Oral moisturizer
A food composition with chamomile and thyme promotes BLMH, CAPN1, and TGM1 expression, addressing the limitations of existing oral moisturizers by enhancing skin moisturization and wound healing.
Patent Information
- Application Number
- JP2021079102
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2021-05-07
- Publication Date
- 2025-07-25
- Estimated Expiration
- 2041-05-07
AI Technical Summary
Existing oral moisturizers do not effectively promote the expression of bleomycin hydrolase (BLMH), calpain 1 (CAPN1), and transglutaminase 1 (TGM1) enzymes, which are crucial for maintaining skin moisturization and wound healing, and the use of chamomile and thyme in bath agents does not address these effects.
A food composition containing chamomile and thyme is developed to promote the expression of BLMH, CAPN1, and TGM1, utilizing various extraction methods and formulations such as tablets, capsules, and beverages to enhance their efficacy.
The composition exhibits remarkable moisturizing and wound healing effects by significantly enhancing the expression of BLMH, CAPN1, and TGM1, reducing transepidermal water loss and improving skin conditions like dryness and wrinkles.
Smart Images

Figure 0007713218000001 
Figure 0007713218000002 
Figure 0007713218000003
Abstract
Description
Technical Field
[0001] The present invention relates to an oral moisturizer characterized by containing chamomile and thyme. More specifically, it relates to a bleomycin hydrolase (BLMH) expression promoter, a calpain 1 (CAPN1) expression promoter, a transglutaminase 1 (TGM1) expression promoter, which are characterized by containing chamomile and thyme, and a food composition for moisturizing, promoting BLMH expression, promoting CAPN1 expression, and promoting TGM1 expression, which contains chamomile and thyme.
Background Art
[0002] The moisturizing function of the skin is borne by the stratum corneum. In order for the stratum corneum to keep the moisture inside the skin constant without letting it escape, it is important that natural moisturizing factor (NMF) is sufficiently produced in keratinocytes and NMF is retained inside the cells by the formation of the cornified cell envelope of keratinocytes (Non-Patent Document 1).
[0003] Bleomycin hydrolase (BLMH) and calpain 1 (CAPN1) are enzymes that act in the process of producing NMF by the degradation of filaggrin, and play important roles in maintaining and enhancing the skin's moisturizing function as essential factors for NMF production.
[0004] Transglutaminase 1 (TGM1) is an enzyme responsible for the binding of precursor proteins (such as involucrin) in the formation of the cornified cell membrane, and plays an important role in maintaining and enhancing the skin's moisturizing function. In addition, it has been reported that the activation of TGM1 also works for wound healing in addition to moisturizing (Non-Patent Document 2).
[0005] Although the use of chamomile and thyme is known as a bath agent composition (Patent Document 1), since it is a bath agent, it is completely different from the form of the oral moisturizer of the present invention. Further, although a profilaggrin mRNA expression promoter (Patent Document 2) characterized by containing at least one selected from 11 extracts such as wild thyme extract and chamomile extract is known, since it is an external preparation (skin cosmetic), it is completely different from the form of the oral moisturizer of the present invention. Further, it has not been shown that chamomile and thyme have an action of promoting the expression of BLMH, CAPN1, and TGM1.
Prior Art Documents
Patent Documents
[0006]
Patent Document 1
Patent Document 2
Non-Patent Documents
[0007]
Non-Patent Document 1
Non-Patent Document 2
Summary of the Invention
Problems to be Solved by the Invention
[0008] The present invention relates to an oral moisturizer characterized by containing chamomile and thyme. More specifically, it relates to a bleomycin hydrolase (BLMH) expression promoter, a calpain 1 (CAPN1) expression promoter, a transglutaminase 1 (TGM1) expression promoter, and a moisturizing, BLMH expression promoting, CAPN1 expression promoting, and TGM1 expression promoting food composition, each characterized by containing chamomile and thyme.
Means for Solving the Problems
[0009] As a result of intensive research, the present inventors have found that by combining chamomile and thyme, it has an extremely remarkable moisturizing effect. Furthermore, it has been found that by combining chamomile and thyme, it has an extremely remarkable effect of promoting the expression of BLMH, an effect of promoting the expression of CAPN1, and an effect of promoting the expression of TGM1.
[0010] As the chamomile of the present invention, chamomile (Matricaria chamomilla L.) belonging to the genus Matricaria of the family Asterales can be used. The part to be used is not particularly limited, but the capitulum is preferred.
[0011] As the thyme of the present invention, common thyme (Thymus vulgaris L.) belonging to the genus Thymus of the family Lamiaceae can be used. In addition, hybrids of common thyme (such as citrus thyme) and wild thyme (scientific name: Thymus serpyllum) of the same genus can also be used. Although not particularly limited, common thyme is preferred. The part to be used is not particularly limited, but the aerial part is preferred.
[0012] For the chamomile and thyme used in the present invention, as needed, the original state, crushed products, squeezed products, dried products, etc. can be appropriately selected. Further, it may be used after being treated by atomization treatment, roll press treatment, grinding treatment, ultra-high pressure microsteam treatment, or other mechanical methods commonly used industrially.
[0013] Chamomile and thyme used in the present invention can be subjected to extraction operations as necessary. As extraction solvents, water, lower alcohols (such as methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (such as 1,3-butylene glycol, propylene glycol, glycerin, etc.), ketones (such as acetone, methyl ethyl ketone, etc.), acetonitrile, esters (such as ethyl acetate, butyl acetate, etc.), hydrocarbons (such as hexane, heptane, petroleum ether, etc.), ethers (such as ethyl ether, tetrahydrofuran, propyl ether, etc.) and the like can be used. These solvents can be used alone or in combination of two or more. Also, as extraction methods, continuous extraction, immersion extraction, etc. can be mentioned, and if necessary, treatments such as concentration, dilution, filtration, decolorization and deodorization by activated carbon treatment can be carried out before use. Furthermore, the extracted solution can be subjected to treatments such as concentration to dryness, spray drying, freeze drying, etc., and used as a dried product.
[0014] For chamomile and thyme used in the present invention, any processed product or extract can be used. Although not particularly limited, it is preferable to use an extract obtained using water as the solvent.
[0015] The intake amounts of chamomile and thyme used in the present invention vary depending on the dosage form, purpose of use, age, body weight, etc. As dried products of chamomile and thyme, they can be orally administered once to several times a day in the range of 0.1 to 1000 mg / day, preferably 1 to 200 mg / day, more preferably 5 to 50 mg / day. In some cases, an amount less than the above dosage range may be sufficient, and in other cases, it may be necessary to administer in excess of the range. Also, regarding the method of adding the active ingredient in formulation, it can be added in advance or during the manufacturing process, and it can be appropriately selected considering workability.
[0016] The internal-use moisturizer of the present invention can be used in any of foods, quasi-drugs or pharmaceuticals. As its dosage form, tablets, granules, soft capsules, hard capsules, beverages, sugar-coated tablets, powders, syrups, pills, suspensions, liquids, emulsions, etc. can be adopted.
[0017] The oral moisturizer of the present invention can contain other components as necessary within the range that does not impair the effects. It may contain other medicinal components, and in addition to herbs, ceramides, vitamins, amino acids, minerals, etc., excipients such as lactose, starch, cellulose, maltitol, dextrin, surfactants such as glycerin fatty acid esters, sucrose fatty acid esters, coating agents such as gelatin, pullulan, shellac, zein, oils and fats such as wheat germ oil, rice germ oil, safflower oil, waxes such as beeswax, rice bran wax, carnauba wax, sweeteners such as sucrose, glucose, fructose, stevia, saccharin, sucralose, and acidulants such as citric acid, malic acid, gluconic acid, etc. can be appropriately contained. Among them, ceramides, hyaluronic acid, astaxanthin, proteoglycan, collagen peptides, GABA (gamma-aminobutyric acid) are preferred, and ceramides and GABA are particularly preferred.
[0018] The oral moisturizer of the present invention is an agent that increases the water content in the skin and suppresses the amount of water evaporation from the skin, and can prevent and improve dry skin, xeroderma, seborrhea sicca, wrinkles, atopic dermatitis, rough skin, and abnormal keratinization. Also, as other uses, it can be used as an oral wound healing agent.
Effects of the Invention
[0019] The oral moisturizer characterized by containing chamomile and thyme of the present invention has extremely remarkable moisturizing effects, BLMH expression promoting effects, CAPN1 expression promoting effects, and TGM1 expression promoting effects.
Modes for Carrying Out the Invention
[0020] The following examples are for illustrative purposes and the scope of the claims of the present invention is not limited by these examples. The % of the content shown in the examples indicates weight %.
Examples
[0021] Production Example 1 Chamomile Hot Water Extract 100 g of chamomile flower heads were added with 2 L of purified water, extracted at 95 - 100 °C for 2 hours, and then the filtrate was concentrated and freeze-dried to obtain 13.3 g of chamomile hot water extract.
[0022] Production Example 2 Chamomile 30% Ethanol Extract 100 g of chamomile flower heads were added with 1.4 L of purified water and 0.6 L of ethanol, extracted at room temperature for 5 days, and then the filtrate was concentrated to dryness to obtain 7.7 g of chamomile 30% ethanol extract.
[0023] Production Example 3 Chamomile Ethanol Extract 100 g of chamomile flower heads were added with 1 L of ethanol, extracted at room temperature for 5 days, and then the filtrate was concentrated to dryness to obtain 3.2 g of chamomile ethanol extract.
[0024] Production Example 4 Thyme Hot Water Extract 100 g of thyme aerial parts were added with 2 L of purified water, extracted at 95 - 100 °C for 2 hours, and then the filtrate was concentrated and freeze-dried to obtain 9.8 g of thyme hot water extract.
[0025] Production Example 5 Thyme 30% Ethanol Extract 100 g of thyme aerial parts were added with 1.4 L of purified water and 0.6 L of ethanol, extracted at room temperature for 5 days, and then the filtrate was concentrated to dryness to obtain 5.6 g of thyme 30% ethanol extract.
[0026] Production Example 6 Thyme Ethanol Extract 100 g of thyme aerial parts were added with 1 L of ethanol, extracted at room temperature for 5 days, and then the filtrate was concentrated to dryness to obtain 4.1 g of thyme ethanol extract.
Examples
[0027] Formulation Example 1 Tablet <Formulation> Component Content (%) 1. Chamomile Hot Water Extract (Production Example 1) 0.08 2. Thyme Hot Water Extract (Production Example 4) 0.08 3. Erythritol 30.00 4. Add maltitol so that the total amount is 100. 5. Citric acid 5.00 6. Sucrose fatty acid ester 3.00 7. Flavor 3.00 <Manufacturing method> Mix components 1 - 5, and perform fluidized bed granulation using 10% water as a binder. Add components 6 and 7 to the granules obtained by granulation, mix them, and tablet them to obtain 1 - g tablets. <Usage> Take 3 tablets per day.
[0028] Prescription Example 2 Tablet <Prescription> Component Content (%) 1. Chamomile hot water extract (Production Example 1) 0.03 2. Thyme hot water extract (Production Example 4) 0.03 3. Rice - derived glucosylceramide 0.05 4. Erythritol 30.00 5. Add maltitol so that the total amount is 100. 6. Citric acid 5.00 7. Sucrose fatty acid ester 3.00 8. Flavor 3.00 <Manufacturing method> Mix components 1 - 6, and perform fluidized bed granulation using 10% water as a binder. Add components 7 and 8 to the granules obtained by granulation, mix them, and tablet them to obtain 1 - g tablets. <Usage> Take 3 tablets per day.
[0029] Prescription Example 3 Granules <Prescription> Component Content (%) 1. Chamomile hot water extract (Production Example 1) 0.3 2. Thyme hot water extract (Production Example 4) 0.3 3. Lactose 99.4 <Manufacturing method> Granulate components 1 - 3 by the dry method to obtain granules. <Usage> Take 3.2 g per day.
[0030] Formulation Example 4 Soft Capsules <Formulation> Ingredient Content (%) 1. Chamomile hot water extract (Production Example 1) 0.005 2. Thyme hot water extract (Production Example 4) 0.005 3. Rice germ oil 84.990 4. Beeswax 12.000 5. Vitamin E 3.000 <Manufacturing Method> Ingredients 1 to 5 were mixed and filled into a film composed of gelatin, glycerin, and caramel dye at 350 mg. After drying, soft capsules were obtained. <Dosage> Take 3 capsules per day.
[0031] Formulation Example 5 Beverage <Formulation> Ingredient Content (%) 1. Chamomile hot water extract (Production Example 1) 0.1 2. Thyme hot water extract (Production Example 4) 0.1 3. Citric acid 6.0 4. Sucrose 11.0 5. Flavor 1.0 6. Water 81.8 <Manufacturing Method> Ingredients 1 to 5 were stirred and dissolved in a part of the water of Ingredient 6. Then, the remaining water of Ingredient 6 was added and mixed, and the sterilized product was used as a beverage. <Dosage> Take 50 mL per day.
[0032] Comparative Example 1 Conventional Tablet In the tablet of Formulation Example 1, the chamomile hot water extract (Production Example 1) and thyme hot water extract (Production Example 4) were replaced with maltitol to obtain a conventional tablet.
[0033] Comparative Example 2 Tablet Containing Only Chamomile In the tablet of Formulation Example 1, a tablet containing only chamomile was prepared by replacing the thyme hot water extract (Production Example 4) with the chamomile hot water extract (Production Example 1).
[0034] Comparative Example 3 Tablet containing only thyme In the tablet of Formulation Example 1, a tablet containing only thyme was prepared by replacing the chamomile hot water extract (Production Example 1) with the thyme hot water extract (Production Example 4).
Example
[0035] Test Example 1 Promoting effect of chamomile and thyme on BLMH expression, CAPN1 expression and TGM1 expression To human keratinocyte HaCaT cultured to confluence in DMEM medium, the chamomile hot water extract (Production Example 1) and the thyme hot water extract (Production Example 4) were added alone or in combination for 6 hours or 24 hours, and gene expression analysis of BLMH, CAPN1, and TGM1 was performed by real-time PCR method. The expression level under the non-added condition was set as 1 for comparison. In addition, gene expression analysis of peptidyl arginine deiminase 1 (PADI1), which is involved in skin moisturization, was performed.
[0036] Primer set for BLMH AACCAGCCCATTGACTTCC (SEQ ID NO: 1) ACCATCCTGATCATCCTTCTCTG (SEQ ID NO: 2) Primer set for CAPN1 TGCTCCATAGACATCTCCAG (SEQ ID NO: 3) GAATGACATCCAGAACTCCC (SEQ ID NO: 4) Primer set for TGM1 GCTCATATCATCCACCACCT (SEQ ID NO: 5) ATCTTAGCAGACTCCAGCCA (SEQ ID NO: 6) Primer set for PADI1 GACTGGAACCGTAATGTGCT (SEQ ID NO: 7) GACCACCATGTTAACCATGTCTG (SEQ ID NO: 8) Primer set for GAPDH (Internal standard) TGCACCACCAACTGCTTAGC (SEQ ID NO: 9) TCTTCTGGGTGGCAGTGATG (SEQ ID NO: 10)
[0037] The results of Test Example 1 are shown in Tables 1 and 2. When the chamomile hot water extract (Production Example 1) and the thyme hot water extract (Production Example 4) were added in combination, the expression of BLMH, CAPN1, and TGM1 was significantly enhanced as compared with the addition alone. Therefore, a remarkably significant moisturizing effect was shown by combining chamomile and thyme.
[0038]
Table 1
[0039]
Table 2
[0040] In addition, the combination of the chamomile hot water extract (Production Example 1) and the thyme hot water extract (Production Example 4) significantly enhanced the expression of TGM1. Therefore, it was shown that the combination of chamomile and thyme has a remarkably significant wound healing promoting effect.
[0041] Test Example 2 Moisturizing effect by human drinking Sixty men and women (aged 20 to 60) were divided into 4 groups of 15 each, and tablets containing chamomile and thyme (Formulation Example 1), conventional tablets (Comparative Example 1), tablets containing only chamomile (Comparative Example 2), and tablets containing only thyme (Comparative Example 3) were taken 3 tablets a day for 3 months. For the evaluation of the moisturizing effect, the change rate of the transdermal water evaporation amount measured by a tevameter before and after drinking was calculated, and compared with the change rate of Comparative Example 1 as 100%.
[0042] The results of Test Example 2 are shown in Table 3. The tablets containing chamomile and thyme (Formulation Example 1) showed a significantly greater decrease in transepidermal water loss than Comparative Example 2 and Comparative Example 3. Therefore, a remarkably significant moisturizing effect was shown by combining chamomile and thyme.
[0043] [Table 3]
[0044] Also, the tablets of Formulation Example 1 showed improvement in dryness and puffiness of the body such as the cheeks, lips, elbows, shins, ankles, and heels in the appearance evaluation by photographs. Also, a much more significant improvement was observed in the tablets of Formulation Example 1 than in Comparative Example 2 and Comparative Example 3.
[0045] From the above results, a remarkably significant moisturizing effect, BLMH expression promoting effect, CAPN1 expression promoting effect, and TGM1 expression promoting effect were shown by the combination of chamomile and thyme.
Industrial Applicability
[0046] The oral moisturizer of the present invention showed a remarkably significant moisturizing effect, BLMH expression promoting effect, CAPN1 expression promoting effect, and TGM1 expression promoting effect. Therefore, it can be used as a food, quasi-drug for oral use, or pharmaceutical having a moisturizing effect, BLMH expression promoting effect, CAPN1 expression promoting effect, and TGM1 expression promoting effect.
Claims
**Claim 1**: An oral moisturizer characterized by containing chamomile flower heads and the aerial parts of thyme. **Claim 2**: A bleomycin hydrolase (BLMH) expression promoter characterized by containing chamomile flower heads and the aerial parts of thyme. **Claim 3**: A calpain 1 (CAPN1) expression promoter characterized by containing chamomile flower heads and the aerial parts of thyme. **Claim 4**: A transglutaminase 1 (TGM1) expression promoter characterized by containing chamomile flower heads and the aerial parts of thyme. **Claim 5**: A food composition for moisturizing, promoting BLMH expression, promoting CAPN1 expression, and promoting TGM1 expression, characterized by containing the agent according to any one of Claims 1 to 4.
Citation Information
Patent Citations
Bath medicine composition and its use
JP1997002935A
Skin care preparation
JP2001354537A
Filaggrin production-accelerating agent and skin cosmetic
JP2006016337A
Inhibitor for inhibiting moisture keeping function reduction caused by saccharization, skin cosmetic and food / drink
JP2021050178A
Profilaggrin mRNA expression enhancer
JP4768238B2