Method for producing nucleic acid oligomer

Abstract

The present invention provides an efficient method for producing nucleic acid oligomers and in particular provides a method for efficiently deprotecting a protecting group on a hydroxy group of the ribose in a nucleic acid oligomer. The present invention specifically provides a method for producing a nucleic acid oligomer represented by formula (4), comprising bringing the nucleic acid oligomer represented by formula (3) into contact with a fluoride ion to react therewith in an inert gas atmosphere having an oxygen concentration not greater than 15% (the groups in formula (3) and formula (4) are as defined in the description).

Description

[Technical field]

[0001] This patent application claims priority and the benefit of Japanese Patent Application No. 2019-187930 (filed October 11, 2019) under the Paris Convention, the entire contents of which are incorporated herein by reference.

[0002] The present invention relates to a method for producing a nucleic acid oligomer containing ribose, and more specifically, to a method for deprotecting the protecting group of the hydroxyl group of ribose contained in the nucleic acid oligomer. [Background technology]

[0003] RNA, a nucleic acid oligomer containing ribose, is a useful material that can be used as an RNA probe, antisense RNA, ribozyme, siRNA, aptamer, etc.

[0004] Nucleic acid oligomers can be synthesized by solid-phase synthesis, in which phosphoramidites of nucleosides (hereinafter referred to as "amidites") are used as raw materials. The nucleic acid oligomers synthesized by extending nucleic acids on a solid-phase support are cut out from the solid-phase support, and then the protecting group of the hydroxyl group at the 2'-position of ribose is removed by deprotection to produce the desired nucleic acid oligomer. The purity of the nucleic acid oligomers synthesized in this way is not necessarily satisfactory because they go through multiple steps such as an extension reaction step of the nucleic acid on the solid-phase support, a cutout step from the solid-phase support, and a deprotection step of each protecting group, and the synthesis is not efficient (Patent Documents 1 and 2). [Prior art documents] [Patent documents]

[0005] [Patent Document 1] International Publication No. 2006 / 022323 [Patent Document 2] International Publication No. 2013 / 027843 Summary of the Invention [Problem to be solved by the invention]

[0006] An object of the present invention is to provide a method for efficiently producing a nucleic acid oligomer. [Means for solving the problem]

[0007] As a result of extensive research to achieve the above-mentioned object, the inventors have discovered that the protecting groups of the hydroxyl groups of ribose contained in a nucleic acid oligomer can be efficiently deprotected by contacting the nucleic acid oligomer with fluoride ions in an inert gas atmosphere having an oxygen concentration below a certain level, and as a result, an efficient method for producing a nucleic acid oligomer can be provided.

[0008] The present invention has been completed based on these findings, and includes, but is not limited to, the following aspects.

[0009] Item 1. In an inert gas atmosphere with an oxygen concentration of 15% or less, the reaction mixture is reacted with the reaction mixture in the presence of the reaction agent in the form of formula (3): [ka] (In the formula, G 4 represents a protecting group for a hydrogen atom or a hydroxyl group, G 5 represents an ammonium ion, an alkylammonium ion, an alkali metal ion, a hydrogen ion, or a hydroxyalkylammonium ion, B C each independently represents the same or different nucleobase, R are each independently the same or different and each represents a hydrogen atom, a fluorine atom, or an OQ group; Q are each independently the same or different and each independently represent a tert-butyldimethylsilyl group, a methyl group, a 2-methoxyethyl group, a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position of ribose, an ethylidene group bonded to the carbon atom at the 4' position of ribose, or a group represented by the formula (1): [ka] (In the formula, R a and R b are the same or different and each represents a methyl group, an ethyl group, or a hydrogen atom, The bond marked with * indicates a bond with the oxygen atom of the OQ group. and n represents an integer of 1 to 5. However, R a and R b does not simultaneously represent a hydrogen atom.) represents a protecting group of Y's are independently the same or different and each represents an oxygen atom or a sulfur atom; m represents an integer between 2 and 200; W and X are defined as either (a) or (b) below, (a) When W is a hydroxyl group, X has the same definition as the R group above. (b) when X is a hydroxyl group, W is an OV group; V represents a tert-butyldimethylsilyl group or a group of the formula (1) above. However, at least one of the groups R, W, and X represents a hydroxyl group protected by a protecting group of the formula (1). When m is an integer of 3 or more, the nucleic acid oligomer represented by formula (3) is a nucleic acid oligomer in which a non-nucleotide linker may be incorporated in place of p nucleotides (wherein p is a positive integer satisfying the formula: m-1>p) between the 5'-terminal and 3'-terminal nucleotides. The method comprises contacting a nucleic acid oligomer represented by the formula (4): [ka] (In the formula, R' are each independently the same or different and represent a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group; Q' are each independently the same or different and each represent a methylene group bonded to the carbon atom at 4' position of ribose, an ethylene group bonded to the carbon atom at 4' position, or an ethylidene group bonded to the carbon atom at 4' position of ribose, Substituent G in formula (4) 4 , G 5 , Y, B c and m are the same as those in formula (3), W0 is a hydroxyl group; X0 has the same definition as the R' group above. When m is an integer of 3 or more, the nucleic acid oligomer represented by formula (4) is a nucleic acid oligomer in which a non-nucleotide linker may be incorporated in place of p nucleotides (wherein p is a positive integer satisfying the formula: m-1>p) between the 5'-terminal and 3'-terminal nucleotides. (hereinafter, in this specification, referred to as "the production method of the present invention"). Item 2. The method according to item 1, wherein the non-nucleotide linker is a linker having an amino acid backbone. Item 3. The method according to item 2, wherein the linker having an amino acid skeleton has a structure represented by the following formula (A14-1), (A14-2) or (A14-3): [ka] (In the formula, 5' and 3' represent the 5'-end and 3'-end of the nucleic acid oligomer, respectively.) Item 4. The method according to any one of items 1 to 3, wherein W is a hydroxyl group, X is an R group, W0 is a hydroxyl group, and X0 is an R' group. Item 5. The method according to any one of Items 1 to 4, wherein the fluoride ion source is a tetraalkylammonium fluoride. Item 6. The method according to any one of Items 1 to 5, wherein the tetraalkylammonium fluoride is tetra-n-butylammonium fluoride (TBAF). Item 7. The method according to any one of items 1 to 6, wherein the reaction is carried out in an inert gas atmosphere having an oxygen concentration of 10% or less. Item 8. The method according to any one of items 1 to 6, wherein the reaction is carried out in an inert gas atmosphere having an oxygen concentration of 5% or less. Item 9. The production method according to any one of items 1 to 6, wherein the reaction is carried out in an inert gas atmosphere having an oxygen concentration of 0%. Item 10. The method according to any one of items 1 to 9, wherein the time required for adding the entire amount of fluoride ions to the nucleic acid oligomer represented by formula (3) is 30 minutes or longer. Item 11. The method according to any one of Items 1 to 10, wherein the ratio of the protecting group of the formula (1) among R, W and X of the nucleic acid oligomer represented by formula (3) is 5% or more. Item 12. The method according to any one of Items 1 to 10, wherein the ratio of the protecting group of the formula (1) among R, W and X of the nucleic acid oligomer represented by formula (3) is 10% or more. Item 13. The method according to any one of Items 1 to 10, wherein the ratio of the protecting group of the formula (1) among R, W and X of the nucleic acid oligomer represented by formula (3) is 20% or more. Item 14. The method according to any one of Items 1 to 10, wherein the ratio of the protecting group of the formula (1) among R, W and X of the nucleic acid oligomer represented by formula (3) is 30% or more. Item 15. The method according to any one of Items 1 to 10, wherein the ratio of the protecting group of the formula (1) among R, W and X of the nucleic acid oligomer represented by formula (3) is 40% or more. Item 16. The method according to any one of Items 1 to 10, wherein the ratio of the protecting group of the formula (1) among R, W and X of the nucleic acid oligomer represented by formula (3) is 50% or more. Item 17. The method according to any one of Items 1 to 10, wherein the ratio of the protecting group of the formula (1) among R, W and X of the nucleic acid oligomer represented by formula (3) is 60% or more. Item 18. The method according to any one of Items 1 to 10, wherein the ratio of the protecting group of the formula (1) among R, W and X of the nucleic acid oligomer represented by formula (3) is 70% or more. Item 19. The method according to any one of items 1 to 10, wherein the ratio of the protecting group of formula (1) among R, W and X of the nucleic acid oligomer represented by formula (3) is 80% or more. Item 20. The method according to any one of Items 1 to 10, wherein the ratio of the protecting group of the formula (1) among R, W and X of the nucleic acid oligomer represented by formula (3) is 90% or more. Item 21. The method according to any one of Items 1 to 10, wherein the ratio of the protecting group of the formula (1) among R, W and X of the nucleic acid oligomer represented by formula (3) is 95% or more. Item 22. The method according to any one of items 1 to 10, wherein the proportion of the protecting group of formula (1) among R, W and X in the nucleic acid oligomer represented by formula (3) is 100%. Effect of the Invention

[0010] The present invention provides an efficient method for producing a nucleic acid oligomer, which is expected to improve the purity of the produced nucleic acid oligomer. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0011] The present invention describes a method for producing a nucleic acid oligomer represented by formula (4) in which the protecting group of formula (1) is deprotected by contacting a nucleic acid oligomer represented by formula (3) with fluoride ions in an inert gas atmosphere having an oxygen concentration of 15% or less.

[0012] In formula (1), R a and R b may be a methyl group, an ethyl group or a hydrogen atom, and preferably R a is a methyl or ethyl group, R b is hydrogen, more preferably R a is a methyl group, R bis hydrogen. n is preferably an integer of 1 to 4, more preferably an integer of 1 to 3, further preferably 1 or 2, and particularly preferably 1.

[0013] At least one of R, W, and X in formula (3) represents a hydroxyl group protected by a protecting group of formula (1). The proportion of formula (1) among R, W, and X may be 1% or more, more preferably 5% or more, more preferably 10% or more, more preferably 20% or more, more preferably 30% or more, more preferably 40% or more, more preferably 50% or more, more preferably 60% or more, more preferably 70% or more, more preferably 80% or more, more preferably 90% or more, and even more preferably 95% or more.

[0014] In the contact reaction between the nucleic acid oligomer represented by formula (3) and fluoride ions, fluoride ions may be added to the nucleic acid oligomer represented by formula (3), or conversely, the nucleic acid oligomer represented by formula (3) may be added to fluoride ions, or both may be added simultaneously. A method in which fluoride ions are added to the nucleic acid oligomer represented by formula (3) is preferred. The time required for adding the entire amount of fluoride ions to the nucleic acid oligomer represented by formula (3) is preferably 5 minutes or more, more preferably 10 minutes or more, more preferably 15 minutes or more, more preferably 30 minutes or more, and even more preferably 1 hour or more. Such addition is preferably carried out dropwise onto the surface of or into the solution containing the nucleic acid oligomer represented by formula (3) over a period of 5 minutes or more, more preferably over a period of 10 minutes or more, even more preferably over a period of 15 minutes or more, even more preferably over a period of 30 minutes or more, and even more preferably over a period of 1 hour or more.

[0015] In the step of deprotecting the hydroxyl-protecting group represented by formula (1), typically, tetraalkylammonium fluoride is used as the fluoride ion source. Examples of tetraalkylammonium fluoride include tetrabutylammonium fluoride and tetramethylammonium fluoride. Among them, tetrabutylammonium fluoride (TBAF) is more preferable. The amount of fluoride ion used is usually 1 to 1000 moles, preferably 1 to 500 moles, per mole of the protecting group to be removed. Mole The amount is more preferably 2 to 200 mol, and further preferably 4 to 100 mol.

[0016] In this step, an organic solvent inert to the reaction is usually used, specifically, for example, a sulfoxide solvent, a nitrile solvent, an ether solvent, an amide solvent, a ketone solvent, an aliphatic hydrocarbon solvent, an ester solvent, an aromatic solvent, or a mixed solvent of two or more of these, and among these solvents, a sulfoxide solvent is preferred. An example of a sulfoxide solvent is dimethyl sulfoxide. An example of a nitrile solvent is acetonitrile and propionitrile. An example of an ether solvent is tetrahydrofuran. An example of an amide solvent is N-methyl-2-pyrrolidone. An example of a ketone solvent is acetone and methyl ethyl ketone. An example of an aliphatic hydrocarbon solvent is hexane and heptane. An example of an ester solvent is methyl acetate and ethyl acetate. An example of an aromatic solvent is toluene and pyridine. Among them, dimethyl sulfoxide or a mixed solvent of dimethyl sulfoxide and acetonitrile is preferred.

[0017] The fluoride ion source, which is a reagent used in the step of removing the hydroxyl-protecting group represented by formula (1), is usually dissolved in a solvent and then dehydrated before use. Examples of dehydrating agents include molecular sieves and sulfates, and preferably molecular sieves 4A are used.

[0018] The amount of the solvent used is usually 5 to 8,000 L, preferably 50 to 2,000 L, and more preferably 100 to 1,600 L per mole of the nucleic acid oligomer subjected to the deprotection step.

[0019] If necessary, a compound that reacts with the nitrile compound represented by the following formula (2), which is a by-product in this step, to capture the nitrile compound can be added. Examples of the capturing compound include nitroalkanes, alkylamines, amidines, thiols, thiol derivatives, and mixtures of two or more of these. An example of the "nitroalkane" is nitromethane. An example of the "alkylamine" is a linear alkylamine having 1 to 6 carbon atoms, and a cyclic amine having 1 to 8 carbon atoms. Specific examples of the compound include methylamine, ethylamine, n-propylamine, n-butylamine, n-pentylamine, n-hexylamine, morpholine, and piperidine. An example of the "amidine" is benzamidine and formamidine. An example of the "thiol" is a linear thiol having 1 to 6 carbon atoms. Specifically, for example, methanethiol, ethanethiol, 1-propanethiol, 1-butanethiol, 1-pentanethiol, and 1-hexanethiol can be mentioned. As the "thiol derivative", for example, alcohols or ethers having the same or different linear alkylthiol groups having 1 to 6 carbon atoms can be mentioned. Specifically, for example, 2-mercaptoethanol, 4-mercapto-1-butanol, 6-mercapto-1-hexanol, mercaptomethyl ether, 2-mercaptoethyl ether, 3-mercaptopropyl ether, 4-mercaptobutyl ether, 5-mercaptopentyl ether, and 6-mercaptohexyl ether can be mentioned. As the compound to be captured, nitromethane is more preferably used.

[0020] Formula (2): [ka] (In the formula, R a and R b are the same or different and represent a methyl group, an ethyl group, or a hydrogen atom, provided that R a and R bdoes not simultaneously represent a hydrogen atom.) A compound represented by the formula:

[0021] The amount of the compound that captures the by-product compound represented by formula (2) can be 0.1 to 100.0 mol % relative to the fluoride ion source that removes the protecting group of the hydroxyl group represented by formula (1), and is preferably 1.0 to 50.0 mol %, preferably 2.0 to 40.0 mol %, and more preferably 3.0 to 30.0 mol %.

[0022] The temperature for the deprotection reaction of the hydroxyl-protecting group represented by formula (1) varies depending on the type of deprotecting agent used, but is usually 0°C to 80°C, preferably 10°C to 45°C, and more preferably 15°C to 35°C. Furthermore, the time for the deprotection reaction varies depending on the type of deprotecting agent used and the reaction temperature, but is usually 1 to 100 hours, preferably 1 to 24 hours, more preferably 2 to 12 hours, more preferably 3 to 10 hours, more preferably 3 to 8 hours, and even more preferably 3 to 6 hours. The reaction temperature may be changed at any timing, and the deprotecting agent for deprotecting the hydroxyl-protecting group represented by formula (1) may be added at any timing.

[0023] The inert gas atmosphere having an oxygen concentration of 15% or less may be adjusted, for example, by preparing an inert gas having an oxygen concentration of the above-mentioned predetermined concentration or less, supplying it to the reaction system, and measuring and confirming that the oxygen concentration in the gas phase is within the above-mentioned set concentration range. Specifically, the adjustment can be performed by flowing a high-purity inert gas such as argon or nitrogen, or an inert gas whose oxygen concentration has been adjusted to a predetermined concentration, into the gas phase of the reaction system, or by replacing the gas phase atmosphere of the reaction system with the inert gas or an inert gas whose concentration has been adjusted. The inert gas used in the process of the present invention includes, but is not limited to, nitrogen gas, argon gas, helium gas, and carbon dioxide, and is preferably nitrogen gas or argon gas.

[0024] The reaction system atmosphere may be substituted by vacuum substitution, pressure substitution, flow substitution, bubbling substitution, or freeze degassing, and may be subjected to ultrasonic waves or heating. More preferred methods are flow substitution and vacuum substitution. The oxygen concentration is preferably 15% or less, more preferably 10% or less, more preferably 5% or less, and even more preferably 0%.

[0025] Stirring of the reaction system during the elimination reaction of the protecting group is not essential, but usually, the stirring power Pv is 0.0 to 0.5 kW / m 3 Stirring is performed in the range of Pv 0.1 to 0.3 kW / m 3 It is preferable to stir the mixture in a stirring manner.

[0026] The nucleic acid oligomer produced after the reaction can be separated and purified from the reaction mixture by a conventional method, for example, extraction, concentration, neutralization, filtration, centrifugation, recrystallization, silica gel column chromatography, thin layer chromatography, reverse phase column chromatography, ion exchange column chromatography, gel filtration column chromatography, hydrophobic interaction chromatography, hydrophilic interaction liquid chromatography, precipitation (e.g., precipitation of the nucleic acid oligomer using ethanol, isopropanol, methanol or polyethylene glycol), dialysis, ultrafiltration, or the like, to remove the protection by the formula (1), which is the protecting group of the hydroxyl group at the 2'-position or 3'-position. The purified nucleic acid oligomer can be isolated. The isolated nucleic acid oligomer is usually obtained as a nucleic acid oligomer with a protected hydroxyl group at its 5'-end.

[0027] The reaction for obtaining a nucleic acid oligomer represented by the following formula (4) by deprotecting the protecting group represented by formula (1) from a nucleic acid oligomer represented by formula (3) is as follows (Scheme 1). [ka]

[0028] In formula (3) or formula (4), when R represents an OQ group and R' represents an OQ' group, the structure of ribose is represented by the following formula (LNA-1), (LNA-2) or (LNA-3). [ka] (In the formula, Base represents a nucleic acid base.)

[0029] Nucleosides (ribose and deoxyribose) contained in the nucleic acid oligomer used in the present invention include, but are not limited to, DNA, RNA, 2'-O-MOE (2'-O-methoxyethyl), 2'-O-Me, 2'-F RNA, and the above-mentioned LNA.

[0030] The nucleic acid oligomer represented by formula (3) can be obtained, for example, as shown in Scheme 2, by cleaving the nucleic acid oligomer produced by solid-phase synthesis represented by formula (5) from the solid-phase support. [ka]

[0031] In the nucleic acid oligomer of formula (5) synthesized on a solid support, During the ceremony, Substituent B a each independently represents the same or different optionally protected nucleobase, G 4 and Y is as defined in formula (3) above, G 2 each independently represents the same or different phosphate protecting group, When X1 represents OZ, W1 represents an OV group; V represents a tert-butyldimethylsilyl group or a group of the formula (1) above. When X1 represents an R group, W1 represents a group represented by OZ; Z represents a group consisting of a solid phase carrier and a linking moiety connecting the solid phase carrier with the oxygen atom of the hydroxyl group at the 2'- or 3'-position of ribose at the 3'-end of the nucleic acid oligomer.

[0032] More specifically, Z represents a structure represented by the following formula (6): [ka] In formula (6), Sp represents a spacer. The spacer (Sp) is, for example, exemplified by one having the structural formula shown in formula (7) below.

[0033] [ka]

[0034] The linker may have a structure shown in the following formula (8-1), (8-2), (8-3), (8-4), (8-5), (8-6), (8-7), or (8-8), for example. Examples of solid supports include inorganic porous supports and organic resin supports. Examples of inorganic porous supports include controlled pore glass (CPG) and zeolite. Examples of organic resin supports include supports made of polystyrene.

[0035] [ka] [ka] (In the formula, A may be a hydroxyl group, an alkoxy group, or an alkyl group. Examples of the alkoxy group include a methoxy group and an ethoxy group. Examples of the alkyl group include a methyl group, an ethyl group, an isopropyl group, and an n-propyl group. Si indicates that it is bonded to the oxygen of a hydroxyl group on the surface of the carrier.)

[0036] The compound of the formula (5) is produced, for example, by the amidite method using an amidite compound of the following formula (A13). [ka] (In the formula, R represents a hydrogen atom, a fluorine atom, or an OQ group; Q represents a tert-butyldimethylsilyl group, a methyl group, a 2-methoxyethyl group, a methylene group bonded to the 4' carbon atom, an ethylene group bonded to the 4' carbon atom, an ethylidene group bonded to the 4' carbon atom, or a protecting group represented by formula (1); B a represents an optionally protected nucleobase, G 1 represents a protecting group for a hydroxyl group, G 2 represents a protecting group for phosphate, G 3 represents an alkyl group, or a cyclic structure formed by bonding together at their terminals.

[0037] B a The nucleic acid base in is not particularly limited. Examples of the nucleic acid base include adenine, cytosine, guanine, uracil, thymine, 5-methylcytosine, pseudouracil, and 1-methylpseudouracil. The nucleic acid base may also be substituted with a substituent. Examples of such a substituent include halogen atoms such as fluoro, chloro, bromo, and iodine groups, acyl groups such as acetyl groups, alkyl groups such as methyl and ethyl groups, arylalkyl groups such as benzyl groups, alkoxy groups such as methoxy groups, alkoxyalkyl groups such as methoxyethyl groups, cyanoalkyl groups such as cyanoethyl groups, hydroxy groups, hydroxyalkyl groups, acyloxymethyl groups, amino groups, monoalkylamino groups, dialkylamino groups, carboxy groups, cyano groups, and nitro groups, as well as combinations of two or more of these substituents.

[0038] When a nucleic acid base has an amino group outside the ring, the protecting group for the amino group is not particularly limited, and any protecting group known in nucleic acid chemistry can be used. Examples of such protecting groups include benzoyl, 4-methoxybenzoyl, acetyl, propionyl, butyryl, isobutyryl, phenylacetyl, phenoxyacetyl, 4-tert-butylphenoxyacetyl, 4-isopropylphenoxyacetyl, and (dimethylamino)methylene groups, as well as combinations of two or more of these protecting groups.

[0039] B a More specifically, [ka]

[0040] (In the above formula, R 4 represents a hydrogen atom, a methyl group, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group, or a benzoyl group, R 5 represents a hydrogen atom, an acetyl group, an isobutyryl group, or a benzoyl group, R 6 represents a hydrogen atom, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group, or an isobutyryl group, R 7 represents a 2-cyanoethyl group, R 8 represents a hydrogen atom, a methyl group, a benzoyl group, a 4-methoxybenzoyl group, or a 4-methylbenzoyl group, R 9 represents a dimethylaminomethylene group. The group represented by any one of the following formulas:

[0041] G 1As the protecting group, any protecting group that can function as a protecting group can be used without particular limitation, and a wide variety of known protecting groups used in amidite compounds can be used.

[0042] G 1 is preferably the following group:

[0043] [ka] (In the formula, R 1 , R 2 and R 3 are the same or different and represent hydrogen or an alkoxy group.

[0044] R 1 , R 2 and R 3 It is preferred that one of them is hydrogen and the remaining two are the same or different (preferably the same) alkoxy groups, and the alkoxy group is particularly preferably a methoxy group.

[0045] G 2 As the protecting group, there is no particular limitation so long as it can function as a protecting group, and a wide variety of known protecting groups used in amidite compounds can be used. 2 Examples of the alkyl group include an alkyl group, an alkenyl group, an alkynyl group, a cycloalkyl group, a haloalkyl group, an aryl group, a heteroaryl group, an arylalkyl group, a cycloalkenyl group, a cycloalkylalkyl group, a cyclylalkyl group, a hydroxyalkyl group, an aminoalkyl group, an alkoxyalkyl group, a heterocyclylalkenyl group, a heterocyclylalkyl group, a heteroarylalkyl group, a silyl group, a silyloxyalkyl group, a mono-, di-, or trialkylsilyl group, and a mono-, di-, or trialkylsilyloxyalkyl group, which may be substituted with one or more electron-withdrawing groups.

[0046] G 2is preferably an alkyl group substituted with an electron-withdrawing group. Examples of the electron-withdrawing group include a cyano group, a nitro group, an alkylsulfonyl group, a halogen atom, an arylsulfonyl group, a trihalomethyl group, and a trialkylamino group, and is preferably a cyano group.

[0047] G 2 Particularly preferred as the group are the following groups: [ka]

[0048] G 3 is two G 3 may be bonded to each other to form a ring structure. 3 It is preferable that both of the groups are isopropyl groups.

[0049] R 1 , R 2 , R 3 and G 2 The alkyl group in the definition may be either linear or branched, and is preferably an alkyl group having 1 to 12 carbon atoms, more preferably an alkyl group having 1 to 6 carbon atoms. Specific examples of the alkyl group include methyl, ethyl, n-propyl, and the like. P Examples of the alkyl groups include butyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, and hexyl. Conversion The alkyl portion constituting the alkoxy group in the definition has the same definition as the alkyl group herein.

[0050] G 4 represents a protecting group for a hydrogen atom or a hydroxyl group, and when it represents a protecting group, it is G 1 It represents the same protecting group as G 4 is a hydrogen atom when deprotected, and the nucleotide compound in this case is also subjected to a series of steps in a nucleic acid extension reaction.

[0051] G 5represents an ammonium ion, an alkyl ammonium ion, an alkali metal ion, a hydrogen ion, or a hydroxyalkyl ammonium ion. Specific examples of the alkyl ammonium ion include methyl, ethyl, n-propyl, and the like. P Examples of the hydroxyalkyl ammonium ion include ethyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, and hexyl, and more specifically, for example, diethylammonium ion, triethylammonium ion, tetrabutylammonium ion, hexylammonium ion, and dibutylammonium ion. Examples of the alkali metal ion include sodium ion and lithium ion. Examples of the hydroxyalkyl moiety of the hydroxyalkyl ammonium ion include hydroxymethyl, hydroxyethyl, hydroxy-n-propyl, hydroxyisopropyl, hydroxy-n-butyl, and trishydroxymethyl, and more specifically, examples of the hydroxyalkyl ammonium ion include trishydroxymethyl ammonium ion.

[0052] As used herein, the term "nucleobase" refers to a group having a natural or non-natural nucleobase backbone. The nucleobase also includes modified forms in which the natural or non-natural nucleobase backbone is modified. C More specifically, examples of the nucleic acid base represented by the formula (I) include the following structures: [ka]

[0053] (In the above formula, R 4’ represents a hydrogen atom or a methyl group, R 5’ represents a hydrogen atom or an acetyl group, R 6’ represents a hydrogen atom, R 8’ represents a hydrogen atom or a methyl group.

[0054] B a is B C or a nucleobase protected with a protecting group.

[0055] A method for producing a nucleoside containing ribose whose hydroxyl group is protected with a protecting group represented by formula (1) and an amidite compound thereof will be described below. An amidite compound in which the hydroxyl group at the 2'-position of ribose is protected with a protecting group represented by formula (1) can be produced, for example, according to the following Schemes 3 and 4 described in WO 2019 / 208571, Japanese Patent Application No. 2018-083148, and PCT / JP2019 / 017249. [ka] [ka] (In the formula, R a and R b are the same or different and each represents a methyl group, an ethyl group, or a hydrogen atom, provided that R a and R b do not simultaneously represent a hydrogen atom; R c is a methyl group or an ethyl group, B a represents an optionally protected nucleobase, n represents an integer of 1 to 5, G represents a protecting group for the hydroxyl group shown in the formula. G 1 and G 2 are each independently the same or different and represent a hydroxyl-protecting group, and G 3 are the same or different and represent an alkyl group.

[0056] The above Schemes 3 and 4 are outlined below.

[0057] First, as shown in Scheme 3, 1reacts with cyanide ions to give 3-hydroxyalkylnitrile compounds 2 Then, the compound 2 is reacted with a bis(alkylthiomethyl) ether to give the ether compound 3 get. Next, as shown in Scheme 4, 4 In the presence of an oxidizing agent, the compound 5 (prepared according to the method described in Scheme 3) to give the compound 6 (The hydroxyl group at the 2'-position of ribose is protected with a protecting group represented by formula (1)) is then obtained. 6 to obtain the compound 7 The compound is obtained. 7 The hydroxyl group of the protecting group G 1 to selectively protect the compound 8 In addition, the compound 8 Phosphorodiamidite compound 9 to give the desired amidite compound. 10 Manufactured.

[0058] Scheme 3 In the reaction of Scheme 3, As the cyanide ion, for example, cyanide ions derived from sodium cyanide, potassium cyanide, copper cyanide, trimethylsilyl cyanide, etc. can be used.

[0059] When trimethylsilyl cyanide is used, it is preferable to add a base.

[0060] Examples of the base in this reaction include alkali metal hydroxides, alkaline earth metal hydroxides, and ammonium hydroxide, as well as combinations of two or more of these. In the present invention, lithium hydroxide and lithium hydroxide monohydrate are preferably used. The amount of the base is determined by the amount of the epoxy compound. 1 The amount is usually 0.01 to 1 equivalent, and preferably 0.1 to 0.3 equivalent, relative to the amount of the compound.

[0061] The amount of cyanide ions in the compound1 The amount is usually 0.3 to 2 equivalents, and preferably 0.6 to 0.8 equivalents, relative to the amount of the compound.

[0062] When "equivalents" are referred to herein, they mean "molar equivalents" unless otherwise specified.

[0063] The reaction temperature of this reaction is usually −20 to 40° C., and preferably 0 to 35° C. The reaction time of this reaction is usually 0.5 to 24 hours, and preferably 1 to 5 hours.

[0064] Ether Compounds 3 can be produced, for example, by reacting a bis(alkylthiomethyl) ether or a bis(phenylthiomethyl) ether with a 3-hydroxy-3-alkylpropanenitrile in the presence of an oxidizing agent and an acid in a solvent. [ka]

[0065] Bis(alkylthiomethyl)ethers or bis(phenylthiomethyl)ethers can be obtained, for example, by reacting bischloromethyl ethers or bis(aryloxymethyl)ethers with the corresponding alkyl mercaptans or phenyl mercaptans as shown in the following formula: An example of the bis(aryloxymethyl)ether is bis(2,4,6-trichlorophenyloxymethyl)ether. [ka] Alternatively, the compound can be produced according to the method described in the Examples below or by a method with appropriate modifications of these methods, if necessary.

[0066] Examples of the oxidizing agent include N-halogenated succinimides such as N-chlorosuccinimide, N-bromosuccinimide, and N-iodosuccinimide, N-halogenated hydantoins such as 1,3-diiodo-5,5-dimethylhydantoin, and halogens such as chlorine, bromine, and iodine, as well as combinations of two or more of these. In the present invention, N-halogenated succinimides are preferably used, and N-iodosuccinimide is more preferably used.

[0067] In this reaction, in addition to the oxidizing agent, an acid may be used. The acid is not particularly limited, but may be, for example, perfluoroalkyl carboxylic acid and its salt, perfluoroalkyl sulfonic acid and its salt, alkyl sulfonic acid and its salt, or a combination of two or more of these. The salt may be, for example, copper salt or silver salt. Specific examples of the acid include methanesulfonic acid, paratoluenesulfonic acid, camphorsulfonic acid, trifluoromethanesulfonic acid, and silver trifluoromethanesulfonate, or a combination of two or more of these. In the present invention, trifluoromethanesulfonic acid is preferably used.

[0068] Examples of the solvent include tetrahydrofuran, 2-methyltetrahydrofuran, cyclopentyl methyl ether, dioxane, dichloromethane, toluene, and the like, as well as combinations of two or more of these. In the present invention, tetrahydrofuran is preferably used.

[0069] The amount of 3-hydroxyalkylnitrile is usually 0.5 to 2.0 equivalents relative to the bis(alkylthiomethyl)ether or bis(phenylthiomethyl)ether, and preferably 0.8 to 1.5 equivalents. The amount of oxidizing agent is usually 0.5 to 2 equivalents relative to the bis(alkylthiomethyl)ether or bis(phenylthiomethyl)ether, and preferably 0.7 to 1.2 equivalents. The amount of acid is usually 0.001 to 2.0 equivalents relative to the bis(alkylthiomethyl)ether or bis(phenylthiomethyl)ether, and preferably 0.01 to 0.1 equivalents.

[0070] The reaction temperature of this reaction is usually −80° C. to 0° C., and preferably −50° C. to −30° C. The reaction time of this reaction is usually 1 to 24 hours, and preferably 2 to 6 hours.

[0071] The completion of the reaction can be confirmed, for example, by sampling a part of the reaction mass and subjecting it to an analysis method such as GC, TLC, or LC. After completion of the reaction, a base such as triethylamine may be added to the reaction mass to terminate the reaction. The reaction mass can be poured into water and subjected to usual post-treatment operations such as extraction with an organic solvent, washing, and concentration to obtain the ether compound. 6 By subjecting the residue to purification procedures such as distillation and column chromatography, a high purity ether compound can be obtained. 3 can be obtained.

[0072] Scheme 4 In the reaction of Scheme 4, Step 1 (Etherification step) compound 6 The process for producing the compound 4 The compound 5 This reaction is usually carried out by adding an oxidizing agent. The oxidizing agent used in this step is not particularly limited, but is preferably at least one selected from the group consisting of N-chlorosuccinimide, N-bromosuccinimide, N-iodosuccinimide, iodine, 1,3-diiodo-5,5'-dimethylhydantoin, bromine and chlorine.

[0073] In this step, an acid can also be added. The acid used is not particularly limited, but is preferably at least one selected from the group consisting of perfluoroalkyl carboxylic acids, perfluoroalkyl sulfonic acids, alkyl sulfonic acids, and salts thereof.

[0074] The reaction solvent used in this step is not particularly limited, but examples thereof include ethers such as diethyl ether, THF (tetrahydrofuran), 2-methyltetrahydrofuran, tetrahydropyran, 4-methyltetrahydropyran, dimethoxyethane, diglyme, cyclopentyl methyl ether, and dioxane, nitriles such as acetonitrile, aromatic hydrocarbons such as toluene, chlorobenzene, and dichlorobenzene, dichloromethane, and combinations of two or more of these solvents. Preferred solvents include ethers such as diethyl ether, THF (tetrahydrofuran), 2-methyltetrahydrofuran, tetrahydropyran, 4-methyltetrahydropyran, dimethoxyethane, diglyme, cyclopentyl methyl ether, and dioxane. More preferred solvents include tetrahydropyran and 4-methyltetrahydropyran.

[0075] During this process, the reaction between The time is not particularly limited, but is, for example, 10 minutes to 12 hours, and preferably 10 minutes to 6 hours.

[0076] The reaction temperature in this step is not particularly limited, but is, for example, -80 to 30°C, and preferably -60 to 10°C.

[0077] In this step, the ether compound 5 The concentration of is not particularly limited and can be set appropriately.

[0078] In this process, the ether compound 5 The number of moles of the compound 4 The molar amount is, for example, 0.5 to 2 times, and preferably 0.8 to 1.5 times, relative to the number of moles of the above.

[0079] In this step, the moles of the oxidizing agent are 4 The molar amount is, for example, 0.5 to 10 times, and preferably 0.8 to 6 times, relative to the number of moles of the compound.

[0080] Step 2 (deprotection step) The compound obtained in step 1 6 is subjected to a deprotection reaction to obtain the compound 7 The deprotection step can be carried out by a known method, but typically, the deprotection can be carried out by the action of hydrogen fluoride / triethylamine or hydrogen fluoride / pyridine in a solvent.

[0081] Step 3 (Protection of 5'-hydroxyl group) The compound obtained in the above step 7 is subjected to a protection step, and the introduction of a protecting group can be carried out by a known method, but typically, the compound 7 The compound is reacted with 4,4'-dimethoxytrityl chloride to introduce a protecting group. 8 is manufactured.

[0082] Process 4 (amidite process) This step is the compound obtained in the previous step. 8 To, compound 9 Typically, the reaction is carried out by reacting the compound 9 The reaction is carried out by reacting 2-cyanoethyl-N,N,N',N'-tetraisopropylphosphorodiamidite as the amide, to obtain the amidite compound 10 The amidite formation can be carried out in accordance with the method described in Examples 2 to 5 of Japanese Patent No. 5,554,881.

[0083] The following describes non-nucleotide linkers that can be introduced in place of p nucleotides (where p is a positive integer satisfying the formula: m-1>p) between the 5'-terminal and 3'-terminal nucleotides of the nucleic acid oligomers of formula (3) and formula (4). Examples of non-nucleotide linkers include linkers having an amino acid skeleton (for example, the linkers having an amino acid skeleton described in Japanese Patent No. 5157168 or Japanese Patent No. 5554881). Specifically, non-limiting examples include those represented by formula (A14-1), (A14-2) or ( A 14-3) (for example, as described in Japanese Patent No. 5555346 or Japanese Patent No. 5876890) are exemplified. In addition to these linkers, the linkers described in International Publication No. 2012 / 005368, International Publication No. 2018 / 182008, or International Publication No. 2019 / 074110 are exemplified. [ka]

[0084] Nucleotides and amidites in which the R group in formula (3) and the R′ group in formula (4) are substituents other than a hydroxyl group can be produced from nucleosides synthesized by known methods described in Japanese Patent No. 3745226, WO 2001 / 053528, or JP 2014-221817 A and known methods cited therein. Furthermore, they can be produced using commercially available products in accordance with the methods described in the Examples below or by appropriately modifying these methods.

[0085] Cleavage of nucleic acid oligomers (hereinafter referred to as oligonucleotides) from solid phase supports The cleavage step was carried out by using concentrated aqueous ammonia as a cleavage agent to cleave a nucleic acid oligomer having a desired chain length.

[0086] In the phosphoramidite method, a nucleic acid extension reaction is carried out by repeatedly performing the deprotection step, the condensation step, and the oxidation step according to a generally known method (for example, the method described in the aforementioned Japanese Patent No. 5,157,168 or Japanese Patent No. 5,554,881).

[0087] (Nucleic acid extension reaction) In this specification, the term "nucleic acid extension reaction" refers to a reaction in which nucleotides are sequentially linked via phosphodiester bonds to extend an oligonucleotide. The nucleic acid extension reaction can be carried out according to the general procedure of the phosphoramidite method. The nucleic acid extension reaction may be carried out using an automatic nucleic acid synthesizer that employs the phosphoramidite method.

[0088] The chain length of the nucleic acid oligomer may be, for example, 2 to 200 mer, 10 to 150 mer, or 15 to 110 mer.

[0089] The 5'-deprotection step is a step of deprotecting the protecting group of the 5' hydroxyl group at the end of the RNA strand supported on the solid phase carrier. Common protecting groups include 4,4'-dimethoxytrityl group (DMTr group), 4-monomethoxytrityl group, and 4,4',4"-trimethoxytrityl group. Deprotection can be carried out using an acid. Examples of acids for deprotection include trifluoroacetic acid, dichloroacetic acid, trifluoromethanesulfonic acid, trichloroacetic acid, methanesulfonic acid, hydrochloric acid, acetic acid, and p-toluenesulfonic acid.

[0090] The condensation step is a reaction in which a nucleoside phosphoramidite represented by formula (A13) is bonded to the 5' hydroxyl group at the end of the oligonucleotide chain deprotected in the deprotection step. The phosphoramidite used in the nucleic acid extension is an amidite compound represented by formula (A13) or (A12). Other usable phosphoramidites include 2'-OMe, 2'-F, 2'-O-tert-butyldimethylsilyl group, 2'-O-methoxyethyl group, 2'-H, 2'-fluoro-2'-deoxy-β-D-arabinofuranosyl, and the like. The nucleoside phosphoramidite used has a 5' hydroxyl group protected by a protecting group (e.g., DMTr group). The condensation step can be carried out using an activator that activates the nucleoside phosphoramidite. Examples of the activator include 5-benzylthio-1H-tetrazole (BTT), 1H-tetrazole, 4,5-dicyanoimidazole (DCI), 5-ethylthio-1H-tetrazole (ETT), N-methylbenzimidazolium triflate (N-MeBIT), benzimidazolium triflate (BIT), N-phenylimidazolium triflate (N-PhIMT), imidazolium triflate (IMT), 5-nitrobenzimidazolium triflate (NBT), 1-hydroxybenzotriazole (HOBT), and 5-(bis-3,5-trifluoromethylphenyl)-1H-tetrazole.

[0091] After the condensation step, the unreacted 5' hydroxyl group may be appropriately capped using a known capping solution such as an acetic anhydride-tetrahydrofuran solution or a phenoxyacetic anhydride / N-methylimidazole solution.

[0092] The oxidation step is a step of converting the phosphorous acid group formed in the condensation step into a phosphorous or thiophosphoric acid group. This step is a reaction of converting trivalent phosphorus into pentavalent phosphorus using an oxidizing agent, and can be carried out by reacting the oxidizing agent with an oligonucleic acid derivative supported on a solid phase carrier. When converting a phosphorous group to a phosphoric group, for example, iodine, or a peracid such as tert-butyl hydroperoxide or hydrogen peroxide, or (10-camphorsulfonyl)oxaziridine (CSO) can be used as an "oxidizing agent". The oxidizing agent can be used after diluting with an appropriate solvent to a concentration of 0.005 to 2M. The solvent used in the reaction is not particularly limited as long as it does not interfere with the reaction, and examples of the solvent include pyridine, THF, water, acetonitrile, 1-methylimidazole (NMI), and any mixed solvent of two or more of these. For example, iodine / water / pyridine / acetonitrile, iodine / water / pyridine, iodine / water / pyridine / acetonitrile / NMI, iodine / water / pyridine / THF, iodine / water / pyridine / THF / NMI, CSO / acetonitrile, iodine / pyridine-acetic acid, or a peracid (tert-butyl hydroperoxide / methylene chloride) can be used.

[0093] When converting a phosphorous acid group into a thiophosphate group, for example, sulfur, 3H-1,2-benzodithiol-3-one-1,1-dioxide (Beaucage reagent), 3-amino-1,2,4-dithiazole-5-thione (ADTT), 5-phenyl-3H-1,2,4-dithiazol-3-one (POS), [(N,N-dimethylaminomethylidene)amino]-3H-1,2,4-dithiazoline-3-thione (DDTT), or phenylacetyl disulfide (PADS) can be used as the "oxidizing agent". The oxidizing agent can be used after diluting with a suitable solvent to a concentration of 0.01 to 2M. The solvent used in the reaction is not particularly limited as long as it is not involved in the reaction, and examples thereof include dichloromethane, acetonitrile, pyridine, or any mixed solvent thereof. The oxidation step may be performed after the capping operation, or conversely, the capping operation may be performed after the oxidation step, and the order is not limited.

[0094] In the step of deprotecting the phosphate protecting group, after the synthesis of a nucleic acid having a desired sequence is completed, an amine is allowed to act on the phosphate portion to deprotect the protecting group. Examples of the amine include diethylamine described in Japanese Patent No. 4705716.

[0095] The protecting group of the 5' hydroxyl group of the nucleoside introduced at the end of the elongation may be used for column purification using the 5' protecting group as a tag after cleavage from the solid phase support and deprotection of the protecting group as described below, or the protecting group of the 5' hydroxyl group may be deprotected after column purification.

[0096] Furthermore, the oligonucleotide chain is cleaved and recovered from the solid phase support using aqueous ammonia or amines, for example, as shown in the above Scheme 2. Examples of amines include methylamine, ethylamine, isopropylamine, ethylenediamine, and diethylamine.

[0097] Nucleic acid oligomers that can be produced using the production method of the present invention include, but are not limited to, nucleic acid oligomers in which the nucleosides contained therein are RNA, DNA, 2'-O-MOE, 2'-O-Me, 2'-F RNA, and LNA. For example, Xiulong, Shen et al., Nucleic Acids Research, 2018, Vol. 46, No. 46, 1584-1600, and Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558, provide examples of various nucleosides.

[0098] Nucleic acid oligomers that can be produced using the production method of the present invention include, but are not limited to, nucleic acid oligomers in which the nucleosides contained therein are RNA, DNA, and RNA having 2'-O-MOE, 2'-O-Me, 2'-F, and LNA. For example, examples of various nucleosides described in Xiulong, Shen et al., Nucleic Acids Research, 2018, Vol. 46, No. 46, 1584-1600, and Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558 can be mentioned.

[0099] Typical examples of nucleic acid oligomers that can be used in the production method of the present invention are shown below in addition to the examples described in the Examples, but are not limited to these. In the following explanation of the sequences, U represents uridine, C represents cytidine, A represents adenosine, and G represents guanosine. Examples of the nucleic acid oligomers described in International Publication No. 2019 / 060442 include those having the following sequences (B) and (C). Sequence (B): 5'-AUGGAAUmACUCUUGGUUmACdTdT-3' (Antisense) (SEQ ID NO: 3) 21mer Sequence (C): 5'-GUmAACmCmAAGAGUmAUmUmCmCmAUmdTdT-3' (Sense) (SEQ ID NO: 4) 21mer In sequences (B) and (C), Um represents 2'-O-methyluridine, Cm represents 2'-O-methylcytidine, and dT represents thymidine. Examples of such oligonucleotides include the nucleic acid oligomers described in Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, pp. 546-558 (see page 553). A typical example is a nucleic acid oligomer having the following sequence (D): Sequence (D): 5'-AGAGCCAGCCUUCUUAUUGUUUUAGAGCUAUGCUGU-3' (SEQ ID NO: 5) 36mer Examples include the nucleic acid oligomer described in JP4965745. A typical example is a nucleic acid oligomer having the following sequence (E). Sequence (E): 5'-CCAUGAGAAGUAUGACAACAGCC-P-GGCUGUUGUCAUACUUCUCAUGGUU-3' 49mer. CCAUGAGAAGUAUGACAACAGCC (SEQ ID NO: 6), GGCUGUUGUCAUACUUCUCAUGGUU (SEQ ID NO: 7). In sequence (E), "P" is represented by the partial structure separated by a wavy line in the following formula (A5). An example is a nucleic acid oligomer having the following sequence (F), which is described in Nucleic Acids Research, 2019, Vol. 47, No. 2: p. 547. Sequence (F): 5'-ACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU-3' (SEQ ID NO: 8) 67mer An example is a nucleic acid oligomer having the following sequence (G), which is described on page 173 of JP 2015-523856. Sequence (G): 5'-GUUUUCCCUUUUCAAAGAAAUCUCCUGGGCACCUAUCUUCUUAGGUGCCCUCCCUUGUUUAAACCUGACCAGUUAACCGGCUGGUUAGGUUUUU-3' (SEQ ID NO: 9) 94mer Examples of the nucleic acid oligomer include those described in JP 2017-537626. Typical examples include nucleic acid oligomers having the following sequences (F), (G), (H), and (J). Sequence (F): 5'-AGUCCUCAUCUCCCUCAAGCGUUUUAGAGCUAGUAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' (SEQ ID NO: 10) 100mer Sequence (G): 5'-GCAGAUGUAGUGUUUCCACAGUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU-3' (SEQ ID NO: 11) 113mer Sequence (H): 5'-dAdGdTdCdCdTdCdAdTdCdTdCdCdCdTdCdAdAdGdCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU -3' (SEQ ID NO: 12) 113mer In the sequence (H), dT represents thymidine, dC represents 2'-deoxycytidine, dA represents 2'-deoxyadenosine, and dG represents 2'-deoxyguanosine. Sequence (J): 5'-AmsGmsUmsCCUCAUCUCCCUCAAGCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUmsUmsU-3' (SEQ ID NO: 13) 113mer In sequence (J), Um represents 2'-O-methyluridine, Am represents 2'-O-methyladenosine, Gm represents 2'-O-methylguanosine, and s represents a phosphorothioate modification. EXAMPLES

[0100] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

[0101] Measurement method The measurement methods used in the following tests are shown below.

[0102] (Measurement method 1: Method for measuring the purity of oligonucleotides) The purity of the oligonucleotide crude product after solid-phase synthesis was measured by HPLC. The crude product was separated into each component by HPLC (wavelength 260 nm, column ACQUITY UPLC Oligonucleotide BEH C18, 2.1 mm x 100 mm, 1.7 μm), and the purity of the oligonucleotide was calculated from the area value of the main product in the total area value of the obtained chromatogram.

[0103] The HPLC measurement conditions are shown in Table 1 below. [Table 1]

[0104] (Measurement method 2: Measurement of oligonucleotide yield) The OD of the crude product 260 The OD was measured. 260 represents the UV260nm absorbance per 10mm path length in 1mL solution (pH=7.5). It is generally known that 1OD=40μg for RNA, so the above OD 260 The yield was calculated based on the measured values. Furthermore, the yield per unit volume of the solid phase carrier was calculated. For Examples 1 to 5 and Comparative Examples 1 and 2, the relative yield to the yield of Example 1 was determined.

[0105] (Measurement method 3: Oxygen concentration measurement) The oxygen concentration in the atmosphere (gas phase) of the reaction system was measured using PACK KEEPER (Residual Oxygen Meter) manufactured by IIJIMA ELECTRONICS CORP. Before measuring the oxygen concentration, the device was calibrated by measuring the oxygen concentration in air and pure nitrogen, and then the needle attached to the device was inserted into a container such as a flask capped with a septum to measure the oxygen concentration in the gas phase of the system. The measured oxygen concentration was displayed in real time, and the point where the measured value stabilized was regarded as the oxygen concentration of the atmosphere.

[0106] Solid Phase Synthesis of Oligonucleotides Sequence (I): 5'-AGCAGAGUACACACAGCAUAUACC-P-GGUAUAUGCUGUGUGUACUCUGCUUC-PG-3' (SEQ ID NOs: 1 and 2) 53mer In the sequence (I), "A" is represented by a partial structure separated by a wavy line in the following formula (A1). "C" is represented by a partial structure separated by a wavy line in the following formula (A2). "G" is represented by a partial structure separated by a wavy line in the following formula (A3). U is represented by a partial structure separated by a wavy line in the following formula (A4). "P" is represented by a partial structure separated by a wavy line in the following formula (A5). Note that "A" at the 5'-end is represented by a partial structure separated by a wavy line in the following formula (A6). Also, "G" at the 3'-end is represented by a partial structure separated by a wavy line in the following formula (A7). However, the phosphate group in the structural formula may be a salt. AGCAGAGUAC ACACAGCAUA UACC (SEQ ID NO: 1) GGUAUAUGCU GUGUGUACUC UGCUUC (SEQ ID NO: 2)

[0107] [ka]

[0108] [ka]

[0109] [ka]

[0110] [ka]

[0111] [ka]

[0112] [ka]

[0113] [ka]

[0114] Controlled pore glass (CPG) was used as the solid phase support, and an AKTA oligopilot plus100 (GE Healthcare) was used as the nucleic acid synthesizer to synthesize an oligonucleotide consisting of the above sequence (I) from the 3' end to the 5' end by phosphoramidite solid phase synthesis. The synthesis was carried out on a 78.20 μmol scale. The synthesis was carried out using adenosine PMM amidite (compound (A8)), cytidine PMM amidite (compound (A9)), guanosine PMM amidite (compound (A10)), uridine PMM amidite (compound (A11)), and the like described in Patent Application No. 2018-083148 were used. edge Compound (A12) described in Publication No. 2017 / 188042 was used, a high-purity trichloroacetic acid toluene solution was used as the deblocking solution, 5-benzylmercapto-1H-tetrazole was used as the condensing agent, an iodine solution was used as the oxidizing agent, and a phenoxyacetic anhydride solution and an N-methylimidazole solution were used as the capping solution. After completion of nucleic acid elongation, a diethylamine solution was applied to the nucleic acid on the support to selectively deprotect the cyanoethyl protecting group of the phosphoric acid moiety. Here, PMM is an abbreviation for (((1-cyanopropan-2-yl)oxy)methoxy)methyl group.

[0115] [ka]

[0116] [ka]

[0117] [ka]

[0118] [ka]

[0119] [ka]

[0120] Next, specific examples of the production of oligonucleotides (nucleic acid oligomers) produced by the method of the present invention will be described. Here, in the following examples, the oligonucleotides produced by the method of the present invention are oligonucleotides having the sequences (I) shown in SEQ ID NOs: 1 and 2. The guanosine derivative described in the following Examples and Comparative Examples means a compound represented by the following structural formula: The circle illustrated in the following structural formula is a schematic representation of CPG. [ka]

[0121] Example 1 Solid-phase synthesis of sequence (I) was carried out by AKTA oligopilot plus100 using CPG carrying 78.20 μmol of guanosine derivative and amidites shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12). Then, CPG carrier carrying 16.46 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid-phase carrier using aqueous ammonia. Next, the liberated oligonucleotide was dissolved in 6.6 mL of dimethyl sulfoxide, and 1.97 μmol of the solution was collected in a 100 mL volume, 29 mm diameter eggplant flask, and 10.6 μL of nitromethane and a 15 mm diameter stirrer were added thereto, and the flask was then sealed with a 29 mm diameter septum. Further, a needle for blowing nitrogen from a nitrogen cylinder into the system, a needle for removing the blown nitrogen, and a measuring needle of an Oxygen Meter were pierced into the septum, and the system was replaced with nitrogen by flowing nitrogen, and the oxygen concentration in the gas phase was set to 0%. Here, the oxygen concentration in the gas phase was measured using the method described in the measurement method 3 above. Furthermore, 1.10 mL of a dimethyl sulfoxide solution of 1 M tetra-n-butylammonium fluoride (TBAF) (the amount of TBAF is 10.2 moles per mole of protective group) that had been dehydrated with molecular sieves 4A was dropped onto the surface of the oligonucleoside solution at 33°C over 1 hour using a syringe pump from KD Scientific, and the mixture was kept warm for 4 hours to deprotect the 2'-PMM protective group. The crude product was obtained by precipitation. The yield was 14.1 mg, and the purity was 62%. The purity of the oligonucleotide in the obtained crude product was measured by the method described in Measurement Method 1 above, and the yield of the oligonucleotide was measured by the method described in Measurement Method 2 above.

[0122] Example 2 Using CPG carrying 78.20 μmol of guanosine derivative and the amidite shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12), solid-phase synthesis of sequence (I) was carried out by AKTA oligopilot plus100. Then, the CPG carrier carrying 19.91 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid-phase carrier using ammonia water. Next, the liberated oligonucleoside was dissolved in 8.0 mL of dimethyl sulfoxide, and 3.03 μmol of the solution was collected in a 100 mL, 29 mm diameter eggplant flask, and 15.9 μL of nitromethane and a 15 mm diameter stirrer were added thereto, and the flask was sealed with a 29 mm diameter septum. Further, a needle for blowing nitrogen from a nitrogen cylinder into the system, a needle for removing the blown nitrogen, and a measuring needle of an Oxygen Meter were pierced into the septum, and nitrogen was flowed into the system to replace the inside of the system with nitrogen, and the oxygen concentration in the gas phase was set to 0%. The oxygen concentration in the gas phase was confirmed by measuring in the same manner as in Example 1. Furthermore, 1.66 mL of a dimethyl sulfoxide solution of 1 M tetra-n-butylammonium fluoride (TBAF) (the amount of TBAF is 10.0 moles per mole of protective group) that had been dehydrated with molecular sieves 4A was flowed into the surface of the oligonucleoside solution at 33°C under stirring with a stirrer within 1 minute using a syringe, and the mixture was kept warm for 4 hours to deprotect the 2'-PMM protective group. The crude product was obtained by precipitation. The yield was 21.7 mg and the purity was 60%. The purity and yield of the oligonucleotide were measured for the obtained crude product in the same manner as in Example 1.

[0123] Example 3 Solid-phase synthesis of sequence (I) was carried out using AKTA oligopilot plus100 with CPG carrying 78.20 μmol of guanosine derivative and amidites shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12). Then, CPG carrier carrying 16.46 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid-phase carrier using aqueous ammonia. Next, the liberated oligonucleoside was dissolved in 6.6 mL of dimethyl sulfoxide, and 1.00 μmol of the solution was collected in a 100 mL 29 mm diameter eggplant flask, and 5.3 μL of nitromethane and a 15 mm diameter stirrer were added thereto, and the flask was sealed with a 29 mm diameter septum. Further, a needle for blowing nitrogen from a nitrogen cylinder into the system, a needle for removing the blown nitrogen, and a measuring needle of an Oxygen Meter were pierced into the septum, and the system was replaced with nitrogen by flowing nitrogen, and the oxygen concentration in the gas phase was set to 5%. The oxygen concentration in the gas phase was confirmed by measuring in the same manner as in Example 1. Furthermore, 0.56 mL of a dimethyl sulfoxide solution of 1 M tetra-n-butylammonium fluoride (TBAF) (the amount of TBAF was 10.2 moles per mole of protective group) that had been dehydrated with molecular sieves 4A was flowed into the surface of the oligonucleoside solution at 33°C under stirring with a stirrer within 1 minute using a syringe, and the mixture was kept warm for 4 hours to deprotect the 2'-PMM protective group. The crude product was obtained by precipitation. The yield was 7.1 mg and the purity was 60%. The purity and yield of the oligonucleotide were measured for the obtained crude product in the same manner as in Example 1.

[0124] Example 4 Solid-phase synthesis of sequence (I) was carried out using AKTA oligopilot plus100 with CPG carrying 78.20 μmol of guanosine derivative and amidites shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12). Then, CPG carrier carrying 16.46 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid-phase carrier using aqueous ammonia. Next, the liberated oligonucleoside was dissolved in 6.6 mL of dimethyl sulfoxide, and 0.98 μmol of the solution was collected in a 100 mL 29 mm diameter eggplant flask, and 5.3 μL of nitromethane and a 15 mm diameter stirrer were added thereto, and the flask was then sealed with a 29 mm diameter septum. Further, a needle for blowing nitrogen from a nitrogen cylinder into the system, a needle for removing the blown nitrogen, and a measuring needle of an Oxygen Meter were pierced into the septum, and the system was replaced with nitrogen by flowing nitrogen, and the oxygen concentration in the gas phase was set to 10%. The oxygen concentration in the gas phase was confirmed by measuring in the same manner as in Example 1. Furthermore, 0.56 mL of a dimethyl sulfoxide solution of 1 M tetra-n-butylammonium fluoride (TBAF) (the amount of TBAF was 10.4 moles per mole of protective group) that had been dehydrated with molecular sieves 4A was flowed into the surface of the oligonucleoside solution at 33° C. with a syringe within 1 minute while stirring with a stirrer, and the mixture was kept warm for 4 hours to deprotect the 2'-PMM protective group. The crude product was obtained by precipitation. The yield was 6.9 mg and the purity was 54%. The purity and yield of the oligonucleotide were measured for the obtained crude product in the same manner as in Example 1.

[0125] Example 5 Solid-phase synthesis of sequence (I) was carried out using AKTA oligopilot plus100 with CPG carrying 78.20 μmol of guanosine derivative and amidites shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12). Then, CPG carrier carrying 16.46 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid-phase carrier using aqueous ammonia. Next, the liberated oligonucleoside was dissolved in 6.6 mL of dimethyl sulfoxide, and 1.00 μmol of the solution was collected in a 100 mL 29 mm diameter eggplant flask, and 5.3 μL of nitromethane and a 15 mm diameter stirrer were added thereto, and the flask was sealed with a 29 mm diameter septum. Further, a needle for blowing nitrogen from a nitrogen cylinder into the system, a needle for removing the blown nitrogen, and a measuring needle of an Oxygen Meter were pierced into the septum, and the system was replaced with nitrogen by flowing nitrogen, and the oxygen concentration in the gas phase was set to 15%. The oxygen concentration in the gas phase was confirmed by measuring in the same manner as in Example 1. Furthermore, 0.56 mL of a dimethyl sulfoxide solution of 1 M tetra-n-butylammonium fluoride (TBAF) (the amount of TBAF was 10.2 moles per mole of protective group) that had been dehydrated with molecular sieves 4A was flowed into the surface of the oligonucleoside solution at 33°C under stirring with a stirrer within 1 minute using a syringe, and the mixture was kept warm for 4 hours to deprotect the 2'-PMM protective group. The crude product was obtained by precipitation. The yield was 7.1 mg and the purity was 46%. The purity and yield of the oligonucleotide were measured for the obtained crude product in the same manner as in Example 1.

[0126] (Reference example 1) Solid-phase synthesis of sequence (I) was carried out by AKTA oligopilot plus100 using CPG carrying 78.20 μmol of guanosine derivative and amidites shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12). Then, 19.91 μmol was collected, and the oligonucleotide was liberated from the solid-phase support using aqueous ammonia. Next, the liberated oligonucleoside was dissolved in 8.0 mL of dimethyl sulfoxide, and 1.01 μmol was collected in a 100 mL volume 29 mm diameter eggplant flask, and 5.3 μL of nitromethane and a 15 mm diameter stirrer were added thereto, and the flask was then sealed with a 29 mm diameter septum. The measurement needle of the Oxygen Meter was pierced into the septum, and the oxygen concentration in the gas phase in the system was measured in the same manner as in Example 1, and the oxygen concentration was 21%. Further, 0.56 mL of 1M tetra-n-butylammonium fluoride (TBAF) in dimethyl sulfoxide (TBAF amount: 10.1 moles per mole of protecting group) that had been dehydrated using molecular sieves 4A was poured onto the surface of the oligonucleoside solution at 33°C within 1 minute using a syringe while stirring with a stirrer, and the mixture was kept warm for 4 hours to deprotect the 2'-PMM protecting group. The crude product was obtained by precipitation. The yield was 7.2 mg, and the purity was 41%. The purity and yield of the oligonucleotide were measured for the obtained crude product in the same manner as in Example 1.

[0127] (Reference example 2) Solid-phase synthesis of sequence (I) was carried out by AKTA oligopilot plus100 using CPG carrying 78.20 μmol of guanosine derivative and amidites shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12). Then, CPG carrier carrying 16.46 μmol of oligonucleotide was collected, and the oligonucleotide was liberated from the solid-phase carrier using ammonia water. Next, the liberated oligonucleoside was dissolved in 6.6 mL of dimethyl sulfoxide, and 1.96 μmol of the solution was collected in a 100 mL volume 29 mm diameter eggplant flask, and 10.6 μL of nitromethane and a 15 mm diameter stirrer were added thereto, and the flask was then sealed with a 29 mm diameter septum. The measurement needle of the Oxygen Meter was pierced into the septum, and the oxygen concentration in the gas phase in the system was measured in the same manner as in Example 1, and the oxygen concentration was 21%. Further, 1.10 mL of 1M tetra-n-butylammonium fluoride (TBAF) in dimethyl sulfoxide (TBAF amount: 10.2 moles per mole of protective group) that had been dehydrated with molecular sieves 4A was dropped onto the surface of the oligonucleoside solution at 33°C over 1 hour using a syringe pump from KD Scientific, and the mixture was kept warm for 4 hours to deprotect the 2'-PMM protective group. The crude product was obtained by precipitation. The yield was 14.2 mg, and the purity was 47%. The purity and yield of the oligonucleotide were measured for the crude product obtained in the same manner as in Example 1.

[0128] The measurement results are shown in Table 2 below. [Table 2]

[0129] As shown in Table 2 above, when the deprotection reaction of the protecting group of the ribose hydroxyl group contained in the oligonucleotide described in the specification was carried out under an inert gas atmosphere with an oxygen concentration of 15% or less, the deprotection reaction proceeded more efficiently than when the deprotection reaction was carried out at an oxygen concentration of more than 15%. Furthermore, it was found that the deprotection reaction proceeded even more efficiently by extending the time required for adding TBAF to 30 minutes or more, and as a result, the purity of the resulting deprotected oligonucleotide was high.

[0130] (Reference example) Preparation of PMM amidite 1) Production of 3-hydroxybutanenitrile [ka] Lithium hydroxide monohydrate (1.8g, 42.8mmol) was added to propylene oxide (12.4g, 0.21mol), cooled to 4℃, and trimethylsilyl cyanide (15.5g, 0.15mol) was slowly added dropwise. After several tens of minutes had passed since the completion of the dropwise addition, the internal temperature rose to 35℃. The mixture was stirred in an ice bath (internal temperature 5℃) for 30 minutes, at 10-15℃ for 1 hour, and at room temperature (25℃) for 30 minutes. Water (15mL) was added to the reaction liquid and stirred at room temperature for 30 minutes. After that, the mixture was extracted with diethyl ether (50mL×3 times), washed with saturated saline, dried with anhydrous sodium sulfate, and the solvent was distilled off to obtain 10.6g (yield 84%) of crude 3-hydroxybutanenitrile as a colorless, transparent liquid.

[0131] 2) Manufacturing of PMM agent [ka] Bis(methylthiomethyl)ether (32.41g, 0.234mol, 2.0eq.) was dissolved in dry THF (300mL), molecular sieves 4A (32g) was added, and the mixture was stirred for 10 minutes. The mixture was cooled to -50°C, trifluoromethanesulfonic acid (TfOH) (0.88mL, 5.85mmol, 0.05eq.) and N-iodosuccinimide (NIS) (31.5g, 0.140mol, 1.2eq.) were added, and crude 3-hydroxybutanenitrile (10g, 0.117mol) was added dropwise thereto, and the mixture was stirred at around -50 to -45°C for 2 hours. A saturated aqueous solution of sodium sulfite (150mL), saturated sodium bicarbonate (150mL), and ethyl acetate (300mL) were added to the reaction solution, and the mixture was stirred at 0 to 10°C for 10 minutes. After separation, the organic layer was washed with saturated saline (150 mL) and dried over anhydrous magnesium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel chromatography (Hexane / AcOEt=10 / 1 to 5 / 1, silica 800 mL) to obtain 5.9 g (yield 28%) of a yellow liquid PMM agent. Purification by GC / FID showed a purity of 97.2%.

[0132] PMM Agent [ka] pale yellow transparent liquid 1 H-NMR (CDCl3): δ 4.93-4.84 (m, 2H) 4.75(s, 2H) 4.06-4.00 (m, 1H) 2.57 (t, 2H), 2.17(s, 3H) 1.35 (d, 3H)

[0133] For the production method of bis(methylthiomethyl)ether, see JP2016-50203A.

[0134] 3) Manufacturing of PMM agent [ka] Bismethylthiomethyl ether (7.45g, 53.9mmol), molecular sieves 4A (7.5g) and THF (111mL) were mixed and cooled (-60 to -55℃), and N-iodosuccinimide (NIS) (14.4g, 1.19eq), trifluoromethanesulfonic acid (TfOH) (143μL, 0.030eq) and 3-hydroxybutanenitrile (5.0g, 1.09eq) were added. After stirring at -50 to -45℃ for 4 hours, triethylamine (5.1mL) was added dropwise. The reaction vessel was immersed in a water bath to warm the reaction solution to around 10℃, and the reaction solution was poured into a previously prepared 10℃ aqueous solution (sodium thiosulfate pentahydrate 21.8g, sodium bicarbonate 7.7g and water 165mL). Ethyl acetate (50 mL) was added, and the mixture was stirred at 10-15°C for 30 minutes. The mixture was filtered through Celite (7.5 g) and separated. The organic layer was washed with saturated saline (30 mL), dried over magnesium sulfate (3.8 g), and concentrated on a rotary evaporator to obtain 11.5 g of crude product (11.5 g, GC purity 49.8%). The mixture was purified using a silica gel column (silica gel 300 mL, hexane / ethyl acetate = 10 / 1) to obtain 3-((methylthiomethoxy)methoxy)butanenitrile (light yellow transparent liquid, 5.32 g, yield 56%, purity 99.5%).

[0135] 4) Preparation of amidites The following is an example of the preparation of PMM amidite U, in which the nucleic acid base moiety is uracil. PMM amidites having nucleic acid bases other than uracil can also be prepared in a similar manner.

[0136] [ka] TIPS-U (20.0 g), THF (40 ml) and toluene (60 ml) were charged in a vessel, concentrated to 74 ml, and dehydrated. The reaction solution was cooled to -50°C, and a PMM reagent (10.80 g), TfOH (12.48 g), and a solution of NIS (12.4 g) / THF (26 ml) were added dropwise. After stirring at -50°C for 2 hours, the reaction solution was poured into an ice-cooled solution of sodium bicarbonate (7.0 g) / sodium thiosulfate (20.0 g) / water (130 ml) and separated at room temperature. Then, it was washed with a solution of sodium bicarbonate (3.5 g) / sodium thiosulfate (10.0 g) / water (65 ml). The organic layer was concentrated to obtain a crude product containing the target compound. Exact Mass: 613.3, Actual Mass: 612.3 (ESI (-))

[0137] [ka] The crude PMM-U-1 was dissolved in acetone (40 mL), triethylamine trihydrofluoride (7.28 g) was added, and the mixture was stirred at 20° C. for 18 hours. The reaction solution was poured into tert-butyl methyl ether (200 ml) and stirred for 30 minutes. The reaction solution was filtered, and the solid remaining on the filter paper was washed with tert-butyl methyl ether (40 ml). The resulting precipitate was collected by filtration and dried under reduced pressure to obtain a crude product (14.56 g) containing the target compound. Exact Mass: 371.1, Actual Mass: 370.2 (ESI(-))

[0138] [ka] The crude PMM-U-2 (14.5 g), pyridine (72.5 ml), acetonitrile (29 ml) and toluene (72.5 ml) were charged and cooled on ice. 4,4'-dimethoxytrityl chloride (15.86 g) was added to the mixture and stirred at room temperature for 4 hours. Then, methanol (7.2 ml) and toluene (29 ml) were added, and the mixture was washed twice with 5% aqueous sodium bicarbonate solution (43.5 ml) and once with 10% aqueous sodium chloride solution (43.5 ml). The organic layer was then concentrated. The concentrate was purified by silica gel column chromatography to obtain the target product (21.12 g). Exact Mass: 673.3, Actual Mass: 672.3 (ESI (-))

[0139] [ka] PMM-U-3 (20.0 g), acetonitrile (60 ml), diisopropylammonium tetrazolide (5.88 g), and 2-cyanoethyl-N,N,N',N'-tetraisopropyl phosphorodiamidite (10.75 g) were charged and stirred at 35°C for 4 hours. Toluene (200 ml) was added to the reaction solution, and the mixture was washed once with 5% aqueous sodium hydrogen carbonate solution (100 ml), five times with 50% aqueous DMF solution (200 ml), twice with water (100 ml), and once with 10% aqueous sodium chloride solution (100 ml). The organic layer was then concentrated and purified by silica gel column chromatography to obtain the target product (22.72 g).

[0140] The present invention provides an efficient method for producing a nucleic acid oligomer. It is expected that the purity of the nucleic acid oligomer produced by the method for producing a nucleic acid oligomer will be improved. [Sequence List Free Text]

[0141] SEQ ID NOs: 1 to 13 in the sequence listing represent the base sequences of oligonucleotides produced according to the production method of the present invention.

Claims

1. In an inert gas atmosphere having an oxygen concentration of 15% or less, a reaction mixture containing a compound represented by the formula (3): 【Chemistry 1】 (In the formula, G ４ represents a protecting group for a hydrogen atom or a hydroxyl group, and when representing a protecting group, represents the following group: 【change】 (In the formula, R 1 , R 2 and R 3 are the same or different and each represents hydrogen or an alkoxy group.) G ５ represents an ammonium ion, an alkylammonium ion, an alkali metal ion, a hydrogen ion, or a hydroxyalkylammonium ion, B Ｃ each independently represents the same or different nucleobase, R are each independently the same or different and each represents a hydrogen atom, a fluorine atom, or an OQ group; Q are each independently the same or different and each independently represent a tert-butyldimethylsilyl group, a methyl group, a 2-methoxyethyl group, a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position of ribose, an ethylidene group bonded to the carbon atom at the 4' position of ribose, or a group represented by formula (1): 【Chemistry 2】 (In the formula, R ａ and R ｂ are the same or different and each represents a methyl group, an ethyl group, or a hydrogen atom, The bond marked with * indicates a bond with the oxygen atom of the OQ group. n represents an integer of 1 to 5. However, R ａ and R ｂ does not simultaneously represent a hydrogen atom.) represents a protecting group of Y's are independently the same or different and each represents an oxygen atom or a sulfur atom; m represents an integer of 2 to 200; W and X are defined as either (a) or (b) below: (a) When W is a hydroxyl group, X has the same definition as R above. (b) when X is a hydroxyl group, W is an OV group; V represents a tert-butyldimethylsilyl group or a group represented by the formula (1) above. However, at least one of the groups R, W, and X represents a hydroxyl group protected by a protecting group of the formula (1). When m is an integer of 3 or more, the nucleic acid oligomer represented by formula (3) is a nucleic acid oligomer in which a non-nucleotide linker may be incorporated in place of p nucleotides (wherein p is a positive integer satisfying the formula: m-1>p) between the 5'-terminal and 3'-terminal nucleotides. The method comprises contacting a nucleic acid oligomer represented by the formula (4): 【Chemistry 3】 (In the formula, R' are each independently the same or different and each independently represent a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group; Q' are each independently the same or different and each represent a methylene group bonded to the 4' carbon atom of ribose, an ethylene group bonded to the 4' carbon atom, or an ethylidene group bonded to the 4' carbon atom of ribose, Substituent G in Formula (4) ４ , G ５ , Y, B ｃ and m are the same as those in formula (3), W ０ is a hydroxyl group, X ０ has the same definition as the R′ group above. When m is an integer of 3 or more, the nucleic acid oligomer represented by formula (4) is a nucleic acid oligomer in which a non-nucleotide linker may be incorporated in place of p nucleotides (wherein p is a positive integer that satisfies the formula: m-1>p) between the 5'-terminal and 3'-terminal nucleotides. A method for producing a nucleic acid oligomer represented by the formula: the fluoride ion source is a tetraalkylammonium fluoride; the non-nucleotide linker is a linker consisting of an amino acid backbone, The linker having an amino acid skeleton is a linker having a structure represented by the following formula (A14-1), (A14-2) or (A14-3): 【change】 (In the formula, 5' and 3' represent the 5'-end and 3'-end of the nucleic acid oligomer, respectively.)

2. W is a hydroxyl group, X is an R group, and W ０ is a hydroxyl group, and X ０ The process according to claim 1 , wherein is an R′ group.

3. The method according to claim 1 or 2, wherein the tetraalkylammonium fluoride is tetra-n-butylammonium fluoride (TBAF).

4. The method according to any one of claims 1 to 3, wherein the reaction is carried out in an inert gas atmosphere having an oxygen concentration of 10% or less.

5. The method according to any one of claims 1 to 3, wherein the reaction is carried out in an inert gas atmosphere having an oxygen concentration of 5% or less.

6. The method according to any one of claims 1 to 3, wherein the reaction is carried out in an inert gas atmosphere having an oxygen concentration of 0%.

7. The method according to any one of claims 1 to 6, wherein the time required for adding the entire amount of fluoride ions to the nucleic acid oligomer represented by formula (3) is 30 minutes or longer.

8. The method according to any one of claims 1 to 7, wherein the ratio of the protecting group of the formula (1) among R, W and X of the nucleic acid oligomer represented by the formula (3) is 5% or more.

9. The method according to any one of claims 1 to 7, wherein the ratio of the protecting group of the formula (1) among R, W and X of the nucleic acid oligomer represented by the formula (3) is 10% or more.

10. The method according to any one of claims 1 to 7, wherein the ratio of the protecting group of the formula (1) among R, W and X of the nucleic acid oligomer represented by the formula (3) is 20% or more.

11. The method according to any one of claims 1 to 7, wherein the ratio of the protecting group of the formula (1) among R, W and X of the nucleic acid oligomer represented by the formula (3) is 30% or more.

12. The method according to any one of claims 1 to 7, wherein the ratio of the protecting group of the formula (1) among R, W and X of the nucleic acid oligomer represented by the formula (3) is 40% or more.

13. The method according to any one of claims 1 to 7, wherein the ratio of the protecting group of the formula (1) among R, W and X of the nucleic acid oligomer represented by the formula (3) is 50% or more.

14. The method according to any one of claims 1 to 7, wherein the ratio of the protecting group of the formula (1) among R, W and X of the nucleic acid oligomer represented by the formula (3) is 60% or more.

15. The method according to any one of claims 1 to 7, wherein the ratio of the protecting group of the formula (1) among R, W and X of the nucleic acid oligomer represented by the formula (3) is 70% or more.

16. The method according to any one of claims 1 to 7, wherein the ratio of the protecting group of the formula (1) among R, W and X of the nucleic acid oligomer represented by the formula (3) is 80% or more.

17. The method according to any one of claims 1 to 7, wherein the ratio of the protecting group of the formula (1) among R, W and X of the nucleic acid oligomer represented by the formula (3) is 90% or more.

18. The method according to any one of claims 1 to 7, wherein the ratio of the protecting group of the formula (1) among R, W and X of the nucleic acid oligomer represented by the formula (3) is 95% or more.

19. The method according to any one of claims 1 to 7, wherein the ratio of the protecting group of the formula (1) among R, W and X of the nucleic acid oligomer represented by the formula (3) is 100%.

Images