RNAi agents and compositions for inhibiting expression of angiopoietin-like 3 (ANGPTL3) and methods of use - Patents.com

Abstract

Provided are RNAi agents and compositions for inhibiting the expression of angiopoietin-like 3 (ANGPTL3), as well as methods of use. [Solution] The present disclosure relates to RNAi agents, such as double-stranded RNAi agents capable of inhibiting angiopoietin-like 3 (ANGPTL3, also known as ANGPL3, angiopoietin-like protein 3) gene expression, and compositions containing the ANGPTL3 RNAi agents. Methods of using the ANGPTL3 RNAi agents and compositions are also disclosed. The ANGPTL3 RNAi agents disclosed herein can be conjugated to a targeting ligand to facilitate delivery to cells, including hepatocytes. Pharmaceutical compositions containing one or more ANGPTL3 RNAi agents, optionally together with one or more additional therapeutic agents, are also described.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 62 / 694,976, filed July 7, 2018, U.S. Provisional Patent Application No. 62 / 651,284, filed April 2, 2018, U.S. Provisional Patent Application No. 62 / 583,919, filed November 9, 2017, and U.S. Provisional Patent Application No. 62 / 558,819, filed September 14, 2017, the contents of each of which are incorporated by reference in their entirety herein.

[0002] Sequence Listing This application contains a Sequence Listing which has been submitted in ASCII format and is hereby incorporated by reference in its entirety. The ASCII copy is entitled 30658_SequenceListing and is 111 kb in size.

[0003] FIELD OF THEINVENTION The present disclosure relates to RNA interference (RNAi) agents, eg, double-stranded RNAi agents, compositions comprising angiopoietin-like 3 RNAi agents, and methods of use thereof, for the inhibition of angiopoietin-like 3 gene expression. [Background technology]

[0004] background Angiopoietin-like 3 (also called ANGPTL3, ANGPL3, ANG3, or angiopoietin-like protein 3) is an angiopoietin protein encoded by the human angiopoietin-like 3 gene that has been reported to be involved in the regulation of lipid metabolism. ANGPTL3 is a 460 amino acid polypeptide consisting of a signal peptide, an N-terminal coiled-coil domain, and a C-terminal fibrinogen (FBN)-like domain. ANGPTL3 is known to be produced primarily in hepatocytes in humans, and after synthesis, is secreted into the circulation. ANGPTL3 acts as an inhibitor of lipoprotein lipase, which catalyzes the hydrolysis of triglycerides, and as an inhibitor of endothelial lipase, which hydrolyzes lipoprotein phospholipids. Inhibition of these enzymes can cause increased triglyceride, high-density lipoprotein (HDL), and phospholipid levels in plasma. Furthermore, loss-of-function mutations in ANGPTL3 cause familial hypobetalipoproteinemia, which is characterized by low levels of plasma triglycerides and low-density lipoprotein (LDL-C).In humans, loss-of-function mutations in ANGPTL3 are also correlated with a reduced risk of atherosclerotic cardiovascular disease. Effective therapeutic agents that target ANGPTL3 can provide beneficial effects in the treatment (including preventive treatment) of cardiometabolic diseases, such as hypertriglyceridemia, obesity, hyperlipidemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, type II diabetes, cardiovascular disease, coronary artery disease, nonalcoholic fatty liver disease, nonalcoholic fatty liver disease, homozygous and heterozygous familial hypercholesterolemia, statin-resistant hypercholesterolemia, and other metabolic-related disorders and diseases.Although certain double-stranded RNA-based compounds have been identified as being able to inhibit the expression of ANGPTL3 gene (see, for example, International Patent Application Publication Nos. WO2012 / 177784, WO2016 / 168286, and WO2016 / 154127), the ANGPTL3 RNAi agent disclosed herein has not been disclosed or known before, and provides highly potent and highly efficient ANGPTL3-specific inhibition of the expression of ANGTPL3 gene. [Prior art documents] [Patent documents]

[0005] [Patent Document 1] International Publication No. 2012 / 177784 [Patent Document 2] International Publication No. 2016 / 168286 [Patent Document 3] International Publication No. 2016 / 154127 Summary of the Invention [Means for solving the problem]

[0006] There is a need for a novel ANGPTL3 specific RNA interference (RNAi) agent (also referred to herein as RNAi agent, RNAi trigger or trigger), such as double-stranded RNAi agent, that can selectively and effectively inhibit the expression of ANGPTL3 gene.Furthermore, there is a need for a composition that includes novel ANGPTL3 specific RNAi agent, particularly for treating diseases associated with increased triglyceride (TG) level.

[0007] In general, the present disclosure features ANGPTL3 gene specific RNAi agent, composition comprising ANGPTL3 RNAi agent, and method for inhibiting the expression of ANGPTL3 gene in vitro and / or in vivo using ANGPTL3 RNAi agent and composition comprising ANGPTL3 RNAi agent described herein.The ANGPTL3 RNAi agent described herein can selectively and efficiently reduce or inhibit the expression of ANGPTL3 gene, thereby reducing TG level and / or cholesterol level in subject, for example, human or animal subject.

[0008] The described ANGPTL3 RNAi agent can be used in the method for therapeutic treatment (including prophylactic and preventive treatment) of the symptoms and diseases associated with elevated TG levels and / or elevated cholesterol levels, including but not limited to hypertriglyceridemia, obesity, hyperlipidemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, type II diabetes, cardiovascular disease, coronary artery disease, nonalcoholic steatohepatitis, nonalcoholic fatty liver disease, homozygous and heterozygous familial hypercholesterolemia, statin-resistant hypercholesterolemia, and other metabolic-related disorders and diseases.The ANGPTL3 RNAi agent disclosed herein can selectively reduce ANGPTL3 gene expression, thereby in particular leading to the reduction of TG levels and / or cholesterol levels in a subject.The method disclosed herein includes the administration of one or more ANGPTL3 RNAi agents to a subject, for example, a human or animal subject, using any suitable method known in the art, such as subcutaneous injection or intravenous administration.

[0009] In one aspect, the disclosure features an RNAi agent for inhibiting expression of a human ANGPTL3 gene, the RNAi agent including a sense strand and an antisense strand.

[0010] Also described herein is a composition that comprises or consists of an RNAi agent that can inhibit the expression of ANGPTL3 gene, wherein the RNAi agent comprises or consists of a sense strand and an antisense strand, and the composition further comprises at least one pharma- ceutically acceptable excipient.The composition described herein that comprises one or more of the disclosed ANGPTL3 RNAi agents can selectively and efficiently reduce the expression of ANGPTL3 gene.The composition that comprises one or more ANGPTL3 RNAi agents can be administered to a subject, such as a human or animal subject, for the treatment (including preventive treatment or inhibition) of symptoms and diseases associated with elevated TG, elevated cholesterol and / or enhanced ANGPTL3 expression.

[0011] The ANGPTL3 RNAi agents described herein include a sense strand (also referred to as a passenger strand) and an antisense strand (also referred to as a guide strand). The sense strand and the antisense strand may be partially, substantially, or fully complementary to one another. The length of the sense and antisense strands of the RNAi agents described herein may each be 16-30 nucleotides in length. In some embodiments, the sense and antisense strands are independently 17-26 nucleotides in length. The sense and antisense strands may be the same length or different lengths. In some embodiments, the sense and antisense strands are independently 21-26 nucleotides in length. In some embodiments, the sense and antisense strands are independently 21-24 nucleotides in length. In some embodiments, both the sense and antisense strands are 21 nucleotides in length. In some embodiments, the sense and / or antisense strands are independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. The RNAi agents described herein, upon delivery to cells expressing ANGPTL3, inhibit expression of one or more ANGPTL3 genes in vivo or in vitro.

[0012] The sense strand of the ANGPTL3 RNAi agent described herein comprises at least 16 consecutive nucleotides with at least 85% identity to the core stretch sequence (also referred to herein as "core stretch" or "core sequence") of the same number of nucleotides in ANGPTL3 mRNA. In some embodiments, this sense strand core stretch is 16, 17, 18, 19, 20, 21, 22 or 23 nucleotides long. In some embodiments, this sense strand core stretch is 17 nucleotides long. In some embodiments, this sense strand core stretch is 19 nucleotides long.

[0013] The antisense strand of the ANGPTL3 RNAi agent described herein comprises at least 16 consecutive nucleotides with at least 85% complementarity with the core stretch of the same number of nucleotides in ANGPTL3 mRNA and the core stretch of the same number of nucleotides in corresponding sense strand.In some embodiments, this antisense strand core stretch is 16, 17, 18, 19, 20, 21, 22 or 23 nucleotides long.In some embodiments, this antisense strand core stretch is 19 nucleotides long.In some embodiments, this antisense strand core stretch is 17 nucleotides long.

[0014] In some embodiments, an ANGPTL3 RNAi agent disclosed herein targets a portion of the ANGPTL3 gene having a sequence of any of the sequences disclosed in Table 1.

[0015] Examples of ANGPTL3 RNAi agent sense and antisense strands that may be included in the ANGPTL3 RNAi agents disclosed herein are provided in Tables 3 and 4. Examples of ANGPTL3 RNAi agent duplexes are provided in Table 5. Examples of 19 nucleotide core stretch sequences that consist of or are included in the sense and antisense strands of the ANGPTL3 RNAi agents disclosed herein are provided in Table 2.

[0016] In another aspect, the present disclosure features a method for delivering ANGPTL3 RNAi agent to liver cells in a subject, such as a mammal, in vivo.Also described herein is a composition for use in such a method.One or more ANGPTL3 RNAi agents can be delivered to target cells or tissues using any oligonucleotide delivery technology known in the art.Nucleic acid delivery methods include, but are not limited to, encapsulation in liposomes, iontophoresis, or incorporation into other vehicles such as hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres, proteinaceous vectors, or Dynamic Polyconjugate™ (DPC) (see, for example, WO2000 / 053722, WO2008 / 0022309, WO2011 / 104169, and WO2012 / 083185, each of which is incorporated herein by reference).

[0017] In some embodiments, the ANGPTL3 RNAi agent is delivered to a target cell or tissue by covalently linking the RNAi agent to a targeting group, such as an asialoglycoprotein receptor ligand (i.e., a ligand that includes a compound that has affinity for the asialoglycoprotein receptor), or by conjugating the RNAi agent to a targeting group. In some embodiments, the asialoglycoprotein receptor ligand comprises, consists of, or consists essentially of galactose or a galactose derivative cluster. In some embodiments, the ANGPTL3 RNAi agent is linked to a targeting ligand that includes the galactose derivative N-acetyl-galactosamine. In some embodiments, the galactose derivative cluster comprises an N-acetyl-galactosamine trimer or an N-acetyl-galactosamine tetramer. In some embodiments, the galactose derivative cluster is an N-acetyl-galactosamine trimer or an N-acetyl-galactosamine tetramer. In some embodiments, the ANGPTL3 RNAi agent conjugated to the targeting ligand comprising N-acetyl-galactosamine is selectively internalized by liver cells, particularly liver cells, either by receptor-mediated endocytosis or other means.Examples of targeting groups useful for delivering RNAi agents are disclosed, for example, in International Patent Application Publication No. WO2018 / 044350 and WO2017 / 156012, the contents of each of which are incorporated herein by reference in their entirety.

[0018] The targeting group can be linked to the 3' or 5' end of the sense strand or antisense strand of the ANGPTL3 RNAi agent. In some embodiments, the targeting group is linked to the 3' or 5' end of the sense strand. In some embodiments, the targeting group is linked to the 5' end of the sense strand. In some embodiments, the targeting group is linked internally to the nucleotide on the sense strand and / or antisense strand of the RNAi agent. In some embodiments, the targeting group is linked to the RNAi agent via a linker.

[0019] A targeting group, with or without a linker, can be linked to the 5' or 3' end of any of the sense and / or antisense strands disclosed in Tables 2, 3, and 4. A linker, with or without a targeting group, can be attached to the 5' or 3' end of any of the sense and / or antisense strands disclosed in Tables 2, 3, and 4.

[0020] In some embodiments, described herein are compositions that include one or more ANGPTL3 RNAi agents having a double-stranded structure disclosed in Table 5.

[0021] In a further aspect, described herein is a pharmaceutical composition comprising one or more of the described ANGPTL3 RNAi agents, optionally in combination with one or more additional (i.e., second, third, etc.) therapeutic agents. In some embodiments, the pharmaceutical composition comprising one or more of the described ANGPTL3 RNAi agents, optionally in combination with one or more additional (i.e., second, third, etc.) therapeutic agents, can be formulated in a pharmaceutically acceptable carrier or diluent. In some embodiments, these compositions can be administered to a subject, such as a mammal. In some embodiments, the mammal is a human.

[0022] In some embodiments, compositions comprising at least two ANGPTL3 RNAi agents with different nucleotide sequences or cocktails are described herein.In some embodiments, two or more different ANGPTL3 RNAi agents are each separately and independently linked to a targeting group.In some embodiments, two or more different ANGPTL3 RNAi agents are each linked to a targeting group that comprises or consists of a targeting ligand that comprises one or more moieties that target asialoglycoprotein receptor.In some embodiments, two or more different ANGPTL3 RNAi agents are each linked to a targeting group that comprises or consists of a targeting ligand that comprises one or more galactose derivatives.In some embodiments, two or more different ANGPTL3 RNAi agents are each linked to a targeting group that comprises or consists of a targeting ligand that comprises one or more N-acetyl-galactosamine.

[0023] In another aspect, the disclosure features a method for inhibiting expression of the ANGPTL3 gene, comprising administering to a subject or a cell of a subject an amount of an ANGPTL3 RNAi agent capable of inhibiting expression of the ANGPTL3 gene, wherein the ANGPTL3 RNAi agent comprises a sense strand and an antisense strand, and wherein the antisense strand comprises any one of the antisense strand nucleotide sequences in Table 2 or Table 3. In some embodiments, disclosed herein is a method for inhibiting expression of the ANGPTL3 gene, comprising administering to a subject or a cell an amount of an ANGPTL3 RNAi agent capable of inhibiting expression of the ANGPTL3 gene, wherein the ANGPTL3 RNAi agent comprises a sense strand and an antisense strand, and wherein the sense strand comprises any one of the sense strand nucleotide sequences in Table 2 or Table 4. Also described herein are compositions for use in such methods.

[0024] In a further aspect, the disclosure features a method of treatment (including preventative or prophylactic treatment) of a disease or condition caused by elevated TG levels and / or elevated cholesterol levels, comprising administering to a subject in need thereof an ANGPTL3 RNAi agent having an antisense strand comprising any of the sequences in Tables 2 or 3. In some embodiments, described herein is a method of treatment (including preventative treatment) of a disease or condition caused by elevated TG levels and / or elevated cholesterol levels, comprising administering to a subject in need thereof an ANGPTL3 RNAi agent having a sense strand comprising any of the sequences in Tables 2 or 4. Also described herein are compositions for use in such methods.

[0025] Also described is a method of treating a human subject having or at risk of developing a pathological condition (e.g., a condition or disease) mediated at least in part by ANGPTL3 gene expression, comprising administering to the subject a therapeutically effective amount of an ANGPTL3 RNAi agent and / or an ANGPTL3 RNAi agent-containing composition. The method of treating a subject with an ANGPTL3 RNAi agent and / or an ANGPTL3 RNAi agent-containing composition can be combined with one or more steps of administering one or more additional (i.e., second, third, etc.) therapeutic agents or treatments, as appropriate. The additional therapeutic agent may be another ANGPTL3 RNAi agent (e.g., an ANGPTL3 RNAi agent that targets a different sequence in the ANGPTL3 gene). The additional therapeutic agent may be a small molecule drug, an antibody, an antibody fragment, and / or an aptamer. In some embodiments, the one or more additional therapeutic agents are statins, such as atorvastatin, fluvastatin, pravastatin, pitavastatin, rosuvastatin, or simvastatin.

[0026] In some embodiments, the described ANGPTL3 RNAi agent is optionally combined with one or more additional therapeutic agents. The ANGPTL3 RNAi agent and the additional therapeutic agent can be administered in a single composition, or they can be administered separately. In some embodiments, the one or more additional therapeutic agents are administered separately in a separate dosage form from the RNAi agent (e.g., the ANGPTL3 RNAi agent is administered by subcutaneous injection, while the additional therapeutic agent related to the method of treatment dosing regimen is administered orally). In some embodiments, the described ANGPTL3 RNAi agent is administered to a subject in need thereof via subcutaneous injection, and the one or more optional additional therapeutic agents are administered orally, together providing a treatment regimen for diseases and conditions associated with elevated TG and / or cholesterol levels. In some embodiments, the described ANGPTL3 RNAi agent is administered to a subject in need thereof via subcutaneous injection, and the one or more optional additional therapeutic agents are administered via another subcutaneous injection. In some embodiments, the ANGPTL3 RNAi agent and the one or more additional therapeutic agents are combined in a single dosage form (e.g., a "cocktail" formulated in a single composition for subcutaneous injection). ANGPTL3 with or without one or more additional therapeutic agents The RNAi agent can be combined with one or more excipients to form a pharmaceutical composition.

[0027] In some embodiments, disclosed herein is a method for inhibiting expression of the ANGPTL3 gene in a cell or a subject, the method comprising administering to the cell or subject an ANGPTL3 RNAi agent having a sense strand comprising any of the sequences in Table 4 and an antisense strand comprising any of the sequences in Table 3.

[0028] In some embodiments, the composition described is for delivering ANGPTL3 RNAi agent to liver cell, particularly hepatocyte, in vivo, and comprises ANGPTL3 RNAi agent conjugated to targeting group.In some embodiments, the targeting group is asialoglycoprotein receptor ligand.

[0029] In some embodiments, disclosed herein is a method for inhibiting expression of the ANGPTL3 gene in a cell, the method comprising administering one or more ANGPTL3 RNAi agents having a double-stranded duplex structure as described in Table 5.

[0030] In some embodiments, disclosed herein is a method of treatment (including prophylactic or preventative treatment) of a disease, disorder, or condition caused by elevated TG levels and / or elevated cholesterol levels, comprising administering to a subject in need thereof a therapeutically effective amount of an ANGPTL3 RNAi agent comprising an antisense strand that is at least partially complementary to a portion of an ANGPTL3 mRNA having a sequence in Table 1. In some embodiments, disclosed herein is a method of treatment (including prophylactic or preventative treatment) of a disease or condition caused by elevated TG levels and / or elevated cholesterol levels, comprising administering to a subject in need thereof a therapeutically effective amount of an ANGPTL3 RNAi agent comprising an antisense strand that comprises any of the sequences in Tables 2 or 3, and a sense strand that comprises any of the sequences in Tables 2 or 4 that is at least partially complementary to the antisense strand. In some embodiments, disclosed herein is a method of treatment (including prophylactic or preventative treatment) of a disease or condition caused by elevated TG levels and / or elevated cholesterol levels, comprising administering to a subject in need thereof a therapeutically effective amount of an ANGPTL3 RNAi agent comprising a sense strand comprising any of the sequences in Table 2 or 4, and an antisense strand comprising any of the sequences in Table 2 or 3 that is at least partially complementary to the sense strand.

[0031] In some embodiments, disclosed herein is a method for inhibiting the expression of ANGPTL3 gene in a cell, comprising administering to the cell an ANGPTL3 RNAi agent comprising an antisense strand that is at least partially complementary to a portion of ANGPTL3 mRNA having a sequence in Table 1. In some embodiments, disclosed herein is a method for inhibiting the expression of ANGPTL3 gene in a cell, comprising administering to the cell an ANGPTL3 RNAi agent comprising an antisense strand that is at least partially complementary to a portion of ANGPTL3 mRNA having a sequence in Table 1. In some embodiments, disclosed herein is a method for inhibiting the expression of ANGPTL3 gene in a cell, comprising administering to the cell an ANGPTL3 RNAi agent comprising an antisense strand that is at least partially complementary to a portion of ANGPTL3 mRNA having a sequence in Table 2 or 3. In some embodiments, disclosed herein is a method for inhibiting the expression of ANGPTL3 gene in a cell, comprising administering to the cell an ANGPTL3 RNAi agent comprising an antisense strand that is at least partially complementary to a portion of ANGPTL3 mRNA having a sequence in Table 2 or 3.

[0032] In some embodiments, disclosed herein is a composition for inhibiting expression of the ANGPTL3 gene in a cell, the method comprising administering a composition comprising an ANGPTL3 RNAi agent having a double-stranded duplex structure as described in Table 5.

[0033] In some embodiments, disclosed herein is a composition for delivering ANGPTL3 RNAi agent to liver cells in vivo, comprising ANGPTL3 RNAi agent conjugated or linked to targeting group.In some embodiments, targeting group is asialoglycoprotein receptor ligand.In some embodiments, described is a composition for delivering ANGPTL3 RNAi agent to liver cells in vivo, comprising ANGPTL3 RNAi agent linked to N-acetyl-galactosamine targeting ligand.

[0034] The ANGPTL3 RNAi agent disclosed herein is designed to target a specific position (SEQ ID NO: 1) on the ANGPTL3 gene.As defined herein, the antisense strand sequence is designed to target the ANGPTL3 gene at a given position on the gene when the 5'-end nucleobase of the antisense strand is aligned with the position that is 19 nucleotides downstream (towards the 3' end) from the position on the gene when base-pairing with the gene.For example, as illustrated in Tables 1 and 2 herein, the antisense strand sequence designed to target the ANGPTL3 gene at position 304 requires that the 5'-end nucleobase of the antisense strand is aligned with the 322nd position of the ANGPTL3 gene when base-pairing with the gene.

[0035] As provided herein, an ANGPTL3 RNAi agent does not require that the nucleobase at position 1 (5'→3') of the antisense strand be complementary to the gene, provided that there is at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) between the antisense strand and the gene over a core stretch sequence of at least 16 contiguous nucleotides. For example, for an ANGPTL3 RNAi agent disclosed herein that is designed to target position 304 of the ANGPTL3 gene, the 5'-terminal nucleobase of the antisense strand of the ANGPTL3 RNAi agent must align with position 322 of the gene; however, the 5'-terminal nucleobase of the antisense strand may, but need not, be complementary to position 322 of the ANGPTL3 gene, provided there is at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) between the antisense strand and the gene over a core stretch sequence of at least 16 contiguous nucleotides. In particular, as demonstrated by the various examples disclosed herein, the specific binding site of a gene by the antisense strand of an ANGPTL3 RNAi agent (e.g., whether the ANGPTL3 RNAi agent is designed to target the ANGPTL3 gene at position 304, 921, 922, or elsewhere) is an important factor in the level of inhibition achieved by the ANGPTL3 RNAi agent.

[0036] The use of ANGPTL3 RNAi agent provides a method for therapeutic (including preventive) treatment of disease / disorders associated with elevated TG and / or cholesterol levels and / or enhanced or elevated ANGPTL3 expression.The described ANGPTL3 RNAi agent mediates RNA interference and inhibits the expression of one or more genes required for the production of ANGPTL3.The ANGPTL3 RNAi agent can also be used to treat or prevent various diseases or disorders, including hypertriglyceridemia, obesity, hyperlipidemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, diabetes, cardiovascular disease, coronary artery disease, and other metabolic-related disorders and diseases.Furthermore, a composition is described for the in vivo delivery of ANGPTL3 RNAi agent to liver cells.

[0037] The pharmaceutical composition comprising one or more ANGPTL3 RNAi agents can be administered in several ways, depending on whether local or systemic treatment is desired.Administration can be, but is not limited to, intravenous, intraarterial, subcutaneous, intraperitoneal, subdermal (e.g., by implantation device), and intraparenchymal administration.In some embodiments, the pharmaceutical composition described herein is administered by subcutaneous injection.

[0038] In some embodiments, disclosed herein is a composition for delivering ANGPTL3 RNAi agent to liver cells in vivo, comprising ANGPTL3 RNAi agent conjugated or linked to targeting group.In some embodiments, targeting group is asialoglycoprotein receptor ligand.In some embodiments, described is a composition for delivering ANGPTL3 RNAi agent to liver cells in vivo, comprising ANGPTL3 RNAi agent linked to targeting ligand comprising N-acetyl-galactosamine.

[0039] In some embodiments, the ANGPTL3 RNAi agents described herein are (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32 ...). ), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s.

[0040] In some embodiments, the ANGPTL3 RNAi agents described herein are (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG33), (NAG34), (NAG35), (NAG36), (NAG37), (NAG38), (NAG39), (NAG40), (NAG41), (NAG42), (NAG43), (NAG44), (NAG45), (NAG46), (NAG47), (NAG48), (NAG49), (NAG50), (NAG50)s, (NAG51), (NAG51)s, (NAG52), (NAG53), (NAG54), (NAG55), (NAG56), (NAG57), (NAG58), (NAG59), (NAG60), (NAG61), (NAG62), (NAG63), (NAG64), (NAG65), (NAG66), (NAG67), (NAG68), (NAG69), (NAG70), (NAG71), (NAG72), (NAG73), (NAG74), (NAG75), (NAG76), (NAG77), (NAG78), (NAG79), (NAG80), (NAG81), (NAG82), (NAG83), (NAG84), (NAG85), (NAG86), (NAG87), (NAG88), (NAG89), (NAG90), (NAG91), (NAG92), (NAG93), (NAG94), (NAG , (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), and (NAG39)s.

[0041] The described ANGPTL3 RNAi agent and / or the composition comprising the ANGPTL3 RNAi agent can be used in a method for therapeutic treatment of a disease or condition caused by elevated TG and / or cholesterol levels. Such a method includes administering to a subject, for example a human or animal subject, an ANGPTL3 RNAi agent described herein.

[0042] In some embodiments, the ANGPTL3 RNAi agents disclosed herein comprise an antisense strand consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5'→3') UACUGAUCAAAUAUGUUGAGC (SEQ ID NO:3) by 0 or 1 nucleobase. In some embodiments, the ANGPTL3 RNAi agents disclosed herein comprise an antisense strand consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5'→3') UACUGAUCAAAUAUGUUGAGC (SEQ ID NO:3) by no more than 1 nucleotide, where all or substantially all of the nucleotides are modified nucleotides. In some embodiments, the ANGPTL3 RNAi agents disclosed herein comprise an antisense strand consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5'→3') UACUGAUCAAAUAUGUUGAGC (SEQ ID NO:3) by 0 or 1 nucleobase, where SEQ ID NO:3 is located at positions 1-21 (5'→3') of the antisense strand.

[0043] In some embodiments, the ANGPTL3 RNAi agents disclosed herein include an antisense strand consisting essentially of, or including, a modified nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO:2), where a, c, g, and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand. As will be clearly understood by one of skill in the art, the inclusion of phosphorothioate linkages shown in the modified nucleotide sequences disclosed herein replaces phosphodiester linkages typically present in oligonucleotides (see, e.g., Figures 5A-5K, which show all internucleoside linkages). In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising the nucleotide sequence (5'→3')usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO:2), where a, c, g and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand.

[0044] In some embodiments, the ANGPTL3 RNAi agents disclosed herein include an antisense strand consisting essentially of, or including, a modified nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')usAfscUfgAfuCfaAfaUfaUfgUfuGfasGfsc (SEQ ID NO: 4), where a, c, g, and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand. As will be clearly understood by one of skill in the art, the inclusion of phosphorothioate linkages shown in the modified nucleotide sequences disclosed herein replaces phosphodiester linkages typically present in oligonucleotides (see, e.g., Figures 5A-5K, which show all internucleoside linkages). In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising the nucleotide sequence (5'→3')usAfscUfgAfuCfaAfaUfaUfgUfuGfasGfsc (SEQ ID NO:4), where a, c, g and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand.

[0045] In some embodiments, the ANGPTL3 RNAi agents disclosed herein comprise an antisense strand consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5'→3') UACUGAUCAAAUAUGUUGAGU (SEQ ID NO: 6) by 0 or 1 nucleobase. In some embodiments, the ANGPTL3 RNAi agents disclosed herein comprise an antisense strand consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5'→3') UACUGAUCAAAUAUGUUGAGU (SEQ ID NO: 6) by no more than 1 nucleotide, where all or substantially all of the nucleotides are modified nucleotides. In some embodiments, the ANGPTL3 RNAi agents disclosed herein comprise an antisense strand consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5'→3') UACUGAUCAAAUAUGUUGAGU (SEQ ID NO: 6) by 0 or 1 nucleobase, where SEQ ID NO: 5 is located at positions 1-21 (5'→3') of the antisense strand.

[0046] In some embodiments, the ANGPTL3 RNAi agents disclosed herein include an antisense strand consisting essentially of, or comprising a modified nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsu (SEQ ID NO:5), where a, c, g, and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand. As will be clearly understood by one of skill in the art, the inclusion of phosphorothioate linkages shown in the modified nucleotide sequences disclosed herein replaces phosphodiester linkages typically present in oligonucleotides (see, e.g., Figures 5A-5K, which show all internucleoside linkages). In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising the nucleotide sequence (5'→3')usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsu (SEQ ID NO:5), where a, c, g and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand.

[0047] In some embodiments, the ANGPTL3 RNAi agents disclosed herein comprise an antisense strand consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5'→3') UUUGAAUUAAUGUCCAUGGGC (SEQ ID NO:8) by 0 or 1 nucleobase. In some embodiments, the ANGPTL3 RNAi agents disclosed herein comprise an antisense strand consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5'→3') UUUGAAUUAAUGUCCAUGGGC (SEQ ID NO:8) by no more than 1 nucleotide, where all or substantially all of the nucleotides are modified nucleotides. In some embodiments, the ANGPTL3 RNAi agents disclosed herein comprise an antisense strand consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5'→3') UUUGAAUUAAUGUCCAUGGGC (SEQ ID NO:8) by 0 or 1 nucleobase, where SEQ ID NO:8 is located at positions 1-21 (5'→3') of the antisense strand.

[0048] In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising, a modified nucleotide sequence differing by no more than one nucleotide from the nucleotide sequence (5'→3')usUfsusGfaAfuUfaAfuGfuCfcAfuGfggsc (SEQ ID NO:7), where a, c, g and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand. In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising the nucleotide sequence (5'→3')usUfsusGfaAfuUfaAfuGfuCfcAfuGfggsc (SEQ ID NO:7), where a, c, g and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand.

[0049] In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5'→3') UUUGAAUUAAUGUCCAUGGGU (SEQ ID NO: 10) by 0 or 1 nucleobase. In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5'→3') UUUGAAUUAAUGUCCAUGGGU (SEQ ID NO: 10) by no more than 1 nucleotide, wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5'→3') UUUGAAUUAAUGUCCAUGGGU (SEQ ID NO: 10) by 0 or 1 nucleobase, wherein SEQ ID NO: 10 is located at positions 1-21 (5'→3') of the antisense strand.

[0050] In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising, a modified nucleotide sequence differing by no more than one nucleotide from the nucleotide sequence (5'→3')usUfsusGfaAfuUfaAfuGfuCfcAfuGfgGfsu (SEQ ID NO:9), where a, c, g and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand. In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising the nucleotide sequence (5'→3')usUfsusGfaAfuUfaAfuGfuCfcAfuGfgGfsu (SEQ ID NO:9), where a, c, g and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand.

[0051] In some embodiments, the ANGPTL3 RNAi agents disclosed herein comprise an antisense strand consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5'→3') UGUUGAAUUAAUGUCCAUGGA (SEQ ID NO: 12) by 0 or 1 nucleobase. In some embodiments, the ANGPTL3 RNAi agents disclosed herein comprise an antisense strand consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5'→3') UGUUGAAUUAAUGUCCAUGGA (SEQ ID NO: 12) by no more than 1 nucleotide, where all or substantially all of the nucleotides are modified nucleotides. In some embodiments, the ANGPTL3 RNAi agents disclosed herein comprise an antisense strand consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5'→3') UGUUGAAUUAAUGUCCAUGGA (SEQ ID NO: 12) by 0 or 1 nucleobase, where SEQ ID NO: 12 is located at positions 1-21 (5'→3') of the antisense strand.

[0052] In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand that consists essentially of, or comprises, a modified nucleotide sequence differing by no more than one nucleotide from the nucleotide sequence (5'→3')usGfsusugaauuaaUfgUfcCfaUfgGfsa (SEQ ID NO:11), where a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand. In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising the nucleotide sequence (5'→3')usGfsusugaauuaaUfgUfcCfaUfgGfsa (SEQ ID NO:11), where a, c, g and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand.

[0053] In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand that consists essentially of, or comprises, a modified nucleotide sequence differing by no more than one nucleotide from the nucleotide sequence (5'→3')usGfsusUfgAfaUfuAfaUfgUfcCfaUfgGfsa (SEQ ID NO: 13), where a, c, g and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand. In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising the nucleotide sequence (5'→3')usGfsusUfgAfaUfuAfaUfgUfcCfaUfgGfsa (SEQ ID NO: 13), where a, c, g and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand.

[0054] In some embodiments, the ANGPTL3 RNAi agents disclosed herein comprise an antisense strand consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5'→3') ACAUCGUCUAACAUAGCAACC (SEQ ID NO: 15) by 0 or 1 nucleobase. In some embodiments, the ANGPTL3 RNAi agents disclosed herein comprise an antisense strand consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5'→3') ACAUCGUCUAACAUAGCAACC (SEQ ID NO: 15) by no more than 1 nucleotide, where all or substantially all of the nucleotides are modified nucleotides. In some embodiments, the ANGPTL3 RNAi agents disclosed herein comprise an antisense strand consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5'→3') ACAUCGUCUAACAUAGCAACC (SEQ ID NO: 15) by 0 or 1 nucleobase, where SEQ ID NO: 14 is located at positions 1-21 (5'→3') of the antisense strand.

[0055] In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand that consists essentially of, or comprises, a modified nucleotide sequence differing by no more than one nucleotide from the nucleotide sequence (5'→3')asCfsasUfcGfucuaaCfaUfaGfcAfaCfsc (SEQ ID NO: 14), where a, c, g and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand. In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising the nucleotide sequence (5'→3') asCfsasUfcGfucuaaCfaUfaGfcAfaCfsc (SEQ ID NO: 14), where a, c, g and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand.

[0056] In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising a nucleobase sequence that differs by 0 or 1 nucleobase from the nucleotide sequence (5'→3') UACUGAUCAAAUAUGUUGAGC (SEQ ID NO: 3) and a sense strand consisting essentially of, or comprising a nucleobase sequence that differs by 0 or 1 nucleobase from the nucleotide sequence (5'→3') GCUCAACAUAUUUGAUCAGUA (SEQ ID NO: 17). In some embodiments, an ANGPTL3 RNAi agent disclosed herein includes an antisense strand that consists essentially of, or comprises a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3') UACUGAUCAAAUAUGUUGAGC (SEQ ID NO: 3), in which all or substantially all of the nucleotides are modified nucleotides, and a sense strand that consists essentially of, or comprises a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3') GCUCAACAUAUUUGAUCAGUA (SEQ ID NO: 17), in which all or substantially all of the nucleotides are modified nucleotides.

[0057] In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising, a nucleobase sequence differing by 0 or 1 nucleobase from the nucleotide sequence (5'→3') UACUGAUCAAAUAUGUUGAGC (SEQ ID NO: 3), and an antisense strand consisting essentially of, or comprising, a nucleobase sequence differing by 0 or 1 nucleobase from the nucleotide sequence (5'→3') GCUCAACAU (A 2N ) UUUGAUCAGUA (SEQ ID NO: 19) differing by 0 or 1 nucleobase, 2N) represents a 2-aminoadenine nucleotide. In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand that consists essentially of, or includes a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3') UACUGAUCAAAUAUGUUGAGC (SEQ ID NO:3), where all or substantially all of the nucleotides are modified nucleotides, and the nucleotide sequence (5'→3') GCUCAACAU(A 2N ) UUUGAUCAGUA (SEQ ID NO: 19) and a sense strand consisting essentially of, or comprising a nucleotide sequence that differs by no more than one nucleotide from (A 2N ) represents a 2-aminoadenine nucleotide, and all or substantially all of the nucleotides are modified nucleotides.

[0058] In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising, a nucleobase sequence differing by 0 or 1 nucleobase from the nucleotide sequence (5'→3') UACUGAUCAAAUAUGUUGAGC (SEQ ID NO: 3), and an antisense strand consisting essentially of, or comprising, a nucleobase sequence differing by 0 or 1 nucleobase from the nucleotide sequence (5'→3') GCUCAAC (A 2N )U(A 2N ) UUUGAUCAGUA (SEQ ID NO: 21) differing by 0 or 1 nucleobase, 2N ) represents a 2-aminoadenine nucleotide. In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand that consists essentially of, or comprises a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3') UACUGAUCAAAUAUGUUGAGC (SEQ ID NO: 3), where all or substantially all of the nucleotides are modified nucleotides, and an antisense strand that consists essentially of, or comprises a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3') UACUGAUCAAAUAUGUUGAGC (SEQ ID NO: 3), where all or substantially all of the nucleotides are modified nucleotides. 2N )U(A 2Na sense strand consisting essentially of, or comprising, a nucleotide sequence that differs by one or less nucleotides from (A 2N ) represents a 2-aminoadenine nucleotide, including a sense strand in which all or substantially all of the nucleotides are modified nucleotides.

[0059] In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising the nucleobase sequence differing by 0 or 1 nucleobase from the nucleotide sequence (5'→3') UACUGAUCAAAUAUGUUGAGU (SEQ ID NO: 6) and a sense strand consisting essentially of, or comprising the nucleobase sequence differing by 0 or 1 nucleobase from the nucleotide sequence (5'→3') ACUCAACAUAUUUGAUCAGUA (SEQ ID NO: 24). In some embodiments, an ANGPTL3 RNAi agent disclosed herein includes an antisense strand consisting essentially of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3') UACUGAUCAAAUAUGUUGAGU (SEQ ID NO: 6), where all or substantially all of the nucleotides are modified nucleotides, and a sense strand consisting essentially of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3') ACUCAACAUAUUUGAUCAGUA (SEQ ID NO: 24), where all or substantially all of the nucleotides are modified nucleotides.

[0060] In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising a nucleobase sequence that differs by 0 or 1 nucleobase from the nucleotide sequence (5'→3') UUUGAAUUAAUGUCCAUGGGC (SEQ ID NO: 8) and a sense strand consisting essentially of, or comprising a nucleobase sequence that differs by 0 or 1 nucleobase from the nucleotide sequence (5'→3') GCCCAUGGACAUUAAUUCAAA (SEQ ID NO: 26). In some embodiments, an ANGPTL3 RNAi agent disclosed herein includes an antisense strand consisting essentially of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3') UUUGAAUUAAUGUCCAUGGGC (SEQ ID NO:8), in which all or substantially all of the nucleotides are modified nucleotides, and a sense strand consisting essentially of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3') GCCCAUGGACAUUAAUUCAAA (SEQ ID NO:26), in which all or substantially all of the nucleotides are modified nucleotides.

[0061] In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising the nucleobase sequence differing by 0 or 1 nucleobase from the nucleotide sequence (5'→3') UUUGAAUUAAUGUCCAUGGGU (SEQ ID NO: 10) and a sense strand consisting essentially of, or comprising the nucleobase sequence differing by 0 or 1 nucleobase from the nucleotide sequence (5'→3') ACCCAUGGACAUUAAUUCAAA (SEQ ID NO: 28). In some embodiments, an ANGPTL3 RNAi agent disclosed herein includes an antisense strand consisting essentially of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3') UUUGAAUUAAUGUCCAUGGGU (SEQ ID NO: 10), where all or substantially all of the nucleotides are modified nucleotides, and a sense strand consisting essentially of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3') ACCCAUGGACAUUAAUUCAAA (SEQ ID NO: 28), where all or substantially all of the nucleotides are modified nucleotides.

[0062] In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising a nucleobase sequence that differs by 0 or 1 nucleobase from the nucleotide sequence (5'→3') UGUUGAAUUAAUGUCCAUGGA (SEQ ID NO: 12) and a sense strand consisting essentially of, or comprising a nucleobase sequence that differs by 0 or 1 nucleobase from the nucleotide sequence (5'→3') UCCAUGGACAUUAAUUCAACA (SEQ ID NO: 30). In some embodiments, an ANGPTL3 RNAi agent disclosed herein includes an antisense strand consisting essentially of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3') UGUUGAAUUAAUGUCCAUGGA (SEQ ID NO: 12), where all or substantially all of the nucleotides are modified nucleotides, and a sense strand consisting essentially of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3') UCCAUGGACAUUAAUUCAACA (SEQ ID NO: 30), where all or substantially all of the nucleotides are modified nucleotides.

[0063] In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising a nucleobase sequence that differs by 0 or 1 nucleobase from the nucleotide sequence (5'→3') ACAUCGUCUAACAUAGCAACC (SEQ ID NO: 15) and a sense strand consisting essentially of, or comprising a nucleobase sequence that differs by 0 or 1 nucleobase from the nucleotide sequence (5'→3') GGUUGCUAUGUUAGACGAUGU (SEQ ID NO: 32). In some embodiments, an ANGPTL3 RNAi agent disclosed herein includes an antisense strand consisting essentially of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3') ACAUCGUCUAACAUAGCAACC (SEQ ID NO: 15), where all or substantially all of the nucleotides are modified nucleotides, and a sense strand consisting essentially of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3') GGUUGCUAUGUUAGACGAUGU (SEQ ID NO: 32), where all or substantially all of the nucleotides are modified nucleotides.

[0064] In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3') usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO: 2), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3') gcucaacaUfAfUfuugaucagua (SEQ ID NO: 16), where a, c, g and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage. In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3') usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO:2), and a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3') gcucaacaUfAfUfuugaucagua (SEQ ID NO:16), wherein the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises N-acetyl-galactosamine.

[0065] In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3') usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO: 2), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3') gcucaacaUfa_2NUfuugaucagua (SEQ ID NO: 18), where a, c, g and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; a_2N represents 2'-O-methyl-2-amino adenosine (see Table 6); Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage. In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3') usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO:2), and a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3') gcucaacaUfa_2NUfuugaucagua (SEQ ID NO:18), wherein the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises N-acetyl-galactosamine.

[0066] In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3') usAfscUfgAfuCfaAfaUfaUfgUfuGfasGfsc (SEQ ID NO: 4), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3') gcucaacaUfAfUfuugaucagua (SEQ ID NO: 16), where a, c, g and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage. In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3') usAfscUfgAfuCfaAfaUfaUfgUfuGfasGfsc (SEQ ID NO:4), and a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3') gcucaacaUfAfUfuugaucagua (SEQ ID NO:16), wherein the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises N-acetyl-galactosamine.

[0067] In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3') usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO: 2), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3') gcucaaca_2NUfa_2NUfuugaucagua (SEQ ID NO: 20), where a, c, g and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; a_2N represents 2'-O-methyl-2-amino adenosine (see Table 6); Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage. In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3') usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO:2), and a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3') gcucaaca_2NUfa_2NUfuugaucagua (SEQ ID NO:20), wherein the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises N-acetyl-galactosamine.

[0068] In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3') usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO: 2), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3') gcUfcAfaCfaUfAfUfuugaucagua (SEQ ID NO: 22), where a, c, g and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; a_2N represents 2'-O-methyl-2-amino adenosine (see Table 6); Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage. In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3') usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO:2), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3') gcUfcAfaCfaUfAfUfuugaucagua (SEQ ID NO:22), wherein the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises N-acetyl-galactosamine.

[0069] In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3') usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsu (SEQ ID NO:5), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3') acucaacaUfAfUfuugaucagua (SEQ ID NO:23), where a, c, g and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage. In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3') usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsu (SEQ ID NO:5), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3') acucaacaUfAfUfuugaucagua (SEQ ID NO:23), wherein the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises N-acetyl-galactosamine.

[0070] In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3') usUfsusGfaAfuUfaAfuGfuCfcAfuGfggsc (SEQ ID NO:7), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3') gcccauggAfCfAfuuaauucaaa (SEQ ID NO:25), where a, c, g and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage. In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3') usUfsusGfaAfuUfaAfuGfuCfcAfuGfggsc (SEQ ID NO:7), and a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3') gcccauggAfCfAfuuaauucaaa (SEQ ID NO:25), wherein the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises N-acetyl-galactosamine.

[0071] In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usUfsusGfaAfuUfaAfuGfuCfcAfuGfgGfsu (SEQ ID NO:9), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3')acccauggAfCfAfuuaauucaaa (SEQ ID NO:27), where a, c, g and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage. In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3') usUfsusGfaAfuUfaAfuGfuCfcAfuGfgGfsu (SEQ ID NO:9), and a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3') acccauggAfCfAfuuaauucaaa (SEQ ID NO:27), wherein the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises N-acetyl-galactosamine.

[0072] In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usGfsusugaauuaaUfgUfcCfaUfgGfsa (SEQ ID NO:11), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3')uccauggaCfAfUfuaauucaaca (SEQ ID NO:29), where a, c, g and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage. In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usGfsusugaauuaaUfgUfcCfaUfgGfsa (SEQ ID NO:11), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3')uccauggaCfAfUfuaauucaaca (SEQ ID NO:29), wherein the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises N-acetyl-galactosamine.

[0073] In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3') usGfsusUfgAfaUfuAfaUfgUfcCfaUfgGfsa (SEQ ID NO: 13), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3') uccauggaCfAfUfuaauucaaca (SEQ ID NO: 29), where a, c, g and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage. In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3') usGfsusUfgAfaUfuAfaUfgUfcCfaUfgGfsa (SEQ ID NO: 13), and a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3') uccauggaCfAfUfuaauucaaca (SEQ ID NO: 29), wherein the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises N-acetyl-galactosamine.

[0074] In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3') asCfsasUfcGfucuaaCfaUfaGfcAfaCfsc (SEQ ID NO: 14), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3') gguugcuaUfGfUfuagacgaugu (SEQ ID NO: 31), where a, c, g and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage. In some embodiments, an ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3') asCfsasUfcGfucuaaCfaUfaGfcAfaCfsc (SEQ ID NO: 14), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3')cccuaaaaGfGfGfacaguauucu (SEQ ID NO: 31), wherein the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises N-acetyl-galactosamine.

[0075] In some embodiments, the ANGPTL3 RNAi agent disclosed herein has the following nucleotide sequence (5'→3'): UACUGAUCAAAUAUGUUGAGC (SEQ ID NO:3); UACUGAUCAAAUAUGUUGAGU (SEQ ID NO:6); UUUGAAUUAAUGUCCAUGGGC (SEQ ID NO:8); UUUGAAUUAAUGUCCAUGGGU (SEQ ID NO: 10); UGUUGAAUUAAUGUCCAUGGA (SEQ ID NO: 12); or ACAUCGUCUAACAUAGCAACC (SEQ ID NO: 15) and an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotide from one of the above, and the ANGPTL3 RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; all or substantially all of the nucleotides in both the antisense strand and the sense strand are modified nucleotides.

[0076] In some embodiments, the ANGPTL3 RNAi agent disclosed herein has the following nucleotide sequence (5'→3'): UACUGAUCAAAUAUGUUGAGC (SEQ ID NO:3); UACUGAUCAAAUAUGUUGAGU (SEQ ID NO:6); UUUGAAUUAAUGUCCAUGGGC (SEQ ID NO:8); UUUGAAUUAAUGUCCAUGGGU (SEQ ID NO: 10); UGUUGAAUUAAUGUCCAUGGA (SEQ ID NO: 12); or ACAUCGUCUAACAUAGCAACC (SEQ ID NO: 15) and an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotide from one of, wherein the ANGPTL3 RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; all or substantially all of the nucleotides in both the antisense strand and the sense strand are modified nucleotides; the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence; the sense strand also comprises a targeting ligand covalently linked to the 5' end; and the targeting ligand comprises N-acetyl-galactosamine.

[0077] In some embodiments, the ANGPTL3 RNAi agent disclosed herein has the following nucleotide sequence (5'→3'): UACUGAUCAAAUAUGUUGAGC (SEQ ID NO:3); UACUGAUCAAAUAUGUUGAGU (SEQ ID NO:6); UUUGAAUUAAUGUCCAUGGGC (SEQ ID NO:8); UUUGAAUUAAUGUCCAUGGGU (SEQ ID NO: 10); UGUUGAAUUAAUGUCCAUGGA (SEQ ID NO: 12); or ACAUCGUCUAACAUAGCAACC (SEQ ID NO: 15) and an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotide from one of the following, where the ANGPTL3 RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; all or substantially all of the nucleotides in both the antisense strand and the sense strand are modified nucleotides; the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence; the sense strand also comprises a targeting ligand covalently linked to the 5' end; the targeting ligand comprises N-acetyl-galactosamine, and each of the antisense strand sequences is located at positions 1-21 of the antisense strand.

[0078] In some embodiments, the ANGPTL3 RNAi agents disclosed herein comprise an antisense strand and a sense strand, wherein the antisense strand and the sense strand have the following nucleotide sequence (5'→3') pair: UACUGAUCAAAUAUGUUGAGC (SEQ ID NO: 3) and GCUCAACAUAUUUGAUCAGUA (SEQ ID NO: 17); UACUGAUCAAAUAUGUUGAGC (SEQ ID NO: 3) and GCUCAACAU (A 2N ) UUUGA UCAGUA (SEQ ID NO: 19) (wherein, (A 2N ) represents 2-aminoadenine nucleotide); UACUGAUCAAAUAUGUUGAGC (SEQ ID NO: 3) and GCUCAAC(A 2N )U(A 2N )UUUGAUCAGUA (SEQ ID NO:21) (wherein (A 2N ) represents 2-aminoadenine nucleotide); UACUGAUCAAAUAUGUUGAGU (SEQ ID NO:6) and ACUCAACAUAUUUGAUCAGUA (SEQ ID NO:24); UUUGAAUUAAUGUCCAUGGGC (SEQ ID NO:8) and GCCCAUGGACAUUAAUUCAAA (SEQ ID NO:26); UUUGAAUUAAUGUCCAUGGGU (SEQ ID NO: 10) and ACCCAUGGACAUUAAUUCAAA (SEQ ID NO: 28); UGUUGAAUUAAUGUCCAUGGA (SEQ ID NO: 12) and UCCAUGGACAUUAAUUCAACA (SEQ ID NO: 30); or ACAUCGUCUAACAUAGCAACC (SEQ ID NO: 15) and GGUUGCUAUGUUAGACGAUGU (SEQ ID NO: 32) wherein all or substantially all of the nucleotides in both the antisense and sense strands are modified nucleotides.

[0079] In some embodiments, the ANGPTL3 RNAi agents disclosed herein comprise an antisense strand and a sense strand, wherein the antisense strand and the sense strand have the following nucleotide sequence (5'→3') pair: UACUGAUCAAAUAUGUUGAGC (SEQ ID NO: 3) and GCUCAACAUAUUUGAUCAGUA (SEQ ID NO: 17); UACUGAUCAAAUAUGUUGAGC (SEQ ID NO: 3) and GCUCAACAU (A 2N ) UUUGAUCAGUA (SEQ ID NO: 19) (wherein, (A 2N ) represents 2-aminoadenine nucleotide); UACUGAUCAAAUAUGUUGAGC (SEQ ID NO: 3) and GCUCAAC(A 2N )U(A 2N )UUUGAUCAGUA (SEQ ID NO:21) (wherein (A 2N ) represents 2-aminoadenine nucleotide); UACUGAUCAAAUAUGUUGAGU (SEQ ID NO:6) and ACUCAACAUAUUUGAUCAGUA (SEQ ID NO:24); UUUGAAUUAAUGUCCAUGGGC (SEQ ID NO:8) and GCCCAUGGACAUUAAUUCAAA (SEQ ID NO:26); UUUGAAUUAAUGUCCAUGGGU (SEQ ID NO: 10) and ACCCAUGGACAUUAAUUCAAA (SEQ ID NO: 28); UGUUGAAUUAAUGUCCAUGGA (SEQ ID NO: 12) and UCCAUGGACAUUAAUUCAACA (SEQ ID NO: 30); or ACAUCGUCUAACAUAGCAACC (SEQ ID NO: 15) and GGUUGCUAUGUUAGACGAUGU (SEQ ID NO: 32) wherein all or substantially all of the nucleotides in both the antisense strand and the sense strand are modified nucleotides; the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence; the sense strand also comprises a targeting ligand covalently linked to the 5' end; and the targeting ligand comprises N-acetyl-galactosamine.

[0080] In some embodiments, the ANGPTL3 RNAi agent disclosed herein has the following nucleotide sequence (5'→3'): usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc(SEQ ID NO:2); usAfscUfgAfuCfaAfaUfaUfgUfuGfasGfsc(SEQ ID NO:4); usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsu(SEQ ID NO:5); usUfsusGfaAfuUfaAfuGfuCfcAfuGfggsc(SEQ ID NO:7); usUfsusGfaAfuUfaAfuGfuCfcAfuGfgGfsu(SEQ ID NO:9); usGfsusugaauuaaUfgUfcCfaUfgGfsa (SEQ ID NO: 11); usGfsusUfgAfaUfuAfaUfgUfcCfaUfgGfsa (SEQ ID NO: 13); asCfsasUfcGfucuaaCfaUfaGfcAfaCfsc (SEQ ID NO: 14) (wherein a, c, g and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage), wherein the ANGPTL3 RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand, and wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides.

[0081] In some embodiments, the ANGPTL3 RNAi agent disclosed herein has the following nucleotide sequence (5'→3'): usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc(SEQ ID NO:2); usAfscUfgAfuCfaAfaUfaUfgUfuGfasGfsc(SEQ ID NO:4); usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsu(SEQ ID NO:5); usUfsusGfaAfuUfaAfuGfuCfcAfuGfggsc(SEQ ID NO:7); usUfsusGfaAfuUfaAfuGfuCfcAfuGfgGfsu(SEQ ID NO:9); usGfsusugaauuaaUfgUfcCfaUfgGfsa (SEQ ID NO: 11); usGfsusUfgAfaUfuAfaUfgUfcCfaUfgGfsa (SEQ ID NO: 13); asCfsasUfcGfucuaaCfaUfaGfcAfaCfsc (SEQ ID NO: 14) and an antisense strand that consists essentially of, or comprises a modified nucleotide sequence that differs by 0 or 1 nucleotide from one of the following, wherein the ANGPTL3 RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; all or substantially all of the nucleotides of the sense strand are modified nucleotides; all or substantially all of the nucleotides of both the antisense strand and the sense strand are modified nucleotides; the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence; the sense strand also comprises a targeting ligand covalently linked to the 5' end; and the targeting ligand comprises N-acetyl-galactosamine.

[0082] In some embodiments, the ANGPTL3 RNAi agents disclosed herein comprise the following nucleotide sequence pair (5'→3'): usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO: 2) and gcucaacaUfAfUfuugaucagua (SEQ ID NO: 16); usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO: 2) and gcucaacaUfa_2NUfuugaucagua (SEQ ID NO: 18); usAfscUfgAfuCfaAfaUfaUfgUfuGfasGfsc (SEQ ID NO: 4) and gcucaacaUfAfUfuugaucagua (SEQ ID NO: 16); usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO: 2) and gcucaaca_2NUfa_2NUfuugaucagua (SEQ ID NO:20); usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO: 2) and gcUfcAfaCfaUfAfUfuugaucagua (SEQ ID NO:22); usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsu (SEQ ID NO: 5) and acucaacaUfAfUfuugaucagua (SEQ ID NO:23); usUfsusGfaAfuUfaAfuGfuCfcAfuGfggsc (SEQ ID NO: 7) and gcccauggAfCfAfuuaauucaaa (SEQ ID NO:25); usUfsusGfaAfuUfaAfuGfuCfcAfuGfgGfsu (SEQ ID NO: 9) and acccauggAfCfAfuuaauucaaa (SEQ ID NO:27); usGfsusugaauuaaUfgUfcCfaUfgGfsa (SEQ ID NO: 11) and uccauggaCfAfUfuaauucaaca (SEQ ID NO:29); usGfsusUfgAfaUfuAfaUfgUfcCfaUfgGfsa (SEQ ID NO: 13) and uccauggaCfAfUfuaauucaaca (SEQ ID NO: 29); or asCfsasUfcGfucuaaCfaUfaGfcAfaCfsc (SEQ ID NO: 14) and gguugcuaUfGfUfuagacgaugu (SEQ ID NO: 31) (wherein a, c, g and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; a_2N represents 2'-O-methyl-2-amino adenosine (see Table 6); and s represents a phosphorothioate linkage), comprising an antisense strand and a sense strand that consist essentially of, or comprise a modified nucleotide sequence that differs by 0 or 1 nucleotide from one of the following:

[0083] In some embodiments, the ANGPTL3 RNAi agents disclosed herein comprise the following nucleotide sequence pair (5'→3'): usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO: 2) and gcucaacaUfAfUfuugaucagua (SEQ ID NO: 16); usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO: 2) and gcucaacaUfa_2NUfuugaucagua (SEQ ID NO: 18); usAfscUfgAfuCfaAfaUfaUfgUfuGfasGfsc (SEQ ID NO: 4) and gcucaacaUfAfUfuugaucagua (SEQ ID NO: 16); usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO: 2) and gcucaaca_2NUfa_2NUfuugaucagua (SEQ ID NO:20); usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO: 2) and gcUfcAfaCfaUfAfUfuugaucagua (SEQ ID NO:22); usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsu (SEQ ID NO: 5) and acucaacaUfAfUfuugaucagua (SEQ ID NO:23); usUfsusGfaAfuUfaAfuGfuCfcAfuGfggsc (SEQ ID NO: 7) and gcccauggAfCfAfuuaauucaaa (SEQ ID NO:25); usUfsusGfaAfuUfaAfuGfuCfcAfuGfgGfsu (SEQ ID NO: 9) and acccauggAfCfAfuuaauucaaa (SEQ ID NO:27); usGfsusugaauuaaUfgUfcCfaUfgGfsa (SEQ ID NO: 11) and uccauggaCfAfUfuaauucaaca (SEQ ID NO:29); usGfsusUfgAfaUfuAfaUfgUfcCfaUfgGfsa (SEQ ID NO: 13) and uccauggaCfAfUfuaauucaaca (SEQ ID NO: 29); or asCfsasUfcGfucuaaCfaUfaGfcAfaCfsc (SEQ ID NO: 14) and gguugcuaUfGfUfuagacgaugu (SEQ ID NO: 31) (wherein a, c, g and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; a_2N represents 2'-O-methyl-2-amino adenosine (see Table 6); and s represents a phosphorothioate linkage), wherein the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, the targeting ligand comprising N-acetyl-galactosamine.

[0084] In some embodiments, an ANGPTL3 RNAi agent disclosed herein has the sequence (5'→3'): UACUGAUCAAAUAUGUUGA (SEQ ID NO:50); UGUUGAAUUAAUGUCCAUG (SEQ ID NO:55); UUUGAAUUAAUGUCCAUGG (SEQ ID NO: 60); or ACAUCGUCUAACAUAGCAA (SEQ ID NO: 64) and an antisense strand comprising a nucleobase sequence which differs by 0 or 1 nucleobase from the nucleotide sequence selected from the group consisting of:

[0085] In some embodiments, an ANGPTL3 RNAi agent disclosed herein has the sequence (5'→3'): UACUGAUCAAAUAUGUUGA (SEQ ID NO:50); UGUUGAAUUAAUGUCCAUG (SEQ ID NO:55); UUUGAAUUAAUGUCCAUGG (SEQ ID NO: 60); or ACAUCGUCUAACAUAGCAA (SEQ ID NO: 64) and an antisense strand comprising a nucleobase sequence that differs by 0 or 1 nucleobase from a nucleotide sequence selected from the group consisting of: wherein all or substantially all of the nucleotides are modified nucleotides.

[0086] In some embodiments, an ANGPTL3 RNAi agent disclosed herein has the sequence (5'→3'): UACUGAUCAAAUAUGUUGA (SEQ ID NO:50); UGUUGAAUUAAUGUCCAUG (SEQ ID NO:55); UUUGAAUUAAUGUCCAUGG (SEQ ID NO: 60); or ACAUCGUCUAACAUAGCAA (SEQ ID NO: 64) and an antisense strand comprising a nucleobase sequence that differs by 0 or 1 nucleobase from a nucleotide sequence selected from the group consisting of: wherein all or substantially all of the nucleotides are modified nucleotides, and wherein SEQ ID NO:50, SEQ ID NO:55, SEQ ID NO:60, or SEQ ID NO:64 are located at nucleotide positions 1 to 19 (5'→3') of the antisense strand, respectively.

[0087] In some embodiments, the ANGPTL3 RNAi agents disclosed herein each have the sequence (5'→3'): UACUGAUCAAAUAUGUUGA (SEQ ID NO:50) and UCAACAUAUUUGAUCAGUA (SEQ ID NO:130); UACUGAUCAAAUAUGUUGA (SEQ ID NO:50) and UCAACAU(A 2N ) UUUGAUCAGUA (SEQ ID NO: 131) (wherein, (A 2N ) represents 2-aminoadenine nucleotide); UACUGAUCAAAUAUGUUGA (SEQ ID NO:50) and UCAAC(A 2N )U(A 2N )UUUGAUCAGUA (SEQ ID NO: 132) (wherein (A 2N ) represents 2-aminoadenine nucleotide); UGUUGAAUUAAUGUCCAUG (SEQ ID NO:55) and CAUGGACAUUAAUUCAACA (SEQ ID NO:145); UUUGAAUUAAUGUCCAUGG (SEQ ID NO:60) and CCAUGGACAUUAAUUCAAA (SEQ ID NO:150); ACAUCGUCUAACAUAGCAA (SEQ ID NO: 64) and UUGCUAUGUUAGACGAUGU (SEQ ID NO: 154) The nucleotide sequence pair includes an antisense strand and a sense strand that contain a nucleobase sequence that differs by 0 or 1 nucleobase from the nucleotide sequence pair selected from the group consisting of:

[0088] In some embodiments, the ANGPTL3 RNAi agents disclosed herein each have the sequence (5'→3'): UACUGAUCAAAUAUGUUGA (SEQ ID NO:50) and UCAACAUAUUUGAUCAGUA (SEQ ID NO:130); UACUGAUCAAAUAUGUUGA (SEQ ID NO:50) and UCAACAU(A 2N ) UUUGAUCAGUA (SEQ ID NO: 131) (wherein, (A 2N ) represents 2-aminoadenine nucleotide); UACUGAUCAAAUAUGUUGA (SEQ ID NO:50) and UCAAC(A 2N )U(A 2N )UUUGAUCAGUA (SEQ ID NO: 132) (wherein (A 2N ) represents 2-aminoadenine nucleotide); UGUUGAAUUAAUGUCCAUG (SEQ ID NO:55) and CAUGGACAUUAAUUCAACA (SEQ ID NO:145); UUUGAAUUAAUGUCCAUGG (SEQ ID NO:60) and CCAUGGACAUUAAUUCAAA (SEQ ID NO:150); ACAUCGUCUAACAUAGCAA (SEQ ID NO: 64) and UUGCUAUGUUAGACGAUGU (SEQ ID NO: 154) and an antisense strand that comprises a nucleobase sequence that differs by 0 or 1 nucleobase from the nucleotide sequence pair selected from the group consisting of: wherein all or substantially all of the nucleotides are modified nucleotides.

[0089] In some embodiments, the compositions described herein comprising one or more ANGPTL3 RNAi agents are packaged in a kit, container, pack, dispenser, pre-filled syringe, or vial. In some embodiments, the compositions described herein are administered parenterally.

[0090] As used herein, the terms "oligonucleotide" and "polynucleotide" each refer to a polymer of linked nucleosides, which may be independently modified or unmodified.

[0091] As used herein, "RNAi agent" (also referred to as "RNAi trigger") refers to a composition containing an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that can degrade or inhibit (e.g., under appropriate conditions) translation of a messenger RNA (mRNA) transcript of a target mRNA in a sequence-specific manner. As used herein, an RNAi agent can operate by the RNA interference mechanism (i.e., inducing RNA interference by interacting with the RNA interference pathway machinery (RNA-induced silencing complex or RISC) of mammalian cells) or by any alternative mechanism or pathway. Although RNAi agents, as that term is used herein, are believed to operate primarily by the RNA interference mechanism, the disclosed RNAi agents are not bound by or limited to any particular pathway or mechanism of action. The RNAi agents disclosed herein include sense and antisense strands and include, but are not limited to, short (or small) interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and dicer substrates. The antisense strand of the RNAi agent described herein is at least partially complementary to the mRNA to be targeted (i.e., ANGPTL3 mRNA). The RNAi agent may contain one or more modified nucleotides and / or one or more non-phosphodiester bonds.

[0092] As used herein, the terms "silencing," "reducing," "inhibiting," "downregulating," or "knockdown," when referring to the expression of a given gene, mean that expression of the gene, as measured by the level of RNA transcribed from the gene or the level of a polypeptide, protein, or protein subunit translated from the mRNA, is decreased in a cell, group of cells, tissue, organ, or subject in which the gene is transcribed, when the cell, group of cells, tissue, organ, or subject is treated with an RNAi agent as described herein, compared to a second cell, group of cells, tissue, organ, or subject that has not been so treated.

[0093] As used herein, the terms "sequence" and "nucleotide sequence" mean a sequence or order of nucleic acid bases or nucleotides written with a sequence of letters using standard nomenclature.

[0094] As used herein, "base", "nucleotide base" or "nucleobase" refers to a heterocyclic pyrimidine or purine compound that is a component of nucleotide, including the primary purine bases adenine and guanine, and the primary pyrimidine bases cytosine, thymine, and uracil. Nucleobases can be further modified to include, but are not limited to, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases (see, for example, Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008). The synthesis of such modified nucleobases (including phosphoramidite compounds that include modified nucleobases) is known in the art.

[0095] As used herein, and unless otherwise indicated, the term "complementary" when used to describe a first nucleobase or nucleotide sequence (e.g., an RNAi agent sense strand or a target mRNA) in the context of a second nucleobase or nucleotide sequence (e.g., an RNAi agent antisense strand or a single-stranded antisense oligonucleotide) refers to the ability of an oligonucleotide or polynucleotide comprising a first nucleotide sequence to hybridize (form base pair hydrogen bonds under mammalian physiological conditions (or similar conditions in vitro)) with an oligonucleotide or polynucleotide comprising a second nucleotide sequence under certain standard conditions to form a double-stranded or double helix structure. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs, and include natural or modified nucleotides or nucleotide mimics, at least to the extent that the above hybridization requirements are met. Sequence identity or complementarity is independent of modification. For example, a and Af, as defined herein, are complementary to U (or T) and identical to A for purposes of determining identity or complementarity.

[0096] As used herein, "perfectly complementary" or "fully complementary" means that in a hybridized pair of nucleic acid base or nucleotide sequence molecules, all (100%) of the bases in a contiguous sequence of a first oligonucleotide hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may include all or a portion of the first or second nucleotide sequence.

[0097] As used herein, "partially complementary" means that in a hybridized pair of nucleic acid base or nucleotide sequence molecules, at least 70%, but not all, of the bases in a contiguous sequence of a first oligonucleotide hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may include all or a portion of the first or second nucleotide sequence.

[0098] As used herein, "substantially complementary" means that in a hybridized pair of nucleic acid base or nucleotide sequence molecules, at least 85%, but not all, of the bases in a contiguous sequence of a first oligonucleotide hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may include all or a portion of the first or second nucleotide sequence.

[0099] As used herein, the terms "complementary," "fully complementary," "partially complementary," and "substantially complementary" are used in reference to nucleobase or nucleotide matches between a sense strand and an antisense strand of an RNAi agent, or between an antisense strand of an RNAi agent and the sequence of an ANGPTL3 mRNA.

[0100] As used herein, the term "substantially identical" or "substantial identity" applied to a nucleic acid sequence means that a nucleotide sequence (or a portion of a nucleotide sequence) has at least about 85% sequence identity or higher, e.g., at least 90%, at least 95%, or at least 99% identity, compared to a reference sequence. The percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window. The percentage is calculated by determining the number of positions where the same type of nucleobase is present in both sequences, obtaining the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. The invention disclosed herein encompasses nucleotide sequences that are substantially identical to those disclosed herein.

[0101] As used herein, the terms "treat", "treatment" and the like refer to methods or steps taken to provide relief or abatement from the number, severity, and / or frequency of one or more symptoms of a disease in a subject. As used herein, "treat" and "treatment" may include preventative treatment, management, prophylactic treatment, and / or inhibition or reduction of the number, severity, and / or frequency of one or more symptoms of a disease in a subject.

[0102] As used herein, the phrase "introducing into cell" when referring to RNAi agent means functionally delivering RNAi agent into cell.The phrase "functionally delivering" means delivering RNAi agent into cell in a manner that allows RNAi agent to have expected biological activity, for example, sequence-specific inhibition of gene expression.

[0103] Unless otherwise stated, symbols used herein [ka] The use of means that any group or groups can be attached thereto in accordance with the scope of the invention described herein.

[0104] As used herein, the term "isomers" refers to compounds that have identical molecular formulae but differ in the nature or sequence of bonds of their atoms or the arrangement of their atoms in space. Isomers that differ in the arrangement of their atoms in space are called "stereoisomers." Stereoisomers that are not mirror images of one another are called "diastereoisomers," and stereoisomers that are non-superimposable mirror images are called "enantiomers" or sometimes optical isomers. A carbon atom bonded to four non-identical substituents is called a "chiral center."

[0105] As used herein, unless specifically identified in a structure as having a particular conformation, for each structure in which an asymmetric center exists, thus giving rise to an enantiomer, diastereomer, or other stereoisomeric configuration, each structure disclosed herein is intended to represent all such possible isomers, including its optically pure and racemic forms. For example, the structures disclosed herein are intended to encompass mixtures of diastereomers as well as single stereoisomers.

[0106] As used in the claims of this specification, the phrase "consisting of The phrase "consisting essentially of" excludes any element, step, or ingredient not specified in the claim. As used in the claims herein, the phrase "consisting essentially of" limits the claim to those materials or steps specified and that do not materially affect the basic and novel characteristics of the claimed invention.

[0107] Those skilled in the art will readily understand and appreciate that the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or S atoms) in a protonated or deprotonated state depending on the environment in which the compound or composition is placed. Thus, as used herein, the structures disclosed herein contemplate that certain functional groups, such as, for example, OH, SH, or NH, may be protonated or deprotonated. The disclosures herein are intended to encompass the disclosed compounds and compositions regardless of their protonation state based on the environment (such as pH), as would be readily understood by those skilled in the art.

[0108] As used herein, the term "linked" or "conjugated" when referring to a connection between two compounds or molecules means that the two compounds or molecules are joined by a covalent bond. Unless otherwise stated, the terms "linked" and "conjugated" as used herein may refer to a connection between a first compound and a second compound with or without any intervening atom or group of atoms.

[0109] As used herein, the term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to." The term "or" is used herein to mean, and is used interchangeably with, the term "and / or," unless context clearly indicates otherwise.

[0110] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art.Methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, but suitable methods and materials are described below.All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety.In case of conflict, the present specification, including definitions, will control.In addition, materials, methods, and examples are illustrative only and are not intended to be limiting.

[0111] Other objects, features, aspects, and advantages of the present invention will become apparent from the following detailed description, the accompanying drawings, and the claims. [Brief description of the drawings]

[0112] [Figure 1A]1A-1D are chemical structural representations of ANGPTL3 RNAi agent AD05488 conjugated to an N-acetyl-galactosamine tridentate ligand having the structure (NAG37)s (see Table 6) at the 5' end of the sense strand, shown in sodium salt form. [Figure 1B] 1A-1D are chemical structural representations of ANGPTL3 RNAi agent AD05488 conjugated to an N-acetyl-galactosamine tridentate ligand having the structure (NAG37)s (see Table 6) at the 5' end of the sense strand, shown in sodium salt form. [Figure 1C] 1A-1D are chemical structural representations of ANGPTL3 RNAi agent AD05488 conjugated to an N-acetyl-galactosamine tridentate ligand having the structure (NAG37)s (see Table 6) at the 5' end of the sense strand, shown in sodium salt form. [Figure 1D] 1A-1D are chemical structural representations of ANGPTL3 RNAi agent AD05488 conjugated to an N-acetyl-galactosamine tridentate ligand having the structure (NAG37)s (see Table 6) at the 5' end of the sense strand, shown in sodium salt form.

[0113] [Figure 2A] 2A-2D are chemical structural representations of the ANGPTL3 RNAi agent AD05488 conjugated to an N-acetyl-galactosamine tridentate ligand having the structure (NAG37)s (see Table 6) at the 5' end of the sense strand, shown in free acid form. [Figure 2B] 2A-2D are chemical structural representations of the ANGPTL3 RNAi agent AD05488 conjugated to an N-acetyl-galactosamine tridentate ligand having the structure (NAG37)s (see Table 6) at the 5' end of the sense strand, shown in free acid form. [Figure 2C]2A-2D are chemical structural representations of the ANGPTL3 RNAi agent AD05488 conjugated to an N-acetyl-galactosamine tridentate ligand having the structure (NAG37)s (see Table 6) at the 5' end of the sense strand, shown in free acid form. [Figure 2D] 2A-2D are chemical structural representations of the ANGPTL3 RNAi agent AD05488 conjugated to an N-acetyl-galactosamine tridentate ligand having the structure (NAG37)s (see Table 6) at the 5' end of the sense strand, shown in free acid form.

[0114] [Figure 3A] 3A-3D are chemical structural representations of ANGPTL3 RNAi agent AD05775 conjugated to an N-acetyl-galactosamine tridentate ligand having a (NAG37)s structure (see Table 6) at the 5' end of the sense strand, shown in sodium salt form. [Figure 3B] 3A-3D are chemical structural representations of ANGPTL3 RNAi agent AD05775 conjugated to an N-acetyl-galactosamine tridentate ligand having a (NAG37)s structure (see Table 6) at the 5' end of the sense strand, shown in sodium salt form. [Figure 3C] 3A-3D are chemical structural representations of ANGPTL3 RNAi agent AD05775 conjugated to an N-acetyl-galactosamine tridentate ligand having a (NAG37)s structure (see Table 6) at the 5' end of the sense strand, shown in sodium salt form. [Figure 3D] 3A-3D are chemical structural representations of ANGPTL3 RNAi agent AD05775 conjugated to an N-acetyl-galactosamine tridentate ligand having a (NAG37)s structure (see Table 6) at the 5' end of the sense strand, shown in sodium salt form.

[0115] [Figure 4A]4A-4D are chemical structural representations of ANGPTL3 RNAi agent AD05775 conjugated to an N-acetyl-galactosamine tridentate ligand having the (NAG37)s structure (see Table 6) at the 5' end of the sense strand, shown in free acid form. [Figure 4B] 4A-4D are chemical structural representations of ANGPTL3 RNAi agent AD05775 conjugated to an N-acetyl-galactosamine tridentate ligand having the (NAG37)s structure (see Table 6) at the 5' end of the sense strand, shown in free acid form. [Figure 4C] 4A-4D are chemical structural representations of ANGPTL3 RNAi agent AD05775 conjugated to an N-acetyl-galactosamine tridentate ligand having the (NAG37)s structure (see Table 6) at the 5' end of the sense strand, shown in free acid form. [Figure 4D] 4A-4D are chemical structural representations of ANGPTL3 RNAi agent AD05775 conjugated to an N-acetyl-galactosamine tridentate ligand having the (NAG37)s structure (see Table 6) at the 5' end of the sense strand, shown in free acid form.

[0116] [Figure 5A] Figure 5A is a schematic diagram of modified sense and antisense strands of ANGPTL3 RNAi agent AD05488 (see Tables 3-5) conjugated to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s (see Table 6). Figure 5A discloses SEQ ID NOs: 2 and 300. In Figures 3A-3B, the following abbreviations are used: a, c, g, and u are 2'-O-methyl modified nucleotides; Af, Cf, Gf, and Uf are 2'-fluoro modified nucleotides; p is a phosphodiester bond; s is a phosphorothioate bond; invAb is an inverted abasic residue; a_2N is a 2'-O-methyl-2-aminoadenosine modified nucleotide (see Table 6); (NAG37)s is a tridentate N-acetyl-galactosamine targeting ligand having the structure shown in Table 6.

[0117] [Figure 5B] Figure 5B is a schematic diagram of modified sense and antisense strands of ANGPTL3 RNAi agent AD05775 (see Tables 3-5) conjugated to an N-acetyl-galactosamine tridentate ligand having the structure (NAG37)s (see Table 6). Figure 5B discloses SEQ ID NOs: 2 and 334.

[0118] [Figure 5C] Figure 5C is a schematic diagram of modified sense and antisense strands of ANGPTL3 RNAi agent AD05791 (see Tables 3-5) conjugated to an N-acetyl-galactosamine tridentate ligand having the (NAG37)s structure (see Table 6). Figure 5C discloses SEQ ID NOs: 4 and 300.

[0119] [Figure 5D] Figure 5D is a schematic diagram of modified sense and antisense strands of ANGPTL3 RNAi agent AD05777 (see Tables 3-5) conjugated to an N-acetyl-galactosamine tridentate ligand having the (NAG37)s structure (see Table 6). Figure 5D discloses SEQ ID NOs: 2 and 336.

[0120] [Figure 5E] Figure 5E is a schematic diagram of modified sense and antisense strands of ANGPTL3 RNAi agent AD05743 (see Tables 3-5) conjugated to an N-acetyl-galactosamine tridentate ligand having the (NAG37)s structure (see Table 6). Figure 5E discloses SEQ ID NOs: 2 and 326.

[0121] [Figure 5F]Figure 5F is a schematic diagram of modified sense and antisense strands of ANGPTL3 RNAi agent AD05487 (see Tables 3-5) conjugated to an N-acetyl-galactosamine tridentate ligand having the (NAG37)s structure (see Table 6). Figure 5F discloses SEQ ID NOs: 5 and 299.

[0122] [Figure 5G] Figure 5G is a schematic diagram of modified sense and antisense strands of ANGPTL3 RNAi agent AD05307 (see Tables 3-5) conjugated to an N-acetyl-galactosamine tridentate ligand having the (NAG37)s structure (see Table 6). Figure 5G discloses SEQ ID NOs: 7 and 278.

[0123] [Figure 5H] Figure 5H is a schematic diagram of modified sense and antisense strands of ANGPTL3 RNAi agent AD05418 (see Tables 3-5) conjugated to an N-acetyl-galactosamine tridentate ligand having the (NAG37)s structure (see Table 6). Figure 5H discloses SEQ ID NOs: 9 and 292.

[0124] [Figure 5I] Figure 5I is a schematic diagram of modified sense and antisense strands of ANGPTL3 RNAi agent AD05577 (see Tables 3-5) conjugated to an N-acetyl-galactosamine tridentate ligand having the (NAG37)s structure (see Table 6). Figure 5I discloses SEQ ID NOs: 11 and 279.

[0125] [Figure 5J] Figure 5J is a schematic diagram of modified sense and antisense strands of ANGPTL3 RNAi agent AD05308 (see Tables 3-5) conjugated to an N-acetyl-galactosamine tridentate ligand having the (NAG37)s structure (see Table 6). Figure 5J discloses SEQ ID NOs: 13 and 279.

[0126] [Figure 5K] Figure 5K is a schematic diagram of modified sense and antisense strands of ANGPTL3 RNAi agent AD05840 (see Tables 3-5) conjugated to an N-acetyl-galactosamine tridentate ligand having the (NAG37)s structure (see Table 6). Figure 5K discloses SEQ ID NOs: 15 and 357. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0127] Detailed Description RNAi agents Described herein are RNAi agents (herein referred to as ANGPTL3 RNAi agents or ANGPTL3 RNAi triggers) for inhibiting expression of the ANGPTL3 gene. Each ANGPTL3 RNAi agent includes a sense strand and an antisense strand. The sense strand and the antisense strand may each be 16-30 nucleotides in length. The sense and antisense strands may be the same length or may be different lengths. In some embodiments, the sense and antisense strands are each independently 17-27 nucleotides in length. In some embodiments, the sense and antisense strands are each independently 17-21 nucleotides in length. In some embodiments, both the sense and antisense strands are each 21-26 nucleotides in length. In some embodiments, the sense and antisense strands are each 21-24 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length while the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides in length while the antisense strand is about 23 nucleotides in length. In some embodiments, sense strand is 23 nucleotides long, and antisense strand is 21 nucleotides long.In some embodiments, both sense strand and antisense strand are 21 nucleotides long.In some embodiments, the sense and antisense strands of RNAi agent are each independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 or 27 nucleotides long.In some embodiments, double-stranded RNAi agent has a double-strand length of about 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides.

[0128] In some embodiments, the region of perfect, substantial, or partial complementarity between the sense and antisense strands is 16-26 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides in length and is located at or near the 5' end of the antisense strand (e.g., this region can be separated from the 5' end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides that are not perfect, substantially, or partially complementary).

[0129] The sense strand and the antisense strand each contain a core stretch (also referred to herein as a "core sequence" or "core stretch sequence") that is 16-23 nucleotides in length. The antisense strand core stretch is 100% (perfectly) complementary or at least about 85% (substantially) complementary to a nucleotide sequence (e.g., sometimes referred to as a target sequence) present in the ANGPTL3 mRNA target. The sense strand core stretch sequence is 100% (perfectly) complementary or at least about 85% (substantially) complementary to a core stretch sequence in the antisense strand, and thus the sense strand core stretch sequence is typically perfectly identical or at least about 85% identical to a nucleotide sequence (target sequence) present in the ANGPTL3 mRNA target. The sense strand core stretch sequence may be the same length as the corresponding antisense core sequence or may be of a different length. In some embodiments, the antisense strand core stretch sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the sense strand core stretch sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.

[0130] Examples of nucleotide sequences for use in forming ANGPTL3 RNAi agents are provided in Tables 2, 3, and 4. Examples of RNAi agent duplexes comprising the sense and antisense strand sequences in Tables 2, 3, and 4 are shown in Table 5.

[0131] The sense and antisense strands of ANGPTL3 RNAi agent are annealed to form a double strand.The sense and antisense strands of ANGPTL3 RNAi agent can be partially, substantially, or completely complementary to each other.In the complementary double strand region, the sense strand core stretch sequence is at least 85% complementary or 100% complementary to the antisense core stretch sequence. In some embodiments, the sense strand core stretch sequence contains a sequence of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that is at least 85% or 100% complementary to a corresponding 16, 17, 18, 19, 20, 21, 22, or 23 nucleotide sequence of the antisense strand core stretch sequence (i.e., the sense and antisense core stretch sequences of an ANGPTL3 RNAi agent have a region of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that are at least 85% base-paired, or 100% base-paired).

[0132] In some embodiments, the antisense strand of an ANGPTL3 RNAi agent disclosed herein differs from any of the antisense strand sequences in Table 2 or Table 3 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of an ANGPTL3 RNAi agent disclosed herein differs from any of the sense strand sequences in Table 2 or Table 4 by 0, 1, 2, or 3 nucleotides.

[0133] The sense strand and / or the antisense strand may optionally and independently contain an additional 1, 2, 3, 4, 5, or 6 nucleotides (extension) at the 3' end, 5' end, or both 3' and 5' ends of the core stretch sequence. If present, the additional nucleotides of the antisense strand may or may not be complementary to the corresponding sequence in the ANGPTL3 mRNA. If present, the additional nucleotides of the antisense strand may or may not be identical to the corresponding sequence in the ANGPTL3 mRNA. If present, the additional nucleotides of the antisense strand may or may not be complementary to the additional nucleotides of the corresponding sense strand, if present.

[0134] As used herein, an extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5' and / or 3' end of the sense strand core stretch sequence and / or the antisense strand core stretch sequence. The extension nucleotides on the sense strand may or may not be complementary to any of the nucleotides of the core stretch sequence or the extension nucleotides in the corresponding antisense strand. Conversely, the extension nucleotides on the antisense strand may or may not be complementary to any of the nucleotides of the core stretch sequence or the extension nucleotides in the corresponding sense strand. In some embodiments, both the sense and antisense strands of the RNAi agent contain 3' and 5' extensions. In some embodiments, one or more of the 3' extension nucleotides of one strand are base-paired with one or more 5' extension nucleotides of the other strand. In other embodiments, one or more of the 3' extension nucleotides of one strand are not base-paired with one or more 5' extension nucleotides of the other strand. In some embodiments, the ANGPTL3 RNAi agent has an antisense strand with a 3' extension and a sense strand with a 5' extension. In some embodiments, the extended nucleotide is unpaired and forms overhang.As used herein, "overhang" refers to one or more unpaired nucleotide stretches located at the end of sense strand or antisense strand that do not form part of hybridized or double-stranded part of the RNAi agent disclosed herein.

[0135] In some embodiments, the ANGPTL3 RNAi agent comprises an antisense strand with a 3' extension of 1, 2, 3, 4, 5 or 6 nucleotides in length.In other embodiments, the ANGPTL3 RNAi agent comprises an antisense strand with a 3' extension of 1, 2 or 3 nucleotides in length.In some embodiments, one or more of the antisense strand extension nucleotides comprise uracil or thymidine nucleotides or nucleotides that are complementary to corresponding ANGPTL3 mRNA sequence.

[0136] In some embodiments, the 3' end of the antisense strand comprises an abasic residue (Ab), which can also be referred to as an "abasic site" or "abasic nucleotide". An abasic residue (Ab) is a nucleotide or nucleoside that lacks a nucleobase at the 1' position of the sugar moiety (see, for example, U.S. Patent No. 5,998,203). In some embodiments, Ab or AbAb can be added to the 3' end of the antisense strand.

[0137] In some embodiments, the sense strand or antisense strand, as used herein, may include a "terminal cap," which is a non-nucleotide compound or other moiety that can be incorporated into one or more ends of the strand of an RNAi agent disclosed herein, and in some instances can provide the RNAi agent with certain beneficial properties, such as, for example, protection against exonuclease degradation. In some embodiments, an inverted abasic residue (invAb) is added to the terminal cap (see Table 6). (See, for example, F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16). Terminal caps are generally known in the art and include, for example, an inverted abasic residue and a carbon chain, such as a terminal C3, C6, or C12 group. In some embodiments, the terminal cap is present at the 5' end, the 3' end, or both the 5' and 3' ends of the sense strand.

[0138] In some embodiments, the ANGPTL3 RNAi agent comprises a sense strand with a 3' extension of 1, 2, 3, 4 or 5 nucleotides in length.In some embodiments, one or more of the sense strand extension nucleotides comprise adenosine, uracil, or thymidine nucleotides, AT dinucleotides, or nucleotides corresponding to nucleotides in ANGPTL3 mRNA sequence.In some embodiments, the 3' sense strand extension comprises or consists of one of the following sequences, including but not limited to: T, UT, TT, UU, UUT, TTT, or TTTT (each listed from 5' to 3').

[0139] In some embodiments, the 3' end of the sense strand may include an additional abasic residue or an inverted abasic end cap. In some embodiments, a UUAb, UAb, or Ab is added to the 3' end of the sense strand.

[0140] In some embodiments, one or more inverted abasic residues (invAb) are added to the 3' end of the sense strand. In some embodiments, one or more inverted abasic residues (invAb) are added to the 5' end of the sense strand. In some embodiments, one or more inverted abasic residues or inverted abasic sites are inserted between the targeting ligand and the nucleobase sequence of the sense strand of the RNAi agent. In some embodiments, the inclusion of one or more inverted abasic residues or inverted abasic sites at or near the end or ends of the sense strand of the RNAi agent allows for enhanced activity or other desirable properties of the RNAi agent.

[0141] In some embodiments, the ANGPTL3 RNAi agent comprises a sense strand with a 5' extension of 1, 2, 3, 4, 5 or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprise uracil or adenosine nucleotides or nucleotides corresponding to nucleotides in ANGPTL3 mRNA sequence. In some embodiments, the sense strand 5' extension is one of the following sequences, including but not limited to: CA, AUAGGC, AUAGG, AUAG, AUA, A, AA, AC, GCA, GGCA, GGC, UAUCA, UAUC, UCA, UAU, U, UU (each listed from 5' to 3'). The sense strand may have a 3' extension and / or a 5' extension.

[0142] In some embodiments, the 5' end of the sense strand may include one or more additional abasic residues (e.g., (Ab) or (AbAb)). In some embodiments, one or more inverted abasic residues (invAb) are added to the 5' end of the sense strand. In some embodiments, one or more inverted abasic residues can be inserted between the targeting ligand and the nucleobase sequence of the sense strand of the RNAi agent. In some embodiments, the inclusion of one or more inverted abasic residues at or near the terminus or termini of the sense strand of the RNAi agent can allow for enhanced activity or other desirable properties of the RNAi agent. In some embodiments, the abasic (deoxyribose) residue can be replaced with a ribitol (abasic ribose) residue.

[0143] In some embodiments, the 3' end of the antisense strand core stretch sequence or the 3' end of the antisense strand sequence may comprise an inverted abasic residue (invAb (see Table 6)).

[0144] Examples of sequences used in forming an ANGPTL3 RNAi agent are provided in Tables 2, 3, and 4. In some embodiments, the antisense strand of an ANGPTL3 RNAi agent comprises any of the sequences in Tables 2 or 3. In certain embodiments, the ANGPTL3 The antisense strand of an RNAi agent comprises or consists of any one of the modified sequences in Table 3. In some embodiments, the antisense strand of an ANGPTL3 RNAi agent comprises the sequence of nucleotides (from the 5' end to the 3' end) 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24 of any of the sequences in Table 2 or 3. In some embodiments, the sense strand of an ANGPTL3 RNAi agent comprises the sequence of any of the sequences in Table 2 or 4. In some embodiments, the sense strand of an ANGPTL3 RNAi agent comprises a sequence of nucleotides (from the 5' end to the 3' end) 1-18, 1-19, 1-20, 1-21, 1-22, 1-23, 1-24, 1-25, 1-26, 2-19, 2-20, 2-21, 2-22, 2-23, 2-24, 3-20, 3-21, 3-22, 3-23, 3-24, 4-21, 4-22, 4-23, 4-24, 5-22, 5-23, or 5-24 of any of the sequences in Table 2 or 4. In certain embodiments, the sense strand of an ANGPTL3 RNAi agent comprises or consists of a modified sequence of any one of the modified sequences in Table 4.

[0145] In some embodiments, the sense and antisense strands of the RNAi agents described herein contain the same number of nucleotides. In some embodiments, the sense and antisense strands of the RNAi agents described herein contain different numbers of nucleotides. In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the RNAi agent form blunt ends. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the RNAi agent form blunt ends. In some embodiments, both ends of the RNAi agent form blunt ends. In some embodiments, neither end of the RNAi agent is blunt. As used herein, "blunt end" refers to an end of a double-stranded RNAi agent where the terminal nucleotides of the two annealed strands are complementary (form complementary base pairs).

[0146] In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the RNAi agent form a frayed end. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the RNAi agent form a frayed end. In some embodiments, both ends of the RNAi agent form frayed ends. In some embodiments, neither end of the RNAi agent is a frayed end. As used herein, frayed end refers to an end of a double-stranded RNAi agent where the terminal nucleotides of the two annealed strands are paired (i.e., do not form an overhang) but are not complementary (i.e., form a non-complementary pair). In some embodiments, one or more unpaired nucleotides at the end of one strand of the double-stranded RNAi agent form an overhang. The unpaired nucleotides may be in the sense strand or the antisense strand, creating a 3' or 5' overhang. In some embodiments, the RNAi agent contains a blunt end and a frayed end, a blunt end and a 5' overhang, a blunt end and a 3' overhang, a frayed end and a 5' overhang, a frayed end and a 3' overhang, two 5' overhangs, two 3' overhangs, a 5' overhang and a 3' overhang, two frayed ends, or two blunt ends. Typically, if present, the overhangs are located at the 3' end of the sense strand, the antisense strand, or both the sense and antisense strands.

[0147] Modified nucleotides, when used in various polynucleotide or oligonucleotide constructs, can retain the activity of these compounds while simultaneously increasing the serum stability of the compounds in cells and can also minimize the potential for activating interferon activity in humans upon administration of the polynucleotide or oligonucleotide construct.

[0148] In some embodiments, ANGPTL3 RNAi agent is prepared or provided as salt, mixed salt or free acid.In some embodiments, ANGPTL3 RNAi agent is prepared as sodium salt.These forms that are well known in the art are within the scope of the invention disclosed herein.

[0149] Modified Nucleotides In some embodiments, the ANGPTL3 RNAi agent contains one or more modified nucleotides. As used herein, a "modified nucleotide" is a nucleotide other than a ribonucleotide (2'-hydroxyl nucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides include, but are not limited to, deoxyribonucleotides, nucleotide mimics, abasic nucleotides (represented herein as Ab), 2'-modified nucleotides, 3'-3' linked (inverted) nucleotides (represented herein as invdN, invN, invn), nucleotides containing modified nucleobases, bridged nucleotides, peptide nucleic acids (PNAs), 2',3'-seco nucleotide mimics (unlocked nucleobase analogs, referred to herein as N UNA or NUNA), locked nucleotides (referred to herein as N LNA or NLNA), 3'-O-methoxy (2' internucleoside linkage) nucleotides (referred to herein as 3'-OMen), 2'-F-arabinonucleotides (referred to herein as NfANA or Nf ANA, 5'-Me, 2'-fluoro nucleotides (represented herein as 5Me-Nf), morpholino nucleotides, vinylphosphonate deoxyribonucleotides (represented herein as vpdN), vinylphosphonate-containing nucleotides, and cyclopropylphosphonate-containing nucleotides (cPrpN). 2'-modified nucleotides (i.e., nucleotides having a group other than a hydroxyl group at the 2' position of the five-membered sugar ring) include, but are not limited to, 2'-O-methyl nucleotides (represented herein as a lowercase "n" in nucleotide sequences), 2'-deoxy-2'-fluoro nucleotides (also referred to herein as 2'-fluoro nucleotides and represented herein as Nf), 2'-deoxy nucleotides (represented herein as dN), 2'-methoxyethyl (2'-O-2-methoxylethyl) nucleotides (represented herein as 2'-MOE and represented herein as NM), 2'-amino nucleotides, and 2'-alkyl nucleotides. Not all positions in a given compound need to be uniformly modified.On the contrary, more than one modification can be incorporated into a single ANGPTL3 RNAi agent, or even into a single nucleotide thereof.The sense strand and antisense strand of ANGPTL3 RNAi agent can be synthesized and / or modified by methods known in the art.Modification at one nucleotide is independent of modification at another nucleotide.

[0150] Modified nucleobases include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine ... These include synthetic and natural nucleobases such as uracil, 5-halouracil, cytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-sulfhydryl, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and adenine, 8-azaguanine and adenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine and 3-deazaadenine.

[0151] In some embodiments, all or substantially all of the nucleotides of the RNAi agent are modified nucleotides.As used herein, an RNAi agent in which substantially all of the nucleotides present are modified nucleotides is an RNAi agent that has 4 or fewer (i.e., 0, 1, 2, 3 or 4) nucleotides in both sense and antisense strands that are ribonucleotides (i.e., unmodified).As used herein, a sense strand in which substantially all of the nucleotides present are modified nucleotides is a sense strand that has 2 or fewer (i.e., 0, 1 or 2) nucleotides in the sense strand that are unmodified ribonucleotides.As used herein, an antisense strand in which substantially all of the nucleotides present are modified nucleotides is an antisense strand that has 2 or fewer (i.e., 0, 1 or 2) nucleotides in the sense strand that are unmodified ribonucleotides.In some embodiments, one or more nucleotides of an RNAi agent are unmodified ribonucleotides.

[0152] Modified Internucleoside Linkages In some embodiments, one or more nucleotides of an ANGPTL3 RNAi agent are linked by a non-canonical bond or backbone (ie, a modified internucleoside bond or modified backbone). Modified internucleoside linkages or backbones include, but are not limited to, phosphorothioate groups (represented herein as a lower case "s"), chiral phosphorothioates, thiophosphonates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, alkylphosphonates (e.g., methylphosphonates or 3'-alkylenephosphonates), chiral phosphonates, phosphinates, phosphoramidates (e.g., 3'-aminophosphoramidates, aminoalkylphosphoramidates, or thionophosphoramidates), thionoalkyl-phosphonates, thionoalkylphosphotriesters, morpholino linkages, boranophosphates with normal 3'-5' linkages, 2'-5' linked analogs of boranophosphates, or boranophosphates with inverted polarity in which adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. In some embodiments, modified internucleoside bond or backbone lacks phosphorus atom. Modified internucleoside bond lacking phosphorus atom includes, but is not limited to, short chain alkyl or cycloalkyl intersugar bond, mixed heteroatom and alkyl or cycloalkyl intersugar bond, or one or more short chain heteroatom or heterocyclic intersugar bond. In some embodiments, modified internucleoside backbone includes, but is not limited to, siloxane backbone, sulfide backbone, sulfoxide backbone, sulfone backbone, formacetyl and thioformacetyl backbone, methyleneformacetyl and thioformacetyl backbone, alkene-containing backbone, sulfamic acid backbone, methyleneimino and methylenehydrazino backbone, sulfonic acid and sulfonamide backbone, amide backbone, and other backbone with mixed N, O, S, and CH2 components.

[0153] In some embodiments, the sense strand of an ANGPTL3 RNAi agent may contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, the antisense strand of an ANGPTL3 RNAi agent may contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or both the sense strand and the antisense strand may independently contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. In some embodiments, the sense strand of an ANGPTL3 RNAi agent may contain 1, 2, 3, or 4 phosphorothioate linkages, the antisense strand of an ANGPTL3 RNAi agent may contain 1, 2, 3, or 4 phosphorothioate linkages, or both the sense strand and the antisense strand may independently contain 1, 2, 3, or 4 phosphorothioate linkages.

[0154] In some embodiments, the sense strand of the ANGPTL3 RNAi agent contains at least two phosphorothioate internucleoside linkages. In some embodiments, the at least two phosphorothioate internucleoside linkages are between the nucleotides 1-3 from the 3' end of the sense strand. In some embodiments, one phosphorothioate internucleoside linkage is at the 5' end of the sense strand and another phosphorothioate linkage is at the 3' end of the sense strand. In some embodiments, two phosphorothioate internucleoside linkages are located at the 5' end of the sense strand and another phosphorothioate linkage is at the 3' end of the sense strand. In some embodiments, the sense strand does not contain any phosphorothioate internucleoside linkages between nucleotides, but does contain one, two, or three phosphorothioate linkages between the terminal nucleotides at both the 5' and 3' ends, and an optionally present inverted abasic residue end cap. In some embodiments, the targeting ligand is linked to the sense strand via a phosphorothioate linkage.

[0155] In some embodiments, the antisense strand of the ANGPTL3 RNAi agent contains four phosphorothioate internucleoside linkages. In some embodiments, the four phosphorothioate internucleoside linkages are between nucleotides 1-3 from the 5' end of the antisense strand and between nucleotides 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5' end of the antisense strand. In some embodiments, three phosphorothioate internucleoside linkages are located between positions 1-4 from the 5' end of the antisense strand and a fourth phosphorothioate internucleoside linkage is located at positions 20-21 from the 5' end of the antisense strand. In some embodiments, the ANGPTL3 RNAi agent contains at least three or four phosphorothioate internucleoside linkages in the antisense strand.

[0156] In some embodiments, an ANGPTL3 RNAi agent contains one or more modified nucleotides and one or more modified internucleoside linkages. In some embodiments, a 2'-modified nucleoside is combined with a modified internucleoside linkage.

[0157] ANGPTL3 RNAi agents In some embodiments, an ANGPTL3 RNAi agent disclosed herein targets the ANGPTL3 gene at or near the location of the ANGPTL3 sequence shown in Table 1. In some embodiments, the antisense strand of an ANGPTL3 RNAi agent disclosed herein comprises a core stretch sequence that is fully, substantially, or at least partially complementary to the sequence of a target ANGPTL3 19-mer disclosed in Table 1. [Table 1-1] [Table 1-2]

[0158] In some embodiments, an ANGPTL3 RNAi agent comprises an antisense strand in which position 19 of the antisense strand (5'→3') can base pair with position 1 of a 19-mer target sequence disclosed in Table 1. In some embodiments, an ANGPTL3 RNAi agent comprises an antisense strand in which position 1 of the antisense strand (5'→3') can base pair with position 19 of a 19-mer target sequence disclosed in Table 1.

[0159] In some embodiments, an ANGPTL3 RNAi agent comprises an antisense strand in which position 2 of the antisense strand (5'→3') can base pair with position 18 of a 19-mer target sequence disclosed in Table 1. In some embodiments, an ANGPTL3 RNAi agent comprises an antisense strand in which positions 2 through 18 of the antisense strand (5'→3') can base pair with each of the respective complementary bases located from positions 18 through 2 of a 19-mer target sequence disclosed in Table 1.

[0160] For the RNAi agent disclosed herein, the nucleotide at position 1 of antisense strand (5'->3'-end) can be perfectly complementary to ANGPTL3 gene, or can be non-complementary to ANGPTL3 gene.In some embodiments, the nucleotide at position 1 of antisense strand (5'->3'-end) is U, A, or dT.In some embodiments, the nucleotide at position 1 of antisense strand (5'->3'-end) forms A:U or U:A base pair with sense strand.

[0161] In some embodiments, the antisense strand of an ANGPTL3 RNAi agent comprises (from the 5' to the 3' end) a sequence of 2-18 or 2-19 nucleotides of any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, the sense strand of an ANGPTL3 RNAi agent comprises (from the 5' to the 3' end) a sequence of 1-17, 1-18, or 2-18 nucleotides of any of the sense strand sequences in Table 2 or Table 4.

[0162] In some embodiments, an ANGPTL3 RNAi agent comprises (i) an antisense strand that comprises (from the 5' to the 3' end) a sequence of 2-18 or 2-19 nucleotides of any of the antisense strand sequences in Table 2 or Table 3, and (ii) a sense strand that comprises (from the 5' to the 3' end) a sequence of 1-17 or 1-18 nucleotides of any of the sense strand sequences in Table 2 or Table 4.

[0163] In some embodiments, an ANGPTL3 RNAi agent comprises a 19-mer core nucleotide sequence shown in Table 2 below. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4]

[0164] The sense and antisense strands of an ANGPTL3 RNAi agent that comprises or consists of a sequence in Table 2 may be modified or unmodified nucleotides. In some embodiments, an ANGPTL3 RNAi agent having sense and antisense strand sequences that comprise or consist of a sequence in Table 2 is entirely or substantially entirely modified nucleotides.

[0165] In some embodiments, the antisense strand of an ANGPTL3 RNAi agent disclosed herein differs from any of the antisense strand sequences in Table 2 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of an ANGPTL3 RNAi agent disclosed herein differs from any of the sense strand sequences in Table 2 by 0, 1, 2, or 3 nucleotides.

[0166] As used herein, each N listed in the sequences disclosed in Table 2 can be independently selected from any and all nucleobases (including those found in both modified and unmodified nucleobases). In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have a nucleobase that is complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have a nucleobase that is not complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have a nucleobase that is the same as the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have a different nucleobase from the N nucleotide at the corresponding position on the other strand.

[0167] The antisense strand of certain modified ANGPTL3 RNAi agents, as well as their underlying unmodified nucleobase sequences, are provided in Table 3. The sense strand of certain modified ANGPTL3 RNAi agents, as well as their underlying unmodified nucleobase sequences, are provided in Table 4. In forming an ANGPTL3 RNAi agent, each of the nucleotides in each of the underlying sequences listed in Tables 3 and 4, and Table 2 above, may be a modified nucleotide.

[0168] The ANGPTL3 RNAi agent described herein is formed by annealing antisense strand and sense strand.The sense strand containing the sequence listed in Table 2 or Table 4 can be hybridized with any antisense strand containing the sequence listed in Table 2 or Table 3, under the condition that the two sequences have at least 85% complementary region over the sequence of 16, 17, 18, 19, 20 or 21 consecutive nucleotides.

[0169] In some embodiments, the antisense strand of an ANGPTL3 RNAi agent comprises a nucleotide sequence of any of the sequences in Table 2 or Table 3.

[0170] In some embodiments, an ANGPTL3 RNAi agent comprises or consists of a duplex having the sense and antisense nucleobase sequences of any of the sequences in Table 2, Table 3, or Table 4.

[0171] Examples of antisense strands containing modified nucleotides are provided in Table 3. Examples of sense strands containing modified nucleotides are provided in Table 4.

[0172] As used in Tables 3 and 4, the following notations are used to denote modified nucleotides, targeting groups, and linking groups: A = adenosine 3'-phosphate C=Cytidine-3'-phosphate G=guanosine-3'-phosphate U = uridine-3'-phosphate I = inosine-3'-phosphate n = any 2'-OMe modified nucleotide a = 2'-O-methyladenosine-3'-phosphate as = 2'-O-methyladenosine-3'-phosphorothioate c = 2'-O-methylcytidine-3'-phosphate cs = 2'-O-methylcytidine-3'-phosphorothioate g = 2'-O-methylguanosine-3'-phosphate gs = 2'-O-methylguanosine-3'-phosphorothioate t=2'-O-methyl-5-methyluridine-3'-phosphate ts = 2'-O-methyl-5-methyluridine-3'-phosphorothioate u = 2'-O-methyluridine-3'-phosphate us = 2'-O-methyluridine-3'-phosphorothioate i = 2'-O-methylinosine-3'-phosphate is = 2'-O-methylinosine-3'-phosphorothioate Nf = any 2'-fluoro modified nucleotide Af = 2'-fluoroadenosine-3'-phosphate Afs = 2'-fluoroadenosine-3'-phosphorothioate Cf = 2'-fluorocytidine-3'-phosphate Cfs = 2'-fluorocytidine-3'-phosphorothioate Gf = 2'-fluoroguanosine-3'-phosphate Gfs = 2'-fluoroguanosine-3'-phosphorothioate Tf = 2'-fluoro-5'-methyluridine-3'-phosphate Tfs = 2'-fluoro-5'-methyluridine-3'-phosphorothioate Uf = 2'-fluorouridine-3'-phosphate Ufs = 2'-fluorouridine-3'-phosphorothioate dN = any 2'-deoxyribonucleotide dA = 2'-deoxyadenosine-3'-phosphate dAs = 2'-deoxyadenosine-3'-phosphorothioate dC = 2'-deoxycytidine-3'-phosphate dCs = 2'-deoxycytidine-3'-phosphorothioate dG = 2'-deoxyguanosine-3'-phosphate dGs = 2'-deoxyguanosine-3'-phosphorothioate dT = 2'-deoxythymidine-3'-phosphate dTs = 2'-deoxythymidine-3'-phosphorothioate dU = 2'-deoxyuridine-3'-phosphate dUs = 2'-deoxyuridine-3'-phosphorothioate N UNA = 2',3'-seco nucleotide mimic (unlocked nucleobase analogue)-3'-phosphate N UNA s = 2',3'-seco nucleotide mimic (unlocked nucleobase analogue)-3'-phosphorothioate A UNA = 2',3'-seco-adenosine-3'-phosphate A UNAs = 2',3'-seco-adenosine-3'-phosphorothioate C UNA = 2',3'-seco-cytidine-3'-phosphate C UNA s = 2',3'-seco-cytidine-3'-phosphorothioate G UNA = 2',3'-seco-guanosine-3'-phosphate G UNA s = 2',3'-seco-guanosine-3'-phosphorothioate U UNA = 2',3'-seco-uridine-3'-phosphate U UNA s = 2',3'-seco-uridine-3'-phosphorothioate a_2N=See Table 6 a_2Ns = Please refer to Table 6 pu_2N=See Table 6 pu_2Ns = See Table 6 N LNA = Locked nucleotide Nf ANA = 2'-F-arabinonucleotide NM = 2'-O-methoxyethyl nucleotide AM = 2'-O-methoxyethyl adenosine-3'-phosphate AMs = 2'-O-methoxyethyl adenosine-3'-phosphorothioate GM = 2'-O-methoxyethyl guanosine-3'-phosphate GMs = 2'-O-methoxyethylguanosine-3'-phosphorothioate TM = 2'-O-methoxyethylthymidine-3'-phosphate TMs = 2'-O-methoxyethylthymidine-3'-phosphorothioate mCM = see Table 6 mCMs = see Table 6 R=Ribitol (invdN) = any inverted deoxyribonucleotide (3'-3' linked nucleotide) (invAb) = inverted (3'-3' linked) abasic deoxyribonucleotide, see Table 6 (invAb)s = inverted (3'-3' linked) abasic deoxyribonucleotide-5'-phosphorothioate, see Table 6 (invn) = any inverted 2'-OMe nucleotide (3'-3' linked nucleotide) s = phosphorothioate bond sp = See Table 6 D2u = See Table 6 pD2u = see Table 6 vpdN = vinylphosphonate deoxyribonucleotide (5Me-Nf) = 5'-Me, 2'-fluoro nucleotide cPrp = cyclopropylphosphonic acid, see Table 6 epTcPr = see Table 6 epTM = see Table 6

[0173] Those of skill in the art will readily understand that, unless otherwise indicated by the sequence (e.g., by a phosphorothioate linkage "s"), the nucleotide monomers, when present in an oligonucleotide, are linked to one another by 5'-3'-phosphodiester bonds. As those of skill in the art will clearly understand, the inclusion of phosphorothioate linkages shown in the modified nucleotide sequences disclosed herein replaces the phosphodiester linkages typically present in oligonucleotides (see, e.g., Figures 5A-5K, which show all internucleoside linkages). Furthermore, those of skill in the art will readily understand that the terminal nucleotide at the 3' end of a given oligonucleotide sequence typically has a hydroxyl (-OH) group at each 3' position of a given monomer in place of a phosphate moiety ex vivo. Furthermore, as those of skill in the art will readily understand and appreciate, while the phosphorothioate chemical structures shown herein typically show an anion on the sulfur atom, the invention disclosed herein encompasses all phosphorothioate tautomers and / or diastereomers (e.g., when the sulfur atom has a double bond and the anion is an oxygen atom). Unless otherwise expressly indicated herein, such understanding of those of skill in the art is used in describing the ANGPTL3 RNAi agents and compositions of ANGPTL3 RNAi agents disclosed herein.

[0174] Certain examples of targeting groups and linking groups for use with the ANGPTL3 RNAi agents disclosed herein are provided below in Table 6. More specifically, the targeting groups and linking groups include the following: (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG31), (NAG32), (NAG33), (NAG34), (NAG35), (NAG36), (NAG37), (NAG38), (NAG39), (NAG39), (NAG39), (NAG30), (NAG31), (NAG32), (NAG33), (NAG34), (NAG35), (NAG36), (NAG37), (NAG38), (NAG39), (NAG39), (NAG39), (NAG30), (NAG31), (NAG32), (NAG33), (NAG34), (NAG34), (NAG34), (NAG35 ... 0)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s, the chemical structures of which are provided in Table 6 below. Each sense and / or antisense strand may have any targeting or linking group listed herein, as well as other targeting or linking groups conjugated to the 5' and / or 3' ends of the sequence. [Table 3-1] [Table 3-2] [Table 3-3]

[0175] [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4] [Table 4-5]

[0176] The ANGPTL3 RNAi agent described herein is formed by annealing antisense strand and sense strand.The sense strand containing the sequence listed in table 2 or table 4 can be hybridized with any antisense strand containing the sequence listed in table 2 or table 3, under the condition that the two sequences have at least 85% complementary region over the sequence of 16, 17, 18, 19, 20 or 21 consecutive nucleotides.

[0177] In some embodiments, the antisense strand of an ANGPTL3 RNAi agent disclosed herein differs from any of the antisense strand sequences in Table 3 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of an ANGPTL3 RNAi agent disclosed herein differs from any of the sense strand sequences in Table 4 by 0, 1, 2, or 3 nucleotides.

[0178] In some embodiments, the antisense strand of the ANGPTL3 RNAi agent comprises a nucleotide sequence of any of the sequences in Table 2 or Table 3. The antisense strand of an RNAi agent comprises a sequence of nucleotides (from the 5' end to the 3' end) 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24 of any of the sequences in Table 2 or Table 3. In certain embodiments, the antisense strand of an ANGPTL3 RNAi agent comprises or consists of a modified sequence of any one of the modified sequences in Table 3.

[0179] In some embodiments, the sense strand of an ANGPTL3 RNAi agent comprises the nucleotide sequence of any of the sequences in Table 2 or Table 4. In some embodiments, the sense strand of an ANGPTL3 RNAi agent comprises the sequence of nucleotides (from the 5' end to the 3' end) 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, or 4-24 of any of the sequences in Table 2 or Table 4. In certain embodiments, the sense strand of an ANGPTL3 RNAi agent comprises or consists of any one of the modified sequences in Table 4.

[0180] For the ANGPTL3 RNAi agent disclosed herein, the nucleotide at position 1 of antisense strand (5'->3'-end) can be perfectly complementary to ANGPTL3 gene, or can be non-complementary to ANGPTL3 gene.In some embodiments, the nucleotide at position 1 of antisense strand (5'->3'-end) is U, A, or dT (or modified version thereof).In some embodiments, the nucleotide at position 1 of antisense strand (5'->3'-end) forms A:U or U:A base pair with sense strand.

[0181] In some embodiments, the antisense strand of an ANGPTL3 RNAi agent comprises (from the 5' to the 3' end) a sequence of 2-18 or 2-19 nucleotides of any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, the sense strand of an ANGPTL3 RNAi agent comprises (from the 5' to the 3' end) a sequence of 1-17 or 1-18 nucleotides of any of the sense strand sequences in Table 2 or Table 4.

[0182] In some embodiments, an ANGPTL3 RNAi agent comprises (i) an antisense strand that comprises (from the 5' to the 3' end) a sequence of 2-18 or 2-19 nucleotides of any of the antisense strand sequences in Table 2 or Table 3, and (ii) a sense strand that comprises (from the 5' to the 3' end) a sequence of 1-17 or 1-18 nucleotides of any of the sense strand sequences in Table 2 or Table 4.

[0183] A sense strand containing a sequence listed in Table 2 or Table 4 can be hybridized to any antisense strand containing a sequence listed in Table 2 or Table 3, provided that the two sequences have a region of at least 85% complementarity over a sequence of 16, 17, 18, 19, 20, or 21 consecutive nucleotides. In some embodiments, an ANGPTL3 RNAi agent has a sense strand consisting of any of the modified sequences in Table 4, and an antisense strand consisting of any of the modified sequences in Table 3. Certain representative sequence pairs are illustrated by the duplex ID numbers shown in Table 5.

[0184] In some embodiments, the ANGPTL3 RNAi agent comprises, consists of, or essentially consists of a duplex represented by any one of the duplex ID numbers presented herein.In some embodiments, the ANGPTL3 RNAi agent comprises any sense strand and antisense strand nucleotide sequence of a duplex represented by any one of the duplex ID numbers presented herein.In some embodiments, the ANGPTL3 RNAi agent comprises any sense strand and antisense strand nucleotide sequence of a duplex represented by any one of the duplex ID numbers presented herein, and a targeting group and / or a linking group, wherein the targeting group and / or linking group are covalently linked (i.e., conjugated) to the sense strand or antisense strand.In some embodiments, the ANGPTL3 RNAi agent comprises any sense strand and antisense strand modified nucleotide sequence of a duplex represented by any one of the duplex ID numbers presented herein. In some embodiments, an ANGPTL3 RNAi agent comprises a sense strand and an antisense strand modified nucleotide sequence of any of the duplex ID numbers presented herein and a targeting group and / or linking group, where the targeting group and / or linking group are covalently linked to the sense strand or the antisense strand.

[0185] In some embodiments, an ANGPTL3 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 2 or Table 5, and further comprises a targeting group. In some embodiments, an ANGPTL3 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 2 or Table 5, and further comprises an asialoglycoprotein receptor ligand targeting group.

[0186] In some embodiments, an ANGPTL3 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 2 or Table 5, respectively, as defined in Table 6: (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG 28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s. In some embodiments, the targeting group is (NAG25) or (NAG25)s as defined in Table 6. In other embodiments, the targeting group is (NAG37) or (NAG37)s as defined in Table 6.

[0187] In some embodiments, an ANGPTL3 RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense strand and / or sense strand nucleotide sequences in Table 3 or Table 4.

[0188] In some embodiments, an ANGPTL3 RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense strand and / or sense strand nucleotide sequences of any of the duplexes in Table 5, and further comprises an asialoglycoprotein receptor ligand targeting group.

[0189] In some embodiments, an ANGPTL3 RNAi agent comprises, consists of, or consists essentially of any of the duplexes in Table 5. [Table 5-1] [Table 5-2]

[0190] In some embodiments, the ANGPTL3 RNAi agent is prepared or provided as a salt, mixed salt, or free acid. The RNAi agent described herein inhibits or knocks down the expression of one or more ANGPTL3 genes in vivo and / or in vitro upon delivery to cells expressing the ANGPTL3 gene.

[0191] Targeting Groups, Linking Groups, and Delivery Vehicles In some embodiments, the ANGPTL3 RNAi agent is conjugated to one or more non-nucleotide groups, including, but not limited to, a targeting group, a linking group, a delivery polymer, or a delivery vehicle. The non-nucleotide group can enhance the targeting, delivery, or binding of the RNAi agent. Examples of targeting groups and linking groups are provided in Table 6. The non-nucleotide group may be covalently linked to the 3' and / or 5' end of either the sense strand and / or the antisense strand. In some embodiments, the ANGPTL3 RNAi agent contains a non-nucleotide group linked to the 3' and / or 5' end of the sense strand. In some embodiments, the non-nucleotide group is linked to the 5' end of the sense strand of the ANGPTL3 RNAi agent. The non-nucleotide group may be directly or indirectly linked to the RNAi agent via a linker / linking group. In some embodiments, the non-nucleotide group is linked to the RNAi agent via a labile, cleavable, or reversible bond or linker.

[0192] In some embodiments, the non-nucleotide group enhances the pharmacokinetics or biodistribution properties of the RNAi agent or conjugate to which it is attached, improving cell- or tissue-specific distribution and cell-specific uptake of the RNAi agent or conjugate. In some embodiments, the non-nucleotide group enhances endocytosis of the RNAi agent.

[0193] A targeting group or targeting moiety enhances the pharmacokinetics or biodistribution properties of the conjugate or RNAi agent to which it is attached, improving the cell-specific (including in some cases organ-specific) distribution and cell-specific (or organ-specific) uptake of the conjugate or RNAi agent. A targeting group may be monovalent, bivalent, trivalent, tetravalent, or may have higher valency with respect to the target to which it is directed. Exemplary targeting groups include, but are not limited to, compounds with affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics with affinity for cell surface molecules. In some embodiments, the targeting group is linked to the RNAi agent using a linker such as a PEG linker, or in some cases, one, two, or three abasic and / or ribitol (abasic ribose) residues that can serve as a linker. In some embodiments, the targeting group comprises a galactose derivative cluster.

[0194] ANGPTL3 RNAi agents described herein can be synthesized with reactive groups, such as amino groups (also referred to herein as amines), at the 5' and / or 3' ends. The reactive groups can then be used to attach targeting moieties using methods typical in the art.

[0195] In some embodiments, the targeting group comprises an asialoglycoprotein receptor ligand.As used herein, an asialoglycoprotein receptor ligand is a ligand that contains a compound that has affinity for the asialoglycoprotein receptor.As pointed out herein, the asialoglycoprotein receptor is highly expressed in liver cells.In some embodiments, the asialoglycoprotein receptor ligand comprises or consists of one or more galactose derivatives.As used herein, the term galactose derivative includes both galactose and the derivative of galactose that has affinity for the asialoglycoprotein receptor that is equal to or higher than the affinity of galactose. Galactose derivatives include, but are not limited to, galactose, galactosamine, N-formylgalactosamine, N-acetyl-galactosamine, N-propionyl-galactosamine, Nn-butanoyl-galactosamine, and N-iso-butanoylgalactose-amine (see, for example, ST Iobst and K. Drickamer, JBC, 1996, 271, 6686).Galactose derivatives and clusters of galactose derivatives that are useful for targeting oligonucleotides and other molecules to the liver in vivo are known in the art (see, for example, Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al., 1982, J. Biol. Chem., 257, 939-945).

[0196] Galactose derivatives have been used to target molecules to hepatocytes in vivo through their binding to the asialoglycoprotein receptor expressed on the surface of hepatocytes. Binding of the asialoglycoprotein receptor ligand to the asialoglycoprotein receptor facilitates cell-specific targeting to hepatocytes and endocytosis of the molecule into hepatocytes. The asialoglycoprotein receptor ligand can be a monomer (e.g., with a single galactose derivative) or a polymer (e.g., with multiple galactose derivatives). Galactose derivatives or galactose derivative clusters can be attached to the 3' or 5' end of the sense or antisense strand of the RNAi agent using methods known in the art. Preparation of targeting groups such as galactose derivative clusters is described, for example, in International Patent Application Publication No. WO2018 / 044350 to Arrowhead Pharmaceuticals, Inc. and International Patent Application Publication No. WO2017 / 156012 to Arrowhead Pharmaceuticals, Inc., the contents of both of which are incorporated herein by reference in their entirety.

[0197] As used herein, a galactose derivative cluster includes a molecule having two to four terminal galactose derivatives. The terminal galactose derivative is attached to the molecule through its C-1 carbon. In some embodiments, the galactose derivative cluster is a galactose derivative trimer (also called a tri-antennary galactose derivative or a trivalent galactose derivative). In some embodiments, the galactose derivative cluster includes N-acetyl-galactosamine. In some embodiments, the galactose derivative cluster includes three N-acetyl-galactosamines. In some embodiments, the galactose derivative cluster is a galactose derivative tetramer (also called a tetra-antennary galactose derivative or a tetravalent galactose derivative). In some embodiments, the galactose derivative cluster includes four N-acetyl-galactosamines.

[0198] As used herein, a galactose derivative trimer contains three galactose derivatives, each linked to a central branch point. As used herein, a galactose derivative tetramer contains four galactose derivatives, each linked to a central branch point. The galactose derivatives can be linked to the central branch point through the C-1 carbon of the sugar. In some embodiments, the galactose derivatives are linked to the branch point via a linker or spacer. In some embodiments, the linker or spacer is a flexible hydrophilic spacer, such as a PEG group (see, for example, U.S. Pat. No. 5,885,968; Biessen et al. J. Med. Chem. 1995 Vol. 39 p. 1538-1546). In some embodiments, the PEG spacer is a PEG3 spacer. The branch point can be any small molecule that allows for the attachment of three galactose derivatives and further allows for the attachment of the branch point to an RNAi agent. An example of a branch point group is di-lysine or diglutamate. The linkage of the branch point to the RNAi agent can occur through a linker or spacer. In some embodiments, the linker or spacer includes a flexible hydrophilic spacer, such as, but not limited to, a PEG spacer. In some embodiments, the linker includes a rigid linker, such as a cyclic group. In some embodiments, the galactose derivative comprises or consists of N-acetyl-galactosamine. In some embodiments, the galactose derivative cluster comprises a galactose derivative tetramer, which can be, for example, an N-acetyl-galactosamine tetramer.

[0199] The embodiments of the present disclosure include pharmaceutical compositions for delivering ANGPTL3 RNAi agent to liver cells in vivo.Such pharmaceutical compositions can include ANGPTL3 RNAi agent conjugated to galactose derivative cluster.In some embodiments, galactose derivative cluster includes galactose derivative trimer, which can be N-acetyl-galactosamine trimer, or galactose derivative tetramer, which can be N-acetyl-galactosamine tetramer.

[0200] Targeting groups include, but are not limited to, (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29 ... NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), and (NAG39)s. Other targeting groups, including galactose cluster targeting ligands, are known in the art.

[0201] In some embodiments, a linking group is conjugated to the RNAi agent. The linking group facilitates covalent linking of the agent to a targeting group, a delivery polymer, or a delivery vehicle. The linking group can be linked to the 3' and / or 5' end of the sense or antisense strand of the RNAi agent. In some embodiments, the linking group is linked to the sense strand of the RNAi agent. In some embodiments, the linking group is conjugated to the 5' or 3' end of the sense strand of the RNAi agent. In some embodiments, the linking group is conjugated to the 5' end of the sense strand of the RNAi agent. Examples of linking groups include, but are not limited to, reactive groups such as primary amines and alkynes, alkyl groups, abasic nucleotides, ribitol (abasic ribose), and / or PEG groups.

[0202] A linker or linking group is a connection between two atoms that connects one chemical group or segment of interest (such as an RNAi agent) to another chemical group or segment of interest (such as a targeting group or a delivery polymer) via one or more covalent bonds. A labile linkage contains a labile bond. The linkage may optionally include a spacer that increases the distance between the two atoms that are connected. The spacer can further add flexibility and / or length to the linkage. Spacers include, but are not limited to, alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, aralkenyl groups, and aralkynyl groups, each of which may contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and saccharides. Spacer groups are well known in the art, and the above list is not intended to limit the scope of the description.

[0203] In some embodiments, when two or more RNAi agents are included in a single composition, each of the RNAi agents can be linked to the same targeting group or two different targeting groups (i.e., targeting groups with different chemical structures). In some embodiments, the targeting group is linked to the ANGPTL3 RNAi agent disclosed herein without using an additional linker. In some embodiments, the targeting group itself is designed to have a linker or other moiety to facilitate easy conjugation. In some embodiments, when two or more ANGPTL3 RNAi agents are included in a single composition, each of the RNAi agents can utilize the same linker or different linkers (i.e., linkers with different chemical structures).

[0204] Any of the ANGPTL3 RNAi agent nucleotide sequences listed in Tables 2, 3, or 4, whether modified or unmodified, may contain a 3' and / or 5' targeting group or linking group. Any of the ANGPTL3 RNAi agent sequences listed in Tables 3 or 4 or otherwise described herein that contain a 3' or 5' targeting group or linking group may alternatively contain no 3' or 5' targeting group or linking group, or a different 3' or 5' targeting group or linking group, including but not limited to those shown in Table 6. Any of the ANGPTL3 RNAi agent duplexes listed in Table 5, whether modified or unmodified, may further contain a targeting group or linking group, including but not limited to those shown in Table 6, and the targeting group or linking group may be attached to the 3' or 5' end of either the sense or antisense strand of the ANGPTL3 RNAi agent duplex.

[0205] Examples of targeting groups and linking groups are provided in Table 6. Table 4 provides several embodiments of ANGPTL3 RNAi agent sense strands having a targeting group or linking group attached to the 5' or 3' end. [Table 6-1] [Table 6-2] [Table 6-3] [Table 6-4] [Table 6-5] [Table 6-6] [Table 6-7] [Table 6-8] [Table 6-9] [Table 6-10] [Table 6-11] [Table 6-12] [Table 6-13] [Table 6-14] [Table 6-15] [Table 6-16] [Table 6-17]

[0206] In each of the above structures in Table 6, NAG comprises an N-acetyl-galactosamine or another galactose derivative that one of skill in the art would understand to be attached in light of the above structures and the description provided herein. For example, in some embodiments, NAG in the structures provided in Table 6 comprises the following structure: [ka] It is represented by:

[0207] Each (NAGx) may be linked to the ANGPTL3 RNAi agent via a phosphate group (in the case of (NAG25), (NAG30), and (NAG31)), or a phosphorothioate group (in the case of (NAG25)s, (NAG29)s, (NAG30)s, (NAG31)s, or (NAG37)s), or another linking group. [ka]

[0208] Other linking groups known in the art may also be used.

[0209] In some embodiments, delivery vehicle can be used to deliver RNAi agent to cell or tissue.Delivery vehicle is a compound that improves the delivery of RNAi agent to cell or tissue.Delivery vehicle can include or consist of polymers such as, but not limited to, amphiphilic polymers, membrane active polymers, peptides, melittin peptides, melittin-like peptides (MLPs), lipids, reversibly modified polymers or peptides, or reversibly modified membrane active polyamines.

[0210] In some embodiments, RNAi agent can be combined with lipid, nanoparticle, polymer, liposome, micelle, DPC or other delivery system available in the art.RNAi agent can also be chemically conjugated to targeting group, lipid (including but not limited to cholesterol and cholesteryl derivative), nanoparticle, polymer, liposome, micelle, DPC (see, for example, WO2000 / 053722, WO2008 / 0022309, WO2011 / 104169, and WO2012 / 083185, WO2013 / 032829, WO2013 / 158141, each of which is incorporated herein by reference), or other delivery system available in the art.

[0211] Pharmaceutical Compositions and Formulations The ANGPTL3 RNAi agents disclosed herein can be prepared as pharmaceutical compositions or formulations (also referred to herein as "medicines"). In some embodiments, the pharmaceutical compositions comprise at least one ANGPTL3 RNAi agent. These pharmaceutical compositions are particularly useful in inhibiting expression of a target mRNA in a target cell, cell group, tissue, or organism. The pharmaceutical compositions can be used to treat a subject having a disease, disorder, or condition that would benefit from a reduction in the level of a target mRNA or an inhibition of expression of a target gene. The pharmaceutical compositions can be used to treat a subject at risk of developing a disease, disorder, or condition that would benefit from a reduction in the level of a target mRNA or an inhibition of expression of a target gene. In one embodiment, the method comprises administering to a subject to be treated an ANGPTL3 RNAi agent linked to a targeting ligand as described herein. In some embodiments, one or more pharma- ceutical acceptable excipients (including vehicles, carriers, diluents, and / or delivery polymers) are added to a pharmaceutical composition comprising an ANGPTL3 RNAi agent to form a pharmaceutical formulation or medicament suitable for in vivo delivery to a subject, including a human.

[0212] The pharmaceutical compositions comprising ANGPTL3 RNAi agents and the methods disclosed herein reduce the level of target mRNA in a cell, a group of cells, a group of cells, a tissue, an organ, or a subject, including by inhibiting the expression of ANGPTL3 mRNA in a subject by administering to the subject a therapeutically effective amount of an ANGPTL3 RNAi agent described herein.In some embodiments, the subject has previously been identified or diagnosed as having a pathogenic upregulation of a target gene in a target cell or tissue.In some embodiments, the subject has previously been identified or diagnosed as having an elevated triglyceride (TG) level and / or an elevated cholesterol level, or any other dyslipidemia. In some embodiments, the subject has previously been diagnosed with one or more cardiometabolic diseases, such as hypertriglyceridemia, obesity, hyperlipidemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, atherosclerosis, type II diabetes, cardiovascular disease, coronary artery disease, nonalcoholic steatohepatitis, nonalcoholic fatty liver disease, homozygous and heterozygous familial hypercholesterolemia, statin-resistant hypercholesterolemia, and other metabolic-related disorders and diseases. In some embodiments, the subject has suffered from symptoms associated with one or more cardiometabolic diseases associated with or caused by elevated or increased TG levels, elevated or increased cholesterol levels, or fatty liver.

[0213] In some embodiments, the described pharmaceutical compositions comprising ANGPTL3 RNAi agents are used to treat or manage clinical findings associated with elevated TG levels, elevated cholesterol levels, fatty liver, and / or overexpression of ANGPTL3 mRNA in a subject. In some embodiments, a therapeutically (including prophylactically) effective amount of one or more of the pharmaceutical compositions is administered to a subject in need of such treatment. In some embodiments, administration of any of the disclosed ANGPTL3 RNAi agents can be used to reduce the number, severity, and / or frequency of disease symptoms in a subject.

[0214] The described pharmaceutical compositions comprising ANGPTL3 RNAi agents can be used to treat ANGPTL3 At least one symptom can be treated in the subject with disease or disorder that benefits from reducing or inhibiting mRNA expression.In some embodiments, the symptom is treated by administering to the subject a therapeutically effective amount of one or more pharmaceutical compositions that comprise ANGPTL3 RNAi agent.In other embodiments, the symptom is prevented or inhibited by administering to the subject a prophylactically effective amount of one or more ANGPTL3 RNAi agents.

[0215] The route of administration is the route by which the ANGPTL3 RNAi agent comes into contact with the body. In general, the methods of administering drugs and oligonucleotides and nucleic acids for the treatment of mammals are well known in the art and can be applied to the administration of the compositions described herein. The ANGPTL3 RNAi agent disclosed herein can be administered by any suitable route in a preparation appropriately adjusted for a particular route. Thus, the pharmaceutical composition described herein can be administered by injection, for example, intravenously, intramuscularly, intradermally, subcutaneously, intraarticularly, or intraperitoneally. In some embodiments, the pharmaceutical composition described herein is administered via subcutaneous injection.

[0216] Pharmaceutical compositions comprising the ANGPTL3 RNAi agents described herein can be delivered to cells, cell groups, tissues, or subjects using oligonucleotide delivery techniques known in the art. In general, any suitable method recognized in the art for delivering nucleic acid molecules (in vitro or in vivo) can be adapted for use with the compositions described herein. For example, delivery can be by local administration (e.g., direct injection, implantation, or topical administration), systemic administration, or by subcutaneous, intravenous, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal, and intrathecal), intramuscular, transdermal, airway (aerosol), nasal, oral, rectal, or topical (including buccal and sublingual) administration. In some embodiments, the compositions are administered via subcutaneous or intravenous infusion or injection.

[0217] In some embodiments, the pharmaceutical compositions described herein include one or more pharma- ceutical acceptable excipients. The pharmaceutical compositions described herein are formulated for administration to a subject.

[0218] As used herein, a pharmaceutical composition or medicament comprises a pharmacologically effective amount of at least one of the described therapeutic compounds and one or more pharma- ceutically acceptable excipients. A pharma-ceutically acceptable excipient (excipient) is a substance other than the active pharmaceutical ingredient (API, therapeutic product, e.g., ANGPTL3 RNAi agent) that is intentionally included in the drug delivery system. The excipient does not exert or is not intended to exert a therapeutic effect at the intended dosage. The excipient can act to a) aid in the processing of the drug delivery system during manufacture, b) protect, support, or enhance the stability, bioavailability, or patient acceptability of the API, c) aid in product identification, and / or d) enhance any other attribute of the overall safety, efficacy of the delivery of the API during storage or use. A pharma-ceutically acceptable excipient may or may not be an inert substance.

[0219] Excipients include, but are not limited to, absorption enhancers, anti-adhesives, anti-foaming agents, antioxidants, binders, buffers, carriers, coatings, colors, delivery enhancers, delivery polymers, detergents, dextran, dextrose, diluents, disintegrants, emulsifiers, bulking agents, fillers, flavors, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, surfactants, suspending agents, sustained release matrices, sweeteners, thickeners, isotonicity agents, vehicles, water repellents, and wetting agents.

[0220] Suitable pharmaceutical compositions for injectable use include sterile aqueous solutions (if water soluble) or dispersions and sterile powders for extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor® EL™ (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). Suitable carriers should be stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. In many cases, it is preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

[0221] Sterile injection solution can be prepared by incorporating the active compound in the required amount in a suitable solvent with one or combination of the above-listed components as required, and then performing sterilization filtration.Generally, dispersion is prepared by incorporating the active compound into a sterile vehicle that contains the basic dispersion medium and other necessary components from the above-listed components.For the preparation of sterile powder for sterile injection solution, the preparation method includes vacuum drying and freeze-drying, which produces the powder of active ingredient and any additional desired components from its previously sterile-filtered solution.

[0222] Formulations suitable for intra-articular administration may be in the form of a sterile aqueous preparation of the drug, which may be in microcrystalline form, for example, in the form of an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymer systems may also be used to present the drug for both intra-articular and intraocular administration.

[0223] Active compound can be prepared with carriers that protect the compound against rapid removal from the body, such as controlled release formulations, including implants and microencapsulated delivery systems.Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid.Methods for preparing such formulations will be clear to those skilled in the art.Liposomal suspensions can also be used as pharmaceutically acceptable carriers.These can be prepared according to the methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.

[0224] ANGPTL3 RNAi agent can be formulated into composition in unit dosage form for ease of administration and uniformity of dosage.Unit dosage form refers to a physically separate unit suitable as a single dosage for the subject to be treated; each unit contains a predetermined amount of active compound calculated to produce desired therapeutic effect associated with required pharmaceutical carrier.The specification for unit dosage form of the present disclosure is determined and directly depends on the unique characteristics of active compound and therapeutic effect to be achieved, as well as the inherent limitation in the art of combining such active compound for individual treatment.

[0225] The pharmaceutical composition may contain other additional components that are commonly found in pharmaceutical compositions. Such additional components include, but are not limited to, antipruritic agents, astringents, local anesthetics, analgesics, antihistamines, or anti-inflammatory agents (e.g., acetaminophen, NSAIDs, diphenhydramine, etc.). It is also envisioned that cells, tissues, or isolated organs that express or contain the RNAi agent defined herein can be used as a "pharmaceutical composition". As used herein, "pharmacologically effective amount", "therapeutically effective amount", or simply "effective amount" refers to the amount of RNAi agent that produces a pharmacological, therapeutic, or preventive result.

[0226] In some embodiments, the method disclosed herein further comprises administering a second therapeutic agent or treatment in addition to administering the RNAi agent disclosed herein.In some embodiments, the second therapeutic agent is another ANGPTL3 RNAi agent (e.g., an ANGPTL3 RNAi agent that targets a different sequence within an ANGPTL3 target).In other embodiments, the second therapeutic agent may be a small molecule drug, an antibody, an antibody fragment, or an aptamer.

[0227] In general, an effective amount of an active compound is in the range of about 0.1 to about 100 mg / kg body weight / day, for example, about 1.0 to about 50 mg / kg body weight / day. In some embodiments, an effective amount of an active compound is in the range of about 0.25 to about 5 mg / kg body weight / dose. In some embodiments, an effective amount of an active ingredient is in the range of about 0.5 to about 4 mg / kg body weight / dose. The amount administered may also depend on variables such as the overall health of the patient, the relative biological potency of the compound being delivered, the formulation of the drug, the presence and type of excipients in the formulation, and the route of administration. Also, the initial dosage administered may be increased beyond the upper upper level to rapidly achieve the desired blood or tissue levels, or the initial dosage may be less than the optimal dosage.

[0228] For the treatment of a disease or to form a medicament or composition for the treatment of a disease, the pharmaceutical compositions described herein comprising an ANGPTL3 RNAi agent can be combined with an excipient or with a second therapeutic agent or treatment, including, but not limited to, a second or other RNAi agent, a small molecule drug, an antibody, an antibody fragment, a peptide, and / or an aptamer.

[0229] When added to a pharma- ceutically acceptable excipient or adjuvant, the described ANGPTL3 RNAi agents can be packaged in a kit, container, pack, or dispenser.The pharmaceutical compositions described herein may also be packaged in pre-filled syringes or vials.

[0230] Methods of Treatment and Inhibition of Expression The ANGPTL3 RNAi agent disclosed herein can be used to treat subjects (e.g., humans or other mammals) with diseases or disorders that benefit from the administration of the RNAi agent.In some embodiments, the RNAi agent disclosed herein can be used to treat subjects (e.g., humans) that benefit from the reduction and / or inhibition of the expression of ANGPTL3 mRNA and / or ANGPTL3 protein levels, such as subjects diagnosed with hypertriglyceridemia, obesity, hyperlipidemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, type II diabetes, cardiovascular disease, coronary artery disease, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, homozygous and heterozygous familial hypercholesterolemia, statin-resistant hypercholesterolemia, and other metabolic-related disorders and diseases.

[0231] In some embodiments, the subject is administered a therapeutically effective amount of any one or more ANGPTL3 RNAi agents. The treatment of the subject may include therapeutic and / or prophylactic treatment. The subject is administered a therapeutically effective amount of any one or more ANGPTL3 RNAi agents described herein. The subject may be a human, a patient, or a human patient. The subject may be an adult, an adolescent, a child, or an infant. The administration of the pharmaceutical compositions described herein may be to a human or an animal.

[0232] The ANGPTL3 RNAi agent described herein can be used to treat at least one symptom in a subject having an ANGPTL3-related disease or disorder, or a disease or disorder that is at least partially mediated by ANGPTL3 gene expression. In some embodiments, the ANGPTL3 RNAi agent is used to treat or manage the clinical findings of a subject having an ANGPTL3-related disease or disorder. The subject is administered a therapeutically effective amount of one or more of the ANGPTL3 RNAi agents or ANGPTL3 RNAi agent-containing compositions described herein. In some embodiments, the method disclosed herein comprises administering to the subject to be treated a composition comprising the ANGPTL3 RNAi agent described herein. In some embodiments, the subject is treated by preventing or inhibiting at least one symptom by administering to the subject a prophylactically effective amount of any one or more of the ANGPTL3 RNAi agents described herein.

[0233] In certain embodiments, the disclosure provides methods for treatment of a disease, disorder, condition, or pathology mediated at least in part by ANGPTL3 gene expression in a patient in need thereof, comprising administering to the patient any of the ANGPTL3 RNAi agents described herein.

[0234] In some embodiments, the gene expression level and / or mRNA level of the ANGPTL3 gene in a subject to which a described ANGPTL3 RNAi agent is administered is is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 95%, 96%, 97%, 98%, 99%, or greater than 99% compared to the subject before administration of the RNAi agent or a subject not receiving the ANGPTL3 RNAi agent. In some embodiments, the ENaC level or ENaC channel activity level in certain epithelial cells of a subject administered with the described ANGPTL3 RNAi agent is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more than 99% compared to the subject before administration of the ANGPTL3 RNAi agent or the subject that has not received the ANGPTL3 RNAi agent. Gene expression levels, protein levels, and / or mRNA levels in a subject can be reduced in a cell, cell group, and / or tissue of the subject.

[0235] In some embodiments, the ANGPTL3 protein level of a subject administered a described ANGPTL3 RNAi agent is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more than 99% compared to the subject before administration of the ANGPTL3 RNAi agent or a subject that has not received the ANGPTL3 RNAi agent. Protein levels in a subject can be reduced in a cell, a group of cells, a tissue, blood, and / or other bodily fluid of the subject.

[0236] In some embodiments, the triglyceride (TG) level in a subject administered a described ANGPTL3 RNAi agent is reduced by at least about 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more than 99% compared to the subject before administration of the ANGPTL3 RNAi agent or to a subject not administered the ANGPTL3 RNAi agent. The TG level in a subject may be reduced in a cell, cell group, tissue, blood, and / or other bodily fluid of the subject.

[0237] In some embodiments, total cholesterol levels in a subject to whom a described ANGPTL3 RNAi agent has been administered are reduced by at least about 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more than 99% compared to the subject before administration of the ANGPTL3 RNAi agent or a subject not administered the ANGPTL3 RNAi agent. In some embodiments, the low density lipoprotein (LDL) cholesterol level in a subject administered a described ANGPTL3 RNAi agent is reduced by at least about 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more than 99% compared to the subject before administration of the ANGPTL3 RNAi agent or to a subject not administered the ANGPTL3 RNAi agent. The total cholesterol level and / or the LDL cholesterol level in a subject may be reduced in a cell, cell group, tissue, blood, and / or other bodily fluid of the subject.

[0238] The reduction of ANGPTL3 mRNA level, ANGPTL3 protein level, TG level, cholesterol level and LDL cholesterol level can be evaluated by any method known in the art.As used herein, the reduction or decrease of ANGPTL3 mRNA level and / or protein level is collectively referred to herein as the reduction or decrease of ANGPTL3 or the inhibition or decrease of the expression of ANGPTL3.The examples described herein illustrate the known method for evaluating the inhibition of ANGPTL3 gene expression.

[0239] Cells, tissues, organs, and non-human organisms Contemplated herein is a cell, tissue, organ, and non-human organism that comprises at least one of the ANGPTL3 RNAi agents described herein.Cell, tissue, organ, or non-human organism is produced by delivering RNAi agent to cell, tissue, organ, or non-human organism.

[0240] The embodiments and articles provided above will now be illustrated with the following non-limiting examples. EXAMPLES

[0241] Example 1 Synthesis of ANGPTL3 RNAi agents The ANGPTL3 RNAi agent duplexes shown above in Table 5 were synthesized according to the following general procedure.

[0242] A. Synthesis. The sense and antisense strands of the RNAi agents were synthesized according to the phosphoramidite technique on solid phase used in oligonucleotide synthesis. Depending on the scale, either MerMade96E® (Bioautomation), MerMade12® (Bioautomation), or OP Pilot 100 (GE Healthcare) were used. Synthesis was carried out on a solid support made of controlled pore glass (CPG, 500 Å or 600 Å, obtained from Prime Synthesis, Aston, PA, USA). All RNA and 2'-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA) or Hongene Biotech (Shanghai, PRC). 2'-O-methyl phosphoramidites were the following: (5'-O-dimethoxytrityl-N 6 -(benzoyl)-2'-O-methyl-adenosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, 5'-O-dimethoxy-trityl-N 4 -(Acetyl)-2'-O-methyl-cytidine-3'-O-(2-cyanoethyl-N,N-diisopropyl-amino) phosphoramidite, (5'-O-dimethoxytrityl-N 2The protecting groups included 5'-(isobutyryl)-2'-O-methyl-guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, and 5'-O-dimethoxytrityl-2'-O-methyl-uridine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite. The 2'-deoxy-2'-fluoro-phosphoramidite carried the same protecting groups as the 2'-O-methylamidite. 5'-(4,4'-dimethoxytrityl)-2',3'-seco-uridine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite were also purchased from Thermo Fisher Scientific or Hongene Biotech. 5'-Dimethoxytrityl-2'-O-methyl-inosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite was purchased from Glen Research (Virginia) or Hongene Biotech. Abasic (3'-O-dimethoxytrityl-2'-deoxyribose-5'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite was purchased from ChemGenes (Wilmington, MA, USA) or SAFC (St Louis, MO, USA). 5'-O-Dimethoxytrityl-N 2 ,N 6 -(Phenoxyacetate)-2'-O-methyl-diaminopurine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite was purchased from ChemGenes or Hongene Biotech.

[0243] The targeted ligand-containing phosphoramidites were dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), and all other amidites were dissolved in anhydrous acetonitrile (50 mM) or anhydrous dimethylformamide, with the addition of molecular sieves (3 Å). 5-benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) were used as activator solutions. Coupling times were 12 min (RNA), 15 min (targeted ligand), 90 s (2'OMe), and 60 s (2'F). To introduce phosphorothioate bonds, a 100 mM solution of 3-phenyl-1,2,4-dithiazolin-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used. Unless specifically identified as a "naked" RNAi agent in which no targeting ligand is present, each of the ANGPTL3 RNAi agent duplexes synthesized and tested in the following examples utilized N-acetyl-galactosamine as the "NAG" in the targeting ligand chemical structures depicted in Table 6.

[0244] B. Cleavage and deprotection of the support-bound oligomer. After finalization of the solid-phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40 wt% methylamine and 28% ammonium hydroxide solution (Aldrich) in water for 1.5 hours at 30° C. The solution was evaporated and the solid residue was reconstituted in water (see below).

[0245] C. Purification. Crude oligomers were purified by anion exchange HPLC using a TSKgel SuperQ-5PW, 13 μm column and a Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0, containing 20% ​​acetonitrile, and buffer B was the same as buffer A with the addition of 1.5 M sodium chloride. UV traces at 260 nm were recorded. Appropriate fractions were pooled and then run on a size exclusion HPLC using a GE Healthcare XK 26 / 40 column packed with Sephadex G-25 fine with filtered DI water or a running buffer of 100 mM ammonium bicarbonate, pH 6.7, and 20% acetonitrile.

[0246] D. Annealing. Complementary strands were mixed to form RNAi agents by combining equimolar RNA solutions (sense and antisense) in 1x phosphate-buffered saline (Corning, Cellgro). Some RNAi agents were lyophilized and stored at -15 to -25 °C. The duplex concentration was determined by measuring the absorbance of the solution on a UV-Vis spectrophotometer in 1x phosphate-buffered saline. The absorbance of the solution at 260 nm was then multiplied by the conversion factor and dilution factor to determine the duplex concentration. The conversion factor used was 0.037 mg / (mL cm) or calculated from the experimentally determined absorption coefficient.

[0247] Example 2 In vivo testing of ANGPTL3 RNAi agents in mice To evaluate the in vivo activity of ANGPTL3 RNAi agents designed to target different locations on the ANGPTL3 gene, 6-8 week old female C57bl / 6 mice were used. Pre-dose serum samples were collected after a 4 hour fast on day -1. On day 1, each mouse received a single subcutaneous dose of 200 μl containing either 3 mg / kg (mpk) of ANGPTL3 RNAi agent in D5W (5% dextrose in water) or a control without RNAi agent (D5W) according to the dosing groups listed in Table 7. [Table 7-1] [Table 7-2]

[0248] Each of the RNAi agents contained a modified sequence and an N-acetyl-galactosamine-containing targeting ligand conjugated to the 5' end of the sense strand (see Tables 3, 4, and 5 for modified sequence and targeting ligand structure). Injections were performed between the skin and muscle in the loose skin of the neck and shoulder area (i.e., subcutaneous injection). Three mice from each group were tested (n=3). Serum was collected on days 8, 13, 22, 29, and 36 (groups 1 and 5-11 only). Mice were fasted for 4 hours before each collection. ANGPTL3 protein levels in serum were measured by ELISA assay (R&D Systems) according to the manufacturer's recommendations. Triglycerides, high-density lipoprotein (HDL), and total cholesterol in serum were measured in a Cobas® Integra 400 (Roche Diagnostics) according to the manufacturer's recommendations.

[0249] ANGPTL3 protein level, triglyceride level, HDL level and total cholesterol level of each animal were normalized.For normalization, ANGPTL3 protein, triglyceride level, HDL level and total cholesterol level of each animal at a certain time point were divided by the expression level before treatment in that animal (in this case, day -1) to determine the expression ratio "normalized to before treatment".Then, the expression at a certain time point was normalized to the D5W control group by dividing the "normalized to before treatment" ratio of each individual animal by the average "normalized to before treatment" ratio of all mice in the D5W control group.This gives the expression at each time point normalized to the expression of the control group. Data from the studies described in this Example are presented below in Tables 8-11. [Table 8] [Table 9] [Table 10] [Table 11]

[0250] ANGPTL3 RNAi agents AD05342 and AD05343 (groups 2 and 3) contained a nucleotide sequence designed to inhibit expression of the ANGPTL3 gene at position 743 of the gene; ANGPTL3 RNAi agent AD05344 (group 4) contained a nucleotide sequence designed to inhibit expression of the ANGPTL3 gene at position 744 of the gene; ANGPTL3 RNAi agents AD05306 and AD05307 (groups 5 and 6) contained a nucleotide sequence designed to inhibit expression of the ANGPTL3 gene at position 921 of the gene; ANGPTL3 RNAi agents AD05308 and AD05309 (groups 7 and 8) contained a nucleotide sequence designed to inhibit expression of the ANGPTL3 gene at position 922 of the gene; ANGPTL3 RNAi agents AD05310 and AD05311 (groups 9 and 10) contained a nucleotide sequence designed to inhibit expression of the ANGPTL3 gene at position 1302 of the gene; and ANGPTL3 RNAi agent AD05312 (group 11) contained a nucleotide sequence designed to inhibit expression of the ANGPTL3 gene at position 1304 of the gene (see SEQ ID NO:1 for the referenced ANGPTL3 gene sequence).

[0251] As shown in Table 8 above, at least each of the RNAi agents of groups 5, 6, 7, 8, 9, 10, and 11 showed ANGPTL3 inhibition. For example, at day 29, group 7 (ANGPTL3 RNAi agent AD05308), which includes a nucleotide sequence designed to target position 922 of the ANGPTL3 gene, showed about a 91% percent reduction in ANGPTL3 protein (0.088) compared to the control. Similarly, both group 5 (ANGPTL3 RNAi agent AD05306) and group 6 (ANGPTL3 RNAi agent AD05307), which are designed to target position 921 of the ANGPTL3 gene, showed a greater than 75% reduction in ANGPTL3 protein (i.e., 0.240 and 0.206) at day 29.

[0252] Example 3 In vivo testing of ANGPTL3 RNAi agents in mice To evaluate the in vivo activity of ANGPTL3 RNAi agents designed to target positions 921 and 922 on the ANGPTL3 gene, 6-8 week old female C57bl / 6 mice were used. Pre-dose serum samples were collected after a 4 hour fast on day -1. On day 1, each mouse received a single subcutaneous dose of 200 μl containing either 1 mg / kg (mpk) of ANGPTL3 RNAi agent in D5W (5% dextrose in water) or a control without RNAi agent (D5W) according to the dosing groups listed in Table 12. [Table 12]

[0253] Each of the RNAi agents contained a modified sequence and an N-acetyl-galactosamine-containing targeting ligand conjugated to the 5' end of the sense strand (see Tables 3, 4, and 5 for modified sequence and targeting ligand structure). Injections were performed between the skin and muscle of the loose skin of the neck and shoulder area (i.e., subcutaneous injection). Three mice of each group were tested (n=3). Serum was collected on days 9, 15, 22, and 29. Before each collection, the mice were fasted for 4 hours. ANGPTL3 protein levels in serum were measured by ELISA assay (R&D Systems) according to the manufacturer's recommendations. Triglycerides, high-density lipoprotein (HDL), and total cholesterol in serum were measured in Cobas® Integra 400 (Roche Diagnostics) according to the manufacturer's recommendations.

[0254] ANGPTL3 protein level, triglyceride level, HDL level and total cholesterol level of each animal were normalized.For normalization, ANGPTL3 protein, triglyceride level, HDL level and total cholesterol level of each animal at a certain time point were divided by the expression level before treatment in that animal (in this case, day -1) to determine the expression ratio "normalized to before treatment".Then, the expression at a certain time point was normalized to the D5W control group by dividing the "normalized to before treatment" ratio of each individual animal by the average "normalized to before treatment" ratio of all mice in the D5W control group.This gives the expression at each time point normalized to the expression of the control group. Data from the studies described in this Example are presented below in Tables 13-16. [Table 13-1] [Table 13-2] [Table 14-1] [Table 14-2] [Table 14-3] [Table 15-1] [Table 15-2] [Table 15-3] [Table 16-1] [Table 16-2] [Table 16-3]

[0255] The ANGPTL3 RNAi agents of groups 2-11 have different sequences and modification patterns, but each contains a nucleotide sequence designed to inhibit expression of the ANGPTL3 gene at position 921 of the gene, and the ANGPTL3 RNAi agents of groups 12-19 each contains a nucleotide sequence designed to inhibit expression of the ANGPTL3 gene at position 922 of the gene (see SEQ ID NO: 1 of the referenced ANGPTL3 gene sequence). As shown in Table 12 above, each of the RNAi agents achieved inhibition of ANGPTL3 compared to the control. For example, group 12 (ANGPTL3 RNAi agent AD05308) achieved a nearly 80% reduction in ANGPTL3 protein levels compared to the control (0.209) at day 22.

[0256] Example 4 In vivo testing of ANGPTL3 RNAi agents in mice To evaluate the in vivo activity of ANGPTL3 RNAi agents designed to target additional locations on the ANGPTL3 gene, 6-8 week old female C57bl / 6 mice were used. Pre-dose serum samples were collected on day -1 after a 4 hour fast. On day 1, each mouse received a single subcutaneous dose of 200 μl containing either 1 mg / kg (mpk) or 0.5 mg / kg (mpk) of ANGPTL3 RNAi agent in D5W (5% dextrose in water), or a control without RNAi agent (D5W), according to the dosing groups listed in Table 17. [Table 17-1] [Table 17-2]

[0257] Each of the RNAi agents contained a modified sequence and an N-acetyl-galactosamine-containing targeting ligand conjugated to the 5' end of the sense strand (see Tables 3, 4, and 5 for modified sequence and targeting ligand structure). Injections were performed between the skin and muscle of the loose skin of the neck and shoulder area (i.e., subcutaneous injection). Three mice of each group were tested (n=3). Serum was collected on days 8, 15, 22, 29, and 43 (groups 1-3, 9, and 11-13 only). Mice were fasted for 4 hours before each collection. ANGPTL3 protein levels in serum were measured by ELISA assay (R&D Systems) according to the manufacturer's recommendations. Triglycerides, high-density lipoprotein (HDL), and total cholesterol in serum were measured in Cobas® Integra 400 (Roche Diagnostics) according to the manufacturer's recommendations.

[0258] ANGPTL3 protein level, triglyceride level, HDL level and total cholesterol level of each animal were normalized.For normalization, ANGPTL3 protein, triglyceride level, HDL level and total cholesterol level of each animal at a certain time point were divided by the expression level before treatment in that animal (in this case, day -1) to determine the expression ratio "normalized to before treatment".Then, the expression at a certain time point was normalized to the D5W control group by dividing the "normalized to before treatment" ratio of each individual animal by the average "normalized to before treatment" ratio of all mice in the D5W control group.This gives the expression at each time point normalized to the expression of the control group. Data from the studies described in this Example are presented below in Tables 18-22. [Table 18-1] [Table 18-2] [Table 19-1] [Table 19-2] [Table 20-1] [Table 20-2] [Table 21-1] [Table 21-2] [Table 22-1] [Table 22-2]

[0259] ANGPTL3 RNAi agents AD05487 and AD05488 (groups 2 and 3) contained a nucleotide sequence designed to inhibit expression of the ANGPTL3 gene at position 304 of the gene; ANGPTL3 RNAi agents AD05489 and AD05490 (groups 4 and 5) contained a nucleotide sequence designed to inhibit expression of the ANGPTL3 gene at position 172 of the gene; ANGPTL3 RNAi agents AD05491 and AD05492 (groups 6 and 7) contained a nucleotide sequence designed to inhibit expression of the ANGPTL3 gene at position 1008 of the gene; ANGPTL3 RNAi agent AD0593 (group 8) contained a nucleotide sequence designed to inhibit expression of the ANGPTL3 gene at position 1009 of the gene; ANGPTL3 RNAi agents AD05494, AD05495, and AD05308 (groups 9, 10, 11, and 12) contained a nucleotide sequence designed to inhibit expression of the ANGPTL3 gene at position 1302 of the gene; and ANGPTL3 RNAi agent AD05418 (group 13) contained a nucleotide sequence designed to inhibit expression of the ANGPTL3 gene at position 921 of the gene (see SEQ ID NO: 1 for the referenced ANGPTL3 gene sequence).

[0260] As shown in Table 18 above, most of the RNAi agents achieved a reduction in ANGPTL3 protein levels at nearly every time point measured, but the ANGPTL3 RNAi agents of Group 2 (AD05487) and Group 3 (AD05488), each containing a nucleotide sequence designed to inhibit ANGPTL3 gene expression at position 304 of the gene, outperformed the other groups in this study. For example, at days 15 and 22, ANGPTL3 RNAi agent AD05488 (Group 3) achieved greater than 90% knockdown of ANGPTL3 protein (i.e., 0.070 at day 15 and 0.092 at day 22). Similarly, ANGPTL3 RNAi agent AD05487 (Group 2) achieved nearly 75% knockdown at days 15 and 22 (i.e., 0.170 at day 15 and 0.138 at day 22). Moreover, the same trends were observed for further measured parameters including TG, total cholesterol, and LDL, with both Group 2 (AD05487) and Group 3 (AD05488) generally outperforming other RNAi agents tested (see Tables 19-22). For example, for Groups 2 and 3, triglyceride levels were reduced by at least 28% (i.e., 0.556 or 0.721), total cholesterol was reduced by at least 31% (i.e., 0.560 or 0.683), and LDL levels were reduced by nearly 20% (0.744 or 0.801) at day 29.

[0261] Example 5 In vivo testing of ANGPTL3 RNAi agents in cynomolgus monkeys ANGPTL3 RNAi agents were evaluated in cynomolgus monkeys. On day 1, cynomolgus monkeys (Macaca fascicularis) primates (also referred to herein as "cynos") were administered a single subcutaneous injection of 0.3 mL / kg (approximately 2-3 mL volume, depending on the animal's weight) containing 3.0 mg / kg of ANGPTL3 RNAi agent AD05308 or AD05418 formulated in saline. Each of the ANGPTL3 RNAi agents contained modified nucleotides and included an N-acetyl-galactosamine targeting ligand conjugated to the 5' end of the sense strand, as shown in Tables 3, 4, and 5.

[0262] Two cynomolgus monkeys were tested per group (n=2). Blood samples were collected and serum samples were analyzed on days -37 (pre-dose), -15 (pre-dose), and -1 (pre-dose), 8, 16, 23, 30, and 37. Cynomolgus monkeys were fasted overnight before each collection. ANGPTL3 protein levels in serum were measured by ELISA assay (R&D Systems) according to the manufacturer's recommendations. ANGPTL3 protein levels were normalized. For normalization, the ANGPTL3 protein level for each animal at a time point was divided by the average expression level before treatment in that animal (in this case days -37, -15, and -1) to determine the "normalized to pre-treatment" expression ratio.

[0263] Data from the studies described in this Example are presented below in Tables 23 and 24. [Table 23] [Table 24]

[0264] Each of the cynomolgus monkeys administered either AD05308 or AD05418 showed a reduction in ANGPTL3 protein compared to pre-treatment measurements at all measured time points. For example, for individual animals, on day 16, cynomolgus monkeys administered AD05418 showed either a reduction of about 64% (0.358 normalized protein level) or a reduction of 69% (0.309 normalized protein level) in ANGPTL3 protein. Furthermore, even on day 37, cynomolgus monkeys in group 2 (AD05418) showed an average reduction of about 73% (0.270) in ANGPTL protein levels.

[0265] Example 6 In vivo testing of ANGPTL3 RNAi agents in mice To evaluate the in vivo activity of additional ANGPTL3 RNAi agents designed to target position 304 on the ANGPTL3 gene, 6-8 week old female C57bl / 6 mice were used. Pre-dose serum samples were collected on day -1 after a 4 hour fast. On day 1, each mouse received a single subcutaneous dose of 200 μl containing 0.5 mg / kg (mpk) of ANGPTL3 RNAi agent in D5W (5% dextrose in water) or a control without RNAi agent (D5W) according to the dosing groups listed in Table 25. [Table 25]

[0266] Each of the RNAi agents contained a modified sequence and an N-acetyl-galactosamine-containing targeting ligand conjugated to the 5' end of the sense strand (see Tables 3, 4, and 5 for modified sequence and targeting ligand structure). Injections were performed between the skin and muscle of the loose skin of the neck and shoulder area (i.e., subcutaneous injection). Three mice of each group were tested (n=3). Serum was collected on days 8, 15, 22, 30, and for certain groups (i.e., groups 1, 2, 5, and 10 only), on day 43. Mice were fasted for 4 hours before each collection. ANGPTL3 protein levels in serum were measured by ELISA assay (R&D Systems) according to the manufacturer's recommendations. Serum triglycerides, total cholesterol, high density lipoprotein (HDL), and low density lipoprotein (LDL) were measured in Cobas® Integra 400 (Roche Diagnostics) according to the manufacturer's recommendations.

[0267] ANGPTL3 protein level, triglyceride level, total cholesterol level, HDL level and LDL level of each animal were normalized.For normalization, ANGPTL3 protein level, triglyceride level, HDL level and total cholesterol level for each animal at a certain time point were divided by the expression level before treatment in that animal (in this case, day -1) to determine the expression ratio "normalized to before treatment".Then, the expression at a certain time point was normalized to the D5W control group by dividing the "normalized to before treatment" ratio for each individual animal by the average "normalized to before treatment" ratio of all mice in the D5W control group.This resulted in the expression at each time point normalized to the expression of the control group.

[0268] Data from the studies described in this Example are presented in the table below. [Table 26-1] [Table 26-2] [Table 27] [Table 28-1] [Table 28-2] [Table 29] [Table 30]

[0269] ANGPTL3 RNAi agents (i.e., AD05488, AD05652, AD05653, AD05654, AD05655, AD05656, AD05657, AD05658, AD05660, AD05661, and AD05662), each of which comprises a nucleotide sequence designed to target the ANGPTL3 gene at position 304 (see, e.g., SEQ ID NO: 1), were tested. As shown above, each of the RNAi agents showed a substantial reduction in ANGPTL3 protein levels until at least day 22. Reductions in TG levels and total cholesterol were also observed.

[0270] Example 7 In vivo testing of ANGPTL3 RNAi agents in mice To further evaluate the in vivo activity of additional ANGPTL3 RNAi agents designed to target position 304 on the ANGPTL3 gene, 6-8 week old female C57bl / 6 mice were used. Pre-dose serum samples were collected on day -1 after a 4 hour fast. On day 1, each mouse received a single subcutaneous dose of 200 μl containing 0.5 mg / kg (mpk) of ANGPTL3 RNAi agent in D5W (5% dextrose in water) or a control without RNAi agent (D5W) according to the dosing groups listed in Table 31. [Table 31]

[0271] Each of the RNAi agents contained a modified sequence and an N-acetyl-galactosamine-containing targeting ligand conjugated to the 5' end of the sense strand (see Tables 3, 4, and 5 for modified sequence and targeting ligand structure). Injections were performed between the skin and muscle of the loose skin of the neck and shoulder area (i.e., subcutaneous injection). Three mice of each group were tested (n=3). Serum was collected on days 8, 15, 22, and 29. Before each collection, mice were fasted for 4 hours. ANGPTL3 protein levels in serum were measured by ELISA assay (R&D Systems) according to the manufacturer's recommendations. Triglycerides, total cholesterol, high density lipoprotein (HDL), and low density lipoprotein (LDL) in serum were measured in Cobas® Integra 400 (Roche Diagnostics) according to the manufacturer's recommendations.

[0272] ANGPTL3 protein level, triglyceride level, total cholesterol level, HDL level and LDL level of each animal were normalized.For normalization, ANGPTL3 protein level, triglyceride level, HDL level and total cholesterol level for each animal at a certain time point were divided by the expression level before treatment in that animal (in this case, day -1) to determine the expression ratio "normalized to before treatment".Then, the expression at a certain time point was normalized to the D5W control group by dividing the "normalized to before treatment" ratio for each individual animal by the average "normalized to before treatment" ratio of all mice in the D5W control group.This resulted in the expression at each time point normalized to the expression of the control group.

[0273] Data from the studies described in this Example are presented below in Tables 32-36. [Table 32] [Table 33-1] [Table 33-2] [Table 34] [Table 35-1] [Table 35-2] [Table 36]

[0274] Example 8 In vivo testing of ANGPTL3 RNAi agents in cynomolgus monkeys Additional ANGPTL3 RNAi agents were evaluated in cynomolgus monkeys. On day 1, cynomolgus monkeys (Macaca fascicularis) primates (also referred to herein as "cynos") were administered a single subcutaneous injection of 0.3 mL / kg (approximately 1-2 mL volume, depending on the animal's weight) containing 3.0 mg / kg of one of the ANGPTL3 RNAi agents AD05577, AD05307, AD05488, AD05654, or AD05659, each formulated in saline. Each of the ANGPTL3 RNAi agents contained modified nucleotides and included an N-acetyl-galactosamine targeting ligand conjugated to the 5' end of the sense strand, as shown in Tables 3, 4, and 5.

[0275] Two cynomolgus monkeys were tested per group (n=2). Blood samples were collected and serum samples were analyzed on days -8 (pre-dose), 1 (pre-dose), 8, 15, 22, 29, and 36. Cynomolgus monkeys were fasted overnight before each collection. ANGPTL3 protein levels in serum were measured by ELISA assay (R&D Systems) according to the manufacturer's recommendations. Serum triglycerides, total cholesterol, high-density lipoprotein (HDL), and low-density lipoprotein (LDL) were measured in Cobas® Integra 400 (Roche Diagnostics) according to the manufacturer's recommendations.

[0276] The ANGPTL3 protein level, triglyceride level, total cholesterol level, HDL level, and LDL level of each animal were normalized. For normalization, the ANGPTL3 protein, triglyceride, HDL, and total cholesterol levels for each animal at a time point were divided by the average expression level before treatment in that animal (in this case, days -8 and 1 (pre-administration)) to determine the "normalized to pre-treatment" expression ratio.

[0277] Data from the studies described in this Example are presented below in Tables 37-41. [Table 37] [Table 38-1] [Table 38-2] [Table 39] [Table 40] [Table 41]

[0278] Cynomolgus monkeys administered either AD05577, AD05307, AD05488, AD05654, or AD05659 each showed a decrease in ANGPTL3 protein compared to pre-treatment measurements at all measured time points.

[0279] Example 9 In vivo testing of ANGPTL3 RNAi agents in cynomolgus monkeys Additional ANGPTL3 RNAi agents were evaluated in cynomolgus monkeys. On day 1, cynomolgus monkey (Macaca fascicularis) primates (also referred to herein as "cynos") were administered a single subcutaneous injection of 0.3 mL / kg (approximately 2-3 mL volume, depending on the animal's weight) containing 2.0 mg / kg of an ANGPTL3 RNAi agent, including either AD05488, AD05743, AD05775, or AD05841, each formulated in saline. Each of the ANGPTL3 RNAi agents contained modified nucleotides and included an N-acetyl-galactosamine targeting ligand conjugated to the 5' end of the sense strand, as shown in Tables 3, 4, and 5. ANGPTL3 RNAi agents AD05488, AD05743, and AD05775 included nucleotide sequences designed to target position 304 of the ANGPTL3 gene. The ANGPTL3 RNAi agent AD05841 contained a nucleotide sequence designed to target position 1035 of the ANGPTL3 gene.

[0280] Three cynomolgus monkeys were tested per group (n=3). Blood samples were collected and serum samples were analyzed on days -14 (pre-dose), -7 (pre-dose), 1 (pre-dose), 8, 15, 22, 29, and 35. Cynomolgus monkeys were fasted overnight before each collection. ANGPTL3 protein levels in serum were measured by ELISA assay (R&D Systems) according to the manufacturer's recommendations. Serum triglycerides, total cholesterol, high-density lipoprotein (HDL), and low-density lipoprotein (LDL) were measured in Cobas® Integra 400 (Roche Diagnostics) according to the manufacturer's recommendations.

[0281] ANGPTL3 protein levels, triglyceride levels, total cholesterol levels, HDL levels, and LDL levels of each animal were normalized. For normalization, the ANGPTL3 protein, triglyceride, HDL, and total cholesterol levels for each animal at a time point were divided by the average expression level before treatment in that animal (in this case, days -14, -7, and 1) to determine the "normalized to before treatment" expression ratio.

[0282] Data from the studies described in this Example are presented below in Tables 42-45. [Table 42] [Table 43-1] [Table 43-2] [Table 44] [Table 45] [Table 46]

[0283] Cynomolgus monkeys administered either AD05488, AD05743, AD05775, and AD05841, each at a dosage level of 2.0 mg / kg, each showed a decrease in ANGPTL3 protein compared to pre-treatment measurements at each of the time points measured.

[0284] Example 10 Further in vivo testing of ANGPTL3 RNAi agents in mice To evaluate the in vivo activity of additional ANGPTL3 RNAi agents designed to target position 304 on the ANGPTL3 gene, 6-8 week old female C57bl / 6 mice were used. Pre-dose serum samples were collected on day -1 after a 4 hour fast. On day 1, each mouse received a single subcutaneous dose of 200 μl containing 0.5 mg / kg (mpk) of ANGPTL3 RNAi agent in D5W (5% dextrose in water) or a control without RNAi agent (D5W) according to the dosing groups listed in Table 47. [Table 47]

[0285] Each of the RNAi agents contained a modified sequence and an N-acetyl-galactosamine-containing targeting ligand conjugated to the 5' end of the sense strand (see Tables 3, 4, and 5 for modified sequences and targeting ligand structures). As noted above, each of the ANGPTL3 RNAi agents administered in this study contained a nucleotide sequence designed to target the ANGPTL3 gene at position 304. Injections were performed between the skin and muscle in the loose skin of the neck and shoulder area (i.e., subcutaneous injections). Three mice from each group were tested (n=3). Serum was collected on days 8, 15, 22, 29, and for some groups (i.e., only groups 1, 2, and 9-13), on day 36. Mice were fasted for 4 hours before each collection. ANGPTL3 protein levels in serum were measured by ELISA assay (R&D Systems) according to the manufacturer's recommendations. Serum triglycerides, total cholesterol, high density lipoprotein (HDL), and low density lipoprotein (LDL) were measured on a Cobas® Integra 400 (Roche Diagnostics) according to the manufacturer's recommendations.

[0286] ANGPTL3 protein level, triglyceride level, total cholesterol level, HDL level and LDL level of each animal were normalized.For normalization, ANGPTL3 protein level, triglyceride level, HDL level and total cholesterol level for each animal at a certain time point were divided by the expression level before treatment in that animal (in this case, day -1) to determine the expression ratio "normalized to before treatment".Then, the expression at a certain time point was normalized to the D5W control group by dividing the "normalized to before treatment" ratio for each individual animal by the average "normalized to before treatment" ratio of all mice in the D5W control group.This resulted in the expression at each time point normalized to the expression of the control group.

[0287] Data from the studies described in this Example are presented below in Tables 48-52. [Table 48-1] [Table 48-2] [Table 49-1] [Table 49-2] [Table 50-1] [Table 50-2] [Table 51-1] [Table 51-2] [Table 52]

[0288] As shown above in Table 48, each of the ANGPTL3 RNAi agents tested showed significant reductions in ANGPTL3 protein at all time points, with similar trends observed for reductions in TG, total cholesterol, and LDL levels.

[0289] Example 11 In vivo testing of ANGPTL3 RNAi agents in mice To evaluate the dose response of ANGPTL3 RNAi agent AD05488, 6-8 week old female C57bl / 6 mice were used. Pre-dose serum samples were collected on day -1 after a 4 hour fast. On day 1, each mouse received a single subcutaneous dose of 200 μl containing the respective mg / kg dose of ANGPTL3 RNAi agent in D5W (5% dextrose in water) or a control without RNAi agent (D5W) according to the dosing groups listed in Table 53. [Table 53]

[0290] The RNAi agent tested (AD05488) contained a modified sequence and an N-acetyl-galactosamine-containing targeting ligand conjugated to the 5' end of the sense strand (see Tables 3, 4, and 5 for modified sequence and targeting ligand structure). Injections were performed between the skin and muscle of the loose skin in the neck and shoulder area (i.e., subcutaneous injection). Four mice of each group were tested (n=4). Serum was collected on days 8, 15, 22, and 29. Before each collection, mice were fasted for 4 hours. ANGPTL3 protein levels in serum were measured by ELISA assay (R&D Systems) according to the manufacturer's recommendations. Serum triglycerides, total cholesterol, high density lipoprotein (HDL), and low density lipoprotein (LDL) were measured in Cobas® Integra 400 (Roche Diagnostics) according to the manufacturer's recommendations.

[0291] ANGPTL3 protein level, triglyceride level, total cholesterol level, HDL level and LDL level of each animal were normalized.For normalization, ANGPTL3 protein level, triglyceride level, HDL level and total cholesterol level for each animal at a certain time point were divided by the expression level before treatment in that animal (in this case, day -1) to determine the expression ratio "normalized to before treatment".Then, the expression at a certain time point was normalized to the D5W control group by dividing the "normalized to before treatment" ratio for each individual animal by the average "normalized to before treatment" ratio of all mice in the D5W control group.This resulted in the expression at each time point normalized to the expression of the control group.

[0292] Data from the studies described in this Example are presented below in Tables 54-58. [Table 54] [Table 55-1] [Table 55-2] [Table 56] [Table 57-1] [Table 57-2] [Table 58]

[0293] In addition, ANGPTL3 mRNA level was also evaluated.All mice in each group were sacrificed after serum collection on the 29th day, and liver was harvested, and about 100mg of liver sample was collected and flash frozen in liquid nitrogen for RNA isolation.Then, the level of ANGPTL3 mRNA in mouse liver was measured by RT-qPCR, and the results are shown in the following table 59: [Table 59]

[0294] In particular, as shown in Tables 54 and 59, administration of the ANGPTL3 RNAi agent AD05488 demonstrated a reduction in both ANGPTL3 protein and ANGPTL3 mRNA.

[0295] Example 12 In vivo testing of ANGPTL3 RNAi agents in LDL receptor (LDLR) knockout mice To evaluate the effect of RNAi agent administration in disease models, mice carrying a genetic mutation in the LDL receptor (herein referred to as LDLR KO mice) were purchased (The Jackson Laboratory). LDLR KO mice are mice that express the LDL receptor . tm1HerThey are homozygous for the mutation and have elevated serum cholesterol levels, especially when fed a high fat diet. Thirty-nine LDLR KO mice were fed a high fat diet (Teklad Custom Diets TD.88137) for three weeks prior to the start of the study. An additional eight LDLR KO mice were fed a chow diet for the same three-week period. Pre-dose serum samples were collected on days -15 and -1 after a four-hour fast. On day 1, each mouse received a single subcutaneous dose of 200 μl per 30 g of animal body weight containing the respective mg / kg dose of ANGPTL3 RNAi agent in D5W (5% dextrose in water), a control without an RNAi agent (D5W), or a control RNAi agent containing a nucleotide sequence designed to target the Hepatitis B virus (HBV) genome. A second injection of the same formulation was administered to the animals on day 29. The dosing regimen for the study is described below in Table 60. [Table 60]

[0296] Each mouse was maintained on its respective diet throughout the study period. The RNAi agent tested (AD05488) contained a modified sequence and an N-acetyl-galactosamine-containing targeting ligand conjugated to the 5' end of the sense strand (see Tables 3, 4, and 5 for modified sequence and targeting ligand structure). Injections were performed between the skin and muscle of the loose skin in the neck and shoulder area (i.e., subcutaneous injection). Serum was collected on days 8, 15, 22, 29 (before the second dose), 36, 43, 50, and 57. Before each collection, the LDLR KO mice were fasted for 4 hours. On day 15, four LDLR KO mice from groups 1, 2, and 3 (i.e., the group that received a high-fat "western" diet) were sacrificed after serum collection, and on day 29, four more LDLR KO mice from groups 1, 2, and 3 were sacrificed after serum collection for the purpose of performing mRNA evaluation.

[0297] Serum ANGPTL3 protein levels were measured by ELISA assay (R&D Systems) according to the manufacturer's recommendations. Serum triglycerides, total cholesterol, high-density lipoprotein (HDL), and low-density lipoprotein (LDL) were measured in Cobas® Integra 400 (Roche Diagnostics) according to the manufacturer's recommendations.

[0298] ANGPTL3 protein, triglyceride, total cholesterol, HDL, and LDL levels were normalized for each animal. For normalization, the ANGPTL3 protein, TG, total cholesterol, HDL, or LDL level for each animal at a time point was divided by the average expression level before treatment in that animal (in this case the average of days -15 and -1) to determine the "normalized to before treatment" expression ratio.

[0299] Expression at a particular time point was then normalized to a D5W control group fed the same diet (i.e., either a high-fat "western" diet or a chow-fed diet) by dividing the "normalized to pre-treatment" ratio for each individual animal by the average "normalized to pre-treatment" ratio for all mice in the D5W control group fed the respective same diet, resulting in expression at each time point normalized to control expression.

[0300] Data from the studies described in this Example are presented below in Tables 61-65. [Table 61] [Table 62] [Table 63] [Table 64] [Table 65-1] [Table 65-2]

[0301] As shown in Tables 61-65, the groups administered 3.0 mg / kg of the ANGPTL3 RNAi agent AD05488 (i.e., groups 2 and 5) showed significant reductions in ANGPTL3 protein levels, TG levels, and total cholesterol in this model. LDLR KO mice fed a high fat "Western" diet showed particularly low levels compared to controls with two doses of the 3 mg / kg dose of the ANGPTL3 RNAi agent AD05488, resulting in an approximately 99% reduction (0.007) in ANGPTL3 protein levels at day 57. HBV It is also noted that Group 3, which included an RNAi agent control comprising a nucleotide sequence designed to target mRNA, performed as expected and showed essentially no inhibition of ANGPTL3.

[0302] In addition, ANGPTL3 mRNA levels were also evaluated. On day 15, 4 mice were sacrificed from each of groups 1, 2, and 3. On day 29, 4 more mice were sacrificed from each of groups 1, 2, and 3. On day 57, all remaining animals in all groups were sacrificed. At the time of sacrifice, liver was harvested and about 100 mg liver sample from the middle lobe was collected and snap frozen in liquid nitrogen for RNA isolation. The level of ANGPTL3 mRNA in mouse liver was then measured by RT-qPCR and normalized to the mRNA level of mice from group 1 (high fat "western" diet, D5W administration, sacrificed on day 15), and the results are shown in Table 66 below. [Table 66-1] [Table 66-2]

[0303] Administration of the ANGPTL3 RNAi agent AD05488 showed a significant reduction in ANGPTL3 mRNA levels in both high-fat "western" and chow-fed animals.

[0304] (Example 13) In vivo testing of ANGPTL3 RNAi agents in rhesus monkeys fed a high fructose corn syrup (HFCS) diet ANGPTL3 RNAi agent AD05488 was further evaluated in rhesus monkeys fed a high fructose corn syrup (HFCS) diet. Rhesus monkeys were fed a HFCS diet for 37 days prior to dosing. These animals were known to develop an increase in plasma triglycerides of more than 180 mg / dL with the HFCS diet. On day 1 and again on day 29, four rhesus monkeys were administered a subcutaneous injection containing 4.0 mg / kg of ANGPTL3 RNAi agent AD05488 formulated in saline (n=4). Two additional rhesus monkeys were administered a normal saline control. ANGPTL3 RNAi agent AD05488 contained modified nucleotides and contained an N-acetyl-galactosamine targeting ligand conjugated to the 5' end of the sense strand, as shown in Tables 3, 4, and 5.

[0305] Fasting blood samples were collected for analysis, and serum samples were analyzed on days -8 (pre-dose), 8, 15, 21, 29, and 36. Serum ANGPTL3 expression levels, triglycerides, total cholesterol, high density lipoprotein (HDL), and low density lipoprotein (LDL) were measured on a Cobas® Integra 400 (Roche Diagnostics) according to the manufacturer's recommendations.

[0306] The ANGPTL3 protein level, triglyceride level, total cholesterol level, HDL level, and LDL level of each animal were normalized. For normalization, the ANGPTL3 protein, triglyceride, HDL, and total cholesterol levels for each animal at a time point were divided by the expression level before treatment in that animal (in this case, day -8) to determine the "normalized to before treatment" expression ratio.

[0307] Data from the studies described in this Example are presented below in Tables 67-71. [Table 67] [Table 68] [Table 69-1] [Table 69-2] [Table 70] [Table 71]

[0308] Rhesus monkeys administered AD05488 at a dosage level of 4.0 mg / kg showed a significant reduction in ANGPTL3 protein compared to pre-treatment measurements at each of the time points measured. Additionally, reductions in triglyceride and total cholesterol levels were evident.

[0309] Example 14 In vivo testing of ANGPTL3 RNAi agents and statins in LDL receptor (LDLR) knockout mice To evaluate the effect of co-administration of RNAi agents and statins in disease models, LDLR KO mice were purchased (The Jackson Laboratory). Forty-one male 7-8 week old LDLR KO mice were placed on a high fat ("Western") diet (Teklad Custom Diets TD.88137) for 3 weeks prior to the start of the study and maintained on that diet throughout the study period. Pre-dose serum was collected after a 4 hour fast on study day 1. The dosing regimen for the study is described below in Table 72. [Table 72]

[0310] The vehicle used for the gavage of the study was a 1:1 mixture of purchased Ora-Plus®:Ora-Sweet® solution. To prepare the atorvastatin gavage, each desired dose of atorvastatin was first dissolved in sterile water (0.3 mL of water per mL of desired formulation) and vortexed until smooth, after which a mixture of 1:1 Ora-Plus®:Ora-Sweet® solution (0.7 mL of vehicle per mL of desired formulation) was added and vortexed. On day 1 and each day thereafter, a gavage dose was administered to each of the groups except group 2. On day 23, groups 1, 2, 3, and 4 received a single subcutaneous administration of a 2.5 mg / kg dose (31.25 μg / mL solution) of ANGPTL3 RNAi agent in D5W (5% dextrose in water) or a vehicle control without RNAi agent (D5W).

[0311] The RNAi agent tested (AD05488) contained a modified sequence and an N-acetyl-galactosamine-containing targeting ligand conjugated to the 5' end of the sense strand (see Tables 3, 4, and 5 for modified sequence and targeting ligand structure). Injections were performed between the skin and muscle of the loose skin of the neck and shoulder area (i.e., subcutaneous injection). Serum was collected on days 8, 15, 22 (before RNAi agent injection), 29, 36, 43, and 50. Before each collection, LDLR KO mice were fasted for 4 hours.

[0312] Serum ANGPTL3 protein levels were measured by ELISA assay (R&D Systems) according to the manufacturer's recommendations. Serum triglycerides, total cholesterol, and low-density lipoprotein (LDL), among other biomarkers, were measured in Cobas® Integra 400 (Roche Diagnostics) according to the manufacturer's recommendations.

[0313] ANGPTL3 protein levels, triglyceride levels, total cholesterol levels, HDL levels, and LDL levels were normalized for each animal. For normalization, the respective levels of ANGPTL3 protein, TG, total cholesterol, or LDL for each animal at a time point were divided by the expression level before treatment in that animal (in this case the pre-dose level on day 1) to determine the "normalized to pre-treatment" expression ratio. Data from the study described in this Example are shown below in Tables 73-76. [Table 73-1] [Table 73-2] [Table 74-1] [Table 74-2] [Table 75-1] [Table 75-2] [Table 75-3] [Table 76-1] [Table 76-2]

[0314] Mice given daily atorvastatin showed approximately 40-60% reductions in triglycerides, 23-40% reductions in total cholesterol, and 30-45% reductions in LDL cholesterol. Mice treated with higher doses of atorvastatin typically produced greater reductions.

[0315] ANGPTL3 RNAi agent AD05488, when administered with co-administration of atorvastatin (i.e., groups 3 and 4), showed additive effects on lipid parameters. For example, in groups with co-administration of atorvastatin and RNAi agent, the overall reduction in triglycerides, total cholesterol, and LDL was about 95%, about 70%, and about 80%, respectively. The overall lipid parameter profile with co-administration of atorvastatin was slightly better than that with administration of ANGPTL3 RNAi agent AD05488 alone. Furthermore, the group with ANGPTL3 RNAi agent AD05488 showed a clear reduction in ANGPTL3 protein levels, while the group without administration of ANGPTL3 RNAi agent showed no reduction in ANGPTL3 protein.

[0316] Other embodiments Although the invention has been described in conjunction with its detailed description, it is to be understood that the description is intended to illustrate, and not to limit, the scope of the invention, as defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims. The present invention provides, for example, the following items. (Item 1) An RNAi agent for inhibiting expression of the ANGPTL3 gene, comprising: an antisense strand comprising at least 17 contiguous nucleotides that differ from any one of the sequences provided in Table 2 or Table 3 by 0 or 1 nucleotide; and a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand; 2. An RNAi agent comprising: (Item 2) 2. The RNAi agent of item 1, wherein the antisense strand comprises nucleotides 2 to 18 of any one of the sequences provided in Table 2 or Table 3. (Item 3) 3. The RNAi agent of claim 1 or 2, wherein the sense strand comprises a nucleotide sequence of at least 17 contiguous nucleotides that differs by 0 or 1 nucleotide from any one of the sense strand sequences provided in Table 2 or Table 4, and the sense strand has a region of at least 85% complementarity over 17 contiguous nucleotides of the antisense strand. (Item 4) 4. The RNAi agent of any one of items 1 to 3, wherein at least one nucleotide of the RNAi agent is a modified nucleotide or comprises a modified internucleoside linkage. (Item 5) 4. The RNAi agent of any one of items 1 to 3, wherein all or substantially all of the nucleotides of the sense and / or antisense strand of the RNAi agent are modified nucleotides. (Item 6) 6. The RNAi agent of item 4 or 5, wherein the modified nucleotide is selected from the group consisting of 2'-O-methyl nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2',3'-seco nucleotide mimics, locked nucleotides, 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted 2'-O-methyl nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, vinylphosphonate deoxyribonucleotides, and 3'-O-methyl nucleotides. (Item 7) 6. The RNAi agent of item 5, wherein all or substantially all of the modified nucleotides are 2'-O-methyl and 2'-fluoro nucleotides. (Item 8) 8. The RNAi agent of any one of items 1 to 7, wherein the antisense strand comprises a nucleotide sequence of any one of the modified antisense strand sequences provided in Table 3. (Item 9) 9. The RNAi agent of any one of items 1 to 8, wherein the sense strand comprises a nucleotide sequence of any of the modified sense strand sequences provided in Table 4. (Item 10) The RNAi agent of item 1, wherein the antisense strand comprises a nucleotide sequence of any one of the modified sequences provided in Table 3, and the sense strand comprises a nucleotide sequence of any one of the modified sequences provided in Table 4. (Item 11) 11. The RNAi agent of any one of items 1 to 10, which is linked to a targeting ligand. (Item 12) 12. The RNAi agent of claim 11, wherein the targeting ligand comprises n-acetyl-galactosamine. (Item 13) The targeting ligand is (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG32), (NAG33), (NAG34), (NAG35), (NAG36), (NAG37), (NAG38), (NAG39), (NAG39)s, (NAG40), (NAG40)s, (NAG41), (NAG42), (NAG43), (NAG44), (NAG45), (NAG46), (NAG47), (NAG48), (NAG49), (NAG49)s, (NAG40), (NAG41), (NAG42), (NAG43), (NAG44), (NAG45), (NAG46), (NAG47), (NAG47), (NAG48), (NAG49), (NAG49), (NAG49), (NAG50), (NAG50), (NAG50), (NAG51), (NAG52), (NAG53), (NAG54), (NAG55), (NAG55), (NAG56), (NAG57), (NAG57), (NAG58), (NAG59), (NAG60), (NAG61), (NAG62), (NAG63), (NAG64), (NAG64), (NAG65), (NAG65), (NAG66), (NAG67), (NAG67), (NAG68), (NAG69), (NA 13. The RNAi agent of claim 11 or 12, comprising a structure selected from the group consisting of: (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), and (NAG39)s. (Item 14) The RNAi agent of item 13, wherein the targeting ligand comprises the structure of (NAG37) or (NAG37)s. (Item 15) 15. The RNAi agent of any one of items 11 to 14, wherein the targeting ligand is linked to the sense strand. (Item 16) 16. The RNAi agent of claim 15, wherein the targeting ligand is linked to the 5' end of the sense strand. (Item 17) 17. The RNAi agent according to any one of items 1 to 16, wherein the sense strand is 18 to 30 nucleotides in length and the antisense strand is 18 to 30 nucleotides in length. (Item 18) 18. The RNAi agent according to item 17, wherein the sense strand and the antisense strand are each 18 to 27 nucleotides in length. (Item 19) 19. The RNAi agent according to item 18, wherein the sense strand and the antisense strand are each 18 to 24 nucleotides in length. (Item 20) 20. The RNAi agent of item 19, wherein the sense strand and the antisense strand are each 21 nucleotides in length. (Item 21) 21. The RNAi agent of any one of items 17 to 20, having two blunt ends. (Item 22) 22. The RNAi agent of any one of items 1 to 21, wherein the sense strand comprises one or two terminal caps. (Item 23) 23. The RNAi agent of any one of items 1 to 22, wherein the sense strand comprises one or two inverted abasic residues. (Item 24) The RNAi agent of item 1, comprising a sense strand and an antisense strand that form a duplex having the structure of any one of the duplexes in Table 5. (Item 25) The following nucleotide sequence (5'→3'): UACUGAUCAAAUAUGUUGAGC (SEQ ID NO:3); UACUGAUCAAAUAUGUUGAGU (SEQ ID NO:6); UUUGAAUUAAUGUCCAUGGGC (SEQ ID NO:8); UUUGAAUUAAUGUCCAUGGGU (SEQ ID NO: 10); UGUUGAAUUAAUGUCCAUGGA (SEQ ID NO: 12); or ACAUCGUCUAACAUAGCAACC (SEQ ID NO: 15) 2. The RNAi agent according to item 1, comprising an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from one of the above by 0 or 1 nucleotide. (Item 26) The sense strand has the following nucleotide sequence (5'→3'): GCUCAACAUAUUUGAUCAGUA (SEQ ID NO: 17); GCUCAACAU(A 2N ) UUUGAUCAGUA (SEQ ID NO: 19) (wherein, (A 2N ) represents 2-aminoadenosine nucleotide) GCUCAAC(A 2N )U(A 2N ) UUUGAUCAGUA (SEQ ID NO: 21) (wherein, (A 2N ) represents 2-aminoadenosine nucleotide) ACUCAACAUAUUUGAUCAGUA (SEQ ID NO:24); GCCCAUGGACAUUAAUUCAAA (SEQ ID NO:26); ACCCAUGGACAUUAAUUCAAA (SEQ ID NO:28); UCCAUGGACAUUAAUUCAACA (SEQ ID NO: 30); or GGUUGCUAUGUUAGACGAUGU (SEQ ID NO: 32) 26. The RNAi agent according to item 25, which consists of, consists essentially of, or comprises a nucleotide sequence which differs from one of the above by 0 or 1 nucleotide. (Item 27) 27. The RNAi agent of item 25 or 26, wherein all or substantially all of the nucleotides are modified nucleotides. (Item 28) 27. The RNAi agent of item 25 or 26, wherein the sense strand further comprises an inverted abasic residue at the 3' end of the nucleotide sequence, the 5' end of the nucleotide sequence, or both. (Item 29) The following nucleotide sequence (5'→3'): usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc(SEQ ID NO:2); usAfscUfgAfuCfaAfaUfaUfgUfuGfasGfsc(SEQ ID NO:4); usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsu(SEQ ID NO:5); usUfsusGfaAfuUfaAfuGfuCfcAfuGfggsc(SEQ ID NO:7); usUfsusGfaAfuUfaAfuGfuCfcAfuGfgGfsu(SEQ ID NO:9); usGfsusugaauuaaUfgUfcCfaUfgGfsa (SEQ ID NO: 11); usGfsusUfgAfaUfuAfaUfgUfcCfaUfgGfsa (SEQ ID NO: 13); or asCfsasUfcGfucuaaCfaUfaGfcAfaCfsc (SEQ ID NO: 14) (wherein a, c, g, and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate bond). 2. The RNAi agent of claim 1, comprising an antisense strand comprising, consisting of, or consisting essentially of a modified nucleotide sequence that differs from one of the above by 0 or 1 nucleotide, and wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides. (Item 30) The sense strand has the following nucleotide sequence (5'→3'): gcucaacaUfAfUfuugaucagua (SEQ ID NO: 16); gcucaacaUfa_2NUfuugaucagua (SEQ ID NO: 18); gcucaaca_2NUfa_2NUfuugaucagua (SEQ ID NO:20); gcUfcAfaCfaUfAfUfuugaucagua (SEQ ID NO:22); acucaacaUfAfUfuugaucagua (SEQ ID NO:23); gcccauggAfCfAfuuaauucaaa (SEQ ID NO:25); acccauggAfCfAfuuaauucaaa (SEQ ID NO:27); uccauggaCfAfUfuaauucaaca (SEQ ID NO: 29); or gguugcuaUfGfUfuagacgaugu (SEQ ID NO: 31) (wherein a, c, g and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s represents a phosphorothioate linkage; and a_2N represents 2'-O-methyl-2-amino adenosine), and wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides. (Item 31) 31. The RNAi agent of any one of items 25 to 30, wherein the sense strand further comprises an inverted abasic residue at the 3' end of the nucleotide sequence, the 5' end of the nucleotide sequence, or both. (Item 32) 32. The RNAi agent of any one of items 25 to 31, wherein the sense strand of the RNAi agent is linked to a targeting ligand. (Item 33) 33. The RNAi agent of item 32, wherein the targeting ligand has affinity for an asialoglycoprotein receptor. (Item 34) 34. The RNAi agent of item 33, wherein the targeting ligand comprises N-acetyl-galactosamine. (Item 35) The RNAi agent of item 1 having a double-stranded structure selected from the group consisting of AD05488 (sequence numbers 2 and 300) and AD05775 (sequence numbers 2 and 334); AD05791 (sequence numbers 4 and 300); AD05777 (sequence numbers 2 and 336); AD05743 (sequence numbers 2 and 326); AD05487 (sequence numbers 5 and 299); AD05307 (sequence numbers 7 and 278); AD05418 (sequence numbers 9 and 292); AD05577 (sequence numbers 11 and 279); AD05308 (sequence numbers 13 and 279); and AD05840 (sequence numbers 15 and 357). (Item 36) 36. The RNAi agent of item 35, having a double-stranded structure selected from the group consisting of AD05488 (sequence numbers 2 and 300) and AD05775 (sequence numbers 2 and 334). (Item 37) 37. A composition comprising the RNAi agent of any one of items 1 to 36, comprising a pharma- ceutically acceptable excipient. (Item 38) 38. The composition of item 37, further comprising a second RNAi agent for inhibiting expression of ANGPTL3. (Item 39) 39. The composition according to item 37 or 38, further comprising one or more additional therapeutic agents. (Item 40) A method for inhibiting expression of the ANGPTL3 gene in a cell, the method comprising introducing into the cell an effective amount of an RNAi agent described in any one of items 1 to 36 or a composition described in any one of items 37 to 39. (Item 41) The method of claim 40, wherein the cell is in a subject. (Item 42) 42. The method of claim 41, wherein the subject is a human subject. (Item 43) 43. The method of any one of items 40 to 42, wherein the ANGPTL3 gene expression is inhibited by at least about 30%. (Item 44) A method for treating an ANGPTL3-related disease or disorder, comprising administering to a human subject in need thereof a therapeutically effective amount of a composition described in any one of items 37 to 39. (Item 45) 45. The method according to item 44, wherein the disease is a cardiometabolic disease. (Item 46) 45. The method according to item 44, wherein the disease is hypertriglyceridemia, obesity, hyperlipidemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, type II diabetes, cardiovascular disease, coronary artery disease, nonalcoholic steatohepatitis, nonalcoholic fatty liver disease, homozygous and heterozygous familial hypercholesterolemia, or statin-resistant hypercholesterolemia. (Item 47) 47. The method of any one of items 40 to 46, wherein the RNAi agent is administered at a dose of about 0.05 mg / kg human subject body weight to about 5.0 mg / kg human subject body weight. (Item 48) 48. The method of any one of paragraphs 40 to 47, wherein the RNAi agent is administered in two or more doses. (Item 49) 40. A method for reducing triglyceride levels in a subject, comprising administering to the subject an effective amount of a composition according to any one of items 37 to 39. (Item 50) 40. A method for lowering cholesterol levels in a subject, comprising administering to the subject an effective amount of a composition according to any of items 37 to 39. (Item 51) 40. A method for reducing low density lipoprotein (LDL) levels in a subject, comprising administering to the subject an effective amount of a composition according to any one of items 37 to 39. (Item 52) 52. The method of any one of items 44 to 51, further comprising administration of a statin. (Item 53) 53. The method of claim 52, wherein the statin is selected from the group consisting of atorvastatin, fluvastatin, pravastatin, pitavastatin, rosuvastatin, and simvastatin. (Item 54) Use of the RNAi agent of any one of items 1 to 36 or the composition of any one of items 37 to 39 for the treatment of a disease, disorder, or condition mediated at least in part by ANGPTL3 gene expression. (Item 55) 55. The use according to item 54, wherein the condition is elevated triglyceride levels and / or elevated cholesterol levels. (Item 56) Use of an RNAi agent according to any one of items 1 to 36, or a composition according to any one of items 37 to 39, for the preparation of a pharmaceutical composition for treating a disease, disorder, or condition mediated at least in part by ANGPTL3 gene expression. (Item 57) 57. The use according to any one of items 54 to 56, wherein the disease is hypertriglyceridemia, obesity, hyperlipidemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, type II diabetes mellitus, cardiovascular disease, coronary artery disease, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, homozygous and heterozygous familial hypercholesterolemia, or statin-resistant hypercholesterolemia. (Item 58) 57. The use according to any one of items 54 to 56, wherein the disease is a cardiometabolic disease. (Item 59) 59. The use of any one of items 54 to 58, wherein the RNAi agent is administered at a dose of about 0.05 mg / kg human subject body weight to about 5.0 mg / kg human subject body weight. (Item 60) 60. The use according to any one of items 54 to 59, wherein the triglyceride level, cholesterol level, and / or low density lipoprotein (LDL) level in a subject is reduced.

Claims

1. An RNAi agent for inhibiting expression of the ANGPTL3 gene, comprising: an antisense strand, wherein nucleotides 1 to 19 from the 5' end of the antisense strand comprise the nucleotide sequence (5'→3') UACUGAUCAAAAUAUGUUGA (SEQ ID NO:50); a sense strand comprising a nucleotide sequence complementary to the antisense strand; Including, The RNAi agent, wherein all of the nucleotides of the antisense strand and the sense strand are modified nucleotides.

2. 2. The RNAi agent of claim 1, wherein the modified nucleotide is selected from the group consisting of 2'-O-methyl nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2',3'-seco nucleotide mimics, locked nucleotides, 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, vinylphosphonate deoxyribonucleotides, cyclopropylphosphonate containing nucleotides, and 3'-O-methyl nucleotides.

3. The RNAi agent of claim 1 or 2, wherein each modified nucleotide is independently a 2'-O-methyl nucleotide or a 2'-fluoro nucleotide.

4. The RNAi agent of any one of claims 1 to 3, wherein the RNAi agent is linked to a targeting ligand.

5. The RNAi agent of claim 4, wherein the targeting ligand comprises N-acetyl-galactosamine.

6. The targeting ligand is (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG The RNAi agent of claim 4, comprising a structure selected from the group consisting of (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), and (NAG39)s.

7. The targeting ligand is 【Chemistry 1-1】 or 【Chemistry 1-2】 The RNAi agent of claim 6, comprising:

8. The RNAi agent of any one of claims 4 to 7, wherein the targeting ligand is linked to the sense strand.

9. The RNAi agent of any one of claims 4 to 8, wherein the targeting ligand is linked to the 5' end of the sense strand.

10. The RNAi agent of any one of claims 1 to 9, wherein the sense strand is 18 to 30 nucleotides in length and the antisense strand is 18 to 30 nucleotides in length.

11. The RNAi agent of claim 10, wherein the sense strand is 18-27 nucleotides in length and the antisense strand is 19-27 nucleotides in length.

12. The RNAi agent of claim 11, wherein the sense strand is 18-24 nucleotides in length and the antisense strand is 19-24 nucleotides in length.

13. The RNAi agent of claim 10, wherein the sense strand and the antisense strand are each 21 nucleotides in length.

14. The RNAi agent of any one of claims 1 to 13, wherein the sense strand comprises one or two terminal caps.

15. The RNAi agent of any one of claims 1 to 14, wherein the sense strand comprises one or two inverted abasic residues.

16. UACUGAUCAAAAUAUGUUGAGC (SEQ ID NO: 3), or UACUGAUCAAAAUAUGUUGAGU (SEQ ID NO: 6) The RNAi agent according to any one of claims 1 to 15, comprising an antisense strand comprising any one of the nucleotide sequences (5'→3') represented by:

17. The sense strand is GCUCAACAUAUUUGAUCAGUA (SEQ ID NO: 17); GCUCAACAU(A ２Ｎ ) UUUGAUCAGUA (SEQ ID NO: 19) (wherein, (A ２Ｎ ) represents a 2-aminoadenosine nucleotide; GCUCAAC (A ２Ｎ ) U(A ２Ｎ ) UUUGAUCAGUA (SEQ ID NO:21) (wherein, (A ２Ｎ ) represents a 2-amino adenosine nucleotide; or ACUCAACAUAUUUGAUCAGUA (SEQ ID NO: 24) The RNAi agent according to any one of claims 1 to 16, comprising a nucleotide sequence which differs by 0 or 1 nucleotide from any one of the nucleotide sequences (5'→3') which are:

18. a. an antisense strand comprising the nucleotide sequence (5'→3') of UACUGAUCAAAAUAUGUUGAGC (SEQ ID NO:3) and a sense strand comprising the nucleotide sequence (5'→3') of GCUCAACAUAUUUGAUCAGUA (SEQ ID NO:17); b. an antisense strand comprising the nucleotide sequence (5' to 3') of UACUGAUCAAAAUAUGUUGAGC (SEQ ID NO: 3); ２Ｎ ) UUUGAUCAGUA (SEQ ID NO: 19) (wherein, (A ２Ｎ ) represents a 2-amino adenosine nucleotide; and c. An antisense strand comprising the nucleotide sequence (5'->3') of UACUGAUCAAAAUAUGUUGAGC (SEQ ID NO: 3) and ２Ｎ ) U(A ２Ｎ ) UUUGAUCAGUA (SEQ ID NO:21) (wherein, (A ２Ｎ a sense strand comprising the nucleotide sequence (5'→3') where: d. an antisense strand comprising the nucleotide sequence (5'→3') of UACUGAUCAAAAUAUGUUGAGU (SEQ ID NO: 6) and a sense strand comprising the nucleotide sequence (5'→3') of ACUCAACAUAUUUGAUCAGUA (SEQ ID NO: 24); The RNAi agent according to any one of claims 1 to 17, comprising:

19. The RNAi agent of any one of claims 16-18, wherein the sense strand further comprises one or more inverted abasic residues at the 3' end of the nucleotide sequence, at the 5' end of the nucleotide sequence, or both.

20. The antisense strand is usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO:2); usAfscUfgAfuCfaAfaUfaUfgUfuGfasGfsc (SEQ ID NO: 4); and usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsu (SEQ ID NO: 5) and a modified nucleotide sequence selected from the group consisting of the nucleotide sequence (5' to 3') The RNAi agent according to any one of claims 1 to 16, wherein a, c, g and u represent 2'-O-methyl adenosine, 2'-O-methyl cytidine, 2'-O-methyl guanosine and 2'-O-methyl uridine, respectively; Af, Cf, Gf and Uf represent 2'-fluoro adenosine, 2'-fluoro cytidine, 2'-fluoro guanosine and 2'-fluoro uridine, respectively; and s represents a phosphorothioate bond.

21. The sense strand is gcucaacaUfAfUfuugaucagua (SEQ ID NO: 16); gcucaacaUfa_2NUfuugaucagua (SEQ ID NO: 18); gcucaaca_2NUfa_2NUfuugaucagua (SEQ ID NO:20); gcUfcAfaCfaUfAfUfuugaucagua (SEQ ID NO: 22); or acucaacaUfAfUfuugaucagua (SEQ ID NO: 23) and a modified nucleotide sequence selected from the group consisting of the nucleotide sequence (5' to 3') The RNAi agent according to any one of claims 1 to 20, wherein a, c, g, and u represent 2'-O-methyl adenosine, 2'-O-methyl cytidine, 2'-O-methyl guanosine, and 2'-O-methyl uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, 2'-fluoro cytidine, 2'-fluoro guanosine, and 2'-fluoro uridine, respectively; s represents a phosphorothioate bond; and a_2N represents 2'-O-methyl-2-amino adenosine.

22. The RNAi agent of any one of claims 16-21, wherein the sense strand further comprises an inverted abasic residue at the 3' end of the nucleotide sequence, at the 5' end of the nucleotide sequence, or both.

23. The RNAi agent of any one of claims 16 to 22, wherein the sense strand of the RNAi agent is linked to a targeting ligand.

24. The RNAi agent of claim 23, wherein the targeting ligand has affinity for an asialoglycoprotein receptor.

25. The RNAi agent of claim 24, wherein the targeting ligand comprises N-acetyl-galactosamine.

26. 2. The RNAi agent of claim 1, wherein the RNAi agent has a double helix structure selected from the group consisting of AD05775 (SEQ ID NOs: 2 and 334), AD05791 (SEQ ID NOs: 4 and 300), AD05777 (SEQ ID NOs: 2 and 336), AD05743 (SEQ ID NOs: 2 and 326), and AD05487 (SEQ ID NOs: 5 and 299).

27. the antisense strand is comprised of a modified nucleotide sequence (5'->3') that is usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO:2); and the sense strand is comprised of a modified nucleotide sequence (5'->3') that is (NAG37)s(invAb)sgcucaacaUfa_2NUfuugaucaguas(invAb) (SEQ ID NO:334); a, c, g and u are 2'-O-methyl adenosine, cytidine, guanosine and uridine, respectively; Af, Cf, Gf and Uf are 2'-fluoro adenosine, cytidine, guanosine and uridine, respectively; a_2N is 2'-O-methyl-2-amino adenosine; s is a phosphorothioate bond; (invAb) is an inverted abasic deoxyribose residue; and (NAG37)s has the structure 【Chemistry 2】 The RNAi agent of claim 26.

28. the antisense strand consists of a modified nucleotide sequence (5'->3') that is usAfscUfgAfuCfaAfaUfaUfgUfuGfasGfsc (SEQ ID NO: 4); and the sense strand consists of a modified nucleotide sequence (5'->3') that is (NAG37)s(invAb)sgcucaacaUfAfUfuugaucaguas(invAb) (SEQ ID NO: 300); a, c, g and u are 2'-O-methyl adenosine, 2'-O-methyl cytidine, 2'-O-methyl guanosine and 2'-O-methyl uridine, respectively; Af, Cf, Gf and Uf are 2'-fluoro adenosine, 2'-fluoro cytidine, 2'-fluoro guanosine and 2'-fluoro uridine, respectively; s is a phosphorothioate bond; (invAb) is an inverted abasic deoxyribose residue; and (NAG37)s has the structure 【Chemistry 3】 The RNAi agent of claim 26.

29. the antisense strand consists of a modified nucleotide sequence (5'->3') that is usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO:2); and the sense strand consists of a modified nucleotide sequence (5'->3') that is (NAG37)s(invAb)sgcucaaca_2NUfa_2NUfuugaucaguas(invAb) (SEQ ID NO:336); a, c, g and u are 2'-O-methyl adenosine, 2'-O-methyl cytidine, 2'-O-methyl guanosine and 2'-O-methyl uridine, respectively; Af, Cf, Gf and Uf are 2'-fluoro adenosine, 2'-fluoro cytidine, 2'-fluoro guanosine and 2'-fluoro uridine, respectively; a_2N is 2'-O-methyl-2-amino adenosine; s is a phosphorothioate bond; (invAb) is an inverted abasic deoxyribose residue; and (NAG37)s has the structure 【Chemistry 4】 The RNAi agent of claim 26.

30. the antisense strand is comprised of a modified nucleotide sequence (5'->3') that is usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO:2); and the sense strand is comprised of a modified nucleotide sequence (5'->3') that is (NAG37)s(invAb)sgcUfcAfaCfaUfAfUfuugaucaguas(invAb) (SEQ ID NO:326); a, c, g and u are 2'-O-methyl adenosine, 2'-O-methyl cytidine, 2'-O-methyl guanosine and 2'-O-methyl uridine, respectively; Af, Cf, Gf and Uf are 2'-fluoro adenosine, 2'-fluoro cytidine, 2'-fluoro guanosine and 2'-fluoro uridine, respectively; s is a phosphorothioate bond; (invAb) is an inverted abasic deoxyribose residue; and (NAG37)s has the structure 【Chemistry 5】 27. The RNAi agent of claim 26.

31. the antisense strand is comprised of a modified nucleotide sequence (5'->3') that is usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsu (SEQ ID NO:5); the sense strand is comprised of a modified nucleotide sequence (5'->3') that is (NAG37)s(invAb)sacucaacaUfAfUfuugaucaguas(invAb) (SEQ ID NO:299); a, c, g and u are 2'-O-methyl adenosine, 2'-O-methyl cytidine, 2'-O-methyl guanosine and 2'-O-methyl uridine, respectively; Af, Cf, Gf and Uf are 2'-fluoro adenosine, 2'-fluoro cytidine, 2'-fluoro guanosine and 2'-fluoro uridine, respectively; s is a phosphorothioate bond; (invAb) is an inverted abasic deoxyribose residue; and (NAG37)s has the structure 【Chemistry 6】 The RNAi agent of claim 26.

32. A pharma- ceutically acceptable salt of the RNAi agent of any one of claims 1 to 31.

33. 33. The pharma- ceutically acceptable salt of claim 32, wherein the pharma- ceutically acceptable salt is a sodium salt.

34. A pharmaceutical composition comprising the RNAi agent of any one of claims 1 to 31 and a pharma- ceutically acceptable excipient.

35. 35. The pharmaceutical composition of claim 34, wherein the pharma- ceutically acceptable excipient comprises saline.

36. 36. The pharmaceutical composition of claim 34 or 35, wherein the pharma- ceutically acceptable excipient comprises water for injection.

37. The pharmaceutical composition of any one of claims 34 to 36, further comprising a pharma- ceutically acceptable buffer.

38. 38. The pharmaceutical composition of claim 37, wherein the pharma- ceutically acceptable excipient comprises phosphate buffered saline.

39. The pharmaceutical composition according to any one of claims 34 to 38, wherein the pharmaceutical composition is packaged in a pre-filled syringe.

40. The pharmaceutical composition according to any one of claims 34 to 38, wherein the pharmaceutical composition is packaged in a vial.

41. 41. The pharmaceutical composition of any one of claims 34 to 40 for use in the treatment of a disease or disorder selected from the group consisting of hypertriglyceridemia, obesity, hyperlipidemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, type II diabetes mellitus, cardiovascular disease, coronary artery disease, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, homozygous and / or heterozygous familial hypercholesterolemia, or statin-resistant hypercholesterolemia.

Images