Protein translation using circular RNA and its applications

Abstract

To develop a cap-independent translation initiation element of non-viral origin.SOLUTION: Provided are a circular RNA construct and applications thereof. The circular RNA construct has a structure represented by formula I in the 5'-3' direction: TI-Z1-Z2 (I), wherein TI is a translation initiation element, Z1 is an expression cassette for exogenous protein expression, and Z2 is absent or another element.SELECTED DRAWING: None

Description

Detailed Description of the Invention

[0001] [Technical field] The present invention relates to the field of biotechnology, specifically to protein translation using circular RNA and its applications.

[0002] [Background technology] Proteins are the most important biopolymers in living organisms, and their mutations or abnormal expression can cause diseases. Therefore, protein replacement or expression can treat the corresponding diseases. Common protein replacement or expression therapies include ribonucleic acid (DNA) vector-based delivery systems, deoxyribonucleic acid (RNA) vector-based delivery systems, and protein delivery systems. All of these methods require the production of proteins through messenger RNA translation. The common translation initiation method in eukaryotic organisms is cap-dependent translation, which mainly initiates translation by identifying a special cap structure at the 5´ end of messenger RNA via translation initiation factors, and this type of translation method only exists in linear messenger RNA. In addition, there is a type of non-cap-dependent translation initiation, which mainly initiates translation through interactions between specific protein factors and RNA elements. This type of translation can initiate translation with linear or circular RNA. Common non-cap-dependent translation initiation elements are some elements with specific secondary structures in viral RNAs, which can borrow the host cell's translation system to express the proteins they require. For example, there is an internal ribosome entry site (IRES) element contained in the RNA of encephalomyocarditis virus or hepatitis C virus.

[0003] Circular RNA is a single-stranded closed-loop RNA form that is different from linear RNA. Due to its structural specificity, it is less susceptible to exonuclease degradation and is more stable than linear RNA. Therefore, protein expression by circular RNA translation is more sustained and effective, and is an important hand fragment that replaces linear RNA translation. However, circular RNA translation can only use non-cap-dependent translation in trans, so how to design and select appropriate non-cap translation initiation elements is an important technology for such applications. A common hand fragment is to use viral IRES to initiate the translation of circular RNA, but pathogenic viral RNA may cause immune rejection in the host in vivo, and at the same time, viral-derived RNA elements contain complex RNA secondary structures and long sequences, limiting the construction of expression systems based on viral IRES and their later gene therapy applications.

[0004] Therefore, there is an urgent need in the art to develop non-viral, non-cap-dependent translation initiation elements. [Summary of the Invention] [Problem to be solved by the invention] It is an object of the present invention to provide non-cap-dependent translation initiation elements of non-viral origin.

[0005] [Means for solving the problem] A first aspect of the present invention provides a circular RNA construct, the circular RNA construct having a structure shown in formula I from the 5'-3' direction: TI-Z1-Z2(I) In the formula: TI is the translation initiation element, Z1 is an expression cassette for expressing an exogenous protein, Z2 is none or another element; Also, each "-" is a bond or a nucleotide connecting sequence, Here, the length of the TI element is 6 to 30 nt, preferably 8 to 24 nt, and more preferably 10 to 20 nt. In the TI element, the content of A is ≧35%, preferably ≧45%, more preferably ≧60%; In the TI element, the content of T is ≧20%, preferably ≧30%, more preferably ≧50%; In the TI element, the content of A+T is ≧65%, preferably ≧80%, more preferably ≧90%; In the TI element, the content of G is ≦35%, preferably ≦25%, more preferably ≦10%.

[0006] In another preferred embodiment, the circular RNA construct is a circular messenger RNA construct. In another preferred example, the content of A in the TI element is 35 to 100%, preferably 45 to 100%, more preferably 60 to 100%.

[0007] In another preferred example, the content of T in the TI element is 20 to 100%, preferably 30 to 100%, more preferably 50 to 100%.

[0008] In another preferred example, in the TI element, the content of A+T is 65 to 100%, preferably 80 to 100%, more preferably 90 to 100%.

[0009] In another preferred example, the content of G in the TI element is 0 to 35%, preferably 0 to 25%, and more preferably 0 to 10%.

[0010] In another preferred embodiment, the TI element comprises one or more nucleotide sequences selected from the group consisting of the nucleotide sequences shown in Table 1.

[0011] [Table 1]

[0012] [Table 2]

[0013] In another preferred example, the TI element has 1 to 24 (preferably 1 to 15, more preferably 1 to 10, more preferably 1 to 6) nucleotides added to the 5' end and / or 3' end of the nucleotide sequence shown in Table 1, and has the function of a TI element.

[0014] In another preferred embodiment, the coding sequence of the TI element comprises: (a) a polynucleotide represented by a sequence such as SEQ ID NO.: 1-40; (b) a polynucleotide having a nucleotide sequence identity of ≧75% (preferably ≧85%, more preferably ≧90% or ≧95% or ≧98% or ≧99%) to the sequence shown in SEQ ID NO.: 1 to 40; (c) a polynucleotide that truncates or adds 1 to 18 (preferably 1 to 10, more preferably 1 to 6) nucleotides at the 5' end and / or 3' end of a polynucleotide shown in SEQ ID NO.: 1 to 40; and (d) The polynucleotide is selected from the group consisting of polynucleotides complementary to any one of (a) to (c).

[0015] In another preferred embodiment, the TI element has a sequence as shown in SEQ ID NO.:1-40. In another preferred embodiment, the coding sequence of the TI element is shown in SEQ ID NO.:1-40.

[0016] In another preferred embodiment, the Z1 element comprises a stop codon. In another preferred embodiment, the Z1 element does not contain a stop codon. In another preferred embodiment, the coding sequence of the exogenous protein is derived from a prokaryote or a eukaryote.

[0017] In another preferred embodiment, the coding sequence of the exogenous protein is derived from an animal, a plant, or a pathogen. In another preferred embodiment, the coding sequence for the exogenous protein is derived from a mammal, preferably a primate, rodent, including human, mouse and rat.

[0018] In another preferred embodiment, the coding sequence of the exogenous protein is selected from the group consisting of, for example, a luciferin protein, or a luciferase (e.g., firefly luciferase), green fluorescent protein, yellow fluorescent protein, aminoacyl-tRNA synthetase, glyceraldehyde-3-phosphate dehydrogenase, catalase, actin, exogenous DNA of a variable region encoding an antibody, DNA of a luciferase mutant, or a combination thereof.

[0019] In another preferred embodiment, the exogenous protein is selected from the group consisting of luciferin protein, or luciferase (e.g., firefly luciferase), green fluorescent protein, yellow fluorescent protein, aminoacyl-tRNA synthetase, glyceraldehyde-3-phosphate dehydrogenase, catalase, actin, variable regions of antibodies, luciferase mutants, α-amylase, Enterobacteriaceae, Hepatitis C virus E2 glycoprotein, insulin precursor, interferon αA, interleukin-1β, lysozyme, serum albumin, single chain antibody fragment (scFV), transthyretin, tyrosinase, xylanase, or a combination thereof.

[0020] In another preferred embodiment, the Z2 element is selected from the group consisting of polyA, a multiple cloning site, an aptamer, an miRNA binding site, a translation enhancing element, or a combination thereof.

[0021] In another preferred embodiment, one or more adenines (A) of the TI element are methylated. In another preferred embodiment, the sequence of the circular RNA construct is shown in SEQ ID NO.:61.

[0022] A second aspect of the invention provides a vector, said vector comprising an expression cassette for the construct according to the first aspect of the invention. In another preferred embodiment, the expression cassette comprises a first intron and a second intron.

[0023] In another preferred embodiment, the first intron and the second intron are fully complementary or not fully complementary. In another preferred embodiment, the vector has the sequence shown in SEQ ID NO.:62.

[0024] In another preferred embodiment, the sequence of the first intron is shown in SEQ ID NO.:63. In another preferred embodiment, the sequence of the second intron is shown in SEQ ID NO.:64.

[0025] A third aspect of the invention provides a genetically engineered cell, wherein the genetically engineered cell has integrated into one or more sites in its genome a nucleic acid construct according to the first aspect of the invention, or wherein the genetically engineered cell comprises a vector according to the second aspect of the invention.

[0026] In another preferred embodiment, the genetically engineered cells include prokaryotic and eukaryotic cells. In another preferred embodiment, the eukaryotic cell comprises a higher eukaryotic cell.

[0027] In another preferred embodiment, the genetically engineered cells are selected from the group consisting of human derived cells (e.g., HeLa cells), Chinese hamster ovary cells, insect cells, wheat germ cells, rabbit reticulocytes, yeast cells, or combinations thereof.

[0028] In another preferred embodiment, the genetically engineered cell is a yeast cell. In another preferred embodiment, the yeast cell is selected from the group consisting of Saccharomyces, Kluyveromyces yeast, or a combination thereof.

[0029] In another preferred embodiment, the Kluyveromyces yeast is selected from the group consisting of Kluyveromyces lactis, Kluyveromyces marxianus, Kluyveromyces doburii, or a combination thereof.

[0030] A fourth aspect of the present invention is (a) a construct according to the first aspect of the invention, and (b) providing a reaction system comprising a spliceosome, a ribosome, and other components required for the reaction selected from the group consisting of translation initiation factor EIF4G2, translation initiation factor EIF4A, translation initiation factor EIF4B, or a combination thereof;

[0031] In another preferred embodiment, the reaction system further comprises YTHDF3, PABPC1, and / or hnRNPA1 proteins. In another preferred embodiment, the reaction system is an in vitro reaction system.

[0032] A fifth aspect of the present invention is (i) providing a reaction system according to the fourth aspect of the present invention; and (ii) incubating the synthesis system of step (i) under suitable conditions for a time T1 to synthesize said protein.

[0033] In another preferred embodiment, the method optionally further comprises the step (iii) of separating or detecting the protein from the in vitro reaction system.

[0034] In another preferred example, the reaction temperature in the step (ii) is 25 to 42°C, preferably 30 to 40°C, and more preferably 35 to 37°C.

[0035] In another preferred example, in the step (ii), the reaction time T1 is 1 hour to 20 hours, preferably 2 hours to 12 hours, more preferably 3 hours to 6 hours.

[0036] A sixth aspect of the present invention is a method for producing a composition comprising the steps of: (k1) a first container and a construct according to the first aspect of the present invention located within the first container; (k2) a second container and other components necessary for the reaction located in the second container selected from the group consisting of spliceosomes, ribosomes, translation initiation factor EIF4G2, translation initiation factor EIF4A, translation initiation factor EIF4B, or a combination thereof; and (kt) A kit for in vitro protein synthesis is provided, the kit including a label or manual.

[0037] In another preferred embodiment, the first container and the second container are the same container or different containers. In another preferred embodiment, the kit comprises: (k3) further comprising a third container, and one or more containers selectively selected from the group consisting of YTHDF3, PABPC1, and / or hnRNPA1 proteins located within the third container.

[0038] A seventh aspect of the present invention provides the use of a construct according to the first aspect of the invention, a vector according to the second aspect of the invention, a genetically engineered cell according to the third aspect of the invention, a reaction system according to the fourth aspect of the invention or a kit according to the sixth aspect of the invention for use in high throughput in vitro protein synthesis.

[0039] [Effects of the invention] It should be understood that within the scope of the present invention, the above technical features of the present invention and the technical features specifically described below (e.g., in the Examples) can be combined with each other to form new or preferred technical solutions, which will not be repeated here due to space limitations. [Brief description of the drawings]

[0040] [Figure 1] 1 shows the various cell populations screened by flow cytometry. [Diagram 2] Western blot detection of the activity of signature sequences of translation initiation elements. [Diagram 3] Western blot detection of the activity of translation initiation elements generated by antilearning. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0041] As a result of extensive and thorough research, through a large amount of screening and exploration, a specific translation initiation element has been unexpectedly screened for the first time, which has high translation activity, and the translation proposed element of the present invention can be inserted into a circular RNA expression vector to significantly improve the translation efficiency both in vivo and in vitro. Based on this, the present inventors have completed the present invention.

[0042] First intron In the present invention, the 3' end of the first intron contains a splice acceptor site that contains a fragment of a cis element (length 50 bp to 300 bp) that forms the second intron pair.

[0043] The sequence is as follows: GACTGAACATGGAGGAATTGAGGTTGGGTATTTCCCCTGAGGTAGGAAAAAAGGCTGGGTCAGTTTCCCGTTAGCCGTCAAGTCCTCATCACATCTTTAAGCCTTCCATGCAGGATAAAGGGCTGCAGAGCTATTTTCAAATTGACATCAAACTGGATTTCTGTTGACTTCGTCTTCCCTTTTTAAGGTCCACAGAAGAAGATGGGAAGGAAAGAAGTCTGAGGGCATCTTATT TGCACTCCGCTGTCATTTCTAAGGAAGGCTTTAATGCCAAATTCTCATCTTTTATGTCCCCACTAAATCCTAAAGGTTCTTGAACTTCTGATCAGACAGCCAAAAAATGAACCATCAACTAGCTTAACCTAACATATGTGAGGATAGAGGACTGGGACAGCTCTCTGGGCCACTGGAGAGTCAGACAGGCCTGCCCTCTGTGTGACTTGACCGCGGTCTCTTTCTTCCAG(SEQ ID NO.:63) Second intron In the present invention, the 5' end of the second intron contains a splice donor site that includes a fragment of a cis element (length 50 bp to 300 bp) that forms the first intron pair.

[0044] The sequence is as follows: GTAAGTCTCGACGGATCCCAAATAAGATGCCCTCAGACTTCTTTCCTTCCCATCTTCTTCTGTGGACCTTAAAAAAGGGAAGACGAAGTCAACAGAAATCCAGTTTGATGTCAATTTGAAAATAGCTC TGCAGCCCTTTATCCTGCATGGAAGGCTTAAAGATGTGATGAGGACTTGACGGCTAACGGGAAACTGACCCAGCCTTTTTCCTACCTCAGGGGAAATACCCAACCTCAATTCCTCCATGTTCAG(SEQ ID NO.:64) Circular RNA constructs A first aspect of the present invention provides a circular RNA construct, the circular RNA construct having a structure shown in formula I from the 5'-3' direction: TI-Z1-Z2(I) In the formula: TI is the translation initiation element, Z1 is an expression cassette for expressing an exogenous protein, Z2 is none or another element; Also, each "-" is a bond or a nucleotide connecting sequence, Here, the length of the TI element is 6 to 30 nt, preferably 8 to 24 nt, and more preferably 10 to 20 nt. In the TI element, the content of A is ≧35%, preferably ≧45%, more preferably ≧60%; In the TI element, the content of T is ≧20%, preferably ≧30%, more preferably ≧50%; In the TI element, the content of A+T is ≧65%, preferably ≧80%, more preferably ≧90%; In the TI element, the content of G is ≦35%, preferably ≦25%, more preferably ≦10%.

[0045] In a preferred embodiment, the content of A in the TI element is 35 to 100%, preferably 45 to 100%, more preferably 60 to 100%.

[0046] In a preferred embodiment, the content of T in the TI element is 20 to 100%, preferably 30 to 100%, more preferably 50 to 100%.

[0047] In a preferred embodiment, in the TI element, the content of A+T is 65 to 100%, preferably 80 to 100%, more preferably 90 to 100%.

[0048] In a preferred embodiment, the content of G in the TI element is 0 to 35%, preferably 0 to 25%, and more preferably 0 to 10%.

[0049] In the present invention, the selection of the coding sequence of the exogenous protein is not particularly limited, and typically, the coding sequence of the exogenous protein is selected from the group consisting of luciferin protein, or luciferase (e.g., firefly luciferase), green fluorescent protein, yellow fluorescent protein, aminoacyl-tRNA synthetase, glyceraldehyde-3-phosphate dehydrogenase, catalase, actin, exogenous DNA of variable regions encoding antibodies, DNA of luciferase mutants, or combinations thereof.

[0050] The coding sequence for the exogenous protein may also encode a protein selected from the group consisting of α-amylase, Enterobacterial A, Hepatitis C virus E2 glycoprotein, insulin precursor, interferon αA, interleukin-1β, lysozyme, serum albumin, single chain antibody fragment (scFV), transthyretin, tyrosinase, xylanase, or a combination thereof.

[0051] Furthermore, the nucleic acid construct of the present invention is circular. The nucleic acid construct of the present invention is single-stranded. The nucleic acid construct of the present invention is RNA. In a preferred embodiment, the sequence of the circular RNA construct of the present invention is shown in SEQ ID NO.:61.

[0052] Circular RNA sequence using GFP as an example: 5'--3'(SEQ ID NO.:61) In a preferred embodiment, the sequence of the circular RNA precursor (including the first and second introns) used as an example for GFP is as follows:

[0053] 5'-GACTGAACATGGAGGAATTGAGGTTGGGTATTTCCCCTGAGGTAGGAAAAAGGCTGGGTCAGTTTCCCGTTAGCCG In a preferred embodiment, the TI element of the invention comprises a nucleotide sequence selected from the group consisting of the nucleotide sequences shown in Table 1.

[0054] [Table 3]

[0055] [Table 4]

[0056] In a preferred embodiment, the coding sequence of the TI element of the invention is shown in SEQ ID NO.:1-40. In the present invention, the circular RNA construct to which the present invention is applied has high translation activity and can significantly enhance translation efficiency in vivo or in vitro.

[0057] Reaction System The present invention relates to (a) a construct according to the first aspect of the invention, and (b) providing a reaction system comprising a spliceosome, a ribosome, and other components required for the reaction selected from the group consisting of translation initiation factor EIF4G2, translation initiation factor EIF4A, translation initiation factor EIF4B, or a combination thereof;

[0058] In another preferred embodiment, the reaction system comprises YTHDF3, PABPC1, and and / or further comprising an hnRNPA1 protein. In the present invention, the reaction system can be in vitro or in vivo.

[0059] kit The present invention relates to (k1) a first container, and the nucleic acid construct according to claim 1 located in the first container; (k2) a second container and other components necessary for the reaction located in the second container selected from the group consisting of spliceosomes, ribosomes, translation initiation factor EIF4G2, translation initiation factor EIF4A, translation initiation factor EIF4B, or a combination thereof; and (kt) A kit for in vitro protein synthesis is provided, the kit including a label or manual.

[0060] In a preferred embodiment, the first container and the second container are the same container or different containers. Coding sequence for exogenous protein (exogenous DNA) As used herein, the terms "exogenous protein coding sequence" and "exogenous DNA" are used interchangeably and both refer to an exogenous DNA molecule used to direct protein synthesis. Typically, the DNA molecule is linear or circular. The DNA molecule comprises a sequence that codes for an exogenous protein.

[0061] In the present invention, examples of the sequence encoding the exogenous protein include, but are not limited to, a genomic sequence and a cDNA sequence. The sequence encoding the exogenous protein further includes a promoter sequence, a 5' untranslated sequence, and a 3' untranslated sequence.

[0062] In the present invention, the selection of the exogenous DNA is not particularly limited, and typically, the exogenous DNA is selected from the group consisting of exogenous DNA of a variable region encoding a luciferin protein, or luciferase (e.g., firefly luciferase), green fluorescent protein, yellow fluorescent protein, aminoacyl-tRNA synthetase, glyceraldehyde-3-phosphate dehydrogenase, catalase, actin, an antibody, etc., DNA of a luciferase mutant, or a combination thereof.

[0063] The exogenous DNA may also be selected from the group consisting of exogenous DNA encoding α-amylase, Enterobacteriaceae A, Hepatitis C virus E2 glycoprotein, insulin precursor, interferon αA, interleukin-1β, lysozyme, serum albumin, single chain antibody fragment (scFV), transthyretin, tyrosinase, xylanase, and the like, or combinations thereof.

[0064] In a preferred embodiment, the exogenous DNA encodes a protein selected from the group consisting of enhanced green fluorescent protein (eGFP), yellow fluorescent protein (YFP), Escherichia coli β-galactosidase (LacZ), human lysine-tRNA synthetase, human leucine-tRNA synthetase, glyceraldehyde-3-phosphate dehydrogenase, mouse catalase, or a combination thereof.

[0065] In vitro protein synthesis methods The present invention relates to (i) providing a reaction system according to the second aspect of the present invention; Incubating the synthetic system of step (i) for a time T1 under suitable conditions to form the tandem (ii) synthesizing a protein comprising the steps of:

[0066] In another preferred embodiment, the method optionally further comprises the step (iii) of separating or detecting the protein from the reaction system.

[0067] The main advantages of the present invention are: (1) The present invention provides the first set of methods for designing and synthesizing a novel, artificially synthesized, non-viral-derived eukaryotic translation initiation element with high translation activity and controllable sequence structure and length, which drives the translation of a circular RNA.

[0068] (2) The present invention screens for a specific translation initiation element, which is very short, only 6 to 30 nt, but has high translation activity. By inserting the translation initiation element into a circular RNA expression vector, the translation efficiency can be significantly enhanced both in vivo and in vitro.

[0069] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and do not limit the scope of the present invention. In the following examples, the experimental methods that do not show specific conditions are usually in accordance with conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or conditions suggested by manufacturers. Unless otherwise specified, percentages and parts are calculated by weight percentages and parts by weight.

[0070] Unless otherwise stated, all materials and reagents used in the examples of the present invention are commercially available products. An example of an exogenous protein is GFP.

[0071] Experimental Method 1. Based on the unique circular RNA reporter gene system of the present invention (the circular RNA reporter gene can be expressed under the driving of translation initiation element to produce green fluorescent protein), a library containing millions of different sequences is constructed, and different cell populations are screened by cell transfection and flow cytometry (negative: no green fluorescence, positive: with different intensity of green fluorescence). Amplicon sequencing is performed on the collected various cell populations, and the sequence information contained in the negative and various positive cells is analyzed in combination with computational biology analysis, and sequence features of various lengths are extracted from these sequence information.

[0072] 2. Through anti-neural network training to generate non-viral derived translation initiation element modules based on these negative and preferred sequence features.

[0073] 3. The generated translation initiation element module and module combination element are inserted into a circular RNA expression vector, and the activity of the translation initiation element is detected by cell transfection and Western blot.

[0074] Experimental Results 1. A high-throughput screening system based on circular RNA separates cell populations containing different green fluorescence intensities (positive) and cell populations without fluorescence (negative).

[0075] The results are shown in Table 1 and Figure 1. The results show that the circular RNA system can express green fluorescent protein and can be used for screening. The system was able to separate cell populations with different fluorescence intensities, indicating that different insert sequences in the library have different effects on translation initiation of circular RNA.

[0076] 2. As shown in Table 1, sequence features contained in the high green fluorescent cell population obtained by mining computational biology analysis of amplicon sequence data of various cell populations obtained by screening, these sequences all usually contain a large amount of AU bases with few GC bases that are prone to forming RNA secondary structures, indicating that the core module of this type of translation initiation element is structure-independent and at the same time has significant differences from viral IRES, and is a new element that can promote non-cap-dependent translation of circular RNA.

[0077] [Table 5]

[0078] [Table 6]

[0079] 3. The translation activity of the basic characteristic sequence of the translation initiation element (six base sequence characteristics) was detected by cell transfection and Western blot, and the results are shown in Figure 2. The results show that these translation elements all have the translation initiation function, but there are differences in the translation initiation ability contained in different sequences. This indicates that translation initiation elements with different activities can be obtained based on the combination of these different sequence characteristics.

[0080] 4. Translation initiation elements (12 bases are used as an example) generated by anti-learning based on the characteristic sequences of positive and negative cell populations. The top 20 sequences with different translation activity strengths are listed. As shown in Table 2, translation initiation elements with high activity are basically AT-rich sequences.

[0081] [Table 7] TIFF0007673989000008.tif236170TIFF0007673989000009.tif32170

[0082] 5. The translation initiation elements of different strengths obtained by anti-learning are inserted into the circular RNA expression vector, and their translation activity is detected by cell transfection and Western blot. The results are shown in Figure 3. According to the results, the strong activity elements in Table 2 can translate and produce more GFP protein, and the medium and weak activity elements also have a certain translation efficiency, but it is lower than the translation efficiency of the strong activity elements.

[0083] The results show that the anti-learning method of the present invention can effectively predict the activity of translation initiation elements, and the method can be used to generate translation initiation elements of different lengths and strengths, and the translation initiation elements of the present invention have higher translation activity and can significantly enhance translation efficiency.

[0084] All documents mentioned in the present invention are incorporated by reference in this application as if each document was incorporated by reference individually. Furthermore, after reading the above teachings of the present invention, those skilled in the art may make various changes or modifications to the present invention, and these equivalents are also included in the scope defined by the appended claims of this application.

Claims

1. A circular RNA construct comprising a TI (translation initiation element), The circular RNA construct has the structure shown in formula I from the 5'-3' direction, TI-Z1-Z2(I) In the formula: Z1 is an expression cassette for expressing an exogenous protein, Z2 is none or another element; Also, each "-" is a bond, wherein the length of the TI element is 6 nt and the TI element comprises the nucleotide sequence "TAATAG", The construct, wherein the sequence encoding the exogenous protein is selected from the group consisting of luciferin protein, or luciferase, green fluorescent protein, yellow fluorescent protein, aminoacyl-tRNA synthetase, glyceraldehyde-3-phosphate dehydrogenase, catalase, actin, or exogenous DNA encoding a variable region of an antibody, DNA of a luciferase mutant, and combinations thereof.

2. one or more adenines (A) of the TI element are methylated The circular RNA construct of claim 1.

3. A vector comprising: The vector, characterized in that it comprises the circular RNA construct described in claim 1.

4. 1. A genetically engineered cell comprising: A genetically engineered cell, characterized in that the circular RNA construct of claim 1 is integrated into one or more sites in the genome of the genetically engineered cell.

5. 1. A genetically engineered cell comprising: A genetically engineered cell comprising the vector of claim 3.

6. 1. A reaction system comprising: The reaction system, characterized in that it comprises the circular RNA construct described in claim 1 and other components necessary for the reaction selected from the group consisting of spliceosomes, ribosomes, translation initiation factor EIF4G2, translation initiation factor EIF4A, translation initiation factor EIF4B, and combinations thereof.

7. 1. A method for synthesizing a protein in vitro, comprising: A method for synthesizing a protein in vitro, comprising the step of incubating the reaction system according to claim 6 for T1 hour under suitable conditions to synthesize the protein.

8. A kit for in vitro protein synthesis, comprising: The kit, comprising: (k1) a first container containing the circular RNA construct described in claim 1; (k2) a second container containing other components required for a synthesis reaction selected from the group consisting of spliceosomes, ribosomes, translation initiation factor EIF4G2, translation initiation factor EIF4A, translation initiation factor EIF4B, and combinations thereof; and (k3) a label or manual for using the kit.

Images