Flora improver, antibacterial agent, flora improvement method, and bacterial count suppression method
Agarooligosaccharides and 3,6-anhydro-L-galactose-based solutions selectively reduce harmful gut bacteria without impacting beneficial ones, enhancing flora health and reducing side effects.
Patent Information
- Application Number
- JP2025522884
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2024-02-15
- Filing Date
- 2025-02-14
- Publication Date
- 2025-07-17
- Estimated Expiration
- 2045-02-14
AI Technical Summary
Conventional prebiotics fail to effectively increase beneficial bacteria while reducing harmful bacteria due to environmental limitations and competitive relationships, leading to potential side effects from reducing beneficial bacteria.
The use of agarooligosaccharides and 3,6-anhydro-L-galactose, or oligosaccharides with 3,6-anhydro-L-galactose at the reducing end, in specific dosages that do not suppress the growth of Bifidobacterium and Lactobacillus, while effectively reducing harmful bacteria such as Ruminococcus and Fusobacterium.
This approach creates an environment favorable for beneficial bacteria to thrive by reducing harmful bacteria without affecting Bifidobacterium and Lactobacillus, improving flora health and reducing side effects like diarrhea.
Smart Images

Figure 0007709716000001_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a flora improver, an antibacterial agent, a flora improvement method, and a bacterial count suppression method, which are characterized by using agarooligosaccharide, 3,6-anhydro-L-galactose, and / or an oligosaccharide having 3,6-anhydro-L-galactose at the reducing end in an amount that does not suppress the number of Bifidobacterium and / or Lactobacillus bacteria.
Background Art
[0002] Humans usually coexist with microorganisms that live in groups in specific parts of the body, such as the skin, nose, mouth, throat, large intestine, and vagina. The microbial community present in these certain environments is called the "flora". It is known that the flora of the body is deeply involved in the health status of the host, and maintaining a good flora leads to the maintenance and improvement of health.
[0003] Therefore, substances that improve the flora are in demand. For example, substances that are utilized by intestinal bacteria to improve the flora are called prebiotics, and fructooligosaccharide, galactooligosaccharide, dietary fiber, etc. are known. In addition, Patent Document 1 discloses an intestinal flora improver containing soy isoflavone as an active ingredient.
Prior Art Documents
Patent Documents
[0004]
Patent Document 1
Summary of the Invention
Problems to be Solved by the Invention
[0005] Many conventional prebiotics serve as substrates for specific beneficial bacteria such as Bifidobacterium, promoting the growth of these bacteria or activating their metabolism to improve the flora. However, whether in the intestine or on the skin, there is a limit to the environmental carrying capacity of the specific site where the flora exists. There is a competitive relationship between harmful bacteria and beneficial bacteria in the target flora. If the harmful bacteria already have an advantage, there is concern that there is a limit to the effect of increasing the beneficial bacteria with prebiotics that serve as food for the beneficial bacteria.
[0006] Therefore, the inventors considered that by reducing harmful bacteria without reducing beneficial bacteria, the flora can be improved more effectively even in a situation where harmful bacteria are dominant. That is, an object of the present invention is to provide a technology capable of reducing harmful bacteria without reducing beneficial bacteria, as well as a flora improving agent and an antibacterial agent using the same.
[0007] Furthermore, there are many probiotic products (such as foods, supplements, feeds, pharmaceuticals, etc.) containing typical beneficial bacteria such as Bifidobacterium and Lactobacillus. According to the technology capable of reducing harmful bacteria without reducing beneficial bacteria, it is considered that it can also contribute to the improvement of the productivity, storage stability, and effectiveness of these products, as well as the stability and improvement of their manufacturing and quality.
[0008] As a result of intensive research, the inventors found that agarooligosaccharides, 3,6-anhydro-L-galactose, and oligosaccharides having 3,6-anhydro-L-galactose at the reducing end can suppress the number of harmful bacteria such as the genus Ruminococcus and the genus Fusobacterium without suppressing the number of representative beneficial bacteria such as Bifidobacterium and Lactobacillus at a predetermined concentration. Based on such findings, the following inventions were completed.
[0009] (1) The first aspect of the flora improving agent according to the present invention is characterized in that it contains agarooligosaccharide as an active ingredient and uses the active ingredient in any of the following amounts (a) to (c); (a) The dosage that does not suppress the number of bacteria of the genus Bifidobacterium, (b) The dosage that does not suppress the number of bacteria of the genus Lactobacillus, (c) The dosage of 80 mg or more and less than 12,000 mg per day.
[0010] (2) The first aspect of the antibacterial agent according to the present invention is characterized in that it uses agarooligosaccharide as an active ingredient and uses the active ingredient in any of the following dosages (a) to (c); (a) The dosage that does not suppress the number of bacteria of the genus Bifidobacterium, (b) The dosage that does not suppress the number of bacteria of the genus Lactobacillus, (c) The dosage of 80 mg or more and less than 12,000 mg per day.
[0011] (3) In the present invention, the agarooligosaccharide may contain agarobiose.
[0012] (4) The second aspect of the flora improver according to the present invention is characterized in that it uses 3,6-anhydro-L-galactose and / or an oligosaccharide having this at the reducing end as an active ingredient and uses the active ingredient in any of the following dosages (a) to (c); (a) The dosage that does not suppress the number of bacteria of the genus Bifidobacterium, (b) The dosage that does not suppress the number of bacteria of the genus Lactobacillus, (c) The dosage of 80 mg or more and less than 12,000 mg per day.
[0013] (5) The second aspect of the antibacterial agent according to the present invention is characterized in that it uses 3,6-anhydro-L-galactose and / or an oligosaccharide having this at the reducing end as an active ingredient and uses the active ingredient in any of the following dosages (a) to (c); (a) The dosage that does not suppress the number of bacteria of the genus Bifidobacterium, (b) The dosage that does not suppress the number of bacteria of the genus Lactobacillus, (c) The dosage of 80 mg or more and less than 12,000 mg per day.
[0014] (6) The method for improving the flora according to the present invention (hereinafter sometimes simply referred to as "flora improvement method" in the present invention) includes a step of using agarooligosaccharide, 3,6-anhydro-L-galactose and / or an oligosaccharide having the same at the reducing end in any of the following usage amounts (a) to (c); (a) A usage amount that does not suppress the number of bacteria of the genus Bifidobacterium, (b) A usage amount that does not suppress the number of bacteria of the genus Lactobacillus, (c) A usage amount of 80 mg or more and less than 12,000 mg per day.
[0015] (7) The method for suppressing the number of bacteria according to the present invention (hereinafter sometimes simply referred to as "bacterial count suppression method" in the present invention) is a method for suppressing the number of bacteria other than those of the genus Bifidobacterium and / or the genus Lactobacillus, and includes a step of using agarooligosaccharide, 3,6-anhydro-L-galactose and / or an oligosaccharide having the same at the reducing end in any of the following usage amounts (a) to (c); (a) A usage amount that does not suppress the number of bacteria of the genus Bifidobacterium, (b) A usage amount that does not suppress the number of bacteria of the genus Lactobacillus, (c) A usage amount of 80 mg or more and less than 12,000 mg per day.
[0016] (8) The use according to the present invention is the use of agarooligosaccharide, 3,6-anhydro-L-galactose and / or an oligosaccharide having the same at the reducing end for producing the flora improving agent or antibacterial agent according to the present invention.
[0017] The present invention may be used except for medical acts.
Effects of the Invention
[0018] According to the present invention, it is possible to suppress the number of harmful bacteria without suppressing the number of beneficial bacteria. By the specific decrease in harmful bacteria, an environment in which beneficial bacteria can grow is created in the flora, and as a result, it is considered that the occupancy rate of beneficial bacteria increases. Therefore, according to the present invention, the flora can be effectively improved. In addition, it can contribute to the production, quality improvement, and effect improvement of probiotic products containing beneficial bacteria.
[0019] In addition, conventional oral antibacterial agents also exhibit antibacterial effects on beneficial intestinal bacteria, resulting in side effects such as diarrhea due to the decrease in beneficial bacteria. According to the present invention, since beneficial bacteria are not reduced, such side effects can be expected to be reduced.
[0020] In addition, agarooligosaccharide, 3,6-anhydro-L-galactose, and oligosaccharides having this at the reducing end, which are the active ingredients of the present invention, are sugars made from agar that has been ingested as a food since ancient times, and their safety is extremely high. Therefore, according to the present invention, it is possible to improve the flora or suppress the number of specific bacteria without having concerns about safety.
Brief Description of the Drawings
[0021]
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Embodiments for Carrying Out the Invention
[0022] Hereinafter, the present invention will be further described. The present invention provides a bacterial flora improving agent according to the first and second aspects and an antibacterial agent according to the first and second aspects. In the present invention, these agents may be collectively referred to as "this agent" or any one of these agents. Further, the present invention provides the use of agarooligosaccharide, 3,6-anhydro-L-galactose and / or an oligosaccharide having this at the reducing end for producing this agent.
[0023] In addition, the present invention provides a method for improving the bacterial flora and a method for suppressing the number of bacteria. The method for suppressing the number of bacteria is a method for suppressing the number of other bacteria without suppressing the number of bacteria belonging to the genus Bifidobacterium and / or the genus Lactobacillus. Here, "other bacteria" means bacteria other than the genus Bifidobacterium and / or the genus Lactobacillus.
[0024] "Flora improver" refers to a composition that improves the flora. In the present invention, "improving the flora" means increasing the proportion or number of beneficial bacteria in the flora, or decreasing the proportion or number of harmful bacteria. Whether the flora has been improved can be confirmed, for example, by measuring the number of bacteria of one or more bacterial species reported as beneficial bacteria or the number of bacteria of one or more bacterial species reported as harmful bacteria in the flora.
[0025] "Antibacterial agent" refers to a composition having an activity (antibacterial activity) that suppresses the growth and proliferation of bacteria.
[0026] "Beneficial bacteria" refer to bacteria that can bring about some beneficial effects, directly or indirectly, to humans and animals. For example, bacteria that exhibit effects contributing to the maintenance and promotion of health, the production and quality improvement of foods, pharmaceuticals, cosmetics, etc., environmental conservation, environmental improvement, and the promotion of crop growth are exemplified. Specific bacterial species include, for example, Bifidobacterium bifidum, B. breve, B. infantis (reclassified as B. longum subsp. infantis), B. longum, B. adolescentis, B. pseudolongum, B. thermophilum, B. lactis, B. animalis, B. pseudocatenulatum, etc. of the genus Bifidobacterium (Bifidobacteria), Lactiplantibacillus plantarum of the genus Lactiplantibacillus, Lactobacillus delbrueckii, L. acidophilus, L. casei, L. paracasei, L. plantarum, L. helveticus, L. salivarius, L. rhamnosus, L. bulgaricus, L. fermentum, L. reuteri, etc. of the genus Lactobacillus, etc. can be exemplified.
[0027] "Harmful bacteria" refers to bacteria that can directly or indirectly exert some adverse effects on humans and animals. For example, bacteria that have an adverse impact on the health of the host or the environment are exemplified. Specific bacterial species include, for example, the genus Lachnococcus such as Lachnococcus gnavus, the genus Fusobacterium such as Fusobacterium mortiferum and F. nucleatum, the genus Blautia such as Blautia wexlerae, B. luti, B. producta, B. coccoides, the genus Enterococcus such as Enterocloster bolteae and E. faecalis, the genus Treponema such as Treponema brennaborense and T. denticola, the genus Streptococcus such as Streptococcus parasanguinis and S. pneumoniae, the genus Bacteroides such as Bacteroides acidifaciens, B. caccae, B. acidifaciens, B. fragilis, Marvinbryantia formatexigens, Anaerotruncus colihominis, Tannerella forsythia, Porphyromonas gingivalis, Escherichia coli, Roseburia faecis, Faecalibacterium prausnitzii, Eubacterium rectale, Haemophlus influenzae, Moraxella catarrhalis, Rothia mucilaginosa, Mycoplasma salivarium, Helicobacter pylori, Actinobacillus actinomycetemcomitans, Gammaproteobacteria (class Gammaproteobacteria), Erysipelotrichia (class Erysipelotrichia), and the like can be exemplified.
[0028] In the present invention, suppressing the number of bacteria and suppressing growth are synonymous. Similarly, not suppressing the number of bacteria and not suppressing growth are synonymous.
[0029] "To ""suppress the number of bacteria"" includes cases where the number of bacteria is decreased, as well as cases where the number of bacteria is maintained at an equivalent level or increased, but the degree of increase is smaller compared to the case where the active ingredient of the present invention (agarooligosaccharide, 3,6-anhydro-L-galactose and / or oligosaccharide having this at the reducing end) is not used."
[0030] "Also, ""not suppressing the number of bacteria"" includes cases where even if the number of bacteria has decreased, the number of bacteria is equivalent (no significant difference) to the case where the active ingredient of the present invention is not used, or the degree of decrease is smaller compared to the case where the active ingredient of the present invention is not used."
[0031] Whether the number of a specific bacterium is suppressed or not can be confirmed according to a conventional method. For example, as shown in the examples described later, if a specific bacterium is in an isolated state, the active ingredient of the present invention is added to the medium for culturing it, and compared with the case where this is not added, the degree of growth can be confirmed by a turbidity method or the like."
[0032] "Also, for a specimen in which a plurality of bacterial species are co-cultured or a specimen reflecting a flora (feces, cecal contents, intestinal lavage fluid, a sample obtained by scraping the oral cavity, etc.), the number of each bacterium can be confirmed by quantitative PCR using a primer specific to the bacterium. That is, the number of bacteria is compared by quantitative PCR between the case where the active ingredient of the present invention is used and the case where it is not used, and for each bacterium, the presence or absence of suppression of the number of bacteria can be confirmed."
[0033] The present invention is characterized by using agarooligosaccharide, 3,6-anhydro-L-galactose and / or oligosaccharide having this at the reducing end as an active ingredient."
[0034] Agarooligosaccharide is an oligosaccharide of an even sugar composed of repeating units of agarobiose, a disaccharide consisting of D-galactose and 3,6-anhydro-L-galactose. Examples of agarooligosaccharides include agarobiose, which is the smallest unit and a disaccharide; agarotetraose, which is a tetrasaccharide; agarohexaose, which is a hexasaccharide; agarooctaose, which is an octasaccharide; agarodecaose, which is a decasaccharide, and the like. In the present invention, the agarooligosaccharide contains at least one of these oligosaccharides, and may consist of one kind or may contain two or more kinds.
[0035] As shown in the examples described later, among agarooligosaccharides, agarobiose and agarotetraose exhibit particularly high growth inhibitory effects against harmful bacteria. Therefore, it is preferable that the agarooligosaccharide contains agarobiose. In this case, the agarooligosaccharide may consist only of agarobiose or may contain agarooligosaccharides other than agarobiose. Examples of the content ratio of agarobiose in the agarooligosaccharide in this case include 1 to 100% by mass, 10 to 100% by mass, 20 to 100% by mass, 30 to 100% by mass, 40 to 100% by mass, 50 to 100% by mass, and the like.
[0036] Agarooligosaccharide is an oligosaccharide having 3,6-anhydro-L-galactose at the reducing end. Therefore, in the present invention, 3,6-anhydro-L-galactose or an oligosaccharide having this at the reducing end may be used as an active ingredient. Examples of the number of sugars of the oligosaccharide in this case include 2 to 8 sugars, 2 to 10 sugars, 2 to 12 sugars, and the like.
[0037] As the agarooligosaccharide, commercially available agarooligosaccharide (agar oligosaccharide) can be used, and it can also be produced and used according to a conventional method. Examples of a general production method of agarooligosaccharide include, for example, a method of hydrolyzing agar. Hydrolysis includes a method using an acid and a method using an enzyme.
[0038] Examples of the acid decomposition method include using the solid acid described in Japanese Patent No. 4796697, using mineral acids such as sulfuric acid and hydrochloric acid, using organic acids such as acetic acid and citric acid, etc., and any method may be used. According to acid decomposition, an even sugar having 3,6-anhydro-L-galactopyranose at the reducing end can be obtained.
[0039] Examples of the enzymatic decomposition method include decomposition by α-agarase and decomposition by β-agarase. According to α-agarase, similar to the case of acid decomposition, an even sugar having 3,6-anhydro-L-galactopyranose at the reducing end can be obtained. The decomposition by α-agarase can be carried out, for example, by the method described in Japanese Patent Application Laid-Open No. H2-65789.
[0040] The hydrolyzate of agar may be used as it is as an agarooligosaccharide, or the hydrolyzate may be purified or pH-adjusted before use. Examples of the purification method include filtration using filter paper, activated carbon, etc. Further, the agarooligosaccharide solution obtained by the hydrolysis treatment may be used in a liquid state, or may be made into a powder by vacuum freeze-drying or the like if necessary.
[0041] Note that agar is a dehydrated and dried viscous substance extracted from red algal seaweeds such as tengusa and ogonori, and mainly contains polysaccharides agarose and agaropectin. As raw materials for producing agarooligosaccharides, substances containing agarose or agaropectin as components other than agar can also be used. Specific examples of such substances include solutions obtained by hot water extraction of red algae such as the tengusa family, ogonori family, and igisu family, which are raw materials for agar. Examples of red algae of the tengusa family include maxa, onigusa, obusa, hirakusa, obakusa, yuikiri, etc., examples of red algae of the ogonori family include ogonori, oogonori, etc., and examples of red algae of the igisu family include igisu, egonori, etc. These red algae can be used alone or in combination of two or more.
[0042] As shown in the examples described below, the sugar composition of agarooligosaccharides can be confirmed by liquid chromatography including high performance liquid chromatography. Further, by this method, agarooligosaccharides having a desired number of sugars, such as only agarobiose, only agaro - tetrasaccharide, and only agaro - hexasaccharide, can be fractionated and collected, and the sugar composition of the agarooligosaccharides can be adjusted and used.
[0043] Regarding agarooligosaccharides prepared by decomposing agar with concentrated sulfuric acid using agar as a raw material, an example of the sugar composition confirmed by HPLC is shown below (Shirai I, Sakai T, Shiba K, Uzuhashi Y, Karasawa K. Agaro - oligosaccharides prevent myostatin hyperexpression and myosin heavy chain protein degradation in C2C12 myotubes induced by tumor necrosis factor - α. CellBio. 2018;7(2):23 - 34.). Disaccharide (agarobiose): 41.8 Tetrasaccharide (agaro - tetrasaccharide): 41.0 Hexasaccharide (agaro - hexasaccharide): 14.5 Octasaccharide (agaro - octasaccharide): 2.7
[0044] 3,6 - anhydro - L - galactose can be obtained by using commercially available products such as reagents, or can be produced by a conventional method. Examples of such production methods include the method described in Japanese Patent No. 4007760. That is, 50 μL of 10 - fold concentrated phosphate buffered saline and 50 μL of β - galactosidase phosphate buffered saline solution at 10 units / μL are added to 450 μL of a 100 mM aqueous solution of agarobiose and mixed, and the mixture is reacted at 37°C for 1 hour. After adding 5 mL of a 1 - butanol:ethanol = 1:1 mixed solution to this reaction solution, the insoluble matter is precipitated by centrifugation, and the obtained supernatant is subjected to column chromatography using a silica gel column, and 1 - butanol:ethanol:water = 5:5:1 is used as an eluent and compressed at 0.3 kg / cm 2Apply pressure and perform separation. By fractionating to 7 mL per fraction, a liquid containing high-purity 3,6-anhydro-L-galactose can be obtained in fractions from, for example, fraction 14 to fraction 17. If these fractions are collected and dried under reduced pressure, 3,6-anhydro-L-galactose can be obtained.
[0045] The active ingredient of the present invention can be used in a form that directly or indirectly contacts the flora to be improved or the bacterial group whose bacterial count is to be suppressed. More specific usage modes can be appropriately set according to the usage target and purpose. For example, for improving the flora possessed by a human or an animal / for suppressing the bacterial count of bacteria possessed by a human or an animal, it can be orally ingested by a human or an animal, or applied or sprayed on the site where the flora or the bacteria exist, that is, usage modes such as oral administration, enteral administration, percutaneous administration, transmucosal administration, etc. can be exemplified.
[0046] The active ingredient of the present invention can be used, for example, in the following amounts. (a) Dosage that does not suppress the bacterial count of the genus Bifidobacterium. Dosage that exhibits antibacterial activity without suppressing the bacterial count of the genus Bifidobacterium. Or dosage that suppresses the bacterial count of harmful bacteria without suppressing the bacterial count of the genus Bifidobacterium. (b) Dosage that does not suppress the bacterial count of the genus Lactobacillus. Dosage that exhibits antibacterial activity without suppressing the bacterial count of the genus Lactobacillus. Or dosage that suppresses the bacterial count of harmful bacteria without suppressing the bacterial count of the genus Lactobacillus. (c) Dosage of 80 mg or more and less than 12000 mg per day.
[0047] The dosage that does not suppress the number of Bifidobacterium can be appropriately set according to the attributes and conditions of the target of use, the composition of the flora, the form and purpose of the product, etc. For example, as the dosage (intake amount / dosage amount) when applied in a form to be administered or ingested by humans or animals, the lower limit can be exemplified by 0.0125 mg / kg body weight or more, 0.025 mg / kg body weight or more, 0.05 mg / kg body weight or more, 0.1 mg / kg body weight or more, etc. On the other hand, the upper limit can be exemplified by 1000 mg / kg body weight or less, 800 mg / kg body weight or less, 600 mg / kg body weight or less, 400 mg / kg body weight or less, 200 mg / kg body weight or less, etc.
[0048] <Calculation method of fecal concentration> Alternatively, as shown in the examples described later, agarooligosaccharides do not suppress the number of Bifidobacterium when the concentration in the medium is less than 0.3% by mass. On the other hand, the amount of adult feces is generally 100 - 500 g per day (Reference 1), and since about 80% of it is water (Reference 2), the amount of water excreted as feces is 80 - 400 mL / day. If the concentration of agarooligosaccharides in this fecal water (concentration in feces) is less than 0.3% by mass, it is considered that the number of Bifidobacterium in the intestine is not suppressed, and the value is 80 - 400 g / day × 0.3% by mass = 240 - 1200 mg / day. Therefore, for the active ingredient of the present invention, the dosage (intake amount / dosage amount) that does not suppress the number of Bifidobacterium can also be exemplified by less than 1200 mg per adult per day. ※Reference 1: Tsurumi Clinic, Home>Announcement / Column>Ask Dr. Tsurumi about "Having a bowel movement once every two days means being sick", [online], [searched on November 29, 2023], Internet <https: / / www.tsurumiclinic.com / news / 2020 / 06 / 20200624-225.htmL> ※Reference 2: Taiho Pharmaceutical, Understanding the Intestinal Environment from Feces! Feces are an important "message" from the body, [online], [searched on November 30, 2023], Internet <https: / / www.taiho.co.jp / kenko / otayori / chounai04.htmL>
[0049] <Calculation Method for Allowable Amount per Bacterial Count> Alternatively, as shown in the examples described below, when agarooligosaccharide is contained at 1.5 mg (concentration 0.3% by mass) in about 500 μL of the medium for the main culture, the turbidity of the genus Bifidobacterium becomes 0.14 (according to the McFarland nephelometry, viable cell count 1.96×10^8 CFU / mL), and the addition amount less than that does not suppress the bacterial count of the genus Bifidobacterium. That is, the allowable amount of agarooligosaccharide for the genus Bifidobacterium (the amount that does not suppress its growth) can also be considered to be less than 1.5 mg per 0.98×10^8 viable cells. On the other hand, the amount of feces of an adult is generally 100 - 500 g per day (Reference 1), and the number of bacteria in feces is about 10^11 bacteria / g (Reference 3). Therefore, the number of bacteria excreted per day is about 1.0 - 5.0×10^13. Since the proportion of the genus Bifidobacterium in the intestinal bacteria of Japanese people is said to be about 0.18% (Reference 4), the number of Bifidobacterium excreted per day is about 1.0 - 5.0×10^13×0.18% = about 180 - 900×10^8. If the number of Bifidobacterium excreted is regarded as the number of bacteria living in the intestine, the allowable amount of agarooligosaccharide for the genus Bifidobacterium in the intestine is less than about 180 - 900×10^8÷0.98×10^8×1.5 mg = 276 - 918 mg per day. Therefore, for the active ingredient of the present invention, the usage amount (intake amount, dosage amount) that does not suppress the bacterial count of the genus Bifidobacterium can also be exemplified as less than 918 mg per day for an adult. ※Reference 3: Hirokazu Tsuji, Development and Application of the Intestinal Flora Analysis System Yakult Intestinal Flora - SCAN (YIF - SCAN) Human Intestinal Flora from a Quantitative Perspective, Chemistry and Biology, Vol. 56, No. 5, pp. 371 - 375, 2018 ※Reference 4: Suguru Nishijima et al., The gut microbiome of healthy Japanese and its microbial and functional uniqueness, DNA Research, Volume 23, Issue 2, April 2016, Pages 125-133, https: / / doi.org / 10.1093 / dnares / dsw002
[0050] The dosage that does not suppress the number of Lactobacillus bacteria can be appropriately set according to the attributes and conditions of the target of use, the composition of the flora, the form and purpose of the product, etc. For example, when applied in the form of administration or ingestion to humans or animals, the dosage (intake amount · dosage amount) per day for adults can be exemplified by a lower limit of 0.0125 mg / kg body weight or more, 0.025 mg / kg body weight or more, 0.05 mg / kg body weight or more, 0.1 mg / kg body weight or more, etc. On the other hand, the upper limit can be exemplified by 1000 mg / kg body weight or less, 800 mg / kg body weight or less, 600 mg / kg body weight or less, 400 mg / kg body weight or less, 200 mg / kg body weight or less, etc.
[0051] Alternatively, as shown in the examples described later, agarooligosaccharide does not suppress the number of Lactobacillus bacteria when the concentration in the medium is less than 3% by mass. Applying this value to the above-mentioned fecal concentration calculation method, it becomes 80 - 400 g / day × 3% by mass = 2400 - 12000 mg / day. Therefore, for the active ingredient of the present invention, the dosage (intake amount · dosage amount) that does not suppress the number of Bifidobacterium bacteria can also be exemplified by less than 12000 mg per day for adults.
[0052] On the other hand, as shown in the examples described later, agarooligosaccharide suppresses the number of harmful bacteria when the concentration in the medium is at least 0.1% by mass or more. Applying this value to the above-mentioned fecal concentration calculation method, it becomes 80 - 400 g / day × 0.1% by mass = 80 - 400 mg / day. That is, regarding the active ingredient of the present invention, the dosage (intake amount / dosage amount) that exhibits antibacterial activity without suppressing the number of bacteria of the genus Bifidobacterium can also be exemplified as 80 mg or more and less than 1200 mg per day for an adult. Also, regarding the active ingredient of the present invention, the dosage (intake amount / dosage amount) that exhibits antibacterial activity without suppressing the number of bacteria of the genus Lactobacillus can also be exemplified as 80 mg or more and less than 12000 mg per day for an adult.
[0053] The content of the active ingredient in the product can also be appropriately set according to the form and use of the product based on the above dosage guidelines. Specifically, as the content, for example, 0.0001% by mass or more, 0.001% by mass or more, 0.01% by mass or more, 0.1% by mass or more, 100% by mass or less, 90% by mass or less, 80% by mass or less, 70% by mass or less, 60% by mass or less, 50% by mass or less, 40% by mass or less, 35% by mass or less, 30% by mass or less, 10% by mass or less, 5% by mass or less, etc. can be exemplified.
[0054] The active ingredient of the present invention may be used as it is in the form of pharmaceuticals, quasi-drugs, reagents, other drugs, foods and drinks, supplements, etc., or may be used in combination with other components as a raw material of these products. These products can be manufactured by methods known to those skilled in the art using the active ingredient as a raw material.
[0055] Hereinafter, the present invention will be described based on examples. Note that the technical scope of the present invention is not limited to the features shown by these examples.
Examples
[0056] <Test method> (1) Preparation of agarooligosaccharide 50 g of agar (「Ultra Agar AX-30」 manufactured by Ina Food Industry Co., Ltd.) was added to 1000 g of purified water, heated and dissolved. Then, 2 g of concentrated sulfuric acid was added and stirred at 90 °C for 3 hours. After adjusting the pH to 3.5 with sodium hydroxide, it was treated with activated carbon and further filtered through filter paper to collect the filtrate. This was further filtered through a filter with a pore size of 0.1 μm to collect the filtrate, which was then powdered by vacuum freeze-drying to obtain agarooligosaccharide powder.
[0057] (2) Preparation of Disaccharides to Octasaccharides The agarooligosaccharide prepared by the test method (1) was subjected to recycled size exclusion chromatography to collect fractions containing disaccharides, tetrasaccharides, hexasaccharides, and octasaccharides, respectively. The recycled size exclusion chromatography was performed under the following conditions. ≪Conditions for Recycled Size Exclusion Chromatography≫ System: LaboACE LC-7080 Plus (manufactured by Nippon Analytical Industry Co., Ltd.) Column: JAIGEL-W252 / W253 (manufactured by Nippon Analytical Industry Co., Ltd.) Mobile phase: An aqueous solution containing 0.005% (v / v) acetic acid and 10% (v / v) ethanol Flow rate: 3.5 mL / min
[0058] The composition of each fraction was confirmed using high performance liquid chromatography (Prominence (registered trademark) HPLC system manufactured by Shimadzu Corporation). The measurement conditions for HPLC were as follows: two columns of TSKgel (registered trademark) α-2500 (manufactured by Tosoh Corporation) were connected in series, elution was performed under the conditions of solvent H2O, flow rate of 0.3 mL / min, and temperature of 60 °C, and detection was by RI (differential refraction).
[0059] Each fraction was dried to obtain agarobiose, agarotetraose, agarohexaose, and agarooctaose. In this example, agarobiose, agarotetraose, agarohexaose, and agarooctaose may be referred to as "disaccharide", "tetrasaccharide", "hexasaccharide", and "octasaccharide", respectively.
[0060] (3) Strains The strains shown in (a) to (c) in Table 1 were used. In Table 1, "JCM" is an abbreviation for the Microbial Materials Development Laboratory of the RIKEN BioResource Research Center. All strains were anaerobically cultured using the anaerobic culture kit "AnaeroPack" (Mitsubishi Gas Chemical).
Table 1
[0061] (4) Culture medium For the strains of (a) to (e), the culture medium used was Brain-Heart Infusion medium (※1) 1 L, to which 5 g of yeast extract, 5 g of K2HPO4, 8 g of glucose, 0.5 g of L-cysteine hydrochloride, 1 g of Tween 80, 0.005 g of hemin, 0.002 g of vitamin K1, 0.001 g of resazurin sodium salt, 0.025 g of acetic acid, and 0.01 g of MgSO2·7H2O were added. ※1 Composition of Brain-Heart Infusion medium (per 1 L); brain heart infusion, 5 g / L yeast extract, 5 g K2HPO4, 8 g glucose, 0.5 g L-cysteine hydrochloride, 1 g Tween 80, 0.005 g hemin, 0.002 g vitamin K1, 1 mg resazurin, 50 mL salt solution (※2). ※2 Composition of salt solution (per 1 L); 5 g sodium acetate, 2 g ammonium citrate, 0.2 g MgSO2·7H2O, 0.05 g MnSO4·H2O, pH 6.8.
[0062] For the strains of (e) and (c), the culture medium used was MRS medium (※3) (Merk-Millipore). ※3 Composition of MRS medium (g / L); 10.0 g casein-derived peptone, 8.0 g meat extract, 4.0 g yeast extract, 20.0 g glucose, 2.0 g K2HPO4, 1.0 g Tween 80, 2.0 g ammonium citrate, 5.0 g sodium acetate, 0.2 g magnesium sulfate, 0.04 g manganese sulfate, pH 5.7 (25 °C).
[0063] (5) Statistical analysis The results of the bacterial count measurement by turbidimetry and the results of quantitative PCR were tested by the Kruskal-Wallis test and the unpaired t-test, respectively, using the statistical analysis software GraphPad Prism version 9.5.1 (GraphPad Software). In this test, a P value < 0.05 was considered to indicate a significant difference and was indicated by an asterisk (*).
[0064] <Example 1> Effect on Ruminococcus gnavus The degree of growth of Ruminococcus gnavus cultured in the presence of agarooligosaccharide was confirmed. Ruminococcus gnavus has an extremely low population in the human intestine of healthy individuals, while it has been reported to increase in the intestines of patients with diseases such as inflammatory bowel disease (※4), moyamoya disease, non-moyamoya intracranial arterial disease (※5), heart failure (※6), spondyloarthritis (※7), coronary artery disease (※8), atherosclerotic cardiovascular disease (※9), etc., and in individuals with a large amount of body fat (※10). In addition, it has also been reported to produce inflammatory polysaccharides and induce the secretion of inflammatory cytokines from host dendritic cells, leading to the onset of Crohn's disease (※11), and is considered an unfavorable bacterium for humans at least. ※4. Hall AB, Yassour M, Sauk J, Garner A, Jiang X, Arthur T, et al. A novel Ruminococcus gnavus clade enriched in inflammatory bowel disease patients. Genome Med. 2017;9(1):103; doi: 10.1186 / s13073-017-0490-5. ※5. Yohei Mineharu et al., Increased abundance of Ruminococcus gnavus in gut microbiota is associated with moyamoya disease and non-moyamoya intracranial large artery disease, Sci Rep. 2022 Nov 24;12(1):20244. doi: 10.1038 / s41598-022-24496-9. ※6. Simadibrata, Daniel M. MD et al., S178?A Systematic Review of the Gut Microbiota Profile in Patients With Heart Failure, The American Journal of Gastroenterology 117(10S):p e129, October 2022. | DOI: 10.14309 / 01.ajg.0000857352.83593.b6 ※7. Maxime Breban et al., Faecal microbiota study reveals specific dysbiosis in spondyloarthritis, Ann Rheum Dis. 2017 Sep;76(9):1614-1622. doi: 10.1136 / annrheumdis-2016-211064. Epub 2017 Jun 12. ※8. Takumi Toya et al., Coronary artery disease is associated with an altered gut microbiome composition, PLoS One. 2020 Jan 29;15(1):e0227147. doi: 10.1371 / journal.pone.0227147. eCollection 2020. ※9. I C L van den Munckhof 1 et al., Role of gut microbiota in chronic low-grade inflammation as potential driver for atherosclerotic cardiovascular disease: a systematic review of human studies, Obes Rev. 2018 Dec;19(12):1719-1734. doi: 10.1111 / obr.12750. Epub 2018 Aug 24. ※10. Louise Grahnemo et al., Cross-sectional associations between the gut microbe Ruminococcus gnavus and features of the metabolic syndrome, Lancet Diabetes Endocrinol. 2022 Jul;10(7):481-483. doi: 10.1016 / S2213-8587(22)00113-9. ※11. Henke MT, Kenny DJ, Cassilly CD, Vlamakis H, Xavier RJ, Clardy J. Ruminococcus gnavus, a member of the human gut microbiome associated with Crohn’s disease, produces an inflammatory polysaccharide. Proceedings of the National Academy of Sciences. 2019;116(26):12672-7.
[0065] (1) Culture in the presence of agarooligosaccharide After inoculating Luminococcus gnavus into a culture medium, it was statically cultured anaerobically at 37 °C for 37 hours, and this was used as a mother seed solution. An agarooligosaccharide was added to a 20% (w / w) aqueous glucose solution to final concentrations of 0% by mass, 0.1% by mass, and 0.2% by mass to prepare a sugar solution. The culture medium was dispensed at 470 μL / well into 96-deep well plates (AxyGen Scientific, CA, USA), and further, the sugar solution was dispensed at 2.5 μL / well. Then, the mother seed solution was inoculated at 25 μL / well and main-cultured under the same conditions for 23 hours (※ the final concentration of agarooligosaccharide in the medium for the main culture was 0% by mass, 0.1% by mass, and 0.2% by mass).
[0066] (2) Measurement of the number of bacteria by the turbidity method 20 μL of the culture solution of the main culture was collected and diluted 10-fold by adding 180 μL of water. The absorbance (OD660) of the diluted culture solution was measured using a microplate reader (Wako SUNRISE Rainbow) (N = 8). The results are shown in Figure 1.
[0067] As shown in Figure 1, the absorbance (OD660) was 1.27 when the agarooligosaccharide concentration was 0% by mass, whereas it was 0.77 and 0.09 at 0.1% by mass and 0.2% by mass, respectively, and both values were smaller than those in the case of 0% by mass. That is, agarooligosaccharide suppressed the number of Luminococcus gnavus bacteria at concentrations of 0.1% by mass and 0.2% by mass. From these results, it became clear that agarooligosaccharide can suppress the growth of the genus Luminococcus in both cases where the concentration in the medium is 0.1% by mass and 0.2% by mass.
[0068] (3) Culture in the presence of disaccharides to octasaccharides Agarooligosaccharide was replaced with a disaccharide, a tetrasaccharide, a hexasaccharide, or an octasaccharide, and Luminococcus gnavus was cultured by the method described in Example 1(1) of this example, and the number of bacteria was measured by the turbidity method described in Example 1(2) of this example (N = 2). The concentration of the 2-8 saccharides in the medium was 0.1% by mass. The results are shown in Figure 2.
[0069] As shown in Fig. 2, when the medium contained 0.1% by mass of disaccharide, tetrasaccharide, hexasaccharide or octasaccharide, the absorbance (OD660) was 0.03, 0.04, 0.02 and 0.06, respectively, and all of these values were significantly lower than 1.37 when the medium did not contain these sugars (only glucose). From these results, it was revealed that agarooligosaccharide, agarobiose, agaro - tetrasaccharide, agarooctaose and agarooctaose could suppress the growth of the genus Luminococcus at a concentration of 0.1% by mass in the medium. In addition, since all of these oligosaccharides have 3,6 - anhydro - L - galactose at the reducing end, it was revealed that 3,6 - anhydro - L - galactose or oligosaccharides having this at the reducing end can suppress the growth of the genus Luminococcus.
[0070] <Example 2> Effect on Fusobacterium nucleatum The degree of growth of Fusobacterium nucleatum cultured in the presence of agarooligosaccharide was confirmed. Fusobacterium nucleatum is known as a causative bacterium of periodontal disease and has also been shown to be involved in the exacerbation of colorectal cancer (※12, ※13), and it is a pathogenic bacterium. ※12. Castellarin M, Warren RL, Freeman JD, Dreolini L, Krzywinski M, Strauss J, et al. Fusobacterium nucleatum infection is prevalent in human colorectal carcinoma. Genome Res. 2012;22(2):299 - 306; doi: 10.1101 / gr.126516.111. ※13. Wu J, Li Q, Fu X. Fusobacterium nucleatum contributes to the carcinogenesis of colorectal cancer by inducing inflammation and suppressing host immunity. Translational oncology. 2019;12(6):846 - 51.
[0071] (1) Culture in the presence of agarooligosaccharide Luminococcus gnavus was replaced with Fusobacterium nucleatum, and cultured by the method described in Example 1(1). The absorbance of the culture solution was measured by the turbidity method described in Example 1(2) (N = 8). However, the concentration of agarooligosaccharide in the medium was 0.2% by mass, and the culture time of this culture was 9 hours. The results are shown in Fig. 3.
[0072] As shown in Fig. 3, the absorbance (OD660) was 0.96 when the agarooligosaccharide concentration in the medium was 0% by mass, whereas it was 0.40 at 0.2% by mass, which was significantly lower. That is, agarooligosaccharide suppressed the number of Fusobacterium nucleatum at a concentration of 0.2% by mass. From this result, it was clarified that agarooligosaccharide can suppress the growth of the genus Fusobacterium at a concentration of 0.2% by mass in the medium.
[0073] (2) Culture in the presence of disaccharide and tetrasaccharide Luminococcus gnavus was replaced with Fusobacterium nucleatum, and agarooligosaccharide was replaced with disaccharide or tetrasaccharide. Fusobacterium nucleatum was cultured by the method described in Example 1(1), and the number of bacteria was measured by the turbidity method described in Example 1(2) (N = 2). The concentrations of disaccharide and tetrasaccharide in the medium were 0.1% by mass. The results are shown in Fig. 4.
[0074] As shown in Fig. 4, the absorbance (OD660) was 0.04 and 0.27 when the medium contained 0.1% by mass of disaccharide or tetrasaccharide, respectively, and both values were significantly lower compared to 1.23 when these were not contained (glucose only). In particular, the disaccharide had the lowest absorbance. From this result, it became clear that agarooligosaccharide, agarobiose, and agaro - tetrasaccharide can suppress the growth of Fusobacterium at a concentration of 0.1% by mass in the medium. Also, since all of these oligosaccharides have 3,6 - anhydro - L - galactose at the reducing end, it became clear that 3,6 - anhydro - L - galactose or an oligosaccharide having this at the reducing end can suppress the growth of Fusobacterium.
[0075] <Example 3> Effect on Bifidobacterium The degree of growth of Bifidobacterium (Bifidobacterium bifidum) cultured in the presence of agarooligosaccharide was confirmed. Bifidobacterium bifidum is a so - called beneficial intestinal bacterium known to have effects beneficial to the host's health, such as preventing infectious diseases and immunomodulatory effects (※14, ※15). ※14. Lim HJ, Shin HS. Antimicrobial and Immunomodulatory Effects of Bifidobacterium Strains: A Review. J Microbiol Biotechnol. 2020;30(12):1793 - 800; doi: 10.4014 / jmb.2007.07046. ※15. Valdes L, Salazar N, Gonzalez S, Arboleya S, Rios - Covian D, Genoves S, et al. Selection of potential probiotic bifidobacteria and prebiotics for elderly by using in vitro faecal batch cultures. European Food Research and Technology. 2017;243:157 - 65.
[0076] Luminococcus gnavus was replaced with Bifidobacterium longum or Bifidobacterium adolescentis and cultured by the method described in Example 1(1), and the absorbance of the culture solution was measured by the turbidimetry method described in Example 1(2) (N = 4). However, the concentrations of agarooligosaccharide in the medium were 0% by mass, 0.1% by mass, 0.2% by mass, and 0.3% by mass. The results are shown in Fig. 5.
[0077] As shown in Fig. 5, the absorbance (OD660) of Bifidobacterium longum was 0.51 when the agarooligosaccharide concentration was 0% by mass, but 0.53 and 0.52 at 0.1% by mass and 0.2% by mass, respectively, which was equivalent to the case of 0% by mass. At 0.3% by mass, it was 0.06, showing a tendency to be smaller than the case of 0% by mass, but there was no significant difference.
[0078] The absorbance (OD660) of Bifidobacterium adolescentis was 0.64 when the agarooligosaccharide concentration was 0% by mass, but 0.65 and 0.49 at 0.1% by mass and 0.2% by mass, respectively, which was equivalent to the case of 0% by mass. At 0.3% by mass, it was 0.14, which was smaller than the case of 0% by mass.
[0079] That is, agarooligosaccharide did not suppress the number of Bifidobacterium longum and Bifidobacterium adolescentis at concentrations less than 0.3% by mass. From this result, it was revealed that agarooligosaccharide does not suppress the growth of bifidobacteria when the concentration in the medium is less than 0.3% by mass.
[0080] <Example 4> Effect on Lactobacillus The degree of growth of Lactobacillus cultured in the presence of agarooligosaccharide was confirmed. Lactobacillus, like bifidobacteria, is a beneficial bacterium known to contribute to the health of the host, such as preventing infectious diseases (※16, ※17). ※16. Barrons R, Tassone D. Use of Lactobacillus probiotics for bacterial genitourinary infections in women: a review. Clin Ther. 2008;30(3):453-68; doi: 10.1016 / j.clinthera.2008.03.013. ※17. Reid G, Burton J. Use of Lactobacillus to prevent infection by pathogenic bacteria. Microbes Infect. 2002;4(3):319-24; doi: 10.1016 / s1286-4579(02)01544-7.
[0081] Instead of replacing Luminococcus gnavus with Lactobacillus plantarum or Lactobacillus casei, it was cultured by the method described in Example 1(1), and the absorbance of the culture solution was measured by the turbidity method described in Example 1(2) (N = 4). The concentrations of agarooligosaccharide in the medium were 0% by mass, 1% by mass, 2% by mass, 3% by mass, and 5% by mass. The results are shown in Figure 6.
[0082] As shown in Figure 6, the absorbance (OD660) of Lactobacillus plantarum was 2.49 when the agarooligosaccharide concentration was 0% by mass, while it was 2.01 and 1.86 at 1% by mass and 2% by mass, respectively, which was equivalent to the case of 0% by mass. At 3% by mass and 5% by mass, they were 1.59 and 1.40, respectively, which were smaller than the case of 0% by mass.
[0083] The absorbance (OD660) of Lactobacillus casei was also 2.74 when the agarooligosaccharide concentration was 0% by mass, while it was 2.05 and 1.81 at 1% by mass and 2% by mass, respectively, which was equivalent to the case of 0% by mass. At 3% by mass and 5% by mass, they were 1.72 and 1.43, respectively, which were smaller than the case of 0% by mass.
[0084] That is, at a concentration of less than 3% by mass, the number of Lactobacillus plantarum and Lactobacillus casei was not suppressed by agarooligosaccharide. From this result, it was revealed that agarooligosaccharide does not suppress the growth of the genus Lactobacillus when the concentration in the medium is less than 3% by mass.
[0085] <Example 5> Examination of the number of bacteria in mixed culture Since it was revealed that agarooligosaccharide suppresses the growth of the genus Luminococcus while not suppressing the growth of Bifidobacterium, the number of each bacterium was confirmed when these bacteria were mixed and cultured in the presence of 0.1% by mass of agarooligosaccharide.
[0086] (1) Mixed culture in the presence of agarooligosaccharide After inoculating Luminococcus gnavus and Bifidobacterium longum into the culture medium respectively, they were statically cultured anaerobically at 37 °C for 37 hours to prepare a seed mother liquor of Luminococcus gnavus (OD660 = 1.42, gnavus seed mother liquor) and a seed mother liquor of Bifidobacterium longum (OD660 = 2.63, longum seed mother liquor). These seed mother liquors were inoculated simultaneously at the following ratios and cultured by the method described in Example 1(1) of this example, and the total number of bacteria was measured by the turbidity method described in Example 1(2) of this example (N = 8). The concentration of agarooligosaccharide in the medium was 0.1% by mass. The results are shown in Figure 7. (b) Gnavus seed mother liquor: Longum seed mother liquor = 20:0 (μL) (c) Gnavus seed mother liquor: Longum seed mother liquor = 20:1 (μL) (d) Gnavus seed mother liquor: Longum seed mother liquor = 20:10 (μL) (e) Gnavus seed mother liquor: Longum seed mother liquor = 0:1 (μL)
[0087] As shown in Fig. 7, the absorbance (OD660) was 0.03 when only the Gnabas species mother liquor was inoculated ((A)), while it was 0.48 and 0.52 for the mixed inoculation of the Longum species mother liquor ((C)) and ((D)), respectively, which were significantly higher than that of ((A)). The absorbance of ((B)) inoculated with only the Longum species mother liquor was 0.45, showing a tendency to be higher than that of ((A)). That is, when Bifidobacterium longum was mixed with Luminococcus gnavus for culturing, the inhibitory effect on the total bacterial count was significantly reduced.
[0088] (2) Measurement of the number of each bacterium by quantitative PCR Since the mother liquor of ((C)) is as described above, the bacterial count ratio at the start of the mixed culture is Luminococcus gnavus: Bifidobacterium longum = approximately 10: approximately 1. Therefore, the number of each bacterium in the culture solution of ((C)) after the mixed culture was measured by quantitative PCR. As an index for the number of Luminococcus gnavus, the DNA copy number of the gyrB gene of Luminococcus gnavus (a gene encoding the β subunit of DNA gyrase) was measured. As an index for the number of Bifidobacterium longum, the DNA copy number of the 16S rRNA gene of Bifidobacterium was measured.
[0089] Specifically, first, about 480 μL of the remaining culture solution of ((C)) for which the absorbance had been measured was subjected to centrifugation at 4000 revolutions per minute for 10 minutes to collect the precipitate (bacterial cells), which was then suspended in 0.5 mL of water. After the suspension was placed at 70 °C for 10 minutes, it was disrupted with zirconia beads at 4300 revolutions per minute for 10 minutes using FastPrep FP100A (MP Biomedicals) to obtain a disrupted solution. DNA was extracted from the disrupted solution using Magtration System 12GC and GC series MagDEA DNA 200 (Precision System Science), and the obtained supernatant was subjected to centrifugation at 15000 revolutions per minute for 1 minute. The precipitate was collected and used as template DNA. The following primers were used. ≪For amplification of the gyrB gene of Luminococcus gnavus≫ Forward primer; 5’- GGAGCAGACCAGATCCAAAT -3’ (SEQ ID NO: 1) Reverse primer; 5’- CCAATATACATTCCCGGTCTTT -3’ (SEQ ID NO: 2) ≪For amplification of the 16S ribosomal RNA gene of Bifidobacterium≫ Forward primer; 5’- GATTCTGGCTCAGGATGAACGC -3’ (SEQ ID NO: 1) Reverse primer; 5’- CTGATAGGACGCGACCCCAT -3’ (SEQ ID NO: 2)
[0090] The PCR reaction and detection were performed using "QuantStudio 3" (Thermo Fisher Scientific). The reaction solution was prepared according to the attached instructions using the reagent "PowerTrack SYBR Green Master Mix" (Thermo Fisher Scientific). The reaction conditions were first 95°C for 2 minutes, followed by 40 cycles of 95°C for 10 seconds, 55°C for 15 seconds, and 72°C for 15 seconds, and finally 72°C for 1 minute. After the reaction, melting curve analysis was performed to confirm that the amplification reaction by each primer was specific. Generally, bacteria are considered to have an average of about 4 copies of the 16S rRNA gene. Therefore, the value obtained by dividing the DNA copy number of the 16S rRNA gene by 4 was used as the number of Bifidobacterium longum cells. The DNA copy number of the gyrB gene was directly used as the number of Luminococcus gnavus cells. For each cell count, the percentage with the total cell count set to 100% was calculated (N = 8). The results are shown in Figure 8.
[0091] As shown in Fig. 8, the number of bacteria of Luminococcus gnavus was about 4%, while the number of bacteria of Bifidobacterium longum was about 96%, and most of them were Bifidobacterium longum. That is, the number of bacteria at the start of the mixed culture was Luminococcus gnavus:Bifidobacterium longum = about 10:about 1, but after culturing in the presence of 0.1% by mass of agarooligosaccharide, it became Luminococcus gnavus:Bifidobacterium longum = about 4:about 96. From this result, it was revealed that agarooligosaccharide can specifically suppress the growth of the genus Luminococcus at a concentration of 0.1% by mass, and as a result, improve the occupancy rate of bifidobacteria.
Claims
1. An agent for suppressing the number of harmful bacteria including at least the genus Luminococcus or Fusobacterium without suppressing the number of bacteria of the genus Bifidobacterium and / or the genus Lactobacillus, said agent comprising agarooligosaccharide as an active ingredient.
2. The agent according to claim 1, wherein the agarooligosaccharide is an agarooligosaccharide containing agarobiose.
3. An agent for suppressing the number of harmful bacteria including at least the genus Luminococcus or Fusobacterium without suppressing the number of bacteria of the genus Bifidobacterium and / or the genus Lactobacillus, said agent comprising 3,6-anhydro-L-galactose and / or an oligosaccharide having the same at the reducing end as an active ingredient.
4. A method (excluding medical acts) for suppressing the number of harmful bacteria including at least the genus Luminococcus or Fusobacterium without suppressing the number of bacteria of the genus Bifidobacterium and / or the genus Lactobacillus, said method comprising a step of bringing agarooligosaccharide, 3,6-anhydro-L-galactose and / or an oligosaccharide having the same at the reducing end into contact with the bacterial flora directly or indirectly.
5. A method for producing the agent according to any one of claims 1 to 3, said method comprising a step of formulating agarooligosaccharide, 3,6-anhydro-L-galactose and / or an oligosaccharide having the same at the reducing end as a raw material.
Citation Information
Patent Citations
Composition for adjusting enterobacterial flora
JP2017163980A
Composition for body condition maintaining, body condition enhancement or body condition adjustment
JP2018197229A
Composition for improving intestinal flora diversity
JP2020178684A
Composition for preventing, treating or suppressing intestinal disorders
JP2020178685A
Use of agarobiose or agarooligosaccharide having anticariogenic activity
US20200078383A1