Bacterial culture and detection methods

Abstract

To provide a culturing method that can grow anaerobic bacteria in a liquid sample by simple operation and in a short time, a detection method that can detect anaerobic bacteria in a liquid sample by simple operation and in a short time, and a solid medium suitable for growing bacteria in a liquid sample.SOLUTION: A bacteria culturing method includes culturing a liquid sample, which may contain anaerobic bacteria, in a state where a solid medium is covered. A method for detecting anaerobic bacteria including the steps of: culturing a liquid sample, which may contain anaerobic bacteria, in a state where a solid medium is covered; and using the cultured liquid sample as a sample containing a template to perform nucleic acid amplification to amplify a target sequence portion of a nucleic acid of target anaerobic bacteria. There is also provided a granular solid medium.SELECTED DRAWING: Figure 2

Description

[Technical field]

[0001] The present invention relates to a method for culturing bacteria in a liquid sample, which is capable of growing anaerobic bacteria such as Streptococcus mutans if present in the sample, a culture method and medium, a method for detecting anaerobic bacteria in a liquid sample, and a granular solid medium. [Background technology]

[0002] Streptococcus mutans is not only a typical causative agent of dental caries, but is also known to be associated with systemic diseases.

[0003] For example, Non-Patent Document 1 examines 279 subjects to determine whether they have Streptococcus mutans (cnm-positive Streptococcus mutans) in their saliva, which has the surface cnm protein that binds to type I collagen, whether they have cerebral microbleeds, and their cognitive function. The results show that subjects with cerebral microbleeds were more likely to have cnm-positive Streptococcus mutans than subjects without cerebral microbleeds, that the risk of cerebral microbleeds was significantly higher in the group in which cnm-positive Streptococcus mutans was detected than in the group in which it was not detected (odds ratio = 14.3), and that the group with cnm-positive Streptococcus mutans had lower cognitive function. Non-patent document 2 similarly discloses that 51 subjects were examined for the presence or absence of CNM-positive Streptococcus mutans in the saliva and the presence or absence of cerebral microbleeds, and found that the group with CNM-positive Streptococcus mutans had a higher incidence of cerebral microbleeds.

[0004] Furthermore, Non-Patent Document 3 discloses that the invasion of cnm-positive Streptococcus mutans into the bloodstream aggravates inflammatory bowel disease.

[0005] Furthermore, Non-Patent Documents 3 and 4 disclose that when a strain of Streptococcus mutans having cnm protein and PA protein on its surface was intravenously administered to mice fed a high-fat diet, the mice developed symptoms of non-alcoholic steatohepatitis (NASH). In recent years, even non-alcoholic people have been found to suffer from liver damage due to excessive nutritional intake, and this condition is called non-alcoholic fatty liver disease (NAFLD). Among NAFLD, non-alcoholic steatohepatitis (NASH), in which inflammatory changes and fibrosis progress along with fatty liver disease, is problematic because it can progress to cirrhosis and even liver cancer, and early detection is necessary.

[0006] Thus, Streptococcus mutans, especially those with cnm and PA proteins on the bacterial surface, are associated with cerebral microbleeds and subsequent severe systemic diseases such as stroke, dementia, inflammatory bowel disease, and NASH. Therefore, by examining the presence or absence of these bacteria, it is possible to predict the onset of these diseases and prevent them early.

[0007] Various methods for detecting Streptococcus mutans in the oral cavity are known. The method generally used is that described in Non-Patent Document 2. In this method, saliva or dental plaque is applied to MSB (Mitis-Salivarius-Bacitracin) agar medium, and after culturing for two days, colonies are collected and inoculated into a liquid medium and cultured for one day. The grown bacteria are collected, and DNA is extracted by lysozyme lysis, RNase treatment, and ethanol precipitation. PCR is performed using primers specific to the Streptococcus mutans gene to determine the presence or absence of Streptococcus mutans. This method requires 3 to 4 days.

[0008] Patent Document 1 also describes that the presence or absence of Streptococcus mutans can be determined in a short time without requiring complicated operations by applying saliva or dental plaque to an MSB solid medium and culturing it for a short time of 40 hours or less, recovering the bacteria grown on the solid medium with a bacteria collection liquid, and subjecting the recovered liquid to nucleic acid amplification. This method can detect Streptococcus mutans in a short time of up to one and a half days.

[0009] However, Streptococcus mutans is a facultative anaerobic bacterium and grows more easily under anaerobic conditions than under aerobic conditions. In particular, in order to grow efficiently from a sample with a small number of bacteria such as saliva, it is necessary to create anaerobic conditions. In the method of Patent Document 1, in order to create anaerobic conditions, it is necessary to use an oxygen scavenger and a dedicated airtight container, and an anaerobic chamber (glove box) filled with nitrogen gas or a hydrogen-nitrogen mixed gas. The anaerobic chamber is very expensive, and a new oxygen scavenger and dedicated airtight container are required for each culture, so the method of Patent Document 1 is somewhat expensive. Furthermore, in the method of Patent Document 1, the culture must be carried out in the presence of an oxygen scavenger or in an anaerobic chamber with the lid of the culture vessel open, which entails the risk of contamination. Furthermore, in the method of Patent Document 1, in order to collect the bacteria grown on the surface of the solid medium, it is necessary to add a small amount of a collecting liquid such as a liquid medium and wipe the surface of the medium, which is somewhat time-consuming. [Prior art documents] [Patent documents]

[0010] [Patent Document 1] Patent Publication No. 2020-68678 [Non-patent literature]

[0011] [Non-Patent Document 1] SCIENTIFIC REPORTS 6:38561(2016) [Non-Patent Document 2] Oral Diseases (2015) 21, 886-893 [Non-Patent Document 3] Osaka University Dental Journal, 62(1)P.15-17 [Non-Patent Document 4] SCIENTIFIC REPORTS 6:36886(2016) Summary of the Invention [Problem to be solved by the invention]

[0012] The present invention aims to provide a culture method capable of growing anaerobic bacteria in a liquid sample in a short period of time with simple operations, a detection method capable of detecting anaerobic bacteria in a liquid sample in a short period of time with simple operations, and a solid medium suitable for growing bacteria in a liquid sample. [Means for solving the problem]

[0013] The present inventors have conducted extensive research to solve the above problems and have obtained the following findings. (1) By covering a liquid sample such as saliva with a solid medium and culturing it on the solid medium, the surface of the solid medium becomes moderately anaerobic, allowing the anaerobic bacteria in the liquid sample (facultative anaerobic bacteria and obligate anaerobic bacteria) to grow efficiently. (2) The target anaerobic bacteria can be selectively grown by using a solid medium that selectively grows the target anaerobic bacteria, or by adding a component to which the target anaerobic bacteria are specifically resistant to a liquid sample and culturing it. (3) The liquid sample after cultivation is used as a sample containing a template to perform nucleic acid amplification to amplify a specific target sequence portion on the nucleic acid of the target anaerobic bacterium, thereby determining whether or not the anaerobic bacterium was present in the liquid sample.

[0014] The present invention has been completed based on the above findings, and provides the following [1] to [7]. [1] A bacterial cultivation method in which a liquid sample containing possible anaerobic bacteria is cultured covered with a solid medium. [2] The method according to [1], wherein the solid medium is formed into a granular shape. [3] The method according to [1] or [2], wherein the liquid sample is a sample selected from the group consisting of a biological sample, an environmental water sample, and a food sample. [4] A method for detecting anaerobic bacteria, comprising the steps of culturing a liquid sample in which anaerobic bacteria may be present while covering it with a solid medium, and performing nucleic acid amplification using the cultured liquid sample as a sample containing a template to amplify a target sequence portion of a nucleic acid possessed by the anaerobic bacteria of interest. [5] The method according to [4], wherein the solid medium is formed into a granular shape. [6] The method according to [4] or [5], wherein the liquid sample is a sample selected from the group consisting of a biological sample, an environmental water sample, and a food sample. [7] Granular solid medium. Effect of the Invention

[0015] In the past, anaerobic bacteria were cultured by sealing culture vessels such as petri dishes or microtubes in airtight containers together with oxygen scavengers, or by using large-scale equipment such as anaerobic chambers. Even facultative anaerobic bacteria were cultured in this way because cariogenic bacteria present in the oral cavity, such as Streptococcus mutans and Streptococcus sobrinus, grow more easily under anaerobic conditions than under aerobic conditions. In this respect, in the method of the present invention, by covering the solid medium with a liquid sample, the surface of the solid medium and its vicinity become anaerobic conditions suitable for the growth of anaerobic bacteria, so that anaerobic bacteria can grow if they are present in the liquid sample. Therefore, anaerobic bacteria can be grown easily and efficiently without using oxygen scavengers or special containers and devices. In addition, the method can be carried out at a very low cost.

[0016] Furthermore, the method of the present invention does not require the preparation of a template sample solution for nucleic acid amplification by recovering bacterial cells grown on a solid medium into a liquid as in the method of Patent Document 1, and the liquid sample after culture can be directly subjected to nucleic acid amplification, thereby reducing the amount of work required. Furthermore, the method of the present invention can detect a target base sequence by subsequent nucleic acid amplification without the need for a procedure for extracting nucleic acids from the bacterial cells grown in a liquid sample, making it a labor-saving method in this respect as well. Due to these characteristics, the method of the present invention makes it possible to determine the presence or absence of the target anaerobic bacteria in a short time, as little as 12 to 13 hours, after collection of a liquid sample. Therefore, the method of the present invention is suitable for mass screening and hospital screening which involve handling a large number of test samples.

[0017] Furthermore, when using an oxygen scavenger or an anaerobic chamber, the container cannot be sealed, which raises the risk of contamination. However, in the method of the present invention, the container can be sealed, which makes it possible to suppress contamination. In this way, since the method of the present invention allows cultivation with the lid of the culture vessel closed, for example, a patient can place saliva into a microtube containing solid medium and mail it to a testing institution with the lid closed, making it suitable for mail-in testing.

[0018] A suitable application of the method of the present invention is the detection of Streptococcus mutans from oral samples. However, even if saliva, which has a low bacterial density unlike dental plaque, is used as the test sample, the method of the present invention can detect Streptococcus mutans by subsequent nucleic acid amplification if Streptococcus mutans is present. As described above, the method of the present invention can process a large number of test samples easily and in a short time, making it easy to incorporate into hospital tests and mass health checks, etc., which will enable prediction and early prevention of cerebral microbleeds and the resulting onset of stroke, dementia, inflammatory bowel disease, NASH and the resulting onset of liver cirrhosis and liver cancer in a large number of subjects, leading to a reduction in medical costs. In addition, if Streptococcus mutans is detected, it can be bacteriostatically treated by oral irrigation with medicines or by taking Lactobacillus reuteri L8020 strain, which inhibits the proliferation of Streptococcus mutans. This can suppress dental caries, cerebral microbleeds and the resulting strokes, dementia, inflammatory bowel disease, NASH and the resulting liver cirrhosis and liver cancer. [Brief description of the drawings]

[0019] [Figure 1] FIG. 2 shows the sizes of the plate-shaped MSB agar medium and culture vessels used in each Example. [Diagram 2] FIG. 1 shows that cnm-positive Streptococcus mutans in saliva could be detected using granular agar medium. [Diagram 3] FIG. 1 shows that cnm-positive Streptococcus mutans could be detected even in diluted saliva. [Figure 4] FIG. 13 shows that Streptococcus mutans could be detected by the LAMP method even when the PA protein gene was targeted. [Diagram 5] FIG. 1 shows that Streptococcus sobrinus was detected by the method of the present invention. [Figure 6] FIG. 13 shows that Streptococcus mutans proliferated in saliva when saliva was cultured using a granular agar medium. [Figure 7] FIG. 13 shows that Streptococcus mutans in saliva could be detected even using a solid medium solidified with gelatin. [Figure 8] FIG. 13 shows that Streptococcus mutans and / or Streptococcus sobrinus in saliva could be detected even when tellurite and bacitracin were added to saliva instead of to a solid medium. [Figure 9]FIG. 1 shows that Streptococcus mutans in saliva could be detected using frozen granular MSB agar medium. [Figure 10] FIG. 13 shows that Streptococcus mutans in saliva could be detected using freeze-dried granular MSB agar medium. [Figure 11] FIG. 1 shows that the method of the present invention was able to detect Bifidobacterium longum, which is an obligate anaerobic bacterium. [Figure 12] FIG. 1 shows that increasing the concentration of all components in TOS propionic acid agar medium by three times increases the detection sensitivity of Bifidobacterium longum. [Figure 13] FIG. 13 shows that Streptococcus mutans in saliva could be detected even when the concentrations of all components of MSB agar medium were doubled. [Figure 14] FIG. 13 shows that Streptococcus mutans in saliva could be detected even after long-term storage of freeze-dried MSB agar medium. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0020] The present invention will be described in detail below. (1) Bacterial culture method The method for culturing bacteria of the present invention is a method in which a liquid sample in which anaerobic bacteria may be present is cultured in a state in which it is covered with a solid medium.

[0021] sample The test sample may be in a liquid state. In the present invention, the term "liquid state" refers to a state in which the sample has fluidity to such an extent that the sample can be spread to cover a solid medium, and viscous samples are also included in the liquid sample. Examples of such liquid samples include biological samples such as saliva, blood, urine, dental plaque suspension, and fecal suspension, and environmental water samples such as river water, lake water, seawater, wastewater (sewage), and drinking water, etc. In addition, examples of such liquid samples include food in the form of a solution or suspension, and food samples in which food is dissolved or suspended in water or an aqueous solution.

[0022] As described below, examples of anaerobic bacteria suitable for use in the method of the present invention include cariogenic bacteria such as Streptococcus mutans and Streptococcus sobrinus. These are facultative anaerobic bacteria. In order to detect caries-causing bacteria in the oral cavity, saliva and dental plaque are used as samples. Since dental plaque is a mass of bacteria, if it contains caries-causing bacteria, the bacterial density is very high. Therefore, it is easy to increase the number of bacteria by culturing, and the amplified nucleic acid is easy to detect. However, since it is usually difficult for the subject to collect plaque himself, it is desirable to use saliva in order to easily test for caries-causing bacteria. However, since the bacterial density in saliva is low, conventional methods for detecting caries-causing bacteria require a relatively long time of culturing. In this regard, the method of the present invention can detect caries-causing bacteria by short-time culturing and nucleic acid amplification even when saliva is used. Therefore, saliva is a suitable target sample for the method of the present invention. Blood is also a suitable target sample for the method of the present invention when detecting the presence of Streptococcus mutans in blood to the extent that it induces cerebral microbleeds.

[0023] In addition, examples of anaerobic bacteria suitable for the method of the present invention include bacteria causing food poisoning. Examples of bacteria causing food poisoning include facultative anaerobic bacteria such as Salmonella spp., Vibrio parahaemolyticus, Escherichia coli (enterohaemorrhagic E. coli O157, diarrheagenic E. coli, etc.), Bacillus cereus, Vibrio cholerae, Staphylococcus aureus, and Listeria monocytogenes; and obligate anaerobic bacteria such as Clostridium botulinum and Clostridium perfringens. Examples of samples for detecting bacteria causing food poisoning include environmental water samples, food samples, and biological samples.

[0024] The method of the present invention can also be suitably used to detect useful anaerobic bacteria. For example, facultative anaerobic bacteria such as Lactobacillus spp., Lactococcus spp., and Streptococcus spp., and obligate anaerobic bacteria such as Bifidobacterium spp. (bifidobacteria) are bacteria used in the production of fermented milk products, and the method of the present invention can be used to confirm whether or not these bacteria are present in a food sample. This makes it possible to examine the quality of the food and to confirm whether or not there is any food fraud.

[0025] Solid media The solid medium is a medium solidified using a gelling agent such as agar or gelatin, and may be any medium that contains components necessary for the growth of anaerobic bacteria. If a component to which the target anaerobic bacteria are specifically resistant is added to a solid medium, the target anaerobic bacteria can be selectively grown. Alternatively, such a component to which the target anaerobic bacteria are resistant can be added to a liquid sample, and in this case, the target anaerobic bacteria can also be selectively grown. When such a component to which the target anaerobic bacteria are resistant is added to a liquid sample, the component to which the target anaerobic bacteria are resistant may or may not be added to a solid medium.

[0026] For example, bacitracin, a drug that shows high resistance against Streptococcus mutans and Streptococcus sobrinus, can be used. The concentration of bacitracin in the solid medium and / or liquid sample may be about 0.05 to 0.5 Units / mL, preferably 0.1 to 0.3 Units / mL, more preferably 0.2 Units / mL. The use of tellurite in addition to bacitracin improves the selectivity of growth of Streptococcus mutans and Streptococcus sobrinus. Furthermore, if the solid medium and / or liquid sample contains a relatively high concentration of sucrose, it becomes difficult for contaminating bacteria to grow, but Streptococcus mutans and Streptococcus sobrinus can grow. Therefore, the solid medium preferably contains, for example, 5 to 40% by weight, particularly 10 to 30% by weight, particularly 15 to 20% by weight of sucrose. It is also preferable to add sucrose to the liquid sample so that the concentration is within this range.

[0027] In the present invention, the component capable of selectively growing the target anaerobic bacteria is not limited to one that does not allow any bacteria other than the target anaerobic bacteria to grow at all, and may be one that allows other bacteria to grow to an extent that does not affect the results of the method of the present invention. Examples of solid media that can selectively grow cariogenic bacteria such as Streptococcus mutans and Streptococcus sobrinus include MSB solid media and TYCSB (Trypticase-yeast-cysteine-sucrose-bacitracin) solid media. Examples of solid media that can selectively grow obligate anaerobic Bifidobacterium bacteria (bifidobacteria) include TOS propionic acid solid media. TOS propionic acid solid media contains galactooligosaccharides that selectively promote the growth of Bifidobacterium bacteria. Examples of solid media that can selectively grow Lactobacillus bacteria (lactic acid bacteria) include solid media such as Rogosa agar medium and MRS agar medium.

[0028] Generally, a solid medium containing 1.5 w / v% agar is used, and the solid medium used in the present invention may be blended with a gelling agent to achieve this level of hardness. Examples of gelling agents include agar and gelatin. The gelling agent concentration is preferably 0.2 w / v% or more, more preferably 0.5 w / v% or more, and even more preferably 1 w / v% or more. Also, it is preferably 20 w / v% or less, more preferably 10 w / v% or less, and even more preferably 5 w / v% or less. When the gelling agent is agar, it can be 3 w / v% or less, or 2 w / v% or less. Within the above range, the solid medium is resistant to crushing during distribution, storage, and use. If the gelling agent concentration is too high, the medium components are hardly dissolved in the liquid sample, making it difficult for bacteria to grow near the surface of the solid medium. However, if the gelling agent concentration is within the above range, bacteria can grow near the surface of the solid medium. A solid medium can be prepared by pouring a medium that has been heated to a liquid state into a culture vessel and then allowing it to cool and solidify, as is commonly done.

[0029] If the concentration of all components in the solid medium is made higher than the concentration specified by the manufacturer, bacteria in the sample will grow more easily, improving the sensitivity of bacterial detection. The concentration of all components in the solid medium can be 1 to 10 times, 1 to 5 times, 1 to 3 times, or 1 to 2 times the concentration specified by the manufacturer.

[0030] Granular solid medium Alternatively, a granular solid medium formed separately can be placed in the culture vessel. By forming the solid medium into granules, the specific surface area of ​​the solid medium increases, increasing the area of ​​the medium in contact with the liquid sample, improving the growth efficiency of the anaerobic bacteria. It is preferable that the granular solid medium has a higher specific gravity than the liquid sample, which makes it easier to sink the medium in the liquid sample. Another advantage of using a granular solid medium is that multiple types of solid medium with different compositions can be mixed and used. The shape of the particles is not particularly limited, and may be spherical, polyhedral, spheroidal, small plate-like, rectangular, cuboidal, rod-like, amorphous, etc. In order to increase the specific surface area, the particles may be formed into a shape with strong undulations like confetti, a shape having fine holes or grooves on the surface, or a shape having fine cavities extending from the surface to the inside. The size of the granular solid medium varies depending on the capacity of the culture vessel, but the major axis is preferably 0.5 mm or more, more preferably 1.5 mm or more, more preferably 2 mm or more, and 50 mm or less, more preferably 10 mm or less, more preferably 3 mm or less. In particular, 2.5 mm is preferred. It is preferred to use a large number of granular solid media of a size generally called granular in the culture vessel.

[0031] Granular solid media can be molded, for example, by pouring a medium that has been heated to a liquid state into a mold such as a sphere, polyhedron, spheroid, small plate, or cube and then cooling and solidifying it, by extruding a medium that has been heated to a liquid state into cold water or the like to solidify it and then cutting it as necessary, or by injecting a medium that has been heated to a liquid state into cold water, etc. After molding, holes, grooves, and minute cavities extending from the surface to the inside can be provided using a needle, laser, water jet, etc.

[0032] The granular solid medium is stored in a frozen or freeze-dried state, and when used, the frozen or freeze-dried medium can be directly added to a liquid sample. The freeze-dried product may be stored at room temperature, but is preferably stored at -80 to 4°C, particularly -20 to 4°C. The storage period can be 1 day to 3 years, particularly 1 day to 1 year, particularly 1 day to 6 months. The freeze-dried solid medium can also be used after being rehydrated with sterilized water. The ability to freeze or freeze-dry the solid medium is a major advantage since it allows testing institutions to prepare and store large quantities of the solid medium. Granular solid medium can also be sealed in a container such as a film or bottle and stored at room temperature or in a refrigerator after being sterilized without heating using UV or ozone. Granular solid medium may be packaged individually or in multiple packages (e.g., a single-use amount).

[0033] The shape of the culture vessel is not particularly limited, and examples thereof include a vessel having a single recess such as a dish-shaped vessel or a cylindrical bag-shaped vessel, a vessel having a plurality of dish-shaped or cylindrical bag-shaped recesses, a set of a plurality of cylindrical bag-shaped vessels, etc. For example, general-purpose products such as microtubes, multi-well plates, and petri dishes can be used.

[0034] culture For culturing, a liquid sample is placed in a culture vessel and the surface of the solid medium is covered with the liquid sample. It is sufficient to cover the entire surface of the solid medium.

[0035] When using a solid medium obtained by pouring a liquid medium into a culture vessel and solidifying it, the thickness of the liquid sample covering the surface of the solid medium is preferably 1 mm or more, more preferably 2 mm or more, more preferably 3 mm or more, and even more preferably 4 mm or more, so that the surface of the solid medium can be kept in a sufficiently anaerobic environment. The upper limit of the thickness of the liquid sample covering the surface of the solid medium is not particularly limited, but may be about 50 mm. For example, in the case of a slant medium prepared in a culture vessel or when the medium surface is uneven, the upper part of the slant medium or the convex part of the medium surface may be above the surface of the liquid sample. In this case, too, by adjusting the amount of liquid sample used, the surface part of the solid medium covered with the liquid sample can be made into an anaerobic condition sufficient for anaerobic bacteria to grow. In this case, it is sufficient that 10% or more, preferably 25% or more, preferably 50% or more, preferably 80% or more, preferably 90% or more, and preferably 95% or more of the solid medium surface is covered with the liquid sample.

[0036] When a granular solid medium is placed in a culture vessel, it is preferable to cover the liquid sample to a height of 1 mm or more, preferably 2 mm or more, preferably 3 mm or more, and preferably 4 mm or more from the top of the granules. That is, when a granular solid medium is used, it is preferable to cover the surface of the solid medium with a liquid sample to a thickness of 1 mm or more, preferably 2 mm or more, preferably 3 mm or more, and preferably 4 mm or more. This allows the surface of the solid medium to be in a sufficiently anaerobic environment. The upper limit of the height from the top of the granules to the surface of the liquid medium is not particularly limited, but may be about 50 mm. However, if there is too much solid medium compared to the liquid sample, a part of the granular solid medium may be above the liquid sample. In this case, too, by adjusting the volume of the vessel and the amount of liquid sample used, the surface of the solid medium covered with the liquid sample can be made into an anaerobic condition sufficient for anaerobic bacteria to grow. The order in which the liquid sample and the granular solid medium are placed in the culture vessel does not matter. In the present invention, it is preferable to use a granular solid medium, and it is preferable to culture the liquid sample by immersing a plurality or a large number of granular solid media in a container.

[0037] The incubation time varies depending on the type of sample and bacteria, but is preferably 12 hours or more, more preferably 16 hours or more, and even more preferably 20 hours or more, and is preferably 48 hours or less, more preferably 37 hours or less, and even more preferably 24 hours or less. If the incubation time is within this range, when the sample after incubation is used as it is as a sample liquid for nucleic acid amplification, if anaerobic bacteria are present in the liquid sample, the presence of the bacteria can be confirmed. The culture temperature may be the optimum temperature for the anaerobic bacteria to be detected, for example, about 30 to 45°C, particularly about 35 to 40°C, particularly about 36 to 38°C.

[0038] (2) Method for detecting anaerobic bacteria The method for detecting anaerobic bacteria of the present invention comprises the steps of culturing a liquid sample in which anaerobic bacteria may be present while covering it with a solid medium, and performing nucleic acid amplification using the cultured liquid sample as a sample containing a template to amplify a target sequence portion of nucleic acid contained in the anaerobic bacteria of interest. The method for culturing a liquid sample in which anaerobic bacteria may be present is as described above.

[0039] Nucleic acid extraction In the method of the present invention, nucleic acid (DNA or RNA) may be extracted from the recovered bacteria, but anaerobic bacteria can also be detected by directly subjecting the cultured liquid sample to a nucleic acid amplification method without extraction. The nucleic acid extraction in the present invention refers to a treatment for increasing the permeability of cells to release at least a part of the nucleic acid outside the cells. Such treatments are well known to those skilled in the art, and include, for example, heating (heating at about 65 to 100°C), surfactant (nonionic surfactant such as TritonX-100, ionic surfactant such as SDS or guanidine salt, etc.) treatment, calcium chloride treatment, enzyme (cell wall lysing enzyme such as lysozyme, etc.) treatment, pulse voltage application, osmotic shock, electron beam irradiation, etc.

[0040] Nucleic Acid Amplification Methods for amplifying DNA include methods involving a heat denaturation step of double-stranded DNA, such as PCR (polymerase chain reaction) (Science 239, 487-491 (1988)) and LCR (ligase chain reaction) (Proc. Natl. Acad. Sci. USA, 88: 189-193 (1991)); LAMP (loop-mediated isothermal amplification) (International Publication No. 00 / 28082), SDA (strand displacement amplification) (U.S. Pat. No. 5,455,166), ICAN (isothermal and chimeric primer-initiated amplification of nucleic acids) (International Publication No. 00 / 56877), SMAP (Smart amplification process) (Seibutsu butsuri kagaku, 52 (4): 183-187, 2008), 3SR (self-stranded sequence and isothermal amplification methods that do not involve a heat denaturation step of double-stranded DNA, such as the isothermal amplification method (Am. Biotechnol. Lab. 8, 14-25 (1990)).

[0041] RNA can also be amplified instead of DNA. When amplifying RNA, since RNA is single-stranded from the beginning, there is no need to heat-denaturate it, and isothermal amplification can be performed. In addition, RNA has a high intracellular copy number, which increases the detection sensitivity, and since it has high diversity between species, the detection accuracy of the target anaerobic bacteria is high. Examples of nucleic acid amplification methods that amplify RNA include TMA (Transcription Mediated Amplification) (In Ferre, F. (ed), Gene quantification, Boston, Birkhauser p189-201 (1998)), NASBA (Nucleic Acid Sequence-Based Amplification) (In Ferre, F. (ed), Gene quantification, Boston, Birkhauser p169-188 (1998)), and TRC (Transcription-reverse transcription concerted reaction) (J. Clin. Microbiol,.42 (9): 4284-4292, 2004).

[0042] Alternatively, methods such as RT (reverse transcription)-PCR and RT-LAMP can be used to amplify DNA using RNA as a template.

[0043] Among these, the isothermal amplification method is preferred because it is simple and does not require temperature changes, and the equipment is inexpensive. Among these, the LAMP method is particularly simple because it can amplify DNA in one step using one type of synthetic enzyme. In addition, the LAMP method has high amplification efficiency, so it can detectably amplify even small amounts of target DNA, and has extremely high specificity, which reduces erroneous detection of related bacterial species. In isothermal amplification, the temperature during amplification varies depending on the type of DNA polymerase, but may be, for example, about 50 to 70°C, preferably 60 to 70°C, and more preferably 60 to 67°C.

[0044] The target sequence portion to be amplified by the nucleic acid amplification method may be a specific base sequence portion on the nucleic acid of the target anaerobic bacterium. The target sequence portion may be the whole or a part of any gene, and a sequence portion spanning between genes may also be amplified. Usually, a portion of 100 to 300 bases may be amplified. When detecting Streptococcus mutans, the glycosyltransferase gene (GenBank accession number: M1736) has a relatively large base sequence difference between species of the genus Streptococcus, so if a sequence portion including all or a part of the glycosyltransferase gene is targeted, it can be detected with high accuracy. Also, if a sequence portion including all or a part of the gene encoding the cnm protein (GenBank accession number: AB465300.1) is targeted, it can detect cnm-positive Streptococcus mutans, and if a sequence portion including all or a part of the gene encoding the PA protein (GenBank accession number: KM219946) is targeted, it can detect PA-positive Streptococcus mutans.

[0045] In particular, by targeting the sequence portion of the transglucosidase gene of Streptococcus mutans, which consists of the base sequence shown in Sequence No. 1, nucleic acid amplification can be performed with even higher specificity, i.e., false detection of other bacterial species and missed detection of Streptococcus mutans are reduced. Furthermore, by targeting the sequence portion of the cnm protein gene of Streptococcus mutans, which consists of the base sequence shown in sequence number 2, nucleic acid amplification with even higher specificity can be performed, i.e., false detection of other bacterial species or cnm-negative Streptococcus mutans, and missed detection of cnm-positive Streptococcus mutans are reduced.

[0046] Determination of the presence or absence of anaerobic bacteria The target sequence of the anaerobic bacteria of interest can be amplified by carrying out an amplification reaction in the presence of an intercalator that binds to double-stranded nucleic acid, such as ethidium bromide (EtBr) or SYBR GREEN, and then checking the fluorescence under an ultraviolet lamp. In addition, a chelating agent such as calcein binds to manganese ions and is quenched before amplification, but as the nucleic acid amplification reaction progresses, the manganese ions are taken by the pyrophosphate ions produced, causing the agent to emit fluorescence, and the fluorescence is further enhanced by binding to magnesium ions in the reaction solution, so the presence or absence of amplification can be confirmed by checking the fluorescence under an ultraviolet lamp. In addition, pyrophosphate is generated as a by-product in the extension reaction by DNA polymerase, which reacts with magnesium ions in the reaction solution to produce magnesium pyrophosphate. In methods that generate a large amount of amplified product, such as the LAMP method, magnesium pyrophosphate precipitates in the reaction solution, causing it to become cloudy, so the amplification of the target sequence can be confirmed by visually checking the cloudiness. In addition, when the LAMP amplification reaction occurs, the pH of the reaction solution becomes acidic, so by adding a pH indicator to the reaction solution, the solution changes color, and this can be used as an indicator to confirm the amplification of the target sequence.

[0047] (3) Granular solid medium The present invention provides a granular solid medium. Conventionally used flat solid media are used to spread a sample containing bacteria to form a single colony and isolate a single strain, or to spread a sample containing bacteria to increase the number of bacteria and scrape it off for use in the next step. In contrast, granular solid media have a much larger specific surface area than flat solid media, and can be used in a variety of culture vessels with various contents, so that they can be used in a small-sized culture vessel together with a small amount of liquid sample containing bacteria and the bacteria can be grown on the surface. In addition, components that can grow bacteria diffuse from the solid medium into the liquid sample, so bacteria can grow not only on the surface of the solid medium but also in the liquid sample. After that, the bacteria that have grown on the surface of the granular solid medium can be collected, or the bacteria that have grown in the liquid sample can be collected and used in the next step. As a method for collecting the bacteria that have grown on the surface of the granular solid medium, a method of using the granular solid medium with the bacteria attached thereto in the next step can be mentioned. When the next step is nucleic acid amplification, the granular solid medium with the bacteria attached thereto can be added directly to the reaction solution.

[0048] Granular solid media can, among other things, efficiently grow anaerobic bacteria. When a liquid sample is inoculated into a liquid medium, the part of the liquid medium away from the surface may be in anaerobic conditions, but in reality, inoculating a liquid sample into the liquid medium does not allow anaerobic bacteria to grow efficiently. In contrast, if a granular solid medium is used so that its surface is covered with a liquid sample, the area near the surface of the solid medium will be in anaerobic conditions suitable for the growth of anaerobic bacteria, and anaerobic bacteria can grow efficiently. As mentioned above, when a non-granular solid medium such as a plate-like medium is used with its surface covered with a liquid sample, the area near the surface of the solid medium becomes an anaerobic condition suitable for the growth of anaerobic bacteria, and anaerobic bacteria can be grown efficiently. However, a granular solid medium is particularly suitable for the growth of anaerobic bacteria because its surface can be easily covered with even a small amount of liquid sample.

[0049] The target sample for which the granular solid medium of the present invention is used includes the liquid sample exemplified in the bacterial growth method of the present invention, and the anaerobic bacteria suitable for detection include the anaerobic bacteria exemplified in the bacterial growth method of the present invention. The granular solid medium of the present invention is particularly suitable when the liquid sample is saliva, and is particularly suitable for growing facultative anaerobic bacteria, particularly cariogenic bacteria such as Streptococcus mutans and Streptococcus sobrinus. The shape, properties, manufacturing method, and method of use during cultivation of the granular solid medium are as explained in the section "(1) Method of culturing bacteria."

[0050] In addition, the granular solid medium is cultured while covered with a liquid sample in which anaerobic bacteria may be present, and the cultured liquid sample is used as a sample containing a template to perform nucleic acid amplification to amplify the target sequence portion of the nucleic acid possessed by the target anaerobic bacteria, thereby enabling efficient detection of anaerobic bacteria even when the amount of liquid sample is small. In this case, the details of the detection method for anaerobic bacteria are as explained in the section "(2) Anaerobic detection method", such as the fact that nucleic acid extraction is not required and that it can be applied to various nucleic acid amplification methods. If a liquid sample is cultured on a granular solid medium, it becomes easier to detect anaerobic bacteria, especially when nucleic acid amplification is performed by the LAMP method. EXAMPLES

[0051] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these. Example 1 (Detection of Streptococcus mutans in saliva using granular agar medium) Preparation of MSB agar medium 9g of mitis salivarius agar (BD) and 15g of sucrose (Wako) were mixed, diluted to 100mL with distilled water, and autoclaved (121℃, 15min). After autoclaving, 100μL of 1% tellurite solution (BBL Tellurite solution 1%) (BD) and 50μL of 400U / ml bacitracin (SIGMA) were added to the medium that had cooled down to a level where it would not solidify. After stirring, the mixture was poured into a petri dish and left to stand until the medium solidified. The upper end of the Pasteur pipette (the end with the larger diameter) was pressed against the MSB agar medium in the petri dish to cut out a cylindrical MSB agar medium (Figure 1a). The cylindrical MSB agar medium was approximately 5 mm in diameter, 3 mm thick, and weighed approximately 75 mg.

[0052] Saliva culture The cylindrical MSB agar medium was placed in a 2 mL microtube (Greiner) (Figure 1b), and 150 μL of saliva was added to it using a Pipetman (Gilson). This caused the cylindrical MSB agar medium to be covered with saliva. The surface of the saliva was 1 mm higher than the top of the cylindrical MSB agar medium. The microtube was then capped and incubated at 37°C for 24 hours. The saliva samples used were one known to contain cnm-positive S. mutans and another known to not contain cnm-positive S. mutans. As a control, the saliva samples were cultured in the same manner without the addition of a cylindrical MSB agar medium.

[0053] LAMP reaction After 24 hours of incubation, the microtube was tapped to mix the contents. 5 μL of saliva was removed from the microtube after incubation and used as a sample solution containing the template to amplify DNA using LAMP reagent (Loopamp DNA Amplification Reagent, Eiken Chemical Co., Ltd.). The amounts of each component contained in 25 μL of the LAMP reaction solution are as follows. Primers: 1600 nM FIP, 1600 nM BIP, 800 nM LF, 800 nM LB, 400 nM F3, 400 nM R3 Saliva (template DNA): 5 μL Loopamp fluorescent and visual detection reagent (Eiken Chemical Co., Ltd.) 1μL 0.8M Betaine After preparing the above LAMP reaction solution, the reaction was carried out at 64° C. for 90 minutes. The primer sets used are as follows: Primer set for amplifying the cnm protein gene (referred to as "cnm primers") F3: CCAGTAATACTGTCATTGAAAGT (SEQ ID NO: 3) B3: CGCTTTGAGTTTGATGAGC (SEQ ID NO: 4) FIP: AACCATTAAGCTGGAGGTTCAGGAACTGCTTTGTCTTGCGT (SEQ ID NO: 5) BIP: CGTATAACCTGTTCCTCTGACTGTAATATTAAAGCAGGCGACAC (SEQ ID NO: 6) LF: GCAAGTATGTTGGTGATTTG (SEQ ID NO: 7) LB: CCTGAATTCTGCCAGTTAAC (SEQ ID NO: 8)

[0054] The results of observing each reaction tube under an ultraviolet lamp are shown in Figure 2. In Figure 2, "Mutans bacteria" is "Streptococcus mutans" (the same applies to the following figures). As a result, when only saliva containing Streptococcus mutans was cultured, Streptococcus mutans did not grow, and as a result, it could not be detected by the LAMP method (tube 2 in Figure 2). On the other hand, when saliva containing Streptococcus mutans was cultured in a cylindrical MSB agar medium, Streptococcus mutans grew, and as a result, it could be detected by the LAMP method using the cnm primer (tube 4 in Figure 2). It was found that Streptococcus mutans can be grown by culturing saliva using the method of the present invention, and that Streptococcus mutans can be detected even if the cultured saliva is directly used in a LAMP reaction without a DNA extraction procedure.

[0055] Example 2 (Study of saliva concentration) Next, we investigated whether the LAMP method could amplify sequences specific to the nucleic acids of Streptococcus mutans even when the amount of Streptococcus mutans in saliva was low. The saliva used in Example 1, which was known to contain cnm-positive Streptococcus mutans, was diluted 10-fold, 100-fold, 1000-fold, and 10000-fold with PBS, and cultured together with cylindrical MSB agar medium in the same manner as in Example 1, and nucleic acid amplification was carried out by the LAMP method. As a control, the original saliva alone was cultured in the same manner without the cylindrical MSB agar medium, and nucleic acid amplification was carried out by the LAMP method.

[0056] The results of observing each reaction tube under an ultraviolet lamp are shown in Figure 3. Streptococcus mutans could be detected even when the saliva was diluted 10-fold (tube 1 in Figure 3). On the other hand, when the original saliva was cultured without using the cylindrical MSB agar medium, Streptococcus mutans could not be detected (tube 5 in Figure 3). By adding the cylindrical MSB agar medium, even if the number of Streptococcus mutans bacteria was small, it was possible to efficiently grow them to a level that could be detected by nucleic acid amplification. It was found that even when only a small amount of saliva can be collected, such as from a subject with dry mouth, Streptococcus mutans can be detected by diluting the saliva and subjecting it to the method of the present invention.

[0057] Example 3 (Study of target base sequence) Saliva known to contain PA-positive Streptococcus mutans and saliva known not to contain PA-positive Streptococcus mutans were cultured on cylindrical MSB agar medium in the same manner as in Example 1. The cultured saliva was used as a sample containing a template, and nucleic acid amplification was performed by the LAMP method using primers targeting the PA protein gene. The LAMP reaction conditions were the same as in Example 1. The primer sets used are as follows: Primer set for amplifying the PA protein gene (referred to as "PA primers") F3: AGGCATACGAAGATGAACAA (SEQ ID NO: 9) B3: GCTAAAAGCATCATCCACAG (SEQ ID NO: 10) FIP: GGTTCTGTTAAGTTTCCGTCTTCATGCTTCTATTAAAGCTGCACTG (SEQ ID NO: 11) BIP: TGGTCTATGATCTTGAGCCAAATGAGAAGCCTTAAGGAACTTCC (SEQ ID NO: 12) LB: GAACTTATCTTTGACAACAG (SEQ ID NO: 13)

[0058] The results of observing each reaction tube under an ultraviolet lamp are shown in FIG. We were able to detect S. mutans not only by targeting the gene encoding the cnm protein, but also by targeting the gene encoding the PA protein, indicating that S. mutans can be detected by targeting any gene contained in S. mutans for nucleic acid amplification.

[0059] Example 4 (Detection of Streptococcus sobrinus) Streptococcus sobrinus is a facultative anaerobic bacterium similar to Streptococcus mutans and is known as a causative bacterium of dental caries. It was examined whether or not Streptococcus sobrinus can be detected by the method of the present invention. The saliva samples were taken from four subjects who were known to contain Streptococcus sobrinus. Each saliva sample was cultured using a cylindrical MSB agar medium in the same manner as in Example 1. As a control, each saliva sample was cultured without using a cylindrical MSB agar medium. The culture conditions were the same as in Example 1. After 24 hours of incubation, the contents were mixed by tapping the microtube. 1 μL of cultured saliva was removed from the microtube and used as a sample solution containing the template to amplify DNA using LAMP reagents (WarmStart Colorimetric LAMP 2x Master Mix, New England Biolabs). The amounts of each component contained in 25 μL of the LAMP reaction solution are as follows. Primers: 1600 nM FIP, 1600 nM BIP, 800 nM LF, 800 nM LB, 400 nM F3, 400 nM R3 Saliva (template DNA): 1 μL WarmStart Colorimetric LAMP 2x Master Mix (New England Biolabs) 12.5μL Loopamp fluorescent and visual detection reagent (Eiken Chemical Co., Ltd.) 1μL 5M Betaine (SIGMA) 4μL After preparing the above LAMP reaction solution, the reaction was carried out at 63° C. for 30 minutes. The primer sets used are as follows: Primer set for amplifying a sequence specific to the nucleic acid of Streptococcus sobrinus F3: GGGAGGCTCAAAGGAACT (SEQ ID NO: 14) B3: GATGATTTGCTCATCATAGTCTG (SEQ ID NO: 15) FIP: GGTAGCAAAGGTTAAATAGCCCATCGCTATTTTTACTGCTACAGC (SEQ ID NO: 16) BIP: TGCTTCTCTCTCTTATCAGTATCGGTCTTTATGACCAGTTGTCGA (SEQ ID NO: 17) LF: TCCTACGGCAATGCCAATG (SEQ ID NO: 18) LB: TTGGTCAACACACTAGAACCCG (SEQ ID NO: 19) The above primers were prepared with reference to the following paper. Rapid Detection of the Cariogenic pathogens Streptococcus Mutans and Streptococcus Sobrinus Using Loop-Mediated Isothermal Amplification S Nagashima, A Yoshida, T Ansai, H Watari, T Notomi, K Maki, T Takehara Oral Microbiol Immunol. 2007 Dec;22(6):361-8.

[0060] The results of observing each reaction tube under an ultraviolet lamp are shown in Figure 5. In Figure 5, "Sobrinus" is "Streptococcus sobrinus." By culturing the saliva samples from all four subjects (A to D) on cylindrical MSB agar plates, the amplification of sequences specific to the nucleic acids of Streptococcus sobrinus was confirmed using the LAMP method. It has been found that the method of the present invention is capable of detecting a wide range of facultative anaerobic bacteria.

[0061] Example 5 (Confirmation of growth of Streptococcus mutans using pH as an indicator) It is believed that the reason why the method of the present invention can detect facultative anaerobic bacteria is that by covering the solid medium with a liquid sample, the surface of the solid medium is not exposed to air, creating anaerobic conditions near the surface of the solid medium, which allows the facultative anaerobic bacteria to grow. To prove this hypothesis, it was confirmed whether or not facultative anaerobic bacteria actually grew. It is known that Streptococcus mutans decomposes sugar (sucrose) to produce lactic acid, thereby making the environment acidic. Therefore, if the culture medium becomes acidic after culturing Streptococcus mutans using the method of the present invention, it is understood that Streptococcus mutans is proliferating. Therefore, the pH of the culture medium was measured immediately after culturing (after 1 minute) and after culturing for 24 hours.

[0062] Specifically, a cylindrical MSB agar medium was placed in a 2 mL microtube (Greiner), and 150 μL of saliva known to contain cnm-positive Streptococcus mutans was added. The medium was cultured at 37°C for 24 hours. One minute and 24 hours after the start of culture, 1 μL of saliva was sampled, and the pH was determined using pH test paper (Advantec Toyo). The color of the pH test paper is shown in Figure 6(a). For saliva incubated for 1 minute, the test paper is green, indicating that the pH is around 7. On the other hand, for saliva incubated for 24 hours, the test paper is yellow, indicating that the pH is around 4.

[0063] A pH indicator is added to the LAMP reaction reagent WarmStart Colorimetric LAMP 2x Master Mix (New England Biolabs) to detect the reaction solution becoming acidic as the LAMP reaction progresses and nucleic acids are amplified. When the LAMP reaction is performed using WarmStart Colorimetric LAMP 2x Master Mix, the reaction solution turns yellow. Therefore, separately, 5 μL of saliva after 1 minute incubation and after 24 hours incubation was added to the LAMP reaction solution, WarmStart Colorimetric LAMP 2x Master Mix (New England Biolabs). The appearance of the reaction tube immediately after addition is shown in Figure 6b. The reaction solution to which saliva incubated for 1 minute was added is red, while the reaction solution using saliva incubated for 24 hours is yellow. This method also allowed the detection of the presence of facultative anaerobic bacteria such as Streptococcus mutans and Streptococcus sobrinus using pH as an indicator.

[0064] As described above, the saliva in which Streptococcus mutans has proliferated after 24 hours of culture is highly acidic, so the reaction solution has already turned yellow when it is added to the LAMP reaction solution WarmStart Colorimetric LAMP 2x Master Mix. Therefore, when attempting to confirm the amplification of target nucleic acid by utilizing the phenomenon in which the reaction solution turns yellow as the LAMP reaction proceeds, it is necessary to confirm the amplification by a means other than a pH indicator that detects acidification by yellowing. For this reason, when using the WarmStart Colorimetric LAMP 2x Master Mix reagent as the LAMP reaction reagent as in the above-mentioned Example 4, the presence or absence of amplification can be confirmed by adding, for example, a Loopamp fluorescent / visual detection reagent (calcein).

[0065] From the above results, it is inferred that by culturing saliva using cylindrical MSB agar medium, facultative anaerobic bacteria such as Streptococcus mutans and Streptococcus sobrinus in saliva proliferated, and we believe that this hypothesis is proven.

[0066] Example 6 (Investigation of the type of gelling agent used in the preparation of solid media) Preparation of MSB-G medium 9g of mitis salivarius agar (BD) and 15g of sucrose (Wako) were mixed, and the mixture was made up to 100mL with distilled water and autoclaved (121℃, 15min). After autoclaving, 3g of gelatin (Wako), 100μL of 1% tellurite solution (BBL Tellurite solution 1%) (BD) and 50μL of 400U / ml bacitracin (SIGMA) were added to the medium, which had been cooled to a level where it did not solidify. After stirring, the medium was poured into a petri dish and left to stand until it solidified. This was called MSB-G medium. The upper end of the Pasteur pipette (the end with the larger diameter) was pressed against the MSB-G medium in the petri dish, and a cylindrical MSB-G agar medium was cut out. The shape is the same as in Figure 1a. The cylindrical MSB-G agar medium was about 5 mm in diameter, about 3 mm thick, and weighed about 75 mg.

[0067] Saliva culture The cylindrical MSB-G medium was placed in a 2 mL microtube (Greiner), and 200 μL of saliva known to contain cnm-positive Streptococcus mutans was added using a Pipetman (Gilson). This covered the cylindrical MSB-G medium with saliva. The surface of the saliva was 1 mm higher than the top of the cylindrical MSB-G medium. The microtube was then capped and cultured at 37°C for 24 hours. As a control, saliva alone was cultured in the same manner, without the cylindrical MSB-G medium.

[0068] LAMP reaction The microtube cultured for 24 hours was tapped to mix the contents. 5 μL of saliva after culture was removed from the microtube and used as a sample solution containing the template to amplify the cnm gene in the same manner as in Example 1 using a LAMP method reagent (WarmStart Colorimetric LAMP 2x Master Mix, New England Biolabs) containing Loopamp fluorescent and visual detection reagents.

[0069] The results of observing the reaction tube under an ultraviolet lamp are shown in Figure 7. CNM-positive S. mutans could be detected even when a solid medium solidified with gelatin was used. This shows that the gelling agent that can be used to solidify the medium is not limited to agar.

[0070] Example 7 (Study of the use of antibacterial agents) MSB medium contains mitis salivarius agar, sucrose, tellurite, and bacitracin. Of these, tellurite and bacitracin have antibacterial properties. Tellurite exhibits antibacterial properties by inhibiting the growth of gram-negative bacteria, while bacitracin exhibits antibacterial properties by blocking the synthesis of cell wall peptidoglycan. It is known that the antibacterial activity of these antibacterial agents decreases when stored in an aqueous solution for a long period of time, so frozen storage is preferable to storage in an aqueous solution. However, in general, when solid medium plates containing MSB medium are frozen, there are problems such as the higher concentration of the medium dissolving first when thawed, changing the concentration of the medium, and it takes a long time to thaw, so after preparation, they are generally used up within a short period of time without freezing. When the bacterial detection method of the present invention is carried out in a mass screening, the testing institution needs to prepare and store a large amount of solid medium in advance. In addition, when the bacterial detection method of the present invention is carried out by mail test, it takes time to mail a kit containing a solid medium to the subject and return it after use. Therefore, if there is a method for carrying out the method of the present invention without using MSB solid medium, which generally cannot be stored for a long time, it would be easy to carry out mass screening and mail test. For this reason, an agar medium (MSB(-) medium) was prepared from the components of MSB medium, excluding tellurite and bacitracin, and instead, tellurite and bacitracin were added to the test saliva to examine whether Streptococcus mutans and Streptococcus sobrinus in saliva could be selectively grown and detected.

[0071] Preparation of MSB(-) medium 9 g of mitis salivarius agar (BD) and 15 g of sucrose (Wako) were mixed, and the mixture was diluted to 100 mL with distilled water and autoclaved (121°C, 15 minutes). After autoclaving, the mixture was poured into a petri dish and left to stand until the medium solidified. This was called MSB(-) medium. The upper end of the Pasteur pipette (the end with the larger aperture) was pressed against the MSB(-) medium in the petri dish, and a cylindrical MSB(-) agar medium was cut out (the shape is similar to that of Figure 1a). The cylindrical MSB(-) agar medium was approximately 5 mm in diameter, approximately 3 mm thick, and weighed approximately 75 mg.

[0072] Saliva culture The cylindrical MSB(-) medium was placed in a 2 mL microtube (Greiner), and 195 μL of saliva, known to contain Streptococcus mutans and Streptococcus sobrinus, to which tellurite and bacitracin had been added, was added using a Pipetman (Gilson). This caused the cylindrical MSB agar medium to be covered with saliva. The surface of the saliva was 2 mm higher than the top of the cylindrical MSB agar medium. The microtube was then covered with a lid and incubated at 37°C for 20 hours. The tellurite concentration in saliva was 0.00025-0.001 w / v%, and the bacitracin concentration was 0.05-0.2 U / mL.

[0073] LAMP reaction 2 μL of saliva from a microtube that had been cultured for 20 hours was used as a sample solution containing the template, and DNA was amplified using LAMP reagent (WarmStart Colorimetric LAMP 2x Master Mix, New England Biolabs) supplemented with 1 μL of Loopamp fluorescent and visual detection reagent. The amounts of each component contained in 25 μL of the LAMP reaction solution are as follows. Primers: 1600 nM FIP, 1600 nM BIP, 800 nM LF, 800 nM LB, 400 nM F3, 400 nM R3 Saliva (template DNA): 1 μL WarmStart Colorimetric LAMP 2x Master Mix)12.5μL Loopamp fluorescent and visual detection reagent (Eiken Chemical Co., Ltd.) 1μL 5M Betaine (SIGMA) 4μL The primer sets used were a primer set (PA primers) for amplifying a sequence portion specific to nucleic acid possessed by Streptococcus mutans, and the same primer set for amplifying a sequence portion specific to nucleic acid possessed by Streptococcus sobrinus as that used in Example 4. After preparing the above LAMP reaction solution, the reaction was carried out at 65°C (Streptococcus mutans) or 63°C (Streptococcus sobrinus) for 60 minutes.

[0074] The results of observing each reaction tube under an ultraviolet lamp are shown in Figure 8. In Figure 8, "No DNA" is a control in which distilled water was added to the LAMP reaction solution instead of saliva. Interestingly, the results showed that adding tellurite and bacitracin to saliva enabled the detection of Streptococcus mutans and / or Streptococcus sobrinus, similarly to the case where MSB medium containing tellurite and bacitracin was used.

[0075] Saliva to which tellurite and bacitracin have been added is unlikely to lose its activity even when frozen. Therefore, if the test cannot be performed immediately after collection, adding tellurite and bacitracin to the saliva immediately after collection and then freezing it will be possible to suppress the proliferation of bacteria other than Streptococcus mutans and Streptococcus sobrinus in the saliva, and stable test results will be obtained.

[0076] Example 8 (Study of storage conditions for MSB solid medium 1) As mentioned above, solid media are generally not frozen. However, we investigated whether facultative anaerobic bacteria could be detected when granular solid media was thawed after freezing and then used. Specifically, we investigated whether Streptococcus mutans could be detected when frozen cylindrical MSB agar medium was placed in a liquid sample and cultured. That is, the saliva known to contain PA-positive Streptococcus mutans used in Example 3 was cultured together with cylindrical MSB agar medium and cylindrical MSB agar medium in a frozen state in the same manner as in Example 4, and nucleic acid amplification was performed by the LAMP method. As a control, only the saliva was cultured in the same manner without the cylindrical MSB agar medium, and nucleic acid amplification was performed by the LAMP method. Both MSB agar cylinders were submerged in saliva, and the saliva level was 1 mm higher than the top of the MSB agar cylinders.

[0077] The results of observing each reaction tube under an ultraviolet lamp are shown in Figure 9. Streptococcus mutans could be detected even when cultured with a cylindrical MSB agar medium that had been frozen (tube 3 in Figure 9). The bacteria were also detected on frozen cylindrical MSB agar medium, suggesting that granular solid medium can be stored for long periods in a frozen state.

[0078] Example 9 (Study of storage conditions for MSB solid medium 2) We investigated whether facultative anaerobic bacteria could be detected using a freeze-dried granular solid medium. Specifically, a cylindrical MSB agar medium placed in a microtube was frozen at -82°C for 1 hour, and then freeze-dried by vacuum treatment for 22 hours using a freeze dryer (EYELA FDU-1200, Tokyo Rikakikai). It was examined whether Streptococcus mutans could be detected when the microtube containing the freeze-dried cylindrical MSB agar medium was placed in a liquid sample and cultured. That is, the saliva used in Example 8, which was known to contain PA-positive Streptococcus mutans, was cultured with the cylindrical MSB agar medium and the freeze-dried cylindrical MSB agar medium in the same manner as in Example 8, and nucleic acid amplification was performed by the LAMP method. As a control, only the saliva was cultured in the same manner without the cylindrical MSB agar medium, and nucleic acid amplification was performed by the LAMP method. Immediately after the liquid sample was placed on the freeze-dried cylindrical MSB agar medium, it was below the surface of the saliva, but after a while the saliva surface sank to a position 1 mm higher than the top of the cylindrical MSB agar medium.

[0079] The results of observing each reaction tube under an ultraviolet lamp are shown in Figure 10. Streptococcus mutans could also be detected when cultured with freeze-dried cylindrical MSB agar medium (tube 3 in Figure 10). The bacteria were also detected on freeze-dried cylindrical MSB agar medium, suggesting that granular solid medium can be stored for long periods in a freeze-dried state.

[0080] Since the granulated MSB solid medium can be frozen or freeze-dried for storage, a large amount of MSB solid medium can be prepared in advance in a testing facility and frozen or freeze-dried for storage, which makes it easier to carry out hospital tests or mass medical examinations using the method of the present invention.Furthermore, it becomes possible to produce frozen or freeze-dried MSB solid medium and sell it to testing facilities.

[0081] Example 10 (Detection of obligate anaerobes) An investigation was conducted as to whether or not the method of the present invention can detect bacteria of the genus Bifidobacterium (bifidobacteria), which are obligate anaerobes.

[0082] (1) Design of LAMP primers First, in order to design LAMP primers, a portion of the nucleotide sequence of Bifidobacterium longum strain BB536 was determined. (DNA preparation) The contents of the capsule of "Bifidus Live Bifidobacteria BB536" (product name) (Morinaga Milk Industry) were removed and suspended in 5 mL of distilled water. DNA was extracted from 5 μL of this suspension using "Simple DNA Extraction Kit ver.2" (product name) (Kaneka Corporation). (PCR) PCR was performed using the extracted DNA as a template and Expand long Range (product name) (Roche). The method was as described in the attached manual. The PCR reaction was performed at 98°C for 2 minutes, followed by 35 cycles of 94°C for 20 seconds, 55°C for 20 seconds, and 68°C for 20 seconds. The primers used were as follows. BB536F: gccacttcgccacaaat (SEQ ID NO: 20) BB536R: acttcgccacgcagattctg (SEQ ID NO: 21) (Determination of base sequence) The PCR amplification product was purified using a PCR purification kit (product name) (QIAGEN), and then DNA sequencing was outsourced to Eurofins Genomics, Inc. The primers used for this DNA sequencing were BB536F and BB536R. The determined base sequence was subjected to identity search using NCBI's Nucleotide BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi). As a result, it showed high identity with a part of the base sequence of Bifidobacterium longum zJ1 chromosome, complete genome (GenBank no.: CP040235.1). The base sequences of the regions that showed high identity are shown below. The underlined parts correspond to the base sequences of primer BB536F (underlined second half) and primer BB536R (underlined first half). agttcgccacgcagattctgaataattccggtcgcgtgatgattggttggttcgttgataattccgctgtgggcatttatggcacactttcctcggtgagtaccgtttccgcaatcgt atggtcggcaattaattcttcgtttatcccattcctctatcggaatattgatgattccgaaggcaagaaaagagttcggagcctcgcttcgattctgct gctcacctatgctgcggtatgcgtattgatgactttcctagctcctgaggtggtcaagataatcgcaactgatgaatatatggcagcgatttacatcat gccgccaatttctgcagccattttccagaacgctatttccaatatgtatgcaaacgtgttgttgtatcacaaaaaatcttcatacataatgattgcctct atttgtggcgcagt (SEQ ID NO:22) (LAMP primer design) In order to design a LAMP primer for detecting Bifidobacterium longum BB536 strain in the base sequence of SEQ ID NO: 22, a primer preparation region was determined using PrimerExplorer Ver.5 (https: / / primerexplorer.jp / ). The designed primers are as follows. FIP: AGCAGCAGAATCGAAGCGAG-CGGAATATTGATGATTCCGAAG (SEQ ID NO: 23) BIP: TGCGTATTGATGACTTTCCTAGCTC-GCGGCATGATGTAAATCG (SEQ ID NO: 24) F3: TTCGTTTATCCCATTCCTCTA (SEQ ID NO: 25) B3: TGGAAATAGCGTTCTGGAA (SEQ ID NO: 26)

[0083] (2) Determination of detection limit of LAMP primers In order to examine whether Bifidobacterium longum can be detected by the method of the present invention, it is necessary to isolate the Bifidobacterium longum BB536 strain and determine the detection limit of DNA amplification by LAMP. (Cultivation of Bifidobacterium longum BB536 strain) TOS propionic acid agar medium (Yakult Pharmaceutical Co., Ltd.) was autoclaved according to the attached instructions and then poured into a petri dish to prepare a TOS propionic acid agar medium plate. A suspension of Bifidobacterium longum BB536 strain prepared during DNA extraction was spread onto this TOS propionic acid agar medium, placed in a pouch bag with a double zipper (Mitsubishi Gas Chemical Co., Ltd.) together with an oxygen scavenger, Anaero Pouch Anaerobic (trade name) (Mitsubishi Gas Chemical Co., Ltd.), and cultured for 2 days at 37° C. The resulting colonies were suspended in 1 mL of TE solution (hereinafter referred to as “TE suspension”). (Amplification of Bifidobacterium longum BB536 strain) To find the detection limit of the amount of bacteria for DNA amplification by LAMP, the TE suspension was serially diluted, and the diluted solution was used as a sample solution containing the template, and DNA was amplified using a LAMP reagent (WarmStart Colorimetric LAMP 2x Master Mix, New England Biolabs). The amounts of each component contained in 25 μL of the LAMP reaction solution are as follows. Primers: 1600nM FIP, 1600nM BIP, 400nM F3, 400nM R3 Template DNA: 1 μL WarmStart Colorimetric LAMP 2x Master Mix (New England Biolabs) 12.5μL 5M Betaine (SIGMA) 4μL After preparing the above LAMP reaction solution, the reaction was carried out at 65° C. for 90 minutes. As a result, amplification occurred in the undiluted TE suspension, but not in the 10-fold diluted TE suspension. Based on the above results, when a 10-fold diluted TE suspension was used as a sample, in which the presence of the Bifidobacterium longum BB536 strain could not be detected even if the sample was directly subjected to LAMP, it was examined whether the method of the present invention could detect the presence of the Bifidobacterium longum BB536 strain.

[0084] (3) Detection of Bifidobacterium longum BB536 strain by the method of the present invention (Preparation of granular TOS propionic acid agar medium) The upper end of the Pasteur pipette (the end with the larger diameter) was pressed against the TOS propionic acid agar medium in the petri dish, and a cylindrical TOS propionic acid agar medium was cut out. The shape is the same as in Figure 1a. The cylindrical TOS propionic acid agar medium was about 5 mm in diameter, about 3 mm thick, and weighed about 75 mg. (Cultivation of Bifidobacterium BB536 strain) The cylindrical TOS propionic acid agar medium was placed in a 2 mL microtube (Greiner), and 200 μL of 10-fold diluted TE suspension was added thereto using a Pipetman (Gilson). This covered the cylindrical medium with the 10-fold diluted TE suspension. The liquid surface was 2 mm higher than the top of the cylindrical medium. The microtube was then capped and cultured at 37°C for 24 and 48 hours, respectively. As a control, only the 10-fold diluted TE suspension was cultured in the same manner, without the cylindrical medium. LAMP reaction The microtube cultured for 24 or 48 hours was tapped to mix the contents. 1 μL of the TE suspension after culture was removed from the microtube and used as a sample solution containing the template for amplification using a LAMP reagent (WarmStart Colorimetric LAMP 2x Master Mix, New England Biolabs). The LAMP method was the method described in the section "(1) Design of LAMP primers" in this Example.

[0085] The appearance of the reaction tube after amplification is shown in FIG. The tube in which the 10-fold diluted TE suspension was cultured without the cylindrical medium was red, but the tube in which the 10-fold diluted TE suspension was cultured with the cylindrical medium turned yellow after the amplification reaction. In other words, it can be seen that the Bifidobacterium longum BB536 strain was grown by placing the cylindrical TOS propionic acid agar medium, making it possible to detect it by LAMP. From the above, it was demonstrated that the method of the present invention can detect obligate anaerobes, and that the detection sensitivity is at least 10 times higher than when a suspension of obligate anaerobes is directly subjected to LAMP.

[0086] Example 11 (Concentration of solid medium 1) (Preparation of granular medium) Cylindrical media were prepared using TOS propionic acid agar medium (Yakult Pharmaceutical Co., Ltd.) (same as that prepared in Example 10) (hereinafter referred to as "1x TOS medium") prepared according to the attached instructions, and TOS propionic acid agar medium prepared using three times the amount of all components described in the attached instructions (hereinafter referred to as "3x TOS medium") respectively. The same procedures as in Example 10 were followed except for the medium concentration. (Cultivation of Bifidobacterium longum BB536 strain) Cylindrical 1xTOS medium and 3xTOS medium were placed in 2mL microtubes (Greiner). 200μL of the 50-fold diluted TE suspension prepared in Example 1 (hereinafter referred to as "50-fold diluted TE suspension") was placed in the microtube using a pipette (Gilson). As a result, the cylindrical TOS propionic acid agar medium was covered with the 50-fold diluted TE suspension. The liquid surface was 2mm higher than the top end of the cylindrical medium. The microtube was covered with a lid and cultured at 37°C for 24 or 48 hours. As a control, only the 50-fold diluted TE suspension was cultured in the same manner without the cylindrical medium. (LAMP reaction) The microtube cultured for 24 or 48 hours was tapped to mix the contents. 1 μL of the 50-fold diluted TE suspension after culture was taken out from the microtube and used as a sample solution containing the template, which was amplified using a LAMP reagent (WarmStart Colorimetric LAMP 2x Master Mix, New England Biolabs). The LAMP method was the same as that described in Example 10.

[0087] The appearance of the reaction tube after amplification is shown in FIG. When the TE suspension cultured for 24 hours (first day of culture) was used as a sample, only the 50-fold diluted TE suspension containing 3x TOS medium turned yellow after the LAMP reaction. After 48 hours of culture (second day of culture), the color of the reaction solution after the LAMP reaction turned yellow not only for the 3x TOS medium but also for the 50-fold diluted TE suspension containing 1x TOS medium. It was found that the growth efficiency of Bifidobacterium bacteria was improved by increasing the concentration of TOS propionic acid agar medium. In order to efficiently detect the target anaerobic bacteria, it is considered desirable to use a solid medium prepared at a standard concentration or at a concentration higher than that specified by the manufacturer.

[0088] Example 12 (Study on concentration of solid medium 2) (Preparation of MSB agar medium) 9g of mitis salivarius agar (BD) and 15g of sucrose (Wako) (hereafter referred to as "1x MSB medium"), and 18g of mitis salivarius agar (BD) and 30g of sucrose (Wako) (hereafter referred to as "2x MSB medium") were mixed, and the mixture was diluted to 100mL with distilled water and autoclaved (121℃, 15min). After autoclaving, 100μL of Tellurite solution and 50μL of Bacitracin (400U / mL) were added to the medium that had cooled down to a level where it did not solidify. After stirring, the mixture was poured into a petri dish and left to stand until the medium solidified. In the same manner as in Example 1, cylindrical MSB agar media were prepared. (Saliva culture) Cylindrical 1x MSB medium and 2x MSB medium were placed in 2 mL microtubes (Greiner), and saliva was poured into them with a pipette until the cylindrical medium was covered (150 μL or 300 μL). Saliva that was known to contain cnm-positive Streptococcus mutans and saliva that was known not to contain cnm-positive Streptococcus mutans were used. The tubes were capped and incubated at 37°C for 24 hours. (LAMP reaction) The cultured saliva was used as a template-containing sample to carry out the LAMP reaction. The LAMP reaction method was the same as in Example 1.

[0089] The appearance of each reaction tube after the LAMP reaction is shown in FIG. Because the reactivity of the cnm primer is good, no difference in reactivity was observed between 1x MSB medium and 2x MSB medium. On the other hand, the LAMP reaction was possible even with a twice-concentrated medium, indicating that the medium concentration can be increased to a concentration that does not inhibit the LAMP reaction. Therefore, when the amount of bacteria in a sample is small, it is believed that the target bacteria can be grown efficiently by making the concentrations of all components of the medium higher than the concentrations of standard solid medium or the concentrations specified by the manufacturer.

[0090] Example 13 (Study of storage conditions for MSB solid medium 3) The freeze-dried cylindrical MSB agar medium in Example 9 was stored at -20°C for 196 days. The saliva was cultured using the preserved cylindrical MSB agar medium, and the LAMP reaction was carried out using the cnm primer and the PA primer. The culture method and LAMP method were the same as in Example 1 when the cnm primer was used, and the same as in Example 3 when the PA primer was used. As a control, saliva cultured without using the cylindrical MSB agar medium was also subjected to the LAMP reaction.

[0091] The results of observing each reaction tube under an ultraviolet lamp are shown in Figure 14. Even using the freeze-dried cylindrical MSB agar medium that had been stored for a long time, cnm-positive Streptococcus mutans and PA-positive Streptococcus mutans could be detected. Since detection was possible even in freeze-dried cylindrical MSB agar medium that had been stored for a long time, it was found that the granular medium does not need to be prepared immediately upon use and can be prepared in large quantities at one time and stored. [Industrial Applicability]

[0092] The method for detecting anaerobic bacteria of the present invention can be easily performed in a short time, and is therefore suitable for treating a large number of test samples. For example, the method is suitable for detecting Streptococcus mutans using saliva as a sample in hospital tests, mass medical examinations, mail-order tests, and the like.

Claims

1. A method for culturing bacteria, comprising culturing a liquid sample in which anaerobic bacteria may be present, in a state in which the liquid sample covers 10% or more of the surface of a solid medium so that the thickness of the liquid sample covering the surface of the solid medium is 1 mm or more (excluding the case where the liquid sample is a liquid medium).

2. The method according to claim 1, wherein the solid medium is formed into granules.

3. The method according to claim 1 or 2, wherein the liquid sample is a sample selected from the group consisting of a biological sample, an environmental water sample, and a food sample.

4. A method for detecting anaerobic bacteria, comprising: culturing a liquid sample in which anaerobic bacteria may be present, in a state in which the liquid sample covers at least 10% of the surface of a solid medium so that the thickness of the liquid sample covering the surface of the solid medium is 1 mm or more (except when the liquid sample is a liquid medium); and using the liquid sample after cultivation as a sample containing a template, performing nucleic acid amplification to amplify a target sequence portion of a nucleic acid possessed by the target anaerobic bacteria.

5. The method according to claim 4, wherein the solid medium is formed into granules.

6. The method according to claim 4 or 5, wherein the liquid sample is a sample selected from the group consisting of a biological sample, an environmental water sample, and a food sample.

Images