA libraries originating from two separate hydrogel beads, and panel (b) shows the spatial separation of the two libraries; the separated libraries are spatially distinct and originate from different hydrogel beads, as shown in the micrograph image in panel (c). [Figure 13] Shown is a micrograph of the first sequencing data of bar-coded hydrogel bead libraries from three different bacterial cells (Bsubtilis, E. coli, and A. hydrophila) with spatial separation. [Figure 14A] 1 shows sequencing criteria for spatially indexed B. subtilis, E. coli, and A. hydrophila libraries released from hydrogel beads onto a low-cell surface. [Figure 14B] 1 shows sequencing criteria for spatially indexed B. subtilis, E. coli, and A. hydrophila libraries released from hydrogel beads onto the flow cell surface. [Figure 15] 15A-C show MiSeq sequencing results of flow cells seeded with hydrogel beads containing B.subtilis, E. coli, or A. hydrophila bacteria, where FIG. 15A is an image showing raw data from the MiSeq microscope, FIG. 15B is an image showing different microbial clusters aligned to specific genomes, e.g., the dots are clusters aligned to the E. coli genome showing group distribution patterns, and FIG. 15C is a summary table of pass filters for three different bacterial species. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0009] In the following detailed description, reference is made to the accompanying drawings, which form a part of this specification. In the drawings, like numerals typically identify like elements unless otherwise specified. The exemplary embodiments described in the detailed description, drawings, and claims are not intended to be limiting. Other embodiments may be utilized, and other changes may be made without departing from the spirit or scope of the subject matter presented herein. It is readily understood that aspects of the present disclosure, as generally described herein and illustrated in the drawings, can be arranged, substituted, combined, separated, and designed in a wide variety of different configurations, all of which are expressly contemplated herein.

[0010] Embodiments of the compositions, systems and methods provided herein relate to beads that encapsulate genetic material. The beads can include a hydrogel polymer and a crosslinker that are mixed in the presence of genetic material to form hydrogel beads that encapsulate the genetic material. In some embodiments, the genetic material includes nucleic acids, cells, microbiomes, or genomes. The hydrogel beads can include pores that allow diffusion of reagents through the hydrogel beads while retaining the genetic material within the beads, thereby allowing reactions to occur within the beads. Also provided are methods of performing nucleic acid reactions using beads encapsulating genetic material.

[0011] Some embodiments relate to methods of preparing hydrogel beads that encapsulate whole single cells. In some embodiments, hydrogel beads that encapsulate single cells can be used to process cell genomes and perform total DNA library generation in beads. In some embodiments, hydrogel beads that encapsulate single cells can be used to simultaneously process cell genomic DNA and mRNA and perform total DNA library generation in beads. The pore size of the hydrogel can be designed to allow diffusion of enzymes, chemicals, and smaller size primers (300 bps), so that the complete total genomic DNA, mRNA, and generated DNA library can be retained within the hydrogel beads during the entire method. In some embodiments, specific primers can be chemically bound within the hydrogel bead matrix to hybridize and process specific genomic DNA or mRNA. The DNA library from a single cell can then be released to a specific area on the flow cell surface for example library seeding. The resulting spatial distribution of "DNA clusters" on the flow cell from individual cells results in simplified read alignment during post-processing.

[0012] The hydrogel encapsulation method can be used for other complex library creation operations, such as single-cell genomic / transcriptomic applications, because it allows the retention of nucleic acid molecules within the hydrogel while allowing the exchange of reagents for performing various enzymatic / chemical operations on the DNA molecules. This method improves the utility of single-cell genomics for microbial species to perform various lysis and library creation workflows, compared to the current technique of FACS sorting of microorganisms into microwells, which was found to be low throughput (96 or 384 cells per plate). The method described herein allows the conversion of hundreds of thousands of microorganisms into barcoded libraries in an efficient manner.

[0013] The term "reagent" as used herein describes an agent or mixture of two or more agents useful for reacting, interacting, diluting, or adding to a sample, and may include agents used in nucleic acid amplification reactions, such as, for example, buffers, chemicals, enzymes, polymerases, primers with a size of less than 50 base pairs, template nucleic acids, nucleotides, labels, dyes, or nucleases. In some embodiments, the reagents include lysozyme, proteinase K, random hexamers, polymerases (e.g., Φ29 DNA polymerase, Taq polymerase, Bsu polymerase), transposases (e.g., Tn5), primers (e.g., P5 and P7 adapter sequences), ligases, catalytic enzymes, deoxynucleotide triphosphates, buffers, or divalent cations.

[0014] Hydrogel beads encapsulating genetic material One embodiment includes beads containing hydrogel polymers and genetic material. As used herein, the term "hydrogel" refers to a material formed when organic polymers (natural or synthetic) are crosslinked by covalent, ionic, or hydrogen bonds to form a three-dimensional open lattice structure that traps water molecules to form a gel. In some embodiments, the hydrogel may be a biocompatible hydrogel. As used herein, the term "biocompatible hydrogel" refers to a polymer that forms a gel that is not toxic to living cells and allows sufficient diffusion of oxygen and nutrients to the entrapped cells to maintain viability. In some embodiments, the hydrogel polymer comprises 60-90% fluid, such as water, and 10-30% polymer. In some embodiments, the water content of the hydrogel is about 70-80%.

[0015] Hydrogels may be prepared by crosslinking hydrophilic biopolymers or synthetic polymers. Thus, in some embodiments, hydrogels may include a crosslinker. As used herein, the term "crosslinker" refers to a molecule that can form a three-dimensional network when reacted with a suitable basic monomer. Examples of hydrogel polymers that may include one or more crosslinkers include, but are not limited to, hyaluronan, chitosan, agar, heparin, sulfate, cellulose, alginate (including sulfated alginate), collagen, dextran (including dextran sulfate), pectin, carrageenan, polylysine, gelatin (including gelatin type A), agarose, (meth)acrylic acid-oligo-PEO-oligo-(meth)acrylate, PEO-PPO-PEO copolymer (Pluronics), poly(phosphazene), poly(methacrylate), poly(N-vinylpyrrolidone), PL(G)A-PEO-PL(G)A copolymer, poly(meth)acrylate ... (ethyleneimine), polyethylene glycol (PEG)-thiol, PEG-acrylate, acrylamide, N,N'-bis(acryloyl)cystamine, PEG, polypropylene oxide (PPO), polyacrylic acid, poly(hydroxyethyl methacrylate) (PHEMA), poly(methyl methacrylate) (PMMA), poly(N-isopropylacrylamide) (PNIPAAm), poly(lactic acid) (PLA), poly(lactic acid-co-glycolic acid) (PLGA), polycaprolactone (PCL), poly(vinyl sulfonic acid) (PVSA), poly(L-aspartic acid), poly(L-glutamic acid), bisacrylamide, diacrylate , diallylamine, triallylamine, divinyl sulfone, diethylene glycol diallyl ether, ethylene glycol diacrylate, polymethyl glycol diacrylate, polyethylene glycol diacrylate, trimethyloctadecane trimethacrylate, ethoxylated trimethylolpropane triacrylate, or ethoxylated pentaerythritol tetraacrylate, or combinations thereof.Thus, for example, a combination may include a polymer and a crosslinker, such as polyethylene glycol (PEG)-thiol / PEG-acrylate, acrylamide / N,N'-bis(acryloyl)cystamine (BACy), or PEG / polypropylene oxide (PPO).

[0016] In some embodiments, the crosslinker forms disulfide bonds in the hydrogel polymers. As shown in FIG. 7A, the crosslinker can form disulfide bonds, thereby linking the hydrogel polymers. In some embodiments, the hydrogel polymers form a hydrogel matrix with pores (e.g., a porous hydrogel matrix). These pores can hold genetic material large enough within the hydrogel bead, but allow smaller materials, such as reagents, to pass through the pores, thereby passing in and out of the hydrogel bead. In some embodiments, the pore size is fine-tuned by varying the ratio of the concentration of the polymer to the concentration of the crosslinker. In some embodiments, the ratio of polymer to crosslinker is 30:1, 25:1, 20:1, 19:1, 18:1, 17:1, 16:1, 15:1, 14:1, 13:1, 12:1, 11:1, 10:1, 9:1, 8:1, 7:1, 6:1, 5:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, 1:30, or a ratio within a range defined by any two of the foregoing ratios. In some embodiments, additional functionality such as DNA primers or charged chemical groups can be grafted onto the polymer matrix to meet the requirements of different applications.

[0017] As used herein, the term "porosity" refers to the volume fraction (dimensionless) of a hydrogel that is composed of open space, e.g., pores or other openings. Porosity thus measures the void space in a material and is the volume fraction of voids relative to the total volume as a percentage from 0 to 100% (or 0 to 1). The porosity of a hydrogel may range from 0.5 to 0.99, from about 0.75 to about 0.99, or from about 0.8 to about 0.95.

[0018] The hydrogel can have any pore size. The term "pore size" as used herein means the cross-sectional diameter or effective diameter of the pore. The term "pore size" may also mean the average cross-sectional diameter or average effective diameter of the pore based on measurements of multiple pores. The effective diameter of a non-circular cross-section is equal to the diameter of a circular cross-section having the same cross-sectional area as the non-circular cross-section. In some embodiments, the hydrogel can swell when the hydrogel is hydrated. The size of the pore size can then change depending on the water content in the hydrogel. In some embodiments, the pores of the hydrogel may have pores large enough to retain genetic material within the hydrogel, but allow reagents to pass through.

[0019] In some embodiments, the crosslinker is a reversible crosslinker. In some aspects, the reversible crosslinker can reversibly crosslink the hydrogel polymers and not crosslink in the presence of a cleaver. In some embodiments, the crosslinker can be cleaved by the presence of a reducing agent, high temperature, or an electric field. In some embodiments, the reversible crosslinker can be N,N'-bis(acryloyl)cystamine, a reversible crosslinker for polyacrylamide gels, where disulfide bonds can be broken in the presence of a suitable reducing agent. As shown in Figures 6A and 6B, contacting the crosslinker with a reducing agent breaks the disulfide bonds of the crosslinker and destroys the hydrogel beads. The hydrogel beads break down and release the contents, such as nucleic acids, held therein, as shown in Figure 7C. In some embodiments, the crosslinker is cleaved by increasing the temperature to above 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100°C. In some embodiments, the crosslinker is cleaved by contacting the hydrogel beads with a reducing agent. In some embodiments, the reducing agent includes phosphine compounds, water-soluble phosphines, nitrogen-containing phosphines and their salts and derivatives, dithioerythritol (DTE), dithiothreitol (DTT) (cis and trans isomers of 2,3-dihydroxy-1,4-dithiobutane, respectively), 2-mercaptoethanol or β-mercaptoethanol (BME), 2-mercaptoethanol or aminoethanethiol, glutathione, thioglycolate or thioglycolic acid, 2,3-dimercaptopropanol, tris(2-carboxyethyl)phosphine (TCEP), tris(hydroxymethyl)phosphine (THP), or p-[tris(hydroxymethyl)phosphine]propionic acid (THPP).

[0020] In some embodiments, increasing diffusion by increasing temperature or contact with a reducing agent decomposes the crosslinker, thereby releasing the encapsulated genetic material from the hydrogel beads.

[0021] In some embodiments, crosslinking of the crosslinker forms pores in the hydrogel beads. In some embodiments, the pore size in the hydrogel beads is adjustable and formulated to encapsulate genetic material such as cells or nucleic acids greater than about 300 base pairs, but allow smaller particles such as reagents, or smaller size nucleic acids less than about 50 base pairs, such as primers, to pass through the pores. In some embodiments, the reagents include reagents for isolating nucleic acids from cells, for amplifying or sequencing nucleic acids, or for processing genetic material, such as reagents for preparing nucleic acid libraries. In some aspects, the reagents include, for example, lysozyme, proteinase K, random hexamers, polymerases (e.g., Φ29 DNA polymerase, Taq polymerase, Bsu polymerase), transposases (e.g., Tn5), primers (e.g., P5 and P7 adaptor sequences), ligases, catalytic enzymes, deoxynucleotide triphosphates, buffers, or divalent cations.

[0022] In some embodiments, the hydrogel beads contain genetic material. Genetic material as used herein refers to a cell, a microbiome, or a nucleic acid. In some embodiments, the cell is a single cell, including a prokaryotic cell or a eukaryotic cell. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a human cell. In some embodiments, the cell is a bacterial cell. In some embodiments, the genetic material is a viral particle. In some embodiments, the nucleic acid is a long DNA molecule, genomic DNA, a viral nucleic acid, a bacterial nucleic acid, or a mammalian nucleic acid. Any genetic material may be encapsulated within the hydrogel beads.

[0023] How are the beads manufactured? Some embodiments provided herein relate to a method for producing beads that encapsulate genetic material. In some embodiments, the hydrogel beads are prepared by vortex-assisted emulsion. As used herein, vortex-assisted emulsion refers to the mixing of genetic material and hydrogel polymer in a container, such as a tube, vial, or reaction vessel, as shown in Figures 1A and 1B. The components can be mixed, for example, by manual or mechanical stirring or shaking. In some embodiments, manual mixing results in hydrogel beads that encapsulate genetic material with a diameter of 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, or 150 μm, or a size within a range defined by any two of the above values. In some embodiments, the size of the beads is non-uniform, and thus the size of the beads includes beads of various diameters.

[0024] In some embodiments, the beads are prepared by microfluidic flow techniques. Microfluidic flow includes the use of a microfluidic device 200 for assisted gel emulsion generation, as shown in FIG. 2A. In some embodiments, the microfluidic device 200 includes microchannels configured to generate hydrogel beads 210 of a desired size and configured to encapsulate a selected amount of genetic material per bead. In some embodiments, the microfluidic device 200 has a height of 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 μm, or a height within a range defined by any two of the above values. In some embodiments, the microfluidic device 200 includes one or more channels. In some embodiments, the microfluidic device 200 includes a channel 215 for an aqueous stream and a channel 220 for an immiscible fluid. In some embodiments, the width of the one or more channels is the same. In some embodiments, the width of the one or more channels is different. In some embodiments, the width of one or more channels is 20, 30, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 μm, or a width within a range defined by any two of the above values. In some embodiments, the width of the aqueous channel is 75 μm. In some embodiments, the width of the immiscible fluid channel is 78 μm. One skilled in the art will recognize that the width can be varied to fine-tune the size of the beads 210. In addition to the size of the microfluidic device 200 and the width of the channels, the flow rates of the aqueous and immiscible fluid channels can also affect the size of the hydrogel beads.

[0025] In some embodiments, the flow rate of the solution in the aqueous phase channel is 1, 2, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, or 150 μL / min, or a flow rate within a range defined by any two of the above values. In some embodiments, the flow rate of the immiscible fluid in the immiscible fluid channel is 20, 30, 50, 80, 100, 150, 160, 170, 180, 190, 200, 225, 250, 275, 300, 325, 350, 375, or 400 μL / min, or a flow rate within a range defined by any two of the above values. In some embodiments, the solution in the aqueous phase includes a hydrogel polymer, a crosslinker, and a genetic material, which flows through the aqueous channel 215 into an immiscible fluid, such as a carrier oil, at a flow rate less than the flow rate of the immiscible fluid through the aqueous channel 215, thereby forming droplets. In some embodiments, the immiscible fluid is an oil, such as a mineral oil, a hydrocarbon oil, a silicone oil, or a polydimethylsiloxane oil, or a mixture thereof. In some embodiments, the hydrogel droplets containing the genetic material are formulated with a uniform size distribution. In some embodiments, the size of the hydrogel beads is fine-tuned by adjusting the size of the microfluidic device, the size of one or more channels, or the flow rate of either the aqueous solution or the immiscible fluid, or both. In some embodiments, the resulting hydrogel beads have a diameter in the range of 2 to 150 μm, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, or 150 μm, or have a diameter within a range defined by any two of the above values.

[0026] In some embodiments, the size and uniformity of the hydrogel beads encapsulating the genetic material can be further controlled by contacting the hydrogel polymer with a fluid modifier, such as an alcohol, including isopropyl alcohol, prior to bead formation. As shown in Figure 3, in the absence of isopropyl alcohol, beads of larger diameter are formed than beads formed in the presence of isopropyl alcohol. Isopropyl alcohol affects the fluid properties of the hydrogel polymer, allowing for tuning of the hydrogel beads.

[0027] In some embodiments, the hydrogel beads, whether prepared by vortex-assisted emulsion or microfluidic inertial flow-assisted emulsion, encapsulate single or distinct genetic material. For example, in some embodiments, the beads encapsulate single cells. In some embodiments, the amount of genetic material in the beads can be controlled by diluting or concentrating the genetic material in the input sample. The sample containing the genetic material is mixed with the hydrogel polymer, and the hydrogel polymer containing the genetic material is subjected to vortex-assisted emulsion or microfluidic flow-assisted emulsion as described herein.

[0028] In some embodiments, the hydrogel beads are functionalized with nucleotides. In some embodiments, the nucleotides are oligonucleotides or poly-T nucleotides. In some embodiments, the nucleotides are bound to the hydrogel beads, and the functionalized beads can be used for targeted capture of the nucleotides of interest.

[0029] Methods for processing genetic material within hydrogel beads Some embodiments provided herein relate to methods of processing genetic material within beads. In some embodiments, the genetic material encapsulated within the hydrogel beads is contacted with one or more reagents for nucleic acid processing. In some embodiments, the genetic material is retained within the hydrogel beads and the reagents can pass through the pores of the hydrogel beads. In some embodiments, the reagents can include lysis agents, nucleic acid purification agents, DNA amplification agents, labeling agents, PCR agents, or other agents used in processing the genetic material. In this way, the hydrogel beads provide a microenvironment for controlled reaction of the genetic material within the hydrogel beads by allowing a barrier of reagents to pass in and out of the hydrogel beads while retaining the genetic material itself within the hydrogel beads.

[0030] The term "tagmentation" as used herein refers to the denaturation of DNA by a transposome complex containing a transposase enzyme complexed with an adaptor containing a transposon end sequence. Tagmentation results in simultaneous fragmentation of DNA and ligation of adaptors to the 5' ends of both strands of both strand fragments. Following a purification step to remove the transposase enzyme, additional sequences can be added to the ends of the adapted fragments, for example by PCR, ligation, or any other suitable method known to those skilled in the art. In some embodiments, the entire DNA library creation can be seamlessly accomplished within the hydrogel beads with multiple reagent exchanges by passing the gDNA and its library products through a porous hydrogel while retaining the gDNA and its library products within the hydrogel matrix. The hydrogel may be resistant to high temperatures up to 95°C for several hours to support different biochemical reactions.

[0031] In some embodiments, hydrogel beads encapsulating cells or viral particles are treated to purify and isolate nucleic acids from the cells or particles. Thus, for example, the hydrogel beads are contacted with a lysis buffer. As used herein, "lysis" refers to a perturbation or change to the cell wall or viral particle that facilitates access to or promotes the release of cellular RNA or DNA. Neither complete destruction nor damage of the cell wall is a necessary requirement for lysis. The term "lysis buffer" refers to a buffer containing at least one lysis agent. Exemplary enzymatic lysis agents include, but are not limited to, lysozyme, glucolase, zymolose, lyticase, proteinase K, proteinase E, and viral endolysins and exolysins. Thus, for example, lysis of cells in the beads may be performed by introducing lysis agents such as lysozyme and proteinase K into the hydrogel beads. gDNA from the cells is now contained within the beads. In some embodiments, after lysis treatment, the isolated nucleic acids may be retained within the hydrogel beads and used for further processing.

[0032] As used herein, "isolated," "to isolate," "isolation," "purified," "to purify," "purification," and grammatical equivalents thereof as used herein, unless otherwise specified, refer to a reduction in the amount of at least one contaminant (protein and / or nucleic acid sequence) from a sample or source (e.g., a cell) from which the material is isolated. Purification thus results in "enrichment," e.g., an increase in the amount of a desired protein and / or nucleic acid sequence in a sample.

[0033] Lysis and isolation of the nucleic acid may be followed by amplification, such as multiple displacement amplification (MDA), which is a widely used technique for amplifying small amounts of DNA, particularly from single cells. In some embodiments, the encapsulated nucleic acid is amplified, sequenced, or used for preparation of a nucleic acid library. As used herein, the terms "amplify" or "amplified" and "amplifying" when used in reference to a nucleic acid or a nucleic acid reaction refer to an in vitro method of making copies of a specific nucleic acid, such as a target nucleic acid or a nucleic acid encapsulated in a bead, for example, by an embodiment of the present invention. Numerous methods of amplifying nucleic acids are known in the art, and amplification reactions include polymerase chain reaction, ligase chain reaction, strand displacement amplification reaction, rolling circle amplification reaction, multiple annealing and looping based amplification cycles (MALBAC), transcription-mediated amplification methods such as NASBA, and loop-mediated amplification methods (e.g., "LAMP" amplification using a loop-forming sequence). The nucleic acid to be amplified may be DNA that comprises, consists of, or is derived from DNA or RNA, or a mixture of DNA and RNA, including denatured DNA and / or denatured RNA. The products resulting from the amplification of a nucleic acid molecule (e.g., "amplification products") may be nucleosides or nucleotides of either DNA or RNA, or a mixture of both DNA and RNA, regardless of whether the starting nucleic acid is DNA, RNA, or both, or they may contain nucleosides or nucleotides of denatured DNA or RNA. A "copy" does not necessarily mean perfect sequence complementarity or sequence identity to the target sequence. For example, the copy may contain nucleotide analogs such as deoxyinosine or deoxyuridine, deliberate sequence changes (e.g., sequence changes introduced via primers that contain sequences that are complementary but not complementary to the target sequence), and / or sequence errors that occur during amplification.

[0034] The encapsulated nucleic acid isolated within the hydrogel beads can be amplified according to any suitable amplification method known in the art. In some embodiments, the encapsulated nucleic acid is amplified within the beads. In some embodiments, the beads are captured on a solid support, degraded, the encapsulated nucleic acid is released onto the solid support, and the nucleic acid is amplified on the solid support.

[0035] In some embodiments, the encapsulated nucleic acid is amplified within the hydrogel bead, for example, in some embodiments, amplification primers and enzymes pass through the pores of the hydrogel bead and hybridize to the encapsulated nucleic acid.

[0036] It is understood that any of the amplification methods described herein or generally known in the art can be utilized with universal or target-specific primers to amplify the encapsulated nucleic acid. Suitable methods for amplification include, but are not limited to, polymerase chain reaction (PCR), strand displacement amplification (SDA), transcription mediated amplification (TMA) and nucleic acid sequence based amplification (NASBA), as described in U.S. Pat. No. 8,003,354, which is incorporated herein by reference in its entirety. The above amplification methods can be used to amplify one or more nucleic acids of interest. For example, PCR, including multiplex PCR, SDA, TMA, NASBA, etc., can be utilized to amplify the encapsulated nucleic acid. In some embodiments, a primer specifically directed to the nucleic acid of interest is included in the amplification reaction.

[0037] Other suitable methods for amplification of nucleic acids include oligonucleotide extension and ligation, rolling circle amplification (RCA) (Lizardi et al., Nat. Genet. 19:225-232 (1998), incorporated herein by reference) and oligonucleotide ligation assay (OLA) techniques (see generally U.S. Pat. Nos. 7,582,420, 5,185,243, 5,679,524, and 5,573,907; European Patent Nos. 0320308B1, ... For example, in some embodiments, the amplification method can include a ligation probe amplification or oligonucleotide ligation assay (OLA) reaction that includes a primer specifically directed to the nucleic acid of interest. In some embodiments, the amplification method can include a primer extension ligation reaction that includes a primer specifically directed to the nucleic acid of interest and can pass through the hydrogel pores. As a non-limiting example of primer extension and ligation primers that can be specifically designed to amplify the nucleic acid of interest, the amplification can include primers used in the GoldenGate assay (Illumina, Inc., San Diego, Calif.), as exemplified in U.S. Pat. Nos. 7,582,420 and 7,611,869, each of which is incorporated herein by reference in its entirety. In each of the methods described, the reagents and components involved in the nucleic acid reaction can pass through the pores of the hydrogel beads while retaining the nucleic acid itself within the hydrogel beads.

[0038] In some embodiments, the encapsulated nucleic acid is amplified using cluster amplification, as exemplified by the disclosures of U.S. Patent Nos. 7,985,565 and 7,115,400, the contents of each of which are incorporated herein by reference in their entirety. U.S. Patent Nos. 7,985,565 and 7,115,400 describe a method of nucleic acid amplification that allows the amplification products to be immobilized on a solid support to form an array consisting of clusters or "colonies" of immobilized nucleic acid molecules. Each cluster or colony on such an array is formed from a plurality of identical immobilized polynucleotide strands and a plurality of identical immobilized complementary polynucleotide strands. The array thus formed is generally referred to herein as a "clustered array." The product of a solid-phase amplification reaction as described in US Patent Nos. 7,985,565 and 7,115,400 is a so-called "bridged" structure formed by annealing a pair of immobilized polynucleotide strands and immobilized complementary strands, both strands being immobilized on a solid support at their 5' ends, preferably via covalent bonds. An example of a method for generating immobilized amplicons using immobilized nucleic acid templates. Other suitable methods can also be used to generate immobilized amplicons from immobilized DNA fragments produced according to the methods provided herein. For example, one or more clusters or colonies can be formed by solid-phase PCR, whether or not one or both primers of each pair of amplification primers are immobilized. In some embodiments, the encapsulated nucleic acids are amplified within the beads and then deposited on a solid support in an array or cluster. For example, as shown in FIG. 12, hydrogel beads encapsulating nucleic acids were treated to form two different indexed DNA libraries with the nucleic acids contained therein. Two types of hydrogel beads containing ΦX libraries were prepared, one with index 2 (CGATGT) and the other with index 4 (TGACCA). Hydrogel beads with index 2 and index 4 were mixed and packed into a flow cell. The beads were contacted with a surface, allowed to disintegrate, and the library was attached to the surface.The micrograph shows nucleic acid imaging showing clusters formed based on distinct environments within distinct beads. The image shows spatial separation between the Index 2 and Index 4 libraries, indicating that these libraries originate from different hydrogel beads. Scale bar = 50 μm.

[0039] Further amplification methods include isothermal amplification.Exemplary isothermal amplification methods that can be used include, but are not limited to, multiple displacement amplification (MDA), as exemplified by, for example, Dean et al., Proc. Natl. Acad. Sci. USA, 99:5261-66 (2002), or isothermal strand displacement nucleic acid amplification, as exemplified, for example, in U.S. Patent No. 6,214,587, each of which is incorporated herein by reference in its entirety. Other non-PCR-based methods that can be used in the present disclosure include strand displacement amplification (SDA), as described, for example, in Molecular Methods for Virus Detection by Walker et al., Academic Press, Inc., 1995; U.S. Patent Nos. 5,455,166, 5,130,238, and Walker et al., Nucl.Acids Res.20:1691-96 (1992), or hyperbranched strand displacement amplification, as described, for example, in Genome Research 13:294-307 (2003), by Lage et al., each of which is incorporated herein by reference in its entirety. Isothermal amplification methods may be used with strand-displacing φ29 polymerase or Bst DNA polymerase large fragment, 5'->3'exo- for random-primed amplification of genomic DNA. The use of these polymerases takes advantage of their high processivity and strand displacement activity. High processivity allows the polymerase to generate fragments that are 10-20 kb in length. As noted above, smaller fragments can be produced under isothermal conditions using polymerases with low processivity and strand displacement activity, such as Klenow polymerase. Further description of the amplification reactions, conditions and components are described in detail in the disclosure of U.S. Pat. No. 7,670,810, which is incorporated herein by reference in its entirety. In some embodiments, the polymerase, reagents, and components required to perform these amplification reactions can pass through the pores of the hydrogel beads to interact with the encapsulated nucleic acid, thereby amplifying the nucleic acid within the hydrogel beads. In some embodiments, random hexamers are annealed to denatured DNA and then strand-displacement synthesized at constant temperature in the presence of the catalytic enzyme, Φ29.This results in DNA amplification within the beads, as confirmed by an increase in fluorescence intensity (DNA stained with SYTOX) after MDA (Figure 9, panel a). Independently, after Nextera tagmentation and PCR, a subsequent gDNA amplification by Nextera-based tagmentation after lysis, washing, and PCR may be performed, as indicated by a substantial increase in fluorescence intensity within the beads (Figure 9, panel b). After this Nextera library generation, the gel beads may be heated at 80°C for 3 minutes to release the contents of the beads, i.e., the sequencing-ready library products from single cells, as shown in Figure 9, panel c).

[0040] Another nucleic acid amplification method useful in the present disclosure is tagged fragmented PCR using a population of two-domain primers with a constant 5' region followed by a random 3' region, as described, for example, in Grothues et al., Nucl.Acids Res.21(5):1321-2 (1993), which is incorporated herein by reference in its entirety. The first round of amplification is carried out to allow multiple initializations of heat-denatured DNA based on individual hybridization from the randomly synthesized 3' region. Due to the nature of the 3' region, the initiation sites are considered to be random throughout the genome. Unbound primers can then be removed and further replication can be carried out using primers complementary to the constant 5' region.

[0041] In some embodiments, the encapsulated nucleic acid is fully or partially sequenced within the hydrogel bead. The encapsulated nucleic acid can be sequenced according to any suitable sequencing method, such as direct sequencing methods, including sequencing by synthesis, sequencing by ligation, sequencing by hybridization, nanopore sequencing, etc. As shown diagrammatically in FIG. 8B, single cells encapsulated within hydrogel beads may be processed for single cell sequencing.

[0042] One sequencing method is sequencing by synthesis (SBS). In SBS, the extension of a nucleic acid primer along a nucleic acid template (e.g., a target nucleic acid or its amplicon) is monitored to determine the sequence of nucleotides in the template. The underlying chemical process can be polymerization (e.g., as catalyzed by a polymerase enzyme). In certain polymerase-based SBS embodiments, fluorescently labeled nucleotides are added to the primer (thereby extending the primer) in a template-dependent manner, so that the sequence of the template can be determined using detection of the order and type of nucleotides added to the primer.

[0043] One or more amplified encapsulated nucleic acids can be subjected to SBS or other detection techniques involving repeated delivery of reagents in cycles. For example, to initiate a first SBS cycle, one or more labeled nucleotides, DNA polymerase, etc. can be flowed into / through hydrogel beads housing one or more amplified nucleic acid molecules. The site at which the labeled nucleotide is incorporated by primer extension can be detected. Optionally, the nucleotide can further include a reversible termination property that terminates further primer extension once the nucleotide is added to the primer. For example, a nucleotide analog with a reversible terminator portion can be added to the primer such that no further extension can occur until a deprotecting agent is delivered to remove the portion. Thus, in embodiments using reversible termination, a deblocking reagent can be delivered to the flow cell (before or after detection occurs). Washing can be performed between the various delivery steps. This cycle can then be repeated n times to extend the primer by n nucleotides, thereby detecting a sequence of length n. Exemplary SBS procedures, fluidic systems and detection platforms that can be readily adapted for use with amplicons produced by the methods of the present disclosure are described, for example, in Bentley et al., Nature, 456:53-59 (2008), WO 04 / 018497; U.S. Pat. No. 7,057,026; WO 91 / 06678; WO 07 / 123744; U.S. Pat. Nos. 7,329,492; 7,211,414; 7,315,019; 7,405,281, and U.S. Patent Application Publication No. 2008 / 0108082.

[0044] Other sequencing procedures using cyclic reactions can be used, such as pyrosequencing. Pyrosequencing detects the release of inorganic pyrophosphate (PPi) as specific nucleotides are incorporated into nascent nucleic acid chains (Ronaghi et al., Analytical Biochemistry 242(1), 84-9 (1996); Ronaghi, Genome Res. 11(1), 3-11 (2001); Ronaghi et al., Science 281(5375), 363 (1998); U.S. Patent Nos. 6,210,891; 6,258,568 and 6,274,320, each of which is incorporated herein by reference). In pyrosequencing, the released PPi can be detected by being immediately converted to adenosine triphosphate (ATP) by ATP sulfurylase, and the level of ATP produced can be detected by luciferase-generated photons. In this way, sequencing reaction can be monitored by luminescence detection system.The excitation radiation source used in the fluorescence-based detection system is not necessary for pyrosequencing procedure.Useful fluidic systems, detectors and procedures that can be adapted to the application of pyrosequencing to the amplicons produced according to the present disclosure are described in, for example, International Application No. PCT / US11 / 57111, US Patent Application Publication No. 2005 / 0191698A1, US Patent No. 7,595,883 and US Patent No. 7,244,559, each of which is incorporated herein by reference.

[0045] Some embodiments may utilize methods involving real-time monitoring of DNA polymerase activity. For example, nucleotide incorporation may be detected using fluorescence resonance energy transfer (FRET) interactions between fluorophore-containing polymerases and γ-phosphate-labeled nucleotides, or zero mode waveguides (ZMWs). Techniques and reagents for FRET-based sequencing are described, for example, in Levene et al., Science 299, 682-686 (2003); Lundquist et al., Opt. Lett. 33, 1026-1028 (2008); Korlach et al., Proc. Natl. Acad. Sci. USA 105, 1176-1181 (2008), the disclosures of which are incorporated herein by reference.

[0046] Some SBS embodiments include detection of protons released when nucleotides are incorporated into extension products. For example, sequencing based on detection of released protons can use commercially available electronic detectors and related technologies. Examples of such sequencing systems include pyrosequencing (e.g., commercially available platforms from 454 Life Sciences, a subsidiary of Roche), sequencing using γ-phosphate labeled nucleotides (e.g., commercially available platforms from Pacific Biosciences), sequencing using proton detection (e.g., commercially available platforms from Ion Torrent, a subsidiary of Life Technologies), or the sequencing methods and systems described in US Patent Publication Nos. 2009 / 0026082; 2009 / 0127589; 2010 / 0137143; or 2010 / 0282617, each of which is incorporated herein by reference. The method of amplifying target nucleic acid using dynamic displacement described herein can be easily applied to the substrate used to detect protons. More specifically, the methods described herein can be used to generate clonal populations of amplicons that are used to detect protons.

[0047] Another sequencing technique is nanopore sequencing (see, e.g., Deamer et al., Trends Biotechnol. 18, 147-151 (2000); Deamer et al., Acc. Chem. Res. 35:817-825 (2002); Li et al., Nat. Mater. 2:611-615 (2003), the disclosures of which are incorporated herein by reference). In some nanopore embodiments, the target nucleic acid or individual nucleotides removed from the target nucleic acid pass through the nanopore. As nucleic acids or nucleotides pass through the nanopore, each nucleotide type can be identified by measuring fluctuations in the electrical conductivity of the pore (U.S. Pat. No. 7,001,792; Soni et al., Clin. Chem. 53, 1996-2001 (2007); Healy, Nanomed. 2, 459-481 (2007); Cockroft et al., Am. Chem. Soc. 130, 818-820 (2008); the disclosures of which are incorporated herein by reference).

[0048] Exemplary methods for array-based expression and genotype analysis that can be applied for detection according to the present disclosure are described in U.S. Pat. Nos. 7,582,420, 6,890,741, 6,913,884, or 6,355,431, or U.S. Patent Application Publication Nos. 2005 / 0053980; 2009 / 0186349, or 2005 / 0181440, each of which is incorporated herein by reference.

[0049] In the nucleic acid isolation, amplification, and sequencing methods described herein, various reagents are used for the isolation and preparation of nucleic acids. Such reagents include, for example, lysozyme, proteinase K, random hexamers, polymerases (e.g., Φ29 DNA polymerase, Taq polymerase, Bsu polymerase), transposases (e.g., Tn5), primers (e.g., P5 and P7 adapter sequences), ligases, catalytic enzymes, deoxynucleotide triphosphates, buffers, or divalent cations. These reagents pass through the pores of the hydrogel beads, while the genetic material is retained within the hydrogel beads. The advantage of the methods described herein is that they provide an encapsulated microenvironment for the processing of nucleic acids within the hydrogel beads. This allows single cell processing for rapid and efficient processing of target nucleic acids.

[0050] The adaptor may include a sequencing primer site, an amplification primer site, and an index. An "index" as used herein may include a sequence of nucleotides that may be used as a molecular identifier and / or barcode to tag a nucleic acid and / or identify the source of the nucleic acid. In some embodiments, the index may be used to identify a single nucleic acid or a subpopulation of nucleic acids. In some embodiments, a nucleic acid library may be prepared within hydrogel beads. As shown diagrammatically in FIG. 8A, a single cell encapsulated within a hydrogel bead may be used for combinatorial indexing of a single cell, for example, using the contiguity preserving transposition (CPTSeq) method. In some embodiments, as shown diagrammatically in FIG. 8C, DNA from a single cell may be barcoded, for example, by encapsulation of the single cell after WGA amplification with another bead carrying a barcoded transposon and dissolving the gel matrix by contacting with a reducing agent to release genomic DNA for barcoding.

[0051] The embodiments of the "spatial indexing" methods and techniques described herein shorten the data analysis and simplify the method of library creation from single cells and long DNA molecules. Existing protocols for single cell sequencing require efficient physical separation of cells, uniquely barcoding each isolated cell, and pooling all together to perform sequencing. Current protocols for synthetic long reads also require a laborious barcoding step, and pooling each barcoded fragment together for sequencing, data analysis, and distinguishing the genetic information from each barcoded cell. During these lengthy methods, there is also loss of genetic material that causes dropouts in the sequence. The embodiments described herein not only shorten the method, but can also increase the data resolution for single cells. Furthermore, the embodiments provided herein simplify the assembly of genomes of novel organisms. The embodiments described herein can be used to reveal the co-occurrence of rare genetic variations and mutations. In some embodiments, the DNA library is trapped in hydrogel beads until release, which provides an opportunity to control the size of the fragments released onto the surface by controlling the release method and hydrogel formulation.

[0052] In some aspects, the library may be amplified using a primer site in the adaptor sequence, or sequenced using a sequencing primer site in the adaptor sequence. In some embodiments, the adaptor sequence may include an index to identify the source of the nucleic acid. The efficiency of the subsequent amplification step may be reduced by the formation of primer-dimers. To increase the efficiency of the subsequent amplification step, unligated single-stranded adaptors may be removed from the recombination product.

[0053] Preparation of nucleic acid libraries using hydrogel beads Some embodiments of the systems, methods and compositions provided herein include methods in which an adaptor is ligated to a target nucleic acid. The adaptor can include a sequencing primer binding site, an amplification primer binding site, and an index. For example, the adaptor can include a P5 sequence, a P7 sequence, or a complement thereof. As used herein, the P5 sequence includes the sequence defined by SEQ ID NO: 1 (AATGATACGGCGACCACCGA), and the P7 sequence includes the sequence defined by SEQ ID NO: 2 (CAAGCAGAAGACGGCATACGA). In some embodiments, the P5 or P7 sequence can further include a spacer polynucleotide, which can be 1-20, e.g., 1-15 or 1-10 nucleotides, e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. In some embodiments, the spacer includes 10 nucleotides. In some embodiments, the spacer is a poly-T spacer, such as a 10T spacer. The spacer nucleotide can be included at the 5' end of the polynucleotide or can be attached to a suitable carrier by attachment to the 5' end of the polynucleotide. The attachment can be accomplished by a sulfur-containing nucleophile, such as a phosphorothioate, present at the 5' end of the polynucleotide. In some embodiments, the polynucleotide comprises a poly-T spacer and a 5' phosphorothioate group. Thus, in some embodiments, the P5 sequence is 5' phosphorothioate-TTTTTTTTTTAATGGCGACCACCGA-3', SEQ ID NO:3, and in some embodiments, the P7 sequence is 5' phosphorothioate-TTTTTTTTTTAATGGCGACCACCGA-3', SEQ ID NO:4.

[0054] The index is useful for identifying the source of the nucleic acid molecule. In some embodiments, the adaptor can be modified to prevent the formation of concatemers, for example, by adding a blocking group that prevents the extension of the adaptor at one or both ends. Examples of 3' blocking groups include 3'-spacer C3, dideoxynucleotides, and binding to substrates. Examples of 5' blocking groups include dephosphorylated 5' nucleotides, and binding to substrates.

[0055] The adaptor comprises a nucleic acid, such as a single stranded nucleic acid. The adaptor can comprise a short nucleic acid having a length of about 5 nucleotides, 10 nucleotides, 20 nucleotides, 30 nucleotides, 40 nucleotides, 50 nucleotides, 60 nucleotides, 70 nucleotides, 80 nucleotides, 90 nucleotides, 100 nucleotides, less than, greater than or equal to, or a range between any two of these sizes. In some embodiments, the adaptor is large enough to pass through the pores of the hydrogel bead. The target nucleic acid comprises DNA, such as genomic or cDNA; RNA, such as mRNA, sRNA or rRNA; or a hybrid of DNA and RNA. The nucleic acid may be isolated from a single cell encapsulated within the hydrogel bead. The nucleic acid can comprise phosphodiester bonds and other types of backbones, including, for example, phosphoramide, phosphorothioate, phosphorodithioate, O-methyl phosphoramidite, and peptide nucleic acid backbones and linkages. Nucleic acids can contain any combination of deoxyribonucleotides and ribonucleotides, as well as bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthanine, hypoxanthanine, isocytosine, isoguanine, and base analogs such as nitropyrrole (including 3-nitropyrrole) and nitroindole (including 5-nitroindole). In some embodiments, nucleic acids can contain at least one promiscuous base. Promiscuous bases can include base pairs with two or more different types of bases, and are useful, for example, when included in oligonucleotide primers or inserts used for random hybridization in complex nucleic acid samples, such as genomic DNA samples. Examples of promiscuous bases include inosine paired with adenine, thymine, or cytosine. Other examples include hypoxanthine, 5-nitroindole, acyl 5-nitroindole, 4-nitropyrazole, 4-nitroimidazole, and 3-nitropyrrole. Promiscuous bases can be used that can base pair with at least two, three, four, or more bases.

[0056] The target nucleic acid can include a sample in which the average size of the nucleic acids in the sample is about 2 kb, 1 kb, 500 bp, 400 bp, 200 bp, 100 bp, 50 bp, less than, greater than or equal to, or a range between any two of the above sizes. In some embodiments, the average size of the nucleic acids in the sample is about 2000 nucleotides, 1000 nucleotides, 500 nucleotides, 400 nucleotides, 200 nucleotides, 100 nucleotides, 50 nucleotides, less than, greater than or equal to, or a range between any two of the above sizes. In some embodiments, the nucleic acids are large enough that they are trapped within the hydrogel beads such that they cannot pass through the pores of the hydrogel beads.

[0057] Exemplary methods include dephosphorylating the 5' end of the target nucleic acid to prevent the formation of concatemers in a subsequent religation step; religating a first adaptor to the 3' end of the dephosphorylated target using a ligase in which the 3' end of the first adaptor is blocked; rephosphorylating the 5' end of the religated target; and religating a second adaptor to the 5' end of the dephosphorylated target using a single-stranded ligase in which the 5' end of the second adaptor is unphosphorylated.

[0058] Another example includes partial digestion of the nucleic acid with a 5' exonuclease to form a double-stranded nucleic acid with a single-stranded 3' overhang. An adaptor comprising a 3' blocking group can be re-attached to the 3' end of the double-stranded nucleic acid with a 3' overhang. The re-attached adaptor can be used to dehybridize the double-stranded nucleic acid with a 3' overhang to form a single-stranded nucleic acid. An adaptor comprising a non-phosphorylated 5' end can be re-attached to the 5' end of the single-stranded nucleic acid.

[0059] A method for dephosphorylating a nucleic acid, such as the 5' nucleotide of a nucleic acid, includes contacting the nucleic acid with a phosphatase. Exemplary phosphatases include calf intestinal phosphatase, shrimp alkaline phosphatase, antarctic phosphatase, and APEX alkaline phosphatase (Epicentre).

[0060] Methods for religating nucleic acids include contacting the nucleic acid with a ligase. Exemplary ligases include T4 RNA ligase 1, T4 RNA ligase 2, RtcB ligase, Methanobacterium RNA ligase, and TS2126 RNA ligase (CIRCLIGASE).

[0061] A method for phosphorylating a nucleic acid, such as the 5' nucleotide of a nucleic acid, includes contacting the nucleic acid with a kinase. Exemplary kinases include T4 polynucleotide kinase.

[0062] The embodiments provided herein relate to preparing a nucleic acid library in hydrogel beads such that the nucleic acid library is prepared in a single reaction volume.

[0063] Embodiments of the systems and methods provided herein include kits that include any one or more of the hydrogel polymers, crosslinkers, or microfluidic devices for preparing hydrogel beads that encapsulate genetic material, and further include components useful for processing the genetic material, including reagents for cell lysis, and nucleic acid amplification and sequencing, or for nucleic acid library creation, including lysozyme, proteinase K, random hexamers, polymerases (e.g., Φ29 DNA polymerase, Taq polymerase, Bsu polymerase), transposases (e.g., Tn5), primers (e.g., P5 and P7 adapter sequences), ligases, catalytic enzymes, deoxynucleotide triphosphates, buffers, or divalent cations as described herein. EXAMPLES

[0064] Example 1: Preparation of hydrogel beads The following example demonstrates an embodiment of using manual stirring and a microfluidic droplet generator to prepare hydrogel beads that encapsulate microbial cells.

[0065] Samples containing one or more of E. coli, Bsubtilis, and A. hydrophila stored at -80°C were thawed at room temperature. 100 μL of each bacterial solution was transferred to a sterile 1.7 mL test tube and the samples were washed once with 1 mL of 0.85% NaCl. The samples were pelleted and the wash solution was removed. The bacterial pellet was saved for mixture with the hydrogel solution described below.

[0066] A 12% hydrogel solution was prepared from 40% acrylamide / bis 19:1 (BioRad #161-0144) diluted with deionized water. A 40% (w / v) acrylamide / N,N'-bis(acryloyl)cystamine (BACy) (19:1) monomer stock solution (3.8 g acrylamide, 0.2 g BACy and 6 mL double-distilled (dd) HO) was prepared. The mixture was brought to a final volume of 10 mL. To prepare the solution, the above acrylamide was dissolved in 6 mL double-distilled HO and the resulting solution was used to dissolve the BACy. As dissolution of the monomer is endothermic, slightly heating the mixture helps the monomer to completely dissolve. The hydrogel solution was kept at 4 °C until use. 35 μg of saturated potassium persulfate solution (KPS; Sigma) was added to 200 μL of the 12% hydrogel solution and mixed thoroughly. 235 μL of the hydrogel-KPS solution was added to each tube containing the bacterial cell pellet to resuspend the cells. The hydrogel-bacteria solution was then filled into 600 μL of mineral oil with surfactants (4.5% Span 80, 0.4% Tween 20, and 0.05% Triton X-100). The solution was stirred for 30 seconds to generate a droplet emulsion, and 25 μL of tetramethylethylenediamine (TEMED; Sigma) was immediately added and stirred for an additional 30 seconds.

[0067] To make a 10% gel (2 mL) with an acrylamide / BACy ratio of 19:1, 0.96 mL of double-distilled HO, 0.5 mL of 40% acrylamide / BACy (19:1), 0.5 mL of 10x Tris / borate / EDTA buffer (TBE), 20 μL of TEMED, and 20 μL of KPS (saturated) were mixed.

[0068] To make a 5% gel (2 mL) with an acrylamide / BACy ratio of 19:1, 1.21 mL of double distilled HO, 0.25 mL of 40% acrylamide / BACy (19:1), 0.5 mL of 10x TBE, 20 μL of TEMED, and 20 μL of KPS (saturated) were mixed. The reaction was allowed to polymerize until gelation (no more than 3-6 min).

[0069] Hydrogel beads were then generated that encapsulated the bacterial cells. After 15 minutes of incubation to allow complete cross-linking of the hydrogel beads, approximately 900 μL of petroleum ether was added to each tube. The tubes were vortexed to wash off the oil and the supernatant was removed. 1 mL of PR2 was added to each tube, followed by vortexing and spinning down the beads. The supernatant was removed and the beads were washed three times with 1 mL of PR2. The beads were resuspended in 1 mL of PR2. The hydrogel beads in PR2 can be stored at 4°C for at least 3 weeks.

[0070] Using the method described above using manual emulsion, hydrogel beads with a size distribution ranging from about 2 μm to about 100 μm in diameter can be produced.

[0071] To generate hydrogel beads of uniform size distribution, a microfluidic droplet generator, such as the generator illustrated in FIG. 2, may be used. To form hydrogel beads of uniform size distribution, an aqueous solution containing hydrogel polymers and bacterial cells was introduced into mineral oil in a microfluidic droplet generator. The microfluidic device had a height of 120 μm, the water channel width was 75 μm, and the carrier oil channel width was 78 μm. In this chip, a flow rate of 60 μL / min for the water channel and 300 μL / min for the carrier oil channel was used. Using this device, hydrogel beads with a diameter of approximately 90 μm were generated. The size of the beads can be fine-tuned by adjusting the channel width, the size of the microfluidic device, and the flow rate.

[0072] Additionally, the bead diameter can be fine-tuned by adding isopropyl alcohol. As shown in Figure 3, specific amounts of isopropyl alcohol (ranging from 0% to approximately 30% v / v) can be added to the hydrogel solution to form hydrogel beads of specific diameters. As shown in Figure 3, with increasing amounts of isopropyl alcohol, the diameter of the hydrogel beads decreases from 130 μm (0% isopropyl alcohol) to approximately 75 μm (28% isopropyl alcohol).

[0073] Hydrogel beads can also be fine-tuned to encapsulate the desired amount of cells. As shown in Figures 4A and 4B, a large number of stained bacterial cells were found to be present in each of the approximately 100 μm hydrogel beads (Figure 4A), while only a single cell or a few cells were loaded into each of the approximately 100 μm hydrogel beads (Figure 4B).

[0074] Furthermore, the gelation rate of hydrogel beads can also determine the amount of cells in each hydrogel bead. Hydrogel beads were prepared in the presence of NIH-3T3 mouse fibroblasts. As shown in Figure 6A and Figure 6B, fast gelation of hydrogel beads results in a single cell per bead (Figure 6A), whereas slow gelation results in several cells per bead (Figure 6B).

[0075] Example 2: Nucleotide-functionalized hydrogel beads The following example demonstrates how to functionalize the hydrogel beads from Example 1 with nucleotides.

[0076] DNA-functionalized hydrogel beads were obtained by reacting azide-functionalized hydrogel beads with alkyne-functionalized DNA using copper-catalyzed azide-alkyne cycloaddition (CuAAC) chemistry (Figure 5A). For the synthesis of azide-functionalized hydrogel beads, a hydrogel precursor mixture containing monomers, crosslinkers, and radical generators was mixed and microfluidics was used to generate monodisperse hydrogel beads. The hydrogel beads were doped with BrAPA at concentrations ranging from 0% to 8%. The bromides were subsequently azidized to convert the Br groups to azide groups (N3). The azidized hydrogels were then reacted with alkyne-modified oligonucleotides using CuAAC chemistry. The hydrogel beads without azidation did not have any oligonucleotides grafted onto the beads (Figure 5B, "Original"). On the other hand, the azidized hydrogel beads had oligonucleotides grafted onto the hydrogel beads (Figure 5B, "Azidized (N3)"). The density of grafted oligonucleotides directly correlated with the percentage of BrAPA added in the hydrogel precursor mixture.

[0077] These oligonucleotide-functionalized beads were used to capture mRNA from cells. The hydrogel beads were functionalized with poly-T oligonucleotides (Figure 5C). The poly-T functionalized hydrogel beads were mixed with cells. Then, the cells were lysed, and the beads were collected and washed. Second strand synthesis was performed to generate cDNA from the captured mRNA. As shown in Figure 5D, the electrochromatogram showed a trace of the cDNA with its complement (right curve), and the cDNA duplex was then tagged and fragmented with Nextera. The tagged and fragmented DNA (left curve) was shifted to a lower molecular weight as expected due to tagged fragmentation.

[0078] Example 3: Release of genetic material from hydrogel beads The following examples demonstrate the ability to release the contents of hydrogel beads having genetic material encapsulated therein upon reversible cleavage of the crosslinker.

[0079] Hydrogel beads encapsulating bacterial cells were prepared according to Example 1. The hydrogel beads contain a bisacrylamide crosslinker containing disulfide bonds. The beads were dye-stained for visualization of the bacterial cells. As shown in Figure 7C, the hydrogel beads in the absence of a reducing agent were able to retain the bacterial cells. However, upon contact with a reducing agent, in this case THP, the bacteria were released from the hydrogel beads.

[0080] Example 4: Creation of a nucleic acid library in hydrogel beads The following example demonstrates a method for sequencing nucleic acids from genetic material encapsulated within hydrogel beads.

[0081] The hydrogel beads prepared in Example 1 were obtained and nucleic acids were isolated as follows. 50 μL of a solution of hydrogel beads encapsulating E. coli was transferred to a 200 μL tube (with approximately 50 beads / μL). The beads were spun down and the supernatant was removed. 100 μL of bacterial lysis reagent (0.5 mg lysozyme in 100 μL resuspension buffer from Thermo Fisher Scientific, Charge Switch kit) was added to the tube and incubated at 37° C. for 10 minutes. Then, 500 μL of proteinase K reagent was added and incubated at 55° C. for 20 minutes to completely digest the proteins. At this stage, the E. coli gDNA was exposed but immobilized within the hydrogel matrix. The beads holding the bacterial gDNA were washed with PR2 and the hydrogel beads were recollected. Then, Tn5 transposome reagent (Nextera, Illumina, Inc.) was added to the tube and incubated at 55° C. for 5 minutes. After this step, an adapter containing P5 and P7 ends was inserted into the DNA. Then, 50 μL of stop buffer was filled to generate the Tn5 enzyme. An extension mix of Bsu polymerase and nucleotides for gap filling was added. After this step, the nucleic acid library was prepared and immobilized in the hydrogel bead matrix. These same steps were repeated for each of the B. subtilis hydrogel beads and A. hydrophila to lyse the bacterial cells and terminate the library generation for each hydrogel bead. As shown in Figure 10, the hydrogel beads with the DNA library generated therein were seeded on the surface and the DNA library was released. In Figure 10, panel a) shows the hydrogel with the tagged fragmented genome loaded on the P5 / P7 grafted surface. In Figure 10, panel b) shows the elution, seeding, isothermal bridge amplification and stained single stranded DNA. Figure 10, panel c) shows the gradient of cluster density from high density to low density (left to right), with the higher density indicating the location on the surface of the hydrogel where it arrived first.

[0082] This example demonstrates the preparation of hydrogel beads that encapsulate single bacterial cells within the hydrogel beads, which can be used to process bacterial genomes and perform total DNA library generation within the beads. The pore size of the hydrogel was designed to allow diffusion of enzymes, chemicals and smaller size primers (<50 bps), but retain larger size DNA (>300 bps) so that the complete total genome DNA and generated DNA library are retained within the gel microbeads during the entire process. The DNA library from a single bacterium can then be released to a specific area on the flow cell surface for example for library seeding. This results in a spatial distribution of "DNA clusters" on the flow cell from individual bacterial cells, thereby simplifying read alignment during post-processing.

[0083] Example 5: Sequencing of Nucleic Acids from Hydrogel Beads The following example demonstrates sequencing of a DNA library from hydrogel beads encapsulating genetic material.

[0084] The DNA library prepared from Example 4 was released from the hydrogel and deposited on a surface. The fragmented DNA was eluted from the hydrogel. The control sample was kept without heat treatment. Both samples were enriched by 12-cycle PCR reaction and analyzed on a bioanalyzer to determine the fragment distribution. After double Ampure washing, the E. coli fragments were sequenced on a MiSeq platform (Illumina, Inc., San Diego, CA). As shown in FIG. 11A, the DNA fragments eluted from the hydrogel had a fragment size distribution with an average size of about 350 bp. In contrast, the sample shown in FIG. 11B, which was not heat treated, showed no fragments even after 12-cycle PCR reaction, indicating that the fragments were not released from the hydrogel beads. The fragments were sequenced, and 98% of the sequences aligned to Enterobacteriaceae, and 39% of the sequences aligned to E. coli.

[0085] Example 6: Spatial Indexing The following example demonstrates spatial indexing of a DNA library prepared within hydrogel beads.

[0086] To demonstrate spatial separation between different bacterial species types, E. coli, B. subtilis, and A. hydrophila were selected as model organisms. Each microorganism was embedded in its own group of hydrogel beads. Each bead type containing a single microorganism was treated separately by lysis treatment, and each species had its own unique index added during the library construction protocol. Three different hydrogel beads carrying DNA libraries from E. coli, B. subtilis, and A. hydrophila were then mixed in the same test tube. The hydrogel beads were spun down and the supernatant was removed. 100 μL of mineral oil with surfactant (4.5% Span 80, 0.4% Tween 20, 0.05% Triton X-100) was added to the beads and vortexed for 30 seconds to resuspend the beads in the oil. Then, 25 μL of the oil-reemulsified bead solution was loaded into the MiSeq flow cell. The temperature of the MiSeq flow cell was increased to 90° C. for 3 minutes to denature the DNA library, the denatured library was allowed to diffuse out of the hydrogel beads, followed by 60° C. for 6 minutes, 40° C. for 2 minutes, and 20° C. for 2 minutes, and the single-stranded DNA library was hybridized to the surface P5 / P7 primers for cluster amplification. The seeded libraries were clustered, linearized, and first sequenced, the results of which are shown in FIG. 13. As shown in FIG. 13, the DNA library within the hydrogel beads was able to diffuse out of the beads and bind to the MiSeq flow cell, and amplification occurred on the flow cell in a separate cluster for each organism.

[0087] The MiSeq flow cells seeded with libraries generated in hydrogel beads with these three different microorganisms were further sequenced on a MiSeq (2 × 150 cycle runs). As shown in Figure 14A-B, the sequencing analysis indicates that the experiment was completed with reasonable quality. Each of the three different species was detected. The read lengths generated from the hydrogel-released libraries had very similar size ranges, demonstrating that the size of the library fragments released from the hydrogel can be controlled by the hydrogel composition and DNA release protocol. A ΦX control library was also fixed to check the experimental quality. Figure 15A-C shows the MiSeq sequencing results of the flow cells seeded with hydrogel beads containing E. coli, Bsubtilis, or A. hydrophila, including the raw data from the MiSeq images (Figure 15A), the clusters aligned to specific genomes (Figure 15B), and a summary table of the pass filters for the three different bacterial species (Figure 15C).

[0088] The embodiments, examples, and figures described herein provide compositions, methods, and systems for retaining genetic material in a physically confined space during the process from lysis to library generation. Some embodiments provide libraries from single long DNA molecules or single cells that are released onto the surface of a flow cell in a confined space. When libraries from single DNA molecules or single cells in individual compartments are released onto the surface of a flow cell, the libraries from each compartment are seeded in close proximity to each other.

[0089] As used herein, the term "comprising" is synonymous with "including," "containing," or "characterized by," and may be inclusive or open-ended and does not exclude additional, unrecited elements or method steps.

[0090] The above description discloses several methods and materials of the present invention. The present invention allows for variations in the methods and materials, as well as modifications of the manufacturing methods and devices. Such variations will become apparent to those skilled in the art from consideration of the disclosure or practice of the invention disclosed herein. Thus, the present invention is not intended to be limited to the specific embodiments disclosed herein, but is intended to cover all variations and modifications that fall within the true scope and spirit of the invention.

[0091] All references cited herein, including but not limited to published and unpublished applications, patents, and literature, are incorporated herein by reference in their entirety and made a part hereof. To the extent that publications and patents or patent applications are incorporated in any manner that contradicts the disclosure contained herein, the present specification is intended to supersede any such conflicting material. [Explanation of symbols]

[0092] 200 ... Microfluidic Devices 210 ... Hydrogel beads 215 … Channel for aqueous streams 220 ... Channel for immiscible fluids

Claims

1. contacting a plurality of cells with a hydrogel solution in oil to form a mixture; agitating the mixture with a reversible crosslinker to produce a plurality of beads; contacting the plurality of beads with a reagent to process the genetic material; separating the beads on a solid support; and cutting the separated beads to allow diffusion of the encapsulated material from the separated beads; the hydrogel solution comprises polyethylene glycol (PEG)-thiol / PEG-acrylate or PEG / polypropylene oxide (PPO); A method for analyzing genetic material from individual cells, wherein each bead encapsulates different genetic material and each bead contains pores that allow diffusion of reagents through the bead while retaining the genetic material.

2. 10. The method of claim 1, wherein cleaving the separated beads comprises increasing the temperature of the beads, contacting the beads with a reducing agent, or exposing the beads to an electric field.

3. 3. The method of claim 2, wherein the temperature is increased to greater than 50°C.

4. 3. The method of claim 2, wherein the reducing agent is dithioerythritol (DTE), dithiothreitol (DTT), 2-mercaptoethanol, glutathione, thioglycolate, 2,3-dimercaptopropanol, tris(2-carboxyethyl)phosphine (TCEP), tris(hydroxymethyl)phosphine (THP), or p-[tris(hydroxymethyl)phosphine]propionic acid (THPP).

5. 10. The method of claim 1, wherein the reagents include lysis agents, nucleic acid purification agents, DNA amplification agents, labeling agents, PCR agents, or other agents used in the processing of genetic material.

6. The method of claim 1 , wherein the beads have a diameter of from 2 μm to 120 μm.

7. The method of claim 1 , wherein the oil comprises a mineral oil, a hydrocarbon oil, a silicone oil, or a polydimethylsiloxane oil.

Images