Method for producing cyanobacteria

The use of a gene transfer vector with extended homologous recombination regions addresses the limitations of conventional DNA introduction methods in cyanobacteria, enabling the efficient transfer of long DNA fragments and the production of improved cyanobacteria.

JP7695607B2Active Publication Date: 2025-06-19TOYOTA BOSHOKU KK
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
JP2021101410
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2021-06-18
Publication Date
2025-06-19
Estimated Expiration
2041-06-18

AI Technical Summary

Technical Problem

Conventional methods for introducing DNA into cyanobacteria are limited by the length of DNA that can be introduced, making it difficult to obtain useful cyanobacteria with improved properties.

Method used

A gene transfer vector is used that includes a first and second homologous recombination region, each 5 kbp or more in length, allowing for the introduction of a DNA fragment between these regions, thereby overcoming the length limitations of conventional methods.

Benefits of technology

This approach enables the efficient transfer of long DNA fragments into cyanobacteria, facilitating the production of useful cyanobacteria with enhanced properties in a shorter timeframe compared to existing methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007695607000001
    Figure 0007695607000001
  • Figure 0007695607000002
    Figure 0007695607000002
  • Figure 0007695607000003
    Figure 0007695607000003
Patent Text Reader

Abstract

To provide useful cyanobacteria.SOLUTION: Provided is a cyanobacterium transformed with a gene transfer vector 10. The gene transfer vector 10 has: a first homologous recombination region 11 homologous to the 5' side of a cyanobacterial target DNA; a second homologous recombination region 12 homologous to the 3' side of the target DNA; and a DNA fragment 25 introduced into a portion sandwiched between the first homologous recombination region 11 and the second homologous recombination region 12. The total length of the first homologous recombination region 11 and the second homologous recombination region 12 is 5 kbp or more. The cyanobacterium has a DNA fragment 25 transferred between the 5' side of the target DNA and the 3' side of the target DNA.SELECTED DRAWING: Figure 1
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present disclosure relates to cyanobacteria, a method for producing cyanobacteria, and a gene transfer vector.

Background Art

[0002] Patent Document 1 describes that, as a method for introducing a targeting vector into ES cells, a relatively long DNA fragment can be introduced by using the electroporation method. Patent Document 2 describes a transformation method using Agrobacterium as a method for gene recombination of plants. In this method, it is also described that a long DNA fragment can be introduced and the introduced gene is stably retained.

Prior Art Documents

Patent Documents

[0003]

Patent Document 1

Patent Document 2

Summary of the Invention

Problems to be Solved by the Invention

[0004] Cyanobacteria have advantageous properties as a medium (host) for the production of useful substances, such as fast growth and high photosynthetic ability. Therefore, improvement of cyanobacteria by gene recombination has been carried out. However, in the conventional methods, there is a limitation in the length of DNA that can be introduced into the genomic DNA of cyanobacteria, and there is a problem that it is difficult to obtain useful cyanobacteria.

[0005] The present disclosure has been made in view of the above circumstances, and an object thereof is to provide useful cyanobacteria. Another object is to provide a method for producing useful cyanobacteria and a gene transfer vector used for obtaining useful cyanobacteria. The present disclosure can be realized in the following forms.

Means for Solving the Problems

[0006] 〔1〕Cyanobacteria transformed using a gene transfer vector, wherein the gene transfer vector has a first homologous recombination region homologous to the 5'-side of the target DNA of cyanobacteria, a second homologous recombination region homologous to the 3'-side of the target DNA, and a DNA fragment introduced into a portion sandwiched between the first homologous recombination region and the second homologous recombination region, the total length of the first homologous recombination region and the second homologous recombination region is 5 kbp or more, and the DNA fragment is inserted between the 5'-side and the 3'-side of the target DNA, and the cyanobacteria.

Effects of the Invention

[0007] According to the present disclosure, useful cyanobacteria can be provided. In addition, a method for producing useful cyanobacteria and a gene transfer vector used for obtaining useful cyanobacteria can be provided.

Brief Description of the Drawings

[0008]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Embodiments for Carrying Out the Invention

[0009] Here, desirable examples of the present disclosure are shown. 〔2〕The cyanobacterium, wherein the insertion site of the DNA fragment in the target DNA is a site where the 3'-untranslated regions of adjacent endogenous genes face each other.

[0010] 〔3〕The cyanobacterium, wherein the insertion site of the DNA fragment in the target DNA is a site where the 3'-untranslated regions of the slr1716 gene and the sll1609 gene in the Synechocystis sp. PCC 6803 strain of cyanobacterium face each other.

[0011] 〔4〕The cyanobacterium, wherein the insertion site of the DNA fragment in the target DNA is a site where the 3'-untranslated regions of the slr1966 gene and the sll1893 gene in the Synechocystis sp. PCC 6803 strain of cyanobacterium face each other.

[0012] 〔5〕The cyanobacterium, wherein the DNA fragment is 5 kbp or more.

[0013] 〔6〕A method for producing a cyanobacterium, comprising a step of transforming using a gene transfer vector, wherein the gene transfer vector is A first homologous recombination region homologous to the 5' side of the target DNA of cyanobacteria, a second homologous recombination region homologous to the 3' side of the target DNA, and a DNA fragment introduced into a portion sandwiched between the first homologous recombination region and the second homologous recombination region, and having, The total length of the first homologous recombination region and the second homologous recombination region is 5 kbp or more, In the step of transformation, the method for producing cyanobacteria, wherein the DNA fragment is transferred between the 5' side and the 3' side of the target DNA.

[0014] 〔7〕The method for producing cyanobacteria, wherein the transfer site of the DNA fragment in the target DNA is a site where the 3' untranslated regions of adjacent endogenous genes face each other.

[0015] 〔8〕The method for producing cyanobacteria, wherein the transfer site of the DNA fragment in the target DNA is a site where the 3' untranslated regions of the slr1716 gene and the sll1609 gene in the cyanobacterium Synechocystis sp. PCC 6803 strain face each other.

[0016] 〔9〕The method for producing cyanobacteria, wherein the transfer site of the DNA fragment in the target DNA is a site where the 3' untranslated regions of the slr1966 gene and the sll1893 gene in the cyanobacterium Synechocystis sp. PCC 6803 strain face each other.

[0017] 〔10〕The method for producing cyanobacteria, wherein the DNA fragment is 5 kbp or more.

[0018] 〔11〕A gene transfer vector used for cyanobacteria, A first homologous recombination region homologous to the 5' side of the target DNA of cyanobacteria, and a second homologous recombination region homologous to the 3' side of the target DNA, and having, A gene transfer vector in which the total length of the first homologous recombination region and the second homologous recombination region is 5 kbp or more.

[0019] 〔12〕A gene transfer vector having a selection marker region in a portion sandwiched between the first homologous recombination region and the second homologous recombination region.

[0020] 〔13〕A gene transfer vector having a multiple cloning site for introducing a DNA fragment in a portion sandwiched between the first homologous recombination region and the second homologous recombination region.

[0021] 〔14〕A gene transfer vector that is a fosmid vector.

[0022] Hereinafter, the present disclosure will be described in detail. In this specification, in the description using "~" for a numerical range, unless otherwise specified, the lower limit value and the upper limit value are included. For example, in the description of "10~20", both the lower limit value "10" and the upper limit value "20" are included. That is, "10~20" has the same meaning as "10 or more and 20 or less".

[0023] 1. Cyanobacteria The cyanobacteria of this embodiment are cyanobacteria transformed using the gene transfer vector 10. The gene transfer vector 10 has a first homologous recombination region 11 homologous to the 5' side of the target DNA of cyanobacteria, a second homologous recombination region 12 homologous to the 3' side of the target DNA, and a DNA fragment 25 introduced into a portion sandwiched between the first homologous recombination region 11 and the second homologous recombination region 12. The total length of the first homologous recombination region 11 and the second homologous recombination region 12 (hereinafter, also referred to as "the length of the homologous recombination regions 11, 12") is 5 kbp or more. In the cyanobacteria, the DNA fragment 25 is transferred between the 5' side and the 3' side of the target DNA.

[0024] The genus and strain of cyanobacteria to which the technology of the present disclosure is applied are not particularly limited. Since the genomic DNA of cyanobacteria has been well analyzed, it is preferably the cyanobacterial strain Synechocystis sp. PCC 6803. The names of genes and the like in the present disclosure are putative gene numbers assigned in the genome project achieved by Kazusa DNA Research Institute. Also, in the present disclosure, base sequences and the like are described based on the genomic data of cyanobacteria published in CyanoBase and KEGG (Kyoto Encyclopedia of Genes and Genomes).

[0025] (1) Gene transfer vector 10 FIG. 1 is a diagram conceptually showing the gene transfer vector 10 according to the present embodiment. In the gene transfer vector 10, a DNA fragment 25 is introduced into the portion sandwiched between the first homologous recombination region 11 and the second homologous recombination region 12. In the present disclosure, the "gene transfer vector" may be in a state where the DNA fragment 25 is introduced as shown in FIG. 1, or may be in a state before the DNA fragment 25 is introduced.

[0026] As shown in FIGS. 2 and 3, the gene transfer vector 10 preferably has a selection marker region 21 in the portion sandwiched between the first homologous recombination region 11 and the second homologous recombination region 12. The gene transfer vector 10 preferably has a multiple cloning site 23 for introducing the DNA fragment 25 in the portion sandwiched between the first homologous recombination region 11 and the second homologous recombination region 12. Hereinafter, each region will be described in order.

[0027] (1-1) The first homologous recombination region 11 and the second homologous recombination region 12 The first homologous recombination region 11 and the second homologous recombination region 12 mean a pair of DNA regions having homology to the target DNA in the genomic DNA of cyanobacteria. By crossing between the first homologous recombination region 11 and the second homologous recombination region 12 with the DNA regions having homology respectively, the DNA fragment 25 between the first homologous recombination region 11 and the second homologous recombination region 12 can be transferred into the genomic DNA. The base sequences of the homologous recombination regions 11, 12 are not particularly limited, but have a sequence identity high enough to be able to perform homologous recombination with the target DNA. The identity of the base sequence with the target DNA in the homologous recombination regions 11, 12 can be, for example, 60% or more, preferably 80% or more, more preferably 90% or more, still more preferably 95% or more, and particularly preferably 99% or more.

[0028] The lengths of the homologous recombination regions 11, 12 are 5 kbp or more, preferably 10 kbp or more, more preferably 20 kbp or more, still more preferably 25 kbp or more, and still more preferably 30 kbp or more. If the lengths of the homologous recombination regions 11, 12 are at or above the lower limit value, a relatively long (for example, 5 kbp or more) DNA fragment 25 can be efficiently introduced into the genomic DNA of cyanobacteria. The lengths of the homologous recombination regions 11, 12 are 60 kbp or less, preferably 50 kbp or less, more preferably 40 kbp or less. If the lengths of the homologous recombination regions 11, 12 are at or below the upper limit value, the number of restriction enzyme sites can be reduced, which is advantageous for genetic manipulation. That is, the restriction enzyme sites (cloning sites) for introducing the DNA fragment become easier to use. From these viewpoints, the lengths of the homologous recombination regions 11, 12 are preferably 5 kbp or more and 60 kbp or less, more preferably 10 kbp or more and 50 kbp or less, and even more preferably 25 kbp or more and 40 kbp or less.

[0029] The lengths of the first homologous recombination region 11 and the second homologous recombination region 12 may be the same length, or may be different lengths to the extent that homologous recombination is possible. From the perspective of recombination efficiency, the difference in the lengths of the first homologous recombination region 11 and the second homologous recombination region 12 can be 12 kbp or less, 8 kbp or less, 5 kbp or less, 3 kbp or less, 2 kbp or less. The length of the first homologous recombination region 11 is preferably 2.5 kbp or more and 30 kbp or less, more preferably 5 kbp or more and 25 kbp or less, and even more preferably 12 kbp or more and 22 kbp or less. The length of the second homologous recombination region 12 is preferably 2.5 kbp or more and 30 kbp or less, more preferably 5 kbp or more and 25 kbp or less, and even more preferably 12 kbp or more and 22 kbp or less.

[0030] The insertion site of the DNA fragment 25 in the target DNA is preferably a site where the 3'-untranslated regions of adjacent endogenous genes face each other. If the insertion site of the DNA fragment 25 is located in the untranslated region, the DNA fragment 25 can be inserted without damaging the genes on the genomic DNA of cyanobacteria. Also, if the insertion site of the DNA fragment 25 is a site where the 3'-untranslated regions of adjacent endogenous genes face each other, it is difficult to damage the transcriptional regulatory sites etc. present in the 5'-untranslated region of the endogenous gene, which is preferable.

[0031] Figures 2 and 3 show examples of the insertion sites of DNA fragments in the cyanobacterium Synechocystis sp. PCC 6803 strain. In the gene transfer vector 10 shown in Figure 2, the insertion site TSY17 of the DNA fragment 25 in the target DNA is a site where the 3'-untranslated regions of the slr1716 gene and the sll1609 gene in the cyanobacterium Synechocystis sp. PCC 6803 strain face each other. In the gene transfer vector 10 shown in FIG. 3, the insertion site TSY21 of the DNA fragment 25 in the target DNA is a site where the 3'-untranslated regions of the slr1966 gene and the sll1893 gene in the cyanobacterium Synechocystis sp. PCC 6803 strain face each other.

[0032] Note that the site where the 3'-untranslated regions of adjacent endogenous genes face each other is not limited to the above site, and in the genomic DNA of cyanobacteria such as Synechocystis sp. PCC 6803 strain, it may be other sites where the 3'-untranslated regions of adjacent endogenous genes face each other. Also, the insertion site of the DNA fragment 25 in the target DNA is not limited to the site where the 3'-untranslated regions of adjacent endogenous genes face each other. For example, the insertion site of the DNA fragment in the target DNA may be a site where part or all of the gene showing a predetermined phenotype is deleted from the genomic DNA. In such a case, by observing the phenotype of cyanobacteria, the deletion of the gene can be confirmed and the success or failure of homologous recombination can be determined.

[0033] (1-2) Selection marker region 21 The selection marker region 21 is a site for selecting cyanobacteria in which homologous recombination has occurred. The selection marker region 21 is transferred into the genomic DNA of cyanobacteria together with the DNA fragment 25 and has a gene that functions as an indicator for selecting cyanobacteria into which the DNA fragment 25 has been transferred. Examples of such genes include drug resistance genes. Examples of drug resistance genes include various antibiotic resistance genes such as kanamycin resistance gene, chloramphenicol resistance gene, and hygromycin resistance gene. Note that the selection marker region 21 may be removed after the DNA fragment 25 has been transferred into the genomic DNA of cyanobacteria.

[0034] The selection marker region 21 preferably includes, together with the drug resistance gene, a transcriptional regulatory region of the drug resistance gene and a transcription termination site. According to such a configuration, the transcription of the drug resistance gene can suppress the influence on the genes existing on the homologous recombination regions 11 and 12 adjacent to the selection marker region 21 and the transcription of the foreign gene incorporated into the multiple cloning site 23. Further, the transcription of the genes existing on these homologous recombination regions 11 and 12 and the foreign gene can suppress the influence on the transcription of the drug resistance gene.

[0035] (1-3) Multiple cloning site 23 The multiple cloning site 23 has a restriction enzyme site for inserting the DNA fragment 25 between the first homologous recombination region 11 and the second homologous recombination region 12. According to such a configuration, it is easy to introduce the DNA fragment 25 into the gene transfer vector 10, which is preferable.

[0036] The multiple cloning site 23 may be composed of a known sequence having a plurality of restriction enzyme sites. In the gene transfer vector 10, the types of restriction enzymes that can be used for cloning are restricted depending on the sequences of other regions of the gene transfer vector 10. The gene transfer vector 10 of the present disclosure has longer homologous recombination regions 11 and 12 than conventional vectors, and the types of restriction enzymes that can be used for cloning are also limited. The gene transfer vector 10 having the multiple cloning site 23 can be obtained by appropriately designing the combination of the types and numbers of restriction enzymes included in the multiple cloning site 23 and the base sequence of the homologous recombination regions 11 and 12.

[0037] (1-4) DNA fragment 25 The DNA fragment 25 has, for example, any foreign gene intended to be transferred into cyanobacteria. Examples of such foreign genes include genes having a function of producing useful proteins, biofuels such as alcohols and oils, and substances as alternative raw materials for chemical products. Further, examples of the foreign gene also include genes for improving the production ability of useful substances by improving metabolic pathways and the like.

[0038] The length of the DNA fragment 25 is not particularly limited. Since the gene transfer vector 10 of the present disclosure has the property of being able to transfer a DNA fragment 25 of, for example, 5 kbp or more into the genomic DNA of cyanobacteria, it is suitable for the transfer of a long DNA fragment 25. The inventors of the present application have confirmed that a DNA fragment 25 of up to 35,586 bp can be transferred into the genomic DNA of cyanobacteria using pFOSSynTSY17Km(p), which is an example of the gene transfer vector 10. In the present disclosure, "being able to transfer a DNA fragment" means that, regardless of the recombination efficiency, a transformant into which the DNA fragment has been transferred can be obtained by genetic engineering techniques. The length of the DNA fragment 25 that can be transferred using the gene transfer vector 10 may be 8 kbp or more, 10 kbp or more, 15 kbp or more, 20 kbp or more, 25 kbp or more, 30 kbp or more, 35 kbp or more. The upper limit of the length of the DNA fragment 25 that can be transferred is not particularly limited, but may be 50 kbp or less, 40 kbp or less.

[0039] (1-5) Other regions The gene transfer vector 10 may have homologous recombination regions 11, 12, a selection marker region 21, a multiple cloning site 23, and other regions other than the DNA fragment 25. Examples of other regions include a region 27 for maintaining and replicating the gene transfer vector 10 in Escherichia coli or the like (see FIG. 1).

[0040] (1-6) Types of vectors The gene transfer vector 10 is preferably a fosmid vector. A fosmid vector is a cloning vector based on the F-plasmid of bacteria. Such a gene transfer vector 10 can be prepared using a known and available fosmid vector. Examples of such vectors include fosmid vectors such as pCC2FOS (trademark), pCC1FOS (trademark), etc. Note that the gene transfer vector 10 is not limited to a fosmid vector, and may be a cosmid vector, a viral vector, or the like.

[0041] The gene transfer vector 10 is preferably a fosmid vector that is present at one copy per Escherichia coli cell. If it is based on a plasmid or the like present at 10 to several hundred copies per Escherichia coli cell, the Escherichia coli will not grow, and the gene transfer vector 10 into which the DNA fragment 25 has been introduced cannot be sufficiently obtained. By using a fosmid vector with a low copy number, the gene transfer vector 10 into which the DNA fragment 25 has been introduced can be stably maintained in Escherichia coli. As a result, the gene transfer vector 10 into which the DNA fragment 25 has been introduced can be suitably obtained.

[0042] (2) Transformant The cyanobacterium of the present embodiment is a transformant transformed using the gene transfer vector 10. By using the gene transfer vector 10, a stable transformant in which the DNA fragment 25 has been integrated into the genomic DNA can be easily and efficiently produced. In addition, the cyanobacterium transformed using the gene transfer vector 10 has an advantageous feature that the total base length of regions unnecessary for the production of useful substances transferred into the genomic DNA (for example, a selection marker region, a region derived from a restriction enzyme site, etc.) is shorter than that of a cyanobacterium transformed multiple times using a vector that can introduce only DNA fragments less than 5 kbp. Furthermore, the cyanobacterium transformed using the gene transfer vector 10 has an advantageous feature that the risk of causing mutations in DNA other than the integration site is lower than that of a cyanobacterium transformed multiple times as described above. That is, the risk of mutations occurring in DNA that should not be damaged increases as the number of transformations increases, but the cyanobacterium of the present embodiment can be obtained with a small number of transformations, and DNA mutations are suppressed.

[0043] 2. Method for producing cyanobacterium The method for producing cyanobacteria according to this embodiment includes a step of transformation using a gene transfer vector. Specifically, the method for producing cyanobacteria is a method for obtaining a transformant of cyanobacteria using a gene transfer vector 10, which includes a step of constructing the gene transfer vector 10, introducing a DNA fragment 25 into the constructed gene transfer vector 10. Note that the above-described method can be performed according to, for example, the description below, and more specifically, according to the examples described below. The method for each operation is not particularly limited, and various known genetic engineering methods can be employed.

[0044] (1) Construction of gene transfer vector 10 The gene transfer vector 10 can be constructed according to the following operation procedures S1 to S5. [S1] Extraction and fragmentation of genomic DNA of cyanobacteria [S2] Cloning A DNA fragment of about 25 to 50 kb is recovered. The sequence of this DNA fragment serves as a candidate for the sequence of the homologous recombination region. Hereinafter, this DNA fragment is also referred to as a candidate DNA fragment. Each recovered candidate DNA fragment is inserted into a vector (for example, a fosmid vector) to prepare vectors (recombinant vectors) having various candidate DNA fragments. [S3] Preparation of Escherichia coli (transformant) Vectors having various candidate DNA fragments are introduced (packaged) into bacteriophages. The above-described bacteriophage is allowed to infect a host such as Escherichia coli to introduce the vector, and Escherichia coli (transformant) having a vector having various candidate DNA fragments is obtained. The transformant is grown on an agar medium and obtained as colonies. [S4] Selection of candidate DNA fragments Vectors are extracted from Escherichia coli. The nucleotide sequence of the candidate DNA fragment inserted into the vector is analyzed. The analyzed nucleotide sequence is compared with the nucleotide sequence of the genomic DNA of cyanobacteria, and a candidate DNA fragment having a restriction enzyme site that can be cleaved (digested) at one position is selected. [S5] Addition of Selection Marker Region 21 and Multiple Cloning Site 23 Add the selection marker region 21 and the multiple cloning site 23 to the restriction enzyme site in the candidate DNA fragment.

[0045] (2) Construction of the Gene Transfer Vector 10 into Which the DNA Fragment 25 is Introduced The introduction (ligation) of the DNA fragment 25 into the gene transfer vector 10 can be constructed according to the following operation procedures S6 - S8. [S6] Preparation of the DNA Fragment 25 Amplify the DNA fragment 25 having the foreign gene of interest by PCR or E. coli culture to prepare the DNA fragment 25. [S7] Preparation of the Vector DNA Cut the gene transfer vector 10 at the restriction enzyme site on the multiple cloning site 23 to obtain the vector DNA. [S8] Ligation of the DNA Fragment 25 and the Vector DNA Ligate the prepared DNA fragment 25 and the vector DNA to obtain the gene transfer vector 10 into which the DNA fragment 25 is introduced. For the ligation of the vector DNA and the DNA fragment 25, general ligation techniques (e.g., using enzyme ligase) or the In - Fusion system can be used.

[0046] (3) Obtaining a Transformant of Cyanobacteria The transformation of cyanobacteria can be obtained according to the following operation procedures S9 - S10. [S9] Preparation of Cyanobacteria (Transformant) Mix cyanobacteria (wild strain, non - transformant) with the above - mentioned gene transfer vector 10 to allow the gene transfer vector 10 to be taken up into the cells of cyanobacteria. The gene transfer vector taken up into the cells causes homologous recombination with the target DNA on the genomic DNA, and thereby the DNA fragment 25 is transferred between the 5' side and the 3' side of the target DNA (natural transformation). At this time, in order to improve the transformation efficiency, reagents such as EDTA may be used. [S10] Screening The transformant is grown on an agar medium and obtained as colonies. At this time, a transformant of cyanobacteria is selected using a selection marker.

[0047] 3. Effects of this embodiment According to the gene transfer vector 10 of this embodiment, a long DNA fragment (for example, 5 kbp or more) can be transferred into the genomic DNA of cyanobacteria by a single gene recombination. Therefore, the time required for improving cyanobacteria can be significantly shortened. In the literature "Scientific Reports, Vol. 8, Article number: 7380 (2018)", the following method has been reported as a method for transferring a DNA fragment of about 20 kbp into the genomic DNA of cyanobacteria. This method divides a DNA fragment of about 20 kbp into about 4 kbp and transfers it into the genomic DNA by performing gene recombination and selection marker removal operations five times. Selection marker removal uses a system called SacB to remove the antibiotic resistance gene from the genomic DNA. This method requires a long time to obtain a transformant of cyanobacteria into which the long DNA fragment 25 has been transferred. On the other hand, by using the gene transfer vector 10 of the present disclosure, a transformant of cyanobacteria into which the long DNA fragment 25 has been transferred can be obtained by a small number (for example, one time) of gene recombination operations. In addition, by using the gene transfer vector 10 of the present disclosure, the number of operations for removing the selection marker region 21 and the like can also be reduced. As a result, a transformant of the target cyanobacteria can be obtained in a short period of time.

[0048] The mechanism by which the long DNA fragment 25 can be transferred by using the gene transfer vector 10 of the present disclosure is not clear, but it is presumed as follows. Note that the present disclosure is not limitedly interpreted by this reason for presumption. Conventionally, it has not been easy to synthesize a vector having a long homologous recombination region. For this reason, the length of the homologous recombination region was insufficient, and a long DNA fragment could not be transferred into the genomic DNA of cyanobacteria. On the other hand, since the gene transfer vector 10 of the present disclosure has a homologous recombination region of 5 kbp or more, it is presumed that even a long DNA fragment 25 can be transferred into the genomic DNA of cyanobacteria.

Example

[0049] Hereinafter, the present invention will be described in more detail based on examples, but the present invention is not limited thereto.

[0050] 1. Construction of gene transfer vector The genomic DNA extracted from cyanobacterium Synechocystis sp. PCC 6803 was physically sheared. Specifically, the extracted genomic DNA solution was taken in and out 5 times with the above-mentioned thin pipette tip (manufactured by QSP), and blunt-ended with End-Repair Enzyme Mix (manufactured by Epicentre). Note that physical shearing may be performed by vortexing, ultrasonic treatment, or the like. The blunt-ended DNA fragments were sized by pulsed field electrophoresis, and DNA fragments with an average strand length of 25 to 40 kb were recovered. The recovered DNA fragments were purified with NucleoSpin gDNA Clean-up (MACHEREY-NAGEL GmbH & Co KG). Next, the purified DNA fragments were CopyControl having a chloramphenicol resistance gene TM pCC2FOS TMIt was ligated to the Eco72I site (between the 382nd C and the 383rd G, Figure 4) of the fosmid vector (manufactured by Epicentre). T4 DNA ligase (manufactured by TaKaRa) was used for ligation to the fosmid vector. The DNA ligated to this fosmid vector was in vitro packaged into phages using MaxPlaxTM Lambda Packaging Extracts (manufactured by Epicentre). This was infected into T1 phage-resistant Escherichia coli E. coli EPI-300T1R (manufactured by Epicentre) (hereinafter referred to as EPI300). Then, on an LB medium (LB / Cm) agar plate containing 12.5 μg / mL of chloramphenicol, about 2.0×10 5 transformed Escherichia coli (transformants) were obtained. Approximately 100 colonies were taken from the transformed Escherichia coli and cultured in 4 mL of LB medium (LB / Cm) containing 12.5 μg / mL of chloramphenicol in air at 37°C for 18 hours at 180 rpm each. Next, the cultured Escherichia coli was collected, and the fosmid DNA introduced into the Escherichia coli was extracted using Wizard Plus SV Minipreps DNA Purification Systems (manufactured by Promega). Next, the nucleotide sequence of the DNA derived from the cyanobacterium Synechocystis cloned into the extracted fosmid DNA was analyzed. The nucleotide sequence analysis was performed using the primers pCC2 forward-b and pCC2 reverse-b. The nucleotide sequences of the primers used are as follows. 192_pCC2 forward_b,CCAGTCACGACGTTGTAAAACG 194_pCC2 reverse_b,CGCCAAGCTATTTAGGTGAGAC

[0051] By aligning the analyzed nucleotide sequence with the nucleotide sequence of the genomic DNA of the cyanobacterium Synechocystis (using CyanoBase ([genome.microbedb.jp / cyanobase / ]) or KEGG, Kyoto Encyclopedia of Genes and Genomes ([http: / / www.genome.jp / kegg / ])), information on the entire nucleotide sequence (about 20 - 40 kbp) cloned into fosmid DNA was obtained. From among these nucleotide sequences, fosmids having a restriction enzyme site that can be cleaved (digested) at a position around the middle of the DNA fragment were selected. To this restriction enzyme site (in this example, the SmiI site), a cassette of the kanamycin resistance gene (SEQ ID NO: 5) and cloning sites (BamHI, NotI, EcoRV, SalI, Eco72I, MluI) (Figure 5) were added, and furthermore, a partial DNA fragment was added by PCR so as not to damage the genes originally possessed by the cyanobacterium Synechocystis. The synthesized DNA was designated pFOSSynTSY17Km(p) (an example of a gene transfer vector, Figure 2).

[0052] Note that the gene transfer site TSY17 when using pFOSSynTSY17Km(p) is a site where the slr1716 gene on the genomic DNA of the cyanobacterium Synechocystis and the 3'-untranslated regions of the sll1609 gene face each other. In pFOSSynTSY17Km(p), the length of the first homologous recombination region (SEQ ID NO: 1) was 18178 bp, and the length of the second homologous recombination region (SEQ ID NO: 2) was 19602 bp. The total length of these was 37.8 kbp.

[0053] When using pFOSSynTSY21Km(p) (another example of a gene transfer vector, Figure 3) obtained by a similar method, the gene transfer site TSY21 is a site where the 3'-untranslated regions of the slr1966 gene and the sll1893 gene on the genomic DNA of the cyanobacterium Synechocystis face each other. In pFOSSynTSY21Km(p), the length of the first homologous recombination region (SEQ ID NO: 3) was 24303 bp, and the length of the second homologous recombination region (SEQ ID NO: 4) was 13934 bp. The total length of these was 38.2 kbp.

[0054] 2. Construction of a gene transfer vector into which a DNA fragment was introduced pFOSSynTSY17Km(p) was digested (cut) with the restriction enzyme Eco72I and blunt-ended with End-Repair Enzyme Mix (manufactured by Epicentre) to obtain vector DNA. Next, using human genomic DNA (Human genomic DNA, manufactured by Promega) as template DNA, approximately 17.5 kbp of DNA (SEQ ID NO: 6) containing the human β-globin gene (hβG) was PCR-amplified using KOD-plus-neo polymerase (manufactured by TOYOBO). The nucleotide sequences of the primers used were as follows. 444_hGB17.5F-IFSE2, GATATCGTCGACCACTGCACCTGCTCTGTGATTATGACTATCC 445_hGB17.5R-IFAN2, TCTAGAACGCGTCACACATGATTAGCAAAAGGGCCTAGCTTG The obtained DNA fragment was used as insert DNA. The vector DNA and the insert DNA were ligated by In-Fusion (manufactured by TaKaRa) to synthesize pFOSSynTSY17Km(p)-hβG DNA into which a 17.5 kbp human β-globin gene (hβG) was introduced at the Eco72I site of pFOSSynTSY17Km(p).

[0055] 3. Transformation of the cyanobacterium Synechocystis The Synechocystis sp. PCC 6803 strain of cyanobacteria was used (hereinafter referred to as Synechocystis). The cultivation of Synechocystis was carried out using BG11 medium containing 20 mM TES-KOH (pH 7.5) as the basal medium, and continuous irradiation with white light (50 μmol of photon m -2 s -1 ) was performed while aerobically culturing with stirring at 25 °C on a rotary shaker. In the case of solid medium, a medium supplemented with 1.5% Agar (manufactured by Wako) was used. The cell turbidity of Synechocystis was evaluated by measuring the optical turbidity (OD730) using a spectrophotometer (Bio-Spec mini., manufactured by Shimadzu). 1 μg of pFOSSynTSY17Km(p)-hβG DNA was added to 40 μL of the culture solution of cyanobacteria Synechocystis (OD730 = 25) cells. The cells were statically cultured at 25 °C in the dark for 4 hours and then spread on BG11 agar medium containing 20 μg / ml of the antibiotic kanamycin. In the light (50 μmol of photon m -2 s -1 ) and cultured at 25 °C for 10 days to obtain a plurality of colonies showing kanamycin resistance.

[0056] 4. Confirmation of the introduced DNA in the transformant The obtained colonies were cultured in BG11 liquid medium containing kanamycin, and genomic DNA was extracted. It was confirmed by PCR and Southern blotting that the introduced DNA (β-globin gene, approximately 17.5 kbp) was inserted into the extracted genomic DNA. Figure 6 shows the constitution of the genomic DNA of cyanobacteria Synechocystis. In Figure 6, "WT" represents the wild strain and "+hβG" represents the transformant strain.

[0057] (1) PCR Using the extracted genomic DNA as a template, the introduced DNA was PCR amplified with KOD-plus-neo polymerase (manufactured by TOYOBO) using the following primers. Bands a to d of DNA derived from the introduced DNA (β-globin gene) shown in Figure 6 were confirmed by agarose electrophoresis (see Figure 7). The base sequences of the primers used and the sizes of the detected DNA are as follows. Detection of band a in Figure 7 (462 bp) 390_hGB17.5F, TGCACCTGCTCTGTGATTATGACTATCCCACAGTC 402_hGB17.5F-seq-AN, AGTGGCCTTCCATTATTCATAGTCCTTGCTCTACC Detection of band b in Figure 7 (1,728 bp) 674_hBG-check1-SE, GAAACTGGATGCAGAGACCAGATG 675_hBG-check1-An, AACTATAGCAGAGGCAGAGGAAGG Detection of band c in Figure 7 (1,798 bp) 676_hBG-check2-SE, ACCACACTCCCATAGATGAGTGTC 677_hBG-check2-An, CTCTATAGCTTCCCAACGTGATCG Detection of band d in Figure 7 (509 bp) 403_hGB17.5R-seq-SE, CAGTCTGCCTAGTACATTACTATTTGGAATATATG 391_hGB17.5R, ACATGATTAGCAAAAGGGCCTAGCTTGGACTCAGA

[0058] (2) Southern blotting The extracted genomic DNA was digested with the restriction enzyme SpeI (manufactured by TaKaRa) (37°C, 2 hours). After subjecting the digested sample to electrophoresis, it was transferred to a nylon membrane and hybridized with a probe labeled with a PCR DIG Probe Synthesis Kit (manufactured by Sigma-Aldrich). For the synthesis of the probe, a 462-bp DNA fragment amplified by PCR using the following primers was used. 390_hGB17.5F,TGCACCTGCTCTGTGATTATGACTATCCCACAGTC 402_hGB17.5F-seq-AN,AGTGGCCTTCCATTATTCATAGTCCTTGCTCTACC

[0059] The hybridized membrane was immersed in CDP-Star, and the signal of the probe was detected with a Fusion FX Chemiluminescence Imaging System (manufactured by Vilber-Lourmat). As a result, a 28.9-kbp (28,862 bp) band containing the human β-globin gene of 17.5 kbp (17,567 bp) was detected (Figure 8). In addition, it was confirmed that a gene of up to 35.6 kbp (35,586 bp) can be transferred into the genomic DNA of the cyanobacterium Synechocystis by the same method.

[0060] 5. Effects of the Examples Using the gene transfer vector of this example, a long DNA fragment was transferred into the genomic DNA of cyanobacteria, and useful cyanobacteria could be provided.

[0061] Note that the present invention is not limited to the above-described embodiments and examples, and various modifications can be made.

Explanation of Signs

[0062] 10…Gene transfer vector 11…First homologous recombination region 12…Second homologous recombination region 21…Selectable marker region 23…Multiple Cloning Site 25…DNA Fragment

Claims

1. A method for producing cyanobacteria, comprising a step of transforming using a gene transfer vector, wherein the gene transfer vector has a first homologous recombination region homologous to the 5'-side of the target DNA of cyanobacteria, a second homologous recombination region homologous to the 3'-side of the target DNA, and a DNA fragment introduced into a restriction enzyme site sandwiched between the first homologous recombination region and the second homologous recombination region, the total length of the first homologous recombination region and the second homologous recombination region is 30 kbp or more, the length of the first homologous recombination region is 5 kbp or more, the length of the second homologous recombination region is 5 kbp or more, and in the step of transformation, the DNA fragment is transferred between the 5'-side and the 3'-side of the target DNA. A method for producing cyanobacteria.

2. The method for producing cyanobacteria according to claim 1, wherein the site of transfer of the DNA fragment in the target DNA is a site where the 3'-untranslated regions of adjacent endogenous genes face each other.

3. The method for producing cyanobacteria according to claim 2, wherein the site of transfer of the DNA fragment in the target DNA is a site where the 3'-untranslated regions of the slr1716 gene and the sll1609 gene in the cyanobacterium Synechocystis sp. PCC 6803 strain face each other.

4. The method for producing cyanobacteria according to claim 2, wherein the site of transfer of the DNA fragment in the target DNA is a site where the 3'-untranslated regions of the slr1966 gene and the sll1893 gene in the cyanobacterium Synechocystis sp. PCC 6803 strain face each other.

5. The method for producing cyanobacteria according to any one of claims 1 to 4, wherein the DNA fragment is 5 kbp or more.

6. The gene transfer vector is The method for producing cyanobacteria according to any one of claims 1 to 5, wherein a selection marker region is provided in a portion sandwiched between the first homologous recombination region and the second homologous recombination region.

7. The method for producing cyanobacteria according to any one of claims 1 to 6, wherein the gene transfer vector is a fosmid vector.

Citation Information

Patent Citations

  • Method for non-trace knocking out cyanobacteria gene by one-step transformation

    CN110846340A

  • Method for transforming sweet potato

    JP2004147538A

  • Microginin-producing protein, nucleic acid encoding microginin gene cluster, and method for producing microginin

    JP2009517058A

  • Compositions, methods, and uses relating to the expression of intestinal bacteria-related peptides

    JP2013512256A

  • Compositions, methods, and uses of poxvirus elements in vaccine constructs against influenza virus subtypes or strains

    JP2015527885A