Bridged nucleosides and nucleotides using the same

Cross-linked nucleosides with an HNA backbone address the enzyme resistance and hepatotoxicity issues of 2',4'-BNA, providing improved nuclease resistance and ssRNA binding affinity for pharmaceutical use.

JP7709690B2Active Publication Date: 2025-07-17OSAKA UNIVERSITY +1
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
JP2022501952
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2020-02-18
Filing Date
2021-02-17
Publication Date
2025-07-17
Estimated Expiration
2041-02-17

AI Technical Summary

Technical Problem

Existing artificial nucleic acids, such as 2',4'-BNA, suffer from poor enzyme resistance and hepatotoxicity, while HNA analogs offer improved binding affinity but require enhancements for better nuclease resistance and reduced toxicity.

Method used

Development of cross-linked nucleosides with a hexitol nucleic acid (HNA) backbone, featuring a cross-linked structure between the 1'- and 3'-positions, which enhances nuclease resistance and enzyme stability.

Benefits of technology

The cross-linked nucleosides exhibit improved nuclease resistance and enzyme stability, offering a viable alternative to phosphorothioate-modified nucleic acids with enhanced ssRNA binding affinity, suitable for pharmaceutical applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007709690000124
    Figure 0007709690000124
  • Figure 0007709690000125
    Figure 0007709690000125
  • Figure 0007709690000126
    Figure 0007709690000126
Patent Text Reader

Abstract

This cross-linked nucleoside is a compound indicated by formula (I). This cross-linked nucleoside: can be used as a substitute for a phosphorothioate-modified nucleic acid, which has the risk of accumulating in a specific organ; and has excellent industrial productivity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to cross-linked nucleosides and nucleotides using the same. More specifically, the present invention relates to cross-linked nucleosides having good nuclease resistance and nucleotides using the same.

Background Art

[0002] Artificial nucleic acids having excellent binding affinity for DNA and RNA can be applied to gene diagnosis and nucleic acid pharmaceuticals, and various types of artificial nucleic acids have been developed so far. Among them, 2’,4’-BNA (2’,4’-bridged nucleic acid; also known as LNA), in which the conformation of the nucleic acid sugar moiety is immobilized in the N-type conformation by cross-linking, has excellent binding affinity for single-stranded RNA (ssRNA) and is expected as a nucleic acid pharmaceutical applicable to various applications such as the antisense method (Non-Patent Documents 1 and 2). However, 2’,4’-BNA has a problem of poor enzyme resistance and is likely to induce hepatotoxicity (Non-Patent Document 3).

[0003] On the other hand, hexitol nucleic acid (HNA) in which the nucleic acid sugar moiety is replaced with a pyranose ring has a structure that mimics the N-type conformation of natural nucleic acids and is known to improve the binding affinity for single-stranded RNA (ssRNA) (Non-Patent Documents 4 and 5). Therefore, in recent years, studies on applying HNA and its analogs to antisense pharmaceuticals have been reported, and findings suggesting excellent activity and reduced toxicity have been obtained (Non-Patent Documents 6 and 7).

[0004] As described above, artificial nucleic acids having an HNA backbone have attractive properties for pharmaceutical applications and have been attracting attention as those that improve the problems of 2’,4’-BNA.

Prior Art Documents

Non-Patent Documents

[0005]

Non-Patent Document 1

[0006] The present invention solves the above problems, and an object thereof is to provide a crosslinked nucleoside having good nuclease resistance and an HNA backbone, and a nucleotide using the same. [Means for Solving the Problems]

[0007] The present invention relates to a compound represented by the following formula (I) or a salt thereof:

[0008] [Chemical Formula]

[0009] (In the formula, Base represents a purin-9-yl group or a 2-oxo-1,2-dihydropyrimidin-1-yl group which may have one or more arbitrary substituents selected from group α, wherein the group α consists of a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a mercapto group protected by a protecting group for nucleic acid synthesis, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, an amino group protected by a protecting group for nucleic acid synthesis, and a halogen atom, R 2 and R 3 are each independently a hydrogen atom, a protecting group for a hydroxyl group in nucleic acid synthesis, an alkyl group having 1 to 7 carbon atoms which may form a branch or a ring, an alkenyl group having 2 to 7 carbon atoms which may form a branch or a ring, an aryl group having 3 to 10 carbon atoms which may have one or more arbitrary substituents selected from group α and may contain a heteroatom, an aralkyl group having an aryl moiety having 3 to 12 carbon atoms which may have one or more arbitrary substituents selected from group α and may contain a heteroatom, an acyl group which may have one or more arbitrary substituents selected from group α, a silyl group which may have one or more arbitrary substituents selected from group α, a phosphate group which may have one or more arbitrary substituents selected from group α, a phosphate group protected by a protecting group for nucleic acid synthesis, -P(R 4 )R 5 [wherein, R 4 and R 5 are each independently a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, a mercapto group, a mercapto group protected by a protecting group for nucleic acid synthesis, an amino group, an alkoxy group having 1 to 6 carbon atoms, an alkylthio group having 1 to 6 carbon atoms, a cyanoalkoxy group having 1 to 6 carbon atoms, or a dialkylamino group having an alkyl group having 1 to 6 carbon atoms] represents, X 1 is an alkylene group having 1 to 5 carbon atoms, an alkenylene group having 2 to 5 carbon atoms, or -Y 1 -(CH2) n -, -(CH2) n -Y 1 - or -(CH2)l -Y 1 -(CH2) m -[where Y 1 is a sulfonyl group, a sulfonamide group, an amide group, an ester group, or a carbonyl group, n is an integer from 1 to 5, l and m are positive integers and the sum of l and m is from 2 to 5], and X 2 is an oxygen atom, a sulfur atom, -NH- or a methylene group).

[0010] In one embodiment, the above formula (I) is any of the following formulas (I-1) to (I-3):

[0011]

Chemical formula

[0012] represented by any of them.

[0013] In one embodiment, the above Base is a 6-aminopurin-9-yl group, 2,6-diaminopurin-9-yl group, 2-amino-6-chloropurin-9-yl group, 2-amino-6-fluoropurin-9-yl group, 2-amino-6-bromopurin-9-yl group, 2-amino-6-hydroxypurin-9-yl group, 6-amino-2-methoxypurin-9-yl group, 6-amino-2-chloropurin-9-yl group, 6-amino-2-fluoropurin-9-yl group, 2,6-dimethoxypurin-9-yl group, 2,6-dichloropurin-9-yl group, 6-mercaptopurin-9-yl group, 2-oxo-4-amino-1,2-dihydropyrimidin-1-yl group, 4-amino-2-oxo-5-fluoro-1,2-dihydropyrimidin-1-yl group, 4-amino-2-oxo-5-chloro-1,2-dihydropyrimidin-1-yl group, 2-oxo-4-methoxy-1,2-dihydropyrimidin-1-yl group, 2-oxo-4-mercapto-1,2-dihydropyrimidin-1-yl group, 2-oxo-4-hydroxy-1,2-dihydropyrimidin-1-yl group, 2-oxo-4-hydroxy-5-methyl-1,2-dihydropyrimidin-1-yl group, or 4-amino-5-methyl-2-oxo-1,2-dihydropyrimidin-1-yl group.

[0014] In one embodiment, the above Base is of the following formula:

[0015]

Chemical formula

[0016] and is a group represented by.

[0017] The present invention also relates to an oligonucleotide containing at least one nucleoside structure represented by the following formula (II) or a pharmaceutically acceptable salt thereof:

[0018]

Chemical formula

[0019] (wherein, Base represents a purin-9-yl group or a 2-oxo-1,2-dihydropyrimidin-1-yl group which may have one or more arbitrary substituents selected from group α, where the group α consists of a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a mercapto group protected by a protecting group for nucleic acid synthesis, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, an amino group protected by a protecting group for nucleic acid synthesis, and a halogen atom, X 1 is an alkylene group having 1 to 5 carbon atoms, an alkenylene group having 2 to 5 carbon atoms, or -Y 1 -(CH2) n -,-(CH2) n -Y 1 -or-(CH2) l -Y 1 -(CH2) m -[where Y 1 is a sulfonyl group, a sulfonamide group, an amide group, an ester group, or a carbonyl group, n is an integer from 1 to 5, l and m are positive integers and the sum of l and m is from 2 to 5], X 2 is an oxygen atom, a sulfur atom, -NH- or a methylene group).

[0020] In one embodiment, the above formula (II) is one of the following formulas (II-1) to (II-3):

[0021]

Chemical formula

[0022] represented by any of.

[0023] In one embodiment, the Base is a 6-aminopurin-9-yl group, 2,6-diaminopurin-9-yl group, 2-amino-6-chloropurin-9-yl group, 2-amino-6-fluoropurin-9-yl group, 2-amino-6-bromopurin-9-yl group, 2-amino-6-hydroxypurin-9-yl group, 6-amino-2-methoxypurin-9-yl group, 6-amino-2-chloropurin-9-yl group, 6-amino-2-fluoropurin-9-yl group, 2,6-dimethoxypurin-9-yl group, 2,6-dichloropurin-9-yl group, 6-mercaptopurin-9-yl group, 2-oxo-4-amino-1,2-dihydropyrimidin-1-yl group, 4-amino-2-oxo-5-fluoro-1,2-dihydropyrimidin-1-yl group, 4-amino-2-oxo-5-chloro-1,2-dihydropyrimidin-1-yl group, 2-oxo-4-methoxy-1,2-dihydropyrimidin-1-yl group, 2-oxo-4-mercapto-1,2-dihydropyrimidin-1-yl group, 2-oxo-4-hydroxy-1,2-dihydropyrimidin-1-yl group, 2-oxo-4-hydroxy-5-methyl-1,2-dihydropyrimidin-1-yl group, or 4-amino-5-methyl-2-oxo-1,2-dihydropyrimidin-1-yl group.

[0024] In one embodiment, the Base is of the following formula:

[0025]

Chemical formula

[0026] The present invention also relates to a method for producing the above oligonucleotide or a pharmaceutically acceptable salt thereof, comprising a compound represented by the following formula (I) or a pharmaceutically acceptable salt thereof:

[0027]

Chemical formula

[0028] (wherein, Base represents a purin-9-yl group or a 2-oxo-1,2-dihydropyrimidin-1-yl group which may have one or more arbitrary substituents selected from Group α, where Group α consists of a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a mercapto group protected by a protecting group for nucleic acid synthesis, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, an amino group protected by a protecting group for nucleic acid synthesis, and a halogen atom. R 2 and R 3 are each independently a hydrogen atom, a protecting group for the hydroxyl group in nucleic acid synthesis, an alkyl group having 1 to 7 carbon atoms which may form a branch or a ring, an alkenyl group having 2 to 7 carbon atoms which may form a branch or a ring, an aryl group having 3 to 10 carbon atoms which may have one or more arbitrary substituents selected from Group α and may contain a heteroatom, an aralkyl group having an aryl moiety having 3 to 12 carbon atoms which may have one or more arbitrary substituents selected from Group α and may contain a heteroatom, an acyl group which may have one or more arbitrary substituents selected from Group α, a silyl group which may have one or more arbitrary substituents selected from Group α, a phosphate group which may have one or more arbitrary substituents selected from Group α, a phosphate group protected by a protecting group for nucleic acid synthesis, -P(R 4 )R 5 [wherein R 4 and R 5 are each independently a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, a mercapto group, a mercapto group protected by a protecting group for nucleic acid synthesis, an amino group, an alkoxy group having 1 to 6 carbon atoms, an alkylthio group having 1 to 6 carbon atoms, a cyanoalkoxy group having 1 to 6 carbon atoms, or a dialkylamino group having an alkyl group having 1 to 6 carbon atoms]. X 1 is an alkylene group having 1 to 5 carbon atoms, an alkenylene group having 2 to 5 carbon atoms, or -Y 1 -(CH2) n -, -(CH2) n -Y 1 - or -(CH2) l -Y1 -(CH2) m -[where Y 1 is a sulfonyl group, a sulfonamide group, an amide group, an ester group, or a carbonyl group, n is an integer from 1 to 5, l and m are positive integers and the sum of l and m is from 2 to 5], and X 2 is an oxygen atom, a sulfur atom, -NH-, or a methylene group) which comprises a step of synthesizing an oligonucleotide using

Advantages of the Invention

[0029] According to the present invention, nucleotides using a novel cross-linked nucleoside having an HNA backbone are provided. The cross-linked nucleoside of the present invention can also be used as an alternative to phosphorothioate-modified nucleic acids for which accumulation in specific organs is a concern.

Brief Description of the Drawings

[0030]

Figure 1

Figure 2

Figure 3

Figure 4

Modes for Carrying Out the Invention

[0031] First, the terms used in this specification are defined.

[0032] As used herein, the term "linear alkyl group having 1 to 6 carbon atoms" refers to any linear alkyl group having 1 to 6 carbon atoms, specifically, a methyl group, an ethyl group, an n-propyl group, an n-butyl group, an n-pentyl group, or an n-hexyl group. On the other hand, when referring to the term "alkyl group having 1 to 6 carbon atoms", it refers to any linear, branched or cyclic alkyl group having 1 to 6 carbon atoms.

[0033] As used herein, the term "linear alkoxy group having 1 to 6 carbon atoms" includes an alkoxy group having any linear alkyl group having 1 to 6 carbon atoms. For example, a methoxy group, an ethoxy group, an n-propoxy group, etc. may be mentioned. On the other hand, when referring to the term "alkoxy group having 1 to 6 carbon atoms", it refers to any linear, branched or cyclic alkoxy group having 1 to 6 carbon atoms.

[0034] As used herein, the term "cyanoalkoxy group having 1 to 6 carbon atoms" refers to a group in which at least one hydrogen atom in any linear, branched or cyclic alkoxy group having 1 to 6 carbon atoms is substituted with a cyano group.

[0035] As used herein, the term "linear alkylthio group having 1 to 6 carbon atoms" includes an alkylthio group having any linear alkyl group having 1 to 6 carbon atoms. For example, a methylthio group, an ethylthio group, an n-propylthio group, etc. may be mentioned. On the other hand, when referring to the term "alkylthio group having 1 to 6 carbon atoms", it refers to any linear, branched or cyclic alkylthio group having 1 to 6 carbon atoms.

[0036] As used herein, the term "linear alkylamino group having 1 to 6 carbon atoms" includes an alkylamino group having one or two alkylamino groups having any linear alkyl group having 1 to 6 carbon atoms. For example, a methylamino group, a dimethylamino group, an ethylamino group, a methylethylamino group, a diethylamino group, etc. may be mentioned.

[0037] As used herein, the term "alkyl group having 1 to 7 carbon atoms which may form a branch or a ring" includes any linear alkyl group having 1 to 7 carbon atoms, any branched alkyl group having 3 to 7 carbon atoms, and any cyclic alkyl group having 3 to 7 carbon atoms. Sometimes it is simply referred to as "lower alkyl group". For example, any linear alkyl group having 1 to 7 carbon atoms includes a methyl group, an ethyl group, an n-propyl group, an n-butyl group, an n-pentyl group, an n-hexyl group, and an n-heptyl group; any branched alkyl group having 3 to 7 carbon atoms includes an isopropyl group, an isobutyl group, a tert-butyl group, an isopentyl group, etc.; and any cyclic alkyl group having 3 to 7 carbon atoms includes a cyclobutyl group, a cyclopentyl group, a cyclohexyl group, etc.

[0038] As used herein, the term "alkenyl group having 2 to 7 carbon atoms which may form a branch or a ring" includes any linear alkenyl group having 2 to 7 carbon atoms, any branched alkenyl group having 3 to 7 carbon atoms, and any cyclic alkenyl group having 3 to 7 carbon atoms. Sometimes it is simply referred to as "lower alkenyl group". For example, any linear alkenyl group having 2 to 7 carbon atoms includes an ethenyl group, a 1-propenyl group, a 2-propenyl group, a 1-butenyl group, a 2-butenyl group, a 1-pentenyl group, a 2-pentenyl group, a 3-pentenyl group, a 4-pentenyl group, a 1-hexenyl group, etc.; any branched alkenyl group having 3 to 7 carbon atoms includes an isopropenyl group, a 1-methyl-1-propenyl group, a 1-methyl-2-propenyl group, a 2-methyl-1-propenyl group, a 2-methyl-2-propenyl group, a 1-methyl-2-butenyl group, etc.; and any cyclic alkenyl group having 3 to 7 carbon atoms includes a cyclobutenyl group, a cyclopentenyl group, a cyclohexenyl group, etc.

[0039] As used herein, the term "aryl group having 3 to 10 carbon atoms which may contain a hetero atom" includes any aryl group having 6 to 10 carbon atoms composed of only hydrocarbons, and any heteroaryl group having 3 to 12 carbon atoms in which at least one carbon atom constituting the ring structure of the aryl group is substituted with a hetero atom (for example, a nitrogen atom, an oxygen atom, and a sulfur atom, and combinations thereof). Examples of the aryl group having 6 to 10 carbon atoms include a phenyl group, a naphthyl group, an indenyl group, an azulenyl group, etc., and examples of the any heteroaryl group having 3 to 12 carbon atoms include a pyridyl group, a pyrrolyl group, a quinolyl group, an indolyl group, an imidazolyl group, a furyl group, a thienyl group, etc.

[0040] As used herein, examples of the term "aralkyl group having an aryl moiety having 3 to 12 carbon atoms which may contain a hetero atom" include a benzyl group, a phenethyl group, a naphthylmethyl group, a 3-phenylpropyl group, a 2-phenylpropyl group, a 4-phenylbutyl group, a 2-phenylbutyl group, a pyridylmethyl group, an indolylmethyl group, a furylmethyl group, a thienylmethyl group, a pyrrolylmethyl group, a 2-pyridylethyl group, a 1-pyridylethyl group, a 3-thienylpropyl group, etc.

[0041] In this specification, examples of the term "acyl group" include aliphatic acyl groups and aromatic acyl groups. Specifically, examples of aliphatic acyl groups include alkylcarbonyl groups such as formyl group, acetyl group, propionyl group, butyryl group, isobutyryl group, pentanoyl group, pivaloyl group, valeryl group, isovaleryl group, octanoyl group, nonanoyl group, decanoyl group, 3-methylnonanoyl group, 8-methylnonanoyl group, 3-ethyloctanoyl group, 3,7-dimethyloctanoyl group, undecanoyl group, dodecanoyl group, tridecanoyl group, tetradecanoyl group, pentadecanoyl group, hexadecanoyl group, 1-methylpentadecanoyl group, 14-methylpentadecanoyl group, 13,13-dimethyltetradecanoyl group, heptadecanoyl group, 15-methylhexadecanoyl group, octadecanoyl group, 1-methylheptadecanoyl group, nonadecanoyl group, icosanoyl group and henicosanoyl group; carboxylated alkylcarbonyl groups such as succinoyl group, glutaryl group, adipoyl group; halogeno lower alkylcarbonyl groups such as chloroacetyl group, dichloroacetyl group, trichloroacetyl group, trifluoroacetyl group; lower alkoxy lower alkylcarbonyl groups such as methoxyacetyl group; unsaturated alkylcarbonyl groups such as (E)-2-methyl-2-butenoyl group. Examples of aromatic acyl groups include arylcarbonyl groups such as benzoyl group, α-naphthoyl group, β-naphthoyl group; halogenoarylcarbonyl groups such as 2-bromobenzoyl group, 4-chlorobenzoyl group; lower alkylated arylcarbonyl groups such as 2,4,6-trimethylbenzoyl group, 4-toluoyl group; lower alkoxylated arylcarbonyl groups such as 4-anisoyl group; carboxylated arylcarbonyl groups such as 2-carboxybenzoyl group, 3-carboxybenzoyl group, 4-carboxybenzoyl group; nitrated arylcarbonyl groups such as 4-nitrobenzoyl group, 2-nitrobenzoyl group; lower alkoxycarbonylated arylcarbonyl groups such as 2-(methoxycarbonyl)benzoyl group; arylated arylcarbonyl groups such as 4-phenylbenzoyl group, etc.Preferably, they are formyl group, acetyl group, propionyl group, butyryl group, isobutyryl group, pentanoyl group, pivaloyl group, benzoyl group.

[0042] In this specification, examples of the term "silyl group" include tri-lower alkylsilyl groups such as trimethylsilyl group, triethylsilyl group, isopropyldimethylsilyl group, t-butyldimethylsilyl group, methyldiisopropylsilyl group, methyldi-t-butylsilyl group, triisopropylsilyl group; tri-lower alkylsilyl groups substituted with 1 to 2 aryl groups such as diphenylmethylsilyl group, butyldiphenylbutylsilyl group, diphenylisopropylsilyl group, phenyldiisopropylsilyl group and the like. Preferably, they are trimethylsilyl group, triethylsilyl group, triisopropylsilyl group, t-butyldimethylsilyl group, t-butyldiphenylsilyl group, and more preferably trimethylsilyl group.

[0043] In this specification, examples of the term "halogen atom" include, for example, fluorine atom, chlorine atom, bromine atom, or iodine atom. Preferably, they are fluorine atom or chlorine atom.

[0044] As used herein, the "protecting group" in the terms "amino group protecting group for nucleic acid synthesis", "hydroxyl group protecting group for nucleic acid synthesis", "hydroxyl group protected by a protecting group for nucleic acid synthesis", "phosphate group protected by a protecting group for nucleic acid synthesis", and "mercapto group protected by a protecting group for nucleic acid synthesis" is not particularly limited as long as it can stably protect an amino group, hydroxyl group, phosphate group, or mercapto group during nucleic acid synthesis. Specifically, it refers to a protecting group that is stable under acidic or neutral conditions and can be cleaved by chemical methods such as hydrogenolysis, hydrolysis, electrolysis, and photolysis. Examples of such protecting groups include lower alkyl groups, lower alkenyl groups, acyl groups, tetrahydropyranyl or tetrahydrothiopyranyl groups, tetrahydrofuranyl or tetrahydrothiofuranyl groups, silyl groups, lower alkoxymethyl groups, lower alkoxylated lower alkoxymethyl groups, halogeno lower alkoxymethyl groups, lower alkoxylated ethyl groups, halogenated ethyl groups, methyl groups substituted with 1 to 3 aryl groups, "methyl groups substituted with 1 to 3 aryl groups in which the aryl ring is substituted with a lower alkyl group, lower alkoxy group, halogen atom, or cyano group", lower alkoxycarbonyl groups, "aryl groups substituted with a halogen atom, lower alkoxy group, or nitro group", "lower alkoxycarbonyl groups substituted with a halogen atom or tri-lower alkylsilyl group", alkenyloxycarbonyl groups, "aralkyloxycarbonyl groups in which the aryl ring may be substituted with a lower alkoxy or nitro group", and the like.

[0045] More specifically, examples of the tetrahydropyranyl group or tetrahydrothiopyranyl group include a tetrahydropyran-2-yl group, 3-bromotetrahydropyran-2-yl group, 4-methoxytetrahydropyran-4-yl group, tetrahydrothiopyran-4-yl group, 4-methoxytetrahydrothiopyran-4-yl group, and the like. Examples of the tetrahydrofuranyl group or tetrahydrothiofuranyl group include a tetrahydrofuran-2-yl group and a tetrahydrothiophen-2-yl group. Examples of the lower alkoxymethyl group include a methoxymethyl group, 1,1-dimethyl-1-methoxymethyl group, ethoxymethyl group, propoxymethyl group, isopropoxymethyl group, butoxymethyl group, t-butoxymethyl group, and the like. Examples of the lower alkoxylated lower alkoxymethyl group include a 2-methoxyethoxymethyl group and the like. Examples of the halogenated lower alkoxymethyl group include a 2,2,2-trichloroethoxymethyl group, bis(2-chloroethoxy)methyl group, and the like. Examples of the lower alkoxylated ethyl group include a 1-ethoxyethyl group, 1-(isopropoxy)ethyl group, and the like. Examples of the halogenated ethyl group include a 2,2,2-trichloroethyl group and the like. Examples of the methyl group substituted with 1 to 3 aryl groups include a benzyl group, α-naphthylmethyl group, β-naphthylmethyl group, diphenylmethyl group, triphenylmethyl group, α-naphthyldiphenylmethyl group, 9-anthrylmethyl group, and the like. Examples of the "methyl group substituted with 1 to 3 aryl groups substituted with a lower alkyl group, lower alkoxy group, halogen atom or cyano group" include a 4-methylbenzyl group, 2,4,6-trimethylbenzyl group, 3,4,5-trimethylbenzyl group, 4-methoxybenzyl group, 4-methoxyphenyldiphenylmethyl group, 4,4'-dimethoxytriphenylmethyl group, 2-nitrobenzyl group, 4-nitrobenzyl group, 4-chlorobenzyl group, 4-bromobenzyl group, 4-cyanobenzyl group, and the like. Examples of the lower alkoxycarbonyl group include a methoxycarbonyl group, ethoxycarbonyl group, t-butoxycarbonyl group, isobutoxycarbonyl group, and the like.Examples of the "aryl group substituted with a halogen atom, a lower alkoxy group or a nitro group" include a 4-chlorophenyl group, a 2-fluorophenyl group, a 4-methoxyphenyl group, a 4-nitrophenyl group, a 2,4-dinitrophenyl group, and the like. Examples of the "lower alkoxycarbonyl group substituted with a halogen atom or a tri-lower alkylsilyl group" include a 2,2,2-trichloroethoxycarbonyl group, a 2-trimethylsilylethoxycarbonyl group, and the like. Examples of the alkenyloxycarbonyl group include a vinyloxycarbonyl group, an aryloxycarbonyl group, and the like. Examples of the "aralkyloxycarbonyl group in which the aryl ring may be substituted with a lower alkoxy or a nitro group" include a benzyloxycarbonyl group, a 4-methoxybenzyloxycarbonyl group, a 3,4-dimethoxybenzyloxycarbonyl group, a 2-nitrobenzyloxycarbonyl group, a 4-nitrobenzyloxycarbonyl group, and the like.

[0046] In one embodiment, examples of the "protecting group for the hydroxyl group in nucleic acid synthesis" include, for example, an aliphatic acyl group, an aromatic acyl group, a methyl group substituted with 1 to 3 aryl groups, a "methyl group substituted with 1 to 3 aryl groups in which the aryl ring is substituted with a lower alkyl, a lower alkoxy, a halogen, or a cyano group", and a silyl group. Alternatively, in one embodiment, examples of the "protecting group for the hydroxyl group in nucleic acid synthesis" include, for example, an acetyl group, a benzoyl group, a benzyl group, a p-methoxybenzoyl group, a dimethoxytrityl group, a monomethoxytrityl group, a tert-butyldiphenylsilyl group, a tert-butyldimethylsilyl (TBDMS) group, a [(triisopropylsilyl)oxy]methyl (TOM) group, a [(2-nitrobenzyl)oxy]methyl (NBOM) group, a bis(acetoxyethoxy)methyl ether (ACE) group, a tetrahydro-4-methoxy-2H-pyran-2-yl (Mthp) group, a 1-(2-cyanoethoxy)ethyl (CEE) group, a 2-cyanoethoxymethyl (CEM) group, a tert-butyldithiomethyl (DTM) group, a 2-(4-toluenesulfonyl)ethoxymethyl (TEM) group, and a 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl (4-MABOM) group.

[0047] In one embodiment, examples of the protecting group for the "hydroxyl group protected with a protecting group for nucleic acid synthesis" include an aliphatic acyl group, an aromatic acyl group, a "methyl group substituted with 1 to 3 aryl groups", an "aryl group substituted with a halogen atom, a lower alkoxy group, or a nitro group", a lower alkyl group, and a lower alkenyl group. Alternatively, in one embodiment, examples of the protecting group for the "hydroxyl group protected with a protecting group for nucleic acid synthesis" include a benzoyl group, a benzyl group, a 2-chlorophenyl group, a 4-chlorophenyl group, and a 2-propenyl group.

[0048] In one embodiment, examples of the protecting group for the "amino group in nucleic acid synthesis" include an acyl group, preferably a benzoyl group.

[0049] In one embodiment, examples of the "protecting group" for the "phosphate group protected with a protecting group for nucleic acid synthesis" include a lower alkyl group, a lower alkyl group substituted with a cyano group, an aralkyl group, an "aralkyl group in which the aryl ring is substituted with a nitro group or a halogen atom", and an "aryl group substituted with a lower alkyl group, a halogen atom, or a nitro group". Alternatively, in one embodiment, examples of the "protecting group" for the "phosphate group protected with a protecting group for nucleic acid synthesis" include a 2-cyanoethyl group, a 2,2,2-trichloroethyl group, a benzyl group, a 2-chlorophenyl group, and a 4-chlorophenyl group.

[0050] In one embodiment, examples of the "protecting group" for the "mercapto group protected with a protecting group for nucleic acid synthesis" include an aliphatic acyl group and an aromatic acyl group, preferably a benzoyl group.

[0051] As used herein, -P(R 4 )R 5 [wherein, R 4 and R 5represents, independently of each other, a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, an amino group, an alkoxy group having 1 to 6 carbon atoms, an alkylthio group having 1 to 6 carbon atoms, a cyanoalkoxy group having 1 to 6 carbon atoms, or a dialkylamino group having an alkyl group having 1 to 6 carbon atoms. Among the groups represented by, R 4 is OR 4a and R 5 is NR 5a A group that is is called a "phosphoramidite group" (where R 4a is, for example, a cyanoalkoxy group having 1 to 6 carbon atoms, and R 5a is, for example, an alkyl group having 1 to 6 carbon atoms). Preferred examples of the phosphoramidite group include a group represented by the formula -P(OC2H4CN)(N(iPr)2) or a group represented by the formula -P(OCH3)(N(iPr)2). Here, iPr represents an isopropyl group.

[0052] In this specification, the "alkylene group having 1 to 5 carbon atoms" refers to a group represented by -(CH2) n -(where n is an integer from 1 to 5), that is, a methylene group (-CH2-) and a divalent alkylene group composed of 2 to 5 methylene groups (ethylene group, trimethylene group, tetramethylene group, and pentamethylene group).

[0053] In this specification, the "alkenylene group having 2 to 5 carbon atoms" refers to a divalent group composed of a straight chain having 2 to 5 carbon atoms containing one double bond. Specific examples include -CH=CH-, -CH2-CH=CH-, -CH=CH-CH2-, -CH2-CH2-CH=CH-, -CH2-CH=CH-CH2-, -CH=CH-CH2-CH2-, -CH2-CH2-CH2-CH=CH-, -CH2-CH2-CH=CH-CH2-, -CH2-CH=CH-CH2-CH2-, and -CH=CH-CH2-CH2-CH2-.

[0054] As used herein, the terms "nucleoside" and "nucleoside analog" refer to non-natural forms of "nucleosides" in which a purine or pyrimidine base is bonded to a sugar, and those in which a sugar is bonded to an aromatic heterocyclic ring or aromatic hydrocarbon ring other than purine and pyrimidine, which can substitute for a purine or pyrimidine base.

[0055] As used herein, the terms "artificial oligonucleotide" and "oligonucleotide analog" refer to non-natural derivatives of "oligonucleotides" in which the same or different "nucleosides" or "nucleoside analogs" are linked by phosphodiester bonds, for example, 2 to 50 in number. Such analogs preferably include sugar derivatives in which the sugar moiety is modified; thioate derivatives in which the phosphodiester moiety is thioated; ester compounds in which the terminal phosphate moiety is esterified; and amide compounds in which the amino group on the purine base is amidated.

[0056] As used herein, the term "its salt" refers to a salt of the compound represented by formula (I) of the present invention. Such salts include, for example, alkali metal salts such as sodium salt, potassium salt, lithium salt; alkaline earth metal salts such as calcium salt, magnesium salt; metal salts such as aluminum salt, iron salt, zinc salt, copper salt, nickel salt, cobalt salt; inorganic salts such as ammonium salt; amine salts such as t-octylamine salt, dibenzylamine salt, morpholine salt, glucosamine salt, phenylglycine alkyl ester salt, ethylenediamine salt, N-methylglucamine salt, guanidine salt, diethylamine salt, triethylamine salt, dicyclohexylamine salt, N,N'-dibenzylethylenediamine salt, chloroprocaine salt, procaine salt, diethanolamine salt, N-benzyl-phenethylamine salt, piperazine salt, tetramethylammonium salt, tris(hydroxymethyl)aminomethane salt; halogen atom-containing hydrohalic acid salts such as hydrofluoride salt, hydrochloride salt, hydrobromide salt, hydroiodide salt; inorganic acid salts such as nitrate salt, perchlorate salt, sulfate salt, phosphate salt; lower alkanesulfonate salts such as methanesulfonate salt, trifluoromethanesulfonate salt, ethanesulfonate salt; arylsulfonate salts such as benzenesulfonate salt, p-toluenesulfonate salt; organic acid salts such as acetate salt, malate salt, fumarate salt, succinate salt, citrate salt, tartrate salt, oxalate salt, maleate salt; and amino acid salts such as glycine salt, lysine salt, arginine salt, ornithine salt, glutamate salt, aspartate salt.

[0057] As used herein, the term "pharmaceutically acceptable salts" refers to salts of oligonucleotide analogs containing at least one nucleoside structure represented by formula (II) of the present invention. Such salts include, for example, alkali metal salts such as sodium salts, potassium salts, lithium salts; alkaline earth metal salts such as calcium salts, magnesium salts; metal salts such as aluminum salts, iron salts, zinc salts, copper salts, nickel salts, cobalt salts; inorganic salts such as ammonium salts, amine salts such as t-octylamine salts, dibenzylamine salts, morpholine salts, glucosamine salts, phenylglycine alkyl ester salts, ethylenediamine salts, N-methylglucosamine salts, guanidine salts, diethylamine salts, triethylamine salts, dicyclohexylamine salts, N,N'-dibenzylethylenediamine salts, chloroprocaine salts, procaine salts, diethanolamine salts, N-benzyl-phenethylamine salts, piperazine salts, tetramethylammonium salts, tris(hydroxymethyl)aminomethane salts; halogen atom hydrogen acid salts such as hydrofluoride salts, hydrochloride salts, hydrobromide salts, hydroiodide salts; inorganic acid salts such as nitrate salts, perchlorate salts, sulfate salts, phosphate salts; lower alkane sulfonate salts such as methanesulfonate salts, trifluoromethanesulfonate salts, ethanesulfonate salts, aryl sulfonate salts such as benzenesulfonate salts, p-toluenesulfonate salts, organic acid salts such as acetate salts, malate salts, fumarate salts, succinate salts, citrate salts, tartrate salts, oxalate salts, maleate salts; and amino acid salts such as glycine salts, lysine salts, arginine salts, ornithine salts, glutamate salts, aspartate salts.

[0058] Hereinafter, the present invention will be described in detail.

[0059] (Crosslinked nucleoside) The crosslinked nucleoside of the present invention has the following formula (I):

[0060] [Chemical formula]

[0061] (In the formula, Base represents a purin-9-yl group or a 2-oxo-1,2-dihydropyrimidin-1-yl group which may have one or more arbitrary substituents selected from group α, where the group α consists of a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a mercapto group protected by a protecting group for nucleic acid synthesis, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, an amino group protected by a protecting group for nucleic acid synthesis, and a halogen atom. R 2 and R 3 are each independently a hydrogen atom, a protecting group for a hydroxyl group in nucleic acid synthesis, an alkyl group having 1 to 7 carbon atoms which may form a branch or a ring, an alkenyl group having 2 to 7 carbon atoms which may form a branch or a ring, an aryl group having 3 to 10 carbon atoms which may have one or more arbitrary substituents selected from the group α and may contain a heteroatom, an aralkyl group having an aryl moiety having 3 to 12 carbon atoms which may have one or more arbitrary substituents selected from the group α and may contain a heteroatom, an acyl group which may have one or more arbitrary substituents selected from the group α, a silyl group which may have one or more arbitrary substituents selected from the group α, a phosphate group which may have one or more arbitrary substituents selected from the group α, a phosphate group protected by a protecting group for nucleic acid synthesis, -P(R 4 )R 5 [wherein R 4 and R 5 are each independently a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, a mercapto group, a mercapto group protected by a protecting group for nucleic acid synthesis, an amino group, an alkoxy group having 1 to 6 carbon atoms, an alkylthio group having 1 to 6 carbon atoms, a cyanoalkoxy group having 1 to 6 carbon atoms, or a dialkylamino group having an alkyl group having 1 to 6 carbon atoms]. X 1 is an alkylene group having 1 to 5 carbon atoms, an alkenylene group having 2 to 5 carbon atoms, or -Y 1 -(CH2) n -, -(CH2) n -Y 1 - or -(CH2) l -Y1 -(CH2) m -[where Y 1 is a sulfonyl group, a sulfonamide group, an amide group, an ester group, or a carbonyl group, n is an integer of 1 to 5, l and m are positive integers, and the sum of l and m is 2 to 5], X 2 is an oxygen atom, a sulfur atom, -NH-, or a methylene group), or a salt thereof.

[0062] In the above formula (I), "Base" is, for example, a purine base (i.e., a purin-9-yl group) or a pyrimidine base (i.e., a 2-oxo-1,2-dihydropyrimidin-1-yl group). These bases may have one or more optional substituents selected from the group α consisting of a hydroxyl group, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, and a halogen atom.

[0063] Specific examples of the above-mentioned "Base" include an adenylyl group, a guanylyl group, a cytosinyl group, a uracilyl group, and a thyminyl group, as well as a 6-aminopurin-9-yl group, a 2,6-diaminopurin-9-yl group, a 2-amino-6-chloropurin-9-yl group, a 2-amino-6-fluoropurin-9-yl group, a 2-amino-6-bromopurin-9-yl group, a 2-amino-6-hydroxypurin-9-yl group, a 6-amino-2-methoxypurin-9-yl group, a 6-amino-2-chloropurin-9-yl group, a 6-amino-2-fluoropurin-9-yl group, a 2,6-dimethoxypurin-9-yl group, a 2,6-dichloropurin-9-yl group, a 6-mercaptopurin-9-yl group, a 2-oxo-4-amino-1,2-dihydropyrimidin-1-yl group, a 4-amino-2-oxo-5-fluoro-1,2-dihydropyrimidin-1-yl group, a 4-amino-2-oxo-5-chloro-1,2-dihydropyrimidin-1-yl group, a 2-oxo-4-methoxy-1,2-dihydropyrimidin-1-yl group, a 2-oxo-4-mercapto-1,2-dihydropyrimidin-1-yl group, a 2-oxo-4-hydroxy-1,2-dihydropyrimidin-1-yl group, a 2-oxo-4-hydroxy-5-methyl-1,2-dihydropyrimidin-1-yl group, and a 4-amino-5-methyl-2-oxo-1,2-dihydropyrimidin-1-yl group.

[0064] Alternatively, from the perspective of introduction into nucleic acid pharmaceuticals, "Base" has the following structural formula:

[0065]

Chemical formula

[0066] groups each represented thereby, and a 2-oxo-4-hydroxy-5-methyl-1,2-dihydropyrimidin-1-yl group, a 2-oxo-4-amino-1,2-dihydropyrimidin-1-yl group, a 6-aminopurin-9-yl group, a 2-amino-6-hydroxypurin-9-yl group, a 4-amino-5-methyl-2-oxo-1,2-dihydropyrimidin-1-yl group, and a 2-oxo-4-hydroxy-1,2-dihydropyrimidin-1-yl group are preferred. "Base" also preferably has a hydroxyl group and an amino group constituting the above group protected by a protecting group during the synthesis of the oligonucleotide.

[0067] As shown in formula (I), the crosslinked nucleotide of the present invention has a hexitol nucleic acid (HNA) backbone in which the nucleic acid sugar moiety is composed of a pyranose ring, and a crosslinked structure ( -X 1 -X 2 -) is introduced between the 1'-position and the 3'-position of the HNA backbone.

[0068] Here, focusing on this crosslinked structure, in one embodiment, as an example of the compound represented by formula (I), the following formulas (I-a) to (I-d):

[0069]

Chemical formula

[0070] (In formulas (I-a) to (I-d), Base, R 2 , R 3 and X 1 are the same as those defined in the above formula (I)) are mentioned.

[0071] Alternatively, in one embodiment, as another example of the compound represented by formula (I), the following formulas (I-e) to (I-h):

[0072]

Chemical formula

[0073] (In formulas (I-e) to (I-g), Base, R 2 , R 3 , X 2 , Y 1 , l, m, and n are the same as defined in the above formula (I)), and the compounds represented thereby are included.

[0074] Specific examples of the compounds represented by such formula (I) include, but are not necessarily limited to, the following formulas (I-1) to (I-3):

[0075]

Chemical formula

[0076] (In formulas (I-1) to (I-3), Base, R 2 , and R 3 are the same as defined in the above formula (I)), and the compounds represented thereby are included.

[0077] The cross-linked nucleoside of the present invention has an HNA backbone similar to the N-type conformation of natural nucleic acids, as is apparent from the above formula (I). As a result, the oligonucleotide described below has good binding affinity for single-stranded RNA (ssRNA).

[0078] (Oligonucleotide) In the present invention, the oligonucleotide can be easily produced using such a cross-linked nucleoside of formula (I) through, for example, the amidite method well-known in the art or phosphorylation as described in M. Kuwahara et al., Nucleic Acids Res., 2008, Vol. 36, No. 13, pp. 4257-4265.

[0079] The oligonucleotide of the present invention or a pharmaceutically acceptable salt thereof (hereinafter, these may be collectively referred to as "the oligonucleotide of the present invention") has the following formula (II):

[0080]

Chemical formula

[0081] (In the formula, Base represents a purin-9-yl group or a 2-oxo-1,2-dihydropyrimidin-1-yl group which may have one or more arbitrary substituents selected from group α, wherein the group α consists of a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, an amino group protected with a protecting group for nucleic acid synthesis, and a halogen atom, X 1 is an alkylene group having 1 to 5 carbon atoms, an alkenylene group having 2 to 5 carbon atoms, or -Y 1 -(CH2) n -, -(CH2) n -Y 1 - or -(CH2) l -Y 1 -(CH2) m -[wherein Y 1 is a sulfonyl group, a sulfonamide group, an amide group, an ester group, or a carbonyl group, n is an integer of 1 to 5, l and m are positive integers, and the sum of l and m is 2 to 5], X 2 is an oxygen atom, a sulfur atom, -NH- or a methylene group), and contains at least one nucleoside structure represented by the formula.

[0082] In one embodiment, as an example of the nucleoside structure of formula (II) contained in the oligonucleotide of the present invention, the following formulas (II-a) to (II-d):

[0083]

Chemical formula

[0084] (In formulas (II-a) to (II-d), Base and X 1Those represented by (similar to those defined by the above formula (II)) can be mentioned.

[0085] Alternatively, in one embodiment, as other examples of the nucleoside structure of formula (II) contained in the oligonucleotide of the present invention, the following formulas (II-e) to (II-h):

[0086]

Chemical formula

[0087] (In formulas (II-e) to (II-g), Base, X 2 , Y 1 , l, m, and n are similar to those defined by the above formula (II)) can be mentioned.

[0088] Specific examples of the nucleoside structure of formula (II) contained in such oligonucleotides of the present invention include, but are not necessarily limited to, the following formulas (II-1) to (II-3):

[0089]

Chemical formula

[0090] (In formulas (II-1) to (II-3), Base is similar to that defined by the above formula (I)) can be mentioned.

[0091] The oligonucleotide of the present invention has at least one of the above nucleoside structures at an arbitrary position. The position and number thereof are not particularly limited and can be appropriately designed according to the purpose.

[0092] Oligonucleotides (antisense molecules) containing such nucleoside structures have a dramatically improved nuclease resistance as compared to the case of using conventional 2′,4′-BNA / LNA. They also have an ssRNA binding affinity comparable to that of known 2′,4′-BNA / LNA. The oligonucleotides of the present invention also have an enzyme resistance that exceeds that of phosphorothioate-modified nucleic acids (hereinafter sometimes referred to as PS-modified nucleic acids) contained in many currently marketed nucleic acid pharmaceuticals.

[0093] From these facts, oligonucleotides synthesized using the crosslinked nucleosides of the present invention are expected to be useful as pharmaceuticals (antisense molecules) that inhibit or restore the function of specific genes to treat diseases, including antitumor agents and antiviral agents.

[0094] In particular, in the antisense method, both binding affinity for complementary sense strand RNA and resistance to in vivo DNA degrading enzymes are required. Generally, it is known that in the single-stranded state, the structure of the sugar moiety of nucleic acids constantly fluctuates between a form close to the DNA double strand and a form close to the DNA-RNA double strand or the RNA double strand. Therefore, by chemically modifying the conformation of the nucleic acid sugar moiety in a predetermined manner as in the present invention, it is possible to significantly improve the binding affinity for the target ssRNA. In addition, nucleic acid degrading enzymes cleave the phosphodiester moiety of oligonucleic acids, but in the crosslinked nucleosides of the present invention, bulky substituents are arranged on the sugar moiety, so that the degradation of oligonucleic acids can be suppressed by steric hindrance. Furthermore, in the crosslinked nucleosides of the present invention, a crosslinked structure (-X 1 -X 2 -) is introduced between the 1′-position and the 3′-position of the HNA backbone as described above. Due to the HNA backbone and the crosslinked structure, the crosslinked nucleosides of the present invention have both increased binding affinity for these target ssRNAs and enzyme resistance.

[0095] The oligonucleotides of the present invention can be formulated into parenteral preparations or liposome preparations by blending auxiliary agents commonly used in the pharmaceutical formulation art, such as excipients, binders, preservatives, oxidation stabilizers, disintegrants, lubricants, and flavoring agents. Further, for example, pharmaceutical carriers commonly used in the art can be blended to prepare topical preparations such as solutions, creams, and ointments.

Example

[0096] Hereinafter, the present invention will be described more specifically by way of examples, but the present invention is not limited to these examples.

[0097] (Example 1: Synthesis of crosslinked nucleoside (1))

[0098]

Chemical formula

[0099] (1-1) Synthesis of compound 2

[0100]

Chemical formula

[0101] To a solution of compound 1 (3.00 g, 11.02 mmol) and bis(trimethylsilyl)acetylene (3.76 g, 22.04 mmol) in anhydrous dichloromethane (50 mL) at -20 °C under a nitrogen stream, a 1.0 M solution of SnCl4·dichloromethane (16.53 mL, 16.53 mmol) was added, and the mixture was stirred at the same temperature for 0.5 hour. After the reaction was completed, the reaction solution was added to a saturated aqueous sodium bicarbonate / saturated aqueous Rochelle salt solution (= 1:1 (volume ratio), 200 mL), and the mixture was stirred at 0 °C for 30 minutes. Then, the mixture was extracted with dichloromethane, washed with water and saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure to obtain compound 2 as a crude product. This compound 2 was used in the next reaction without purification.

[0102] (1-2) Synthesis of compound 3

[0103] [Chemical formula]

[0104] To a methanol solution (50 mL) of Compound 2 obtained above, 5 M sodium methoxide - methanol solution (2.20 mL, 11.02 mmol) was added under ice - cooling, and the mixture was stirred at room temperature for 1 hour under a nitrogen stream. After the reaction was completed, strongly acidic cation - exchange resin (DOWEX 50×8 200 - 400 mesh, manufactured by Fujifilm Wako Pure Chemical Corporation) was added to the reaction solution, and the mixture was stirred for 30 minutes to neutralize it. Then the mixture was filtered, and the filtrate was concentrated. The obtained residue was purified by silica gel column chromatography (SiO2, methanol / CHCl3 = 5%) to obtain Compound 3 (1.60 g, 94%, two steps from Compound 1) as a colorless oily substance.

[0105] The physical property data of the obtained Compound 3 are shown in Table 1.

[0106] [Table 1]

[0107] (1 - 3) Synthesis of Compound 4

[0108] [Chemical formula]

[0109] To a dichloromethane solution (150 mL) of the compound 3 (5.36 g, 34.8 mmol) obtained above, meta-chloroperbenzoic acid (mCPBA) (purity 70%, 17.1 g, 69.5 mmol) was added under ice-cooling, and the mixture was stirred at room temperature for 24 hours. After the reaction was completed, the reaction solution was directly loaded onto silica gel column chromatography and simply purified (SiO2, hexane / ethyl acetate = 1:1 to 0 / 1), and a mixture of stereoisomers of epoxy diol (5.62 g) was obtained as a colorless oily substance. Next, an anhydrous acetonitrile solution (150 mL) of this epoxy diol (5.62 g), p-anisaldehyde dimethyl acetal (11.8 mL, 69.5 mmol), and (±)-camphorsulfonic acid (807.6 mg, 3.48 mmol) was heated to reflux under a nitrogen stream for 1.5 hours. After the reaction was completed, the reaction solution was neutralized with triethylamine (1 mL) and slowly ice-cooled. The resulting white solid was collected by filtration, the filtrate was distilled off under reduced pressure, and washed with methanol. The resulting white solid was collected by filtration again, and compound 4 was obtained in total (6.23 g, 62%, two steps from compound 3).

[0110] The physical property data of the obtained compound 4 are shown in Table 2.

[0111]

Table 2

[0112] (1 - 4) Synthesis of Compound 5

[0113]

Chem.

[0114] To a mixed solution of the compound 4 (300 mg, 1.04 mmol) obtained above in methanol / 1,4-dioxane (10 mL, methanol / 1,4-dioxane = 1:4 (volume ratio)), palladium / polyethyleneimine (Pd / PEI) (30 mg, 10 wt%) was added, and the mixture was stirred at room temperature for 1.5 hours under a hydrogen stream. After the reaction was completed, the mixture was loaded onto a short silica gel column chromatography and washed (CHCl3 / methanol = 14 / 1) to obtain the compound 5 as a crude product. In this crude product (compound 5), it was difficult to separate the over-reduced 1-ethyl form, so it was directly used in the next reaction without further purification.

[0115] (1-5) Synthesis of compound 6

[0116]

Chemical formula

[0117] A mixed solution of the compound 5 (298 mg) obtained above in methanol / dichloromethane (10 mL, DCM / MeOH = 4:1 (volume ratio)) was reacted with ozone at -78 °C. After 1 hour, sodium borohydride (157 mg, 4.16 mmol) was added at the same temperature, and the temperature was slowly raised to room temperature. After stirring for 1 hour, saturated aqueous ammonium chloride solution and ethyl acetate were added, and extraction was performed. The organic layer was washed with saturated aqueous sodium bicarbonate and saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO2, acetone / CHCl3 = 20% to 27%) to obtain the compound 6 (250 mg, 82%, two steps from compound 4) as a white solid.

[0118] The physical property data of the obtained compound 6 are shown in Table 3.

[0119]

Table 3

[0120] (1-6) Synthesis of compound 7

[0121]

Chem.

[0122] An anhydrous acetonitrile solution (12 mL) of Compound 6 (353.1 mg, 1.20 mmol), thymine (302.6 mg, 2.40 mmol), and 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU) (717.7 μL, 4.80 mmol) obtained above was heated at 85 °C for 48 h under microwave irradiation. After the reaction was completed, the resulting white solid was collected by filtration to obtain Compound 7 as a crude product. This Compound 7 was used in the next reaction without purification as it was.

[0123] (1 - 7) Synthesis of Compound 8

[0124]

Chem.

[0125] To an anhydrous dichloromethane solution (12 mL) of Compound 7 (516.5 mg), triethylamine (334.5 μL, 2.40 mmol), and 4-dimethylaminopyridine (14.7 mg, 0.120 mmol) obtained above, p-toluenesulfonyl chloride (TsCl) (274.5 mg, 1.44 mmol) was added under ice-cooling, and the mixture was stirred at room temperature for 2.5 h under a nitrogen stream. After the reaction was completed, the reaction solution was added to saturated aqueous sodium bicarbonate and extracted with dichloromethane. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO2, ethyl acetate / CHCl3 = 30% to 80%) to obtain Compound 8 (360 mg, 52%, two steps from Compound 6) as a white solid.

[0126] The physical property data of the obtained Compound 8 are shown in Table 4.

[0127]

Table 4

[0128] (1-8) Synthesis of Compound 9

[0129]

Chemical formula

[0130] To a solution of compound 8 (360 mg, 0.626 mmol) obtained above in anhydrous DMF (6.0 mL) was added 60% oily sodium hydride (62.7 mg, 1.57 mmol), and the mixture was stirred at room temperature for 1 hour under a nitrogen stream. After the reaction was completed, saturated aqueous ammonium chloride solution and ethyl acetate were added, and extraction was performed. The organic layer was washed with saturated aqueous sodium bicarbonate and saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO2, ethyl acetate / hexane = 60% to 90%) to obtain compound 9 (244.6 mg, 97%) as a white solid.

[0131] The physical property data of the obtained compound 9 are shown in Table 5.

[0132]

Table 5

[0133] (1-9) Synthesis of Compound 10

[0134]

Chemical formula

[0135] To a solution of compound 9 (28.7 mg, 0.0713 mmol) obtained above in methanol (1.0 mL) was added Pd(OH)2 / C (7.1 mg), and the mixture was stirred at room temperature for 1 hour under a hydrogen stream. After the reaction was completed, the mixture was filtered, washed with methanol, and the filtrate was distilled off under reduced pressure to obtain compound 10 as a crude product. This compound 10 was used in the next reaction without purification.

[0136] (1-10) Synthesis of Compound 11

[0137] [Chemical Formula]

[0138] To a pyridine anhydrous solution (1.0 mL) of Compound 10 obtained above, 4,4'-dimethoxytrityl chloride (36.2 mg, 0.107 mmol) was added, and the mixture was stirred at room temperature for 3 hours under a nitrogen stream. After the reaction was completed, methanol was added to the reaction solution, and the solvent was distilled off under reduced pressure. Ethyl acetate and saturated aqueous sodium bicarbonate were added to the obtained residue, and extraction was performed. The organic layer was washed with saturated aqueous sodium bicarbonate and saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO2, ethyl acetate / hexane = 70% to 100%) to obtain Compound 11 (31.2 mg, 75%, two steps from Compound 9) as a white solid.

[0139] The physical property data of the obtained Compound 11 are shown in Table 6.

[0140] [Table 6]

[0141] (1-11) Synthesis of Compound 12

[0142] [Chemical Formula]

[0143] To a solution of compound 11 (321.9 mg, 0.549 mmol), N,N - diisopropylethylamine (286.7 μL, 1.65 mmol), and 1 - methylimidazole (13.2 μL, 0.165 mmol) in anhydrous acetonitrile (5.5 mL) under ice - cooling, 2 - cyanoethyl - N,N - diisopropyl phosphorochloridate (183.6 μL, 0.823 mmol) was added, and the mixture was stirred at room temperature for 1 hour under a nitrogen stream. After the reaction was completed, saturated aqueous sodium bicarbonate and ethyl acetate were added, and extraction was carried out. The organic layer was washed with saturated aqueous sodium bicarbonate and saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO2, ethyl acetate / hexane = 65% to 95%) to obtain compound 12 (341.4 mg, 79%) as a white solid.

[0144] The physical property data of the obtained compound 12 are shown in Table 7.

[0145]

Table 7

[0146] (Example 2: Synthesis of Cross - linked Nucleosides (2))

[0147]

Chemical Structure

[0148] (2 - 1) Synthesis of Compound 13

[0149]

Chemical Structure

[0150] First, Compound 5 was obtained from Compound 4 in the same manner as in Example 1. Subsequently, 0.5 M 9-borabicyclo[3.3.1]nonane (9-BBN)·tetrahydrofuran solution (13.9 mL, 6.94 mmol) was added to an anhydrous tetrahydrofuran solution (6.0 mL) of the obtained Compound 5 (1.03 g), and the mixture was stirred at room temperature for 1 hour under a nitrogen stream. After the raw materials disappeared, water (20 mL) and sodium perborate tetrahydrate (5.33 g, 34.7 mmol) were added to the reaction solution under ice cooling, and the mixture was further stirred at room temperature for 1 hour. Then, the mixture was filtered, and the filtrate was extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO2, methanol / CHCl3 = 2% to 5%) to obtain Compound 13 (910 mg, 85%, two steps from Compound 4) as a white solid.

[0151] The physical property data of the obtained Compound 13 are shown in Table 8.

[0152] [Table 8]

[0153] (2-2) Synthesis of Compound 14

[0154] [Chemical formula]

[0155] An anhydrous acetonitrile solution (17.8 mL) of the above-obtained Compound 13 (1.10 g, 3.57 mmol), thymine (900 mg, 7.14 mmol), and 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU) (2.13 mL, 14.3 mmol) was heated at 100 °C for 24 hours under microwave irradiation. After the reaction was completed, the solvent was distilled off under reduced pressure, and dichloromethane and saturated sodium bicarbonate water were added for extraction. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure to obtain Compound 14 as a crude product. This Compound 14 was used in the next reaction without purification.

[0156] (2-3) Synthesis of Compound 15

[0157] [Chemical formula]

[0158] To a solution of the compound 14 (1.58 g) obtained above, triethylamine (1.24 mL, 8.92 mmol), and 4,4-dimethylaminopyridine (43.6 mg, 0.357 mmol) in anhydrous dichloromethane (36 mL) under ice-cooling, p-toluenesulfonyl chloride (TsCl) (1.02 g, 5.35 mmol) was added, and the mixture was stirred at room temperature for 6 hours under a nitrogen stream. After completion of the reaction, the reaction solution was added to saturated aqueous sodium hydrogen carbonate and extracted with dichloromethane. The organic layer was washed with saturated brine and dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO2, ethyl acetate / CHCl3 = 30% to 80%) to obtain compound 15 (1.08 g, 51%, two steps from compound 13) as a white solid.

[0159] The physical property data of the obtained compound 15 are shown in Table 9.

[0160] [Table 9]

[0161] (2-4) Synthesis of Compound 16

[0162] [Chemical formula]

[0163] To a DMF anhydrous solution (18 mL) of Compound 15 (1.08 g, 1.84 mmol) obtained above, 60% oily sodium hydride (183.5 mg, 4.59 mmol) was added, and the mixture was stirred at 90 °C for 48 hours under a nitrogen stream. After the reaction was completed, saturated aqueous ammonium chloride solution and ethyl acetate were added, and extraction was performed. The organic layer was washed with saturated aqueous sodium bicarbonate and saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO2, ethyl acetate / hexane = 60% to 100%) to obtain Compound 16 (480 mg, 63%) as a white solid.

[0164] The physical property data of the obtained Compound 16 are shown in Table 10.

[0165]

Table 10

[0166] (2-5) Synthesis of Compound 17

[0167]

Chemical formula

[0168] To a methanol solution (1.0 mL) of Compound 16 (47.1 mg, 0.113 mmol) obtained above, Pd(OH)2 / C (11.3 mg) was added, and the mixture was stirred at room temperature for 1 hour under a hydrogen stream. After the reaction was completed, the mixture was filtered and washed with methanol, and then the filtrate was distilled off under reduced pressure to obtain Compound 17 as a crude product. This Compound 17 was used in the next reaction without purification.

[0169] (2-6) Synthesis of Compound 18

[0170]

Chemical formula

[0171] To a pyridine anhydrous solution (1.0 mL) of Compound 17 obtained above was added 4,4'-dimethoxytrityl chloride (57.5 mg, 0.170 mmol), and the mixture was stirred at room temperature for 3 hours under a nitrogen stream. After the reaction was completed, methanol was added to the reaction solution, and the solvent was distilled off under reduced pressure. Ethyl acetate and saturated aqueous sodium bicarbonate were added to the obtained residue, and extraction was performed. The organic layer was washed with saturated aqueous sodium bicarbonate and saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO2, ethyl acetate / hexane = 70% to 100%) to obtain Compound 18 (41.5 mg, 61%, two steps from Compound 16) as a white solid.

[0172] The physical property data of the obtained Compound 18 are shown in Table 11.

[0173]

Table 11

[0174] (2-7) Synthesis of Compound 19

[0175]

Chemical formula

[0176] To an anhydrous acetonitrile solution (4.7 mL) of Compound 18 (282.0 mg, 0.469 mmol), N,N-diisopropylethylamine (245.3 μL, 1.41 mmol), and 1-methylimidazole (11.3 μL, 0.141 mmol) obtained above was added 2-cyanoethyl-N,N-diisopropylphosphorochloridate (157.1 μL, 0.704 mmol) under ice cooling, and the mixture was stirred at room temperature for 1 hour under a nitrogen stream. After the reaction was completed, saturated aqueous sodium bicarbonate and ethyl acetate were added, and extraction was performed. The organic layer was washed with saturated aqueous sodium bicarbonate and saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO2, ethyl acetate / hexane = 65% to 95%) to obtain Compound 19 (317.3 mg, 84%) as a white solid.

[0177] The physical property data of the obtained Compound 19 are shown in Table 12.

[0178] [Table 12]

[0179] (Example 3: Synthesis of Crosslinked Nucleosides (3))

[0180] [Chemical formula]

[0181] (3-1) Synthesis of Compound 20

[0182] [Chemical formula]

[0183] First, Compound 5 was obtained from Compound 4 in the same manner as in Example 1. Next, an anhydrous acetonitrile solution (18 mL) of the obtained Compound 5 (1.15 g), thymine (1.01 g, 8.00 mmol), and 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU) (2.39 mL, 16.0 mmol) was heated at 100 °C for 24 hours under microwave irradiation. After the reaction was completed, the solvent was distilled off under reduced pressure, and dichloromethane and saturated aqueous sodium bicarbonate were added for extraction. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO2, acetone / CHCl3 = 20% to 40%) to obtain a mixture (1.17 g, Compound 20:1-ethyl isomer = 1:0.26) of Compound 20 and the 1-ethyl isomer (by-product) as a pale yellow solid. Since it was difficult to separate Compound 20 and the 1-ethyl isomer, they were used in the next reaction without purification.

[0184] The physical property data of the obtained compound 20 are shown in Table 13. For NMR, it was measured in the state of a mixture of the by-product (1-ethyl compound) and compound 20, and the assignment of only the signals of the obtained compound 20 is shown.

[0185]

Table 13

[0186] (3-2) Synthesis of Compound 21

[0187]

Chemical formula

[0188] To a solution of the mixture of the obtained compound 20 and 1-ethyl compound (1.17 g, about 2.81 mmol) in anhydrous tetrahydrofuran (4.7 mL) was added 60% oily sodium hydride (336.8 mg, 8.42 mmol), and the mixture was stirred at room temperature for 1 hour under a nitrogen stream. Subsequently, allyl bromide (308.9 μL, 3.65 mmol) was added to the reaction solution, and the mixture was stirred at room temperature for 4 days under a nitrogen stream. After the reaction was completed, saturated aqueous ammonium chloride solution and ethyl acetate were added, and extraction was performed. The organic layer was washed with saturated aqueous sodium bicarbonate solution and saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO2, ethyl acetate / hexane = 40% to 70%) to obtain a mixture of compound 21 and 1-ethyl compound (by-product) (900 mg, compound 21:1-ethyl compound = 1:0.26) as a yellow solid.

[0189] The physical property data of the obtained compound 21 are shown in Table 14. For NMR, it was measured in the state of a mixture of the by-product (1-ethyl compound) and compound 21, and the assignment of only the signals of the obtained compound 21 is shown.

[0190]

Table 14

[0191] (3-3) Synthesis of Compound 22

[0192]

Chemical formula

[0193] To a solution of a mixture of Compound 21 and its 1-ethyl derivative (900 mg, ca. 1.56 mmol) obtained above in deoxygenated toluene (31 mL), the second-generation Grubbs catalyst (66.3 mg, 0.078 mmol) was added at room temperature under a nitrogen stream, and the mixture was stirred at 50 °C for 5.5 h. Thereafter, the reaction solution was distilled off under reduced pressure, and the resulting residue was purified by silica gel column chromatography (SiO2, ethyl acetate / hexane = 60% to 100%) to obtain Compound 22 (564.1 mg, 33% from Compound 4) as a pale yellow solid.

[0194] The physical property data of the obtained Compound 22 are shown in Table 15.

[0195]

Table 15

[0196] (3-4) Synthesis of Compound 23

[0197]

Chemical formula

[0198] To a methanol solution (12.0 mL) of Compound 22 (522.9 mg, 1.22 mmol) obtained above, Pd(OH)2 / C (122.0 mg) was added, and the mixture was stirred at room temperature for 3 h under a hydrogen stream. After the reaction was completed, the mixture was filtered and washed with methanol, and the filtrate was distilled off under reduced pressure to obtain Compound 23 as a crude product. This Compound 23 was used in the next reaction without purification.

[0199] (3-5) Synthesis of Compound 24

[0200] [Chemistry]

[0201] To a pyridine anhydrous solution (12.0 mL) of Compound 23 obtained above, 4,4'-dimethoxytrityl chloride (620.3 mg, 1.83 mmol) was added, and the mixture was stirred at room temperature for 2.5 hours under a nitrogen stream. After the reaction was completed, methanol was added to the reaction solution, and the solvent was distilled off under reduced pressure. Ethyl acetate and saturated aqueous sodium bicarbonate were added to the obtained residue, and extraction was performed. The organic layer was washed with saturated aqueous sodium bicarbonate and saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO2, acetone / chloroform = 15% to 40%) to obtain Compound 24 (530.1 mg, 71%, two steps from Compound 22) as a white solid.

[0202] The physical property data of the obtained Compound 24 are shown in Table 16.

[0203] [Table 16]

[0204] (3 - 6) Synthesis of Compound 25

[0205] [Chemistry]

[0206] To a solution of compound 24 (227.2 mg, 0.370 mmol), N,N - diisopropylethylamine (193.2 μL, 1.12 mmol), and 1 - methylimidazole (8.90 μL, 0.111 mmol) in anhydrous acetonitrile (3.7 mL) was added 2 - cyanoethyl - N,N - diisopropyl phosphorochloridate (123.7 μL, 0.554 mmol) under ice - cooling, and the mixture was stirred at room temperature for 1 hour under a nitrogen stream. After the reaction was complete, saturated aqueous sodium bicarbonate and ethyl acetate were added, and extraction was performed. The organic layer was washed with saturated aqueous sodium bicarbonate and saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO2, ethyl acetate / hexane = 40% to 80%) to obtain compound 25 (235.4 mg, 78%) as a white solid.

[0207] The physical property data of the obtained compound 25 are shown in Table 17.

[0208]

Table 17

[0209] (Example 4: Synthesis of Cross - linked Nucleosides (4))

[0210]

Chemical formula

[0211] (4 - 1) Synthesis of Compound 26

[0212]

Chemical formula

[0213] To a pyridine solution (8 mL) of the compound 24 (484.7 mg, 0.79 mmol) obtained above, chlorotriethylsilane (650 μL, 3.9 mmol) was added dropwise, and the mixture was stirred at room temperature for 4 hours under a nitrogen stream. After the reaction was completed, saturated aqueous sodium bicarbonate and ethyl acetate were added, and extraction was performed. The organic layer was washed with water and saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO2, hexane / ethyl acetate = 60 / 40 to 40 / 60) to obtain compound 26 (551.2 mg, 96%) as a white solid.

[0214] The physical property data of the obtained compound 26 are shown in Table 18.

[0215] [Table 18]

[0216] (4-2) Synthesis of Compound 27

[0217] [Chemical formula]

[0218] To an anhydrous acetonitrile solution (7 mL) of the compound 26 (514.3 mg, 0.71 mmol), triethylamine (1.5 mL, 10.8 mmol), and 1,2,4-triazole (714.4 mg, 10.3 mmol) obtained above, phosphoryl chloride (200 μL, 2.15 mmol) was added dropwise, and the mixture was stirred at room temperature for 45 minutes under a nitrogen stream. After the reaction was completed, saturated aqueous sodium bicarbonate and ethyl acetate were added, and extraction was performed. The organic layer was washed with water and saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. 1,4-Dioxane (7 mL) and 28% aqueous ammonia solution (1.2 mL, 9.9 mmol) were added, and the mixture was stirred at room temperature for 3 hours. After the reaction was completed, the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO2, ethyl acetate / methanol = 95 / 5 to 90 / 10) to obtain compound 27 (511.9 mg, 99%) as a white solid.

[0219] The physical property data of the obtained compound 27 are shown in Table 19.

[0220]

Table 19

[0221] (4-3) Synthesis of Compound 28

[0222]

Chemical formula

[0223] To a pyridine solution (10 mL) of the compound 27 (702.8 mg, 0.97 mmol) obtained above, benzoic anhydride (328.4 mg, 1.45 mmol) was added, and the mixture was stirred at 40 °C for 6 hours under a nitrogen stream. After the reaction was completed, saturated aqueous sodium bicarbonate and ethyl acetate were added, and extraction was performed. The organic layer was washed with water and saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO2, chloroform / methanol = 99 / 1 to 97 / 3) to obtain compound 28 (634.8 mg, 79%) as a white solid.

[0224] The physical property data of the obtained compound 28 are shown in Table 20.

[0225]

Table 20

[0226] (4-4) Synthesis of Compound 29

[0227]

Chemical formula

[0228] To a solution of compound 28 (43.5 mg, 0.05 mmol) obtained above in tetrahydrofuran (THF) (1.0 mL), tetrabutylammonium fluoride (1 M THF solution, 157 μL, 0.16 mmol) was added dropwise, and the mixture was stirred at room temperature for 4 hours. After the reaction was completed, the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO2, hexane / ethyl acetate = 60 / 40 to 40 / 60), and compound 29 (35.6 mg, 95%) was obtained as a white solid.

[0229] The physical property data of the obtained compound 29 are shown in Table 21.

[0230]

Table 21

[0231] (4-5) Synthesis of compound 30

[0232]

Chemical formula

[0233] To a solution of compound 29 (31.0 mg, 0.04 mmol) obtained above in anhydrous acetonitrile (1 mL), N,N-diisopropylethylamine (23 μL, 0.13 mmol), 1-methylimidazole (1 μL, 0.013 mmol) and 2-cyanoethyl-N,N-diisopropylphosphorochloridate (15 μL, 0.067 mmol) were added, and the mixture was stirred at room temperature for 4 hours under a nitrogen stream. After the reaction was completed, methanol, saturated aqueous sodium bicarbonate and ethyl acetate were added, and extraction was performed. The organic layer was washed with water and saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO2, hexane / ethyl acetate = 65 / 35 to 45 / 55), and compound 30 (34.3 mg, 84%) was obtained as a white solid.

[0234] The physical property data of the obtained compound 30 are shown in Table 22.

[0235]

Table 22

[0236] (Example 5: Synthesis of Crosslinked Nucleosides (5))

[0237]

Chemical Formula

[0238] (5-1) Synthesis of Compound 31

[0239]

Chemical Formula

[0240] A solution of the compound 5 (1.27 g, 4.36 mmol), adenine (650 mg, 4.81 mmol) and 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU) (976 μL, 6.54 mmol) in anhydrous dimethylformamide (11.0 mL) was heated at 150 °C for 2 hours under microwave irradiation. After cooling, ethyl acetate and water were added for extraction. The organic layer was washed with saturated brine and then dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO2, ethyl acetate / methanol = 95 / 5 to 85 / 15) to obtain a mixture of compound 31 and the 1-ethyl isomer (1.69 g) as a pale yellow solid. Since it was difficult to separate compound 31 and the 1-ethyl isomer, they were used in the next reaction without purification as they were.

[0241] The physical property data of the obtained compound 31 are shown in Table 23. For NMR, it was measured in the state of a mixture of the by-product (1-ethyl isomer) and compound 31, and the assignment of only the signals of the obtained compound 31 is shown.

[0242]

Table 23

[0243] (5-2) Synthesis of Compound 32

[0244]

Chemical formula

[0245] To a solution of the mixture of compound 31 and its 1-ethyl derivative (423 mg, ca. 0.10 mmol) obtained above in anhydrous tetrahydrofuran (10 mL) was added N,N-dimethylformamide dimethylacetal (400 μL, 2.99 mmol), and the mixture was stirred at room temperature for 16 h under a nitrogen stream. After completion of the reaction, the solvent was distilled off under reduced pressure. Anhydrous dimethylformamide (10 mL) and 60% oily sodium hydride (60.1 mg, 1.50 mmol) were added, and the mixture was stirred at -30 °C for 1 h under a nitrogen stream. Thereafter, allyl bromide (100 μL, 1.19 mmol) and sodium iodide (30.1 mg, 0.20 mmol) were added to the reaction solution, and the mixture was stirred at -30 °C for 3 h under an argon stream. After completion of the reaction, methanol (1 mL) was added and the mixture was stirred at -20 °C for 20 min, followed by addition of a saturated aqueous ammonium chloride solution. The mixture was extracted with ethyl acetate. The organic layer was washed with saturated aqueous sodium hydrogen carbonate solution, water and saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO2, ethyl acetate / methanol = 98 / 2 to 93 / 7) to obtain a mixture of compound 32 and its 1-ethyl derivative (426.0 mg) as a white solid.

[0246] The physical property data of the obtained compound 32 are shown in Table 24. For NMR measurement, it was carried out on a mixture of the by-product (1-ethyl derivative) and compound 32, and the assignment of only the signals of the obtained compound 32 is shown.

[0247]

Table 24

[0248] (5-3) Synthesis of Compound 33

[0249]

Chemical formula

[0250] To a methanol solution (4.9 mL) of the mixture of compound 32 and the 1-ethyl compound (254.8 mg, about 0.49 mmol) obtained above, 2N aqueous sodium hydroxide solution (1.46 mL, 2.92 mmol) was added, and the mixture was stirred at 40 °C for 1 hour. After the reaction was completed, the precipitated white solid was collected by filtration. The filtrate was evaporated under reduced pressure, and the obtained residue was washed with methanol. The resulting white solid was collected by filtration again. Together, a mixture of compound 33 and the 1-ethyl compound (194.6 mg) was obtained as a white solid.

[0251] The physical property data of the obtained compound 33 are shown in Table 25. For NMR, it was measured in the state of a mixture of the by-product (1-ethyl compound) and compound 33, and the assignment of only the signals of the obtained compound 33 is shown.

[0252]

Table 25

[0253] (5-4) Synthesis of compound 34

[0254]

Chem.

[0255] To a deoxygenated toluene solution (4.5 mL) of the mixture of compound 33 and the 1-ethyl compound (23.5 mg, about 0.045 mmol) obtained above, second-generation Hoveyda-Grubbs catalyst (3.2 mg, 0.005 mmol) and p-benzoquinone (0.7 mg, 0.006 mmol) were added at room temperature under a nitrogen stream, and the mixture was stirred at 50 °C for 20 hours. Then, the reaction solution was evaporated under reduced pressure, and the obtained residue was purified by silica gel column chromatography (SiO2, chloroform / acetone = 95 / 5 to 70 / 30) to obtain compound 34 (18.2 mg, 53%, 6 steps from compound 4) as a white solid.

[0256] The physical property data of the obtained compound 34 are shown in Table 26.

[0257] [Table 26]

[0258] (5-5) Synthesis of Compound 35

[0259] [Chemical formula]

[0260] Acetic acid (116 μL) was added to a methanol / THF mixed solvent (3.9 mL, methanol / THF = 2 / 1) of the above-obtained compound 34 (57.8 mg, 0.13 mmol), and palladium hydroxide / carbon (about 50% water-wetted, 48.1 mg) was added. After that, the mixture was stirred at 60 °C for 7 hours under a hydrogen stream. After the reaction was completed, the mixture was filtered, washed with ethyl acetate, and then the filtrate was evaporated under reduced pressure to obtain compound 35 (29.5 mg, 70%) as a white solid.

[0261] The physical property data of the obtained compound 35 are shown in Table 27.

[0262] [Table 27]

[0263] (5-6) Synthesis of Compound 36

[0264] [Chemical formula]

[0265] To a pyridine solution (1 mL) of compound 35 (25.2 mg, 0.078 mmol) obtained above was added tetramethylsilyl chloride (40 μL, 0.32 mmol), and the mixture was stirred at room temperature for 2 hours under a nitrogen stream. Then, benzoyl chloride (35 μL, 0.30 mmol) was added dropwise, and the mixture was stirred at room temperature for 18 hours under a nitrogen stream. After the reaction was completed, aqueous ammonia (680 μL) was added, and after 5 hours, the reaction solution was concentrated. Pyridine (1 mL) and aqueous ammonia were added to the residue, and the mixture was stirred at room temperature for 3 hours and then concentrated. The obtained residue was purified by silica gel column chromatography (SiO2, ethyl acetate / methanol = 100 / 0 to 93 / 7) to obtain compound 36 (18.2 mg, 55%) as a white solid.

[0266] The physical property data of the obtained compound 36 are shown in Table 28.

[0267]

Table 28

[0268] (5-7) Synthesis of compound 37 To an anhydrous pyridine solution of compound 36 obtained above was added 4,4'-dimethoxytrityl chloride, and the mixture was stirred under a nitrogen stream. After the reaction was completed, methanol was added to the reaction solution, and the solvent was distilled off under reduced pressure. Ethyl acetate and saturated aqueous sodium bicarbonate were added to the obtained residue, and extraction was performed. The organic layer was washed with saturated aqueous sodium bicarbonate and saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography to obtain compound 37.

[0269] (5-8) Synthesis of compound 38 To a solution of Compound 37, N,N - diisopropylethylamine, and 1 - methylimidazole obtained above in anhydrous acetonitrile, 2 - cyanoethyl - N,N - diisopropyl phosphorochloridate is added under ice cooling, and the mixture is stirred under a nitrogen stream. After the reaction is complete, saturated aqueous sodium hydrogen carbonate and ethyl acetate are added, and extraction is performed. The organic layer is washed with saturated aqueous sodium hydrogen carbonate and saturated brine, dried over anhydrous sodium sulfate, and the solvent is distilled off under reduced pressure. The obtained residue is purified by silica gel column chromatography to obtain Compound 38.

[0270] (Example 6: Synthesis of Cross - linked Nucleosides (6))

[0271]

Chemical formula

[0272] (6 - 1) Synthesis of Compound 39

[0273]

Chemical formula

[0274] A solution of Compound 5 (170.6 mg, 0.59 mmol), 2 - amino - 6 - chloropurine (199.3 mg, 1.18 mmol), potassium carbonate (448.0 mg, 3.24 mmol), and 18 - crown - 6 (387.7 mg, 1.47 mmol) in HMPA (2 mL) was stirred at room temperature under a nitrogen stream for 14 hours. After the reaction was complete, the reaction solution was poured into ice water and stirred for 1 hour. The precipitated white solid was collected by filtration and washed with ice water and diethyl ether. The obtained residue was purified by silica gel column chromatography (SiO2, chloroform / methanol = 100 / 0 to 95 / 5) to obtain a mixture (75.4 mg) of Compound 39 and the 1 - ethyl isomer as a white solid.

[0275] The physical property data of the obtained compound 39 are shown in Table 29. For NMR, the measurement was carried out on a mixture of the by-product (1-ethyl compound) and compound 39, and the assignment of only the signals of the obtained compound 39 is shown.

[0276]

Table 29

[0277] (6-2) Synthesis of Compound 40

[0278]

Chemical Formula

[0279] To a solution of a mixture of the obtained compound 39 and the 1-ethyl compound (72.0 mg, about 0.16 mmol) in anhydrous dimethylformamide (16 mL) was added N,N-dimethylformamide dimethylacetal (199.3 mg, 1.18 mmol), and the mixture was stirred at 50 °C under a nitrogen stream for 19 hours. After the reaction was completed, the reaction solution was concentrated. The obtained residue was purified by silica gel column chromatography (SiO2, ethyl acetate) to obtain a mixture of compound 40 and the 1-ethyl compound (50.1 mg) as a white solid.

[0280] The physical property data of the obtained compound 40 are shown in Table 30. For NMR, the measurement was carried out on a mixture of the by-product (1-ethyl compound) and compound 40, and the assignment of only the signals of the obtained compound 40 is shown.

[0281]

Table 30

[0282] (6-8) Synthesis of Compound 48 Using the compound 40 obtained above, compound 48 was synthesized from compound 40 by the same method as in Example 5 (each synthesis method from compound 31 to compound 38).

[0283] (Example 7: Synthesis of Crosslinked Nucleosides (7))

[0284] [Chemical Formula]

[0285] (7-1) Synthesis of Compound 51

[0286] [Chemical Formula]

[0287] To a solution of Compound 1 (1.03 g, 3.77 mmol) in anhydrous acetonitrile (14.7 mL), allyltrimethylsilane (0.705 mL, 4.44 mmol) was added under ice-cooling, and then trimethylsilyl triflate (0.71 mL, 3.93 mmol) was added dropwise. The mixture was stirred at room temperature for 1 hour under a nitrogen stream. After the reaction was completed, saturated aqueous sodium hydrogen carbonate was added to the reaction solution and stirred. Then, the mixture was extracted with ethyl acetate. After washing with water and saturated brine, it was dried over anhydrous sodium sulfate and the solvent was distilled off under reduced pressure. The obtained crude product was used in the next reaction without further purification as it was.

[0288] (7-2) Synthesis of Compound 52

[0289] [Chemical Formula]

[0290] To a solution of Compound 51 obtained above in methanol (14.4 mL), 5 M NaOMe (methanol solution, 0.75 mL, 3.75 mmol) was added under ice-cooling, and the mixture was stirred at room temperature for 1 hour under a nitrogen stream. After the reaction was completed, DOWEX 50×8 200 mesh was added to the reaction solution and stirred to neutralize it. Then the mixture was filtered, and the filtrate was concentrated to obtain Compound 52 (0.56 g, 87%, two steps from Compound 1) as a yellowish-brown oily substance. This Compound 52 is described by Mallikharjuna R. Lambu et al., J. Med. Chem., 2013, 56,6122-6135 It is described in

[0291] (7-3) Synthesis of Compound 54

[0292] [Chemical formula]

[0293] To a solution of the above-obtained Compound 52 (201.1 mg, 1.18 mmol) in toluene (4.70 mL) was added mCPBA (purity 70%, 866 mg, 3.51 mmol) under ice-cooling, and the mixture was stirred at 0 °C for 1 hour. After the reaction was completed, cyclohexene was added to the reaction solution and stirred. Then the mixture was filtered, and the filtrate was concentrated. Next, the obtained epoxy diol was azeotroped with toluene, and then anhydrous acetonitrile (5.0 mL), p-anisaldehyde dimethyl acetal (0.40 mL, 2.35 mmol), and (±)-camphorsulfonic acid (27.3 mg, 0.118 mmol) were added, and the mixture was stirred at 50 °C for 16 hours under a nitrogen stream. After the reaction was completed, the reaction solution was neutralized with triethylamine (0.25 mL) under ice-cooling. The resulting mixed solution was purified by silica gel column chromatography (SiO2, hexane / ethyl acetate = 80 / 20 to 20 / 80), and Compound 54 (92.1 mg, 26%, two steps from Compound 52) was obtained as a yellow solid.

[0294] The physical property data of the obtained Compound 54 are shown in Table 31.

[0295] [Table 31]

[0296] (7-4) Synthesis of Compound 55

[0297] [Chemical formula]

[0298] A solution of the compound 54 (574.8 mg, 1.89 mmol) obtained above, thymine (480 mg, 3.81 mmol), and 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU) (1.13 mL, 7.57 mmol) in anhydrous acetonitrile (9.4 mL) was heated at 100 °C for 24.5 hours under microwave irradiation. Thymine (477.2 mg, 3.78 mmol) and DBU (1.13 mL, 7.57 mmol) were further added to the reaction solution and reacted at 100 °C for 17 hours. After the reaction was completed, the resulting mixed solution was purified by silica gel column chromatography (SiO2, hexane / ethyl acetate = 40 / 60). The obtained compound was dissolved in dichloromethane and washed with saturated aqueous sodium bicarbonate and saturated brine. Thereafter, the organic layer was dried over anhydrous sodium sulfate and the solvent was distilled off under reduced pressure to obtain a white solid 55 (732.7 mg, 90%).

[0299] The physical property data of the obtained compound 55 are shown in Table 32.

[0300]

Table 32

[0301] (7-5) Synthesis of Compound 56

[0302]

Chemical Structure

[0303] To a solution of the compound 55 (254.4 mg, 0.59 mmol) obtained above in anhydrous THF (6.0 mL) was added sodium hydride (60% oily, 61.8 mg, 1.55 mmol) under ice-cooling, and the mixture was stirred at room temperature for 1 hour under a nitrogen stream. Then, allyl bromide (60 μL, 0.71 mmol) was added dropwise to the solution, sodium iodide (27.1 mg, 0.18 mmol) was added, and the mixture was stirred at 50 °C for 9 hours. After the reaction was completed, saturated aqueous ammonium chloride was added, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated aqueous sodium hydrogen carbonate and saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The resulting residue was purified by silica gel column chromatography (SiO2, chloroform / methanol = 7 / 1) to obtain the compound 56 (55.5 mg, 63%) as a white solid.

[0304] The physical property data of the obtained compound 56 are shown in Table 33.

[0305]

Table 33

[0306] (7-6) Synthesis of Compound 57

[0307]

Chem.

[0308] To a deoxygenated dichloroethane solution (50 mL) of the compound 56 (234.7 mg, 0.50 mmol) obtained above were added 1,4-benzoquinone (5.2 mg, 0.048 mmol) and the second-generation Hoveyda-Grubbs catalyst (17.0 mg, 0.027 mmol) under a nitrogen stream at room temperature, and the mixture was stirred at 70 °C for 1.5 hours. Then, the reaction solution was distilled off under reduced pressure, and the resulting residue was purified by silica gel column chromatography (SiO2, hexane / ethyl acetate = 33 / 67). The obtained crude product was used in the next reaction without further purification.

[0309] (7-7) Synthesis of Compound 58

[0310]

Chem.

[0311] To a methanol solution (2.9 mL) of the crude product of Compound 57 (128.5 mg, about 0.291 mmol) obtained above was added Pd(OH)2 / C (31.1 mg, about 50% water-wetted), and the mixture was stirred at room temperature for 10 minutes under a hydrogen stream. After the reaction was completed, the mixture was filtered, washed with methanol, and then the filtrate was evaporated under reduced pressure. The obtained crude product 58 was used in the next reaction as it was without further purification.

[0312] (7-8) Synthesis of Compound 59

[0313]

Chem.

[0314] To a pyridine anhydrous solution (3.0 mL) of Compound 58 obtained above was added 4,4'-dimethoxytrityl chloride (142.7 mg, 0.42 mmol), and the mixture was stirred at room temperature for 1.5 hours under a nitrogen stream. After the reaction was completed, aqueous sodium bicarbonate and ethyl acetate were added to the reaction solution for extraction. The organic layer was washed with saturated aqueous sodium bicarbonate and saturated brine, dried over anhydrous sodium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO2, hexane / ethyl acetate = 25 / 75) to obtain Compound 59 (118.2 mg, 38%, 3 steps from Compound 56) as a white solid.

[0315] The physical property data of the obtained Compound 59 are shown in Table 34.

[0316]

Table 34

[0317] (7-9) Synthesis of Compound 60

[0318] [Chemistry]

[0319] To a solution of compound 59 (34.6 mg, 0.055 mmol) and N,N - diisopropylethylamine (30 μL, 0.176 mmol) in anhydrous acetonitrile (1.0 mL), 10% 1 - methylimidazole (anhydrous acetonitrile solution, 13.0 μL, 0.0163 mmol) was added. Then, under ice - cooling, 2 - cyanoethyl - N,N - diisopropyl phosphorochloridate (20.0 μL, 0.0897 mmol) was added, and the mixture was stirred at room temperature for 1 hour under an argon stream. After the reaction was completed, saturated aqueous sodium bicarbonate and ethyl acetate were added for extraction. The organic layer was washed with saturated aqueous sodium bicarbonate and saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO2, hexane / ethyl acetate = 33 / 67) to obtain compound 60 (38.3 mg, 84%) as a white solid.

[0320] The physical property data of the obtained compound 60 are shown in Table 35.

[0321] [Table 35]

[0322] (Example 8: Synthesis and Purification of Oligonucleotides) Using compounds 12, 19, and 25 prepared in Examples 1 - 3 as amidite blocks, oligonucleotides were synthesized as follows. Compounds other than compounds 12, 19, and 25 that constitute the oligonucleotides were purchased from Proligo unless otherwise specified.

[0323] Compounds 12, 19, and 25 prepared in Examples 1 to 3 were each prepared as a 0.1 M anhydrous acetonitrile solution and charged into an nS-8 Oligonucleotides Synthesizer manufactured by GeneDesign. Each synthesis was carried out under trityl-off conditions. Activator-42 (registered trademark) (manufactured by Proligo) was used as the activator, and the condensation time of Compounds 12, 19, and 25 was extended to 120 seconds × 5. Other operations were carried out according to the usual phosphoramidite method.

[0324] After completion of the synthesis, the product was treated with 28% aqueous ammonia solution at room temperature for 1.5 hours to cut it out from the column carrier, and then left standing at 55 °C for 15 hours to deprotect the base moiety and phosphate moiety. Subsequently, the obtained crude oligonucleotide was purified by reverse-phase HPLC.

[0325] The conditions for this HPLC were as follows. Eluent · Solution A: 0.1 M triethylammonium acetate buffer (pH 7.0) · Solution B: Acetonitrile Gradient · Concentration of Solution B: 6 - 12% (for 20 minutes) Column · XBridgeTM OST C18 2.5 μm (10 × 50 mm) (preparative) manufactured by Waters · XBridgeTM OST C18 2.5 μm (4.6 × 50 mm) (analytical) manufactured by Waters Flow rate · 4.0 mL / min (preparative) · 1.0 mL / min (analytical) Column temperature · 50 °C Detection · UV (260 nm)

[0326] The composition of the purified oligonucleotide was determined by MALDI-TOF-MS measurement. In this measurement, first, a matrix (1 μL) obtained by mixing an aqueous solution of 3-hydroxypicolinic acid (10 mg / mL) and an aqueous solution of diammonium citrate (1 mg / mL) at a volume ratio of 1:1 was dried on an anchor chip, and then an aqueous solution of oligonucleotide (50 μM, 1 μL) was placed thereon and dried again. Thereafter, MALDI-TOF-MS measurement was performed. The measurement of the molecular weight was carried out in the negative mode, and oligothymidylic acids (7mer, 15mer, and 23mer) were used as external standards. Also, the quantification of the synthesized oligonucleotide was performed by measuring the ultraviolet absorption at 260 nm using an absorbance measuring device (SHIMADZU UV-1800 manufactured by Shimadzu Corporation).

[0327] (Example 9: Evaluation of double-strand forming ability) As described in Example 8, oligonucleotides having the sequences shown in the following table were synthesized and purified. (1) 5'-d(GCGTTTTTTGCT)-3' (SEQ ID NO: 1) (2) 5'-d(GCGTTHTTTGCT)-3' (SEQ ID NO: 2) (3) 5'-d(GCGTT1TTTGCT)-3' (SEQ ID NO: 3) (4) 5'-d(GCGTT2TTTGCT)-3' (SEQ ID NO: 4) (5) 5'-d(GCGTT3TTTGCT)-3' (SEQ ID NO: 5) (6) 5'-d(GCGHTHTHTGCT)-3' (SEQ ID NO: 6) (7) 5'-d(GCG1T1T1TGCT)-3' (SEQ ID NO: 7) (8) 5'-d(GCG2T2T2TGCT)-3' (SEQ ID NO: 8) (9) 5'-d(GCG3T3T3TGCT)-3' (SEQ ID NO: 9) (10) 5'-d(GCGTTHHHTGCT)-3' (SEQ ID NO: 10) (11) 5'-d(GCGTT111TGCT)-3' (SEQ ID NO: 11) (12) 5'-d(GCGTT222TGCT)-3' (SEQ ID NO: 12) (13) 5’-d(GCGTT333TGCT)-3’ (SEQ ID NO: 13) (14) 5’-d(GCGHHHHHHGCT)-3’ (SEQ ID NO: 14) (15) 5’-d(GCG111111GCT)-3’ (SEQ ID NO: 15) (16) 5’-d(GCG222222GCT)-3’ (SEQ ID NO: 16) (17) 5’-d(GCG333333GCT)-3’ (SEQ ID NO: 17)

[0328] The above H, 1, 2, and 3 represent the following: H = HNA-T (compound of Non-Patent Document 4) 1 = compound 12 (BANA-T1) 2 = compound 19 (BANA-T2) 3 = compound 25 (BANA-T3)

[0329] Using single-stranded oligo RNA 5’-r(AGCAAAAAACGC)-3’ (SEQ ID NO: 18) and single-stranded oligo DNA 5’-d(AGCAAAAAACGC)-3’ (SEQ ID NO: 19) as target strands, the duplex-forming ability (binding affinity) was examined as follows.

[0330] The duplex-forming ability of the oligonucleotide was examined by measuring the T m value after annealing various oligonucleotides with the target strand to form a duplex. More specifically, a mixed solution of each oligonucleotide (final concentration 4 μM) and sodium chloride (final concentration 100 mM) in a phosphate buffer (10 mM, pH 7.2, 130 μL) was bathed in boiling water and slowly cooled to room temperature. Then, it was cooled to 5°C under a nitrogen stream and the measurement was started. The temperature was raised to 90°C at 0.5°C / min, and the absorbance at 260 nm was plotted at 0.5°C intervals. The T m value was calculated by the midpoint method or the differential method (SEQ ID NO: 17) and taken as the average value in three independent measurements.

[0331] Table 36 (Arrays (1) to (9)) and Table 37 (Arrays (1) and (10) to (17)) show the results of the duplex-forming ability. In these tables, the results for single-stranded oligo RNA are indicated as "ssRNA", the results for single-stranded oligo DNA are indicated as "ssDNA", and the T m of each oligo nucleotide and the T m fluctuation temperature ("ΔT m / mod.") are shown.

[0332] [Table 36]

[0333] [Table 37]

[0334] For ssRNA, the T m value was highest for BANA-T3 (Compound 25), followed by BANA-T2 (Compound 19) and BANA-T1 (Compound 12) in that order. For each of BANA-T1, BANA-T2 (Compound 19) and BANA-T3 (Compound 25), by introducing a plurality into the oligo nucleotide, the T m value increased, indicating a tendency for the duplex-forming ability with respect to RNA to improve. Also, for each of BANA-T1, BANA-T2 (Compound 19) and BANA-T3 (Compound 25), by introducing them continuously, the duplex-forming ability with respect to RNA was further improved, showing a higher duplex-forming ability than in the case of HNA-T.

[0335] (Example 10: Evaluation of Base Selectivity) Regarding the above Arrays (1) to (5), as target strands, single-stranded oligo RNA 5'-r(AGCAAAYAACGC)-3' and single-stranded oligo DNA 5'-d(AGCAAAYAACGC)-3' were used to similarly examine the duplex-forming ability (binding affinity). For single-stranded oligoRNA, Y is any one of rA (SEQ ID NO: 18), rU (SEQ ID NO: 20), rG (SEQ ID NO: 21), and rC (SEQ ID NO: 22), and for single-stranded oligoDNA, Y is any one of dA (SEQ ID NO: 19), dT (SEQ ID NO: 23), dG (SEQ ID NO: 24), and dC (SEQ ID NO: 25).

[0336] The results are shown in Table 38 below. In the table, ΔT m is the T m value of the mismatch minus the T m value of the match (dA or rA).

[0337]

Table 38

[0338] By introducing each of BANA-T1 (Compound 12), BANA-T2 (Compound 19), and BANA-T3 (Compound 25) into the oligonucleotide, the formation of base pairs with G was suppressed compared to the case using natural DNA (dT) (SEQ ID NO: 1).

[0339] (Example 11: Evaluation of nuclease resistance) As described in Example 8, oligonucleotides having the following 10-mer sequences were synthesized and purified and used as test oligonucleotides: 5’-d(TTTTTTTTTX)-3’

[0340] X was any one of the following: X = thymidine (dT) X = 5’-phosphorothioate thymidine (PS) X = LNA-T (LNA) X = HNA-T (HNA) X = Compound 12 (BANA-T1) X = Compound 19 (BANA-T2) X = Compound 25 (BANA-T3)

[0341] To 50 mM Tris-HCl buffer (pH 8.0) containing 7.5 μM of the test oligonucleotide and 10 mM magnesium chloride, 1.0 μg / mL of 3'-exonuclease (Crotalus adamanteus venom phosphodiesterase, CAVP) was added and incubated at 37 °C. At the start of incubation (0 minutes), after 5 minutes, 10 minutes, 20 minutes, and 40 minutes, 20 μL of the sample was taken out each time and combined with 90 μL of MilliQ to make 110 μL. Of this, 100 μL was analyzed by reverse-phase HPLC to calculate the ratio of the uncleaved oligonucleotide. The evaluation was derived from three independent measurements.

[0342] The results are shown in Figure 1. As is clear from Figure 1, when X is LNA-T (LNA) or HNA-T (HNA), the oligonucleotide was degraded by the nuclease in the same way as natural DNA (dT). Even in the case of phosphorothioated (PS) oligo (X = 5'-phosphorothioate thymidine (PS)), the remaining rate of the uncleaved oligonucleotide after 40 minutes of nuclease treatment was about 20%, whereas when each of compound 12 (BANA-T1), compound 19 (BANA-T2), and compound 25 (BANA-T3) was used as X, about 60% remained uncleaved even after 40 minutes of nuclease treatment and was difficult to degrade.

[0343] (Example 12: Evaluation of nuclease resistance) As described in Example 8, oligonucleotides having the following 10-mer sequences were synthesized and purified and used as the test oligonucleotides: 5'-d(TTTTTTTTXT)-3'

[0344] X was any of the following: X = 3'-phosphorothioate thymidine (PS) X = LNA-T (LNA) X = HNA-T (HNA) X = compound 12 (BANA-T1) X = compound 19 (BANA-T2) X = Compound 25 (BANA-T3)

[0345] 1.0 μg / mL of 3'-exonuclease (Crotalus adamanteus venom phosphodiesterase, CAVP) was added to 50 mM Tris-HCl buffer (pH 8.0) containing 7.5 μM of the test oligonucleotide and 10 mM magnesium chloride, and incubated at 37 °C. Twenty minutes after the start of incubation, 20 μL of the sample was taken out and combined with 90 μL of MilliQ to make 110 μL. Of this, 100 μL was analyzed by reverse-phase HPLC to calculate the ratio of the uncleaved oligonucleotide.

[0346] The results are shown in Figure 2. As is clear from Figure 2, when X is LNA-T (LNA) or HNA-T (HNA), the oligonucleotide was completely degraded by the nuclease. For phosphorothioated (PS) oligonucleotides (X = 3'-phosphorothioate thymidine (PS)), the remaining rate of the uncleaved oligonucleotide after 20 minutes of nuclease treatment was about 50%. When Compound 12 (BANA-T1) and Compound 19 (BANA-T2) were used as X, the remaining rates after 20 minutes of nuclease treatment were 2% and 33%, respectively, while when Compound 25 (BANA-T3) was used as X, 95% remained, and it was overwhelmingly more resistant to degradation compared to other modifications.

[0347] (Example 13: Synthesis and purification of oligonucleotides and evaluation of duplex formation ability) As described in Example 8, oligonucleotides of the following sequences were synthesized and purified: (18) 5'-d(GCGTTLLLTGCT)-3' (SEQ ID NO: 26) (19) 5'-d(GCGTTL33TGCT)-3' (SEQ ID NO: 27) (20) 5'-d(GCGTT3L3TGCT)-3' (SEQ ID NO: 28) (21) 5'-d(GCGTT33LTGCT)-3' (SEQ ID NO: 29)

[0348] The above L and 3 represent the following: L = LNA-T (LNA) 3 = Compound 25 (BANA-T3)

[0349] The yields of each oligonucleotide and the results of MALDI-TOF MS measurements are shown in Table 39.

[0350]

Table 39

[0351] Furthermore, as described in Example 9, the ability of each oligonucleotide to form a double strand with RNA was evaluated. As the target strand, single-stranded oligo RNA 5'-r(AGCAAAAAACGC)-3' (SEQ ID NO: 18) was used. The results are shown in Table 38. Table 38 shows the melting temperature T of each oligonucleotide during double-strand formation m and the difference in T with sequence (18) m ("ΔT m "). As shown in Table 40, it was found that the oligonucleotide containing Compound 25 (BANA-T3) has a double-strand forming performance as high as that of the oligonucleotide containing LNA.

[0352]

Table 40

[0353] (Example 14: Synthesis and purification of oligonucleotides and evaluation of double-strand forming ability) Using Compound 25 (BANA-T3) and Compound 30 (BANA- m C3), as described in Example 8, the oligonucleotides of sequences (22) to (25) shown in Table 41 were synthesized and purified (also shown in SEQ ID NOS: 30 to 33, respectively). The oligonucleotides in Table 41 are antisense oligonucleotides against mMALAT1.

[0354] Phosphorothioate (PS) modification was carried out using 0.05 M ((dimethylamino - methylidene) amino) - 3H - 1,2,4 - dithiazoline - 3 - thione (DDTT) (pyridine / acetonitrile (3:2) solution, GLEN RESEARCH) according to the method recommended by the reagent manufacturer.

[0355] Table 41 also shows the yields of these oligonucleotides and the results of MALDI - TOF MS measurement.

[0356]

Table 41

[0357] Furthermore, in the same manner as in Example 9, the ability of each oligonucleotide to form a double - strand with RNA was evaluated. As controls, the two sequences shown in Table 42 below were used (also shown in SEQ ID NO: 34 and SEQ ID NO: 35 respectively).

[0358]

Table 42

[0359] As the target strand, single - stranded oligoRNA 5’ - r(GCAUUCAGUGAACUAG) - 3’ (SEQ ID NO: 36) was used. The results are shown in Table 43. Table 43 shows the melting temperature T m of each oligonucleotide upon double - strand formation and the difference in T m from that of sequence (26) (「ΔT m 」). As shown in Table 41, it was found that the oligonucleotides containing compound 30 (BANA - m C3) and compound 25 (BANA - T3) have a high double - strand forming performance equivalent to that of the oligonucleotides containing LNA.

[0360]

Table 43

[0361] (Example 15: Synthesis and Purification of Oligonucleotides and Evaluation of Toxicity Reduction Effect) As described in Example 8, the oligonucleotide of the sequence (28) shown in Table 44 was synthesized and purified (SEQ ID NO: 37). Phosphorothioate (PS) modification was performed in the same manner as in Example 14. Table 44 also shows the yield of this oligonucleotide and the results of MALDI-TOF MS measurement.

[0362] [Table 44]

[0363] The test oligonucleotide (20 mg / kg) shown in Table 45 was administered intraperitoneally to 6-week-old male C57BL / 6J mice (5 mice / group). After 96 hours, blood was collected under inhalation anesthesia (isoflurane), and the mice were euthanized by exsanguination. Then, the activities of aspartate transaminase (AST) and alanine transaminase (ALT) in the serum were measured using an automatic analyzer (Fujifilm DryChem 4000V).

[0364] [Table 45]

[0365] Table 46 shows the activities of aspartate transaminase (AST) and alanine transaminase (ALT) in the blood when the test oligonucleotide was administered and when physiological saline was administered. In the group administered with the sequence (29) known to exhibit hepatotoxicity, all 5 mice died. On the other hand, the oligonucleotide of the sequence (28) in which a part of the sequence of the oligonucleotide of the sequence (29) was replaced with BANA showed almost no increase in ALT and AST, and a toxicity reduction effect was confirmed.

[0366] [Table 46]

[0367] (Example 16: Evaluation of the effect of antisense oligonucleotides on expression suppression in mouse body) As described in Example 8, oligonucleotides of sequences (22) to (25) and (30) shown in Table 47 were synthesized and purified (also shown in SEQ ID NOs: 30 to 33 and 39, respectively). Phosphorothioate (PS) modification was performed in the same manner as in Example 14. The oligonucleotides in Table 47 are antisense oligonucleotides against mMALAT1.

[0368] [Table 47]

[0369] A test oligonucleotide (20 nmol: 200 μL of 100 μM physiological saline solution) was administered to the tail vein of 6-week-old mice (BALB / cAnNCrlCrlj, female) (5 mice / group). 72 hours later, blood was collected under inhalation anesthesia (isoflurane), and the mice were euthanized by exsanguination. Then, each tissue was collected and RNA extraction (kit used: RNeasy) was performed. The mRNA expression level of MALAT1 in each tissue was measured by real-time PCR (kit used: One Step TB Green (registered trademark) PrimeScript TM RT-PCR Kit (Perfect Real Time), manufactured by Takara Bio Inc.). In real-time PCR, the following primers were used: MALAT1 forward: acattccttgaggtcggcaa (SEQ ID NO: 40) MALAT1 reverse: cacccgcaaaggcctacata (SEQ ID NO: 41) GAPDH forward: tcaccaccatggagaaggc (SEQ ID NO: 42) GAPDH reverse: gctaagcagttggtggtgca (SEQ ID NO: 43)

[0370] The results are shown in FIGS. 3 and 4. FIGS. 3 and 4 show the relative MALAT1 expression levels in various tissues of mice upon administration of various oligonucleotides (FIG. 3: liver, heart, kidney, pancreas, skeletal muscle, lung and stomach, and FIG. 4: spleen, skin, large intestine, brain, mammary gland, eyeball and cartilage). The "relative MALAT1 expression level" was expressed as a relative value with the expression level in the case of administration of only physiological saline (without oligonucleotide) being set to 1. In FIGS. 3 and 4, the oligonucleotides of sequences (22) to (25) are shown as ON22 to ON25, respectively. In FIGS. 3 and 4, the display of the bars showing the results was distinguished between the oligonucleotides of sequences (22) to (25) ( "ON22" to "ON25"), which are oligonucleotides containing compounds 25 (BANA-T3) and 30 (BANA- m C3), the oligonucleotide of sequence (30) ( "ON30"), which is an oligonucleotide containing LNA instead of BANA, and the control (administration of only physiological saline) ( "physiological saline").

[0371] Oligonucleotides of sequences (22) to (25) containing BANA such as compounds 25 and 30 showed equivalent or higher target gene suppression effects in many tissues compared to the oligonucleotide of sequence (30) containing LNA instead of BANA.

[0372] (Example 17: Synthesis and purification of oligonucleotides) Using compound 60 (BANA-T4), the oligonucleotide of the following sequence (31) was synthesized and purified as described in Example 8. (31) 5’-d(GCGTT4TTTGCT)-3’(SEQ ID NO: 44) 4 = compound 60 (BANA-T4)

[0373] The composition of the purified oligonucleotide was determined by MALDI-TOF-MS measurement as described in Example 8. The synthesized oligonucleotide was quantified using an absorbance measuring device.

[0374]

Table 48

Industrial Applicability

[0375] According to the present invention, there are provided novel cross-linked nucleosides capable of substituting for phosphorothioate-modified nucleic acids and nucleotides using the same. The oligonucleotides obtained using the cross-linked nucleosides of the present invention are useful, for example, as materials for nucleic acid pharmaceuticals.

Claims

1. A compound represented by the following formula (I) or a salt thereof: 【Chemical 1】 (In the formula, Base represents a purin-9-yl group or a 2-oxo-1,2-dihydropyrimidin-1-yl group which may have one or more arbitrary substituents selected from group α, where the group α consists of a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a mercapto group protected by a protecting group for nucleic acid synthesis, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, an amino group protected by a protecting group for nucleic acid synthesis, and a halogen atom, R 2 and R 3 are each independently a hydrogen atom, a protecting group for a hydroxyl group in nucleic acid synthesis, an alkyl group having 1 to 7 carbon atoms which may form a branch or a ring, an alkenyl group having 2 to 7 carbon atoms which may form a branch or a ring, an aryl group having 3 to 10 carbon atoms which may have one or more arbitrary substituents selected from the α group and may contain a heteroatom, an aralkyl group having an aryl moiety having 3 to 12 carbon atoms which may have one or more arbitrary substituents selected from the α group and may contain a heteroatom, an acyl group which may have one or more arbitrary substituents selected from the α group, a silyl group which may have one or more arbitrary substituents selected from the α group, a phosphate group which may have one or more arbitrary substituents selected from the α group, a phosphate group protected by a protecting group for nucleic acid synthesis, -P(R 4 )R 5 [wherein, R 4 and R 5 each independently represent a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, a mercapto group, a mercapto group protected by a protecting group for nucleic acid synthesis, an amino group, an alkoxy group having 1 to 6 carbon atoms, an alkylthio group having 1 to 6 carbon atoms, a cyanoalkoxy group having 1 to 6 carbon atoms, or a dialkylamino group having an alkyl group having 1 to 6 carbon atoms]] represents, X 1 is an alkylene group having 1 to 5 carbon atoms or an alkenylene group having 2 to 5 carbon atoms, X 2 is an oxygen atom, the protecting group is a lower alkyl group; a lower alkenyl group; an acyl group; a tetrahydropyranyl or tetrahydrothiopyranyl group; a tetrahydrofuranyl or tetrahydrothiofuranyl group; a silyl group; a lower alkoxymethyl group; a lower alkoxylated lower alkoxymethyl group; a halogeno lower alkoxymethyl group; a lower alkoxylated ethyl group; a halogenated ethyl group; a methyl group substituted with 1 to 3 aryl groups; a methyl group substituted with 1 to 3 aryl groups where the aryl ring is substituted with a lower alkyl group, a lower alkoxy group, a halogen atom or a cyano group; a lower alkoxycarbonyl group; a lower alkoxycarbonyl group substituted with a halogen atom or a tri-lower alkylsilyl group; an alkenyloxycarbonyl group; or an aralkyloxycarbonyl group which may have an aryl ring substituted with a lower alkoxy or nitro group).

2. The compound or a salt thereof according to Claim 1, wherein the formula (I) is any one of the following formulas (I-1) to (I-3): 【Chemical Formula 2】

3. ​ The compound or a salt thereof according to claim 1 or 2, wherein the Base is a 6-aminopurin-9-yl group, 2,6-diaminopurin-9-yl group, 2-amino-6-chloropurin-9-yl group, 2-amino-6-fluoropurin-9-yl group, 2-amino-6-bromopurin-9-yl group, 2-amino-6-hydroxypurin-9-yl group, 6-amino-2-methoxypurin-9-yl group, 6-amino-2-chloropurin-9-yl group, 6-amino-2-fluoropurin-9-yl group, 2,6-dimethoxypurin-9-yl group, 2,6-dichloropurin-9-yl group, 6-mercaptopurin-9-yl group, 2-oxo-4-amino-1,2-dihydropyrimidin-1-yl group, 4-amino-2-oxo-5-fluoro-1,2-dihydropyrimidin-1-yl group, 4-amino-2-oxo-5-chloro-1,2-dihydropyrimidin-1-yl group, 2-oxo-4-methoxy-1,2-dihydropyrimidin-1-yl group, 2-oxo-4-mercapto-1,2-dihydropyrimidin-1-yl group, 2-oxo-4-hydroxy-1,2-dihydropyrimidin-1-yl group, 2-oxo-4-hydroxy-5-methyl-1,2-dihydropyrimidin-1-yl group, or 4-amino-5-methyl-2-oxo-1,2-dihydropyrimidin-1-yl group.

4. The Base is a group represented by the following formula: [Chemical Formula 3] The compound or a salt thereof according to any one of claims 1 to 3, wherein the Base is a group represented by the following formula:

5. An oligonucleotide containing at least one nucleoside structure represented by the following formula (II) or a pharmaceutically acceptable salt thereof: 【Chemical Formula 4】 (In the formula, Base represents a purin-9-yl group or 2-oxo-1,2-dihydropyrimidin-1-yl group which may have one or more arbitrary substituents selected from the α group, where the α group consists of a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a mercapto group protected by a protecting group for nucleic acid synthesis, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, an amino group protected by a protecting group for nucleic acid synthesis, and a halogen atom. X 1 is an alkylene group having 1 to 5 carbon atoms or an alkenylene group having 2 to 5 carbon atoms, X 2 is an oxygen atom, The protecting group is a lower alkyl group; a lower alkenyl group; an acyl group; a tetrahydropyranyl or tetrahydrothiopyranyl group; a tetrahydrofuranyl or tetrahydrothiofuranyl group; a silyl group; a lower alkoxymethyl group; a lower alkoxylated lower alkoxymethyl group; a halogeno lower alkoxymethyl group; a lower alkoxylated ethyl group; a halogenated ethyl group; a methyl group substituted with 1 to 3 aryl groups; a methyl group substituted with 1 to 3 aryl groups in which the aryl ring is substituted with a lower alkyl group, a lower alkoxy group, a halogen atom or a cyano group; a lower alkoxycarbonyl group; a lower alkoxycarbonyl group substituted with a halogen atom or a tri-lower alkylsilyl group; an alkenyloxycarbonyl group; or an aralkyloxycarbonyl group which may be substituted with a lower alkoxy or nitro group on the aryl ring). Claim 6 The formula (II) is any one of the following formulas (II-1) to (II-3): 【Chemical Formula 5】 The oligonucleotide according to claim 5, or a pharmaceutically acceptable salt thereof, represented by any of them. Claim 7 The Base is a 6-aminopurin-9-yl group, 2,6-diaminopurin-9-yl group, 2-amino-6-chloropurin-9-yl group, 2-amino-6-fluoropurin-9-yl group, 2-amino-6-bromopurin-9-yl group, 2-amino-6-hydroxypurin-9-yl group, 6-amino-2-methoxypurin-9-yl group, 6-amino-2-chloropurin-9-yl group, 6-amino-2-fluoropurin-9-yl group, 2,6-dimethoxypurin-9-yl group, 2,6-dichloropurin-9-yl group, 6-mercaptopurin-9-yl group, 2-oxo-4-amino-1,2-dihydropyrimidin-1-yl group, 4-amino-2-oxo-5-fluoro-1,2-dihydropyrimidin-1-yl group, 4-amino-2-oxo-5-chloro-1,2-dihydropyrimidin-1-yl group, 2-oxo-4-methoxy-1,2-dihydropyrimidin-1-yl group, 2-oxo-4-mercapto-1,2-dihydropyrimidin-1-yl group, 2-oxo-4-hydroxy-1,2-dihydropyrimidin-1-yl group, 2-oxo-4-hydroxy-5-methyl-1,2-dihydropyrimidin-1-yl group, or 4-amino-5-methyl-2-oxo-1,2-dihydropyrimidin-1-yl group, and the oligonucleotide according to claim 5 or 6 or a pharmaceutically acceptable salt thereof.

8. The Base is a group represented by the following formula: 【Chemical Formula 6】 and the oligonucleotide according to any one of claims 5 to 7 or a pharmaceutically acceptable salt thereof.

Citation Information

Patent Citations

  • Oligomeric compounds and methods

    US20120021515A1

  • Tetrahydropyran nucleic acid analogs

    US20120022014A1

  • Carbocyclic bicyclic nucleic acid analogs

    WO2008154401A2

  • Carbocyclic alpha-l-bicyclic nucleic acid analogs

    WO2009067647A1

  • Bicyclic cyclohexitol nucleic acid analogs

    WO2009100320A2