L-lysine producing recombinant strains, their construction and use

Abstract

Methods for introducing point mutations into the coding sequence of the NCg12176 gene of Corynebacterium glutamicum or improving its expression, and methods for introducing point mutations into the promoter region sequence of the dapB gene of Corynebacterium glutamicum are provided, which can improve the fermentation production of L-lysine in strains carrying the mutations.

Description

[Technical field]

[0001] This application claims priority to a prior application, filed on August 7, 2020 with the State Intellectual Property Office of the People's Republic of China, bearing patent application number 202010790877.0 and entitled "L-lysine producing recombinant bacterial strain, its construction method and use thereof," and a prior application, filed on June 8, 2020 with the State Intellectual Property Office of the People's Republic of China, bearing patent application number 202010514023.X and entitled "dapB gene modified recombinant bacterial strain, its construction method and use thereof," the entire contents of which are incorporated herein by reference.

[0002] The present invention relates to the technical fields of genetic engineering and microbiology, and more particularly to a recombinant strain having improved L-lysine production ability, and its construction method and use. [Background technology]

[0003] L-lysine has physiological effects such as growth promotion, immune enhancement, and central nervous tissue function improvement. It is one of the eight basic amino acids that humans and animals cannot synthesize on their own and are necessary for growth. Currently, L-lysine is the second largest type of amino acid in the world, and the main production method is fermentation. Corynebacterium is the most important strain used for amino acid production, including Corynebacterium glutamicum, Corynebacterium flavum, Corynebacterium crenatum, and Corynebacterium pekinens, among which Corynebacterium glutamicum is an important strain for lysine production. Approximately 90% of the industrial production of L-lysine is used as a nutritional enhancer in the feed industry, and 10% is used as a flavoring or sweetener in the food industry and as a pharmaceutical intermediate in the pharmaceutical industry.

[0004] Improvements in the production of L-lysine by fermentation can relate to the fermentation technique, such as stirring and oxygen supply, the composition of the nutrient medium, such as sugar concentration during fermentation, processing of the fermentation broth into a suitable product form, such as by drying and granulation or ion exchange chromatography, or the inherent performance characteristics of the relevant microorganism itself.

[0005] Methods for improving the performance and properties of these microorganisms include induced mutagenesis, selection and screening of mutants, so obtained strains that are tolerant to metabolites or auxotrophic for regulatory important metabolites and produce L-lysine.

[0006] In the case of Corynebacterium glutamicum, 4 mol of NADPH is consumed to synthesize 1 mol of L-lysine in the C. glutamicum biosynthetic pathway. Therefore, to improve the accumulation of L-lysine in the C. glutamicum biosynthetic pathway, it is important to increase the amount of NADPH in the C. glutamicum metabolic pathway or to decrease the NADPH requirement in the L-lysine synthesis pathway.

[0007] Dihydropyridinedicarboxylate reductase (DHDPR) is the second key enzyme in the biosynthesis of diaminopimelic acid and L-lysine in bacteria and higher plants. It catalyzes the NAD(P)H-dependent reduction of dihydropyridinedicarboxylate to produce hexahydropyridinedicarboxylate. This enzyme plays an important role in cell wall formation. DHDPR can use NADH and NADPH as cofactors, and DHDPR in different bacteria has different affinities for different cofactors, for example, E. coli prefers NADH, while DHDPR in C. glutamicum mainly uses NADPH as a cofactor and is involved in the synthesis of L-lysine. DHDPR in C. glutamicum, like DHDPR in other discovered organisms, is encoded by the gene dapB, and its enzyme activity is not regulated by the end product of the synthetic pathway, but is inhibited by 2,6-pyridinedicarboxylate (2,6-PDC).

[0008] The yield of lysine is related to the enzymatic activity in the biosynthetic pathway, and this activity can generally be improved by amplifying one or more genes in the lysine biosynthetic pathway or by applying modified promoters of the genes. Summary of the Invention [Problem to be solved by the invention]

[0009] The present invention provides a microorganism or recombinant strain that produces L-lysine, which has improved expression of a polynucleotide encoding the amino acid sequence of SEQ ID NO:3 and / or has mutations at bases -49, -51, and -54 to -58 in the promoter region shown in SEQ ID NO:29. The present invention also provides a method for producing L-lysine using the microorganism or recombinant strain. [Means for solving the problem]

[0010] A first aspect of the present invention provides an L-lysine producing microorganism or recombinant strain belonging to the genus Corynebacterium having improved expression of a polynucleotide encoding the amino acid sequence of SEQ ID NO: 3. According to the present invention, said improved expression is either an enhanced expression of said polynucleotide, the polynucleotide encoding the amino acid sequence of SEQ ID NO: 3 having a point mutation, or the polynucleotide encoding the amino acid sequence of SEQ ID NO: 3 having a point mutation and enhanced expression.

[0011] The amino acid sequence of SEQ ID NO:3 is the protein encoded by gene NCgl2176.

[0012] The microorganism or recombinant strain has an enhanced L-lysine productivity compared to the wild-type or parent strain.

[0013] The polynucleotide may encode an amino acid sequence having about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more sequence identity with the amino acid sequence of SEQ ID NO:3. As used herein, the term "homology" refers to the percentage of identity between two polynucleotide or two peptide modules. Sequence homology between one module and another may be measured by methods known in the art. Such sequence homology may be measured, for example, by the BLAST algorithm.

[0014] Expression of a polynucleotide may be enhanced by substituting or mutating an expression control sequence, introducing a mutation into a polynucleotide sequence, increasing the copy number of a polynucleotide inserted via a chromosome or introduced via a vector, or a combination thereof. The expression control sequence of the polynucleotide may be modified. The expression control sequence controls the expression of the polynucleotide operably linked thereto and may include, for example, a promoter, a terminator, an enhancer, a silencer, etc. The polynucleotide may have an altered start codon. The copy number may be increased by integrating the polynucleotide into a specific site of a chromosome. As used herein, the specific site may include, for example, a transposon site or an intergenic site. The copy number may also be increased by integrating the polynucleotide into an expression vector and introducing the expression vector into a host cell.

[0015] In one embodiment of the invention, the polynucleotide or a polynucleotide carrying a point mutation is integrated into a specific site in the chromosome of the microorganism, thereby increasing its copy number.

[0016] In one embodiment of the present invention, a polynucleotide having a promoter sequence or a polynucleotide having a promoter sequence and a point mutation is integrated into a specific site in the chromosome of a microorganism to overexpress the nucleic acid sequence.

[0017] In one embodiment of the invention, the polynucleotide or a polynucleotide having a point mutation is incorporated into an expression vector and the expression vector is introduced into a host cell to increase the copy number.

[0018] In one embodiment of the present invention, a polynucleotide having a promoter sequence or a polynucleotide having a promoter sequence and a point mutation is incorporated into an expression vector, and the expression vector is introduced into a host cell to overexpress the nucleic acid sequence.

[0019] In one particular embodiment of the invention, the polynucleotide may comprise the nucleotide sequence of SEQ ID NO:1.

[0020] In one embodiment of the invention, the polynucleotide encoding the amino acid sequence of SEQ ID NO:3 comprises a point mutation such that the lysine at position 176 of the amino acid sequence of SEQ ID NO:3 is replaced with a different amino acid.

[0021] According to the invention, preferably, lysine 176 is substituted with asparagine.

[0022] According to the present invention, the amino acid sequence shown in SEQ ID NO:3, in which the 176th lysine (K) is replaced with asparagine (N), is shown in SEQ ID NO:4.

[0023] In one embodiment of the present invention, the polynucleotide sequence having a point mutation is a mutation at base 528 of the polynucleotide sequence shown in SEQ ID NO:1.

[0024] According to the present invention, the mutation comprises an adenine (A) to cytosine (C) mutation at base 528 of the polynucleotide sequence shown in SEQ ID NO:1.

[0025] In one embodiment of the invention, the polynucleotide sequence having a point mutation comprises the polynucleotide sequence shown in SEQ ID NO:2.

[0026] As used herein, the term "operably linked" refers to a regulatory sequence that is functionally linked to a polynucleotide sequence such that the regulatory sequence controls the transcription and / or translation of the polynucleotide sequence. The regulatory sequence is a strong promoter that can increase the expression level of the polynucleotide. The regulatory sequence may be a promoter from a microorganism of the genus Corynebacterium or a promoter from another microorganism. For example, the promoter may be a trc promoter, a gap promoter, a tac promoter, a T7 promoter, a lac promoter, a trp promoter, an araBAD promoter, or a cj7 promoter.

[0027] In one particular embodiment of the invention, said promoter is the promoter of the polynucleotide encoding the amino acid sequence of SEQ ID NO:3 (NCgl2176 gene).

[0028] As used herein, the term "vector" refers to a polynucleotide construct that contains a gene regulatory sequence and a gene sequence and is configured to express a target gene in a suitable host cell. A vector may also refer to a polynucleotide construct, and the vector may contain sequences available for homologous recombination, allowing the vector introduced into a host cell to change the regulatory sequence of an endogenous gene in the genome of the host cell or to insert a target gene that can be expressed into a specific site in the genome of the host. In this regard, the vector used in the present invention may further include a selectable marker to confirm the introduction of the vector into a host cell or the insertion of the vector into a chromosome of the host cell. The selectable marker may include a marker that confers a selectable phenotype, such as drug resistance, auxotrophy, resistance to a cytotoxic agent, or expression of a surface protein. In an environment treated with such a selection agent, cells that express the selectable marker will survive or display a different phenotypic trait, allowing the selection of transformed cells.

[0029] In some specific embodiments of the invention, the vectors used are pK18mobsacB plasmid, pXMJ19 plasmid.

[0030] As used herein, the term "transformation" refers to the introduction of a polynucleotide into a host cell, so that the polynucleotide functions as an extragenomic element or is inserted into the genome of the host cell and can replicate. The transformation method of the vector used in the present invention may include the method of introducing a nucleic acid into a cell. Alternatively, the electric pulse method may be performed by the host cell, as disclosed in the related art.

[0031] According to the present invention, the microorganism or recombinant strain belonging to the genus Corynebacterium may be Corynebacterium glutamicum, Brevibacterium flavum, Brevibacterium lactofermentum, Corynebacterium ammoniagenes, or Corynebacterium pekinense.

[0032] In one embodiment of the present invention, the microorganism belonging to the genus Corynebacterium is Corynebacterium glutamicum YP97158, with accession number: CGMCC No. 12856, accession date: August 16, 2016, accession institution: Center of Ordinary Microorganisms, China Committee for the Preservation and Management of Microorganisms, No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing, telephone number: 010-64807355, and described in Chinese patent application CN106367432A (filed on September 1, 2016, published on February 1, 2017).

[0033] According to the invention, said microorganism or recombinant strain may further have other improvements in terms of increasing L-lysine production, such as increased or decreased expression of genes involved in NADPH production (e.g. the gene encoding glucose dehydrogenase, the gene encoding gluconokinase, the gene encoding glyceraldehyde-3-phosphate dehydrogenase, the gene encoding glucose-6-phosphate dehydrogenase, or the gene encoding 6-phosphogluconate dehydrogenase) and / or other genes involved in L-lysine biosynthesis or secretion (e.g. the gene encoding aspartate aminotransferase, the gene encoding aspartokinase, the gene encoding aspartate semialdehyde dehydrogenase, the gene encoding dihydrodipicolinate synthase, the gene encoding dihydrodipicolinate reductase, the gene encoding m-diaminopimelate dehydrogenase, the gene encoding diaminopimelate decarboxylase, lysE), or replacement of genes by foreign genes.

[0034] A second aspect of the present invention provides polynucleotide sequences, amino acid sequences encoded by the polynucleotide sequences, recombinant vectors comprising the polynucleotide sequences, and recombinant strains containing the polynucleotide sequences.

[0035] In accordance with the present invention, the polynucleotide sequence includes a polynucleotide that encodes a polypeptide containing the amino acid sequence shown in SEQ ID NO:3, wherein lysine 176 is substituted with a different amino acid.

[0036] According to the invention, preferably, lysine 176 is substituted with asparagine.

[0037] According to the present invention, the amino acid sequence shown in SEQ ID NO:3, in which the 176th lysine (K) is replaced with asparagine (N), is shown in SEQ ID NO:4.

[0038] According to the present invention, preferably, the polynucleotide sequence encoding the polypeptide containing the amino acid sequence shown in SEQ ID NO:3 contains the polynucleotide sequence shown in SEQ ID NO:1.

[0039] In one embodiment of the invention, the polynucleotide sequence is a mutation at base 528 of the polynucleotide sequence shown in SEQ ID NO:1.

[0040] According to the present invention, the mutation refers to a change in the base / nucleotide at the site, and the mutation method may be at least one method selected from induced mutagenesis, PCR site-directed mutagenesis, and / or homologous recombination, etc. In the present invention, PCR site-directed mutagenesis and / or homologous recombination are preferably used.

[0041] According to the present invention, the mutation comprises an adenine (A) to cytosine (C) mutation at base 528 of the polynucleotide sequence shown in SEQ ID NO:1.

[0042] In one embodiment of the invention, the polynucleotide sequence comprises the polynucleotide sequence shown in SEQ ID NO:2.

[0043] According to the present invention, the amino acid sequence comprises the amino acid sequence shown in SEQ ID NO:4.

[0044] According to the present invention, the recombinant vector is constructed by introducing the polynucleotide sequence into a plasmid.

[0045] In one embodiment of the invention, the plasmid is a pK18mobsacB plasmid.

[0046] In another embodiment of the invention, the plasmid is a pXMJ19 plasmid.

[0047] Specifically, the polynucleotide sequence and the plasmid may be assembled into a recombinant vector using the NEBuider recombination system.

[0048] According to the invention, said recombinant strain contains said polynucleotide sequence.

[0049] In one embodiment of the present invention, the starting strain of the recombinant strain is YP97158.

[0050] The third aspect of the present invention also provides a method for constructing a recombinant Corynebacterium glutamicum strain.

[0051] According to the present invention, the method of construction comprises: The method includes the step of modifying the polynucleotide sequence of wild-type NCgl2176, for example as shown in SEQ ID NO:1, in a host strain so that the 528th base is mutated, thereby obtaining a recombinant Corynebacterium strain comprising a mutated NCgl2176-encoding gene.

[0052] According to the construction method of the present invention, the modification includes at least one of the following methods: induced mutagenesis, PCR site-directed mutagenesis, and / or homologous recombination.

[0053] According to the construction method of the present invention, the mutation refers to a mutation from adenine (A) to cytosine (C) at the 528th base of SEQ ID NO:1, and specifically, the polynucleotide sequence containing the mutant NCgl2176-encoding gene is shown in SEQ ID NO:2.

[0054] Furthermore, the method of construction further comprises: (1) modifying the nucleotide sequence of the wild-type NCgl2176 gene shown in SEQ ID NO:1 so that the 528th base is mutated to obtain a mutated NCgl2176 gene polynucleotide sequence; (2) ligating the mutated polynucleotide sequence into a plasmid to construct a recombinant vector; and (3) introducing the recombinant vector into a host strain to obtain a recombinant Corynebacterium strain containing the mutated NCgl2176-encoding gene.

[0055] According to the construction method of the present invention, the step (1) includes constructing a point mutant NCgl2176 gene, that is, synthesizing two pairs of primers, P1 and P2 and P3 and P4, for amplifying NCgl2176 gene fragments according to the genome sequence of Corynebacterium glutamicum, and introducing point mutations into the wild-type NCgl2176 gene SEQ ID NO:1 by PCR site-directed mutagenesis to obtain the point mutant NCgl2176 gene nucleotide sequence SEQ ID NO:2, and then isolating NCgl2176 A528C Let us assume that.

[0056] In one embodiment of the present invention, the Corynebacterium glutamicum genome may be derived from the ATCC13032 strain, and the genome sequence may be obtained from the NCBI website.

[0057] In one embodiment of the present invention, in step (1), the primers are as follows: P1:5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGCGGCGACCGCATGGACACCG 3'(SEQ ID NO:5) P2:5'CCGGGGACTGGTTTTCGGGTGTTGGTGTGC 3'(SEQ ID NO:6) P3:5'GCACACCAACACCCGAAAACCAGTCCCCG 3'(SEQ ID NO:7) P4:5'CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCCGAGGTCTCTCAGAATCGGT 3'(SEQ ID NO:8)

[0058] In one embodiment of the invention, the PCR amplification is carried out as follows: denaturation at 94° C. for 30 s (seconds), annealing at 52° C. for 30 s, and extension at 72° C. for 40 s (30 cycles).

[0059] In one embodiment of the invention, the overlap PCR amplification is performed as follows: denaturation at 94° C. for 30 s, annealing at 52° C. for 30 s, and extension at 72° C. for 90 s (30 cycles).

[0060] According to the construction method of the present invention, the step (2) is A528C The pK18mobsacB plasmid was assembled using the NEBuider recombination system to obtain the recombinant plasmid pK18-NCgl2176. A528C The present invention relates to the construction of a recombinant plasmid comprising:

[0061] According to the construction method of the present invention, the step (3) is A528C into a host strain to obtain a recombinant strain.

[0062] In one embodiment of the present invention, the transformation in step (3) is electrotransformation.

[0063] In one embodiment of the invention, the host strain is YP97158.

[0064] In one embodiment of the invention, said recombination is achieved by homologous recombination.

[0065] The fourth aspect of the invention also provides a method for constructing a recombinant Corynebacterium strain.

[0066] According to the present invention, the method of construction comprises: The upstream and downstream homologous arm fragments of the NCgl2176 gene, the NCgl2176 gene coding region and its promoter region sequence, or the NCgl2176 A528C The gene coding region and its promoter region sequence are amplified and NCgl2176 or NCgl2176 are inserted into the genome of the host strain by homologous recombination. A528C By introducing the gene, NCgl2176 or NCgl2176 A528CThe method includes the step of overexpressing the gene.

[0067] In one embodiment of the invention, the primers for amplifying the upstream homology arm fragment are as follows: P7:5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAATGCGTTCTGGACTGAGG3'(SEQ ID NO:11) P8:5'AACACCATTGTCCCTGTTTTGGGCGAAATTTTCCCGGTGCACCGAGAACAGATG3'(SEQ ID NO:12). In one embodiment of the invention, the primers for amplifying the downstream homology arm fragment are as follows: P11:5'CTACGAGACGAAGCCGTTCGCCTGAGATGGCGCAATTAAATCAAG 3'(SEQ ID NO:15) P12:5'CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCGCTATGACACCTTCAACGGATC 3'(SEQ ID NO:16).

[0068] In one embodiment of the present invention, the primers for amplifying the gene coding region and its promoter region sequence are as follows: P9:5'CGGGAAAATTTCGCCCAAAACAGGGACAATGGTGTTATGGCATTTGCAGACATTGTGCGC3'(SEQ ID NO:13) P10:5'CTTGATTTAATTGCGCCATCTCAGGCGAACGGCTTCGTCTCGTAG3'(SEQ ID NO:14).

[0069] In one embodiment of the present invention, the upstream homologous fragment, downstream homologous fragment, and NCgl2176 or NCgl2176 having its own promoter obtained by amplification using the above-mentioned P7 / P12 as primers are A528C These three fragments are mixed and used as a template for amplification to obtain integrated homology arm fragments.

[0070] In one embodiment of the present invention, the PCR system used is composed of 5 μL of 10×Ex Taq Buffer, 4 μL of dNTP Mixture (2.5 mM each), Mg 2+ (25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U / μL) 0.25 μL, total volume 50 μL, PCR amplification was performed as follows: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 120 s (30 cycles), over-extension at 72°C for 10 min.

[0071] In one embodiment of the present invention, the NEBuider recombination system is used to assemble the shuttle plasmid PK18mobsacB and the integration homology arm fragment to obtain an integration plasmid.

[0072] In one embodiment of the present invention, the integrative plasmid is transfected into a host strain and NCgl2176 or NCgl2176 is integrated into the genome of the host strain by homologous recombination. A528C Introducing genes.

[0073] In one embodiment of the invention, the host strain is YP97158.

[0074] In one embodiment of the invention, the host strain is a strain having the polynucleotide sequence shown in SEQ ID NO:2.

[0075] The fifth aspect of the invention also provides a method for constructing a recombinant Corynebacterium strain.

[0076] According to the present invention, the method of construction comprises: NCgl 2176 gene coding region and promoter region sequence, or NCgl 2176 A528C The gene coding region and promoter region sequences are amplified, an overexpression plasmid vector is constructed, and the vector is transformed into a host strain, thereby expressing NCgl 2176 or NCgl 2176 in the host strain. A528C The method includes the step of overexpressing the gene.

[0077] In one embodiment of the present invention, the primers for amplifying the gene coding region and its promoter region sequence are as follows: P17:5'GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCCGGAAAATTTCGCCCAAAACAG3'(SEQ ID NO:21) P18:5'ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAACTCAGGCGAACGGCTTCGTCTCGTAG 3'(SEQ ID NO:22).

[0078] In one embodiment of the present invention, the PCR system comprises 5 μL of 10×Ex Taq Buffer, 4 μL of dNTP Mixture (2.5 mM each), Mg 2+ (25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U / μL) 0.25 μL, total volume 50 μL, and the PCR amplification was performed as follows: 94° C., 5 min pre-denaturation, 94° C., 30 s denaturation, 52° C., 30 s annealing, 72° C., 90 s extension (30 cycles), 72° C., 10 min over-extension.

[0079] In one embodiment of the present invention, the shuttle plasmid pXMJ19 and NCgl2176 or NCgl2176 with its own promoter were synthesized using the NEBuider recombination system. A528C The fragments are assembled to obtain an overexpression plasmid.

[0080] In one embodiment of the invention, the host strain is YP97158.

[0081] In one embodiment of the invention, the host strain is a strain having the polynucleotide sequence shown in SEQ ID NO:2.

[0082] The recombinant strain obtained by the present invention can be used alone for the fermentation production of L-lysine, or it may be mixed with other bacteria that produce L-lysine and fermented to produce L-lysine.

[0083] A further aspect of the present invention provides a promoter nucleotide sequence comprising a nucleotide sequence in which bases −49, −51, and −54 to −58 of the promoter region shown in SEQ ID NO:29 are mutated.

[0084] According to the present invention, the -49th nucleotide cytosine (C) in the promoter region shown in SEQ ID NO:29 is mutated to adenine (A), the -51st nucleotide guanine (G) is mutated to thymine (T), and the -54th to -58th nucleotides CTGCA are mutated to GGTGT.

[0085] According to the present invention, the promoter nucleotide sequence is (a) the nucleotide sequence set forth in SEQ ID NO:30, or (b) a nucleotide sequence having an identity of 90% or more, preferably 95% or more, or 98% or more, to the nucleotide sequence shown in SEQ ID NO:30, (a) which retains the promoter enhancing activity and in which the -49th nucleotide is retained as adenine (A), the -51st nucleotide is retained as thymine (T), and the -54th to -58th nucleotides are retained as GGTGT.

[0086] The present invention also provides an expression cassette comprising the above promoter, the promoter comprising a coding sequence operably linked behind the promoter, in one embodiment of the present invention, the coding sequence being the coding sequence of the dapB gene.

[0087] The present invention also provides a recombinant vector comprising the promoter nucleotide sequence of the present invention.

[0088] According to the present invention, the recombinant vector is constructed by ligating the promoter nucleotide sequence of the present invention into a shuttle plasmid, and in one embodiment of the present invention, the shuttle plasmid is pK18mobsacB plasmid.

[0089] The present invention also provides a recombinant strain comprising the above promoter nucleotide sequence or the above recombinant vector.

[0090] The recombinant strain according to the present invention comprises a nucleotide sequence as shown in SEQ ID NO:30. The nucleotide sequence as shown in SEQ ID NO:30 is a promoter region of the dapB gene. Furthermore, the nucleotide sequence as shown in SEQ ID NO:30 is linked to the coding sequence of the dapB gene. Specifically, the recombinant strain may comprise the expression cassette or recombinant vector of the present invention. Specifically, the recombinant strain according to the present invention is transformed with the expression cassette or recombinant vector. The recombinant strain according to the present invention is obtained by introducing the mutated promoter nucleotide sequence into a host strain and recombining the host strain, which may be at least one selected from L-lysine producing strains known in the art, such as Corynebacterium, and the Corynebacterium may be Corynebacterium glutamicum, Corynebacterium flavum, Corynebacterium crenatum, Corynebacterium pekinens, but is preferably Corynebacterium glutamicum. In one embodiment of the invention, the host strain is YP97158.

[0091] The recombinant strain according to the present invention uses the pK18mobsacB plasmid as a vector.

[0092] The recombinant strain according to the invention may further comprise other modifications.

[0093] The present invention also provides The present invention provides a method for constructing an L-lysine-producing recombinant strain, comprising the step (1) of modifying the promoter region shown in SEQ ID NO:29 so that bases -49, -51, and -54 to -58 are mutated, thereby obtaining a nucleotide sequence containing the mutated promoter region.

[0094] According to the present invention, the mutation refers to a mutation of the -49th nucleotide cytosine (C) to adenine (A), the -51st nucleotide guanine (G) to thymine (T), and the -54th to -58th nucleotides CTGCA to GGTGT in the promoter region shown in SEQ ID NO:29. Specifically, the nucleotide sequence of the mutated promoter region is shown in SEQ ID NO:30. Furthermore, the construction method includes the steps of: (1) ligating the mutated promoter region nucleotide sequence to a plasmid to construct a recombinant vector; and (3) introducing the recombinant vector into a host strain to obtain an L-lysine-producing recombinant strain containing the mutated promoter region.

[0095] According to the present invention, in the step (1), the mutation method includes induced mutagenesis, PCR site-directed mutagenesis or homologous recombination, but is preferably PCR site-directed mutagenesis.

[0096] According to the present invention, the step (1) comprises: This involves designing two pairs of primers that amplify the promoter region of the dapB gene and obtaining the mutated promoter region nucleotide sequence by PCR technology.

[0097] In one embodiment of the present invention, the primer in step (1) is as follows: P1':5' CCGGAATTC ACCATGCCGGACATGCGGAC3'(EcoR I)(SEQ ID NO:31) P2':5'CCTTCTGAACGGGTTGTGGTATAATGGTGG 3'(SEQ ID NO:32) P3':5'CCACCATTATACCACAACCCGTTCAGAAGG 3'(SEQ ID NO:33) P4':5' ACATGCATGC GAATATTGACGTTGAGGAAG 3'(Sph I)(SEQ ID NO:34).

[0098] In one embodiment of the present invention, the step (1) includes performing PCR amplification using Corynebacterium glutamicum ATCC13032 as a template and primers P1' and P2', and P3' and P4', respectively, to obtain two DNA fragments containing point mutations, and performing overlap PCR amplification using the two DNA fragments as templates and primers P1' and P4' to obtain a DNA fragment containing the promoter region nucleotide sequence of the present invention (SEQ ID NO:30).

[0099] According to the present invention, in step (1), the DNA fragment obtained by overlap PCR contains EcoR I and Sph I restriction enzyme cleavage sites at both ends.

[0100] According to the present invention, the step (2) includes isolating and purifying the products amplified by the overlap PCR reaction, subjecting the fragments to double restriction enzyme digestion (EcoR I / Sph I), and then ligating them to a shuttle plasmid that has also been double restricted by the enzymes (EcoR I / Sph I) to obtain an allele replacement recombinant vector.

[0101] According to the present invention, the shuttle plasmid is pK18mobsacB plasmid, and the constructed recombinant vector is pK18-P dapB (C(-49)A,G(-51)T,CTGCA(-54--58)GGTGT) It is.

[0102] In one embodiment of the invention, the recombinant plasmid carries a kanamycin resistance marker.

[0103] In one embodiment of the present invention, the transformation in step (3) is an electrical transformation method, and illustratively, in step (3), the recombinant plasmid is transformed into strain YP97158.

[0104] The present invention also provides a use of the above-mentioned microorganism or recombinant strain of the present invention in producing L-lysine, or a method for improving L-lysine fermentation yield, or a method for producing L-lysine.

[0105] The use and method according to the present invention includes the steps of culturing and fermenting the microorganism or recombinant strain, and recovering L-lysine from the culture to obtain L-lysine. In the use and method according to the present invention, the recombinant strain of the present invention may be used alone or in combination with other L-lysine-producing bacteria.

[0106] The microorganism may be cultured in a suitable medium under culture conditions known in the art. The medium may include a carbon source, a nitrogen source, trace elements, and combinations thereof. During the culture, the pH of the culture may be adjusted. Furthermore, during the culture, the generation of bubbles may be prevented, for example, by using an antifoaming agent. Furthermore, during the culture, the gas may be injected into the culture. The gas may include any gas capable of maintaining the aerobic condition of the culture. During the culture, the temperature of the culture may be 20 to 45°C. The L-lysine produced from the culture may be recovered, i.e., the culture may be treated with sulfuric acid or hydrochloric acid, followed by a combination of methods such as anion exchange chromatography, concentration, crystallization, and isoelectric precipitation.

[0107] In the present invention, each SEQ ID NO: is as follows: SEQ ID NO 1: NCgl2176 wild type ORF sequence TIFF0007644133000001.tif121170SEQ ID NO 2:NCgl2176 A528C ORF sequence TIFF0007644133000002.tif115170SEQ ID NO 3: Amino acid sequence of NCgl2176 wild type encoded protein TIFF0007644133000003.tif45170SEQ ID NO 4:NCgl2176 K176N Amino acid sequence of the encoded protein TIFF0007644133000004.tif43170SEQ ID NO 29: Wild-type promoter sequence TIFF0007644133000005.tif30170SEQ ID NO 30: Promoter sequence after mutation TIFF0007644133000006.tif31170

[0108] Beneficial Effects The present invention has found that by weakening or knocking out the NCgl 2176 gene, the product encoded by the gene affects L-lysine production ability, and by introducing a point mutation into the coding sequence, increasing the copy number of the gene, or overexpressing the resulting recombinant strain, the resulting strain is advantageous in producing high concentrations of L-lysine compared to an unmodified strain. Furthermore, when a recombinant strain is obtained by introducing a point mutation into the promoter region of the dapB gene, the resulting strain also has a significantly improved L-lysine production amount compared to a non-mutated strain, further increasing the production efficiency and reducing the production cost, which is advantageous for widespread use. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0109] The technical solutions of the present invention will be described in more detail below with reference to specific examples. It should be noted that the following examples are merely illustrative and explanatory of the present invention and should not be understood as limiting the scope of the patent right of the present invention. Any technology that can be realized based on the above content of the present invention is within the scope of the present invention. Unless otherwise specified, all raw materials and reagents used in the following examples are commercially available products or can be prepared by known methods, and all operations performed are known in the art or are performed according to the user manuals of commercially available products.

[0110] In the following examples, the composition of the basal medium used to culture the above strains is the same, and the composition of this basal medium is supplemented with sucrose, kanamycin, chloramphenicol, etc. as desired, and the composition of the basal medium is shown below. TIFF0007644133000007.tif75170

[0111] In the following examples, the preparation and conditions of SSCP electrophoresis PAGE are given below. TIFF0007644133000008.tif82170

[0112] In the following examples, the fermentation medium formulation and fermentation control process for L-lysine are shown below. TIFF0007644133000009.tif121170

[0113] TIFF0007644133000010.tif153170

[0114] Example 1 Transformation vector pK18-NCgl 2176 containing the point mutated NCgl 2176 gene coding region A528C Construction According to the wild-type Corynebacterium glutamicum ATCC13032 genome sequence from NCBI, two pairs of primers were designed and synthesized to amplify the NCgl2176 gene coding region sequence, and point mutations were introduced into the NCgl2176 gene coding region (SEQ ID NO: 1) described in the background of strain YP97158 (accession number: CGMCC No. 12856, accession date: August 16, 2016, accession institution: Center of Ordinary Microorganisms, China Commission for the Preservation and Management of Microorganisms, No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing, Tel: 010-64807355, Chinese patent application CN106367432A (application date: September 1, 2016, publication date: February 1, 2017)) by allele replacement, and the corresponding amino acid sequence of the encoded protein is shown in SEQ ID SEQ ID NO:3, and the 528th A in the nucleotide sequence of the NCgl2176 gene is C (SEQ ID NO:2:NCgl2176 A528C ) and the 176th lysine in the corresponding amino acid sequence of the encoded protein is changed to asparagine (SEQ ID NO: 4: NCgl2176 K176N ) was changed to The primers are designed as follows (synthesized by Shanghai Invitrogen): P1:5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGCGGCGACCGCATGGACACCG 3'(SEQ ID NO:5) P2:5'CCGGGGACTGGTTTTCGGGTGTTGGTGTGC 3'(SEQ ID NO:6) P3:5'GCACACCAACACCCGAAAACCAGTCCCCG 3'(SEQ ID NO:7) P4:5'CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCCGAGGTCTCTCAGAATCGGT 3'(SEQ ID NO:8) Construction method: Using Corynebacterium glutamicum ATCC13032 as template, PCR amplification was performed with primers P1 and P2, and P3 and P4, respectively. PCR system: 10× Ex Taq Buffer 5μL, dNTP Mixture (2.5mM each) 4μL, Mg 2+ (25mM) 4μL, each primer (10pM) 2μL, Ex Taq (5U / μL) 0.25μL, total volume 50μL. The PCR amplification was carried out as follows: pre-denaturation at 94° C. for 5 min, denaturation at 94° C. for 30 s, annealing at 52° C. for 30 s, extension at 72° C. for 40 s (30 cycles), over-extension at 72° C. for 10 min. Two DNA fragments (NCgl2176Up and NCgl2176Down), with sizes of 796 bp and 786 bp, respectively, containing the NCgl 2176 gene coding region, were obtained. The two DNA fragments were separated and purified by agarose gel electrophoresis, and then a fragment of approximately 1552 bp in length was amplified by overlap PCR using the two DNA fragments as templates and P1 and P4 as primers. PCR system: 10× Ex Taq Buffer 5μL, dNTP Mixture (2.5mM each) 4μL, Mg 2+ (25mM) 4μL, each primer (10pM) 2μL, Ex Taq (5U / μL) 0.25μL, total volume 50μL. The PCR amplification is carried out as follows: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 90 s (30 cycles), over-extension at 72°C for 10 min. This DNA fragment (NCgl 2176 A528C ) changed the 528th adenine (A) in the coding region of the YP97158NCgl2176 gene to a cytosine (C), and ultimately changed the 176th amino acid in the encoded protein from lysine (K) to asparagine (N). The pK18mobsacB plasmid (purchased from Addgene) was digested with Xba I restriction enzyme, and then subjected to agarose gel electrophoresis to identify NCgl2176. A528C The linearized pK18mobsacB plasmid was isolated and purified, and then assembled using the NEBuider recombination system to create the vector pK18-NCgl2176. A528C The plasmid contains a kanamycin resistance marker. Vector pK18-NCgl2176 A528C The vector pK18-NCgl2176 containing the correct point mutation (AC) was identified by sequencing. A528C was stored and prepared for use.

[0115] Example 2 Point Mutation NCgl2176 A528C Construction of engineered strains containing Construction method: Allele replacement plasmid pK18-NCgl2176 A528Cwas transformed into the L-lysine producing strain YP97158 (construction method of which is referred to WO2014121669A1. As a result of sequencing, it was found that the wild type NCgl2176 gene coding region is retained in the chromosome of the strain) by electric shock, and the single colonies produced by the culture were identified with primer P1 and universal primer M13R, and the strains that could amplify a band of about 1559 bp in size were determined as positive strains. The positive strains were cultured in a medium containing 15% sucrose, and the single colonies produced by the culture were cultured in a medium containing kanamycin and a medium not containing kanamycin, and the strains that grew in the medium not containing kanamycin but did not grow in the medium containing kanamycin were further identified by PCR using the following primers (synthesized by Shanghai Invitrogen). P5:5'GAAACACCGCCCGAATC 3'(SEQ ID NO:9) P6:5'GGAGTGCGTGTTTGTTGATG 3'(SEQ ID NO:10) The PCR amplified product was denatured at high temperature, ice-bathed, and then subjected to sscp electrophoresis (plasmid pK18-NCgl2176 A528C The amplified fragment was used as the positive control, the YP97158 amplified fragment as the negative control, and water as the blank control. Since the fragment structures were different, the electrophoretic positions were different. Therefore, the strains whose electrophoretic positions did not match those of the negative control fragments but matched those of the positive control fragments were strains in which allele replacement was successful. Using primers P5 and P6, the target fragments of the strains in which allele replacement was successful were amplified by PCR again, ligated into the PMD19-T vector, and sequenced. The sequence in which the base sequence was mutated as a result of sequence alignment was verified as a strain in which allele replacement was successful, and was named YPL-4-011.

[0116] Example 3 NCgl2176 or NCgl2176 A528C Construction of engineered strains with genome-wide overexpression of genes According to the wild-type Corynebacterium glutamicum ATCC13032 genome sequence by NCBI, the upstream and downstream homology arm fragments, NCgl2176 or NCgl 2176 A528CThree pairs of primers were designed and synthesized to amplify the gene coding region and promoter region sequences, and NCgl2176 or NCgl2176 were transfected into strain YP97158 by homologous recombination. A528C The gene was introduced. The primers are designed as follows (synthesized by Shanghai Invitrogen Company): P7:5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAATGCGTTCTGGACTGAGG3'(SEQ ID NO:11) P8:5'AACACCATTGTCCCTGTTTTGGGCGAAATTTTCCCGGTGCACCGAGAACAGATG3'(SEQ ID NO:12) P9:5'CGGGAAAATTTCGCCCAAAACAGGGACAATGGTGTTATGGCATTTGCAGACATTGTGCGC3'(SEQ ID NO:13) P10:5'CTTGATTTAATTGCGCCATCTCAGGCGAACGGCTTCGTCTCGTAG3'(SEQ ID NO:14) P11:5'CTACGAGACGAAGCCGTTCGCCTGAGATGGCGCAATTAAATCAAG 3'(SEQ ID NO:15) P12:5'CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCGCTATGACACCTTCAACGGATC 3'(SEQ ID NO:16) Construction method: Using Corynebacterium glutamicum ATCC13032 or YPL-4-011 as a template, PCR amplification was performed with primers P7 / P8, P9 / P10, and P11 / P12, respectively, to obtain an upstream homology arm fragment of approximately 720 bp, an NCgl2176 gene and its promoter fragment of approximately 1092 bp, and an NCgl2176 A528C A gene and its promoter fragment of about 1092 bp and a downstream homologous arm fragment of about 653 bp were obtained. Next, the three fragments amplified above (upstream homologous arm fragment, NCgl2176 gene and its promoter fragment, downstream homologous arm fragment, or upstream homologous arm fragment, NCgl2176) were amplified using P7 / P12 as primers.A528C The gene, its promoter fragment, and downstream homologous arm fragment were mixed and used as a template for amplification to obtain an integrated homologous arm fragment. After the PCR reaction was completed, the amplified product was electrophoresed and recovered, and the desired DNA fragment of about 2504 bp was recovered using a column DNA gel recovery kit (TIANGEN). The fragment was then ligated to the shuttle plasmid PK18mobsacB, which had been digested with XbaI and recovered, using the NEBuider recombination system to form the integrated plasmid PK18mobsacB-NCgl2176 or PK18mobsacB-NCgl2176. A528C The plasmid contained a kanamycin resistance marker, and recombinants in which the plasmid had been integrated into the genome were obtained by screening with kanamycin. PCR system: 10× Ex Taq Buffer 5μL, dNTP Mixture (2.5mM each) 4μL, Mg 2+ (25mM) 4μL, each primer (10pM) 2μL, Ex Taq (5U / μL) 0.25μL, total volume 50μL. The PCR amplification is carried out as follows: 5 min pre-denaturation at 94°C, 30 s denaturation at 94°C, 30 s annealing at 52°C, 120 s extension at 72°C (30 cycles), 10 min over-extension at 72°C. The two integrated plasmids were electroconverted into the L-lysine-producing strain YP97158, and single colonies produced by cultivation were identified by PCR using P13 / P14 primers. Those that amplified a fragment of approximately 1609 bp by PCR were identified as positive strains, and those that did not amplified the fragment were identified as original strains. The positive strains were screened with 15% sucrose, and then cultured in kanamycin-containing and kanamycin-free media. Strains that grew in the kanamycin-free medium but not in the kanamycin-containing medium were further identified by PCR using P15 / P16 primers. Those that amplified a fragment of approximately 1123 bp were identified as NCgl2176 or NCgl2176. A528C The strains in which the gene was integrated into the YP97158 genome were designated YPL-4-012 (without the point mutation) and YPL-4-013 (with the point mutation), respectively. P13:5'TCCAAGGAAGATACACGCC 3'(SEQ ID NO:17) P14:5'CCTGAGCGGAATAGTCCTGTG3'(SEQ ID NO:18) P15:5'ACGCACCCGTGTTCTACCT3'(SEQ ID NO:19) P16:5'CGTTGGAATCTTGCGTTG 3'(SEQ ID NO:20)

[0117] Example 4 NCgl2176 or NCgl2176 A528C Construction of engineered strains with plasmid-mediated gene overexpression According to the wild-type Corynebacterium glutamicum ATCC13032 genome sequence by NCBI, NCgl2176 or NCgl2176 A528C A pair of primers for amplifying the gene coding region and promoter region sequence is designed and synthesized, and the primers are designed as follows (synthesized by Shanghai Invitrogen Company): P17:5'GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCCGGAAAATTTCGCCCAAAACAG3'(SEQ ID NO:21) P18:5'ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAACTCAGGCGAACGGCTTCGTCTCGTAG 3'(SEQ ID NO:22) Construction method: Using wild-type Corynebacterium glutamicum ATCC13032 or YPL-4-011 as a template, PCR amplification was performed with primers P17 / P18 to obtain NCgl2176 or NCgl2176 A528C The gene and its promoter fragment of 1140 bp were obtained, and the amplified product was recovered by electrophoresis. The desired 1140 bp DNA fragment was recovered using a column DNA gel recovery kit, and ligated to the shuttle plasmid pXMJ19, which was cut with EcoR I restriction enzyme and recovered, using the NEBuider recombination system to obtain the overexpression plasmid pXMJ19-NCgl2176 or pXMJ19-NCgl2176. A528CThe plasmid contained a chloramphenicol resistance marker, and the strains transformed with the plasmid were obtained by screening with chloramphenicol. PCR system: 10× Ex Taq Buffer 5μL, dNTP Mixture (2.5mM each) 4μL, Mg 2+ (25mM) 4μL, each primer (10pM) 2μL, Ex Taq (5U / μL) 0.25μL, total volume 50μL. The PCR amplification was carried out as follows: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 90 s (30 cycles), over-extension at 72°C for 10 min. The plasmids were each electroconverted into the L-lysine-producing strain YP97158, and single colonies produced by cultivation were identified by PCR using M13R(-48) and P18 primers. The strains containing a fragment of approximately 1,147 bp in size by PCR amplification were designated as the introduced strains and named YPL-4-014 (without point mutation) and YPL-4-015 (with point mutation), respectively.

[0118] Example 5 Construction of a modified strain with the NCgl2176 gene deleted in the genome According to the genome sequence of Corynebacterium glutamicum ATCC13032 by NCBI, two pairs of primers were synthesized to amplify the fragments at both ends of the NCgl2176 gene coding region as upstream and downstream homology arm fragments. The primers were designed as follows (synthesized by Shanghai Yingjun Co., Ltd.): P19:5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGTCAAAGAGGGCGAGATAAT3'(SEQ ID NO:23) P20: 5'GTTCATGAGACACCCAGTAGG AC GACCTACAGAATACTAGTCAGTG 3'(SEQ ID NO:24) P21:5'CACTGACTAGTATTCTGTAGGTCGTCCTACTGGGTGTCTCATGAAC 3'(SEQ ID NO:25) P22:5'CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCACCGCACGATGGTTCACT3'(SEQ ID NO:26) Using Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed with primers P19 / P20 and P21 / P22 to obtain an upstream homologous arm fragment of 852bp and a downstream homologous arm fragment of 787bp, and then overlap PCR was performed with primers P19 / P22 to obtain a complete homologous arm fragment of 1639bp. After the PCR reaction was completed, the amplified products were electrophoresed and recovered, and the desired 1639bp DNA fragment was recovered using a column DNA gel recovery kit, and ligated to the shuttle plasmid pk18mobsacB plasmid, which was cut with Xba I restriction enzyme and recovered using the NEBuider recombination system, to obtain a knockout plasmid. The plasmid contains a kanamycin resistance marker. The knockout plasmid was electroconverted into the lysine-producing strain YP97158, and single colonies produced by cultivation were subjected to PCR identification using the following primers (synthesized by Shanghai Yingjun Co., Ltd.). P23:5'TCAAAGAGGGCGAGATAAT 3'(SEQ ID NO:27) P24:5'ACCGCACGATGGTTCACT 3'(SEQ ID NO:28) The strains in which the 1521 bp and 2556 bp bands were amplified by the PCR were positive strains, and the strains in which only the 2556 bp band was amplified were original strains. The positive strains were screened on a 15% sucrose medium, and then cultured in a kanamycin-containing medium and a kanamycin-free medium, respectively. The strains that grew in the kanamycin-free medium but not in the kanamycin-containing medium were further identified by PCR using P23 / P24 primers. The strains in which the 1521 bp band was amplified were genetically modified strains in which the NCgl2176 gene coding region was knocked out, and were named YPL-4-016.

[0119] Example 6 L-lysine fermentation experiment Fermentation experiments were carried out using the strains constructed in Examples 2 to 5 and the original strain YP97158 in a fermenter with model number BLBIO-5GC-4-H (purchased from Shanghai Bailun Biotechnology Co., Ltd.) with the medium shown in Table 1 and the control process shown in Table 2. The experiment was repeated three times for each strain, and the results are shown in Table 3. TIFF0007644133000011.tif74170The results shown in Table 3 indicate that overexpression of the NCgl2176 gene in Corynebacterium glutamicum and the introduction of a point mutation in the NCgl2176 gene coding region NCgl2176 A528C and overexpression is favorable for increasing L-lysine production, whereas attenuation or knockout of the gene is unfavorable for lysine accumulation.

[0120] Example 7 Transformation vector pK18-PdapB containing a point mutated dapB gene promoter region (C(-49)A,G(-51)T,CTGCA(-54--58)GGTGT) Construction According to the Corynebacterium glutamicum ATCC13032 genome sequence from NCBI, two pairs of primers were designed and synthesized to amplify the dapB gene promoter sequence, and point mutations were introduced into the dapB gene promoter sequence (SEQ ID NO: 29) in the strain YP97158 background by allelic replacement, in which the C at -49bp of the nucleotide sequence of the dapB gene promoter sequence was changed to A, the G at -51bp of the fermenter was changed to T, and the CTGCA at -54--58bp was changed to GGTGT (SEQ ID NO: 30). The primers are designed as follows (synthesized by Shanghai Invitrogen Company): P1':5' CCGGAATTC ACCATGCCGGACATGCGGAC3'(EcoR I)(SEQ ID NO:31) P2':5'CCTTCTGAACGGGTTGTGGTATAATGGTGG 3'(SEQ ID NO:32) P3':5'CCACCATTATACCACAACCCGTTCAGAAGG 3'(SEQ ID NO:33) P4':5' ACATGCATGCGAATATTGACGTTGAGGAAG 3'(Sph I)(SEQ ID NO:34). Construction method: Using Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed with primers P1' and P2', and P3' and P4', respectively. PCR system: 10× Ex Taq Buffer 5μL, dNTP Mixture (2.5mM each) 4μL, Mg 2+ (25mM) 4μL, each primer (10pM) 2μL, Ex Taq (5U / μL) 0.25μL, total volume 50μL. The PCR amplification was carried out as follows: 5 min pre-denaturation at 94°C, 30 s denaturation at 94°C, 30 s annealing at 52°C, 60 s extension at 72°C, 30 cycles, 10 min over-extension at 72°C. Two DNA fragments (dapB Up and dapB Down fragments) with point mutations and lengths of 665 bp and 644 bp, respectively, were obtained. The two DNA fragments were separated and purified by agarose gel electrophoresis, and then a fragment with a length of approximately 1279 bp (Up-Down fragment) was amplified by overlap PCR using the two purified DNA fragments as templates and P1' and P4' as primers. Overlap PCR system: 5μL of 10× Ex Taq Buffer, 4μL of dNTP Mixture (2.5mM each), Mg 2+ (25mM) 4μL, each primer (10pM) 2μL, Ex Taq (5U / μL) 0.25μL, total volume 50μL. The overlap PCR amplification was carried out as follows: 5 min pre-denaturation at 94°C, 30 s denaturation at 94°C, 30 s annealing at 52°C, 90 s extension at 72°C, 30 cycles, 10 min over-extension at 72°C. The Up-Down fragment was separated and purified by agarose gel electrophoresis, and the fragment contained the dapB gene promoter region and its upstream and downstream sequences, and had EcoR I and Sph I restriction enzyme cleavage sites at each end of the fragment. This DNA fragment changed C at -49 bp of the YP97158 dapB gene promoter region to A, G at -51 bp to T, and CTGCA at -54 to -58 bp to GGTGT. The fragment was subjected to double restriction enzyme digestion (EcoR I / Sph I), purified and recovered, and ligated into shuttle plasmid pK18mobsacB (purchased from Addgene) which was also double restriction enzyme digested (EcoR I / Sph I) to obtain the allele replacement plasmid pK18-PdapB. (C(-49)A,G(-51)T,CTGCA(-54--58)GGTGT) The vector pK18-PdapB contains a kanamycin resistance marker. (C(-49)A,G(-51)T,CTGCA(-54--58)GGTGT) The vector pK18-PdapB with the correct point mutation was then sent to a sequencing company for sequencing identification. (C(-49)A,G(-51)T,CTGCA(-54--58)GGTGT) was stored and prepared for use.

[0121] Example 8 Point Mutation pK18-PdapB (C(-49)A,G(-51)T,CTGCA(-54--58)GGTGT) Construction of engineered strains containing Allelic replacement plasmid pK18-PdapB (C(-49)A,G(-51)T,CTGCA(-54--58)GGTGT) was transformed into the L-lysine producing strain YP97158 (sequenced results showed that the wild-type dapB gene promoter was retained in the chromosome of the strain) by electric shock, and the single colonies produced by the culture were identified with primer P1' and universal primer M13F, and the strains from which a band of 1350 bp was amplified were positive strains. The positive strains were cultured in a medium containing 15% sucrose, and the single colonies produced by the culture were cultured in a medium containing kanamycin and a medium not containing kanamycin, respectively. The strains that grew in the kanamycin-free medium but not in the kanamycin-containing medium were further subjected to PCR identification with the following primers (synthesized by Shanghai Invitrogen Co., Ltd.): P5':5'AGATCGTCGGACTCATTGAC3'(SEQ ID NO:35) P6':5'CAAACATAGTTCCACCTGTG 3'(SEQ ID NO:36) The PCR amplified products were denatured at high temperature, treated in an ice bath, and then subjected to SSCP electrophoresis (plasmid pK18-PdapB (C(-49)A,G(-51)T,CTGCA(-54--58)GGTGT) The amplified fragment was used as the positive control, the YP97158 amplified fragment as the negative control, and water as the blank control. Since the fragment structures were different, the electrophoretic positions were different. Therefore, the strains whose electrophoretic positions did not match those of the negative control fragments and matched those of the positive control fragments were strains in which allele replacement was successful. Next, the target fragment of the positive strain was amplified by PCR, ligated into the PMD19-T vector, and sequenced. The sequence in which the base sequence was mutated as a result of sequence alignment was verified to be a successful allele replacement of the strain, and was named YPL-4-010.

[0122] Example 9 L-lysine fermentation experiment Fermentation experiments were carried out using the strain YPL-4-010 constructed in Example 8 and the original strain YP97158 in a fermenter with model number BLBIO-5GC-4-H (purchased from Shanghai Bailun Biotechnology Co., Ltd.) with the medium shown in Table 1 and the control process shown in Table 2. Each strain was repeated three times, and the results are shown in Table 4. TIFF0007644133000012.tif91170The results shown in Table 4 indicate that PdapB, a point mutation in the dapB gene promoter, was found in Corynebacterium glutamicum. (C(-49)A,G(-51)T,CTGCA(-54--58)GGTGT) Providing the above is advantageous in increasing the amount of L-lysine produced.

[0123] The above describes the embodiments of the present invention. However, the present invention is not limited to the above embodiments. All modifications, equivalent replacements, improvements, etc. made without departing from the spirit and principles of the present invention are intended to be included in the patent scope of the present invention.

Claims

1. A microorganism which produces L-lysine, said microorganism belonging to the genus Corynebacterium, said microorganism having improved expression of a polynucleotide encoding the amino acid sequence of SEQ ID NO:3, said improved expression being enhanced expression of the polynucleotide encoding the amino acid sequence of SEQ ID NO:3, or the polynucleotide encoding the amino acid sequence of SEQ ID NO:3 having a point mutation, or the polynucleotide encoding the amino acid sequence of SEQ ID NO:3 having a point mutation and enhanced expression; The point mutation in the polynucleotide encoding the amino acid sequence of SEQ ID NO:3 results in the substitution of the lysine residue at position 176 of the amino acid sequence of SEQ ID NO:3 with an asparagine residue; and / or the nucleotide at position -49 of the promoter region shown in SEQ ID NO:29 is mutated from cytosine (C) to adenine (A), the nucleotide at position -51 is mutated from guanine (G) to thymine (T), and the nucleotide sequence at positions -54 to -58 is mutated from CTGCA to GGTGT; The microorganism is Corynebacterium glutamicum YP97158; Microorganisms.

2. A polynucleotide encoding the amino acid sequence of SEQ ID NO:3 comprises the nucleotide sequence of SEQ ID NO:1; or The polynucleotide sequence having the point mutation comprises the polynucleotide sequence shown in SEQ ID NO:

2. The microorganism described in claim 1.

3. The nucleotide sequence of the promoter region is The microorganism described in claim 1, which has a nucleotide sequence as shown in SEQ ID NO:

30.

4. A recombinant strain comprising: A polynucleotide encoding the amino acid sequence of SEQ ID NO:4; or A polynucleotide comprising the polynucleotide sequence of SEQ ID NO:2; Including, A recombinant strain, wherein the host strain is Corynebacterium glutamicum YP97158.

5. A recombinant strain comprising: A polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO:30, or an expression cassette comprising the nucleotide sequence shown in SEQ ID NO:30 and a coding sequence operably linked to the nucleotide sequence, or a recombinant vector comprising the nucleotide sequence shown in SEQ ID NO:30; A recombinant strain, wherein the host strain is Corynebacterium glutamicum YP97158.

6. 6. A method for producing L-lysine, comprising culturing the microorganism according to any one of claims 1 to 3 or the recombinant strain according to claim 4 or 5, and recovering L-lysine from the culture.

Images