Method for decomposing a cellulosic fiber material containing a protein

Abstract

To provide a method for decomposing a protein-containing cellulose-based fiber material such as barley refuses.SOLUTION: A protein-containing cellulose-based fiber material is decomposed with microorganisms belonging to the genus Paenibacillus.SELECTED DRAWING: None

Description

Technical Field

[0001] The present invention relates to a method for decomposing cellulose-based fibrous materials containing proteins using microorganisms.

Background Art

[0002] Cellulose-based fibrous materials such as sugarcane, corn, and waste wood are not only converted into ethanol and utilized as new fuel energy after decomposing cellulose-based fibers, but also utilized as raw materials for saccharification. There are chemical decomposition methods and enzymatic decomposition methods for decomposing cellulose-based fibers. The chemical decomposition method decomposes cellulose-based fibers using an alkali or an acid, and acid decomposition has been commonly used for a long time. Acid decomposition includes concentrated sulfuric acid saccharification method and dilute sulfuric acid two-stage saccharification method.

[0003] The enzymatic decomposition method decomposes cellulose by a cellulolytic enzyme (mainly cellulase) or a microorganism that produces a cellulolytic enzyme (Patent Document 1). Decomposition by an enzyme has advantages such as a lighter burden on waste liquid recovery and treatment compared to acid decomposition, the ability to reduce equipment costs such as chemical-resistant equipment, and a high sugar yield without overdecomposition. In addition, the present inventors have previously proposed a BSES method for saccharifying cellulose-based biomass in one step by culturing Clostridium microorganisms in the presence of β-glucosidase (see Patent Document 2).

[0004] On the other hand, among waste materials containing cellulose-based fibers, some contain many reusable components, but there are also many that focus on uses other than decomposing and reusing cellulose. For example, wheat bran, which is a waste material for beer and whiskey brewing, contains proteins and is therefore used as feed for livestock (especially cattle), and there has been little need to reuse cellulose-based fibers.

Prior Art Documents

Patent Documents

[0005] [Patent Document 1] WO2017 / 221765 publication [Patent Document 2] WO2013 / 137151 publication [Non-patent literature]

[0006] [Non-Patent Document 1] Journal of the Brewing Society, Vol. 90, No. 2 (1995), pp. 93-100 [Non-Patent Document 2] Lane, DJ, et al., “In Stackebrandt, E. and Goodfellow, M. (eds.), Nucleic acid techniques in bacterial systematics”, 16S / 23S rRNA sequencing. p115-175, John Wiley & Sons, New York, 1991. [Non-Patent Document 3] Takai, K. and Horikoshi, K., “Rapid detection and quantification of members of archaeal community by quantitative PCR using fluorogenic probes”, Appl. Environ. Microbiol., 66, p5066-5072, 2000. [Non-Patent Document 4] Yokota et al., Int J Syst Evol Microbiol. 2016 Aug;66(8):3088-3094. doi: 10.1099 / ijsem.0.001151. Summary of the Invention [Problem to be solved by the invention]

[0007] However, due to the recent decline in dairy farming and beef cattle raising, and cheap imported feed, the opportunities to use wheat meal as feed have decreased recently. Meanwhile, efforts are being made to reduce carbon dioxide emissions, with the goal of achieving zero net carbon dioxide emissions by 2030. However, energy conservation has already progressed in beer and whiskey brewing, making it extremely difficult to set a target for further carbon dioxide emission reductions. In this regard, attention is being paid to the reuse of wheat meal, which is being used less and less as feed. If wheat meal can be converted into biofuel, it will be possible to reduce carbon dioxide emissions.

[0008] While investigating a method for decomposing wheat meal using microorganisms, the inventors encountered the problem that the cellulose fibers in wheat meal could not be efficiently decomposed using microorganisms that had previously been considered useful for decomposing cellulose.

[0009] Barley, the main ingredient of beer, is usually decomposed by malt enzymes, and starch is liquefied to become an aqueous solution. When the water-soluble substances are filtered through malt husks, a transparent filtrate is obtained, which is called wort, while the insoluble residue, which is mainly made up of the husks used as a filter, is called malt meal. Almost all of the starch contained in malt becomes wort, while high molecular weight proteins, dietary fiber, and lipids remain in the malt meal. It has been reported that the components remaining in the meal are 24-28% protein, 8-11% lipid, 55-61% dietary fiber, 1-3% carbohydrate, and 3-5% ash (Non-Patent Document 1).

[0010] In other words, the most abundant component of wheat meal other than plant fiber is protein, and this protein is found in large amounts in the aleurone layer on the inner surface of the fiber. Therefore, it was speculated that unless this protein is destroyed and broken down, plant fiber cannot be broken down efficiently. In fact, Clostridium thermocellum, known as a highly cellulose-degrading bacterium, was unable to break down wheat meal at all. This was thought to be because the proteins in the aleurone layer get in the way and prevent the decomposition of fiber-degrading enzymes such as cellulase and hemicellulase.

[0011] Therefore, the ability required of microorganisms that decompose wheat bran is to produce cellulase and hemicellulase while producing proteolytic enzymes. However, many of the cellulolytic microorganisms known so far, even if they produce cellulolytic enzymes, often have characteristics such as being unable to produce proteolytic enzymes or having low activity and not decomposing proteolytic enzymes. On the other hand, since cellulase and hemicellulase, which are cellulolytic enzymes, are also proteins, if a microorganism produces proteolytic enzymes, it is conceivable that it will also decompose cellulolytic enzymes.

[0012] Therefore, in order to decompose cellulosic fibers containing proteins in plant fibers such as wheat bran with microorganisms, new microorganisms that can produce cellulolytic enzymes with protease resistance while producing proteolytic enzymes are required. Therefore, as a result of the inventors' search for microorganisms suitable for decomposing wheat bran, it was found that microorganisms belonging to the genus Paenibacillus or a microbial community containing microorganisms belonging to the genus Paenibacillus decompose the protein layer and cellulose fibers of wheat bran, and the present invention was completed.

Means for Solving the Problems

[0013] The present invention is a method for decomposing cellulosic fibers containing proteins by microorganisms. Here, the cellulosic fibers containing proteins are preferably wheat bran discharged from the alcohol, beverage manufacturing factory, or brewery, and the microorganisms are microorganisms having wheat bran decomposition activity, and microorganisms belonging to the genus Paenibacillus are preferred. Specifically, it is to use the I-6 strain (NITE P-03556) and I-7 strain (NITE P-03557) of Paenibacillus macerans (also called P. macerans), or a microbial community containing the above microbial species. In the present invention, a genetically modified microorganism species having the gene sequence of Paenibacillus macerans, or a genetically modified microorganism species having the gene sequence of Paenibacillus macerans I-6 strain (NITE P-03556) or Paenibacillus macerans I-7 strain (NITE P-03557) may be used. The present invention further discloses a genetic recombinant containing the gene sequence of Paenibacillus macerans, or a DNA sequence obtained from Paenibacillus macerans I-6 strain (NITE P-03556) and Paenibacillus macerans I-7 strain (NITE P-03557), or a genetic recombinant containing the self-replicating plasmid DNA sequence (NITE P-03555) derived from the above I-6 strain and I-7 strain. This self-replicating plasmid DNA is used as a plasmid for transformation of other microorganisms including microorganisms of the genus P. macerans for host transformation, and the obtained transformant can be used for the decomposition of wheat bran. In the present invention, it has also been clarified that the genes necessary for the decomposition of wheat bran of Paenibacillus macerans, or Paenibacillus macerans I-6 strain (NITE P-03556) and Paenibacillus macerans I-7 strain (NITE P-03557) are selected and extracted, and introduced into other microorganism species by techniques such as genetic recombination, and the wheat bran is decomposed using the resulting microorganism species.

Advantages of the Invention

[0014] By using the method of the present invention, it is possible to decompose cellulosic fibers containing protein only by microorganisms, so that environmentally friendly treatment can be carried out. In addition, since the protein and cellulosic fibers can be decomposed in one step, complex treatment steps are not required. Furthermore, since the treatment is carried out by microorganisms under anaerobic conditions, there is also little fermentation of the organic matter contained in the cellulosic fibers containing protein and emission of carbon dioxide.

Brief Description of the Drawings

[0015]

Figure 1

Figure 2

Mode for Carrying Out the Invention

[0016] The method for decomposing a cellulosic fiber material containing the protein of the present invention is a method for decomposing wheat bran, which is a cellulosic fiber material containing a representative protein, using a microorganism showing cellulase activity and proteolytic activity. For example, the microorganism showing cellulase activity and proteolytic activity is preferably a microorganism belonging to the genus Paenibacillus.

[0017] As microorganisms of the genus Paenibacillus capable of secreting cellulase and proteolytic enzymes, P. macerans, P. thermophilus, P. oralis, P. timonensis, P. barengoltzii, P. phoenicis, P. yonginensis, P. konsidensis, P. curdlanolyticus, P. sanguinis, P. barengoltzii are preferred. More preferably, P. macerans and P. thermophilus (reclassified as the same genus and species: Hisami Kobayashi et-al. Reclassification of Paenibacillus thermophilus Zhou et al. 2013 as a later heterotypic synonym of Paenibacillus macerans (Schardinger 1905) Ash et al. 1994. Int J Syst Evol Microbiol. 2019 Feb;69(2):417-421. doi: 10.1099 / ijsem.0.003160. Epub 2018 Dec 12.) can be mentioned. As shown in the examples described later, these microorganisms may also perform decomposition in a mixed state. Therefore, it is also possible to use a pure culture of the above microorganisms or a microbial community containing the above microorganisms and other microbial species.

[0018] It should be noted that microorganisms of the genus Paenibacillus are known to be used as pesticides, to produce plant nutrients in the soil, and to decompose plant fibers, but they are not known to decompose cellulosic fibers containing proteins. Examples of cellulosic fibers containing proteins include soybean meal, tea seed cake, crustacean shells, processed fish meat, tea leaves, coffee grounds, microbial pellets, etc., in addition to wheat bran.

[0019] The present invention also provides the DNA of strain I-6 (NITE P-03556) and strain I-7. Using all or part of this DNA, a transformation plasmid can be constructed in combination with a conventionally known and available plasmid, and other microorganisms including P. macerans microorganisms can be transformed.

[0020] Examples of available known plasmids include plasmids derived from Escherichia coli (such as ColE plasmids like pBR322, pBR325, pUC18, pUC19, pUC118, pUC119, pTV118N, pTV119N, pBluescript, pHSG298, pHSG396 or pTrc99A, p15A plasmids like pACYC177 or pACYC184, pSC101 plasmids like pMW118, pMW119, pMW218 or pMW219, etc.), plasmids derived from Agrobacterium (such as pBI101, etc.), plasmids derived from Bacillus subtilis (such as pUB110, pTP5, etc.).

[0021] The transformation plasmid according to the present invention can further contain an origin of replication or an autonomous replication sequence. By including these, it can replicate stably after being introduced into the host cell. Also, the transformation plasmid according to the present invention can contain a selection marker. The selection marker is not particularly limited, and for example, a drug resistance marker gene can be mentioned. For example, genes encoding resistance to ampicillin, tetracycline, chloramphenicol, and kanamycin. Furthermore, an auxotrophic marker gene can also be mentioned as a selection marker. The selection marker is an auxotrophic marker encoding an essential auxotrophic gene deleted in the bacterial strain. By including these selection markers, host cells into which the transformation assisting plasmid has been introduced can be efficiently selected. Also, a promoter sequence may be included to highly express the gene. Suitable promoters include all promoters known to those skilled in the art, such as constitutive promoters (e.g., GAPDH promoter), or, for example, inducible promoters (e.g., Lac promoter, tac promoter, trc promoter, λPL promoter, ara promoter, cumate promoter, tet promoter, or sequences derived therefrom). Methods for introducing the constructed plasmid into host cells include the calcium chloride method or calcium chloride / rubidium chloride method, electroporation method, electroinjection method, methods by chemical treatment such as PEG, methods using a gene gun, etc.

[0022] The DNA of strain I-6 (NITE P-03556) and strain I-7 (NITE P-03557) is specifically pI6ORI (NITE-P03555). By using a plasmid containing the sequence of pI6ORI or a part of the sequence to transform microorganisms other than those of the genus Paenibacillus, it is possible to decompose cellulose-based fibers containing proteins. Examples of microorganisms other than those of the genus Paenibacillus include, for example, anaerobic microorganisms such as Clostridium thermocellum, Clostridium stercorarium, Clostridium thermolacticum, Caldicellulosiruptor saccharolyticus, Caldicellulosiruptor bescii, Caldicellulosiruptor obsidiansis, Thermoanaerobacter cellulolyticus, Anaerocellum thermophilum, Spirochaeta thermophila, Thermotoga maritima, Thermotoga neapolitana, Fervidobacterium riparium, Fervidobacterium islandicum, Herbivorax saccincola, aerobic microorganisms such as Geobacillus stearothermophilus of the genus Geobacillus, Thermus thermophilus of the genus Thermus, Thermotoga maritima of the genus Thermotoga, and Capillibacterium thermochitinicola. Furthermore, the Paenibacillus microorganism, preferably strain I-6 (NITE P-03556) and strain I-7 (NITE P-03557), and the above recombinant microorganism species, or the recombinant Paenibacillus microorganism transformed with the above DNA sequence and the above recombinant microorganism species may be co-cultured, and the microbial flora may be used for decomposing protein-containing cellulose fibers. Hereinafter, the present invention will be specifically described with reference to examples. However, it is obvious that the microorganisms used in the method of the present invention are not limited to the above-described markers, promoters, and hosts.

Example

[0023] (Example 1) (Isolation and Identification of Microbial Strains that Degrade Wheat Bran) Using the soil samples stored by the inventors, screening for microorganisms capable of decomposing wheat bran was carried out by the following method. First, under the culture conditions of the medium temperature zone (37 - 45°C) and the high temperature zone (50 - 60°C), those showing good growth with only wheat bran and water, and having a large difference between the dry weight of the wheat bran before culture and the dry weight of the wheat bran after culture were selected, and further, enrichment culture was repeated 5 times or more under anaerobic conditions for selection. As a result, no candidates were found from the samples in the high temperature zone, but cultures with good growth and a large dry weight difference at 45°C were obtained. Before performing microbial isolation, in order to obtain knowledge about the microbial flora, metagenomic analysis was performed to analyze the 16S rRNA sequence using next-generation sequencing. As shown in Table 1, it was found that several types of bacteria were present in the culture.

[0024]

Table 1

[0025] When viewed from the microbial flora, Paenibacillus macerans accounted for about 65%, the genus Clostridium accounted for about 30%, and other microorganisms of the genus Paenibacillus also mixed at about 9%. From these results, it became clear that, centered on Paenibacillus macerans, even when other species of Clostridium and Paenibacillus genus microorganisms coexist, they show good ability to decompose wheat bran. In order to isolate Paenibacillus macerans, which plays a major role in decomposition, under anaerobic conditions, the supernatant after alkaline treatment of wheat bran was used as a medium, and colonies were isolated by the roll tube method. When the microorganisms that formed each colony were cultured with only the aforementioned wheat bran and water, Paenibacillus macerans strain I-6 (NITE P-03556) and Paenibacillus macerans strain I-7 (NITE P-03557), which efficiently decompose wheat bran, were isolated.

[0026] Furthermore, the characteristics of the isolated strains were examined by phylogenetic tree analysis using 16S rRNA sequences. Genomic DNA used as a PCR template was prepared from each microorganism using the NucleoSpin (registered trademark) Microbial DNA kit (Takara Bio). PCR amplification of the 16S rRNA gene was performed by the following PCR method.

[0027] (Extraction of Genomic DNA) In order to clarify the taxonomic properties of strain I-6 (NITE P-03556) and strain I-7 (NITE P-03557), nucleotide sequence analysis of the 16S rRNA and rpoB genes was performed. The rpoB gene (RNA polymerase B subunit gene (rpoB)) is a gene sequence used as an indicator in addition to the 16S rRNA gene in bacterial classification, so bacterial identification can be more reliably performed.

[0028] The genomic DNA of strain I-6 (NITE P-03556) and strain I-7 (NITE P-03557) was extracted by the following procedure. First, using a medium containing the biomass fiber as a carbon source, strains I-6 (NITE P-03556) and I-7 (NITE P-03557) were each cultured for 4 days. The obtained cultures were centrifuged at 10,000 revolutions at 4°C for 5 minutes to recover the cells cultured with each biomass. Next, to the obtained cells, 10% SDS (sodium lauryl sulfate) was added to a final concentration of 0.5%, and a proteinase K (1 mg / mL) solution was added to a final concentration of 5 μg / mL, and the reaction was carried out at 37°C for 1 hour. Next, a 10% cetyltrimethylammonium bromide - 0.7 M sodium chloride solution was added to a final concentration of 1%, and the reaction was carried out at 65°C for 10 minutes.

[0029] A chloroform - isoamyl alcohol solution equal in volume to the reaction - after culture solution was added, stirred well, centrifuged at 15,000 revolutions for 5 minutes to obtain an aqueous layer. Again, a phenol - chloroform - isoamyl alcohol mixture equal in volume to the obtained aqueous layer was added, stirred, and centrifuged at 15,000 revolutions for 5 minutes to obtain an aqueous layer. Next, 0.6 times the volume of isopropanol was added to the obtained aqueous layer to precipitate genomic DNA, and centrifugation was performed to prepare genomic DNA. Next, the prepared genomic DNA was washed with 70% ethanol and dried.

[0030] (Amplification of Genomic DNA) For the 16S rRNA amplification PCR primers, the 27F oligonucleotide primer (5’ - AGAGTTTGATCCTGGCTCAG - 3’: SEQ ID NO: 1) and the 1492R oligonucleotide primer (5’ - GGCTACCTTGTTACGACTT - 3’: SEQ ID NO: 2) were used. For further confirmation of the bacterial species, in addition to 16S rRNA, a comparison using the sequence of the rpoB gene was carried out. For the PCR primers for amplifying the rpoB gene, the rpoB-1698F oligonucleotide primer (5'-AACATCGGTTTGATCAAC-3': SEQ ID NO: 3) and the rpoB-2041R oligonucleotide primer (5'-CGTTGCATGTTGGTACCCAT-3': SEQ ID NO: 4) were used. PCR was performed to amplify the 16S rRNA gene using ExTaq DNA polymerase (manufactured by Takara Shuzo Co., Ltd.). The PCR conditions were amplification under the conditions of 98°C for 1 minute, 55°C for 1 minute, and 72°C for 2 minutes for 30 cycles. After confirming the amplified band by 0.8% agarose gel electrophoresis for the obtained PCR product, the amplified PCR product was purified using the QIAGEN PCR purification kit (manufactured by QIAGEN).

[0031] (Base Sequence Analysis and Homology Search) For nucleotide sequence analysis and homology search, based on the methods described in Non-Patent Documents 1 and 2, it was carried out by BLAST (http: / / www.ncbi.nlm.nih.gov / blast / Blast.cgi) using the GenBank / EMBL / DDBJ database. The 16S rRNA sequences of the obtained P. macerans I-6 strain (NITE P-03556) and P. macerans I-7 strain (NITE P-03557) are shown in SEQ ID NO: 5 and SEQ ID NO: 6, respectively. Also, the rpoB gene sequences of the P. macerans I-6 strain (NITE P-03556) and P. macerans I-7 strain (NITE P-03557) are shown in SEQ ID NO: 7 and SEQ ID NO: 8, respectively.

[0032] (Example 2) (Ability of Paenibacillus spp. to Degrade Wheat Bran) When analyzing the components of wheat bran used in Example 1, it was found that the crude protein was 23.4%, crude fat was 13.3%, hemicellulose was 33.6%, cellulose was 20%, lignin was 5.2%, and ash was 4.4%. It was also found that the components and component ratios were completely different from those of general cellulose biomass. From this, we investigated whether Paenibacillus microorganisms can decompose cellulose-based fibers containing protein.

[0033] As a comparative control, the ability of Paenibacillus microorganisms to decompose cellulose-based fibers containing protein was confirmed using the P. macerans strain (DSM 24) obtained from the German Collection of Microorganisms and Cell Cultures (DSMZ), the cellulose and hemicellulose highly degrading bacteria Clostridium thermocellum, P. curdlanolyticus, and P. cisolokensis (DSM 101873) (all from Non-Patent Document 4). Using 4% (w / v) wheat bran treated with alkali by NaOH and sterilized distilled water, the ability to decompose wheat bran was compared with the P. macerans strain (DSM 24), Clostridium thermocellum (DSM 1313), P. curdlanolyticus, and P. cisolokensis (DSM 101873). To perform anaerobic culture, the upper layer was replaced with nitrogen gas and sealed with a rubber stopper and an aluminum cap. For the measurement of wheat bran decomposition, the above microorganisms were inoculated with a 1% (v / v) syringe. The P. macerans strain (DSM 24) and P. curdlanolyticus were cultured at 37°C, the P. macerans I-6 and I-7 strains were cultured at 45°C, the P. cisolokensis (DSM 101873) was cultured at 50°C, and Clostridium thermocellum was cultured at 60°C. After 5 days, the remaining wheat bran was dried, and the ratio was determined by subtracting the weight of the initial wheat bran. Biomass decomposition rate (%) = { (dry weight of biomass before decomposition [g / mL]) - (dry weight of residue contained in the culture solution after decomposition [g / mL]) × 100} / dry weight of biomass before decomposition [g / mL] The results are shown in Fig. 1. This test shows the distribution of the decomposition rate from five repeated tests. RI-7 in Fig. 1 is the wheat bran decomposing ability shown by the recombinant I-7 of Examples 4 and 5 described later (see Example 5).

[0034] The type strains P. macerans (DSM 24), P. curdlanolyticus, and P. cisolokensis (DSM 101873) can also decompose wheat bran, but have a very low saccharification rate. On the other hand, it can be seen that the isolated P. macerans I-6 strain and P. macerans I-7 strain have a decomposition rate about 4 times higher compared to other type strains. Clostridium thermocellum, which is a cellulose and hemicellulose-decomposing bacterium, conversely cannot decompose it at all. Therefore, it can be seen that even if it has cellulase and hemicellulase, it is hardly useful for decomposing wheat bran.

[0035] (Example 3) (Protease Activity and Xylanase Activity of Paenibacillus macerans) From the results of Example 2, it is suggested that P. macerans I-6 and P. macerans I-7 not only have cellulose and hemicellulose-decomposing activities, but may also promote decomposition by effectively decomposing the protein coating the wheat bran surface and exposing the fibrous matter. Therefore, it was confirmed whether there is protease activity. Similar to Example 2, using alkali-treated wheat bran, the extracellular enzyme activities of the protease activity, cellulase activity, and xylanase activity of the P. macerans strain type strain (DSM 24), I-6 strain, and I-7 strain were compared.

[0036] (Measurement of Protease Activity) To the solution after culturing the microorganism, add a 1% casein substrate solution and pre-incubate it at 37 °C or 45 °C for 5 minutes in a constant temperature water bath (manufactured by Yamato Scientific Co., Ltd.). Then, add the culture solution and incubate it at 37 °C or 45 °C for 30 minutes. After 30 minutes, add trichloroacetic acid (TCA) reagent to stop the enzyme reaction. After further incubating at 37 °C for 30 minutes, centrifuge to obtain the supernatant. Add a sodium carbonate test solution and stir. Add the Folin test solution and stir, then incubate at 37 °C for 30 minutes in a constant temperature water bath. The colored solution was measured at an absorbance of 660 nm using a spectrophotometer (manufactured by Shimadzu Corporation). One unit of enzyme activity was defined as the amount of enzyme that liberates 1 μmol of amino acid (tyrosine) per minute, and the enzyme activity (U / mg) per 1 mg of enzyme was calculated (Table 2). The protein concentration of the enzyme was measured using the Pierce BCA Protein Assay Kit (manufactured by Thermo Fisher). As the standard substance for protein concentration quantification, bovine serum albumin with a known concentration (manufactured by Thermo Fisher) was used.

[0037] (Measurement of Cellulase Activity and Xylanase Activity) The enzyme activities of DSM 24, I-6 strain, and I-7 strain against cellulose and xylan substrates were examined. To 50 mM sodium acetate buffer (pH 7.0), add the culture solution obtained above, 1% carboxymethylcellulose, and xylan substrate, incubate at 45 °C for 30 minutes, and then quantify the concentration of the released reducing sugar by the Somogyi-Nelson method. One unit of enzyme activity was defined as the amount of enzyme that liberates 1 μmol of reducing sugar per minute, and the enzyme activity (U / mg) per 1 mg of enzyme was calculated (Table 2). The protein concentration of the enzyme was measured using the Pierce BCA Protein Assay Kit (manufactured by Thermo Fisher). As the standard substance for protein concentration quantification, bovine serum albumin with a known concentration (manufactured by Thermo Fisher) was used. The comparison results are shown in Table 2.

[0038]

Table 2

[0039] From the results in Table 2, it was found that P. macerans DSM 24 has protease activity, cellulase and xylanase activities, but the protease activity and cellulase activity of P. macerans strain I-6 or I-7 are about three times higher. There was not much difference in xylanase activity. These results suggested the possibility that protease activity is effective in decomposing wheat bran.

[0040] (Example 4) (Creation of Chloramphenicol-Resistant P. macerans Strains I-6 and I-7) To confirm the possibility of creating recombinants of P. macerans strain I-6 and P. macerans strain I-7, chloramphenicol antibiotic-resistant strains of P. macerans strain I-6 and I-7 were created using a commercially available plasmid vector.

[0041] P. macerans strains I-6 and I-7, which were aerobically cultured in DSM 220 medium until the turbidity reached around 0.5 at a wavelength of 600 nm, were collected by centrifugation and washed twice with a buffer containing 10% sucrose and 1 mM magnesium chloride. The washed cells of P. macerans strains I-6 and I-7 were finally suspended in the buffer about 300-fold and used for transformation by the electroporation method using pNW33N (Bacillus Genetic Stock Center) as a plasmid vector. After electroporation, P. macerans strains I-6 and I-7 were post-cultured at 45 °C for about 3 hours in DSM 220 liquid medium, and spread on DSM 220 plate medium containing a chloramphenicol concentration of 40 μg / mL to observe the appearance of transformants.

[0042] After culturing at 45 °C for 2 days, the colonies that appeared were confirmed. The P. macerans I-6 and I-7 strains containing pNW33N formed colonies as chloramphenicol-resistant, while the non-transformed P. macerans I-6 and I-7 strains could not grow on chloramphenicol plates. The results are shown in Figure 2. In the plate of P. macerans I-7 strain incorporated with pNW33N shown in Figure 2(B), colonies are present, but it can be seen that no colonies are formed on the plate of I-7 strain without pNW33N shown in Figure 2(A). From this, it can be understood that for P. macerans I-6 and I-7 strains, genetically modified organisms using plasmids can be easily obtained.

[0043] (Example 5) A saccharification experiment of wheat bran was carried out on the genetically modified organism P. macerans (RI-7 strain) that became chloramphenicol-resistant. Similar to Example 2, the RI-7 strain was inoculated in the same way into the pretreated wheat bran and a medium containing chloramphenicol at a concentration of 40 μg / mL. Even in the wheat bran culture solution containing chloramphenicol, it showed a saccharification rate equivalent to that of the non-genetically modified I-7 strain (see Figure 1). From this result, it became clear that the genetically modified organism can also maintain the saccharification efficiency and saccharify wheat bran. In each of the above-described examples, the pNW33N plasmid vector was used, but transformation can also be carried out using the sequence deposited as pI6ORI (NITE-P03555). The gene sequence of pI6ORI (NITE-P03555) is shown in SEQ ID NO: 9.

Deposit number

[0044] NITE P-03555

[0045] NITE P-03556

[0046] NITE P-03557

[0047] Sequence Listing Free Text

Claims

1. A method for decomposing a cellulosic fiber material containing a protein using Paenibacillus macerans strain I-6 (NITE P-03556) or Paenibacillus macerans strain I-7 (NITE P-03557).

2. The method for decomposing a cellulosic fiber material containing a protein according to Claim 1, wherein the cellulosic fiber material containing the protein is wheat bran.

3. The method for decomposing a cellulosic fiber material containing a protein according to Claim 1 or 2, wherein the strain I-6 and strain I-7 are genetically recombinant.

4. Paenibacillus macerans strain I-6 (Accession Number NITE P-03556).

5. Paenibacillus macerans strain I-7 (Accession Number NITE P-03557).

Images