Malaria vaccine and methods for preventing and treating malaria

Abstract

[Problem] To provide a malaria vaccine which has an excellent preventative effect against infection and excellent effect of inhibiting malaria transmission, as compared to conventional malaria vaccines. [Solution] It was found that using, as a prime, a recombinant vaccinia virus which includes a gene that codes a CSP amino acid sequence and a gene that codes an s25 amino acid sequence, and using, as a boost, a recombinant adeno-associated virus which includes a gene that codes a CSP amino acid sequence and a gene that codes an s25 amino acid sequence results in a malaria vaccine which has an excellent preventative effect against infection and excellent effect of inhibiting malaria transmission.

Description

[Technical field]

[0001] The present invention relates to a malaria vaccine composition comprising a recombinant vaccinia virus in the prime and a recombinant adeno-associated virus in the boost, and a method for preventing and treating malaria using the composition. This application claims priority to Japanese Application No. 2022-24221 and Japanese Application No. 2022-131078, which are incorporated herein by reference. [Background technology]

[0002] Malaria is one of the world's three major infectious diseases, infecting more than 200 million people and killing 500,000 people every year. Although there are drugs to treat it, we are far from being able to treat all infected people. Furthermore, there are fears of the emergence of drug-resistant malaria parasites. Therefore, the development of a vaccine to protect against infection is eagerly awaited. In addition, as a way to protect society from malaria infection, there is also a desire to develop a method to block the route of transmission from person to mosquito and back to person. One infection-prevention vaccine that has undergone Phase III clinical trials is the RTS,S vaccine from GSK (which uses a fusion protein of the malaria antigens PfCSP and HBsAg, and the special adjuvant AS01), but it only has an efficacy rate of 30%. Furthermore, RTS,S requires three to four doses. In areas where even bednet use rates are low, it would be even more problematic to incur enormous costs in establishing a vaccination health system that would allow three or four doses of the vaccine. In addition, the BK-SE36 vaccine (Phase-I) being developed by the Osaka University group targets erythrocytic stage parasites and focuses on reducing symptoms (Non-Patent Document 1). On the other hand, the vaccine of the present invention targets sporozoite and liver stage parasites and aims for complete protection against infection (asymptomatic). SANARIA has developed the PfSPZ vaccine, which inactivates the malaria parasite (sporozoite). However, it requires more than four doses and has an infection prevention rate of only about 30%. Furthermore, a cold chain is required for storage and transportation, so vaccination is limited to military personnel and travelers. A method has been reported in which priming is performed with a chimpanzee adenovirus vector expressing a malaria antigen, followed by boosting with the MVA strain of vaccinia virus (a vaccinia virus that cannot grow in mammals). However, although this method was effective in protecting mice against infection, clinical trials showed that it only protected 5-15% of mice (Non-Patent Document 2). Furthermore, field trials showed that this method had no protective effect against infection (Non-Patent Document 3). A subunit vaccine using the antigen protein pfs25 of the malaria parasite has been attempted as a transmission-blocking vaccine. However, the effect only lasts for a short period of time. In addition, the adjuvant used (IMX313) is unique, so it cannot be mixed with other vaccines, such as RTS,S (which uses AS01 as an adjuvant). In 2018, the inventors developed a method of infection protection that combines the LC16m8Δ strain (Non-Patent Document 4), which induces much stronger immunity in mice than vaccinia strains that cannot grow (DIs, MVA), with other viral vectors (Patent Document 1).

[0003] (Malaria vaccine development status) Currently, the effective treatments for malaria are sleeping under insecticide-treated bed nets and artemisinin-based combination therapy (ACT). However, there have been reports of the emergence of insecticide-resistant mosquitoes and artemisinin-resistant protozoa, and there is an urgent need to develop a malaria vaccine (see Non-Patent Document 5). RTS,S (MosquirixTM) is known as the malaria vaccine currently being developed the most. RTS,S was developed with the aim of protecting humans from Plasmodium falciparum by activating immunity when the parasite first enters the host's bloodstream or when the parasite infects liver cells. RTS,S is designed to prevent infection, maturation, and proliferation of malaria parasites in the liver, reducing the risk of the parasites proliferating in the liver re-entering the bloodstream and infecting red blood cells, resulting in the development of malaria (see Non-Patent Document 6). However, the efficacy rate of RTS,S in phase III clinical trials is only 30%, so the development of new strategies and concepts for malaria is required (see non-patent document 9).

[0004] (The spread of P. vivax malaria and delays in vaccine development) There are five types of malaria that affect humans, but falciparum malaria accounts for more than 95% of cases, and vivax malaria accounts for more than 3% of cases, with these two accounting for the majority of malaria infections. Falciparum malaria, which has been studied ahead of other diseases, can become severe and even fatal in a short period of time. On the other hand, vivax malaria has mild symptoms, and it has been thought that there are few cases of infection because the Duffy antigen, which acts as a receptor for the invasion of red blood cells by the vivax malaria parasite, is negative in Africans. For this reason, vaccine research has lagged far behind. However, in recent years, due to globalization, global warming, the emergence of mutants, and improved diagnostic technology, the area of ​​infection has been spreading from Southeast Asia and Brazil to Africa (PLoS NeglTrop Dis 2019). There is a need to develop a next-generation malaria vaccine that is effective against not only falciparum malaria but also vivax malaria (WHO Malaria Report 2020), but the results of Phase III clinical trials in Africa for the falciparum malaria vaccine RTS,S (GSK), which is the most advanced in development, showed an efficacy rate of only 31%, with the effect completely disappearing within seven years. Application of RTS,S vaccine technology to the vivax malaria vaccine has been abandoned, and there are discouraging predictions that the development of a vaccine that is effective against both malaria is still a long way off.

[0005] (How to treat malaria) There are several reports on malaria treatment methods, particularly malaria vaccines, as described below.

[0006] (Patent Document 2) Patent Document 2 discloses "a malaria vaccine comprising a recombinant baculovirus comprising: (1) a gene encoding the amino acid sequence of a malaria antigen and a gene encoding the amino acid sequence of DAF, or a gene encoding the amino acid sequence of a malaria antigen; and (2) a promoter capable of expressing the genes; and further, the recombinant baculovirus is characterized in that it is administered to a patient after administering to the patient a recombinant virus other than baculovirus comprising the gene encoding the amino acid sequence of the malaria antigen, a plasmid DNA into which the gene encoding the amino acid sequence of the malaria antigen has been introduced, or a protein having the amino acid sequence of the malaria antigen." However, Patent Document 2 does not disclose or suggest "the composition of the malaria vaccine composition of the present invention."

[0007] (Patent Document 3) Patent document 3 discloses a method for producing a transfer vector including a construct incorporating a dual promoter and a fusion gene, characterized in that a fusion gene including at least one gene encoding a protein that can be a component of a viral particle and at least one immunogenic foreign gene is linked downstream of linked dual promoters, one of which is a vertebrate promoter and the other is a baculovirus promoter. However, Patent Document 3 does not disclose or suggest "the composition of the malaria vaccine composition of the present invention."

[0008] (Patent Document 4) Patent Document 4 discloses "a pharmaceutical composition containing a recombinant Autographa nuclear polyhedrosis virus (AcNPV) as an active ingredient, characterized in that the recombinant AcNPV contains any one of the following fusion genes under the control of a dual promoter linked to at least a polyhedrin promoter and a CAG promoter." However, Patent Document 4 does not disclose or suggest "the composition of the malaria vaccine composition of the present invention."

[0009] (Patent Document 5) Patent document 5 discloses a recombinant baculovirus comprising "(a) a nucleotide sequence encoding a foreign viral envelope protein, (b) a first promoter operably linked to the envelope coding sequence, (c) a nucleotide sequence encoding an antigen protein, and (d) a second promoter operably linked to the antigen coding sequence." However, Patent Document 5 does not disclose or suggest "the composition of the malaria vaccine composition of the present invention."

[0010] (Patent Document 6) Patent Document 6 discloses a kit comprising "the following first and second components, the first and second components further comprising, optionally, a pharma- ceutically acceptable carrier: a) a first component comprising one or more foreign proteins or nucleic acids encoding the foreign proteins, or functional portions thereof; and b) a second component comprising a recombinant modified vaccinia virus Ankara (MVA), the MVA having a nucleic acid sequence encoding a fusion protein, the fusion protein comprising ubiquitin or a functional portion thereof, and one or more foreign proteins or functional portions thereof." However, Patent Document 6 does not disclose or suggest "the composition of the malaria vaccine composition of the present invention."

[0011] (Patent Document 7) Patent document 7 discloses "an immunogenic composition comprising a viral vector comprising a nucleic acid sequence encoding a C4bp domain or a variant or fragment thereof and a nucleic acid sequence encoding an antigen of interest." However, Patent Document 7 does not disclose or suggest "the composition of the malaria vaccine composition of the present invention."

[0012] (Non-Patent Document 7) Non-Patent Document 7 discloses that "by using the priming-boosting method, vaccination with an adenovirus vaccine (ChAd63) followed by vaccination with a vaccinia virus vaccine (MVA) achieved a 40% protective effect against malaria infection." However, Non-Patent Document 7 does not disclose or suggest "the composition of the malaria vaccine composition of the present invention."

[0013] (Non-Patent Document 8) Non-patent document 8 discloses that "the efficacy of preventing malaria infection reached 90% by inoculating MVA-CS (a recombinant virus in which CSP has been incorporated into vaccinia virus) after inoculating FP9-CS (a recombinant virus in which CSP has been incorporated into fowlpox virus)." However, the method described in Non-Patent Document 8 uses an adjuvant, and if this adjuvant is not used, the protective effect against malaria infection decreases to 35%. Furthermore, Non-Patent Document 8 does not disclose or suggest "the composition of the malaria vaccine composition of the present invention."

[0014] For these reasons, the current effectiveness of malaria prevention is insufficient and needs to be further improved. [Prior art documents] [Non-patent literature]

[0015] [Non-Patent Document 1] PLoS ONE.8(5), e64073, 2013 [Non-Patent Document 2] J. Inf. Dis.211:1076-1086, 2015 [Non-Patent Document 3] PLoS ONE.13(12), e0208328, 2018 [Non-Patent Document 4] Proc. Natl. Acad. Sci. 102: 4152-4157 2005; Vaccine 27:966-971, 2009 [Non-Patent Document 5] ReviewArticle Malariain developing countries, (2007),2-5.doi:10.3855 / jidc.4610 [Non-Patent Document 6] GlaxoSmithKline K.K., "GSK's malaria vaccine MosquirixTM (RTS,S) receives recommendation for approval from European regulators for the prevention of malaria in young children in sub-Saharan Africa", [online], July 31, 2015, [Retrieved March 2, 2018], Internet<URL:jp.gsk.com / jp / media / press-releases / 2015 / 20150731-malaria_1 / > [Non-Patent Document 7] Infect. Immu. 82(3):1277-1286,2014 [Non-Patent Document 8] Hum. Vaccin.6(1):78-83,2010 [Non-Patent Document 9] N Engl J Med 367:2284-95,2012. [Patent documents]

[0016] [Patent Document 1] JP 2019-151617 A [Patent Document 2] International Publication No. 2016 / 059911 [Patent Document 3] International Publication No. 2007 / 091624 [Patent Document 4] International Publication No. 2009 / 020236 [Patent Document 5] International Publication No. 2009 / 088256 [Patent Document 6] International Publication No. 2006 / 077161 [Patent Document 7] International Publication No. 2008 / 122817 Summary of the Invention [Problem to be solved by the invention]

[0017] An object of the present invention is to provide a malaria vaccine and a method for preventing and treating malaria which are superior not only in the effect of preventing infection but also in the effect of blocking malaria transmission, as compared with conventional malaria vaccines. [Means for solving the problem]

[0018] As a result of research conducted to solve the above problems, the inventors have discovered that by using a recombinant vaccinia virus containing a gene encoding the amino acid sequence of CSP and a gene encoding the amino acid sequence of s25 as a prime, and a recombinant adeno-associated virus containing a gene encoding the amino acid sequence of CSP and a gene encoding the amino acid sequence of s25 as a boost, a malaria vaccine composition is obtained which is excellent not only in terms of the effect of preventing infection, but also in terms of the effect of preventing malaria transmission, and have completed the present invention.

[0019] The present invention is as follows. 1. A malaria vaccine composition comprising: (1) A recombinant vaccinia virus containing a gene encoding the amino acid sequence of CSP for prime and a gene encoding the amino acid sequence of s25 (2) A recombinant adeno-associated virus containing a gene encoding the amino acid sequence of CSP for boost and a gene encoding the amino acid sequence of s25. 2. A malaria vaccine comprising a recombinant vaccinia virus comprising a gene encoding the amino acid sequence of CSP and a gene encoding the amino acid sequence of s25, Furthermore, the recombinant vaccinia virus is characterized in that it is administered to a human or an animal before administering to the human or an animal a recombinant adeno-associated virus comprising a gene encoding the amino acid sequence of CSP and a gene encoding the amino acid sequence of s25. Malaria vaccine. 3. A malaria vaccine comprising a recombinant adeno-associated virus comprising a gene encoding the amino acid sequence of CSP and a gene encoding the amino acid sequence of s25, Furthermore, the recombinant adeno-associated virus is characterized in that it is administered to a human or an animal after a recombinant vaccinia virus comprising a gene encoding the amino acid sequence of CSP and a gene encoding the amino acid sequence of s25 is administered to the human or an animal. Malaria vaccine. 4. The malaria vaccine composition according to the preceding item 1, wherein the vaccinia virus is an LC16 strain lacking the B5R gene. 5. The malaria vaccine described in the preceding item 2 or 3, wherein the vaccinia virus is an LC16 strain lacking the B5R gene. 6. The malaria vaccine composition according to the preceding item 1 or 4, which is for protection against malaria infection and for blocking malaria transmission. 7. The malaria vaccine described in the preceding item 2, 3 or 5, which is for protection against malaria infection and for blocking malaria transmission. 8. A malaria vaccine composition that confers lifelong immunity to the recipient, comprising: (1) A recombinant vaccinia virus containing a gene encoding the amino acid sequence of CSP for prime and a gene encoding the amino acid sequence of s25 (2) A recombinant adeno-associated virus containing a gene encoding the amino acid sequence of CSP for boost and a gene encoding the amino acid sequence of s25. The present invention is characterized in that a combination of the recombinant vaccinia virus for prime use and the recombinant adeno-associated virus for boost use is inoculated to a recipient two or more times. Malaria vaccine compositions. 9. The malaria vaccine composition described in the preceding item 1, wherein the malaria is Plasmodium vivax. 10. A method for preventing and / or treating malaria, comprising the steps of: 1) administering to a human or animal a recombinant vaccinia virus containing a gene encoding the amino acid sequence of prime CSP and a gene encoding the amino acid sequence of s25; and 2) A step of administering to the human or animal a recombinant adeno-associated virus comprising a gene encoding the amino acid sequence of CSP for boost and a gene encoding the amino acid sequence of s25. 11. The method according to item 10 above, wherein the vaccinia virus is the LC16 strain in which the B5R gene is deleted. 12. The method according to the preceding paragraph 10, for preventing malaria infection and inhibiting malaria transmission. 13. The method according to claim 10, wherein the malaria is Plasmodium vivax. 14. A method for conferring lifelong immunity to a recipient, comprising the steps of: 1) administering to a recipient a recombinant vaccinia virus containing a gene encoding the amino acid sequence of prime CSP and a gene encoding the amino acid sequence of s25; and 2) administering to the recipient a recombinant adeno-associated virus comprising a gene encoding the amino acid sequence of CSP for boosting and a gene encoding the amino acid sequence of s25; The present invention is characterized in that a combination of the recombinant vaccinia virus for prime use and the recombinant adeno-associated virus for boost use is inoculated to the inoculated person two or more times. method. 15. The method according to item 14 above, wherein the vaccinia virus is the LC16 strain lacking the B5R gene. 16. The method according to the preceding paragraph 14, for preventing malaria infection and inhibiting malaria transmission. 17. The method according to claim 14, wherein the malaria is Plasmodium vivax. 18. Use of the following (1) and (2) in the manufacture of a malaria vaccine composition. (1) A recombinant vaccinia virus containing a gene encoding the amino acid sequence of CSP for prime and a gene encoding the amino acid sequence of s25 (2) A recombinant adeno-associated virus containing a gene encoding the amino acid sequence of CSP for boost and a gene encoding the amino acid sequence of s25. 19. Use of the following (1) and (2) in the manufacture of a malaria vaccine composition that confers lifelong immunity to the recipient: (1) A recombinant vaccinia virus containing a gene encoding the amino acid sequence of CSP for prime and a gene encoding the amino acid sequence of s25 (2) A recombinant adeno-associated virus containing a gene encoding the amino acid sequence of CSP for boost and a gene encoding the amino acid sequence of s25. 20. The malaria vaccine composition described in the preceding item 1 or 4, which is for inhibiting ookinete conversion. Effect of the Invention

[0020] The malaria vaccine of the present invention has one or more of the following effects compared to conventional malaria vaccines. (1) High protection against malaria (2) High protection against malaria infection and the prevention of malaria transmission (3) Short-term protection against malaria infection after boosting (4) Long-lasting protection against malaria (5) Efficacy of two doses of vaccination (6) Effect of conferring lifelong immunity to the vaccine recipient [Brief description of the drawings]

[0021] Figures 1 to 6 show the description of the m8Δ / AAV1-Pf(s25-CSP) falciparum malaria vaccine, Figures 7 to 11 show the description of the m8Δ / AAV1-Pv(s25-CSP-S / P) vivax malaria vaccine, and Figures 12 to 15 show the description of the m8Δ / AAV5-Pf(s25-CSP) falciparum malaria vaccine. [Figure 1]The m8Δ / AAV1-Pf(s25-CSP) vaccine configuration and the protective effect against infection in a low-dose PfCSP / Pb sporozoite challenge test performed after vaccination with the vaccine are shown. (a) The configuration of m8Δ and AAV1 expressing the Pfs25-PfCSP fusion protein [Pf(s25-CSP)] is shown. HA means hemagglutinin, p7.5 means the p7.5 promoter, pCMVie means the cytomegalovirus immediate early promoter, S means the signal sequence, F means the FLAG epitope tag, G6S means the GGGGGGS hinge sequence, G means the vesicular stomatitis virus G protein transmembrane domain, and WPRE means the woodchuck hepatitis virus posttranscriptional regulatory element. (b) HEK293T cells transduced with m8Δ-Pf(P7.5-CSP)-HA, m8Δ-Pf(P7.5-s25-CSP)-HA, AAV1-PfCSP or AAV1-Pf(s25-CSP) were lysed and proteins were separated by SDS-PAGE. The monoclonal antibodies 2A10 (anti-PfCSP antibody) and 4B7 (anti-Pfs25 antibody) were used to examine the reactivity of bands on the membrane Western blotted from the SDS-PAGE gel. (c) Balb / c mice were immunized with m8Δ / AAV1-Pf(s25-CSP) (n = 10) and m8Δ / AAV1-PfCSP (n = 10) and the protective effect was compared with that of PBS control mice (n = 10). The protective effect was evaluated by challenging mice with 1,000 PfCSP / Pb sporozoites 28 days after the final immunization, preparing blood smears, and counting the number of days until 1% parasitemia was reached. P values ​​(**** P<0.0001) were calculated using the Log-Rank (Mantel-Cox) test. (d) IgG antibody titers against PfCSP and Pfs25 were measured using peripheral blood samples from the mice in Figure 1(c) on day 41 after m8Δ priming (Priming; P) and day 27 after AAV1 booster (Boosting; B). P values ​​(**** P<0.0001) were calculated using the Mann-Whitney U test.(e) ICR mice were immunized with m8Δ / AAV1-Pf(s25-CSP) (n = 10), and the protective effect against infection was compared with that of PBS control mice (n = 10). The protective effect was evaluated by challenging the mice with 1,000 PfCSP / Pb sporozoites 40 days after the final immunization, preparing blood smears, and counting the number of days until 1% parasitemia was reached. P value (**** P<0.0001) was calculated using the Log-Rank (Mantel-Cox) test. (f) IgG antibody titers against PfCSP and Pfs25 were measured using peripheral blood samples from the mice in Figure 1(e) on day 41 after the m8Δ priming immunization (Priming; P) and day 39 after the AAV1 booster immunization (Boosting; B). P value (**** P<0.0001) was calculated using the Mann-Whitney U test. [Diagram 2] Protective effects in a high-dose PfCSP / Pb sporozoite challenge test performed after vaccination with m8Δ / AAV1-s25-CSP vaccine are shown. (a) (b) Balb / c mice were immunized with m8Δ / AAV1-Pf(s25-CSP) (n = 10 for both short-term and long-term) and Ad / AAV1-Pf(s25-CSP) (n = 10 for short-term and n = 7 for long-term), and the protective effects were compared with those of PBS control mice (n = 10 for both short-term and long-term). Protective effects were evaluated by challenging mice with 2,500 PfCSP / Pb sporozoites on days 29 (a, short-term) and 102 (b, long-term) after the final immunization, and then preparing blood smears and counting the number of days until 1% parasitemia was reached. P values ​​(**** P<0.0001) were calculated using the Log-Rank (Mantel-Cox) test. (c) (d) IgG antibody titers against PfCSP (c) and Pfs25 (d) were measured using peripheral blood samples taken periodically up to 210 days after the final immunization of the mice protected in Figure 2(a) above. P values ​​(*p <0.05) were calculated by repeated measures two-way ANOVA with Sidak's multiple comparison test. [Diagram 3]The transmission blocking effect of the m8Δ / AAV1-Pf(s25-CSP) vaccine is shown. (a) (b) Balb / c mice were immunized with m8Δ / AAV1-Pf(s25-CSP) (short-term n = 3, long-term n = 5), and the transmission blocking effect was compared with that of unvaccinated control mice (short-term n = 3, long-term n = 5). The transmission blocking effect was measured by inoculating mice 37 days (a, short-term) and 236 days (b, long-term) after the final immunization with infected red blood cells of Pb-Pfs25DR3 (a rodent malaria parasite carrying the Pfs25 gene) and then allowing mosquitoes to feed on blood. 10 to 12 days after the blood feeding, the midguts of the mosquitoes were dissected and the number of oocysts was measured. Each data point represents the number of oocysts from a single blood-feeding mosquito, and the horizontal line indicates the average number. Transmission inhibitory activity (TRA) indicates the reduction in the number of oocysts in mosquitoes that fed on the vaccinated mice compared to mosquitoes that fed on non-vaccinated mice, and transmission blocking activity (TBA) indicates the oocyst-negative rate in mosquitoes that fed on the vaccinated mice compared to mosquitoes that fed on non-vaccinated mice. [Figure 4]Protective and transmission-blocking effects of the m8Δ / AAV1-Pf(s25-CSP) vaccine against multiple sporozoite challenge. (a) Balb / c mice were immunized with m8Δ / AAV1-Pf(s25-CSP) (n = 10), and the protective effect was compared with that of PBS control mice (n = 10). The protective effect was evaluated by blood-challenging mice 26 days after the final immunization with PfCSP-Tc / Pb sporozoite-infected mosquitoes (3 mosquitoes ≦ 7 mosquitoes per mouse), preparing blood smears, and counting the number of days until 1% parasitemia was reached (first-round protection). P values ​​(**** P < 0.0001) were calculated using the Log-Rank (Mantel-Cox) test. (b) Mice (n = 10) protected in Figure 4(a) above were challenged with 2,500 PfCSP-Tc / Pb sporozoites on the 86th day after the final immunization (34 days after the blood-feeding challenge in Figure 4(a) above), and blood smears were prepared to evaluate the second protective effect in terms of the number of days until 1% parasitemia was reached. P value (**** P<0.0001) was calculated using the Log-Rank (Mantel-Cox) test. (c) Mice (n = 10) protected in Figure 4(b) above were challenged with 10,000 PfCSP / Pb sporozoites on the 100th day after the final immunization (40 days after the sporozoite challenge in Figure 4(b) above), and blood smears were prepared to evaluate the third protective effect in terms of the number of days until 1% parasitemia was reached. P values ​​(**** P<0.0001) were calculated using the Log-Rank (Mantel-Cox) test. (d) The transmission-blocking effect of the protected mice (n = 5, 5 mice randomly selected from 10 mice) in Figure 4(c) above was compared with that of the unvaccinated control group mice (n = 4). The transmission-blocking effect was measured by inoculating the mice with Pb-Pfs25DR3-infected red blood cells on the 276th day after the final immunization (176 days after the sporozoite challenge in Figure 4(c) above) and then allowing the mosquitoes to feed on blood. On the 10th to 12th day after the blood-feeding, the midguts of the mosquitoes were dissected and the number of oocysts was measured. Each data point represents the number of oocysts from a single blood-feeding mosquito, and the horizontal line indicates the average number. P values ​​(**** P<0.0001) for TRA were calculated using the Mann-Whitney U test.The P value of TRA (****P<0.0001) was calculated using Fisher's exact test. (e) IgG antibody titers against PfCSP and Pfs25 were measured using peripheral blood collected from the vaccine-immunized mice in Figures 4(a)-(d) before each challenge and before the transmission-blocking experiment. P values ​​(***P<0.001, **P<0.01, *P<0.05) were calculated using one-way analysis of variance with Dunnett's multiple comparison test to compare each data point with the data on day 25 after the final immunization. [Diagram 5] Figure 1 shows antigen gene expression on mammalian cell surface by m8Δ malaria vaccine. HEK293T cells were transduced with m8Δ-Pf(P7.5-CSP)-HA or m8Δ-Pf(P7.5-s25-CSP)-HA for 24 hours (MOI = 5 for each). (a) The transduced cells were fixed with methanol and stained with Alexa Fluor 488-labeled 2A10 (anti-PfCSP antibody) and Alexa Fluor 594-labeled 4B7 (anti-Pfs25 antibody), and the fluorescent signals were detected by fluorescence microscopy. (b) The transduced cells were harvested and stained with FITC-labeled 2A10 (anti-PfCSP antibody) and HiLyteFluorTM647-labeled 4B7 (anti-Pfs25 antibody), and antigen gene expression on the cell surface was confirmed by flow cytometry. (c) Mean fluorescence intensity (MFI) for PfCSP of the transduced cells in Figure 5(c) above (n = 5). (d) Mean fluorescence intensity (MFI) for Pfs25 of the transduced cells in Figure 5(c) above (n = 5). [Figure 6] The experimental design of each of the above Figures 1 to 5 is illustrated. The time point of booster immunization with AAV1-Pf(s25-CSP) was set to day 0. Serum collection for antibody titer measurement was performed on the day before AAV1-Pf(s25-CSP) immunization, sporozoite challenge, or infected RBC infection, or periodically after protection. Ts (tail scarification immunization) means inoculation by bifurcated needle in the mouse tail, im means intramuscular inoculation, iv means intravenous administration, and ip means intraperitoneal administration. [Figure 7]The structure of Pv(s25-CSP-S / P) is shown (see SEQ ID NOs: 8 and 9). (a) The artificial synthetic gene sequence of Pv(s25-CSP(S / P) is shown. The Pv(s25-CSP-S / P) gene has been codon-optimized for efficient expression in mammalian cells. a: GDRADGQPA, b: GDRAAGQPA, c: GAGNQPGAN. (b) The construct of recombinant m8Δ is shown. The Pv(s25-CSP-S / P) gene was inserted under the 7.5 promoter. (c) The construct of recombinant AAV is shown. The Pv(s25-CSP-S / P) gene was fused to the transmembrane domain (G) of the VSV-G protein, and WPRE was inserted downstream of it. S, gp64 signal sequence; P7.5, 7.5 promoter; pCMV, CMV promoter; F, flag epitope tag; G6S, GGGGGGS hinge sequence; G, VSV-GTM; WPRE, woodchuck hepatitis virus posttranscriptional regulatory CSP-Sal (SEQ ID NO: 10: CSP-Sal from Plasmodium vivax) and CSP-PNG (SEQ ID NO: 11: CSP-PNG from Plasmodium vivax) were derived from Plasmodium vivax. [Figure 8]Western blotting and indirect immunofluorescence analysis of m8Δ / AAV1-Pv(s25-CSP-S / P) vaccine. (a) (b) Western blotting confirms the expression of PvCSP-Sal (a) and PvCSP-PNG (b) in mammalian cells transfected with m8Δ / AAV1-Pv(s25-CSP-S / P). HEK293T cells were infected with m8Δ-Pv(P7.5-s25-CSP-S / P)-HA at MOI=1 or AAV1-Pv(s25-CSP-S / P) vaccine at MOI=105. After 24 hours, cells were lysed, loaded onto a 10% SDS-PAGE gel, and immunoblotted with anti-PvCSP-Sal antibody 2F2 (a) and anti-PvCSP-PNG antibody 2E10E9 (b). (c) Localization of Pvs25 and PvCSP-Sal, -PNG expression in mammalian cells transfected with m8Δ / AAV1-Pv(s25-CSP-S / P) using indirect immunofluorescence. HEK293T cells were infected with m8Δ-Pv(P7.5-s25-CSP-S / P)-HA vaccine at an MOI of 0.04 or AAV1-Pv(s25-CSP-S / P) vaccine at an MOI of 105, and fixed with PFA 24 hours later. Immunofluorescence staining was performed using 2F2 antibody labeled with R-Phycoerythrin LK23, 2E10E9 antibody labeled with Fluorescein LK01, or anti-Pvs25 polyclonal antibody labeled with HiLyteFlourTM 647 LK13. Cell nuclei were visualized with DAPI. Scale bar = 20 μm. [Figure 9] The antibody titer results of the m8Δ / AAV1-Pv(s25-CSP-S / P) vaccine are shown. The anti-PvCSP-Sal IgG antibody titer (a) and the Pvs25 IgG antibody titer (b) after immunization with the m8Δ / AAV1-Pv(s25-CSP-S / P) vaccine are shown. Serum was collected from each immunized mouse before the final immunization and before the infection experiment, and was measured by ELISA. Significant differences were evaluated by the Kruskal Wallis test. ****p<0.0001 [Figure 10]The results of the protective effect of the m8Δ / AAV1-Pv(s25-CSP-S / P) vaccine are shown. The protective effect against sporozoites in mice immunized with the m8Δ / AAV1-Pv(s25-CSP-S / P) vaccine is shown. 28 days after the final immunization, a challenge infection experiment was performed by administering 1,000 genetically modified Plasmodium vivax parasites (PvCSP-Sal / Pb) via the tail vein, and the protective effect was evaluated (N=10). The protective effect is shown as the percentage when the erythrocytic stage infection rate reached 1%. Significant differences were calculated using multiple comparison tests (ANOVA). ****p<0.0001 [Figure 11] The results of the transmission-blocking effect of the m8Δ / AAV1-Pv(s25-CSP-S / P) vaccine are shown. DMFA was performed using serum 28 days after the final immunization. Each dot indicates the number of oocysts in the midgut of one mosquito that had been sucked by DMFA, and the horizontal line indicates the average number. Also shown are TRA and TBA against the dilution rate of the serum. [Figure 12] The AAV5-Pf(s25-CSP) vaccine configuration and the results of Western blotting of the vaccine are shown. (a) The configuration of AAV5-Pf(s25-CSP) expressing the Pfs25-PfCSP fusion protein [Pf(s25-CSP)] is shown. pCMVie means cytomegalovirus immediate early promoter, S means signal sequence, F means FLAG epitope tag, H means GGGGGS hinge sequence, G means vesicular stomatitis virus G protein transmembrane domain, and WPRE means woodchuck hepatitis virus posttranscriptional regulatory element. (b) Confirmation of Pfs25 and PfCSP expression in mammalian cells transfected with AAV5-Pf(s25-CSP) using Western blotting. HEK293T cells were infected with the AAV5-Pf(s25-CSP) vaccine at MOI=105. After 24 hours, cells were lysed, loaded onto a 10% SDS-PAGE gel, and immunoblotted with 2A10 and 4B7 antibodies. m8Δ indicates the same sample as m8Δ-Pf(P7.5-s25-CSP)-HA (FIG. 1b). [Figure 13]The antibody titer results for the m8Δ / AAV5-Pf(s25-CSP) vaccine are shown. Balb / c mice (n=9) were immunized with the m8Δ-Pf(P7.5-s25-CSP)-HA vaccine (prime), and then immunized with the AAV5-Pf(s25-CSP) vaccine 6 weeks later (boost), and the antibody titer was measured at each time point. Prime indicates the antibody titer 6 weeks after immunization with the m8Δ-Pf(P7.5-s25-CSP)-HA vaccine, and Boost indicates the anti-PfCSP antibody titer (a) and anti-Pfs25 antibody titer (b) 4 weeks after immunization with the AAV5-Pf(s25-CSP) vaccine (boost). [Figure 14] The protective effect of the m8Δ / AAV5-Pf(s25-CSP) vaccine is shown. Balb / c mice were immunized with m8Δ / AAV5-Pf(s25-CSP) (n = 9), and the protective effect was compared with that of PBS control mice (n = 10). The protective effect was evaluated by challenging mice with 2,500 PfCSP-Tc / Pb sporozoites 40 days after the final immunization, preparing blood smears, and counting the number of days until 1% parasitemia was reached. P values ​​(**** P<0.0001) were calculated using the Log-Rank (Mantel-Cox) test. [Figure 15] The results of the transmission-blocking effect of the m8Δ / AAV5-Pf (s25-CSP) vaccine are shown. DMFA was performed using serum 28 days after the final immunization. Each dot indicates the number of oocysts in the midgut of one mosquito that had been sucked by DMFA, and the horizontal line indicates the average number. Also shown are TRA and TBA versus serum dilution rate. [Figure 16] 1 shows the monkey blood sampling schedule. [Figure 17] The results of 14 monkey blood test items are shown. [Figure 18] (a) shows the results of anti-PfCSP antibody titers in monkeys, (b) shows the results of anti-Pfs25 antibody titers at 12 weeks. [Figure 19] The results of the sporozoite neutralization test are shown. [Figure 20] The results of the transmission inhibition test are shown. [Figure 21] 1 shows the results of an ookinete conversion inhibition test. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0022] (Malaria vaccine and malaria vaccine composition of the present invention) The "malaria vaccine" of the present invention is directed to: A recombinant vaccinia virus for use as a prime malaria vaccine, which contains a gene encoding the amino acid sequence of CSP and a gene encoding the amino acid sequence of s25, or a prime malaria vaccine containing said virus. A recombinant adeno-associated virus for boosting a malaria vaccine comprising a gene encoding the amino acid sequence of CSP and a gene encoding the amino acid sequence of s25, or a malaria vaccine for boosting comprising said virus. The "malaria vaccine composition" of the present invention comprises: (1) A recombinant vaccinia virus containing a gene encoding the amino acid sequence of CSP for prime and a gene encoding the amino acid sequence of s25 (2) A recombinant adeno-associated virus containing a gene encoding the amino acid sequence of CSP for boost and a gene encoding the amino acid sequence of s25. The malaria vaccine and malaria vaccine composition of the present invention are described below.

[0023] (gene) In this specification, the term "gene (DNA molecule)" is intended to include not only double-stranded DNA, but also each of the single-stranded DNAs constituting the double-stranded DNA, that is, the sense strand and the antisense strand, and is not limited by its length. Therefore, unless otherwise specified, the gene (polynucleotide) encoding the amino acid sequence of the malaria antigen of the present invention includes double-stranded DNA including genomic DNA and single-stranded DNA (sense strand) including cDNA, as well as single-stranded DNA (antisense strand) having a sequence complementary to the sense strand and synthetic DNA, and fragments thereof.

[0024] (Protein with the amino acid sequence of a malaria antigen) The "protein having the amino acid sequence of CSP" used in the present invention is not particularly limited, so long as it has the same amino acid sequence or the same function as the amino acid sequence of CSP displayed (capable of being displayed) by adeno-associated virus or vaccinia virus and has a homology of 90% or more, 95% or more, 98% or more, or 99% or more. Furthermore, the amino acid sequence may be modified by a method known per se. The "protein having the amino acid sequence of s25" used in the present invention is not particularly limited, so long as it has the same amino acid sequence or the same function as the amino acid sequence of s25 displayed (capable of being displayed) by adeno-associated virus or vaccinia virus and has a homology of 90% or more, 95% or more, 98% or more, or 99% or more. Furthermore, the amino acid sequence may be modified by a method known per se.

[0025] (CSP) CSP (Circumsporozoite Protein) is the main membrane protein of the sporozoite stage protozoan that invades humans from mosquitoes. It has a molecular weight of about 50 kDa, and in the center there is a repeat sequence of 10 to 40 times of 4 to 8 amino acid sequences with high antigenicity. In an invasion inhibition experiment in which a monoclonal antibody against the repeat sequence was mixed with sporozoites and sprayed onto liver cells, it showed a very high invasion inhibition, so CSP is thought to play an important role in invasion into liver cells. Among the many malaria antigens, CSP is particularly expected to be a vaccine candidate antigen and has been studied for many years. RTS,S, the most advanced vaccine for falciparum malaria, is also a malaria parasite ( Plasmodium falciparum The vaccine antigen is the CSP antigen (PfCSP) of malaria parasite. In addition, PfCSP maintains its three-dimensional structure with four cysteines, and it has been reported that this three-dimensional structure plays an important role in the liver invasion mechanism of malaria parasites. The CSP used in the present invention is preferably PfCSP (SEQ ID NO: 1: Plasmodium falciparum), which is a base sequence derived from the malaria parasite, or sPfCSP2 (SEQ ID NO: 2: sPfCSP2 derived from Plasmodium falciparum), which has a base sequence encoding the amino acid region Leu19-Val377 lacking the signal sequence and GPI anchor and has been codon-optimized for expression in mammalian cells; however, other malaria parasite CSP genes (e.g., the PvCSP gene from Plasmodium vivax) can also be used. Furthermore, multiple types of CSP genes corresponding to multiple strains of malaria parasites may be linked together.

[0026] In addition, CSPs for use in the present invention also include the following: (1) Protected, glycosylated, acylated, or acetylated derivatives of CSP. (2) A protein having 90% or more, 95% or more, 98% or more, or 99% or more homology with CSP and having substantially the same function as CSP. (3) A protein in which 100 to 10, 50 to 30, 40 to 20, 10 to 5, or 5 to 1 amino acids are substituted, deleted, inserted and / or added in CSP and which has substantially the same function as CSP. Further, CSP genes for use in the present invention include the following: (1) A gene encoding a polypeptide consisting of the amino acid sequence of CSP. (2) A gene encoding a polypeptide in which 1 to 20 amino acids have been substituted, deleted, inserted and / or added in the amino acid sequence of CSP and which has substantially the same function as CSP. (3) A gene encoding a polypeptide having 90% or more, 95% or more, 98% or more, or 99% or more homology to the amino acid sequence of CSP and having substantially the same function as CSP.

[0027] (s25) s25 (sexual-stage 25-kDa protein) is a multistage target antigen for sexual-stage antigens of the ookinate stage of the malaria parasite {see Mizutani M. et al. "Baculovirus-vectored multistage Plasmodium vivax vaccine induces both protective and transmission-blocking immunities against transgenicrodent malaria parasites." Infection and immunity (2014): IAI-02040.}. The s25 used in the present invention is preferably sPfs25 (SEQ ID NO: 3: sPfs25 derived from Plasmodium falciparum; amino acid sequence: SEQ ID NO: 4: sPfs25 derived from Plasmodium falciparum), which is a base sequence derived from Plasmodium falciparum with the base sequence optimized for mammals, but other malaria parasite s25 genes (e.g., the Pvs25 gene from Plasmodium vivax) can also be used.

[0028] In addition, s25 as used in the present invention also includes the following: (1) Protected derivatives, glycosylated derivatives, acylated derivatives, or acetylated derivatives of s25. (2) A protein having a homology of 90% or more, 95% or more, 98% or more, or 99% or more to s25 and having substantially the same function as s25. (3) A protein in which 100 to 10, 50 to 30, 40 to 20, 10 to 5, or 5 to 1 amino acids have been substituted, deleted, inserted and / or added in s25 and which has substantially the same function as s25. Further, s25 genes for use in the present invention include the following: (1) A gene encoding a polypeptide consisting of the amino acid sequence of s25. (2) A gene encoding a polypeptide in which 1 to 20 amino acids have been substituted, deleted, inserted and / or added in the amino acid sequence of s25 and which has substantially the same function as s25. (3) A gene encoding a polypeptide having 90% or more, 95% or more, 98% or more, or 99% or more homology to the amino acid sequence of s25 and having substantially the same function as s25.

[0029] The protein having the above mutation may be a naturally occurring protein, or may be a protein obtained by introducing a mutation into a naturally occurring gene. Means for introducing a mutation are known per se, and for example, site-directed mutagenesis, homologous recombination, primer extension, polymerase chain reaction (hereinafter abbreviated as PCR), and the like can be used alone or in appropriate combination. For example, the method described in the textbooks (Sambrook et al., eds., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory, 1989; Muramatsu Masami, ed., Laboratory Manual of Genetic Engineering, Maruzen Co., Ltd., 1988) or a modified version of the method can be used, and Ulmer's technique (Ulmer, KM, Science, 1983, vol. 219, pp. 666-671) can also be used. In the case of peptides, from the viewpoint of not changing the basic properties (physical properties, functions, physiological activity, immunological activity, etc.) of the peptide upon introduction of mutations, for example, mutual substitutions between homologous amino acids (polar amino acids, nonpolar amino acids, hydrophobic amino acids, hydrophilic amino acids, positively charged amino acids, negatively charged amino acids, aromatic amino acids, etc.) can be easily assumed.

[0030] The CSP gene and the s25 gene can be preferably introduced by linking them via a hinge sequence. Such a hinge sequence is not particularly limited as long as it does not affect the expression of CSP and s25 on the cell surface, but is preferably an amino acid sequence of SEQ ID NO: 6 (Hinge sequence for Pfs25 and PfCSP), and is preferably a base sequence of SEQ ID NO: 7 (Hinge sequence for Pfs25 and PfCSP). Therefore, in the present invention, it is preferable to introduce a hinge sequence (e.g., SEQ ID NO: 6) between s25 and CSP. Furthermore, in the present invention, in consideration of maintaining the three-dimensional structure of s25, it is preferable to fuse them in the order of [N-terminus-s25-hinge-CSP-VSG membrane anchor].

[0031] (Recombinant adeno-associated virus and its method of manufacture) Adeno-associated viruses are non-replicative, belong to the Parvoviridae family, and are composed of single-stranded DNA. The adeno-associated virus (vector) used in the present invention may be, for example, human adeno-associated virus type 1 (AAV1), AAV8, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV9 {see: Nieto et al. AAV Vectors Vaccines Against Infectious Diseases. FrontImmunol. 5 (2014)}, other human adenovirus serotypes, or adeno-associated viruses derived from other animal species (e.g., chimpanzees, gorillas), and is not particularly limited. However, adeno-associated virus type 1 (AAV1), which expresses a transgene at a high level for a long period of time in skeletal muscles, and AAV5 vectors, which are suitable for intradermal administration, are preferred. AAV vectors have low pathogenicity, so they are highly safe and have few problems before they can be put into practical use. In the development of a malaria vaccine, long-term immunity is also an essential requirement. AAV is a non-pathogenic virus that can express foreign genes for a long period of time. In a method for producing a recombinant adeno-associated virus, a gene encoding the amino acid sequence of CSP, a gene encoding the amino acid sequence of s25, and, if necessary, a gene encoding the amino acid sequence of a protein that can be a component of a virus particle are introduced into a plasmid for producing a publicly known (commercially available) adeno-associated virus vector, and the introduced plasmid is transduced into human fetal kidney-derived cells by a publicly known method and cultured. Next, a recombinant adeno-associated virus expressing the gene encoding the amino acid sequence of CSP and the gene encoding the amino acid sequence of s25 is obtained from the culture supernatant or the cultured cells.

[0032] (Recombinant vaccinia virus and its method of manufacture) The vaccinia virus (vector) used in the present invention is excellent not only in terms of safety but also in terms of inducing a suitable immune response in humans. Examples include the LC16 strain, LC16m8 strain, LC16mO strain, DIs strain, MVA strain, etc., and it is particularly preferable to use a vaccinia virus vector in which one or more nucleotides have been substituted, added, inserted, and / or deleted in the B5R gene, and thus the vector does not produce a normally functional B5R gene product. Vaccinia virus vectors that do not produce such normally functional B5R gene products include the LC16 strain, m8ΔB5R (LC16m8Δ strain, LC16m8Δ2 strain), mOΔB5R (LC16mOΔ strain), m8proB5RdTM, and mOproB5RdTM, which have deleted the B5R gene. Of these, it is particularly preferable to use the LC16 strain, m8ΔB5R (LC16m8Δ strain, LC16m8Δ2 strain), and mOΔB5R (LC16mOΔ strain) which have deleted the B5R gene (see International Publication No. WO 2012 / 053646). In this specification, the LC16mO strain includes not only the LC16mO strain itself, but also strains derived from the LC16mO strain, such as the LC16m8Δ2 strain, LC16m8 strain, LC16mOΔ strain, LC16m8Δ strain, and LC16m8ΔVNC110 strain (see: Vaccines (Basel). 2014 Dec;2(4):755-771.), with the LC16m8Δ2 strain being preferred. Vaccinia virus LC16m8 is a safe and effective live smallpox vaccine approved by the Ministry of Health, Labor and Welfare and has been administered to more than 100,000 infants in Japan. LC16m8Δ was developed by the inventor, Dr. Shida, and his collaborator, Dr. Kidokoro, as a vaccine vector with improved safety (Kidokoro M and Shida H., Vaccines 2014, 2,755-771;doi:10.3390 / vaccines2040755). The recombinant vaccinia virus containing a gene encoding the amino acid sequence of the malaria antigen used in the present invention can be produced by preparing a plasmid (transfer vector) to which a gene encoding the polypeptide of the malaria antigen to be introduced is linked, introducing the plasmid into a cell infected with vaccinia virus, and inducing homologous recombination in the cell. Alternatively, the virus can be produced by digesting a gene fragment encoding the polypeptide of the malaria antigen to be introduced with a restriction enzyme, directly linking it to the vaccinia virus genome digested with the same enzyme, and introducing the recombinant vaccinia virus genome into a cell infected with the virus. Plasmids that can be used in producing vaccinia virus vectors include, for example, pSFJ1-10, pSFJ2-16, pMM4, pGS20, pSC11, pMJ601, p2001, pBCB01-3,06, pTKgpt-F1-3s, pTM1, pTM3, pPR34, pPR35, pgpt-ATA18-2, pHES1-3, pJW322, pVR1, pCA, and pBHAR. The region of the gene encoding a polypeptide of a malaria antigen to be introduced is a gene region that is not essential for the life cycle of the vaccinia virus, and examples of such regions include the hemagglutinin (HA) gene, the thymidine kinase (TK) gene, the B5R gene (between the B4R and B6R genes), and the F fragment. For example, in a recombinant in which a gene encoding a polypeptide of a malaria antigen is introduced into the HA gene, the HA gene is disrupted by the introduced foreign gene and loses its function. As a result, the plaques no longer adsorb chicken red blood cells and appear white, making it easy to select the recombinant. It is preferable that the gene to be introduced is one that changes the characteristics of the virus by substituting, adding, inserting, and / or deleting one or more nucleotides, making it easy to select the recombinant. Examples of cells to be infected with a vaccinia virus vector include RK13 cells, Vero cells, HeLa cells, CV1 cells, COS cells, BHK cells, primary rabbit kidney cells, BSC-1 cells, HTK-143 cells, Hep2 cells, and MDCK cells (see International Publication No. WO 2012 / 053646). When a gene encoding a polypeptide of a malaria antigen is introduced, a suitable promoter can be operably linked upstream of the gene encoding the peptide. Such promoters are not particularly limited, but examples thereof include 7.5 promoter (sometimes referred to as P7.5), EL promoter (sometimes referred to as EL), AT1 promoter, SFJ1-10 promoter (sometimes referred to as SFJ), SFJ2-16 promoter, improved promoter of 7.5 promoter (7.5E), mPH5 promoter, 11K promoter, T7.10 promoter, CPX promoter, HF promoter, H6 promoter, T7 hybrid promoter, etc.

[0033] (Proteins that can be membrane anchor components for expressing vaccine antigen proteins on the surface of infected cells) The recombinant virus of the present invention may contain a gene encoding amino acids of a protein that can become a membrane anchor component for allowing the virus used in the present invention to express a vaccine antigen protein on the surface of infected cells. Examples of genes encoding amino acids of proteins that can be membrane anchor components for expressing vaccine antigens in infected cells using viruses used in the present invention include genes or parts of the gp64 protein (GenBank Accession No. L22858), vesicular stomatitis virus glycoprotein G (VSV-G: GenBank Accession No. M21416), herpes simplex virus glycoprotein (KOS: GenBank Accession No. K01760), human immunodeficiency virus type 1 gp120 (GenBank Accession No. U47783), human respiratory syncytial virus membrane glycoprotein (GenBank Accession No. M86651), influenza A virus hemagglutinin protein (GenBank Accession No. U38242), and the like, as well as genes or parts of the above-mentioned genes, and virus envelope proteins closely related to baculoviruses, and the like, such as the transmembrane domain of VSV-G (VSV-G TM) (SEQ ID NO: 5: Vesicular stomatitis virus) is preferred.

[0034] (Recombinant adeno-associated virus containing a gene encoding the amino acid sequence of CSP and a gene encoding the amino acid sequence of s25) The combination and order of the amino acid sequences encoded by the genes contained in the recombinant adeno-associated virus containing a gene encoding the amino acid sequence of CSP of the present invention and a gene encoding the amino acid sequence of s25 are not particularly limited, but preferably contain, from the N-terminus, s25, a hinge sequence, CSP, and the transmembrane domain of vesicular stomatitis virus glycoprotein G protein (VSV-G TM), and more preferably contain, from the N-terminus, s25, a hinge sequence, CSP, and VSV-G TM.

[0035] (Example of using recombinant viruses as vaccines) An example of a method for using the recombinant virus of the present invention as a vaccine (a prophylactic or therapeutic method) is the priming-boosting method, in which a recombinant vaccine having the following combination is administered once or multiple times to a recipient {human or animal (particularly, vertebrates including mammals, e.g., pets, horses, cows, dogs, cats, rabbits, and racehorses)} intramuscularly, intranasally, or via the airway.

[0036] The method of administration to humans can be any known administration method, and examples thereof include, but are not limited to, the following. The study will be based on GSK's Phase III clinical trial of the RTS,S / AS01 vaccine (N Engl JMed 367:2284-95, 2012). First immunization: Subcutaneous vaccination of a human subject with a recombinant vaccinia virus (1×10 5 ~1×10 10 pfu) Second immunization: intramuscular injection 6 weeks later. Recombinant adeno-associated virus (1×10 9 ~1×10 14 vg) The RTS,S / AS01 vaccine requires three to four inoculations, whereas the malaria vaccine composition of the present invention is effective with only two inoculations in principle.

[0037] (Malaria vaccine or malaria vaccine composition) Examples of combinations of the malaria vaccine or malaria vaccine composition of the present invention include, but are not limited to, the following. Vaccinia virus containing a gene encoding the amino acid sequence of CSP for prime and a gene encoding the amino acid sequence of s25, and adeno-associated virus containing a gene encoding the amino acid sequence of CSP for boost and a gene encoding the amino acid sequence of s25 Here, the gene encoding the amino acid sequence of CSP is preferably PfCSP or PvCSP, the gene encoding the amino acid sequence of s25 is preferably Pfs25 or Pvs25, the recombinant vaccinia virus is preferably m8ΔB5R (LC16m8Δ and LC16m8Δ2), and the recombinant adeno-associated virus is preferably AAV1 or AAV5. The malaria vaccine or malaria vaccine composition of the present invention has been confirmed to be suitable for the following uses as shown in the following examples. By using a vaccinia virus containing a gene encoding the amino acid sequence of CSP and a gene encoding the amino acid sequence of s25 as a prime and an adeno-associated virus containing a gene encoding the amino acid sequence of CSP and a gene encoding the amino acid sequence of s25 as a boost, it has excellent infection prevention effects and excellent malaria transmission prevention effects.

[0038] As shown in the results of the Examples below, the malaria vaccine composition of the present invention exhibited high protective effects without the use of an adjuvant in combination, and therefore an adjuvant does not need to be an essential component, but may be included. The malaria vaccine composition (including malaria vaccine) of the present invention can be administered by directly injecting a recombinant virus suspension suspended in PBS (phosphate buffered saline) or saline or the like locally (e.g., into lung tissue, liver, muscle, brain, etc.), by inhalation via the skin, nasal passage, or airway, or by intravascular administration (e.g., into an artery, vein, or portal vein).

[0039] (Methods for preventing and treating malaria) The present invention also relates to a method for preventing and treating malaria. More specifically, a recombinant vaccinia virus containing a gene encoding the amino acid sequence of CSP and a gene encoding the amino acid sequence of s25 is administered intramuscularly, nasally, or via the airways once or multiple times to a subject (a malaria patient (including a subject to be prevented before the onset of malaria)) by a prime / boost immunization method, before a recombinant adeno-associated virus containing a gene encoding the amino acid sequence of CSP and a gene encoding the amino acid sequence of s25 is administered intramuscularly, nasally, or via the airways once or multiple times to the subject.

[0040] (Characteristics of the Malaria Vaccine Composition of the Present Invention) In the present invention, when recombinant adeno-associated virus and recombinant vaccinia virus are administered to a vertebrate, the CSP protein and s25 protein displayed on the surface of recombinant adeno-associated virus and recombinant vaccinia virus-infected cells function as component vaccines. Furthermore, the CSP protein and s25 protein are produced in mammalian cells, and function as preventive or therapeutic agents for malaria infection due to their immunostimulatory effect.

[0041] Malaria parasites injected from a mosquito reach the liver in the bloodstream, invade and grow. A humoral immune response is effective against sporozoite-stage parasites before they reach the liver, while a cellular immune response is necessary for liver-stage parasites after they invade the liver. After one week, they leave the liver and progress to the erythrocytic stage. Gametocytes, or gametocytes, are born at a certain frequency from the erythrocytic stage, and when a mosquito sucks the blood from these gametocytes, a new mosquito stage begins. The LC16m8Δ / AAV vaccine of the present invention targets the sporozoite to liver stage and the mosquito stage, and is designed to effectively induce a hybrid response of both humoral and cellular immunity against the sporozoite / liver stage surface antigen CSP and the mosquito stage surface antigen s25. As shown in the results of the following examples, this is a bivalent vaccine that exerts an "infection protection effect" and a "transmission prevention effect".

[0042] (Malaria vaccine composition that confers lifelong immunity) As shown in the results of the examples below, the malaria vaccine composition of the present invention can confer lifelong immunity to a recipient by receiving a combined vaccination of a prime recombinant vaccinia virus and a boost recombinant adeno-associated virus two or more times (two, three, three or more than three, four, four or more than four, five or five or more than five times). More specifically, the recipient may maintain immune status for 1 year, 5 years, 10 years, 15 years, 20 years, 30 years or 50 years.

[0043] (Life cycle of Plasmodium vivax malaria and vaccine target antigens) The characteristic life cycle of P. vivax is a dormant stage in the liver called hypnozoite, which emerges from the liver after several months to several years, causing recurrence of malaria. The current malaria specific drug artemisin is ineffective against hypnozoites. The only drug, primaquine, has problems such as contraindications, side effects, and the emergence of resistant parasites, and its use is restricted. There have been serious cases reported in which delayed diagnosis and treatment led to severe illness or death. Combined with the spread of the disease in Africa, the importance of vaccine development is comparable to that of falciparum malaria. As a result, in the vaccine composition of the present invention, the vaccine target antigens are the sporozoite stage PvCSP antigen as an "infection protection vaccine" and the mosquito ookine stage Pvs25 antigen as a "transmission blocking vaccine" that prevents infection from infected individuals to mosquitoes.

[0044] The present invention will be described in detail below using examples, but the technical scope of the present invention is not limited to the following examples.

[0045] All animal care and handling procedures were approved by the Kanazawa University Animal Health Review Committee. All animal experiments were conducted appropriately to minimize animal suffering. EXAMPLES

[0046] In this example, the subject was falciparum malaria. The details are as follows. Materials and Methods (Construction of pVR1-Pf(P7.5-s25-CSP)-HA-VV plasmid) The transmembrane domain of the vsv-g gene, which acts as a cell membrane expression anchor, is located downstream of the pfcsp gene in pENTR-CAG-sPfCSP2-G2-sWPRE. The vsv-g gene contains the vaccinia virus transcription terminator “TTTTTCT” (T 5 NT) sequence is present. To replace the “TTTTTCT” sequence with the “TTCTTCT” codon sequence encoding the same amino acid, a vsv-g gene having Pst I and HindIII sites at both ends and the “TTCTTCT” sequence was artificially synthesized, cleaved with PstI / Hind III, and then substituted with the vsv-g gene of pENTR-CAG-sPfCSP2-G2-sWPRE cleaved with Pst I / Hind III to produce pENTR-CAG-sPfCSP2-G2-sWPRE-Nhe. In order to insert the open reading frame and wpre sequence in pENTR-CAG-sPfCSP2-G2-sWPRE-Nhe into the pVR1 transfer vector, a recombinant plasmid pUC57-Simple-sPfCSP2-VV with Age I and Mun I sites at both ends was prepared. That is, pUC57-Simple-VV-WPRE was prepared by artificially synthesizing the wpre sequence with Age I and Mun I sites at both ends and an Nco I site just before it, and then the open reading frame and wpre sequence of pENTR-CAG-sPfCSP2-G2-sWPRE-Nhe cut with Nco I were placed in the Nco I site of pUC57-Simple-VV-WPRE to give pUC57-Simple-sPfCSP2-VV. The m8Δ transfer vector pVR1 was cleaved with XmaI / EcoRI, and the open reading frame and wpre sequence of pUC57-Simple-sPfCSP2-VV cleaved at AgeI / MunI sites were placed at the same sites to create pVR1-Pf(P7.5-CSP)-HA-VV. To remove the WPRE sequence from pVR1-Pf(P7.5-CSP)-HA-VV, the vsv-g gene with XmaI / FseI sites at both ends was amplified by PCR. The PCR primers used were pVSV-G-F1 (CACCCGGGCGTTCGAACATCCTCACATTCAAGAC) and pVSV-G-R7 (TTTTTGGCCGGCCTTACTTTCCAAGTCGGTTCATC). The amplified gene product was inserted into pCR2.1-TOPO vector and digested with Xma I / Fse I. The digested fragment containing the vsv-g gene was inserted into the Xma I / Fse I site of pVR1-sPfCSP2-VV. As a result, pVR1-Pf(P7.5-CSP)-WPRE(-)-HA-VV, in which the wpre sequence had disappeared, was created. pVR1-Pf(P7.5-CSP)-WPRE(-)-HA-VV was used as a transfer vector for the construction of m8Δ-Pf(P7.5-CSP)-G-WPRE(-)-HA (hereafter referred to as m8Δ-Pf(P7.5-CSP)-HA) virus. pVR1-Pf(P7.5-s25-CSP)-HA-VV was constructed by inserting a DNA fragment obtained by cleaving pENTR-CAG-sPfs25-sPfCSP-G2-sWPRE with EcoRI / XmaI into the EcoRI / XmaI site of pVR1-Pf(P7.5-CSP)-WPRE(-)-HA-VV. pVR1-Pf(P7.5-s25-CSP)-HA-VV was used as a transfer vector for the construction of m8Δ-Pf(P7.5-s25-CSP)-HA virus.

[0047] (Construction of vaccinia virus) Method for producing recombinant vaccinia virus m8Δ-Pf(P7.5-s25-CSP)-HA virus After infecting BHK cells (baby hamster cells) with canarypox, an avian poxvirus, the above plasmid [pVR1-Pf(P7.5-s25-CSP)-HA-VV)] and the above vaccinia virus genome were co-transfected by lipofection. The resulting progeny virus was infected into a monolayer culture of RK13 cells to produce plaques, and HA(-) plaques were collected by the HA test using chicken red blood cells, and the recombinant vaccinia virus was isolated.

[0048] (Construction of recombinant adeno-associated virus and recombinant adenovirus) Methods for producing recombinant adeno-associated virus AAV1-Pf(s25-CSP) and recombinant human adenovirus type 5 AdHu5-Pf(s25-CSP) AAV1-Pf(s25-CSP) virus and AdHu5-Pf(s25-CSP) virus were prepared with reference to the literature: “Sci Rep 8, 3896, doi:10.1038 / s41598-018-21369-y (2018)”, “Front Immunol 10, 730, doi:10.3389 / fimmu.2019.00730 (2019)” and “FrontImmunol 10, 2412, doi:10.3389 / fimmu.2019.02412 (2019)”.

[0049] (Immunoblotting) Human embryonic kidney cells (HEK293T cells) were seeded in 48-well plates and 24 hours later, m8Δ-Pf(P7.5-s25-CSP)-HA and m8Δ-Pf(P7.5-CSP)-HA were infected with 1 multiplicity of infection (MOI) or 10 5The cells were infected with AAV1-Pf(s25-CSP) and AAV1-PfCSP vaccines. 24 hours after infection, the cell supernatant was removed, washed once with PBS, and then 50 μl / well of cell lysate (Laemmli buffer) was added, cut with an insulin syringe with a 29G needle, boiled at 95°C for 5 minutes, and subjected to immunoblotting. A reduced sample was prepared by adding 2-mercaptoethanol to the cell lysate, and a non-reduced sample was prepared by not adding 2-mercaptoethanol. Electrophoresis was performed on a 10% sodium dodecyl sulfate polyacrylamide (SDS-PAGE) gel. The samples were electrophoretically developed on an Immobilon FL® PVDF membrane (Merck Millipore). The membrane was blocked for 1 hour with 5% skim milk in PBS containing 0.1% Tween 20 (PBS-T). The PVDF membranes to which the reduced samples were transferred were incubated with anti-PfCSP antibody 2A10 monoclonal antibody (mAb) diluted 1:10,000 in 5% skim milk. The PVDF membranes to which the non-reduced samples were transferred were incubated with anti-Pfs25 antibody 4B7 mAb diluted 1:10,000 in 5% skim milk. After washing with PBS-T, the blots were probed with goat anti-mouse secondary antibody conjugated with IRDye 800 (Rockland Immunochemicals) diluted 1:20,000 in 5% skim milk. The membranes were visualized using an Odyssey infrared imager (LI-COR). Molecular weight predictions were performed using the ExPASy server.

[0050] {Indirect fluorescent assay (IFA) using HEK293T cells} HEK293T cells were seeded on 8-well-chamber slides and infected with m8Δ-Pf(P7.5-s25-CSP)-HA vaccine at MOI=0.02 24 hours after infection. 24 hours after infection, the cell supernatant was removed, washed with PBS, and fixed in formalin (non-permeabilization buffer) at room temperature for 20 minutes. The cells were washed twice for 2 minutes with PBS and blocked with 10% Normal Goat Serum (NGS) (Sigma-Aldrich Co. LLC) / PBS for 1 hour. Then, 4B7 labeled with Alexa Fluor 594 and 2A10 labeled with Alexa Fluor 488 were diluted 100-fold and 200-fold, respectively, in 10% NGS / PBS, added to each well, and left in the dark for 1 hour. After washing five times for 2 min with PBS-T, sections were mounted with Vectashield containing 4,6'-diamidino2-phenylindole (DAPI; Vector Laboratories). The slides were visualized under an LSM710 inverted laser scanning microscope (Carl Zeiss).

[0051] (Flow cytometry using HEK293T cells) 24 hours after seeding HEK293T cells on a 24-well plate, they were infected with m8Δ-Pf(P7.5-s25-CSP)-HA and m8Δ-Pf(P7.5-CSP)-HA vaccines at an MOI of 5. 24 hours after infection, the cells were harvested, the cell solution was replaced with 1% FBS / PBS solution, and a 100-fold diluted solution of 4B7 labeled with fluorescein and 2A10 labeled with allophycocyanin was added to the cells and left in the dark for 1 hour. The cells were washed with 1% FBS / PBS solution, fixed with 4% paraformaldehyde solution, and then incubated with FACS Verse. TM Fluorescence intensity was quantified using a Flow Cytometer (BD).

[0052] (Mammals and protozoa used) The mammals and protozoa used are as follows: Mice: 6-week-old female BALB / c mice and 6-week-old female ICR mice were obtained from Japan SLC Co., Ltd. and used after 1 week. Mouse malaria parasite: Transgenic mouse malaria parasite {PfCSP expression P. berghei (Pb)PfCSP-Tc / Pb} (described in Insect Mol. Biol. 2013, 22:41) infected with Anopheles mosquito ( Anopheles stephensi The salivary glands of mice (SDA500 strain) were dissected and recombinant Plasmodium falciparum sporozoites were isolated. After homogenization with RPMI 1640 Medium (Gibco, Life Technologies), the mixture was centrifuged to collect the supernatant, and the number of sporozoites was counted under an optical microscope. The number of sporozoites was determined to be 1,000, 2,500, or 10,000 sporozoites per body.

[0053] (Vaccination) Balb / c mice (7-week-old female) purchased from SLC were used, with 10 mice per group. The m8Δ vaccine (m8Δ-Pf(P7.5-CSP)-HA and m8Δ-Pf(P7.5-s25-CSP)-HA) was 1 × 10 7 pfu / 100 μL / mouse, AAV1 vaccine (AAV-PfCSP and AAV-Pf(s25-CSP)) was 1 × 10 10 vg / 100 μL / mouse, AdHu5 vaccine (AdHu5-s25-CSP) was 5 × 10 7 The vaccines were diluted with PBS to pfu / 100 μL / mouse. Each m8Δ vaccine was administered to the base of the tail using a bifurcated needle (ts), and the AAV1 or AdHu5 vaccine was administered to the left thigh muscle (im) using an insulin syringe with a 29G needle. Immunization was performed using the heterologous prime-boost method, with the m8Δ or AdHu5 vaccine as the prime immunization (Prime), followed by a boost with the AAV1 vaccine 6 weeks later.

[0054] {Enzyme-linked immunosorbent assay (ELISA)} Anti-PfCSP antibody titers were quantified by ELISA as described previously (Iyori M, Yamamoto DS, Sakaguchi M, Mizutani M, Ogata S, Nishiura H., et al. DAF-shielded baculovirus-vectored vaccine enhances protection against malaria sporozoite challenge in mice. MalarJ (2017) 16(1):390. doi:10.1 186 / s12936-017-2039-x.). Regarding the anti-Pfs25 antibody titer, the Pfs25 antigen was constructed using the same pfs25 gene used in the m8Δ and AAV1 vaccines and produced using the wheat germ cell-free (WGCF) protein expression system (CellFreeSciences). {Miura K, Takashima E, Deng B, Tullo G, Diouf A, Moretz SE., et al. Functional comparison of Plasmodium falciparum transmission-blocking vaccine candidates by the standard membrane-feeding assay. Infect Immun (2013)81(12):43 77. doi:10.1128 / IAI.01056-13}. Costar® EIA / RIA polystyrene plates (Corning Inc) precoated with 400 ng / well PfCSP or 200 ng / well Pfs25 were blocked with 1% bovine serum albumin (BSA) in PBS and then incubated with serially diluted serum samples, negative controls, and positive controls (mAb 2A10 or mAb 4B7, respectively). Anti-mouse IgG conjugated with horseradish peroxidase (HRP) (Bio-Rad lab, Inc) was used as the secondary antibody. After washing, ABTS (2'-azino-bis (3-ethylbenzothiazoline-6-sulphonicacid) (SIGMA) and H 2 O 2Absorption was detected at 414 nm with citrate-phosphate buffer supplemented with 100 μg / mL of ...

[0055] {Challenge infection test} (Sporozoite challenge test) Infected with PfCSP-Tc / Pb Anopheles stephensi Sporozoites were extracted from the salivary glands of Anopheles mosquitoes and suspended in RPMI-1640 medium (Gibco, Life Technologies). Mice boosted with AAV1-Pf(s25-CSP) vaccine were given 1,000 or 2,500 sporozoites in 100 μL of medium via the tail vein 26 days later. Infection was monitored from days 4 to 14 by Giemsa staining of thin blood smears obtained from the tail. Protective efficacy was calculated using the number of days after sporozoite challenge at which parasitemia reached 1% (1% parasitemia) and the sterile protective efficacy. Sterile protective efficacy was defined as the complete absence of parasitemia 14 days after challenge. The complete protection efficacy was calculated using the following formula: % complete protection efficiency = [1 - (number of infected mice in vaccine group / total number of mice in vaccine group) / (number of infected mice in non-immunized group / total number of mice in non-immunized group)] x 100

[0056] (Challenge test by infected mosquito blood-sucking and multiple challenge test) Each mouse was allowed to feed on blood for 20 min with seven Anopheles mosquitoes infected with PfCSP-Tc / Pb, after which the salivary glands of all mosquitoes were dissected and repeatedly fed on until the number of sporozoite-positive mosquitoes was 3 or more (3 ≤ 7 mosquitoes per meal). Protected mice were challenged with 2,500 sporozoites on day 86 and 10,000 sporozoites on day 100 after the last immunization. The 1% parasitemia and complete protection efficacy were calculated at each challenge.

[0057] {Propagation Blocking Test} (Direct Blood Feeding Test) Mice boosted with the AAV1-Pf(s25-CSP) vaccine were intraperitoneally administered 200 μL of 6 mg / ml phenylhydrazine solution (Sigma) 22 days later, and 1 × 10 6 Pb-Pfs25DR3-infected erythrocytes were intraperitoneally administered to the mice. Three days later, the mice were fed with approximately 60 starving Anopheles gambiae mosquitoes. The midguts of the fed mosquitoes were dissected 10 to 12 days after feeding, and the number of oocysts in the midguts was quantified. The propagation inhibitory activity (TRA) was calculated using the following formula: % Oocyst formation inhibition rate (transmission inhibition activity: TRA) = {1 - (number of oocysts of mosquitoes that fed on vaccine group mice) / (average number of oocysts of mosquitoes that fed on control group mice)} x 100. The propagation blocking activity (TBA) was calculated using the following formula: % Oocyst non-formation rate (transmission blocking activity: TBA) = [1 - (number of mosquitoes that fed on vaccine group mice and did not form oocysts / total number of mosquitoes that fed on vaccine group mice) / (number of mosquitoes that fed on control group mice and did not form oocysts / total number of mosquitoes that fed on control group mice)] x 100.

[0058] (statistical analysis) In the test of protective effect against infection, the number of days to reach 1% parasitemia was compared to calculate the significance of differences between each immunization group and the negative control group using the Log-Rank (Mantel-Cox) test. The complete protective effect was calculated using Fisher's exact test. In the test of IgG antibody titers, the Mann-Whitney U test was used to test between two groups, and one-way analysis of variance with Dunnett's multiple comparison test was used to test between three or more groups. In the test of IgG antibody titers in peripheral blood collected periodically, the significance of differences between each immunization group was calculated using repeated measures two-way analysis of variance with Sidak's multiple comparison test. In the test of transmission-blocking effect, the TRA was calculated using the Mann-Whitney U test, and the TBA was calculated using Fisher's exact test. In all tests, a P value of < 0.05 was considered significant. Statistical analysis was performed using Prism version 8 (GraphPad Software Inc., La Jolla, CA).

[0059] Confirmation of vaccine construction In this embodiment, the hinge G 6 We constructed a bivalent vaccine based on LC16m8Δ (m8Δ) and adeno-associated virus type 1 (AAV1) expressing Pfs25 and PfCSP as fusion proteins using an S linker ( Fig. 1 a). Western blotting confirmed that both viral vectors were able to express the Pfs25-PfCSP fusion protein (Fig. 1b) and further confirmed cell surface expression of PfCSP and Pfs25 (Fig. 5).

[0060] Confirmation of infection prevention effect The protective effect of vaccination with m8Δ / AAV1-Pf(s25-CSP) was determined by complete protection against PfCSP-Tc / Pb sporozoites in Balb / c mice. All 10 control mice were challenged after intravenous inoculation with 1,000 sporozoites, whereas 10 of 10 mice (100%, p<0.0001) in the m8Δ / AAV1-Pf(s25-CSP) group and 9 of 10 mice (90%, p=0.0001) in the m8Δ / AAV1-PfCSP group were completely protected (Fig. 1c). Both the m8Δ / AAV1-Pf(s25-CSP) vaccine and the m8Δ / AAV1-PfCSP vaccine induced significantly higher anti-PfCSP antibody responses as a booster effect compared to a single vaccination with the m8Δ vaccine (Fig. 1d, p<0.0001). In addition to the anti-PfCSP antibody titers, the m8Δ / AAV1-Pf(s25-CSP) vaccine also induced anti-Pfs25 antibody responses with a booster effect (Fig. 1d, p<0.0001). Compared to inbred Balb / c mice, all of which express the same MHC haplotype, ICR mice from a closed colony express different MHC haplotypes. To test whether the m8Δ / AAV1-Pf(s25-CSP) vaccine could be effective against such heterogeneity, we vaccinated ICR mice with the vaccine. We found that vaccination completely protected 9 of 10 mice (90%, p=0.0001) against 1,000 sporozoites (Fig. 1e) and induced anti-PfCSP and anti-Pfs25 antibody responses with boosting effect (Fig. 1f, p<0.0001). From the above, it was confirmed that the m8Δ / AAV1-Pf(s25-CSP) vaccine of the present invention exerts a complete infection protection effect (100%) superior to the m8Δ / AAV1-PfCSP (90%) vaccine, which is a vaccine that expresses PfCSP alone, even though it can express the Pfs25 antigen gene in addition to PfCSP. Furthermore, the m8Δ / AAV1-Pf(s25-CSP) vaccine was also confirmed to be significantly effective in ICR mice with diverse MHC haplotypes, for which the efficacy of known vaccines (e.g., AdHu5 / AAV1-Pf(s25-CSP)) has not been confirmed.

[0061] The protective efficacy of m8Δ / AAV1-Pf(s25-CSP) was compared with AdHu5 / AAV1-Pf(s25-CSP), an adenovirus-based vaccine previously shown to provide complete protection and long-lasting antibody responses. 2,500 sporozoites (high dose) were used in the challenge study. In a short-term (29 days) sporozoite challenge study after the final immunization with the vaccine, 10 out of 10 mice (100%, p<0.0001) in the m8Δ / AAV1-Pf(s25-CSP) group were completely protected, whereas 7 out of 10 mice (70%, p=0.0031) in the AdHu5 / AAV1-Pf(s25-CSP) group were completely protected (Figure 2a). In a sporozoite challenge test conducted long-term (102 days) after the final immunization with the vaccine, 9 out of 10 mice (90%, p = 0.0001) in the m8Δ / AAV1-Pf(s25-CSP) group were completely protected from infection, whereas only 2 out of 7 mice (29%, p = 0.1544) in the AdHu5 / AAV1-Pf(s25-CSP) group were completely protected from infection (Figure 2b). When we observed the anti-PfCSP and anti-Pfs25 antibody responses of the fully protected mice over a long period of time, both antibody responses were maintained significantly higher in the m8Δ / AAV1-s25-CSP group than in the AdHu5 / AAV1-Pf(s25-CSP) group up to 210 days after the final immunization (Fig. 2c-d). As a result, the prevalence rate of infection after vaccination was reduced from 71% (100%-29%) to 10% (100%-90%), a remarkable effect of approximately seven times the original rate (71% ÷ 10%), and the significant effect of a significantly high antibody response that persisted for a long period of time was also confirmed.

[0062] Confirmation of propagation blocking effect The transmission blocking effect of the vaccine was confirmed at short (37 days) and long (236 days) days after the final immunization. The TRA and TBA at the short-term were 99.99% (p<0.0001) and 97.94% (p < 0.0001), respectively (Figure 3a). The TRA and TBA at the long-term were 97.16% (p<0.0001) and 60.08% (p < 0.0001), respectively (Figure 3b).

[0063] - Confirmation of infection prevention effect against repeated infections Since it is common for people living in malaria endemic areas to be infected with malaria parasites multiple times in their lifetime, it is important to develop a vaccine that is effective against multiple exposures to malaria parasites. We confirmed whether the vaccine of the present invention exhibits a protective effect against infection in a multiple sporozoite challenge test. In Balb / c mice, all 10 control mice were infected after blood meal challenge with PfCSP / Pb sporozoite-infected mosquitoes, whereas 10 of 10 mice (100%, p<0.0001) in the m8Δ / AAV1-s25-CSP group were completely protected from infection 26 days after the last immunization (Fig. 4a). The same mice were intravenously challenged with 2,500 and 10,000 sporozoites, respectively, on days 86 and 100 after the last immunization. All vaccinated mice (100%, p<0.0001) were completely protected from infection, whereas all control mice were infected (Fig. 4b, c). Five randomly selected mice were examined for the effect of blocking transmission 276 days after the final immunization. The TRA and TBA were 99.43% (p<0.0001) and 85.02% (p<0.0001), respectively (FIG. 4d). Multiple exposure to PfCSP-Tc / Pb sporozoites significantly increased the anti-PfCSP antibody titer in peripheral blood to 1,280,500 on day 175 compared to 631,750 on day 25 after the final immunization (Fig. 4e, p = 0.0279). On the other hand, the anti-Pfs25 antibody titer was 721,540 on day 25 after the final immunization and significantly decreased to 194,507 on day 175 (Fig. 4e, p = 0.0044). The anti-Pfs25 antibody titer decreased to 68,195 on day 272, just before the transmission-blocking experiment (Fig. 4e, p < 0.0001), but the high transmission-blocking effect was maintained (Fig. 4d). EXAMPLES

[0064] In this example, Plasmodium vivax was the target. Details are as follows.

[0065] Materials and Methods (Construction of pVR1-Pv(s25-CSP-S / P)-HA-VV plasmid) There are two genotypes of Plasmodium vivax that are prevalent worldwide (Salvador strain VK210 and Papua New Guinea strain VK247), and there is a large difference in the central repeat sequence between the PvCSP genes. There are areas where they are infected together, so it is necessary to design a vaccine that is effective against the two strains. The LC16m8Δ / AAV P. vivax vaccine was designed to accommodate this genetic polymorphism. The fusion antigen gene Pv(s25-CSP-S / P) of P. vivax was cloned into pUC57-Simple-Pv(s25-CSP-S / P) and artificially synthesized by Funakoshi Co., Ltd. The DNA gene sequence is shown in SEQ ID NO: 8 (Pv(s25-CSP-S / P)), and the amino acid sequence is shown in SEQ ID NO: 9 (Pv(s25-CSP-S / P)). The structure is also shown in Figure 7a. The structure of Pv(s25-CSP-S / P) was created by ligating a DNA sequence encoding a hinge (GlyGlyGlyGlyGlyGlySer) to the 3' end of the Pvs25 gene of Plasmodium vivax, and then ligating the PvCSP gene derived from the VK210 Salvador strain. In addition, three repeats of the PvCSP gene derived from the VK247 Papua New Guinea strain were inserted. The m8Δ transfer vector pVR was cleaved with EcoR I / Xma I, and the open reading frame of pUC57-Simple-Pv(s25-CSP-S / P) cleaved at the EcoR I / Xma I site was placed at the same site, and the resulting vector was named pVR1-Pv(P7.5-s25-CSP-S / P)-HA-VV. pVR1-Pv(P7.5-s25-CSP-S / P)-HA-VV was used as a transfer vector for generating m8Δ-Pv(P7.5-s25-CSP-S / P)-HA virus.

[0066] (Construction of vaccinia virus) Method for producing recombinant vaccinia virus m8Δ-Pv(P7.5-s25-CSP-S / P)-HA virus (Figure 7b) After infecting BHK cells (baby hamster cells) with canarypox, the avian poxvirus, the above-mentioned plasmid pVR1-Pv(P7.5-s25-CSP-S / P)-HA-VV and the above-mentioned vaccinia virus genome were co-transfected by lipofection. The resulting progeny virus was infected into a monolayer culture of RK13 cells to produce plaques, and HA(-) plaques were collected by the HA test using chicken red blood cells, and the recombinant vaccinia virus was isolated.

[0067] (Construction of recombinant adeno-associated virus) Method for producing recombinant adeno-associated virus AAV1-Pv(s25-CSP-S / P) virus (Figure 7c) The AAV1-Pv(s25-CSP-S / P) virus was prepared with reference to the literature, “Sci Rep 8, 3896, doi:10.1038 / s41598-018-21369-y (2018)” and “Front Immunol 10, 730, doi:10.3389 / fimmu.2019.00730 (2019).”

[0068] (Immunoblotting) Human embryonic kidney cells (HEK293T cells) were seeded in 48-well plates and 24 hours later, infected with m8Δ-Pv(P7.5-s25-CSP-S / P)-HA at a multiplicity of infection (MOI) of 1 or with an MOI of 10 5The cells were infected with AAV1-Pv(s25-CSP-S / P) vaccine. 24 hours after infection, the cell supernatant was removed, washed once with PBS, and then 50 μl / well of cell lysate (Laemmli buffer) was added, cut with an insulin syringe with a 29G needle, boiled at 95°C for 5 minutes, and subjected to immunoblotting. A reduced sample was prepared by adding 2-mercaptoethanol to the cell lysate, and a non-reduced sample was prepared by not adding 2-mercaptoethanol. Electrophoresis was performed on a 10% sodium dodecyl sulfate polyacrylamide (SDS-PAGE) gel. The sample was electrophoretically developed on an Immobilon FL® PVDF membrane (Merck Millipore). The membrane was blocked for 1 hour with 5% skim milk in PBS containing 0.1% Tween 20 (PBS-T). The PVDF membranes to which the reduced samples were transferred were incubated with anti-PvCSP-Sal 2F2 monoclonal antibody (mAb) diluted 1:10,000 in 5% skim milk (Figure 8a) or anti-PvCSP-PNG 2E10E9 mAb diluted 1:1,000 in 5% skim milk (Figure 8b). The PVDF membranes to which the non-reduced samples were transferred were incubated with anti-Pvs25 NHH10 mAb diluted 1:2,000 in 5% skim milk. After washing with PBS-T, the blots were probed with goat anti-mouse secondary antibody labeled with IRDye 800 (Rockland Immunochemicals) diluted 1:20,000 in 5% skim milk. The membranes were visualized using an Odyssey infrared imager (LI-COR). Molecular weight predictions were performed using the ExPASy server.

[0069] {Indirect fluorescent assay (IFA) using HEK293T cells} HEK293T cells were seeded on 8-well chamber slides, and 24 hours later, the m8Δ-Pv(P7.5-s25-CSP-S / P)-HA vaccine was administered at an MOI of 0.04 or at an MOI of 10 5The cells were infected with the AAV1-Pv(s25-CSP-S / P) vaccine. 24 hours after infection, the cell supernatant was removed, washed with PBS, and fixed in formalin (non-permeabilization buffer) at room temperature for 20 minutes. The cells were washed twice for 2 minutes with PBS, and blocked with 10% Normal Goat Serum (NGS) (Sigma-Aldrich Co. LLC) / PBS for 1 hour. Then, the cells were incubated with 10% NGS / PBS for 1 hour with 2F2 labeled with R-Phycoerythrin LK23, 2E10E9 labeled with Fluorescein LK01, and HiLyte Flour labeled with Fluorescein LK01. TM Anti-Pvs25 polyclonal antibodies labeled with 647 LK13 were diluted 1000-fold and added to each well and left in the dark for 1 hour. After washing five times for 2 minutes with PBS-T, the wells were mounted with Vectashield containing 4,6'-diamidino2-phenylindole (DAPI; Vector Laboratories). The slides were visualized with an LSM710 inverted laser scanning microscope (Carl Zeiss) (Figure 8c).

[0070] (Mammals and protozoa used) The mammals and protozoa used are as follows: Mice: BALB / c female mice (6 weeks old) were obtained from Japan SLC Co., Ltd. and used after 1 week. Mouse malaria parasite: Transgenic mouse malaria parasite {PvCSP-Sal expression P. berghei (Pb)PvCSP-Sal} (Sal / Pb; described in Infect Immun. 2014, 82. 10) infected with Anopheles mosquitoes ( Anophelestephensi The salivary glands of mice (SDA500 strain) were dissected and recombinant Plasmodium falciparum sporozoites were isolated. After homogenization with RPMI 1640 Medium (Gibco, Life Technologies), the mixture was centrifuged to collect the supernatant, and the number of sporozoites was counted using an optical microscope. The number of sporozoites was adjusted to 1,000 per body.

[0071] (Vaccination) Balb / c mice (7-week-old female) purchased from SLC were used, with 10 mice per group. The m8Δ vaccine [m8Δ-Pv(P7.5-s25-CSP-S / P)-HA] was 1 × 10 7 pfu / 10 μl / mouse, AAV1 vaccine [AAV1-Pv(s25-CSP-S / P)] was 1 × 10 10 The vaccines were diluted with PBS to a concentration of vg / 100 μL / mouse. Each m8Δ vaccine was administered to the base of the tail of a mouse using a bifurcated needle (ts), and the AAV1 vaccine was administered to the left thigh muscle (im) using an insulin syringe with a 29G needle. Immunization was performed using the heterologous prime-boost method, with the m8Δ vaccine as the prime immunization (Prime) and the AAV1 vaccine as the boost immunization 6 weeks later.

[0072] {Enzyme-linked immunosorbent assay (ELISA)} Anti-PvCSP-Sal and Pvs25 antibody titers were quantified by ELISA as described previously {Infect Immun. 2014, 82.10. doi: 10.1128 / IAI.02040-14}. Costar® EIA / RIA polystyrene plates (Corning Inc.) precoated with 200 ng / well PvCSP-Sal or 400 ng / well Pvs25 were blocked with 1% bovine serum albumin (BSA) in PBS and then incubated with serially diluted serum samples, negative controls, and positive controls (mAb 2A10 or mAb NHH10, respectively). Anti-mouse IgG conjugated with horseradish peroxidase (HRP) (Bio-Rad lab, Inc.) was used as the secondary antibody. After washing, ABTS (2'-azino-bis (3-ethylbenzothiazoline-6-sulphonicacid) (SIGMA) and HRP were added to the plate. 2 O 2Absorption was detected at 414 nm with citrate-phosphate buffer containing 0.15 U each. Endpoint titers were expressed as the reciprocal of the last dilution that gave an optical density at 414 nm 0.15 U above the negative control value (<0.1). All mice used in the experiment were seronegative before immunization. Figure 9a shows anti-PvCSP-Sal antibody titers, and Figure 9b shows anti-Pvs25 antibody titers.

[0073] {Challenge infection test} (Sporozoite challenge test) Infected with PvCSP-Sal / Pb Anopheles stephensi Sporozoites were extracted from the salivary glands of Anopheles mosquitoes and suspended in RPMI-1640 medium (Gibco, Life Technologies). Mice boosted with AAV1-Pv(s25-CSP-S / P) vaccine were given 1,000 sporozoites in 100 μL of medium via the tail vein 28 days later. Infection was monitored from day 4 to day 14 by Giemsa staining of thin blood smears obtained from the tail. Protective efficacy was calculated using the number of days after sporozoite challenge at which parasitemia reached 1% (1% parasitemia) and the sterile protective efficacy. Sterile protective efficacy was defined as the complete absence of parasitemia 14 days after challenge (Fig. 10). The complete protection efficacy was calculated using the following formula: % complete protection efficiency = [1 - (number of infected mice in vaccine group / total number of mice in vaccine group) / (number of infected mice in non-immunized group / total number of mice in non-immunized group)] x 100

[0074] {Propagation Blocking Test} Blood was collected from a patient with P. vivax and blood smears were prepared to confirm the presence of gametocytes. The blood was centrifuged at 2,000 rpm for 5 minutes and the plasma was removed using a Pasteur pipette. RPMI1640 (equivalent to the volume of the concentrated blood) was added and gently mixed with the blood. Five 1.5 mL tubes were filled and each was identified as follows (Control, 1:5, 1:10, 1:50). Three to five day old female mosquitoes that had been reared on sugar solution alone were separated (approximately 120 or 200 mosquitoes) (sugar was removed approximately 24 hours before the experiment) and placed in containers. The infection experiment system for the Direct Membrane Feeding Assay (DMF) consisted of a 37°C water bath and a water circulation system connected to blood samples. A well-stretched piece of parafilm (5 cm × 5 cm) was wrapped around a 500 μl glass feeder, and the glass feeder, hose, and water pump were placed in the aquarium to assemble the circuit. The last hose was checked to ensure that the water flow was continuous. The feeder was fixed with tape to each plastic pot containing female mosquitoes (each pot was clearly marked as a control or treatment group). A sample of blood was added to each feeder using a glass pipette, and the mosquitoes were allowed to fully feed for 30-120 minutes. After feeding, only the fed female anopheles were transferred to a larger cage, raised in 10% sugar solution, and waited in the infection room until dissection. Seven days after infection, the female mosquitoes were removed from the infection room, taken to the dissection room, removed from the cage using a trap, and left in a freezer at -20°C for 3-5 minutes. After sleep, the mosquito was placed in a petri dish containing 70% alcohol and immediately washed with 1x PBS. The midgut was extracted from the mosquito abdomen using a microscope. Then, one drop of 2% mercurochrome dye was dropped into the midgut, and after staining for 5-8 minutes, the oocysts were counted under a microscope (Figure 11). TRA (Transmission reducing activity) was calculated using the following formula: TRA (%) = 100 × {1-(average number of oocysts in the test group / average number of oocysts in the control group)} TBA (Transmission blocking activity) was calculated using the following formula: TBA (%) = 100 × {1-(number of mosquitoes with confirmed oocysts in the test group / number of mosquitoes with confirmed oocysts in the control group)}

[0075] (statistical analysis) In the test of protective effect against infection, the number of days to reach 1% parasitemia was compared to calculate the significance of differences between each immunization group and the negative control group using the Log-Rank (Mantel-Cox) test. The complete protective effect was calculated using Fisher's exact test. In the test of IgG antibody titers, the Mann-Whitney U test was used to test between two groups, and one-way analysis of variance with Dunnett's multiple comparison test was used to test between three or more groups. In the test of IgG antibody titers in peripheral blood collected periodically, the significance of differences between each immunization group was calculated using repeated measures two-way analysis of variance with Sidak's multiple comparison test. In the test of transmission-blocking effect, the TRA was calculated using the Mann-Whitney U test, and the TBA was calculated using Fisher's exact test. In all tests, a P value of < 0.05 was considered significant. Statistical analysis was performed using Prism version 8 (GraphPad Software Inc., La Jolla, CA).

[0076] Confirmation of vaccine construction In this embodiment, the hinge G 6 We constructed a protective and transmission-blocking vaccine based on m8Δ and AAV expressing Pvs25 and PvCSP-S / P as a fusion protein using an S linker (Figure 7). Western blotting confirmed that both viral vectors were able to express the Pv(s25-CSP-S / P) fusion protein (Fig. 8a, b ) and further confirmed the cell surface expression of PvCSP-S / P (Fig. 8c ).

[0077] Confirmation of infection prevention effect Vaccination with m8Δ / AAV1-Pv(s25-CSP-S / P) induced high levels of anti-PvCSP-Sal (Fig. 9a) and anti-Pvs25 (Fig. 9b) antibody titers. Protective efficacy was determined by complete protection against PvCSP-Sal / Pb sporozoites (1,000 mice administered intravenously). In Balb / c mice, 9 out of 10 mice (90%, p<0.0001) were completely protected from infection by m8Δ / AAV1-Pv(s25-CSP-S / P). All unvaccinated control mice were infected (Fig. 10).

[0078] Confirmation of propagation blocking effect The transmission-blocking effect of the vaccine was confirmed 28 days after the final immunization. The TRA and TBA were 93.0% and 73.0%, respectively (FIG. 11). EXAMPLES

[0079] In this example, the effect of AAV5 as a booster vaccine was shown, and the effect was compared with that of AAV1 used in Example 1. The details are as follows. Materials and Methods (Construction of vaccinia virus) The method for producing the recombinant vaccinia virus m8Δ-Pf(P7.5-s25-CSP)-HA virus is described in Example 1.

[0080] (Construction of recombinant adeno-associated virus) The method for producing the recombinant adeno-associated virus AAV5-Pf(s25-CSP) virus is described in AAV1-Pf(s25-CSP) virus using AAV1 (Example 1). The only difference is that AAV5 is used.

[0081] (Immunoblotting) Human embryonic kidney cells (HEK293T cells) were seeded on a 48-well plate and incubated at an MOI of 10 for 24 hours. 5 The detailed method is described in Example 1.

[0082] {Indirect fluorescent assay (IFA) using HEK293T cells} HEK293T cells were seeded on 8-well chamber slides and incubated at an MOI of 10 for 24 hours. 5 The detailed method is described in Example 1.

[0083] (Mammals and protozoa used) The mammals and protozoa used are described in Example 1.

[0084] (Vaccination) Balb / c mice (7-week-old female) purchased from SLC were used, with 10 mice per group. The m8Δ vaccine [m8Δ-Pf(P7.5-s25-CSP)-HA] was 1 × 10 7 pfu / 100 μL / mouse, AAV5 vaccine [AAV5-Pf(s25-CSP)] was 1 × 10 10 The vaccine was diluted with PBS to vg / 100 μL / mouse. The m8Δ vaccine was administered to the base of the mouse tail by vaccinating (ts) using a bifurcated needle, and the AAV5 vaccine was administered by injecting (im) into the left thigh muscle using an insulin syringe with a 29G needle. Immunization was performed by the heterologous prime-boost method, with the m8Δ vaccine as the prime immunization (Prime) and the AAV5 vaccine as the boost immunization 6 weeks later. Detailed methods are described in Example 1.

[0085] {Enzyme-linked immunosorbent assay (ELISA)} Anti-PfCSP antibody titers were quantified by ELISA as described in Iyori M, Yamamoto DS, Sakaguchi M, Mizutani M, Ogata S, Nishiura H., et al. DAF-shielded baculovirus-vectored vaccine enhances protection against malaria sporozoitechallenge in mice. Malar J (2017) 16(1):390. doi:10.1 186 / s12936-017-2039-x. Detailed methods are described in Example 1.

[0086] {Challenge infection test} (Sporozoite challenge test) Infected with PfCSP-Tc / Pb Anopheles stephensi Sporozoites were extracted from the salivary glands of Anopheles mosquitoes and suspended in RPMI-1640 medium (Gibco, Life Technologies). Mice boosted with AAV5-Pf(s25-CSP) vaccine were administered 100 μL of medium containing 2,500 sporozoites via the tail vein 40 days later. The presence or absence of infection was monitored from day 4 to day 14 by Giemsa staining of thin blood smears obtained from the tail. Detailed methods are described in Example 1.

[0087] {Propagation Blocking Test} (Direct Blood Feeding Test) Mice boosted with the AAV5-Pf(s25-CSP) vaccine were intraperitoneally administered 200 μL of 6 mg / ml phenylhydrazine solution (Sigma) 29 days later, and 1 × 10 6 Pb-Pfs25-DR3 infected red blood cells were intraperitoneally administered. After 3 days, the mouse was fed by about 60 starving Anopheles mosquitoes. The midguts of the fed mosquitoes were dissected 10 to 12 days after feeding, and the number of oocysts in the midguts was quantified. The detailed method is described in Example 1.

[0088] (statistical analysis) In the test of protective effect against infection, the number of days until 1% parasitemia was reached was compared, and the significant difference between each immunization group and the negative control group was calculated using the Log-Rank (Mantel-Cox) test. The complete protective effect was calculated using Fisher's exact test. In the test of IgG antibody titer, the Mann-Whitney U test was used for tests between two groups, and one-way analysis of variance with Dunnett's multiple comparison test was used for tests between three or more groups. Detailed methods are described in Example 1.

[0089] Confirmation of vaccine construction In this embodiment, the hinge G 6 We constructed an AAV5-based vaccine expressing Pfs25 and PfCSP as a fusion protein using an S linker (Figure 12a). The structure is the same as in Figure 1a, but the AAV used is AAV5. Western blotting confirmed that AAV5-Pf(s25-CSP) expressed the Pfs25-PfCSP fusion protein (Fig. S12b) and further confirmed cell surface expression of PfCSP and Pfs25 (Fig. S12b).

[0090] Confirmation of infection prevention effect The protective effect of vaccination with m8Δ / AAV5-Pf(s25-CSP) was determined by complete protection against PfCSP / Pb sporozoites. In Balb / c mice, all 10 control mice were infected after intravenous administration of 2,500 sporozoites, whereas 9 out of 9 mice (100%) in the m8Δ / AAV5-Pf(s25-CSP)-treated group were completely protected (Figure 14). This effect was similar to the complete protection achieved by the m8Δ / AAV1-Pf(s25-CSP) vaccine (100%) using AAV1. The m8Δ / AAV5-Pf(s25-CSP) vaccine induced a high anti-PfCSP antibody response as a booster effect with AAV5-Pf(s25-CSP) (Figure 13a, 2.71 × 10 6In addition to the anti-PfCSP antibody titers, the m8Δ / AAV5-Pf(s25-CSP) vaccine also induced anti-Pfs25 antibody responses with a boosting effect (Figure 13b, 7.17 × 10 5 These anti-PfCSP and anti-Pfs25 antibody titers were as high as those of the m8Δ / AAV1-Pf(s25-CSP) vaccine using AAV1. From the above, it was confirmed that the m8Δ / AAV5-Pf(s25-CSP) vaccine using AAV5 of the present invention exhibits complete infection protection effect (100%) equivalent to that of the m8Δ / AAV1-Pf(s25-CSP) vaccine using AAV1 (Example 1).

[0091] Confirmation of propagation blocking effect The transmission blocking effect of the vaccine was confirmed 35 days after the final immunization. The TRA and TBA were 99.94% (p<0.0001) and 95.27% (p<0.0001), respectively (FIG. 15). The TRA and TBA effects were as high as those of the m8Δ / AAV1-Pf(s25-CSP) vaccine using AAV1. It was confirmed that the m8Δ / AAV5-Pf(s25-CSP) vaccine using AAV5 of the present invention exhibits a high transmission blocking effect equivalent to that of the m8Δ / AAV1-Pf(s25-CSP) vaccine using AAV1 (Example 1). EXAMPLES

[0092] In this example, the safety, immunogenicity, and infection protection and transmission blocking effects of the vaccine were examined in rhesus monkeys, an animal model of primates close to humans. The details are as follows.

[0093] Materials and Methods (Vaccinia virus and adeno-associated virus) A method for producing recombinant vaccinia virus m8Δ-Pf(P7.5-s25-CSP)-HA is described in Example 1, and a method for producing recombinant adeno-associated virus type 1 AAV1-Pf(s25-CSP) is described in Example 1.

[0094] (Monkeys and protozoa used) The monkeys and protozoa used are as follows: Rhesus monkeys: Four Indian rhesus monkeys kept at the Institute of Medical and Biological Sciences, Kyoto University, were used. Details are as follows.

[0095] [Table 1]

[0096] Mouse malaria parasite: Recombinant mouse malaria parasite {PfCSP expressing P. berghei (Pb) PfCSP-Tc / Pb} (described in Insect Mol. Biol. 2013, 22:41) was used.

[0097] (Vaccination) m8Δ vaccine [m8Δ-Pf(P7.5-s25-CSP)-HA] was 1 × 10 8 pfu / 10 μL, AAV1 vaccine (AAV1-Pf(s25-CSP)) was 3.3 × 10 12 The vaccine was diluted in PBS to vg / 100 μL. The m8Δ vaccine was administered to the depilated upper back by vaccinating with a bifurcated needle (ts). Eight weeks later, the AAV1 vaccine was boosted into the left thigh muscle (im) using a 29G insulin syringe with a needle.

[0098] (Blood collection schedule and IgG purification method) Blood (10-20 mL) was collected from the upper arm in the presence of EDTA according to the schedule shown in Figure 16. The collected blood was stored at -20°C until use in the following blood tests or as plasma after removing blood cell components by centrifugation. IgG was purified from monkey plasma using HiTrap Protein G HP (Cytiva).

[0099] (Safety testing by blood tests) Blood samples were collected before immunization (0w), one week (1w) after the first m8Δ vaccine administration, and one week (9w) or three weeks (11w) after the booster AAV1 vaccine administration, and blood tests were performed for the items shown in Figure 17.

[0100] {Enzyme-linked immunosorbent assay (ELISA)} Anti-PfCSP antibody titers were quantified by ELISA as previously described. Plasma samples were collected at 0, 4, 8, 12, 16, 20, 24, and 28 weeks. For anti-Pfs25 antibody titers, the Pfs25 antigen was constructed using the same pfs25 gene used in the m8Δ and AAV1 vaccines and produced using the Wheat Germ Cell-Free (WGCF) protein expression system (CellFree Sciences) {Miura K, Takashima E, Deng B, Tullo G, Diouf A, Moretz SE., et al. Functional comparison of Plasmodium falciparum transmission-blocking vaccine candidates by the standard membrane-feeding assay. Infect Immun (2013)81(12):43 77. doi: 10.1128 / IAI.01056-13}. Costar® EIA / RIA polystyrene plates (Corning Inc.) precoated with 400 ng / well PfCSP or 200 ng / well Pfs25 were blocked with 1% bovine serum albumin (BSA) in PBS and then incubated with serially diluted plasma and purified IgG samples. Horseradish peroxidase (HRP)-conjugated anti-human IgG (Bio-Rad lab, Inc.) was used as the secondary antibody. After washing, ABTS (2'-azino-bis (3-ethylbenzothiazoline-6-sulphonicacid) (SIGMA) and H 2 O 2 Detection was at an absorbance wavelength of 414 nm using citrate-phosphate buffer supplemented with 0.15 U. The endpoint titer was expressed as the reciprocal of the last dilution giving an optical density at 414 nm of 0.15 U above the negative control value (<0.1). Plasma samples were measured at 0, 12 w. All four rhesus macaques used in the study were negative for PfCSP and Pfs25 antibodies (<1:1,000) before immunization.

[0101] (In vitro sporozoite neutralization test) The sporozoites were quantified by an in vitro sporozoite neutralization assay as described in the literature. Specifically, human hepatoma-derived HepG2 cells were cultured at 6 × 10 4 The cells were seeded in a 48-well plate at 300 μL / well and cultured in a 37°C incubator for 24 hours. Mosquitoes infected with recombinant malaria parasites (PfCSP-Tc / Pb) were dissected, and the salivary glands were homogenized in a BioMasher column (Biomasher III), centrifuged at 8,000 rpm, 40 s, 4°C, and counted using a C-CHIP (NanoEnTek). 50 μL of the solution was diluted with RPMI (serum-free) to give final concentrations of 1,000 μg / mL, 500 μg / mL, and 100 μg / mL for immunization and pre-immunization, respectively, and 10,000 sporozoites / 50 μL was prepared by diluting the solution with RPMI (serum-free). The IgG solution and spz solution were mixed in a 1.5 mL microtube and left on ice for 40 minutes. After the incubation, the mixture of IgG and sporozoites was added to the wells, centrifuged at 1,000 rpm for 5 min at room temperature, and incubated in an incubator at 37°C for 24 hours. After the incubation, the cell supernatant was removed from the wells, 300 μL / well of RPMI (without serum) was added, and incubated in an incubator at 37°C for 24 hours. After the incubation, RNA extraction and qRT-PCR were performed to measure the amount of ribosomal RNA (rRNA) derived from the protozoa. The reaction data were analyzed using GraphPad Prism (GraphPad Software). The neutralizing activity was calculated as the percentage of the rRNA amount in sporozoite-infected cells containing antibodies at each concentration, assuming that the amount of rRNA derived from the protozoa in cells infected with sporozoites that did not react with the antibody was 100%. The concentration of antibody that inhibited 50% of sporozoite invasion was calculated from the regression line.

[0102] (Transmission Blockage Test) As described in the literature (Mlambo G, Maciel J, Kumar N. Murine model for assessment of Plasmodium falciparum transmission-blocking vaccine using transgenic Plasmodium berghei parasites expressing the target antigen Pfs25. Infect Immun. 2008 May;76(5):2018-24. doi: 10.1128 / IAI.01409-07. Epub 2008 Mar 3.), we transferred monkey antibodies to malaria-infected mice and then allowed mosquitoes to feed on their blood to evaluate the effect of the monkey antibodies in inhibiting malaria growth in mosquitoes. Specifically, 10 mg of purified monkey IgG was intravenously administered to mice infected with s25-expressing mouse malaria (Pb / Pfs25DR3). Approximately 1 hour after antibody administration, the mice were allowed to feed on the blood of mosquitoes. As a control, IgG purified from pre-immune serum collected from the same individual was used. The mosquitoes that had not fed on blood 24 hours later were removed, and the number of oocysts in the mosquito midguts was counted 10-12 days after feeding. The inhibitory effect of the antibodies on the growth of the protozoan parasite was calculated by comparing with the control antibody group.

[0103] (In vitro ookinete conversion inhibition test) As described in the literature (Blagborough AM, Sinden RE. Plasmodium berghei HAP2 induces strong malaria transmission-blocking immunity in vivo and in vitro. Vaccine. 2009 Aug 20;27(38):5187-94. doi: 10.1016 / j.vaccine.2009.06.069. Epub 2009 Jul 9.), the inhibitory effect on ookinete formation (conversion) was evaluated by incubating a mixture of malaria-infected mouse blood and monkey antibodies. Specifically, infected blood was collected by cardiac blood sampling from mice infected with Pfs25-DR3 / Pb, a murine malaria parasite that had been genetically modified to insert Pfs25. 400 μl of medium, 20 μl of infected blood, and 100 μl of serum + PBS mixture were added to each well of a 24-well plate and incubated at 19°C for 24 hours. The antibody concentrations were 500 μg / mL, 250 μg / mL, and 100 μg / mL, respectively. As in the transmission inhibition test, IgG collected from the same individual before immunization was used as a control. After incubation, the mixture in the wells was transferred to an Eppendorf tube and centrifuged at 500g for 5 minutes. The supernatant was removed, and a 500-fold diluted fluorescent antibody was added, mixed, and left at room temperature for 10 minutes. The mixture was then observed under a fluorescent microscope. The number of circular gametocytes and banana-shaped ookinates was counted, and the conversion efficiency of gametocytes to ookinates was calculated.

[0104] (statistical analysis) In the test of protective effect against infection, the number of days until 1% parasitemia was reached was compared and the significant difference between each immunization group and the negative control group was calculated using the Log-Rank (Mantel-Cox) test. The complete protective effect was calculated using Fisher's exact test. In the test of IgG antibody titer, the Mann-Whitney U test was used for tests between two groups, and one-way analysis of variance with Dunnett's multiple comparison test was used for tests between three or more groups.

[0105] Confirmation of vaccine safety In all 14 blood test items shown in Figure 17, no abnormal or dangerous values ​​exceeding the standard values ​​were observed before or after vaccination in any of the four monkeys. This result proves the safety of this vaccine.

[0106] - Confirmation of vaccine immunogenicity After booster immunization with AAV1 vaccine (8 weeks), anti-PfCSP antibody titers rose rapidly, reaching a peak of >1:500,000 at 16 weeks, and continued to remain high thereafter, remaining at around 1:100,000 in all monkeys even at 32 weeks, when observation ended. This demonstrated that this vaccine can induce anti-PfCSP antibodies that are effective in preventing infection over a long period of time (Figure 18(1)). Anti-Pfs25 antibody titers, which are involved in preventing transmission, also reached 200,000-500,000 4 weeks after booster immunization with AAV1 vaccine (12 weeks) (Figure 18(2)). This demonstrated that this vaccine induces high antibody production necessary for both infection protection and transmission prevention effects.

[0107] Confirmation of infection prevention effect The results of the in vitro sporozoite neutralization test are shown in Figure 19. Compared to pre-immune monkey IgG, the infection ratio was significantly reduced in all four monkeys that received immunized monkey IgG. In particular, at 1,000 μg / mL, the infection ratios were 5.0% (monkey MM638), 0.03% (monkey MM641), 12.7% (monkey MM651), and 0.44% (monkey MM633). It was confirmed that immunized monkey IgG had a high defense against invasion (neutralizing activity).

[0108] Confirmation of propagation blocking effect The results of the transmission blocking test are shown in Figure 20. The malaria seropositivity rate in mosquitoes after blood feeding was reduced to 67.9% (monkey MM651), 90.3% (monkey MM641), 53.9% (monkey MM633), and 23.4% (monkey MM638) in the immunized groups compared to the control group.

[0109] Confirmation of in vitro ookinete conversion inhibitory effect The results of the ookinete conversion inhibition test are shown in Figure 21. Compared with the control group, the conversion inhibition rates in the immunized groups were 47.8% (500 μg / mL group), 23.1% (250 μg / mL group), 23.5% (200 μg / mL group), 3.9% (100 μg / mL group)-4.1% (50 μg / mL group) on average for each concentration in four animals, and a significant conversion inhibition effect was confirmed between the 500 μg / mL group and other groups, between the 250 μg / mL group and the 50 μg / mL group, and between the 200 μg / mL group and the 100 μg / mL group and the 50 μg / mL group.

[0110] (Examples of the composition of the malaria vaccine composition of the present invention) Examples of combinations of the components of the malaria vaccine composition of the present invention are shown below, but are not limited thereto. 1) (1) a recombinant vaccinia virus comprising a gene encoding the amino acid sequence of CSP for prime and a gene encoding the amino acid sequence of s25, and (2) a recombinant adeno-associated virus comprising a gene encoding the amino acid sequence of CSP for boost and a gene encoding the amino acid sequence of s25. 2) (1) a recombinant vaccinia virus strain LC16 containing a gene encoding the amino acid sequence of CSP for prime and a gene encoding the amino acid sequence of s25, and (2) a recombinant human adeno-associated virus type 1 containing a gene encoding the amino acid sequence of CSP for boost and a gene encoding the amino acid sequence of s25. 3) (1) a recombinant vaccinia virus strain LC16 containing a gene encoding the amino acid sequence of CSP for prime and a gene encoding the amino acid sequence of s25, and (2) a recombinant human adeno-associated virus type 5 containing a gene encoding the amino acid sequence of CSP for boost and a gene encoding the amino acid sequence of s25. Further examples include malaria vaccine compositions in which each of the virus types described herein is appropriately modified.

[0111] (General remarks) The vaccine of the present invention has been confirmed to have the following properties based on the above examples and the like. 1) The vaccine of the present invention not only provides 100% protection against PfCSP / Pb sporozoites, but also has a transmission-blocking effect, inhibiting the movement of Pb-Pfs25DR3 protozoa into mosquitoes by 99% or more. 2) The vaccine of the present invention has a vaccine-induced immune response effect that lasts for more than 7 months, and provides complete protection against multiple parasitic infections. 3) We confirmed that the vaccine of the present invention is capable of expressing the genes encoding Pfs25 and PfCSP as a fusion protein via the hinge sequence, and further confirmed that it functions not only as a pre-erythrocytic vaccine (PEV) but also as a transmission blocking vaccine (TBV). 4) The vaccine of the present invention showed 90-100% complete protection against challenge with 1,000 sporozoites, and also showed 100% complete protection against challenge with 2,500 sporozoites and blood-sucking challenge by infected mosquitoes. 5) The vaccine of the present invention was able to induce rapid and strong humoral immune responses, and the sustained antigen expression by AAV continuously enhanced the responses, maintaining long-term anti-PfCSP and anti-Pfs25 antibody responses. The long-lasting antibody responses by the vaccination of the present invention were significantly superior to those by the known AdHu5 / AAV1 vaccination (Fig. 2c, 2d). 6) The vaccine of the present invention showed 100% complete protection against repeated sporozoite challenges on days 26, 86, and 100 after the final immunization (Fig. 4a-c). Furthermore, the same mice showed a high inhibition of transmission on day 276 after the final immunization (Fig. 4d). 7) The vaccine of the present invention [m8Δ / AAV1-Pf(s25-CSP)], which has a transmission blocking effect of more than 99%, showed a higher infection prevention effect than m8Δ / AAV1-PfCSP, which has no transmission blocking effect, demonstrating the synergistic effect of the vaccine due to the expression of both the PfCSP and Pfs25 antigens. 8) The vaccine of the present invention has a remarkable suppressive effect on the prevalence of the disease, which is about 7 times (71%÷10%) higher than known vaccines (especially AdHu5 / AAV1-Pf(s25-CSP). 9) From the above, it is considered that the vaccine of the present invention has the ability to confer lifelong immunity to humans by administering a total of two or more doses of m8Δ-Pf(P7.5-s25-CSP)-HA and AAV1-Pf(s25-CSP). More specifically, the results of the examples show that (1) the antibody response lasts until 210 days after immunization (Fig. 2c, 2d), (2) the antibody response increases with multiple exposures to the protozoa (Fig. 4e), (3) the vaccine effect lasts until 276 days after immunization, and (4) the malaria has a high mortality rate in early childhood, but the effect lasts for a long period of time that significantly exceeds that period. Furthermore, in areas where infection is prevalent, a booster effect can be obtained by infection with a protozoa that is prevalent other than the vaccine, and considering the lifespan of mice, the vaccine of the present invention can confer lifelong immunity to humans as well as mice. 10) The vaccine of the present invention is a m8Δ / AAV1-Pv(s25-CSP-S / P) P. vivax malaria vaccine that incorporates the Pv(s25-PvCSP-S / P) gene, which is a fusion of the Pvs25 gene, a transmission-blocking antigen, and the PvCSP-S / P gene, a protective antigen. This vaccine expresses two PvCSP gene polymorphisms (Salvador strain VK210 and Papua New Guinea strain VK247) of P. vivax malaria parasites. When inoculated into mice, it was confirmed that the vaccine induced sufficiently high anti-Pvs25 and anti-PvCSP-Sal antibody titers. It was successful in simultaneously inducing both infection protection effects (90%) and transmission blocking effects (>93%). In addition, it is believed to be effective against two types of strains. 11) The m8Δ / AAV5-Pf(s25-CSP) vaccine using AAV5 of the present invention has the same effect as the m8Δ / AAV1-Pf(s25-CSP) vaccine using AAV1 described above. 12) The safety of the vaccine of the present invention was confirmed in a monkey model. 13) The vaccine of the present invention induced extremely high anti-PfCSP antibody titers (500,000-fold or more) in all monkeys after booster immunization with the AAV1 vaccine. The antibody titers were maintained even after half a year, demonstrating its usefulness as a two-dose malaria vaccine. 14) The anti-PfCSP antibodies induced by the vaccine of the present invention showed very strong in vitro sporozoite neutralizing activity, demonstrating the usefulness of the vaccine of the present invention as a vaccine for preventing malaria infection. 15) The vaccine of the present invention induced extremely high anti-Pfs25 antibody titers (200,000 to 500,000 times) in all monkeys after booster immunization with the AAV1 vaccine. The antibodies showed very strong transmission-blocking activity. The vaccine of the present invention is useful as a malaria transmission-blocking vaccine. 16) Based on the above 12) to 15), the vaccine of the present invention is considered to have the ability to confer lifelong immunity to humans by administering a total of two doses of m8Δ-Pf(P7.5-s25-CSP)-HA and AAV1-Pf(s25-CSP). [Industrial Applicability]

[0112] This vaccine has superior protection against infection compared to conventional malaria vaccines. Furthermore, it is a completely new vaccine that also has the effect of blocking malaria transmission, making it a groundbreaking vaccine that can block the unique route of malaria infection between humans and mosquitoes.

Claims

1. A malaria vaccine composition comprising: (1) A recombinant vaccinia virus comprising a gene encoding the amino acid sequence of a prime CSP and a gene encoding the amino acid sequence of s25, wherein the gene encoding the amino acid sequence of the CSP and the gene encoding the amino acid sequence of the s25 are linked via a gene encoding a hinge sequence; (2) A recombinant adeno-associated virus comprising a gene encoding the amino acid sequence of CSP for boost and a gene encoding the amino acid sequence of s25, wherein the gene encoding the amino acid sequence of CSP and the gene encoding the amino acid sequence of s25 are linked via a gene encoding a hinge sequence.

2. A malaria vaccine comprising a recombinant vaccinia virus comprising a gene encoding an amino acid sequence of CSP and a gene encoding an amino acid sequence of s25, wherein the gene encoding the amino acid sequence of CSP and the gene encoding the amino acid sequence of s25 are linked via a gene encoding a hinge sequence; Furthermore, the recombinant vaccinia virus is characterized in that it is administered to a human or an animal before administering to the human or an animal a recombinant adeno-associated virus comprising a gene encoding the amino acid sequence of CSP, a gene encoding the amino acid sequence of s25, and a gene encoding a hinge sequence linking the gene encoding the amino acid sequence of CSP and the gene encoding the amino acid sequence of s25. Malaria vaccine.

3. A malaria vaccine comprising a recombinant adeno-associated virus comprising a gene encoding an amino acid sequence of CSP and a gene encoding an amino acid sequence of s25, wherein the gene encoding the amino acid sequence of CSP and the gene encoding the amino acid sequence of s25 are linked via a gene encoding a hinge sequence; Furthermore, the recombinant adeno-associated virus is characterized in that it is administered to a human or an animal after administering to the human or an animal a recombinant vaccinia virus comprising a gene encoding the amino acid sequence of CSP, a gene encoding the amino acid sequence of s25, and a gene encoding a hinge sequence linking the gene encoding the amino acid sequence of CSP and the gene encoding the amino acid sequence of s25. Malaria vaccine.

4. The malaria vaccine composition of claim 1, wherein the vaccinia virus is an LC16 strain lacking the B5R gene.

5. The malaria vaccine according to claim 2 or 3, wherein the vaccinia virus is an LC16 strain lacking the B5R gene.

6. The malaria vaccine composition according to claim 1 or 4, which is for protection against malaria infection and for blocking malaria transmission.

7. The malaria vaccine according to claim 2 or 3, which is for protection against malaria infection and for blocking malaria transmission.

8. 1. A malaria vaccine composition that confers lifelong immunity to a recipient, comprising: (1) A recombinant vaccinia virus comprising a gene encoding the amino acid sequence of CSP for prime and a gene encoding the amino acid sequence of s25, wherein the gene encoding the amino acid sequence of CSP and the gene encoding the amino acid sequence of s25 are linked via a gene encoding a hinge sequence. (2) A recombinant adeno-associated virus comprising a gene encoding the amino acid sequence of CSP for boost and a gene encoding the amino acid sequence of s25, wherein the gene encoding the amino acid sequence of CSP and the gene encoding the amino acid sequence of s25 are linked via a gene encoding a hinge sequence. The present invention is characterized in that a combination of the recombinant vaccinia virus for prime use and the recombinant adeno-associated virus for boost use is inoculated to a recipient two or more times. Malaria vaccine compositions.

9. The malaria vaccine composition of claim 1 , wherein the malaria is Plasmodium vivax.

10. The malaria vaccine composition according to claim 1 or 4, which is for inhibiting ookinete conversion.

11. The hinge sequence is G n S array, where n is 2 or more, The malaria vaccine composition of claim 1.

12. G n S sequence is G 6 The malaria vaccine composition of claim 11, wherein the malaria vaccine composition is S.

13. The hinge sequence is G n S array, where n is 2 or more, The malaria vaccine of claim 2.

14. G n S sequence is G 6 The malaria vaccine of claim 13, which is S.

15. The hinge sequence is G n S array, where n is 2 or more, The malaria vaccine of claim 3.

16. G n S sequence is G 6 The malaria vaccine of claim 15, wherein the vaccine is S.

17. The hinge sequence is G n S array, where n is 2 or more, The malaria vaccine composition of claim 8.

18. G n S sequence is G 6 The malaria vaccine composition of claim 17, wherein the malaria vaccine composition is S.

Images