Kit and method for detecting cancer-related mutations

The method uses selective DNA digestion and PCR amplification to detect cancer-related mutations by calculating the ratio between restriction and control loci, addressing the limitations of existing technologies with improved sensitivity and specificity for clinical applications.

JP7717754B2Active Publication Date: 2025-08-04NUCLEIX LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2023101691
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2018-01-07
Filing Date
2023-06-21
Publication Date
2025-08-04
Estimated Expiration
2039-01-06

AI Technical Summary

Technical Problem

Current methods for detecting cancer-related mutations in DNA samples, particularly in clinical samples and circulating tumor DNA, are laborious, expensive, lack sensitivity and specificity, and require complex processing, making them unsuitable for routine clinical use.

Method used

A method involving selective digestion of wild-type DNA with restriction enzymes, followed by PCR amplification and analysis of the amplification products, using a control locus to calculate the ratio between signal intensities of restriction and control loci, enabling accurate detection of cancer-related mutations.

Benefits of technology

The method provides a simple, cost-effective, and highly sensitive means for detecting cancer-related mutations with high specificity, allowing for easy integration into existing diagnostic methods and providing information for treatment selection and prognosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007717754000004
    Figure 0007717754000004
  • Figure 0007717754000005
    Figure 0007717754000005
  • Figure 0007717754000006
    Figure 0007717754000006
Patent Text Reader

Abstract

To provide improved methods and kits for detecting cancer-related mutations in DNA samples, which are simple to operate, cost-effective and characterized by high specificity and sensitivity.SOLUTION: Provided is a method for detecting a cancer-related mutation in a DNA sample. The method comprises: (a) subjecting the DNA sample to digestion with a restriction endonuclease to obtain restriction endonuclease-treated DNA; (b) co-amplifying from the restriction endonuclease-treated DNA a restriction locus comprising a cancer mutation site and a control locus, thereby generating an amplification product for each locus; (c) calculating a ratio between signal intensities of the amplification products of the restriction locus and the control locus; and (d) detecting the cancer-related mutation in the DNA sample by comparing the ratio calculated in step (c) to a predefined threshold ratio.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the detection of cancer-related mutations in DNA samples using enzymatic restriction and real-time PCR.

Background Art

[0002] Cancer is associated with changes in genes encoding various cellular molecules. The range of cancer mutations is diverse in terms of type, number, and functional impact. Examples include single-base changes, deletions, and alternative splicing or translocations. Specific mutations are associated with one or more types of cancer, and the mutant gene products are related to the biological characteristics of cancer.

[0003] The mutation profile of tumor DNA is important for patient management, such as diagnosis, prognosis, and treatment decision-making. However, in clinical samples, there are usually only a small amount of mutant tumor genes within a large amount of normal genes, so the detection of cancer-related mutations in the clinical environment is a challenge. When analyzing circulating tumor DNA (ctDNA) in plasma samples, the detection of cancer-related mutations is particularly difficult. Therefore, a more sensitive and specific assay is needed.

[0004] Currently, most clinical trials of genetic variants are performed using techniques such as allele-specific polymerase chain reaction (PCR), Sanger dideoxy sequencing, pyrosequencing, multiplex ligation-dependent probe amplification (MLPA), and mass spectrometry (MS). New next-generation sequencing (NGS) technologies, also called massively parallel sequencing, have emerged. Using NGS, it is possible to simultaneously perform the amplification and sequencing of multiple sequences. However, this technology is currently expensive and complex for routine clinical trials.

[0005] Jenkins et al. (1999) provided an overview of a methodology named restriction site mutation assay in Mutagenesis, 14(5):439-48 to detect mutations at ubiquitous restriction enzyme sites. Briefly, DNA mutations at ubiquitous restriction enzyme sites result in the loss of the ability of restriction enzymes to recognize specific DNA target sequences. Thus, wild-type DNA is recognized and cleaved by restriction enzymes, while DNA containing mutations at restriction enzyme sites is not recognized by restriction enzymes and remains undigested, serving as a substrate for subsequent PCR amplification. The PCR amplification products are subjected to gel electrophoresis to detect enzyme-resistant bands, i.e., the presence of mutations.

[0006] Jenkins et al. (2002) outlined a method of using restriction enzymes for the analysis of genetic changes contributing to cancer progression in Br J Surg. 89(1):8-20.

[0007] Ward et al. (1998) reported an enriched PCR strategy in Am J Pathol., 153(2):373-379 that allows the amplification of mutant K-ras while inhibiting the formation of wild-type products by simultaneously acting BstNI restriction enzyme and Taq polymerase. This restriction endonuclease-mediated selective PCR assay uses three sets of primers in the reaction mix with BstNI and analyzes the amplification products by gel electrophoresis.

[0008] Asano et al. (2006) reported the development of a PCR-based assay in Clin Cancer Res, 43:12(1), 43-48 for detecting mutations in EGFR exons 19 and 21 and EGFR mutations in clinical samples including biopsies, pleural effusions, and surgically resected tissues from patients with non-small cell lung cancer (NSCLC).

[0009] Zhao et al. (2013) reported in Int. J. Cancer, 132, 2858-2866 a method for detecting somatic mutations from a small number of cells in a one-step reaction tube by combining PCR with restriction endonuclease digestion (referred to as real-time digestion PCR, or RTD-PCR). The PCR mixture contains a thermostable restriction enzyme that digests the wild-type allele during the PCR program, enabling selective amplification of the mutant allele.

[0010] WO2013 / 181276 discloses compositions and methods for detecting mutations in rare nucleic acid molecules among a plurality of nucleic acid molecules. Also disclosed is a method for determining the size of nucleic acid molecules using droplet digital PCR.

[0011] The methods described so far have drawbacks, some of which are laborious and expensive, others have insufficient sensitivity and / or specificity, and lack quantitative data or require complex processing and calibration to provide quantitative data.

[0012] There is a need for improved methods and kits for detecting cancer-related mutations in DNA samples that are easy to operate, cost-effective, and characterized by high specificity and sensitivity. SUMMARY OF THE INVENTION

[0013] According to some aspects, the present invention provides a method for detecting cancer-related mutations in a DNA sample based on selective digestion of wild-type DNA with intact mutant DNA, followed by PCR amplification and analysis of the amplification products. PCR amplification includes co-amplification of two loci, one of which remains intact if a mutation is present and the other always remains intact under the test conditions and functions as a control. The disclosed method involves calculating the ratio between the signal intensities of the amplification products of these loci and detecting cancer-related mutations based on the calculated ratio, resulting in highly accurate mutation detection. The DNA sample may be derived from tumor tissue or a plasma sample. Further, a method for determining whether a subject is positive for cancer-related mutations is provided.

[0014] In particular, the method disclosed herein detects cancer-related mutations within restriction enzyme sites. Non-mutated (wild-type) DNA contains a restriction enzyme site and is recognized by a restriction enzyme. Thus, non-mutated DNA is cleaved when contacted with the restriction enzyme. In mutated DNA, the restriction enzyme site is altered, so the mutated DNA is not recognized by the restriction enzyme. The mutated DNA remains intact when contacted with the restriction enzyme and provides a substrate for subsequent PCR amplification. In the PCR amplification of a locus (the "restriction locus") having a restriction enzyme site that includes the mutation position thereafter, only the mutated DNA is amplified, enabling determination of the presence of the mutation. To achieve high specificity, only mutation levels above a certain threshold are considered clinically significant. Thus, it is important to provide a quantitative means for determining whether a DNA sample is considered positive for a particular mutation. The present invention advantageously addresses this need by co-amplifying a control locus that does not contain the recognition sequence of the restriction enzyme and calculating the ratio between the signal intensities of the amplification products of the restriction locus and the control locus. Different mutation levels result in a difference in the signal ratio between the restriction locus and the control locus, and a higher signal ratio corresponds to a higher mutation level. According to some embodiments, a threshold signal ratio is determined, and if exceeded, a given DNA sample is identified as positive for a particular cancer-related mutation.

[0015] Accordingly, the present invention provides a simple and reliable means for detecting the presence of cancer-related mutations.

[0016] In some embodiments, the cancer mutation position (mutation site) is naturally found within the recognition sequence of a restriction enzyme (i.e., within native DNA). In other embodiments, the cancer mutation site is not naturally found within the recognition sequence of a restriction enzyme. According to these embodiments, for detecting mutations by the methods disclosed herein, the recognition sequence is artificially introduced by PCR. According to these embodiments, the DNA sample to be subjected to digestion and further analysis is a PCR product containing the artificially introduced restriction locus. In additional embodiments, the cancer mutation site is naturally found within the recognition sequence of a particular restriction enzyme, but a different restriction enzyme is desired for use in the methods of the present invention. The recognition sequence of the desired restriction enzyme can be artificially introduced by PCR, and according to these embodiments, the DNA sample to be subjected to digestion and further analysis is a PCR product containing the artificially introduced restriction locus.

[0017] In the case of native DNA and native restriction loci, suitable loci include those of methylation-insensitive restriction enzymes, so that the digestion of DNA is not biased by the presence of methylation.

[0018] Accordingly, in one aspect, the present invention provides a method for detecting cancer-related mutations in a DNA sample, the method comprising: (a) subjecting the DNA sample to digestion with a restriction endonuclease to obtain restriction endonuclease-treated DNA; (b) simultaneously amplifying a restriction locus containing the cancer mutation site and a control locus from the restriction endonuclease-treated DNA, thereby generating amplification products for each locus; (c) calculating the ratio between the signal intensities of the amplification products of the restriction locus and the control locus; and (d) detecting cancer-related mutations in the DNA sample by comparing the ratio calculated in step (c) with a predefined threshold ratio.

[0019] In some embodiments, when the calculated ratio exceeds a predefined threshold ratio, cancer-related mutations are detected.

[0020] According to another aspect, the present invention provides a method for identifying that a subject is positive for cancer-related mutations, the method comprising: (a) subjecting a DNA sample from the subject to digestion with a methylation-insensitive restriction endonuclease to obtain restriction endonuclease-treated DNA; (b) simultaneously amplifying a restriction locus containing a cancer mutation site and a control locus from the restriction endonuclease-treated DNA, thereby generating amplification products for each locus; (c) calculating a ratio between the signal intensities of the amplification products of the restriction locus and the control locus; (d) identifying that the subject is positive for cancer-related mutations by comparing the ratio calculated in step (c) with a predefined threshold ratio.

[0021] In some embodiments, if the calculated ratio exceeds a predefined threshold ratio, the subject is identified as positive for cancer-related mutations.

[0022] In some embodiments, the DNA is derived from tumor tissue.

[0023] In some embodiments, the DNA is derived from plasma.

[0024] In some embodiments, the control locus is a locus lacking the recognition sequence of the restriction endonuclease.

[0025] In some embodiments, the DNA is natural DNA, the restriction locus is a natural restriction locus, and the restriction endonuclease is a methylation-insensitive restriction endonuclease whose recognition sequence contains a cancer mutation site.

[0026] In some embodiments, the cancer mutation is one whose site is naturally found within the recognition sequence of a methylation-insensitive restriction endonuclease and is selected from the group consisting of EGFR exon 19 deletion (E747 - A750), EGFR L858 substitution, P53 H179 substitution, P53 G154 substitution, P53 R282 substitution, P53 R248 substitution, P53 R249 substitution, and BRAF V600 substitution. Each possibility represents a separate embodiment of the present invention.

[0027] In some embodiments, the restriction endonuclease is selected from the group consisting of MseI (EGFR exon 19 deletion), MscI (EGFR L858 substitution), FatI (P53 H179 substitution), MspI (P53 G154 substitution, P53 R282 substitution, P53 R248 substitution), HaeIII (P53 R249 substitution), and TspRI (BRAF V600 substitution). Each possibility represents a separate embodiment of the present invention.

[0028] In other embodiments, the cancer mutation site is not naturally found within the recognition sequence of the restriction endonuclease. According to these embodiments, the DNA is a PCR product, and the restriction locus is a restriction locus artificially introduced into the DNA by said PCR.

[0029] In some embodiments, the cancer mutation is one whose site is not naturally found within the recognition sequence of the restriction endonuclease and is selected from the group consisting of KRAS G12 substitution and EGFR L858 substitution. In some embodiments, the restriction endonuclease is selected from the group consisting of BstNI (KRAS G12 substitution) and AluI (EGFR L858 substitution).

[0030] In some specific embodiments, the cancer mutation is one whose site is not naturally found within the recognition sequence of the restriction endonuclease and is KRAS G12 substitution, and the restriction endonuclease is BstNI. In some embodiments, the control locus is the locus shown in SEQ ID NO: 4.

[0031] In some embodiments, the cancer-related mutations are selected from the group consisting of KRAS G12 substitution, EGFR exon 19 deletion (E747 - A750), EGFR L858 substitution, P53 H179 substitution, P53 G154 substitution, P53 R282 substitution, P53 R248 substitution, P53 R249 substitution, and BRAF V600 substitution. Each possibility represents a separate embodiment of the present invention.

[0032] In some embodiments, step (b) of the method is performed using real-time PCR. In some embodiments, when step (b) is performed using real-time PCR, the method further includes adding a fluorescent probe to assist in the detection of the amplification products of the restriction locus and the control locus.

[0033] In some embodiments, step (b) is performed using real-time PCR, and the calculation of the ratio between the signal intensities of the amplification products of the restriction locus and the control locus includes determining the quantification cycle (Cq) of each locus and calculating 2(Cq control locus - Cq restriction locus).

[0034] According to a further aspect, the present invention provides a kit for detecting cancer-related mutations in a DNA sample, the kit comprising at least one restriction endonuclease for digesting the DNA sample, a plurality of primer pairs for the simultaneous amplification of at least one restriction locus and at least one control locus containing the cancer mutation site after digestion with the restriction endonuclease, a computer-readable medium storing computer software that instructs a computer processor to detect cancer-related mutations in the DNA sample based on a comparison of the ratio of the signal intensities of the amplified restriction locus and control locus with a predefined threshold ratio.

[0035] In some embodiments, the computer software instructs a computer processor to perform steps of determining signal intensities of a restriction locus and a control locus after amplification thereof, calculating a ratio between the signal intensities of the restriction locus and the control locus, comparing the calculated ratio with a predefined threshold ratio, and outputting whether the DNA sample is positive for cancer-related mutations based on the comparison.

[0036] In some embodiments, the kit further includes a plurality of polynucleotide probes for detecting amplification products of at least one restriction locus and at least one control locus.

[0037] According to a further aspect, the present invention provides a system for detecting cancer-related mutations in a DNA sample, the system comprising at least one restriction endonuclease for digesting the DNA sample, a plurality of primer pairs for co-amplifying at least one restriction locus and at least one control locus including a cancer mutation site after digestion by the restriction endonuclease, computer software stored in a computer-readable medium for instructing a computer processor to detect cancer-related mutations in the DNA sample based on a comparison between a ratio of signal intensities of the amplified restriction locus and control locus and a predefined threshold ratio.

[0038] In some embodiments, the computer software instructs a computer processor to perform steps of determining signal intensities of a restriction locus and a control locus after amplification thereof, calculating a ratio between the signal intensities of the restriction locus and the control locus, comparing the calculated ratio with a predefined threshold ratio, and outputting whether the DNA sample is positive for cancer-related mutations based on the comparison.

[0039] These and further aspects and features of the present invention will become apparent from the following detailed description, examples and claims.

Brief Description of the Drawings

[0040]

Figure 1A

Figure 1B

Figure 1C

Figure 1D

Modes for Carrying Out the Invention

[0041] The present invention relates to the detection of mutations, particularly cancer-related mutations, in DNA samples using enzymatic restriction and real-time PCR. The present invention includes calculating the ratio of signal intensities between a restriction locus and a control locus that includes a mutated site (e.g., a cancer mutation site) amplified simultaneously from a DNA sample being tested after digestion of the DNA by a restriction enzyme. Based on the ratio of signal intensities, the sample being tested is identified as positive or negative for the mutation (e.g., a cancer-related mutation).

[0042] The ratio of signal intensities is calculated between loci amplified from the same DNA template in the same reaction mixture (i.e., under the same reaction conditions). This renders the method disclosed herein insensitive to various "noisy" factors such as changes in template DNA concentration, PCR conditions, and the presence of inhibitors.

[0043] Advantageously, according to some embodiments, the method of the present invention is performed without separating and / or sequencing the PCR products. The method of the present invention simply detects mutations with high specificity and sensitivity.

[0044] Furthermore, the present invention provides a simple means for the identification of cancer-related mutations, which can be easily integrated into existing methods for cancer diagnosis and which can simultaneously provide disease diagnosis and information, such as information that can assist in selecting a suitable treatment method and determining the prognosis of the disease. More specifically, the method of the present invention may be integrated into cancer diagnosis methods, such as the method described in the co-pending application of the applicant of the present invention regarding lung cancer diagnosis and the method described in the co-pending application of the applicant regarding bladder cancer diagnosis. The methods disclosed herein include identifying cancer based on changes in DNA methylation at selected genomic loci. Those methods include digesting a DNA sample from a subject tested using a methylation-sensitive restriction endonuclease, co-amplifying at least one differentially methylated restriction locus and a control locus between cancer and normal DNA, and calculating the ratio of the signal intensities of the restriction and control loci. Identification of cancer is performed by comparing the calculated ratio to a reference ratio. Advantageously, the method of the present invention is based on similar steps of DNA digestion followed by amplification, determination of signal intensity, and calculation of ratios, and can be easily performed in parallel with these diagnostic methods to provide diagnosis and information regarding the mutational status. For example, detection of lung cancer-related mutations according to the present invention may be performed in parallel with the aforementioned method for diagnosing lung cancer, and may provide information as to whether the subject tested has lung cancer and whether the subject has one or more mutations that make the subject more receptive to a particular treatment and / or affect the prognosis of the subject.

[0045] In some embodiments, provided herein is a method for detecting cancer-related mutations in a DNA sample, the method comprising: (a) subjecting the DNA sample to digestion with a restriction endonuclease to obtain restriction endonuclease-treated DNA; (b) simultaneously amplifying a restriction locus and a control locus containing a cancer mutation site from the restriction endonuclease-treated DNA, thereby generating an amplification product for each locus; (c) calculating a ratio between the signal intensities of the amplification products of the restriction locus and the control locus; and (d) determining whether the calculated ratio is above or below a predefined threshold ratio, thereby detecting cancer-related mutations in the DNA sample.

[0046] In some embodiments, provided herein is a method for generating a mutation profile in a DNA sample, the method comprising: (a) subjecting the DNA sample to digestion with a restriction endonuclease to obtain restriction endonuclease-treated DNA; (b) simultaneously amplifying a restriction locus and a control locus containing a cancer mutation site from the restriction endonuclease-treated DNA, thereby generating an amplification product for each locus; and (c) calculating a ratio between the signal intensities of the amplification products of the restriction locus and the control locus. In some embodiments, the method further comprises determining whether the calculated ratio is above or below a predefined threshold ratio, thereby generating a mutation profile in the DNA sample.

[0047] In some embodiments, the method comprises detecting a mutation based on a ratio between the signal intensities of the amplification products of the restriction locus and the control locus.

[0048] In some embodiments, the method comprises detecting whether a mutation is present by calculating a ratio between the signal intensities of the amplification products of the restriction locus and the control locus, and detecting a signal ratio above a predefined threshold ratio.

[0049] Collection and Processing of Biological Samples The DNA to be analyzed may be derived from tumor tissue (solid tumor). The DNA to be analyzed may be derived from a plasma sample.

[0050] Terms such as "DNA from", "DNA derived from", "DNA of origin of" refer to DNA obtained from a biological sample such as a tumor sample or a blood (plasma) sample. These terms also include natural DNA, that is, DNA found in a biological sample, and PCR products generated from natural DNA such as PCR products containing artificially introduced restriction loci.

[0051] Tumor and / or plasma samples can be collected from a subject using conventional methods.

[0052] As used herein, the term "subject" is interchangeable with "individual" and typically refers to a human subject. The subject may be a cancer patient or may be suspected of having cancer associated with a specific mutation. In some embodiments, the subject may be at risk of developing cancer associated with a specific mutation, for example, based on family history.

[0053] DNA may be extracted from a biological sample according to methods known in the art.

[0054] In some embodiments, when a cancer-related mutation is naturally found within the restriction locus of a methylation-insensitive restriction enzyme, the natural DNA obtained from the biological sample can be used for analysis of the mutated state.

[0055] In other embodiments, when an artificial restriction locus is introduced, before analysis of the mutated state, the natural DNA obtained from the biological sample is subjected to PCR to introduce the restriction locus. In particular, PCR amplification of a locus containing a cancer mutation site using mismatched primers is performed to introduce an artificial restriction locus. Exemplary procedures are illustrated below.

[0056] DNA digestion According to the method of the present invention, DNA derived from a biological sample or a PCR product generated from DNA derived from a biological sample is applied to digestion by a restriction endonuclease.

[0057] In some embodiments, all of the DNA extracted from the biological sample or generated by PCR is used in the digestion step. In some embodiments, the DNA is not quantified before being subjected to digestion. In other embodiments, the DNA is quantified before its digestion.

[0058] As used interchangeably herein with "restriction enzyme", "restriction endonuclease" refers to an enzyme that cuts DNA at or near a specific recognition nucleotide sequence known as a restriction site.

[0059] A "methylation-insensitive" or "methylation-independent" restriction endonuclease is a restriction endonuclease whose activity is not affected by or does not depend on the presence of methylation. In other words, a methylation-insensitive restriction endonuclease cleaves the restriction site regardless of its methylation state.

[0060] The selection of the restriction endonuclease used by the method of the present invention depends on the nucleotide sequence at or near the position of the cancer-related mutation to be detected. In some embodiments, if the mutation position is naturally found within the recognition sequence of a methylation-insensitive restriction endonuclease, this methylation-insensitive restriction endonuclease can be used. The digestion can be performed on the native DNA derived from the biological sample.

[0061] In other embodiments, for example, if the mutation position is not within the recognition sequence of a methylation-insensitive restriction endonuclease, the restriction endonuclease is selected based on technical criteria such as the ability to function at high temperature, and an appropriate recognition sequence can be introduced by PCR using a mismatched primer. The restriction enzyme is preferably other than a methylation-dependent restriction enzyme. The digestion is performed on the PCR product containing the artificially introduced recognition sequence.

[0062] Amplification of genomic loci As used herein, the terms "genomic locus" or "locus" are interchangeable and refer to a DNA sequence at a specific position on a chromosome. The specific position can be identified by the position of the molecule, i.e., the number of the starting and ending base pairs on the chromosome. A variant of the DNA sequence at a specific genomic position is called an allele. Alleles of a locus are located at the same site on homologous chromosomes. A locus includes a gene sequence as well as other genetic elements (e.g., intergenic sequences).

[0063] "Restriction locus" is used herein to describe a locus that contains the recognition sequence of a restriction enzyme used in the method.

[0064] "Restriction locus containing a cancer mutation site" refers to a restriction locus that contains a position known to be prone to mutation in a specific type of cancer. The cancer mutation site is located within the recognition sequence of the restriction enzyme used in the method. As a result of the DNA mutation, a mutant protein such as a protein in which a specific amino acid is replaced by another amino acid, or a protein in which one or more amino acids are deleted, is generated.

[0065] The term "cancer-related mutation" refers to a DNA mutation that results in a mutant protein associated with one or more types of cancer. The mutation is typically indicated by the name of the protein, the changed amino acid, and its position (amino acid number) within the protein chain. For substitutions, the substituted amino acid is also typically indicated. Examples of cancer-related mutations include the following. -KRAS G12 substitution: For example, G12A, G12C, G12D, G12R, G12S, and G12V are associated with cancers such as lung cancer, pancreatic cancer, bladder cancer, colorectal cancer, etc. (e.g., reviewed in Prior et al. 2012, Cancer Res., 72(10):2457-2467). -EGFR exon 19 deletion (E747 - A750 deletion): Associated with cancers such as lung cancer, mainly non - small cell lung cancer (NSCLC) (e.g., Lovly et al. 2015, EGFR Exon 19 Deletion in Non - Small Cell Lung Cancer. My Cancer Genome (reviewed October 15, 2015). -EGFR L858 substitution: For example, L858R is associated with cancers such as lung cancer, mainly non - small cell lung cancer (NSCLC) (e.g., Lovly et al. 2015, EGFR c.2573T>G (L858R) Mutation in Non - Small Cell Lung Cancer. My Cancer Genome (reviewed October 15, 2015). -P53 H179 substitution: For example, H179R, H179L, and H179Y are associated with cancers such as breast cancer, ovarian cancer, and lung cancer (e.g., COSMIC - the Catalogue of Somatic Mutations in Cancer (cancer.sanger.ac.uk) (reviewed in Forbes et al. 2016, Nucleic Acids Research, 45(D1):D777 - D783). -P53 G154 substitution: For example, G154V and G154S are associated with cancers such as lung cancer, esophageal cancer, and liver cancer (see COSMIC same reference). -P53 R282 substitution: For example, R282W and R282G are associated with cancers such as colorectal cancer, esophageal cancer, and breast cancer (see COSMIC same reference). -P53 R248 substitution: For example, R248Q is associated with cancers such as colorectal cancer, breast cancer, esophageal cancer, CNS cancer, etc., and lymphoma (see COSMIC same reference). -P53 R249 substitution: For example, R249S is associated with cancers such as liver cancer, lung cancer, and breast cancer (see COSMIC same reference). -BRAF V600 substitution: For example, V600E is associated with cancers such as thyroid cancer and skin cancer (see COSMIC same reference).

[0066] As used herein, the terms "non-mutated DNA" and "wild-type DNA" refer to the nucleotide identity at the cancer mutation site, and "non-mutated" and "wild-type" indicate the presence of nucleotides that result in the translation of a proper wild-type protein in vivo.

[0067] The term "mutated DNA" refers to the nucleotide identity at the cancer mutation site, indicating that it contains non-wild-type nucleotides associated with cancer.

[0068] "Control locus" and "internal reference locus" are interchangeable and are used herein to describe a locus, and its digestion by a restriction enzyme applied in the digestion step is independent of the presence or absence of a mutation. Typically, a control locus is a locus lacking the recognition sequence of the restriction enzyme applied in the digestion step. Advantageously, the control locus is an internal locus, i.e., a locus within the DNA sample being analyzed, thus eliminating the need for an external / additional control sample.

[0069] In tissues positive for a mutation, more cells contain the mutation at this position compared to tissues negative for the mutation. A restriction enzyme cleaves its recognition sequence only in non-mutated DNA when the mutation site is included in its recognition sequence. Thus, in a DNA sample with a higher proportion of DNA molecules containing the mutation, the degree of digestion is lower compared to a DNA sample with a higher proportion of non-mutated DNA. Due to the difference in digestion efficiency, different amplification patterns are established in subsequent amplification and quantification steps, enabling the discrimination between DNA positive for the mutation and DNA negative for the mutation.

[0070] As used herein, "amplification" refers to an increase in the copy number of one or more specific nucleic acid targets of interest. Amplification is typically performed by polymerase chain reaction (PCR) in the presence of a PCR reaction mixture that may contain a DNA template, a polymerase (usually Taq polymerase), dNTPs, primers, and probes (if necessary), supplemented with a suitable buffer, as known in the art.

[0071] As used herein, the term "polynucleotide" includes polymeric forms of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. The term "oligonucleotide" is also used herein and typically includes polymeric forms of nucleotides up to 100 bases in length.

[0072] "Amplification product" collectively refers to the nucleic acid molecules of a specific target sequence that are generated and accumulated in an amplification reaction. This term generally refers to the nucleic acid molecules generated by PCR using a given set of amplification primers.

[0073] As used herein, "primer" defines an oligonucleotide that can anneal (hybridize) to a target sequence, thereby generating a double-stranded region that can serve as a starting point for DNA synthesis under suitable conditions. The term "primer pair" refers herein to a pair of oligonucleotides that are selected to be used together to amplify a selected nucleic acid sequence, preferably by one of several types of amplification processes, most preferably PCR. As is generally known in the art, primers can be designed to bind to complementary sequences under selected conditions.

[0074] As used herein, "mismatch primer" defines a primer that partially hybridizes to its corresponding target polynucleotide. A mismatch primer includes a complementary portion and a non-complementary portion. The non-complementary portion of the mismatch primer is located at its 3' end and cannot hybridize to the nucleotide of interest present in the target polynucleotide and is typically 1 nucleotide in length. Typically, the complementary portion of the mismatch primer is completely complementary to the target polynucleotide. The complementary portion can be of any suitable length. In some embodiments, the complementary portion is at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 15, at least 16, at least 17, at least 18, at least 19, or greater than 20 nucleotides in length.

[0075] Primers can be of any suitable length depending on the particular assay format and particular needs. In some embodiments, the primers can include at least 15 nucleotides in length, preferably 19-25 nucleotides in length. Primers can be adapted to be particularly suitable for the selected nucleic acid amplification system. As is generally known in the art, oligonucleotide primers can be designed by considering the melting point of their hybridization to their target sequences.

[0076] In some embodiments, the restriction and control loci can be amplified from the same DNA sample (digested sample) using a pair of reverse and forward primers designed as known in the art to specifically amplify each locus.

[0077] In some embodiments, the primers can be designed to generate an amplification product that is 75-225 bases in length.

[0078] The methods disclosed herein include the simultaneous amplification (a process known as multiplex amplification or co-amplification) of multiple target sequences (restriction loci and control loci) in the same reaction mixture. In this process, it is necessary to use two primer pairs simultaneously. As is known in the art, primers can be designed to function at the same annealing temperature during amplification. In some embodiments, primers having similar melting temperatures (Tm) are used in the methods disclosed herein. For primers used in a pool, a Tm variation of about 3 - 5 °C is considered acceptable.

[0079] In some embodiments, the amplification of genomic loci may be performed using real-time PCR (RT-PCR), also known as quantitative PCR (qPCR), where amplification and detection of the amplification products occur simultaneously.

[0080] In some embodiments, detection of the amplification products in RT-PCR can be achieved using polynucleotide probes, typically fluorescently labeled polynucleotide probes.

[0081] As used herein, "polynucleotide probe" or "oligonucleotide probe" are interchangeable and refer to a labeled polynucleotide that is complementary to a specific sub-sequence within the nucleic acid sequence of a locus of interest, e.g., within the sequence of a restriction locus or a control locus. In some embodiments, detection is achieved by using a TaqMan assay (Roche Molecular Systems Inc.) based on a combination of a reporter molecule and a quencher molecule. In such an assay, the polynucleotide probes have a fluorescent moiety (fluorophore) attached to their 5' end and a quencher attached to their 3' end. During PCR amplification, the polynucleotide probes selectively hybridize to their target sequences on the template and are also cleaved by the 5'-nuclease activity of the polymerase as the polymerase replicates the template. When the polynucleotide probe is intact, the quencher and the fluorescent moiety are in very close proximity, so usually the background fluorescence level is low. When the polynucleotide probe is cleaved, the quencher is separated from the fluorescent moiety and the fluorescence intensity increases. The fluorescence signal correlates with the amount of the amplification product, i.e., the signal increases as the amplification product accumulates.

[0082] As used herein, "selectively hybridizes" (and "selective hybridization", "specifically hybridizes", and "specific hybridization") refers to the preferential binding, duplexing, or hybridization of a nucleic acid molecule (such as a primer or a probe) to a particular complementary nucleotide sequence under stringent conditions. The term "stringent conditions" refers to conditions under which a nucleic acid molecule preferentially hybridizes to its target sequence and hybridizes to a lesser extent or not at all to other non-target sequences. "Stringent hybridization" is sequence-dependent in the context of nucleic acid hybridization and varies under different conditions as known in the art.

[0083] Polynucleotide probes may vary in length. In some embodiments, the polynucleotide probe may comprise 15 to 30 bases. In additional embodiments, the polynucleotide probe may comprise 25 to 30 bases. In some embodiments, the polynucleotide probe may comprise 20 to 30 bases, such as, for example, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases, 25 bases, 26 bases, 27 bases, 28 bases, 29 bases, 30 bases. Each possibility represents a separate embodiment of the present invention.

[0084] The polynucleotide probe can be designed to bind to either strand of the template. Additional considerations include the Tm of the polynucleotide probe, which is preferably compatible with that of the primer. Computer software may be used to design the primer and probe.

[0085] As described above, the methods disclosed herein include the simultaneous amplification of multiple target sequences in the same reaction mixture. To identify the multiple target sequences that are amplified in parallel, polynucleotide probes labeled with different fluorescent colors may be used.

[0086] In some embodiments, the polynucleotide probe forms a fluorophore / quencher pair, as is known in the art, and examples include FAM-TAMRA, FAM-BHQ1, Yakima Yellow-BHQ1, ATTO550-BHQ2, and ROX-BHQ2.

[0087] In some embodiments, the combination of dyes may be compatible with the selected RT-PCR thermocycler.

[0088] In some embodiments, the fluorescence may be monitored between each PCR cycle, providing an amplification plot showing the change in the fluorescence signal from the probe as a function of the number of cycles.

[0089] The following terms are used in the context of RT-PCR. The "quantification cycle" ("Cq") refers to the number of cycles in which fluorescence increases beyond a threshold value that is automatically set by software or manually by the user. In some embodiments, the threshold value may be constant for all loci and may be set in advance before amplification and detection are performed. In other embodiments, the threshold value may be defined separately for each locus after execution, based on the maximum fluorescence level detected for this locus during the amplification cycle.

[0090] The "threshold value" refers to the fluorescence value used for Cq determination. In some embodiments, the threshold value can be a value exceeding the baseline fluorescence and / or a value exceeding the background noise and can be within the exponential growth phase of the amplification plot.

[0091] The "baseline" refers to the initial cycles of PCR where there is little or no change in fluorescence.

[0092] Computer software can be used to analyze the amplification plot and determine the baseline, threshold value, and Cq.

[0093] After digestion with a restriction enzyme, the DNA molecule is protected from digestion, so that the loci where the cancer mutation sites are mutated are amplified with high efficiency. Since the detectable amplification products are shown at relatively few (low) amplification cycles, as a result, the Cq value becomes relatively low. Conversely, loci where the cancer mutation sites are not mutated are cut more extensively during the digestion step, and thus, in the amplification and quantification steps, a higher Cq value is obtained (i.e., it shows an amplification product that becomes detectable after a relatively large number of amplification cycles).

[0094] In an alternative embodiment, amplification and detection of the amplification products can be performed by conventional PCR using fluorescently labeled primers, followed by capillary electrophoresis of the amplification products. In some embodiments, after amplification, the amplification products are separated by capillary electrophoresis and the fluorescence signals are quantified. In some embodiments, an electropherogram can be generated that plots the change in fluorescence signal as a function of size (bp) or time from injection, and each peak in the electropherogram corresponds to the amplification product of a single locus. The height of the peak (given, for example, using "relative fluorescence units", rFU) may represent the intensity of the signal from the amplified locus. Computer software can be used to detect the peaks, calculate the fluorescence intensity (peak height) of the loci for which the amplification products were run on a capillary electrophoresis apparatus, and subsequently calculate the ratio between the signal intensities.

[0095] A DNA sample digested with a restriction enzyme in which the cancer mutation site is mutated generates a relatively strong signal (higher peak) in the electropherogram. Conversely, at loci where the cancer mutation site is not mutated, a relatively weak signal (lower peak) is generated in the electropherogram.

[0096] In some embodiments, the fluorescent label of the primer comprises any one of fluorescein, FAM, lysamine, phycoerythrin, rhodamine, Cy2, Cy3, Cy3.5, Cy5, Cy5.5, Cy7, FluorX, JOE, HEX, NED, VIC and ROX.

[0097] Signal ratio As used herein, the terms "ratio" or "signal ratio" refer to the ratio between the intensities of signals obtained from the co-amplification of a pair of genomic loci in a single DNA sample (in the same reaction mixture), in particular, the co-amplification of a restriction locus and a control locus.

[0098] As used herein, the term "signal intensity" refers to a measure that reflects the amount of locus-specific amplification product corresponding to the initial amount of intact copies of a locus. However, the signal intensity may not indicate the actual amount of amplification product / intact locus, and may not involve any calculation of the absolute amount of amplification product / intact locus. Therefore, when calculating the ratio of signals of amplification products, it is not necessary to calculate the actual DNA concentration itself, and thus no standard curve or reference DNA is required.

[0099] In some exemplary embodiments, amplification and detection of the amplification product are performed by RT-PCR, and the signal intensity of a particular locus is represented by the Cq calculated for this locus. The signal ratio in this case is represented by the following calculation: 2 (Cq of the control locus - Cq of the restricted locus).

[0100] In some embodiments, when there is no amplification or very little amplification, Cq is determined to be "infinity". In some embodiments, in such cases, the numerical value of the formula (Cq of the control locus - Cq of the restricted locus) is set to (-14), and the signal ratio is set to 1:16384. In additional embodiments, in such cases, the signal ratio is set to 1:16000.

[0101] In additional exemplary embodiments, detection of the amplification product is performed by capillary electrophoresis, and the signal intensity of a particular locus is the number of relative fluorescence units (rfu) of its corresponding peak. The signal ratio is calculated by dividing the height of the peak of the restricted locus by the height of the peak of the control locus.

[0102] In some embodiments, calculating the ratio between the signal intensities of the amplification products of the restricted locus and the control locus in a DNA sample involves: (i) determining the signal intensity of the amplification product of the restricted locus, (ii) determining the signal intensity of the amplification product of the control locus, and (iii) calculating the ratio between the two signal intensities.

[0103] In some embodiments, calculating the ratio between the signal intensities of the amplification products of the restriction locus and the control locus in a DNA sample involves determining the Cq of each locus and calculating the difference between the Cq of the control locus and the Cq of the restriction locus. In some embodiments, the calculation further involves applying the following formula: 2 ^ (Cq of control locus - Cq of restriction locus).

[0104] In some embodiments, computer software can be used to calculate the ratio between the signal intensities of the amplification products.

[0105] Determination of Mutation Status The methods disclosed herein are based on evaluating the signal ratio calculated for a given DNA sample to determine its mutation status, i.e., whether it is positive or negative for a particular cancer-related mutation.

[0106] In some embodiments, the ratio calculated for the tested sample is compared to a reference ratio. In some embodiments, the calculated ratio is compared to a threshold ratio. In some embodiments, the calculated signal ratio indicates that the DNA is positive for the mutation if the calculated signal ratio exceeds or falls below a predefined threshold ratio.

[0107] The "threshold ratio" or "cut-off ratio" refers to the signal ratio that distinguishes a population of mutation-negative samples from a population of mutation-positive samples.

[0108] In some embodiments, a lower ratio below the threshold is from a non-mutated sample, e.g., a sample from a normal individual (healthy, i.e., not suffering from cancer), while a higher ratio above the threshold is from a mutated sample, e.g., a sample from a cancer patient positive for the mutation.

[0109] In some embodiments, determining the threshold ratio involves measuring the signal ratio between specific pairs of restriction and control loci in a large population of subjects (or biological samples) having either a known mutant positive or mutant negative mutation status, as determined by other methods. After analyzing the signal ratios in this large sample set, a threshold is set to minimize false positive cases and obtain the desired level of specificity. Preferably, the threshold is set such that a specificity of greater than 95% is obtained.

[0110] As described above, the signal ratio can be determined by a variety of methods, including, for example, measuring peaks after capillary electrophoresis or calculating Cq after RT-PCR.

[0111] In some embodiments, the method of the invention includes providing a threshold ratio.

[0112] In some embodiments, the threshold is a statistically significant value. Often, statistical significance is determined by comparing two or more populations to determine the confidence interval (CI) and / or p-value. In some embodiments, a statistically significant value refers to a confidence interval (CI) of about 90%, 95%, 97.5%, 98%, 99%, 99.5%, 99.9%, and 99.99%, while a preferred p-value is less than about 0.1, 0.05, 0.025, 0.02, 0.01, 0.005, 0.001, or 0.0001. Each possibility represents a separate embodiment of the invention. According to some embodiments, the p-value of the threshold is at most 0.05.

[0113] As used herein, the term "about", when referring to a measurable value, encompasses a variation of + / - 10%, more preferably + / - 5%, even more preferably + / - 1%, and even more preferably + / - 0.1% from the specified value.

[0114] In some embodiments, the sensitivity of the methods disclosed herein can be at least about 75%. In some embodiments, the sensitivity of the method can be at least about 80%. In some embodiments, the sensitivity of the method can be at least about 85%. In some embodiments, the sensitivity of the method can be at least about 90%.

[0115] In some embodiments, the "sensitivity" of a diagnostic assay as used herein refers to the proportion of mutant samples that test positive in the assay (the proportion of "true positives"). Thus, mutant individuals not detected by the assay are "false negatives". Samples that are not mutated and test negative in the assay are called "true negatives". The "specificity" of a diagnostic assay is one minus the false positive rate, where the "false positive" rate is defined as the proportion of samples that test positive in the absence of a mutation. For a particular diagnostic method, it may not provide a definitive diagnosis of a condition, but that may be sufficient if the method provides a positive indicator that is useful for diagnosis.

[0116] In some embodiments, the specificity of the methods disclosed herein can be at least about 65%. In some embodiments, the specificity of the method can be at least about 70%. In some embodiments, the specificity of the method can be at least about 75%. In some embodiments, the specificity of the method can be at least about 80%.

[0117] Kits and Systems In some embodiments, a kit for detecting cancer-related mutations in a DNA sample is provided. In some embodiments, a system for detecting cancer-related mutations in a DNA sample is provided.

[0118] In some embodiments, the kits and systems are for detecting cancer-related mutations according to the methods of the present invention.

[0119] In some embodiments, the kit includes at least one restriction endonuclease for digesting a DNA sample, and a plurality of primer pairs for co-amplifying at least one restriction locus containing a cancer mutation site and at least one control locus after digestion with the restriction endonuclease.

[0120] In some embodiments, the kit further includes a computer-readable medium storing computer software that instructs a computer processor to detect cancer-related mutations in the DNA sample based on a comparison of the ratio of the signal intensities of the amplified restriction locus and the control locus to a predefined threshold ratio.

[0121] In some embodiments, the system includes at least one restriction endonuclease for digesting a DNA sample, a plurality of primer pairs for co-amplifying at least one restriction locus containing a cancer mutation site and at least one control locus after digestion with the restriction endonuclease, and computer software stored on a computer-readable medium that instructs a computer processor to detect cancer-related mutations in the DNA sample based on a comparison of the ratio of the signal intensities of the amplified restriction locus and the control locus to a predefined threshold ratio.

[0122] In some embodiments, the computer software according to the present invention includes steps of determining signal intensities of each restriction locus and each control locus after their simultaneous amplification, calculating a ratio between the signal intensities of each restriction locus and its corresponding control locus, comparing the calculated ratio with a predefined threshold ratio, and outputting whether the DNA sample is positive for cancer-related mutations based on the comparison, and commands a computer processor to execute. In some embodiments, the kit or system includes primers for amplification of a single pair of restriction and control loci for detecting the presence of a single cancer-related mutation. In other embodiments, the kit or system includes primers for amplifying a plurality of restriction loci and corresponding control loci for detecting the presence of a plurality of cancer-related mutations.

[0123] In some embodiments, the computer software receives as input parameters or raw data of the execution of real-time PCR. In some embodiments, the computer software analyzes the execution of real-time PCR and commands a computer processor to determine signal intensities and signal ratios.

[0124] The computer software includes processor-executable instructions stored in a non-transitory computer-readable medium. The computer software may also include stored data. The computer-readable medium is a tangible computer-readable medium such as a compact disc (CD), magnetic storage device, optical storage device, random access memory (RAM), read-only memory (ROM), or any other tangible medium.

[0125] In some embodiments, the kit includes a restriction enzyme, a pair of primers for amplifying a restriction locus and a control locus, means for detecting amplification products of the restriction locus and the control locus, and instructions for determining cancer-related mutations. In some embodiments, the instructions may be electronic instructions.

[0126] In some embodiments, the instruction manual may provide a threshold signal ratio, and if the ratio is exceeded, it is determined that the sample is positive for the mutation. In other embodiments, the instruction manual can provide a threshold signal ratio, and if the ratio is below it, it is determined that the sample is positive for the mutation.

[0127] In some embodiments, the instruction manual may include instructions for performing the method steps described above.

[0128] In some embodiments, the instruction manual may include instructions for guiding the correlation between the signal ratio and the mutation status.

[0129] In some embodiments, the instruction manual can provide instructions for calculating the signal ratio.

[0130] In some embodiments, the kit includes a methylation-insensitive endonuclease.

[0131] In some embodiments, the kit may further include computer software. In some embodiments, the computer software can be computer software for calculating at least one of the signal intensity and the signal ratio.

[0132] In some embodiments, the kit includes fluorescent polynucleotide probes complementary to the restriction locus and the control locus.

[0133] In some embodiments, the kit includes a primer pair complementary to the restriction locus and the control locus described herein, and fluorescent polynucleotide probes complementary to the subsequences within the restriction locus and the control locus.

[0134] In some embodiments, the kit includes mismatch primers for introducing an artificial restriction locus into a DNA sample.

[0135] In some embodiments, the kit comprises one or more containers filled with at least one nucleotide primer pair. In some embodiments, each nucleotide primer pair included in the kit of the invention may comprise a primer complementary to a subsequence within a restriction locus or a control locus, and each nucleotide primer pair is designed to selectively amplify a fragment of the genome containing the restriction or control locus.

[0136] In some embodiments, the kit may comprise primer pairs for selectively amplifying the combinations of loci described above.

[0137] In some embodiments, the kit may further comprise oligonucleotide probes for detecting the amplification products of the loci amplified using the primers in the kit. Each oligonucleotide probe may be complementary to a subsequence within the locus and may be capable of hybridizing thereto. In some embodiments, the oligonucleotide probe may be fluorescently labeled.

[0138] In some embodiments, the kit may further comprise at least one additional component necessary for DNA digestion, locus amplification, and detection of amplification products such as DNA polymerase and nucleotide mixtures.

[0139] In some embodiments, the kit may further comprise a suitable reaction buffer for digestion and amplification, as well as a written protocol for performing mutation detection. The written protocol includes, but is not limited to, DNA digestion parameters, PCR cycling parameters, signal ratio analysis, and signal ratio thresholds, and may include instructions for performing any of the steps disclosed herein.

[0140] In some embodiments, the kit further comprises materials for DNA extraction from tissue or plasma.

[0141] The following examples are presented to more fully illustrate specific embodiments of the present invention. However, they should in no way be construed as limiting the broad scope of the invention. Those skilled in the art can readily devise many variations and modifications of the principles disclosed herein without departing from the scope of the invention.

Example

[0142] Example 1 - Mutation Detection in DNA from Solid Tissues Lung cancer tumor tissue samples (n = 72, including adenocarcinoma, squamous cell carcinoma, and small cell carcinoma) and normal lung tissue samples (n = 25) were tested for KRAS G12 mutations by Sanger sequencing and by enzymatic restriction combined with real-time (RT)-PCR according to the present invention.

[0143] DNA was extracted from tissue samples using the QIAamp® DNA Mini Kit. Since the native DNA sequence of KRAS around codon G12 does not contain a restriction site, 10-cycle pre-analytical PCR to introduce a BstNI restriction site was performed, and the sequence was modified using the following primers. Forward 5’-GGATCATATTCGTCCACAAAATG (SEQ ID NO: 1) Reverse 5’-TATAAACTTGTGGTAGTTGGACCT (SEQ ID NO: 2) The DNA amount for pre-analytical PCR was 4 ng.

[0144] The sequences around codon G12 before and after introduction of the BstNI restriction site are as follows (nucleotides changed to introduce the restriction site are shown in bold, and the introduced restriction site is underlined). TIFF0007717754000001.tif8162TIFF0007717754000002.tif7162

[0145] The modified array is expected to be recognized by BstNI and significantly cleaved upon contact with the enzyme. If there are mutations that change one or more nucleotides G marked in italics, that locus will no longer be recognized by BstNI and will not be cleaved.

[0146] After the introduction of the BstNI site, each DNA sample was subjected to digestion with BstNI. The digestion reaction (total volume 50 microliters) contained 40 microliters of the PCR product diluted (1:100) with the digestion buffer and BstNI. Digestion was carried out at 60 °C for 2 hours.

[0147] The digested DNA was subjected to quantitative RT-PCR to amplify the restriction locus containing the G12 codon and a control locus that does not contain the recognition sequence of BstNI and remains intact when the DNA sample is digested with this enzyme.

[0148] Sequence of the restriction locus (G12 codon shown in bold): TIFF0007717754000003.tif15151

[0149] The restriction locus corresponds to positions 25289485 - 25289577 on chromosome 12.

[0150] Sequence of the control locus: AGCAAGGTGAAGACTAACTTTTCTCTTGTACAGAATCATCAGGCTAAAT TTTTGGCATT ATTTCAGTCC TTGGAGAC (SEQ ID NO: 4).

[0151] The control locus corresponds to positions 121380844 - 121380921 on chromosome 7.

[0152] The amplification reaction (total volume 25 microliters) contained 10 microliters of digested DNA, 0.2 μM primers, dNTPs, and reaction buffer. To enable detection of the amplification products during amplification, a fluorescently labeled polynucleotide probe was added to the reaction for each locus (FAM and JOE labels, for the restriction and control loci respectively). The RT-PCR reaction was carried out on an ABI 7500 FastDx instrument using the following PCR program: 95°C for 10 minutes -> 45X (95°C for 15 seconds -> 60°C for 1 minute).

[0153] Figures 1A - 1D show exemplary quantitative PCR plots, showing the change in fluorescence signal from the probe as a function of cycle number. These figures show the PCR plots of the restriction and control loci in DNA samples from cancerous lung tissue with a G12V mutation (Figure 1A), a G12A mutation (Figure 1B), or no G12 mutation (Figure 1C), and DNA samples from normal lung tissue (no G12 mutation) (Figure 1D).

[0154] In samples with a mutation, the restriction locus was no longer recognized by BstIN, so it remained mostly intact when digested with the enzyme and the restriction locus was amplified with high efficiency. It rose at about the same cycle as the control locus (which was not cut at all), or 1 - 3 cycles later than that.

[0155] In samples with no mutation in G12 (cancerous or normal), the restriction locus was significantly cut by BstNI and little amplification was seen (Figures 1C and 1D).

[0156] For each sample, the ratio between the signal intensity of the restriction locus and the signal intensity of the control locus was calculated as follows: The quantification cycle (Cq) was determined for the restriction and control loci. The Cq values were used in the following formula. 2 (Cq of control locus - Cq of restriction locus)

[0157] The numerical value obtained from this calculation represents the signal ratio between the restricted locus and the control locus.

[0158] In Figure 1A, the Cq of the control locus is 28.3, the Cq of the restricted locus is 27.8, and thus the signal ratio is 1:0.7. This signal ratio is significantly higher than the set threshold (1:500, which will be described in more detail below), indicating the presence of the KRAS G12 mutation in the sample.

[0159] In Figure 1B, the Cq of the control locus is 28.5, the Cq of the restricted locus is 31.3, and thus the signal ratio is 1:6.9. This signal ratio is also significantly higher than the threshold, indicating the presence of the KRAS G12 mutation in the sample.

[0160] Figure 1C - The Cq of the control locus is 27.7. Since the restricted locus does not exceed the minimum fluorescence threshold, the Cq cannot be calculated and is determined as "infinity". In such a case, the numerical value of the signal ratio is set to 1:16000, which is significantly lower than the threshold (1:500). Figure 1D represents a similar case, where the Cq of the control locus is 28 and the Cq of the restricted locus is "infinity". Thus, the signal ratio is 1:16000. Both samples are determined to be negative for the KRAS G12 mutation.

[0161] Results: Sanger sequencing: In normal lung tissue samples, the KRAS G12 mutation was not identified. In 19% of the lung cancer tumor tissue samples, the KRAS G12 mutation was found.

[0162] Enzyme restriction and RT-PCR assay: A threshold signal ratio of 1:500 was set such that the presence of the G12 mutation was indicated by a signal ratio between the restriction locus and the control locus being higher than 1:500 (e.g., 1:200). After analysis of a major set of normal lung and lung tumor tissues to obtain a specificity of greater than 95%, the threshold signal ratio was set to 1:500. Based on the signal ratio data calculated for each sample, all lung cancer tumor tissue samples that were found by sequencing to have the KRAS G12 mutation were also identified as being accompanied by the G12 mutation. In normal lung tissue, the KRAS G12 mutation was not identified.

[0163] Example 2 - Detection of mutations in plasma-derived DNA One hundred and five plasma samples from control patients (without lung cancer) and ninety-nine plasma samples from lung cancer patients were tested for the KRAS G12 mutation as described in Example 1 above.

[0164] A threshold signal ratio for plasma-derived DNA was set at 1:1000 such that the presence of the G12 mutation was indicated when the signal ratio between the restriction locus and the control locus exceeded 1:1000 (e.g., 1:200).

[0165] Assuming that DNA from plasma samples of healthy individuals did not contain the KRAS G12 mutation, a primary set of plasma samples from healthy (without lung cancer) and lung cancer patients was tested, and then the threshold signal ratio was set at 1:1000 in order to minimize false positive cases (to obtain a specificity of greater than 95%).

[0166] Six percent of the lung cancer plasma was identified as G12 mutation positive.

[0167] One percent of the control plasma was identified as G12 mutation positive, indicating that 1% of the cases were false positives.

[0168] The foregoing description of specific embodiments fully discloses the general nature of the present invention, so that others can, by applying current knowledge, without undue experimentation and without departing from the general concept, easily modify and / or adapt such specific embodiments for various uses, and accordingly, such adaptations and modifications should be understood to be within the meaning and scope of the equivalents of the disclosed embodiments and are so intended. It should be understood that the expressions or terms used herein are for the purpose of description and not of limitation. The means, materials, and steps for performing the various disclosed chemical structures and functions can take a variety of alternative forms without departing from the present invention.

Claims

1. A kit for detecting cancer-related mutations in a DNA sample, said kit comprising at least one restriction endonuclease for digesting the DNA sample and a plurality of primer pairs for simultaneous amplification of at least one restriction locus and at least one control locus containing the cancer mutation site after digestion with the restriction endonuclease, said control locus being within the DNA sample, the kit.

2. The kit according to claim 1, wherein the restriction endonuclease is a methylation-insensitive restriction endonuclease.

3. The kit according to claim 1, further comprising means for detecting the amplification products of the at least one restriction locus and the at least one control locus.

4. The kit according to claim 3, wherein the means comprises a plurality of polynucleotide probes.

5. The kit according to any one of claims 1 to 4, further comprising instructions for determining cancer-related mutations.

6. The kit according to claim 5, wherein the instructions provide a threshold signal ratio, above which the sample is determined to be mutation positive.

7. The instructions include instructions for performing a method, the method comprising (a) subjecting the DNA sample to digestion with the restriction endonuclease to obtain restriction endonuclease-treated DNA; (b) simultaneously amplifying the at least one restriction locus and the at least one control locus from the restriction endonuclease-treated DNA, thereby generating amplification products for each locus; (c) calculating the ratio between the signal intensities of the amplification products of the at least one restriction locus and the at least one control locus; (d) detecting the cancer-related mutation in the DNA sample by comparing the ratio calculated in step (c) with a predefined threshold ratio.

8. The kit according to claim 5, wherein the instructions include instructions showing the correlation between the signal ratio and the mutation status.

9. The kit according to claim 5, wherein the instructions provide instructions for calculating the signal ratio.

10. The kit according to claim 1, further comprising mismatch primers for introducing artificial restriction loci into the DNA sample. Claim 11 The kit according to claim 1, further comprising at least one additional component necessary for DNA digestion, locus amplification, and detection of the amplification product. Claim 12 The kit according to claim 11, wherein the at least one additional component comprises a DNA polymerase and a nucleotide mixture. Claim 13 The kit according to claim 1, further comprising a suitable reaction buffer for digestion and amplification, and a written protocol for performing mutation detection. Claim 14 The kit according to claim 1, further comprising materials for DNA extraction from tissue or plasma.

Citation Information

Patent Citations

  • Methods for diagnosing bladder cancer

    US9476100B1