Method for preparing polynucleotide samples from body hair samples, method for RNA expression analysis, method for DNA analysis, storage reagent for body hair samples, and body hair sample collection kit

Abstract

To acquire information on skin cells by a method with reduced invasiveness and analyze the skin by, for example, supporting the diagnosis of skin diseases.SOLUTION: A method for preparing a polynucleotide sample includes preparing a polynucleotide sample from a hair sample containing cells around hair roots, directly collected from an interest region of skin tissue of a subject.SELECTED DRAWING: None

Description

[Technical field]

[0001] This specification discloses a method for preparing a polynucleotide sample from a hair sample. This specification also discloses a method for analyzing RNA expression or DNA using the polynucleotide sample. This specification also discloses a storage reagent for storing the hair sample and a collection kit for the hair sample. [Background technology]

[0002] Skin diseases are diagnosed by doctors by taking a medical history, visual assessment of things like scaling, redness, swelling, the shape of the rash, changes in color, information like stiffness and fever, and blood test results. For more detailed visual diagnosis, a high-performance magnifying glass like a dermoscope is used, which is a very useful method for diagnosis (Non-Patent Document 1). When these methods cannot be used to make an estimate or when it is necessary to determine the internal condition, a tissue diagnosis is performed, usually by taking a part of the skin with an instrument called a trephine and preparing a pathological specimen. In addition, although very rarely, a cytological diagnosis may be performed on a sample collected by puncture aspiration to diagnose cancer, etc. (Non-Patent Document 2).

[0003] In addition, information on the condition of the skin is collected for cosmetic purposes in addition to pathological diagnosis. Skin analysis for cosmetic purposes is sometimes called skin diagnosis. Skin diagnosis is a method for monitoring skin type, sensitivity, skin condition, relative age of the skin, etc. In skin diagnosis, a method of analyzing keratin, sebum, etc. collected using tape or a sampling tool (Patent Document 1) is common. Other skin diagnosis methods include a method of diagnosing the condition of the skin by performing image analysis on the appearance of the skin using a microscope or the like (Patent Document 2), and a method of determining the age by performing image analysis of the entire skin (Patent Document 3). Other skin diagnosis methods include a replica method in which a rubber material or the like is applied to the skin and hardened to produce a replica of the skin, and the skin texture and wrinkle shape are determined based on the replica.

[0004] Furthermore, in addition to skin diagnosis, factors indicating the state of the skin, such as the amount of moisture in the skin measured electrically using a moisture measuring device such as SKICON (Patent Document 4), and the amount of moisture evaporation measured using a TEWA meter, are measured to evaluate the state of the skin.

[0005] Skin diagnosis is used to ensure the effectiveness of topical agents for each individual and as a selection criterion for cosmetics. For example, the method of collecting the cutin on the skin surface with tape is called tape stripping. The size of the collected keratinocytes indicates turnover, age, and the presence or absence of inflammation. Observation of nucleated cells indicates inflammation and the normality of the epidermal barrier. Information obtained from skin diagnosis methods using the collected samples is widely used for skin diagnosis. Also, the measurement of the depth and frequency of wrinkles by diagnosis using an image of a replica correlates well with the apparent age, so it is also used as an efficacy criterion for quasi-drugs. Measuring the amount of moisture can estimate the degree of skin dryness, and the TEWL value indicating the amount of moisture evaporation shows a correlation with the degree of skin inflammation by observing the skin barrier state. Such information can be used not only for beauty but also for medical diagnosis. Furthermore, Patent Document 5 describes performing genetic analysis of a subject using nucleic acid derived from sebum.

Prior Art Documents

Patent Documents

[0006]

Patent Document 1

Patent Document 2

Patent Document 3

Patent Document 4

Patent Document 5

Non-Patent Documents

[0007] [Non-Patent Document 1] How to diagnose? How to cure? The first step in skin care ~ Tips and skills for skin care that can be used right away Yodosha 2013 / 11 / 12 Hisashi Uhara (Author) [Non-Patent Document 2] Shigeo Yokoyama, Shogo Urabe, Ayako Kamachi, Tsutomu Da, Kenji Kashima: Part 2: Actual situation and topics of cytology 24. Skin, Pathology and Clinical Medicine, 31 (special issue), 379-389, 2013 Summary of the Invention [Problem to be solved by the invention]

[0008] Today's cosmetics market focuses not only on broad classifications but also on individual differences. There is a constant demand for the development of superior skin diagnostic methods, such as for tailor-made cosmetics that are designed with an eye on the differences in each individual's skin condition.

[0009] However, conventional skin diagnostic methods rely on comprehensive judgment based on many indirect pieces of information produced by complex factors, making it difficult to standardize judgment criteria and eliminate bias.In addition, there is no sufficient theory for processing information, such as judging internal changes based on superficial information, making it difficult to accumulate information needed to establish evaluation methods.

[0010] In addition, one of the reasons why it is difficult to diagnose skin conditions using current measurement methods is that the samples obtained are not living cells, but only their dead keratin or secreted substances such as lipids. It is the changes in cell activity that determine the aging state and skin condition, and there is a limit to estimating the state of cells before they were alive by examining non-living keratin. In other words, if we succeed in obtaining and analyzing living cells from localized skin, it will be possible to obtain a much larger amount of information indicating skin condition and age than ever before.

[0011] In skin, living cells are not exposed on the surface, and obtaining living cells from any target skin requires some degree of invasiveness of the skin. For example, accurate and large amounts of information can be obtained from pathological specimens, but the invasiveness of the specimens limits the locations and symptoms from which they can be obtained. If the purpose is cosmetic information, most of the information obtained by obtaining cells is skin condition and degree of skin aging, and choosing invasive means to obtain such information is not in the interest of consumers and is not acceptable. As mentioned above, it is indisputable that a method that is as minimally invasive as possible is in the interest of patients in medical diagnosis. Therefore, the establishment of a method that is less invasive and can analyze target skin cells more directly has been latent by consumers, developers, and medical professionals. However, the method described in Patent Document 5 has limitations on the amount of nucleic acid that can be sampled from subjects with low sebum secretion or from areas with low sebum secretion. In view of the problems with the conventional methods described above, an object of the present invention is to obtain skin cell information using a less invasive method and to perform skin analysis, such as aiding in the diagnosis of skin diseases. [Means for solving the problem]

[0012] As a result of extensive research, the present inventors have found that polynucleotide analysis can be performed using a sample of just a few body hairs.

[0013] The present invention has been completed based on this finding, and includes the following aspects. Item 1. A hair sample containing periradicular cells taken directly from the region of interest of the skin tissue of a subject. A method for preparing a polynucleotide sample, comprising preparing a polynucleotide sample from a nucleic acid sequence comprising: Item 2. The preparation method according to Item 1, wherein when the subject is a human, the body hair sample does not include a head hair sample. Item 3. The preparation method according to Item 1 or 2, wherein the polynucleotide is RNA. Item 4. A method for analyzing RNA expression, comprising: performing RNA expression analysis in hair root surrounding cells using a polynucleotide sample prepared by the preparation method according to Item 3. Item 5. The method for analyzing RNA expression according to Item 4, wherein the subject is an individual exposed to a test factor, and the analysis results are used to evaluate the effect of the test factor on the subject. Item 6. The method for analyzing RNA expression according to Item 5, wherein the evaluation is a safety evaluation of the test agent. Item 7. The method for analyzing RNA expression according to Item 5, wherein the evaluation is an evaluation of the usefulness of the test factor. Item 8. The method for analyzing RNA expression according to Item 6 or 7, wherein the evaluation index is an index indicating a skin health condition, a sign of a skin disease, or a skin disease in the subject caused by the test factor. Item 9. The preparation method according to Item 1 or 2, wherein the polynucleotide is DNA. Item 10. A method for DNA analysis, comprising performing at least one of mutation analysis, copy number analysis, and DNA methylation analysis of DNA derived from hair root cells using a polynucleotide sample prepared by the preparation method described in Item 9. Item 11. The DNA analysis method according to Item 10, wherein the subject is an individual exposed to a test factor, and the analysis results are used to evaluate the effect of the test factor on the subject. Item 12. The DNA analysis method according to Item 11, wherein the evaluation is a safety evaluation of the test agent. Item 13. The method for analyzing DNA according to Item 11, wherein the evaluation is an evaluation of the usefulness of the test factor. Item 14. The DNA analysis method according to Item 10, wherein the subject is an individual exposed to a test agent, and the analysis results are used to evaluate the amount of accumulated damage caused by the test agent in the subject. Item 15. The method for analyzing DNA according to Item 14, wherein the test factor is ultraviolet light and / or aging. Item 16. A polynucleotide analysis device for analyzing polynucleotides derived from hair root cells, the polynucleotide analysis device comprising a processing unit, the processing unit acquiring, as subject information, analytical information of polynucleotides derived from hair root cells collected from an area of ​​interest in skin tissue of a subject exposed to a test factor, analyzed using a polynucleotide sample prepared by the preparation method described in any one of items 1 to 3 and item 9, and comparing the subject information with corresponding reference information to evaluate the amount of accumulated or reduced skin damage caused by the test factor in the area of ​​interest in the skin of the subject. Item 17. A polynucleotide analysis program for analyzing polynucleotides derived from perirallar cells, which, when executed by a computer, causes the computer to execute a process comprising the steps of acquiring, as subject information, analytical information of polynucleotides derived from perirallar cells collected from an area of ​​interest in skin tissue of a subject exposed to a test factor, analyzed using a polynucleotide sample prepared by the preparation method described in any one of Items 1 to 3 and Item 9, comparing the subject information with corresponding reference information, and evaluating the amount of accumulated or reduced skin damage caused by the test factor in the area of ​​interest in the skin of the subject. Item 18. A method for analyzing a polynucleotide sample prepared by the method according to any one of items 1 to 3 and 9, the method comprising the steps of: obtaining, as subject information, analysis information of a polynucleotide derived from a hair root cell collected from an area of ​​interest in a skin tissue of a subject exposed to a test factor; comparing the subject information with corresponding reference information; and and evaluating the amount of accumulation or reduction of skin damage caused by the test factor in the region of interest. Item 19. A storage reagent for preserving a hair sample containing hair root cells directly collected from an area of ​​interest in a subject's skin tissue, the storage reagent maintaining the quality of the polynucleotides contained in the hair sample and used in the preparation method described in any one of Items 1 to 3 and 9. Item 20. A sampling kit for collecting a body hair sample containing cells around the hair root directly from the region of interest of the skin tissue of a subject, which is used in the preparation method according to any one of Items 1 to 3 and 9 and includes the storage reagent described in Item 18.

[0014] Since the above embodiment is characterized by analyzing the cells around the hair root from which the industrial hair or other body hair is collected and attached, a skin cell sample can be obtained more easily from the diseased site or the test site of the skin to be examined, a polynucleotide sample can be prepared, and gene information can be analyzed by a next-generation sequencer, real-time PCR, or the like. For the current analysis of gene information, various analyses such as expression profiles, mutation accumulation, and epigenetics have been proposed and established. By using these methods in combination, a large amount of information related to the functions of cells in the skin, the aging state, and the influence of test factors on cell functions can be collected.

Advantages of the Invention

[0015] According to the method for preparing a polynucleotide sample according to the present invention, a polynucleotide sample derived from skin cells can be obtained with less invasiveness. In addition, using the obtained polynucleotide sample, information derived from the skin required in the medical field or the cosmetic field can be collected.

Brief Description of the Drawings

[0016] [Figure 1] Shows an overview of the processing of the analysis program 1042. [Diagram 2] Shows an example of a polynucleotide analysis information database. [Diagram 3] Shows the hardware configuration of the analysis device 10. [Figure 4] Shows the functional configuration of the analysis device 10. [Diagram 5] Shows a part of the processing of the analysis program 1042. [Figure 6] Shows a part of the processing of the analysis program 1042. [Figure 7]1 shows a part of the processing of the analysis program 1042. [Figure 8] 1 shows a part of the processing of the analysis program 1042. [Figure 9] 1 shows a part of the processing of the analysis program 1042. [Figure 10] The results of DNA mutation analysis for a man in his 50s and an example of the displayed mutation analysis results are shown below. [Figure 11] The sequence in which heteroplasmy was found at the position of the mutation shown in Figure 10 is shown. "Position" indicates the position number assigned to the reference sequence. "Ref.seq." indicates the nucleotide sequence of the reference sequence. "Sub.Seq." indicates the subject's sequence corresponding to the reference sequence. "Frequency" indicates the frequency of reads. "Depth" indicates the sequence depth of each read. [Figure 12] The results of DNA mutation analysis for a male in his 20s and an example of the displayed mutation analysis results are shown below. [Figure 13] The sequences in which heteroplasmy was found at the mutation positions shown in Figure 12 are shown. "Position," "Ref.seq.", "Sub.seq.", "Frequency," and "Depth" are the same as in Figure 11. [Figure 14] Figure 14(A) shows the amplification curves of each gene when cDNA samples with different concentrations were used. Figure 14(B) shows the melting curves. Figure 14(C) shows the relative expression level of IL-1α mRNA. Figure 14(D) shows the relative expression level of β-actin mRNA. [Figure 15] The relative expression levels of GAPDH, IL-33, IL-23, IL-17, and TNF-α are shown. [Figure 16] (A) shows the relative expression level of HMGB-1 mRNA, and (B) shows the relative expression level of TNFα mRNA. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0017] 1. Explanation of terms First, the meanings of the main terms used in this specification will be explained.

[0018] The term "subject" refers to an individual from which a hair sample is collected. The "individual" is not particularly limited, and examples thereof include mammals such as humans, mice, rats, dogs, cats, rabbits, cows, horses, goats, sheep, and pigs, and birds such as chickens. Preferred are mammals such as humans, mice, dogs, cats, cows, horses, and pigs, more preferably humans, mice, dogs, or cats, even more preferably humans or mice, and most preferably humans.

[0019] "Body hair" refers to hair that grows on the skin tissue of the body surface of an individual. If the individual is human, the body hair may include down hair and terminal hair. Terminal hair may include head hair, eyebrows, armpit hair, pubic hair, and beard. Preferably, if the individual is human, the body hair does not include head hair. If the individual is avian, the body hair includes feathers.

[0020] In the present specification, the hair preferably includes a part or the whole of the hair bulb. This is because hair without a hair bulb is likely to be torn off when collected and not to include cellular components. Therefore, the "hair sample" is collected directly from the skin tissue of the subject and includes periradicular cells. The periradicular cells may include cells derived from the periradicular tissue, such as hair follicle cells, hair papilla cells, ductal cells, vascular epithelial cells, red blood cells, white blood cells, and platelets. Furthermore, the white blood cells may include lymphocytes, neutrophils, monocytes, eosinophils, and basophils. The periradicular cells may also include microorganisms and cells infected with microorganisms. The microorganisms may include pathogens and microorganisms normally present on the skin. The microorganisms may include bacteria, fungi, viruses, mites, and the like.

[0021] The phrase "directly collect" a hair sample means to collect hair attached to the hair papilla by plucking it. In other words, it is not intended to collect hair that has fallen off the skin. Hair can be collected by known methods such as using fingers, tweezers (including tweezers), hair removal tape, and hair removal wax. Hair can be collected from a site from which a polynucleotide sample is to be collected (hereinafter referred to as an "area of ​​interest"). The hair sample may be collected by the subject himself or by an individual other than the subject. The individual other than the subject is preferably a human. The human who collects the hair sample may include a doctor, a nurse, a hairdresser, and an esthetician. When the subject is a human, it is preferable that the subject himself collects the hair sample.

[0022] The number of hairs required to prepare a polynucleotide sample is about 1 to 10, preferably about 3 to 5. Since the results of the polynucleotide analysis described below vary depending on the site from which the hair sample is collected, when repeatedly collecting hair samples from the region of interest, it is preferable to collect the hair sample from a site as close as possible to the site from which it was previously collected.

[0023] Polynucleotides may include DNA and RNA. DNA may include genomic DNA and mitochondrial DNA. RNA may include messenger RNA (mRNA), non-translated RNA, microRNA, ribosomal RNA (rRNA), transfer RNA (tRNA), etc. Preferred RNAs are mRNA, non-translated RNA, and microRNA.

[0024] The polynucleotide sample is not limited as long as it contains polynucleotides derived from a hair sample. It may be in a dry state or dissolved in a buffer or the like. The polynucleotides contained in the nucleotide sample may be purified, crudely purified, or unpurified.

[0025] The polynucleotide sample may contain ethylenediaminetetraacetic acid, β-mercaptoethanol (or dithiothreitol), bovine serum albumin, sodium chloride, and the like.

[0026] An individual includes an individual who has been exposed to a test agent. The test factor is intended to be a factor to which the effect on the subject is to be evaluated. The test factor is also a factor to which the region of interest from which the hair sample is collected is exposed. The test factor may include substances such as compounds, nucleic acids, carbohydrates, lipids, glycoproteins, glycolipids, lipoproteins, amino acids, peptides, proteins, polyphenols, chemokines, at least one metabolic substance selected from the group consisting of terminal metabolic products, intermediate metabolic products, and synthetic raw materials of the above substances, metal ions, or microorganisms. The above substances may be a single substance or a mixture of multiple substances. Preferably, the substances include medicines, quasi-drugs, medicinal cosmetics, foods, foods for specified health uses, functional foods, and candidate products thereof. The test factor may also include factors other than the substance. For example, test factors other than the substance may include environmental factors such as light, radiation, and atmosphere; and physiological factors such as hormone status. Light may include ultraviolet light, infrared light, visible light, and the like. Radiation may include α rays, β rays, γ rays, X-rays, and the like. The atmospheric factors may include indoor or outdoor humidity, temperature, etc. The physiological factors may include age (aging), sleep time, weight control, menstrual status, and stress.

[0027] The test agent may cause at least one of poor skin health, a symptom of a skin disease, and a skin disease in the subject. Inference as to whether or not the test agent has caused poor skin health, a symptom of a skin disease, or a skin disease is made by determining whether or not the evaluation indicator suggests the onset of poor skin health, a symptom of a skin disease, or a skin disease.

[0028] The test agent may improve or maintain healthy skin, or reduce or inhibit signs of skin disease or skin disease in a subject. An estimation of whether the test agent has caused an improvement in or maintained healthy skin, or whether signs of skin disease or skin disease have been reduced or inhibited, is made by determining whether an index of evaluation is indicative of an improvement in or maintained healthy skin, or a reduction or inhibition of signs of skin disease or skin disease.

[0029] Here, skin diseases may include inflammatory diseases, neoplastic diseases, etc. Inflammatory diseases may include folliculitis (hair folliculitis) and dermatitis. Dermatitis may include non-allergic diseases and allergic diseases, etc. Allergic diseases may include atopic dermatitis, contact dermatitis, psoriasis, etc. Neoplastic diseases may include benign tumors and malignant tumors. Malignant tumors may include skin cancer (particularly squamous cell carcinoma), malignant melanoma, etc.

[0030] Signs of dermatitis include a condition in which no symptoms are visible to the naked eye or felt by the subject on the skin, but infiltration of leukocytes and other substances is observed in the tissue around the hair follicle, and the expression of inflammatory markers in the tissue around the hair follicle is increased.

[0031] The skin health condition may include the condition of skin firmness, skin texture, skin moisture content, amount of mitochondria per cell, etc. The evaluation of the skin health condition is also called a "skin diagnosis." The index for the evaluation is not limited as long as it indicates the health state of the skin, a symptom of a skin disease, or suggests a skin disease.

[0032] Indicators for evaluation include the expression of genes capable of evaluating the health of the skin, signs of skin disease, or skin disease when the polynucleotide is RNA. Examples include the expression of genes whose expression is increased during inflammation, such as TNF-α and interleukin-1. Interleukin-33, interleukin-17, interleukin-23, etc. are genes that are expressed in lymphocytes, antigen-presenting cells, etc. during inflammation, and can be used to evaluate the presence or amount of inflammatory cells that have infiltrated into the tissue surrounding the hair root. Matrix metalloproteinase-1, neutral endopeptidase, hyaluronidase-1, etc. are genes whose expression is increased with ultraviolet irradiation, and are known to degrade proteins necessary for maintaining skin firmness, such as collagen fibers and elastin fibers, and hyaluronic acid, which maintains the texture and moisture content of the skin. For this reason, these genes can be used as indicators of deterioration of the health of the skin. Since expression of the type I collagen gene, elastin gene, and hyaluronic acid synthase gene is necessary for maintaining skin firmness, skin texture, and skin moisture content, expression of these genes can be used as an indicator of improvement of skin health or maintenance of skin health.

[0033] When the polynucleotide is DNA, at least one of DNA mutation, copy number, or DNA methylation is included, which can evaluate the health of the skin, the signs of skin disease, or skin disease. The DNA mutation may include, as an indicator, the number of mutations in the entire genomic DNA and / or mitochondrial DNA, or in a specific gene, or the presence or absence of a specific mutation in a specific gene. The copy number may include the copy number of a specific gene, or the copy number of mitochondrial DNA. The DNA methylation includes the presence or absence of methylation in the entire genomic DNA and / or mitochondrial DNA, or in a specific gene, and the degree of methylation in a polynucleotide sample.

[0034] In addition, the copy numbers of the ND1 gene, ND5 gene, SLCO2B1 gene, and SERPINA1 gene present in mitochondrial DNA in a polynucleotide sample can be converted into the number of mitochondria per cell. The number of mitochondria can be used to evaluate skin age.

[0035] 2. Method for preparing polynucleotide samples, hair sample storage reagent, and hair sample collection kit (1) Method for preparing polynucleotide samples Preparation of a polynucleotide sample from a hair sample can be carried out according to a known method.

[0036] When the polynucleotide is DNA, for example, a hair sample collected from skin tissue is added to a specified dissolving solution, treated with a proteolytic enzyme such as proteinase K, and then phenol / chloroform extraction and ethanol precipitation are performed to extract the DNA.

[0037] When the polynucleotide is RNA, for example, a hair sample collected from skin tissue can be added to a dissolving solution containing guanidine or the like, dissolved, and then RNA can be extracted by performing phenol / chloroform extraction and isopropyl alcohol precipitation.

[0038] When polynucleotides are precipitated with ethanol or isopropyl alcohol, coprecipitating substances such as salmon sperm-derived DNA, yeast-derived tRNA, glycogen, etc. may be added.

[0039] The polynucleotide may be purified using a column such as a silica membrane instead of purification by phenol / chloroform purification and ethanol precipitation or isopropyl alcohol precipitation. Furthermore, a commercially available nucleic acid extraction reagent or nucleic acid extraction kit may be used for extracting polynucleotides. Here, the extracted polynucleotides are mainly derived from periradicular cells.

[0040] (2) Storage reagent for hair samples The storage reagent for the body hair sample is not limited as long as the quality of the polynucleotide can be maintained. The quality of the polynucleotide can be evaluated using the fragmentation or decomposition of the polynucleotide as an index. Since the amount of polynucleotide extracted from the body hair sample is very small, the fragmentation or decomposition of the polynucleotide can be evaluated, for example, by performing PCR or RT-PCR on a DNA sequence or an RNA sequence encoding a housekeeping gene described below using the extracted polynucleotide as a template, amplifying the DNA sequence or the RNA sequence, and determining whether an amplification product of a certain size is obtained. The certain size can be, for example, 200 bp or more, preferably 500 bp or more.

[0041] In the case where the polynucleotide is DNA, for example, a specific dissolving solution or the like can be used as a storage reagent for storing a hair sample collected from skin tissue until DNA extraction. The dissolving solution may contain a buffer solution for adjusting pH (for example, a Tris HCl buffer with a final concentration of about 10 mM to 100 mM, pH 7.0 to 8.5), a chelating agent (ethylenediaminetetraacetic acid with a final concentration of about 0.5 mM to 2 mM), a salt (for example, NaCl with a final concentration of about 150 mM), a surfactant (for example, sodium lauryl sulfate with a final concentration of about 0.1 weight / volume % to 1% weight / volume), water as a solvent, etc. Furthermore, the storage reagent may contain phenol.

[0042] In the case where the polynucleotide is RNA, for example, a specific dissolving solution or the like can be used as a storage reagent for storing a hair sample collected from skin tissue until RNA extraction. The dissolving solution may contain a protein denaturant (for example, a guanidine thiocyanate solution with a final concentration of about 4 M), water as a solvent, etc. Furthermore, the storage reagent may contain dithiothreitol or β-mercaptoethanol (about 1 mM to 2 mM), sodium acetate (final concentration of about 200 mM), and phenol.

[0043] Here, the storage reagent may be a commercially available DNA or RNA extraction reagent. Also, a reagent capable of extracting both DNA and RNA, such as ISOGEN (Nippon Gene) or TRI Reagent (trademark) (Molecular Research Center, Inc.), may be used as the storage reagent.

[0044] (3) Hair sample collection kit The hair sample collection kit may include, for example, the storage reagent described in 2.(2) above and a collection product for collecting the hair sample. Examples of collection products include tweezers (tweezers), depilatory tape, and depilatory wax. The collection kit may further include a phenol reagent, a chloroform reagent (including isoamyl alcohol), and a mixture thereof for extracting polynucleotides. It may also include a protease such as Proteinase K, ethanol or isopropyl alcohol, glycogen, and the like.

[0045] Furthermore, the collection kit may be accompanied by a sheet of paper containing an instruction manual for the kit, a URL, a QR code (trademark), etc. for accessing the instruction manual for the kit via the Internet. 3. RNA expression analysis method The present embodiment relates to a method for analyzing RNA.

[0046] 3-1. Obtaining RNA measurements The polynucleotide sample containing the RNA prepared in the above 2. can be used for RNA expression analysis. The RNA to be the subject of expression analysis is called the "RNA of interest."

[0047] RNA expression analysis can be carried out according to a known method. RNA expression analysis method is preferably capable of quantitatively evaluating expression level. For example, the quantitative evaluation method of RNA expression level can include real-time RT-PCR, microarray, digital PCR, RNA-Seq, etc.

[0048] Quantification by real-time RT-PCR is first performed by performing a reverse transcription reaction using RNA extracted from a hair sample as a template to obtain cDNA. The obtained cDNA can be used as a template and analyzed by real-time PCR or the like using primers specific to the target RNA. The expression level of the RNA of interest by real-time RT-PCR may be expressed as a threshold cycle (Ct) value, ΔCt value, or the like. The Ct value is the number of cycles at which the PCR amplification product reaches a certain amount. The ΔCt value is the difference between the Ct value of the RNA of interest and the Ct value of a housekeeping gene described below.

[0049] In microarray analysis, RNA extracted from a hair sample is used as a template to carry out a reverse transcription reaction, and the resulting cDNA is tagged with primer sites to prepare template DNA. The tagged cDNA is amplified while being fluorescently labeled, and the fluorescently labeled amplified product is hybridized to a probe on a microarray. RNA can be quantified by measuring the fluorescence intensity on the microarray.

[0050] In RNA-Seq, RNA extracted from a hair sample is fragmented, and then the fragments are used as a template to synthesize cDNA by reverse transcription and create a library. The base sequence of the fragments contained in each library is determined by a next-generation sequencer, and the information is mapped to a known reference genome sequence registered in the National Center for Biotechnology Information (NCBI) or the like, and the number of reads of each gene obtained by sequencing is expressed as RPKM (Reads Per Killobases per Million). RPKM may be expressed as the intensity of a signal such as a heat map. Examples of next-generation sequencers include MiSeq (trademark), HiSeq (trademark), NextSeq (trademark), MiniSeq (trademark), and NovaSeq (trademark) from Illumina (San Diego, CA); Ion Proton (trademark), Ion PGM (trademark) from Thermo Fisher (Waltham, MA); and GS FLX + (trademark), GS Junior (trademark) from Roche (Basel, Switzerland).

[0051] A value reflecting the expression level of RNA obtained by real-time RT-PCR, microarray, RNA-Seq, etc. is also referred to as an "RNA measurement value." The RNA measurement value may be expressed as the copy number (absolute amount) of the RNA of interest present in a certain amount of sample. The RNA measurement value may also be a value reflecting the relative expression level to the expression levels of housekeeping genes such as β2-microglobulin mRNA, GAPDH mRNA, Maea mRNA, and β-actin mRNA. Alternatively, the RNA measurement value may be expressed as the intensity of a signal such as fluorescence or luminescence.

[0052] The measured value of the RNA of interest may also be expressed as a relative value of the expression level of the RNA obtained from a subject hair sample relative to the expression level of the RNA of interest obtained from a positive control or negative control hair sample, for example.

[0053] Positive controls can include, for example, individuals exposed to the test agent, individuals with a disease, etc. Negative controls can include individuals not exposed to the test agent, individuals without a disease (e.g., healthy individuals). In this case, it is preferable that the positive or negative control hair sample and the subject's hair sample are collected from the same site. This is because the hair sample This is because the amount of RNA expressed may vary depending on the collection site.

[0054] Also, a positive control hair sample and a negative control hair sample may be collected from one individual. For example, in the left and right regions of the back of one individual sandwiching the sagittal plane, one region may be exposed to the test agent to collect a positive control hair sample, and a negative control hair sample not exposed to the test agent may be collected from the body side of the site exposed to the test agent. This combination may be, for example, the back region and abdominal region sandwiching the coronal plane, and the upper and lower regions sandwiching the transverse plane, instead of the sagittal plane. Furthermore, this is because the expression level of RNA may change depending on the site where the hair sample is collected.

[0055] 3-2.Evaluation of the effect of test factors on subjects using RNA measurements The measured value of RNA obtained from a hair sample collected from an individual exposed to a test agent can be used to evaluate the safety or usefulness of the test agent. In this case, the measured value of RNA used is the measured value of RNA expressed from a gene that serves as an indicator of a symptom of a skin disease in a subject caused by the test agent, or an indicator of a skin disease. The genes that serve as indicators of evaluation are as described in 1 above.

[0056] In a safety test, generally, a subject having at least normal skin is exposed to a test agent, and if, for example, a symptom of a skin disease or a measured value of an RNA of interest that is an index of an evaluation showing a skin disease changes depending on the contact between the subject and the test agent, it can be determined that the test agent is unsafe for the subject.

[0057] Whether the measurement of an RNA of interest is altered in a subject hair sample exposed to a test agent can be determined, for example, by comparing the measurement of the RNA of interest from the subject hair sample to a reference value for the measurement of the same RNA as the RNA of interest.

[0058] For example, in the case of an RNA whose expression increases when exposed to a test factor or is disease-dependent, and the measured value of the RNA derived from a negative control hair sample is used as a reference value, if the measured value of the RNA of interest derived from a subject hair sample becomes higher than the reference value, it can be determined that the measured value of the RNA of interest has fluctuated.

[0059] For example, in the case of an RNA whose expression increases when exposed to a test factor or is disease-dependent, and the measured value of the RNA derived from a positive control hair sample is used as the reference value, it can be determined that the measured value of the RNA of interest derived from the subject's hair sample has fluctuated if the measured value approaches the reference value or is higher than the reference value.

[0060] For example, in the case of an RNA whose expression decreases when exposed to a test factor or due to a disease, when the measured value of the RNA derived from a negative control hair sample is used as a reference value, if the measured value of the RNA of interest derived from a subject hair sample becomes lower than the reference value, it can be determined that the measured value of the RNA of interest has fluctuated.

[0061] For example, in the case of an RNA whose expression decreases when exposed to a test factor or due to a disease, if the measured value of the RNA derived from a positive control hair sample is used as the reference value, it can be determined that the measured value of the RNA of interest derived from the subject's hair sample has fluctuated if it approaches the reference value or is lower than the reference value. Alternatively, the reference value may be a measurement of the RNA of interest from a hair sample taken from the subject prior to exposure to the test agent, as opposed to a positive or negative control.

[0062] When conducting a utility study, typically individuals with symptoms of or a skin disorder are subjected to A subject is exposed to a test agent. Then, for example, if a measurement value of an RNA of interest that is an indicator of a symptom of a skin disease or an evaluation showing a skin disease improves depending on contact between the subject and the test agent, it can be determined that the test agent suggests that the test agent is useful for treating a symptom of a skin disease or a skin disease that the subject has.

[0063] Whether the measurement of an RNA of interest is improved in a hair sample from a subject exposed to a test agent can be determined, for example, by comparing the measurement of the RNA of interest from a hair sample from the subject to a reference value for the measurement of the same RNA as the RNA of interest.

[0064] For example, in the case of an RNA whose expression increases when exposed to a test factor or is disease-dependent, and the measured value of the RNA derived from a negative control hair sample is used as the reference value, it can be determined that the measured value of the RNA of interest derived from the subject's hair sample has improved if the measured value approaches the reference value or is lower than the reference value.

[0065] For example, in the case of an RNA whose expression increases when exposed to a test factor or is disease-dependent, and the measured value of the RNA derived from a positive control hair sample is used as a reference value, if the measured value of the RNA of interest derived from a subject hair sample becomes lower than the reference value, it can be determined that the measured value of the RNA of interest has improved.

[0066] For example, in the case of an RNA whose expression decreases when exposed to a test factor or is disease-dependent, and the measured value of the RNA derived from a negative control hair sample is used as the reference value, it can be determined that the measured value of the RNA of interest derived from the subject's hair sample has improved if the measured value approaches the reference value or is higher than the reference value.

[0067] For example, in the case of an RNA whose expression decreases when exposed to a test factor or due to a disease, when the measured value of the RNA derived from a positive control hair sample is used as a reference value, if the measured value of the RNA of interest derived from a subject hair sample becomes higher than the reference value, it can be determined that the measured value of the RNA of interest has improved.

[0068] The reference value may be a measurement value of the RNA of interest derived from a hair sample taken from the same subject before exposure to the test agent instead of a negative control. Furthermore, when the same subject has both sites exposed to the test agent and sites not exposed to the test agent, the reference value may be a measurement value of the RNA of interest derived from a hair sample taken from a site not exposed to the test agent instead of a negative control.

[0069] The reference value may be a measurement value of the RNA of interest derived from a hair sample taken from the same subject after exposure to the test agent instead of a positive control.Furthermore, when the same subject has both sites exposed to the test agent and sites not exposed to the test agent, the reference value may be a measurement value of the RNA of interest derived from a hair sample taken from the site exposed to the test agent instead of a positive control.

[0070] Furthermore, the reference value may be the mean value, mode, median, minimum value, maximum value, first quartile, third quartile, etc. of the positive control group or the negative control group. The reference value may be a value that can most accurately distinguish between the positive control group and the negative control group. The value that can most accurately distinguish between the positive control group and the negative control group may be determined based on, for example, sensitivity, specificity, positive predictive value, negative predictive value, etc.

[0071] Here, higher than the reference value means that the measured value of the RNA of interest derived from a subject's hair sample is, for example, 115% or more, preferably 130% or more, and more preferably 150% or more of the reference value.

[0072] Furthermore, "lower than the reference value" refers to a case where the measured value of the RNA of interest derived from a subject's hair sample is, for example, less than 85%, preferably less than 70%, and more preferably less than 50% of the reference value. Approaching the reference value refers to, for example, a case where the measured value of the RNA of interest derived from a subject's hair sample is within a range of 85% or more and less than 115% of the reference value. 4. DNA analysis methods The present embodiment relates to a method for analyzing DNA.

[0073] 4-1. Obtaining DNA measurements The polynucleotide sample containing the DNA prepared in 2 above can be used for at least one of DNA mutation analysis, copy number analysis, and DNA methylation analysis.

[0074] DNA mutation analysis, copy number analysis, or DNA methylation analysis can be carried out according to known methods.

[0075] (1) DNA mutation analysis An example of a method for analyzing DNA mutations is DNA sequencing. In DNA sequencing, for example, DNA extracted from a subject's body hair sample is first fragmented, and a DNA library tagged with primer sites and the like is prepared. This library is amplified by PCR or the like and subjected to sequencing. Sequencing can be performed, for example, using a next-generation sequencer. The nucleotide sequence of the obtained subject's DNA is mapped to a known reference genome sequence, the average mitochondrial sequence of Japanese people AF346990, and the presence or absence of mutations, the number of mutations, and the mutation sites can be detected. The next-generation sequencer is as exemplified in 3-1 above. DNA mutation analysis may be performed on the entire DNA contained in a polynucleotide sample, or may be performed on only the region of a specific gene locus such as a specific gene or microsatellite, by amplifying the region.

[0076] (2) Copy number analysis of gene loci Methods for analyzing the copy number of gene loci include real-time PCR, microarrays, and DNA sequencing.

[0077] Quantification of the copy number of a gene locus by real-time PCR can be performed by analyzing the gene locus of interest using a primer specific to the gene locus of interest, using DNA contained in a polynucleotide sample as a template, by real-time PCR, etc. The copy number of DNA may be expressed as a Ct value, a ΔCt value, etc.

[0078] To quantify the copy number of gene loci using a microarray, first prepare template DNA by tagging DNA extracted from a body hair sample with primer sites, etc. The tagged DNA is amplified while being fluorescently labeled, and the fluorescently labeled amplified product is hybridized to the probes on the microarray. The DNA can be quantified by measuring the fluorescence intensity on the microarray.

[0079] To quantify the copy number of a gene locus by DNA sequencing, first synthesize DNA extracted from a hair sample and create a library. The nucleotide sequence of the fragments contained in each library is determined using a next-generation sequencer, and the information is compared with the known reference genome sequence. The number of reads for each gene locus is expressed as RPKM. RPKM may also be expressed as the intensity of a signal, such as a heat map.

[0080] The copy number analysis of the locus may be performed on the entire DNA contained in the polynucleotide sample, or a specific locus region may be amplified and only the region may be analyzed. The copy number analysis of the locus may be performed on genomic DNA, or on mitochondrial DNA. In particular, it has been reported that the copy number of mitochondrial DNA correlates with the condition of the skin. The copy number of mitochondrial DNA can be calculated from the Ct values ​​of the ND1 gene, SLCO2B1 gene, ND5 gene, and SERPINA1 gene in the entire DNA contained in the polynucleotide sample using a program such as https: / / www.takara-bio.co.jp / research / r / mtdna_monitoring_tool / .

[0081] (3) DNA methylation analysis Examples of methods for analyzing DNA methylation include a method in which DNA contained in a polynucleotide sample is treated with bisulfite to convert unmethylated cytosine to uracil, and then the nucleotide sequence of a specific locus is analyzed by PCR, real-time PCR, or sequencing. Alternatively, methylation can be detected by cleaving a methylated site in DNA contained in a polynucleotide sample with a methylation-sensitive restriction enzyme, and then determining whether or not the region of the specific locus has been cleaved by PCR or real-time PCR.

[0082] (4) Measurement value of the DNA of interest The values ​​representing the number of mutations obtained by DNA mutation analysis, the values ​​representing the copy number of gene loci obtained by copy number analysis, and the values ​​representing the degree of methylation obtained by DNA methylation analysis are collectively called "DNA measurements." The specific gene locus being analyzed is also called the "locus of interest."

[0083] The measured value of the DNA of interest may be expressed relative to the measured value of the DNA of interest obtained from a subject hair sample, for example, relative to the measured value of the DNA of interest obtained from a positive control or negative control hair sample.

[0084] Positive controls can include, for example, individuals exposed to the test factor, individuals with a disease, etc. Negative controls can include individuals not exposed to the test factor, and individuals without a disease (e.g., healthy individuals). In this case, it is preferable that the positive or negative control hair sample and the subject's hair sample are collected from the same site. This is because the RNA expression level may change depending on the site where the hair sample is collected. This is because the manner in which DNA mutations occur, the copy number, and the degree of methylation may change depending on the site where the hair sample is collected.

[0085] Also, a positive control hair sample and a negative control hair sample may be collected from one individual. For example, in the left and right regions of the back of one individual sandwiching the sagittal plane, one region may be exposed to the test agent to collect a positive control hair sample, and a negative control hair sample not exposed to the test agent may be collected from the body side of the site exposed to the test agent. This combination may be, for example, the back region and abdominal region sandwiching the coronal plane, and the upper and lower regions sandwiching the transverse plane, instead of the sagittal plane. Furthermore, this is because the expression level of RNA may change depending on the site where the hair sample is collected. 4-2. Evaluation of the effect of test factors on subjects using DNA measurements

[0086] Measurements of DNA obtained from hair samples taken from individuals exposed to a test agent may be used to evaluate the safety or usefulness of the test agent, where the DNA measurements used are indicative of symptoms of a skin disorder in the subject caused by the test agent, or indicative of a skin disorder. This is the measurement of DNA at the locus that serves as an index for evaluation. The genes that serve as indexes for evaluation are as described in 1. above.

[0087] In a safety test, generally, a subject having at least normal skin is exposed to a test agent, and if, for example, a symptom of a skin disease or a measured value of a DNA of interest that is an index of an evaluation showing a skin disease changes depending on the contact between the subject and the test agent, it can be determined that the test agent is unsafe for the subject.

[0088] Whether the measurement of the DNA of interest is altered in a hair sample from a subject exposed to a test agent can be determined, for example, by comparing the measurement of the DNA of interest from a hair sample from the subject to a reference value for the measurement of the same DNA as the DNA of interest.

[0089] For example, in the case of DNA whose measured value increases when exposed to a test factor or due to a disease, when the measured value of DNA derived from a negative control hair sample is used as the reference value, if the measured value of the DNA of interest derived from the subject's hair sample becomes higher than the reference value, it can be determined that the measured value of the DNA of interest has changed.

[0090] For example, in the case of DNA whose measured value increases when exposed to a test factor or due to a disease, if the measured value of DNA derived from a positive control hair sample is used as the reference value, it can be determined that the measured value of the DNA of interest derived from the subject's hair sample has fluctuated if the measured value approaches the reference value or is higher than the reference value.

[0091] For example, in the case of DNA whose measured value decreases when exposed to a test factor or due to a disease, when the measured value of DNA derived from a negative control hair sample is used as the reference value, if the measured value of the DNA of interest derived from the subject's hair sample becomes lower than the reference value, it can be determined that the measured value of the DNA of interest has fluctuated.

[0092] For example, in the case of DNA whose measured value decreases when exposed to a test factor or due to a disease, if the measured value of DNA derived from a positive control hair sample is used as the reference value, it can be determined that the measured value of the DNA of interest derived from the subject's hair sample has fluctuated if it approaches the reference value or becomes lower than the reference value. Alternatively, the reference value may be a measurement of the DNA of interest from a hair sample taken from the subject prior to exposure to the test agent, as opposed to a positive or negative control.

[0093] In the case of carrying out a usefulness test, generally, an individual having a symptom of a skin disease or a skin disease is used as a subject and exposed to a test factor. Then, for example, if the measured value of the DNA of interest, which is an index of the evaluation of the symptom of a skin disease or a skin disease, improves depending on the contact between the subject and the test factor, it can be determined that the test factor is useful for the symptom of a skin disease or a skin disease that the subject has.

[0094] Whether the measurement of the DNA of interest in a hair sample from a subject exposed to a test agent is improved can be determined, for example, by comparing the measurement of the DNA of interest from a hair sample from the subject to a reference value for the measurement of the same DNA as the DNA of interest.

[0095] For example, in the case of DNA whose measured value increases when exposed to a test factor or due to a disease, and the measured value of DNA derived from a negative control hair sample is used as the reference value, it can be determined that the measured value of the DNA of interest derived from the subject's hair sample has improved if the measured value approaches the reference value or is lower than the reference value.

[0096] For example, DNA measurements may increase when exposed to a test agent or due to a disease. In the case of NA, when the measurement value of DNA derived from a positive control hair sample is used as the reference value, if the measurement value of the DNA of interest derived from the subject's hair sample becomes lower than the reference value, it can be determined that the measurement value of the DNA of interest has improved.

[0097] For example, in the case of DNA whose measured value decreases when exposed to a test factor or due to a disease, when the measured value of DNA derived from a negative control hair sample is used as the reference value, it can be determined that the measured value of the DNA of interest derived from the subject's hair sample has improved if the measured value of the DNA of interest approaches the reference value or is higher than the reference value.

[0098] For example, in the case of DNA whose measured value decreases when exposed to a test factor or due to a disease, when the measured value of DNA derived from a positive control hair sample is used as a reference value, if the measured value of the DNA of interest derived from the subject's hair sample becomes higher than the reference value, it can be determined that the measured value of the DNA of interest has improved.

[0099] The reference value may be a measurement value of the DNA of interest derived from a hair sample taken from the same subject before exposure to the test agent instead of a negative control.Furthermore, when the same subject has both sites exposed to the test agent and sites not exposed to the test agent, the reference value may be a measurement value of the RNA of interest derived from a hair sample taken from a site not exposed to the test agent instead of a negative control.

[0100] The reference value may be a measurement of the DNA of interest derived from a hair sample taken from the same subject after exposure to the test agent instead of a positive control.Furthermore, when the same subject has both sites exposed to the test agent and sites not exposed to the test agent, the reference value may be a measurement of the DNA of interest derived from a hair sample taken from the site exposed to the test agent instead of a positive control.

[0101] Furthermore, the reference value may be the mean value, mode, median, minimum value, maximum value, first quartile, third quartile, etc. of the positive control group or the negative control group. The reference value may be a value that can most accurately distinguish between the positive control group and the negative control group. The value that can most accurately distinguish between the positive control group and the negative control group may be determined based on, for example, sensitivity, specificity, positive predictive value, negative predictive value, etc.

[0102] Here, higher than the reference value means that the measured value of the DNA of interest derived from the subject's hair sample is, for example, 115% or more, preferably 130% or more, and more preferably 150% or more of the reference value.

[0103] Furthermore, "lower than the reference value" refers to a case where the measured value of the DNA of interest derived from the subject's hair sample is, for example, less than 85%, preferably less than 70%, and more preferably less than 50% of the reference value. Approaching the reference value refers to, for example, a case where the measured value of the DNA of interest derived from a subject's hair sample is in the range of 85% or more and less than 115% of the reference value.

[0104] 5. Evaluation of accumulation or reduction of skin damage caused by the test agent This embodiment relates to evaluating the accumulation or reduction of skin damage caused by a test agent in the same subject.

[0105] 5-1. Overview of evaluation of accumulation or reduction of skin damage The measured value of the polynucleotide can be used to evaluate whether damage has accumulated in the skin due to the test factor. The hair sample contains hair root cells, which may contain skin epithelial cells, glandular cells, glandular duct cells, hair papilla cells, and their stem cells. In general, the turnover of cells differentiated from stem cells such as skin epithelial cells is said to be about 6 weeks. In other words, epithelial cells that begin to mature from stem cells undergo differentiation and maturation over a period of about six weeks, and then die. However, this cycle can be affected by various environmental factors, physiological factors, and the like, which are exemplified as test factors. Furthermore, if stem cells are damaged by a test factor, the effects of this will persist beyond the turnover period of the skin epithelium.

[0106] This embodiment is a method for analyzing polynucleotides derived from hair root cells, and evaluates the extent to which skin damage caused by test factors such as environmental factors and physiological factors has accumulated or been reduced. The flow of this embodiment is shown in FIG.

[0107] Specifically, the method may include the steps of: acquiring, as subject information, analysis information of polynucleotides derived from periradicular cells collected from an area of ​​interest in skin tissue of a subject exposed to a test factor, analyzed using a polynucleotide sample prepared by the preparation method described in 2 above (step S1); acquiring reference information including a reference value corresponding to a measurement value of the polynucleotide included in the subject information (step S2); comparing the measurement value of the polynucleotide included in the subject information with the corresponding reference value; and evaluating the accumulated amount or reduced amount of skin damage caused by the test factor in the subject in the area of ​​interest in the skin of the subject (step S3). These steps may be performed by a human or a computer. When the above steps are performed by a computer, the method may include a step of outputting the results as step S4.

[0108] In step S1, a polynucleotide sample prepared by the preparation method described in 2 above is used to obtain an RNA measurement value or a DNA measurement value as a polynucleotide measurement value according to the methods described in 3 and 4 above. The polynucleotide measurement value is linked to, for example, information for identifying the subject from whom the measurement value was obtained and information such as the date of collection of the hair sample, to form polynucleotide analysis information. The information for identifying the subject may include an identifier and / or the name of each subject. The information for identifying the subject may also be linked to the biological species, sex, age, month, week, etc. of each subject. Furthermore, the information for identifying the subject may also be linked to the subject's underlying disease, etc.

[0109] The polynucleotide analysis information may be linked to information for identifying the test factor to which the subject was exposed. The information for identifying the test factor may be linked to the name and / or identifier of the test factor, the amount of exposure, the exposure period, etc. The polynucleotide analysis information may include the site where the sample was collected and the type of polynucleotide extracted.

[0110] The analysis information of one polynucleotide may be refined for each hair sample collected at one time point and stored in a database. FIG. 2 illustrates an example of a table of polynucleotide analysis information stored as a database. This table corresponds to the polynucleotide analysis information database DB1 described later. The first line of FIG. 2 shows an identifier (e.g., an identification ID) for identifying each polynucleotide analysis information. The identifier for identifying the polynucleotide analysis information is linked to the measurement value and / or sequence information of the polynucleotide contained in each polynucleotide analysis information. The second line shows the biological species of the subject from which each polynucleotide analysis information is derived. In FIG. 2, "human" is shown as the biological species. The third line shows the subject identifier (identification ID). The polynucleotide analysis information represented by the polynucleotide analysis information IDs "1" and "2" was collected from the same subject, so the subject ID is the same, "1". The polynucleotide analysis information represented by the polynucleotide analysis information IDs "3" and "4" was collected from the same subject, so the subject ID is the same, "2". The fourth line indicates the subject's name. The subject's name corresponds to the subject ID. If the subject is not human, the subject's name may be omitted. The first line indicates the gender of each subject. The sixth line indicates the age of each subject. The seventh line indicates the underlying disease of the subject. The subject with subject ID "1" has xeroderma pigmentosum as an underlying disease. The subject with subject ID "2" has no underlying disease. The eighth line indicates the site where the hair sample, etc. was taken. The ninth line indicates the date the sample was taken. The tenth line indicates the test factor to which the subject was exposed. The test factor is the factor to which the skin area of ​​interest was exposed. The eleventh line indicates the period during which the skin area of ​​interest was exposed to the test factor.

[0111] In this embodiment, the subject information refers to a hair sample obtained from an area of ​​interest exposed to a test agent, and refers to analytical information of polynucleotides obtained from the hair sample collected at the time of evaluation for the purpose of evaluating the accumulated amount or reduction of skin damage caused by the test agent.

[0112] In this embodiment, the reference information is analytical information of a polynucleotide that serves as a reference used to evaluate the accumulated amount or reduced amount of skin damage caused by a test factor based on the subject information. The analytical information of a polynucleotide used as the reference information may be obtained from a hair sample or from a sample other than body hair. Furthermore, the analytical information of a polynucleotide used as the reference information may be analytical information of a polynucleotide obtained from a reference sequence registered in a publicly known database. For example, when evaluating the accumulated amount or reduced amount of damage caused by a test factor to the skin at a certain time point, the reference information can be obtained from skin that is not exposed to the test factor or tissue other than the skin (e.g., oral mucosa, nasal mucosa, etc.). Furthermore, when evaluating the accumulated amount or reduced amount of damage caused by a test factor to the skin at a certain time point, a publicly known reference genome sequence registered in the National Center for Biotechnology Information (NCBI) or the like can be used as the reference information.

[0113] In addition, when evaluating the cumulative amount or reduction of damage caused by a test factor to the skin over time, the reference information can be obtained from a hair sample collected from the same region of interest of the same subject before collecting the hair sample from which the test information is obtained. For example, polynucleotide analysis information can be obtained from a hair sample collected from the same region of interest of the same individual as the individual from which the test information is obtained at least one time point selected from 1 week, 2 weeks, 4 weeks, 6 weeks, 3 months, 6 months, 1 year, 2 years, 3 years, 5 years, 8 years, 10 years, 15 years, and 20 years before collecting the hair sample from which the test information is obtained, and this can be used as the reference information. In the case where the individual is an animal from which adjacent lineage individuals can be obtained, such as a mouse, the same individual may be a group of individuals of the same lineage, or a different individual of the same lineage.

[0114] 5-2. Polynucleotide analysis device This embodiment relates to an analysis device 10 for implementing the polynucleotide analysis method described in the overview of 5-1 above. The hardware configuration and functional configuration of the analysis device 10 will be described below with reference to Figs.

[0115] (1) Hardware configuration 3 shows a hardware configuration of the analysis device 10. The analysis device 10 may be a general-purpose computer. The analysis device 10 is communicatively connected to an input device 111, an output device 112, and a media drive 113. The analysis device 10 can also communicate with a reference sequence database (reference sequence DB) 500 and a measurement device 30 via a network.

[0116] The analysis device 10 includes a CPU 101, a memory 102, a ROM (read only memory) 103, a storage device 104, a communication interface (I / F) 105, an input interface (I / F) 106, an output interface (I / F) 107, and a media interface (I / F) 108. 09, which allows data communication between them.

[0117] The storage device 104 is composed of a hard disk, a semiconductor memory element such as a flash memory, an optical disk, etc. An operating system (OS) 1041, an analysis program 1042 described below, and a polynucleotide analysis information database (DB) DB1 are stored in the storage device 104. The analysis program 1042 cooperates with the operating system 1041 to cause the computer to function as the analysis device 10. Examples of the operating system 1041 include Windows (trademark) and Linux (trademark). The CPU 101 is also called a processing unit 101 in this embodiment.

[0118] The polynucleotide analysis information database DB1 stores the polynucleotide analysis information obtained in 5-1 above. Each piece of information included in the polynucleotide analysis information other than the measurement value of the target polynucleotide may be input by an operator or may reflect information input at the time of requesting a test. The measurement value of the target polynucleotide may be input by the operator, or the CPU 101 may record the measurement value of the target polynucleotide in the polynucleotide analysis information database DB1.

[0119] The input device 111 is composed of a touch panel, a keyboard, a mouse, a pen tablet, a microphone, etc., and is used to input characters or voice to the analysis device 10. The input device 111 may be connected from outside the processing unit 10, or may be integrated with the analysis device 10. The output device 112 is composed of, for example, a display device such as a display, a printer, etc., and outputs various operation windows, analysis results, etc. The media drive 113 may be a USB drive, a flexible disk drive, a CD-ROM drive, a DVD-ROM drive, or the like. The reference sequence database 500 includes the various databases described in 1-1 above. The measuring device 30 is a terminal used by a client who requests an examination, and may be a general-purpose computer.

[0120] That is, the analysis device 10 can construct an analysis system 1000 connected to a reference sequence database 500 and a measurement device 30. The measurement device 30 can be a sequencer that performs sequence analysis, a real-time PCR device, or a PCR device.

[0121] (2) Functional configuration FIG. 4 shows the functional configuration of the analysis device 10. The analysis device 10 includes a measurement data acquisition means M1, a mapping means M2, a subject information acquisition means M3, a reference information acquisition means M4, a subject information acquisition / reference information comparison means M5, an evaluation means M6, and a result output means M7. The measurement data acquisition means M1 corresponds to step S11a, step S11b, step S11c, or step S11d described below. The mapping means corresponds to step S12a, step S12b, step S12c, or step S12d described below. The subject information acquisition means M3 corresponds to step S14a, step S14b, step S14c, or step S13d described below. The reference information acquisition means M4 corresponds to step S2 described below. The subject information acquisition / reference information comparison means M5 corresponds to step S31 described below. The evaluation means M6 corresponds to step S32, step S34, or step S35 described below. The evaluation result output means M7 corresponds to step S4 described later.

[0122] 5-3. Processing of analysis program 1042 The processing that the analysis program 1042 causes the CPU 101 to execute will be described with reference to FIG. 1 and FIG. 5 to FIG.

[0123] The CPU 101 accepts an input from an operator to start processing and starts the processing.

[0124] In step S1 of Fig. 1, the CPU 101 acquires, as subject information, analytical information of polynucleotides derived from periradicular cells collected from a region of interest in skin tissue of a subject exposed to a test factor, as described in 5-1 above. The process in step S1 will be described in more detail with reference to Figs. 5 to 8.

[0125] FIG. 5 shows the process of acquiring test information when the polynucleotide is RNA. The CPU 101 accepts a processing start request input by the operator from the input device 111, and acquires sequence information of the polynucleotide sample from the measurement device 30 in step S11a shown in FIG. 5. Next, the CPU 101 accepts a mapping start request input by the operator from the input device 111 in step S12a, maps the acquired sequence information to a known reference genome sequence stored in the reference sequence database 500, and acquires the number of reads of each RNA. Mapping can be performed using mapping software such as Bowtie2. Therefore, the mapping software such as Bowtie2 can constitute a part of the analysis program 1042. Next, the CPU 101 accepts a measurement value acquisition request input by the operator from the input device 111 in step S13a, and acquires the measurement value of the target RNA from the number of reads of the target RNA. The measurement value of the target RNA can be acquired using mapping software such as Bowtie2. Furthermore, CPU 101 accepts a measurement value recording request input by, for example, an operator from input device 111, and stores the measurement value of the target RNA acquired in step S12a in polynucleotide analytical information database DB1 in storage device 104 in association with analytical information of polynucleotides other than the measurement value of the target RNA. Then, in step S14a, CPU 101 accepts a subject information acquisition request input by the operator from input device 111, and acquires the subject information by calling up analytical information of the polynucleotide that is to be the subject information from polynucleotide analytical information database DB1 to memory 102. After step S14a shown in Fig. 5, CPU 101 proceeds to step S2 shown in Fig. 1.

[0126] FIG. 6 shows a process for acquiring subject information when the polynucleotide is DNA and the measured value of the DNA is a measured value based on mutation analysis. The CPU 101 receives a process start request input by the operator from the input device 111, and in step S11b shown in FIG. 6, acquires sequence information of a polynucleotide sample from the measuring device 30. Next, in step S12b, the CPU 101 receives a mapping start request input by the operator from the input device 111, maps the sequence information acquired in step S11b to a known Reference genome sequence stored in the reference sequence database 500, and acquires information on the locus corresponding to each sequence information. The mapping can be performed using mapping software such as Bowtie2 and BWA. Therefore, mapping software such as Bowtie2 and BWA can form a part of the analysis program 1042. Next, in step S13b, the CPU 101 receives a measured value acquisition request input by the operator from the input device 111, and acquires a measured value of the target DNA indicating which site of each target sequence information has a sequence different from the reference sequence. The acquisition of mutation information can be performed using, for example, GATK (Genome Analysis Toolkit; Broad Institute), Basic Local Alignment Search Tool (BLAST), etc. Also, for the analysis of mitochondrial DNA, mutation information can be acquired using Mitoseek, MtDNA-Server (Cloudgene), etc. Further, the CPU 101 receives, for example, a measured value recording request input by the operator from the input device 111, and stores the measured value of the target DNA acquired in step S12b in the polynucleotide analysis information database DB1 in the storage device 104 in association with the analysis information of polynucleotides other than the measured value of the target DNA Then, in step S14b, CPU 101 accepts a subject information acquisition request input by the operator from input device 111, and acquires the subject information by calling up the polynucleotide analytical information, which is the subject information, from polynucleotide analytical information database DB1 to memory 102. After step S14b shown in FIG. 5, CPU 101 proceeds to step S2 shown in FIG.

[0127] FIG. 7 shows the process of acquiring test information when the polynucleotide is DNA and the measured value of DNA is a copy number analysis. The CPU 101 accepts a request to start processing input by the operator from the input device 111, and acquires sequence information of the polynucleotide sample from the measurement device 30 in step S11c shown in FIG. 7. Next, the CPU 101 accepts a request to start mapping input by the operator from the input device 111 in step S12c, maps the acquired sequence information to a known Reference Genome sequence stored in the reference sequence database 500, and acquires the number of reads at each locus. Mapping can be performed using mapping software such as Bowtie2. Therefore, the mapping software such as Bowtie2 can constitute a part of the analysis program 1042. Next, the CPU 101 accepts a measurement acquisition request input by the operator from the input device 111 in step S13c, and acquires the measured value of the target DNA from the number of reads at the locus containing the target DNA. The measured value of the target DNA can be acquired using mapping software such as Bowtie2. Furthermore, CPU 101 accepts a measurement value recording request input by, for example, an operator from input device 111, and stores the measurement value of the target DNA acquired in step S12c in polynucleotide analytical information database DB1 in storage device 104 in association with analytical information of polynucleotides other than the measurement value of the target DNA. Then, in step S14c, CPU 101 accepts a subject information acquisition request input by the operator from input device 111, and acquires the subject information by calling up analytical information of the polynucleotide that is the subject information from polynucleotide analytical information database DB1 to memory 102. After step S14c shown in FIG. 7, CPU 101 proceeds to step S2 shown in FIG.

[0128] FIG. 8 shows a process for acquiring subject information when the polynucleotide is DNA and the measured value of DNA is a measured value based on methylation analysis. In step S11d shown in FIG. 8, CPU 101 accepts a request to start processing and input of methylation information of a target locus input by an operator from input device 111. Next, in step S12d, CPU 101 accepts, for example, a recording request input by an operator from input device 111, and stores the information acquired in step S11d in the polynucleotide analysis information database DB1 in storage device 104 in association with polynucleotide analysis information other than sequence information. Then, in step S13d, CPU 101 accepts a request to acquire subject information input by an operator from input device 111, and acquires subject information by calling up polynucleotide analysis information, which is the subject information, from polynucleotide analysis information database DB1 to memory 102. After step S13d shown in FIG. 8, CPU 101 proceeds to step S2 shown in FIG. 1.

[0129] Returning to Fig. 1, step S2 will be described. In step S2, reference information including a reference value corresponding to the measurement value of the polynucleotide included in each piece of test information is obtained. As described in 5-1 above, the reference information can be selected depending on whether the accumulated amount or reduced amount of damage caused by the test factor to the skin is evaluated at a single point in time or over time.

[0130] For example, when evaluating the accumulated amount or reduction amount of damage caused by a test agent to the skin at a single point in time, the polynucleotide analysis information shown in polynucleotide analysis information ID1 in FIG. 2 is the test information, and the reference information including the reference value corresponding to the measured value of RNA included in this test information is the polynucleotide obtained from a sample taken from a site not exposed to the test agent. This is the analytical information of the polynucleotide indicated by polynucleotide analytical information ID2, which is analytical information of the polynucleotide. In place of polynucleotide analytical information ID2, a publicly known reference genome sequence may be used as standard information.

[0131] For example, when evaluating the accumulation or reduction of damage caused to the skin by a test factor over time, in Figure 2, the polynucleotide analysis information indicated by polynucleotide analysis information ID3 becomes the subject information, and the reference information containing a reference value corresponding to the measurement value of the DNA contained in this subject information is the polynucleotide analysis information indicated by polynucleotide analysis information ID4 obtained from a hair sample taken from the same region of interest two years later.

[0132] In step S2, the CPU 101 receives a reference information acquisition request input by the operator from the input device 111, and acquires the reference information by calling up the polynucleotide analysis information serving as the reference information from the polynucleotide analysis information database DB1 or from the reference sequence database 500 into the memory 102. The reference information such as the reference genome sequence may be downloaded in advance from the reference sequence database 500 and stored in the storage device 104. After step S2 shown in FIG. 1, the CPU 101 proceeds to step S3.

[0133] In step S3, CPU 101 compares the measurement value of the polynucleotide contained in the subject information with the corresponding reference value, and evaluates the accumulation or reduction of skin damage caused by the test factor in the subject in the area of ​​interest of the subject's skin. The detailed process of step S3 is shown in FIG.

[0134] In step S31, CPU 101 accepts an evaluation processing request input by the operator from input device 111, and compares the measurement value of the polynucleotide contained in the subject information acquired in step S14a shown in Fig. 5, step S14b shown in Fig. 6, step S14c shown in Fig. 7, and step S13d shown in Fig. 9 with the corresponding reference value. Next, CPU 101 determines whether the measurement value of the polynucleotide contained in the subject information is within a reference range. The reference range refers to a range of 85% or more and less than 115% of the reference value included in the reference information acquired in step S2 shown in Fig. 1, for example.

[0135] If the measured value of the polynucleotide included in the subject information is within the reference range in step S31 (if "YES"), CPU 101 proceeds to step S32 and determines that there is no skin damage.

[0136] If the measured value of the polynucleotide included in the subject information is outside the reference range in step S31 (if "NO"), the CPU 101 proceeds to step S33. In step S33, the CPU 101 judges whether the measured value of the polynucleotide included in the subject information indicates "aggravation". The following patterns can be exemplified as "indicating aggravation". For example, when the polynucleotide is RNA and the gene is one whose RNA expression level increases with the accumulation of skin damage, it can be determined that the disease has worsened when the measured value of the RNA included in the subject information exceeds the reference range. For example, when the polynucleotide is RNA and the gene is one whose RNA expression level decreases with the accumulation of skin damage, it can be determined that the disease has worsened when the measured value of the RNA included in the subject information falls below the reference range. For example, when the polynucleotide is DNA and the gene locus is one whose DNA mutation number, copy number, and degree of methylation increase with the accumulation of skin damage, it can be determined that the disease has worsened when the measured value of the DNA included in the subject information exceeds the reference range. If the measured value of the polynucleotide included in the subject information does not indicate "worsening" in step S33 (if "NO"), the CPU 101 proceeds to step S34 and determines that the skin damage is reduced. In step S3, if the measured value of the polynucleotide contained in the subject information indicates "worsening" (if "YES"), the process proceeds to step S35, where it is determined that the skin damage is accumulating. Next, the CPU 101 proceeds to step S4 shown in FIG.

[0137] For example, using the example shown in FIG. 2, the subject indicated by subject ID1 has xeroderma pigmentosum as a basic disease. Since patients with xeroderma pigmentosum have extremely low ability to repair DNA damage caused by ultraviolet rays, which are the test factors, the DNA damage becomes DNA mutations, accumulates, and eventually develops skin cancer. Patients with xeroderma pigmentosum take care to avoid ultraviolet rays as much as possible even in normal life since birth, but it is difficult to evaluate whether the skin protection from ultraviolet rays is sufficient. Also, it is difficult to perform invasive evaluations frequently during childhood. The examination using body hair can easily collect samples even from children and can evaluate the accumulation of mutations. Therefore, this analysis method is useful also from this point of view.

[0138] In addition, matrix metalloproteinase-1, neutral endopeptidase, hyaluronidase-1, etc. have been reported to increase upon ultraviolet irradiation. The expression levels of these genes can also be used to evaluate the exposure amount of ultraviolet rays.

[0139] Also, it is known that mitochondrial DNA mutations increase with skin aging due to light. In other words, the accumulation of mitochondrial DNA mutations serves as a biomarker for skin age. As shown in the examples described later, when analyzing the number of mutations among mitochondrial DNA in a sample collected from the oral mucosa, mitochondrial DNA collected from the face of the same subject, and mitochondrial DNA collected from the arm of the same subject, the mitochondrial DNA derived from body hair samples collected from the face has more mutations than that from the oral cavity, and furthermore, the mitochondrial DNA derived from body hair samples collected from the arm has a tendency to have more mutations than that from the face. Although sunscreen, foundation, etc. block ultraviolet rays to some extent, the arm is considered to be easily exposed to life ultraviolet rays. From this, it is possible to evaluate skin age by this analysis method.

[0140] In addition, the skin age can also be evaluated based on the decrease in the expression levels of type I collagen, elastin, and hyaluronic acid synthase associated with aging. For example, when evaluating the skin age of a subject indicated by subject ID2, when the measured value of at least one RNA selected from type I collagen gene, elastin gene, and hyaluronic acid synthase gene contained in the polynucleotide analysis information indicated by polynucleotide analysis information ID3 is lower than the measured value of at least one RNA selected from type I collagen gene, elastin gene, and hyaluronic acid synthase gene contained in the polynucleotide analysis information indicated by polynucleotide analysis information ID3, the skin age can be evaluated as being increased.

[0141] 5-4. Recording medium storing analysis program 1042 The analysis program 1042 that performs the processes from step S1 to S4 may be stored in a recording medium. That is, the computer program is stored in a recording medium such as a hard disk, a semiconductor memory element such as a flash memory, an optical disk, etc. The computer program may also be stored in a recording medium that can be connected via a network such as a cloud server. The computer program may be a program product in a downloadable format or recorded on a recording medium.

[0142] The format of the program stored in the recording medium is not limited as long as the program can be read by the presentation device. It is preferable that the program is stored in the recording medium in a non-volatile manner. .

[0143] 5-5.Modifications (1) Between step S11a and step S12a, between step S11b and step S12b, or between step S11c and step S12c, the CPU 101 may perform pre-processing of the polynucleotide. The pre-processing of the polynucleotide includes trimming of the sequence length; conversion of the file format in which the sequence information is recorded; removal of adapter sequences and primer sequences derived from tags used when tagging library DNA or polynucleotide fragments, which are not originally contained in the polynucleotide sample; removal of removal sequences such as PCR duplicates caused by PCR errors in wet processing of the next-generation sequencer; removal of low-quality reads, etc. The trimming of the sequence length can be performed using, for example, trimming software SolexaQA. The file format conversion can be performed using software such as Samtools. For example, Samtools converts data in a sam file format output from BWA or the like into data in a bam file format. Data in a bam file format can be analyzed using GATK or the like, and PCR duplicates can be removed. The adapter sequence and the primer sequence can be removed using software such as fastx_clipper. Furthermore, the low-quality reads can be removed using, for example, FastQC. Therefore, these software programs can also constitute a part of the analysis program 1042.

[0144] (2) In the case of DNA mutation analysis, the Integrative Genomics Viewer (Broad Institute) or the like may be used for output processing of the evaluation results, and information on the mutation position of the polynucleotide contained in the subject information and information on the mutation position contained in the reference information may be displayed on one screen as shown in FIG. 10 or FIG. 12 described later. In this case, the analysis device 10 also functions as a presentation device. By displaying in this manner, the operator can easily understand whether the mutation detected in the DNA contained in the polynucleotide sample of the subject is the same mutation as the mutation in the DNA contained in the reference information, or a mutation at a different position. In addition, it is also easy to understand the change in the number of mutations. For example, the evaluation results including mutation position data can be generated in a vcf file format by GATK or the like, and the generated data can be input into the Integrative Genomics Viewer.

[0145] (3) In the above 5-1. and 5-4., the analysis process is performed in steps S1 to S4 shown in Fig. 1. However, step S3 does not necessarily have to be performed by CPU 101. In other words, steps S1, S2, and S4 may be performed by CPU 101, and a human may look at the results output by CPU 101 to output device 112, compare the measurement value included in the subject information corresponding to step S3 with a reference value, and evaluate the accumulated amount or reduction amount of damage caused by the test factor.

[0146] (4) In steps S11a to S13a, steps S11b to S13b, and steps S11c to S13c, an example has been shown in which an operator inputs a request to start processing of each step, and CPU 101 starts processing by accepting this input. However, instead of inputting each request by the operator, CPU 101 may start processing of the next step by using the end of the previous step as a trigger. (5) In this specification, the same reference numerals indicate the same parts and have the same functions. EXAMPLES

[0147] Hereinafter, the present invention will be described in more detail with reference to examples. However, the present invention is not limited to the examples.

[0148] The animal experiments in this example were carried out with the approval of the Nagahama Institute of Bio-Science and Technology's Experimental Facility Management Committee.

[0149] 1. Example 1 To verify the feasibility of DNA analysis using hair samples, hair samples taken from the skin were used. We then performed mutation analysis of the mitochondrial DNA.

[0150] <Sample preparation and next-generation sequencer analysis> Two subjects, one male in his 50s and one male in his 20s, had hair removal wax applied to the cheeks and upper arms of each subject's face, left to stand for about 10 seconds, and then peeled off to remove the vellus hair. Total DNA, including genomic DNA and mitochondrial DNA, was extracted from the wax sheet using a DNA extractor FM kit (Wako). As a control DNA sample, oral mucosa was scraped with a cotton swab and the oral Mucosal cells were collected and total DNA was extracted in the same manner.

[0151] A portion of the extracted DNA was used for PCR amplification using PrimeSTAR GXL DNA Polymerase (Takara).

[0152] Amplification was performed on the full-length sequence of human mitochondrial DNA using the following primer set: I did. Mitochondrial genome primer set I: AAAGCACACATACCAAGGCCAC (SEQ ID NO: 1) TTGGCTCTCCTTGCAAAGTTT (SEQ ID NO: 2) Mitochondrial genome primer set II: TATCCGCCATCCCATACATT (SEQ ID NO: 3) AATGTTGAGCCGTAGATGCC (SEQ ID NO: 4)

[0153] Amplification was performed by 30 cycles of two steps: 98°C for 10 seconds and 68°C for 600 seconds. The reaction solution after the reaction was applied to a 1.2% agarose gel and electrophoresed in TBE buffer. The size of the amplified DNA was confirmed. DNA samples for next-generation sequencer analysis were prepared by performing 20 cycles of the same amplification steps. The prepared DNA samples were made into libraries using the Illumina Nextra XT Library Prep kit, and the libraries were subjected to next-generation sequencer Illumina Miniseq for sequencing of the nucleotide sequences.

[0154] <Measurement data analysis> The sequence data obtained from the next-generation sequencer was trimmed using SolexaQA, and the trimmed sequence data was compared with the average Japanese population using the mapping software BWA. The sam file was generated using Picard and mapped to the target mitochondrial sequence, AF346990. The code is converted from a binary to a bam file, then converted to vcf (variant call format) and then imported into GATK. The detection and frequency measurement of SNPs were performed using the Integrative Genomics Viewer.

[0155] <Measurement results> In the mitochondrial DNA nucleotide sequence contained in the control DNA sample derived from oral mucosal cells collected from each subject, sequences different from AF346990 are congenital (individual) polymorphisms. In addition, the mutations that are different from AF346990 and are commonly found in the oral cavity, cheek, and upper arm of each subject are considered to be congenital polymorphisms, while the rest are considered to be acquired polymorphisms. The acquired polymorphisms are considered to be due to some factor. In the subjects in their 50s analyzed in this study, the oral mucosa cell-derived mitochondrial DNA was found in the gene locus NC_012920 of the reference sequence. There were no congenital polymorphisms in the nucleotide sequence of chondrial DNA. In the mitochondrial DNA from which it was derived, three sequences different from AF346990 were found. Mitochondrial DNA derived from the vellus hairs of the arm skin is different from AF346990 and is also found in the vellus hairs of the cheek. Four sequences were found that were different from the mitochondrial DNA from which the gene was derived. The results are shown in Figures 10 and 11. Figure 10 shows the positions of the mutations in the gene loci. In Figure 10, the gray bars indicate the positions of the mutations in the reference loci. The white bar indicates that the homoplasmy is 100% mutated. The positions of mutations from the reference sequence that are considered to be congenital, i.e., individual or ethnic gene polymorphisms, are shown. The black bars indicate positions of mutations that are likely to be acquired mutations due to heteroplasmy. Figure 11 shows the positions of mitochondrial DNA derived from the vellus hair of the cheek and the vellus hair of the upper arm. The results of another subject in his 20s are shown in Figures 12 and 13. In the subject in his 20s, there were four congenital polymorphisms in the nucleotide sequence of mitochondrial DNA derived from oral mucosa cells. Figure 13 shows the mutation sites where heteroplasmy was found in the detected sequence and the sequence depth of each sequence. In the mitochondrial DNA derived from the vellus hair of the cheek, in addition to the polymorphism present in the oral mucosa cells, four sequences different from AF346990 were found. Furthermore, in the mitochondrial DNA derived from the vellus hair of the upper arm skin, in addition to the one polymorphism present in the oral mucosa cells, 36 sequences different from AF346990 were found. There were relatively few mutations in the face, and a tendency for mutation accumulation in the skin of the arms to be progressing. This may be because the face is often protected by hats and sunscreen, but the arms are often exposed. Also, since men in their 20s were more sunburned than men in their 50s, it is thought that mutations had accumulated in the mitochondrial DNA derived from the downy hairs in the skin of the upper arms.

[0156] 2. Example 2 To confirm the feasibility of RNA analysis using hair samples, RNA samples were prepared from hair samples collected from the skin, and real-time PCR was performed using these RNA samples to analyze the expression of target genes.

[0157] <Sample preparation and real-time RT-PCR analysis> Three hairs each from the eyebrows and lower arms were collected and total RNA was extracted using the Nucleo Spin RNA XS kit. A portion of the extracted RNA was subjected to cDNA synthesis and PCR amplification using the SMART-Seq v4 Ultra Low Input RNA kit for Sequencing (Takara). cDNA was synthesized from the total RNA. After the reaction, the reverse transcription reaction solution was diluted 600-fold with ultrapure water, and this diluted solution was used for real-time analysis. The real-time PCR was performed using Thunderbird SYBR reagent, with the initial concentration at 94°C for 1 minute. After the amplification, 18 cycles of two-step amplification (94°C for 15 seconds, 60°C for 30 seconds) were performed. After the amplification, the amplification curve was confirmed, a melting curve was created, and quantification was performed based on the Ct value. The genes to be amplified were IL-1α, GAPDH, and β-actin.

[0158] <Measurement results> The analysis results are shown in Figure 14. Figure 14(A) shows the results of each gene when cDNA samples with different concentrations were used. The amplification curves of the vectors are shown. The amplification curves are distributed according to the concentration and reflect the amount of RNA expression. The melting curves of each amplified product are shown in Figure 14(B). The amplification curve has one peak at the set temperature, and the amplification curve is This indicates that the RNA sample extracted from the hair sample was amplified. It was thought that RNA expression could be evaluated using this method.

[0159] Figure 14(C) shows the relative expression level of IL-1α mRNA with the expression level of GAPDH as an internal standard. Figure 14(D) shows the relative expression level of β-actin mRNA with the expression level of GAPDH as an internal standard. The expression of α mRNA in the eyebrow hair was approximately 7 times higher than that in the pericilar cells of the arm. The expression level of α-terminal β-terminal ...

[0160] 3. Example 3 To confirm the feasibility of using hair samples to diagnose symptoms of skin diseases, RNA samples were prepared from hair samples taken from the skin of disease model mice, and real-time PCR was performed using these RNA samples to analyze the expression of biomarker genes.

[0161] <Creation of disease model mice, hair collection, and real-time RT-PCR analysis> The hair on the back of a C57 / BL6 mouse was cut short with a clipper. A psoriasis model was created by applying 100 mg of 2% Beserna cream to the affected area every day. The half of the body where the hair was not cut and Veselna Cream was not applied was designated the "non-application area." Before application, and one day, three days, and five days after application, five hairs were collected from each of the application and non-application areas. Total RNA was extracted from the hair samples using the Nucleo Spin RNA XS kit. As in Example 2 Real-time RT-PCR was performed to quantify the expression of IL-33, IL-23, IL-17, and TNF-α mRNA, as well as GAPDH mRNA.

[0162] <Measurement results> The results are shown in Figure 15. The relative expression levels of IL-33, IL-23, IL-17, and TNF-α were evaluated using GAPDH mRNA as an internal standard. Psoriasis developed at the application site of Veselna Cream. As psoriasis developed and symptoms progressed, the relative expression levels of IL-33, IL-23, IL-17, and TNF-α mRNA increased over time. This result was consistent with the severity of visual symptoms. IL-33 also increased the expression of IL-33 in skin tissue. It is a cytokine expressed in lymphocytes infiltrating into tissues, not in cells that constitute the immune system. IL-23 is a cytokine produced by antigen-presenting cells such as dendritic cells. IL-17 is a cytokine produced only by memory T cells and natural killer cells. Therefore, The fact that we were able to evaluate the expression of IL-33, IL-23, and IL-17 mRNA from hair samples indicates that hair samples It is shown that it reflects the activation state of inflammatory cells such as leukocytes infiltrated around the hair root.

[0163] 4. Example 4 The psoriasis model mice were changed to contact dermatitis model mice, an RNA sample was prepared from a hair sample collected from the skin of the disease model mice, and real-time PCR was performed to analyze the expression of biomarker genes.

[0164] <Production of disease model mice, collection of hair, and real-time RT-PCR analysis> The hair on the abdominal and dorsal half parts of C57 / BL6 mice was cut short with a clipper, and 100 μl of a 0.3% dinitrofluorobenzene (DNFB) solution was applied to the part where the hair on the abdomen or back was cut. Also, the half part where the hair was not cut and the DNFB solution was not applied was designated as the "non-applied part". For the abdomen, 5 hairs were collected from the applied part and the non-applied part 3 hours after application. For the back, 5 hairs were collected from the applied part and the non-applied part 6 days after application. Total RNA was extracted from each hair sample using the Nucleo Spin RNA XS kit . Real-time RT-PCR was performed in the same manner as in Example 2, and the expression of HMGB-1 mRNA, β-actin mRNA, and TNFα mRNA was quantified.

[0165] <Measurement results> Figure 16 shows the relative expression levels of each gene using β-actin mRNA as an internal standard. (A) in Figure 16 shows the expression of HMGB-1 mRNA 3 hours after application of the DNFB solution. (B) shows the expression of TNFα mRNA 6 days after application of the DNFB solution. An increase in the expression of TNFα mRNA was observed due to the application of DNFB. On the other hand, no change in the expression of HMGB-1 mRNA was observed due to the application of DNFB. <RNA-seq analysis measurement method and results>

[0166] After trimming the results of the next-generation sequencer, Mm10 mouse sequences were analyzed using Tophat2. The expression levels of each RNA were compared and analyzed using RPMK values. The protein that changed most with the induction of contact dermatitis was IL-1, and other proteins such as IL-33 were also significantly induced. It had been said.

[0167] 5. Example 5 To verify the feasibility of DNA analysis using hair samples, hair samples taken from the skin were used. The mitochondrial DNA and mitochondrial number were measured.

[0168] <Sample preparation and real-time PCR analysis> Five hairs were collected from the upper arm of the subject using tweezers. Total DNA, including genomic DNA and mitochondrial DNA, was extracted using FM (WAKO), and the obtained DNA was dissolved in TE buffer. One-hundredth of the obtained DNA solution was used as a sample for real-time PCR. Using the Human Mitochondrial DNA (mtDNA) Monitoring Primer Set, real-time PCR analysis of the ND1 gene, ND5 gene, SLCO2B1 gene, and SERPINA1 gene was performed to identify each gene. The Ct value of the gene was obtained. The number of mitochondria per cell was calculated from the obtained Ct value (https: / / www.takara-bio.co.jp / research / r / mtdna_monitoring_tool / , provided by Takara Shuzo Co., Ltd.).

[0169] <Measurement results> In real-time PCR, the Ct values ​​of the ND1 gene, ND5 gene, SLCO2B1 gene, and SERPINA1 gene were 22.99, 32.12, 22.51, and 31.94, respectively, and the mitochondrial copy number calculated from these values ​​was 625. This method allows us to calculate the mitochondrial copy number per cell from hair DNA. It was shown that: [Industrial Applicability]

[0170] The present invention can be used to assist in the diagnosis of skin diseases, search for candidate active ingredients for skin diseases, cosmetic analysis of skin, suitability testing for tailored cosmetics and medicines, analysis of skin aging, analysis of the safety and usefulness of administered substances, and symptom analysis of disease model mice, etc. [Explanation of symbols]

[0171] 10 Analysis device 101 Processing section

Claims

1. A method for preparing an RNA sample, comprising: preparing an RNA sample from a hair sample containing the subject's own cells attached to the hair root, the hair being collected by plucking hair attached to a hair papilla in an area of ​​interest on the skin surface of the subject, the method comprising: the subject is a mammal other than a human, the region of interest being the site on the skin surface to which the test agent is directly applied; The results of the RNA expression analysis are used to evaluate a sign of a skin disease or a skin disease in the subject caused by the test factor from the subject's own cells attached to the hair root. Methods for preparing RNA samples.

2. Preparing an RNA sample from a hair sample containing the subject's own cells attached to the hair root, the hair sample being collected by plucking the hair attached to the hair papilla in an area of ​​interest on the skin surface of the subject; A method for RNA expression analysis, comprising: performing RNA expression analysis in a subject's own cells attached to the hair root using the prepared RNA sample, the subject is a mammal other than a human, the region of interest being the site on the skin surface to which the test agent is directly applied; The RNA expression analysis method, wherein the results of the RNA expression analysis are used to evaluate signs of a skin disease or a skin disease in the subject caused by the test factor from the subject's own cells attached to the hair root.

Images