Complement component C5 iRNA composition and method of using the same

Abstract

To provide agents for the treatment of subjects having complement component C5-associated diseases, e.g. paroxysmal nocturnal hemoglobinuria.SOLUTION: The present invention provides a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of complement component C5, wherein the dsRNA comprises a sense strand and an antisense strand, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from a specific nucleotide sequence, and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from another specific nucleotide sequence.SELECTED DRAWING: Figure 1

Description

Technical Field

[0001] Related Applications This application claims the benefit of U.S. Provisional Patent Application No. 61 / 782,531, filed Mar. 14, 2013; U.S. Provisional Patent Application No. 61 / 837,399, filed Jun. 20, 2013; U.S. Provisional Patent Application No. 61 / 904,579, filed Nov. 15, 2013; U.S. Provisional Patent Application No. 61 / 912,777, filed Dec. 6, 2013; and U.S. Provisional Patent Application No. 61 / 942,367, filed Feb. 20, 2014. The entire contents of each of the above provisional patent applications are hereby incorporated by reference herein.

[0002] Sequence Listing This application includes a Sequence Listing that has been electronically submitted in ASCII format and is hereby incorporated by reference in its entirety. The name of the ASCII copy created on Mar. 10, 2014 is 121301-00520_SL.txt, and the size is 734,486 bytes.

Background Art

[0003] Complement was first discovered in the 1890s (Non-Patent Document 1) when it was found to assist or “complement” the killing of bacteria by heat-stable antibodies present in normal serum. The complement system consists of more than 30 proteins that exist either as soluble proteins in the blood or as membrane-bound proteins. Activation of complement results in a sequential cascade of enzymatic reactions known as the complement activation pathway, leading to the formation of the potent anaphylatoxins C3a and C5a, which trigger many physiological reactions ranging from chemotaxis to apoptosis. Initially, complement was thought to play a major role in innate immunity where a strong and rapid response is made against invading pathogens. However, more recently, complement has been shown to play an important role in adaptive immunity, which involves T cells and B cells that help eliminate pathogens in maintaining immune memory to prevent reinvasion of pathogens (Non-Patent Document 2; Non-Patent Document 3), and is increasingly being shown to be involved in human pathological conditions (Non-Patent Document 4; Non-Patent Document 5).

[0004] Complement activation is known to occur through three different pathways involving proteins that mainly exist as inactive zymogens and are subsequently sequentially cleaved and activated: the alternative pathway, the classical pathway, and the lectin pathway (Figure 1). All pathways of complement activation result in the cleavage of C5 molecule to generate anaphylatoxin C5a and C5b which later forms the terminal complement complex (C5b-9). C5a exerts significant pro-inflammatory activity through interaction with the classical G protein-coupled receptor C5aR (CD88) and the non-G protein-coupled receptor C5L2 (GPR77) which are expressed on various immune and non-immune cells. C5b-9 causes cell lysis through the formation of the membrane attack complex (MAC), and sub-lytic MAC and soluble C5b-9 also have many non-cytolytic immune functions. These two complement effectors, C5a and C5b-9, generated from the cleavage of C5, are the major components of the complement system that are responsible for the propagation and / or initiation of lesions in various diseases including paroxysmal nocturnal hemoglobinuria, rheumatoid arthritis, ischemia-reperfusion injury, and neurodegenerative diseases.

PRIOR ART DOCUMENTS

NON-PATENT DOCUMENTS

[0005]

NON-PATENT DOCUMENT 1

NON-PATENT DOCUMENT 2

NON-PATENT DOCUMENT 3

NON-PATENT DOCUMENT 4

NON-PATENT DOCUMENT 5

Summary of the Invention

Problems to be Solved by the Invention

[0006] To date, the anti-C5 antibody, eculizumab (Soliris®), which is the only therapy targeting the C5-C5a axis, has been available for the treatment of diseases related to the complement component C5. Eculizumab has been shown to be effective in the treatment of paroxysmal nocturnal hemoglobinuria (PNH) and atypical hemolytic uremic syndrome (aHUS), and is currently being evaluated in clinical trials for further diseases related to the complement component C5. However, the eculizumab therapy requires a high-dose injection once a week and subsequent maintenance injections every other week at an annual cost of approximately $400,000. Therefore, alternative therapies and combination therapies for subjects suffering from diseases related to the complement component C5 are needed in the art.

Means for Solving the Problems

[0007] The present invention provides an iRNA composition that results in cleavage of an RNA transcript of the C5 gene via an RNA-induced silencing complex (RISC). The C5 gene can be intracellularly present in a cell, such as a cell within a subject, for example, a human. The present invention also provides a method and combination therapy for treating a subject suffering from a disorder, such as a disease related to the complement component C5, for example, paroxysmal nocturnal hemoglobinuria (PNH) and atypical hemolytic uremic syndrome (aHUS), that can benefit from inhibiting or reducing the expression of the C5 gene using an iRNA composition that results in cleavage of an RNA transcript of the C5 gene via an RNA-induced silencing complex (RISC).

[0008] Accordingly, in one aspect, the present invention provides a double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of complement component C5, wherein the dsRNA comprises a sense strand and an antisense strand, the sense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 1 by three or fewer nucleotides, and the antisense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 5 by three or fewer nucleotides.

[0009] In another aspect, the present invention provides a double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of complement component C5, wherein the dsRNA comprises a sense strand and an antisense strand, and the antisense strand comprises a complementary region comprising at least 15 consecutive nucleotides that differ from any one of the antisense sequences listed in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23 by three or fewer nucleotides.

[0010] In one embodiment, the sense strand and the antisense strand comprise a sequence selected from the group consisting of A-118320, A-118321, A-118316, A-118317, A-118332, A-118333, A-118396, A-118397, A-118386, A-118387, A-118312, A-118313, A-118324, A-118325, A-119324, A-119325, A-119332, A-119333, A-119328, A-119329, A-119322, A-119323, A-119324, A-119325, A-119334, A-119335, A-119330, A-119331, A-119326, A-119327, A-125167, A-125173, A-125647, A-125157, A-125173, and A-125127. In another embodiment, the sense strand and the antisense strand comprise a sequence selected from the group consisting of any of the sequences in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23. In one embodiment, the dsRNA agent comprises at least one modified nucleotide.

[0011] In one aspect, the present invention provides a double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of complement component C5, wherein the dsRNA agent comprises a sense strand and an antisense strand, the sense strand comprises the nucleotide sequence AAGCAAGAUAUUUUUAUAAUA (SEQ ID NO: 62), and the antisense strand comprises the nucleotide sequence UAUUAUAAAAAUAUCUUGCUUUU (SEQ ID NO: 113). In one embodiment, the dsRNA agent comprises at least one modified nucleotide as described hereinafter.

[0012] In one aspect, the present invention provides a double-stranded RNAi agent for inhibiting the expression of complement component C5, wherein the double-stranded RNAi agent comprises a sense strand and an antisense strand that form a double-stranded region, the sense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 1 by no more than 3 nucleotides, the antisense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 5 by no more than 3 nucleotides, substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and the sense strand is conjugated to a ligand attached at the 3'-end.

[0013] In one embodiment, all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand comprise modifications.

[0014] In one embodiment, substantially all of the nucleotides of the sense strand are modified nucleotides selected from the group consisting of 2'-O-methyl modification, 2'-fluoro modification, and 3'-terminal deoxy-thymine (dT) nucleotides. In another embodiment, substantially all of the nucleotides of the antisense strand are modified nucleotides selected from the group consisting of 2'-O-methyl modification, 2'-fluoro modification, and 3'-terminal deoxy-thymine (dT) nucleotides. In another embodiment, the modified nucleotide is a short sequence of deoxy-thymine (dT) nucleotides. In another embodiment, the sense strand includes a phosphorothioate internucleotide linkage between two nucleotides at the 5'-terminus. In one embodiment, the antisense strand includes a phosphorothioate internucleotide linkage between two nucleotides at the 5'-terminus and a phosphorothioate internucleotide linkage between two nucleotides at the 3'-terminus. In yet another embodiment, the sense strand is conjugated to one or more GalNAc derivatives linked via a branched divalent or trivalent linker at the 3'-terminus.

[0015] In one embodiment, at least one of the modified nucleotides is selected from the group consisting of 3'-terminal deoxy-thymine (dT) nucleotides, 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides, non-basic nucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholino nucleotides, phosphoramidates, nucleotides containing non-natural bases, nucleotides containing a 5'-phosphorothioate group, and terminal nucleotides conjugated to a cholesteryl derivative or a didodecylamide group of dodecanoic acid.

[0016] In another embodiment, the modified nucleotide includes a short sequence of 3'-terminal deoxy-thymine (dT) nucleotides.

[0017] In one embodiment, the complementary region is at least 17 nucleotides in length. In another embodiment, the complementary region is 19 to 21 nucleotides in length.

[0018] In one embodiment, the complementary region is 19 nucleotides in length.

[0019] In one embodiment, each strand is 30 nucleotides in length or less.

[0020] In one embodiment, at least one strand comprises a 3' overhang of at least one nucleotide. In another embodiment, at least one strand comprises a 3' overhang of at least two nucleotides.

[0021] In one embodiment, the dsRNA agent further comprises a ligand.

[0022] In one embodiment, the ligand is conjugated to the 3' end of the sense strand of the dsRNA agent.

[0023] In one embodiment, the ligand is an N-acetylgalactosamine (GalNAc) derivative.

[0024] In one embodiment, the ligand is

Chemical formula

[0025] In one embodiment, the dsRNA agent is conjugated to a ligand as shown in the following schematic diagram

Chemical formula

[0026] In one embodiment, X is O.

[0027] In one embodiment, the complementary region consists of one of the antisense sequences of any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23.

[0028] In one embodiment, the dsRNA agent is selected from the group consisting of AD-58123, AD-58111, AD-58121, AD-58116, AD-58133, AD-58099, AD-58088, AD-58642, AD-58644, AD-58641, AD-58647, AD-58645, AD-58643, AD-58646, AD-62510, AD-62643, AD-62645, AD-62646, AD-62650, and AD-62651.

[0029] In another aspect, the present invention provides a double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of complement component C5, wherein the dsRNA agent comprises a sense strand and an antisense strand, the sense strand comprises the nucleotide sequence AAGCAAGAUAUUUUUAUAAUA (SEQ ID NO: 62), and the antisense strand comprises the nucleotide sequence UAUUAUAAAAAUAUCUUGCUUUUdTdT (SEQ ID NO: 2899).

[0030] In another aspect, the present invention provides a double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of complement component C5, wherein the dsRNA agent comprises a sense strand and an antisense strand, the sense strand comprises the nucleotide sequence asasGfcAfaGfaUfAfUfuUfuuAfuAfauaL96 (SEQ ID NO: 2876), and the antisense strand comprises the nucleotide sequence usAfsUfuAfuaAfaAfauaUfcUfuGfcuususudTdT (SEQ ID NO: 2889).

[0031] In one aspect, the present invention provides a double-stranded RNAi agent capable of inhibiting the expression of complement component C5 in cells, for example, a double-stranded RNAi agent, wherein the double-stranded RNAi agent comprises a sense strand complementary to the antisense strand, the antisense strand comprises a region complementary to a part of the mRNA encoding C5, each strand is about 14 to about 30 nucleotides in length, and the double-stranded RNAi agent has the formula (III): Sense: 5’n p -N a -(XXX) i -N b -YYY-Nb -(ZZZ) j -N a -n q 3’ Antisense: 3’n p ’-N a ’-(X’X’X’) k -N b ’-Y’Y’Y’-N b ’-(Z’Z’Z’) l -N a ’-n q ’5’(III) (Wherein: i, j, k, and l are each independently 0 or 1; p, p’, q, and q’ are each independently 0 to 6; Each N a and N a ’ represents an oligonucleotide sequence containing either modified or unmodified 0 to 25 nucleotides or combinations thereof, each sequence containing at least two different modified nucleotides; Each N b and N b ’ represents an oligonucleotide sequence containing either modified or unmodified 0 to 10 nucleotides or combinations thereof; Each n p , n p ’, n q , and n q ’ independently represents an overhang nucleotide; XXX, YYY, ZZZ, X’X’X’, Y’Y’Y’, and Z’Z’Z’ each independently represent one motif of three identical modifications on three consecutive nucleotides; The modification on N b is different from the modification on Y, and the modification on N b ’ is different from the modification on Y’; (The sense strand is conjugated to at least one ligand)) To provide a double-stranded RNAi agent represented by.

[0032] In one embodiment, i is 0; j is 0; i is 1; j is 1; both i and j are 0; or both i and j are 1.

[0033] In one embodiment, k is 0; l is 0; k is 1; l is 1; both k and l are 0; or both k and l are 1.

[0034] In one embodiment, XXX is complementary to X’X’X’; YYY is complementary to Y’Y’Y’; ZZZ is complementary to Z’Z’Z’.

[0035] In one embodiment, the YYY motif is present at or near the cleavage site of the sense strand.

[0036] In one embodiment, the Y’Y’Y’ motif is present at positions 11, 12, and 13 of the 5'-terminal antisense strand.

[0037] In one embodiment, Y’ is 2’-O-methyl.

[0038] In one embodiment, formula (III) is formula (IIIa): Sense: 5’n p -N a -YYY-N a -n q 3’ Antisense: 3’n p’ -N a’ -Y’Y’Y’-N a’ -n q’ 5’(IIIa) represented by

[0039] In another embodiment, formula (III) is formula (IIIb): Sense: 5’n p -N a -YYY-N b -ZZZ-N a -n q 3’ Antisense: 3’n p’ -N a’-Y’Y’Y’-N b’ -Z’Z’Z’-N a’ -n q’ 5’(IIIb) (wherein each N b and N b ’ independently represents an oligonucleotide sequence containing 1 to 5 modified nucleotides) is represented by

[0040] In yet another embodiment, formula (III) is formula (IIIc): Sense: 5’n p -N a -XXX-N b -YYY-N a -n q 3’ Antisense: 3’n p’ -N a’ -X’X’X’-N b’ -Y’Y’Y’-N a’ -n q’ 5’(IIIc) (wherein each N b and N b ’ independently represents an oligonucleotide sequence containing 1 to 5 modified nucleotides) is represented by

[0041] In another embodiment, formula (III) is formula (IIId): Sense: 5’n p -N a -XXX-N b -YYY-N b -ZZZ-N a -n q 3’ Antisense: 3’n p’ -N a’ -X’X’X’-N b’ -Y’Y’Y’-N b’ -Z’Z’Z’-N a’ -n q’ 5’(IIId) (wherein each N b and N b ’ independently represents an oligonucleotide sequence containing 1 to 5 modified nucleotides, and each Na and N a ’ independently represents an oligonucleotide sequence containing 2 to 10 modified nucleotides) is represented by

[0042] In one embodiment, the double-stranded region is 15 to 30 nucleotide pairs in length.

[0043] In one embodiment, the double-stranded region is 17 to 23 nucleotide pairs in length. In another embodiment, the double-stranded region is 17 to 25 nucleotide pairs in length. In another embodiment, the double-stranded region is 23 to 27 nucleotide pairs in length. In yet another embodiment, the double-stranded region is 19 to 21 nucleotide pairs in length. In another embodiment, the double-stranded region is 21 to 23 nucleotide pairs in length.

[0044] In one embodiment, each strand has 15 to 30 nucleotides.

[0045] In one embodiment, the modification on the nucleotide is selected from the group consisting of LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-alkyl, 2'-O-allyl, 2'-C-allyl, 2'-fluoro, 2'-deoxy, 2'-hydroxyl, and combinations thereof.

[0046] In one embodiment, the modification on the nucleotide is a 2'-O-methyl or 2'-fluoro modification.

[0047] In one embodiment, the ligand is one or more GalNAc derivatives linked via a divalent or trivalent branched linker.

[0048] In one embodiment, the ligand is

Chemical formula

[0049] In one embodiment, the ligand is attached to the 3' end of the sense strand.

[0050] In one embodiment, the RNAi agent is conjugated to a ligand shown in the following schematic diagram

Chemical Formula

[0051] In one embodiment, the agent further comprises at least one phosphorothioate or methylphosphonate nucleotide internucleotide linkage.

[0052] In one embodiment, the phosphorothioate or methylphosphonate nucleotide internucleotide linkage is at the 3' end of one strand.

[0053] In one embodiment, the strand is an antisense strand. In another embodiment, the strand is a sense strand.

[0054] In one embodiment, the phosphorothioate or methylphosphonate nucleotide internucleotide linkage is at the 5' end of one strand.

[0055] In one embodiment, the strand is an antisense strand. In another embodiment, the strand is a sense strand.

[0056] In one embodiment, the phosphorothioate or methylphosphonate nucleotide internucleotide linkage is at both the 5' and 3' ends of one strand.

[0057] In one embodiment, the strand is an antisense strand.

[0058] In one embodiment, the base pair at the 1st position of the 5' end of the double-stranded antisense strand is an AU base pair.

[0059] In one embodiment, the Y nucleotide comprises a 2'-fluoro modification.

[0060] In one embodiment, the Y' nucleotide comprises a 2'-O-methyl modification.

[0061] In one embodiment, p’>0.

[0062] In one embodiment, p’ = 2.

[0063] In one embodiment, q’ = 0, p = 0, q = 0, and the p’ overhang nucleotide is complementary to the target mRNA.

[0064] In one embodiment, q’ = 0, p = 0, q = 0, and the p’ overhang nucleotide is non - complementary to the target mRNA.

[0065] In one embodiment, the sense strand has a total of 21 nucleotides and the antisense strand has a total of 23 nucleotides.

[0066] In one embodiment, at least one n p ’ is linked to the adjacent nucleotide via a phosphorothioate bond.

[0067] In one embodiment, all n p ’ are linked to the adjacent nucleotide via a phosphorothioate bond.

[0068] In one embodiment, the RNAi agent is selected from the group of RNAi agents listed in Table 4, Table 18, Table 19, or Table 23. In another embodiment, the RNAi agent is selected from the group consisting of AD - 58123, AD - 58111, AD - 58121, AD - 58116, AD - 58133, AD - 58099, AD - 58088, AD - 58642, AD - 58644, AD - 58641, AD - 58647, AD - 58645, AD - 58643, AD - 58646, AD - 62510, AD - 62643, AD - 62645, AD - 62646, AD - 62650, and AD - 62651.

[0069] In one aspect, the present invention provides a double-stranded RNAi agent capable of inhibiting the expression of complement component C5 in cells, wherein the double-stranded RNAi agent comprises a sense strand complementary to the antisense strand, the antisense strand comprises a region complementary to a part of the mRNA encoding complement component C5, each strand is about 14 to about 30 nucleotides in length, and the double-stranded RNAi agent is represented by formula (III). Sense: 5’n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3’ Antisense: 3’n p ’-N a ’-(X’X’X’) k -N b ’-Y’Y’Y’-N b ’-(Z’Z’Z’) l -N a ’-n q ’5’(III) (Wherein: i, j, k, and l are each independently 0 or 1; p, p’, q, and q’ are each independently 0 to 6; Each N a and N a ’ represents an oligonucleotide sequence comprising either modified or unmodified 0 to 25 nucleotides or combinations thereof, and each sequence comprises at least two different modified nucleotides; Each N b and N b ’ represents an oligonucleotide sequence comprising either modified or unmodified 0 to 10 nucleotides or combinations thereof; Each n p , n p ’, n q , and n q ’ independently represents an overhang nucleotide; XXX, YYY, ZZZ, X’X’X’, Y’Y’Y’, and Z’Z’Z’ each independently represent a motif of three identical modifications on three consecutive nucleotides, where the modification is a 2’-O-methyl or 2’-fluoro modification; N b The modification on N is different from the modification on Y, and N b The modification on N’ is different from the modification on Y’; (where the sense strand is conjugated to at least one ligand) to provide a double-stranded RNAi agent represented by

[0070] In another aspect, the present invention provides a double-stranded RNAi agent capable of inhibiting the expression of proprotein convertase subtilisin / kexin type 9 (PCSK9) in cells, wherein the double-stranded RNAi agent comprises a sense strand complementary to the antisense strand, the antisense strand comprises a region complementary to a part of the mRNA encoding complement component C5, each strand is about 14 to about 30 nucleotides in length, and the double-stranded RNAi agent has the formula (III): Sense: 5’n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3’ Antisense: 3’n p ’-N a ’-(X’X’X’) k -N b ’-Y’Y’Y’-N b ’-(Z’Z’Z’) l -N a ’-n q ’5’(III) (wherein: i, j, k, and l are each independently 0 or 1; each n, which may or may not be present, p , n q , and n q ’ independently represents an overhang nucleotide; p, q, and q’ are each independently from 0 to 6; n p ’ > 0 and at least one n p ’ is linked to an adjacent nucleotide via a phosphorothioate bond; each N a and N a ’ represents an oligonucleotide sequence containing either modified or unmodified nucleotides from 0 to 25 or combinations thereof, each sequence containing at least two different modified nucleotides; each N b and N b ’ represents an oligonucleotide sequence containing either modified or unmodified nucleotides from 0 to 10 or combinations thereof; XXX, YYY, ZZZ, X’X’X’, Y’Y’Y’, and Z’Z’Z’ each independently represent one motif of three identical modifications on three consecutive nucleotides, the modification being a 2’-O-methyl or 2’-fluoro modification; N b the modification on N is different from the modification on Y, and the modification on N b ’ is different from the modification on Y’; the sense strand is conjugated to at least one ligand) to provide a double-stranded RNAi agent represented by.

[0071] In a further aspect, the present invention provides a double-stranded RNAi agent capable of inhibiting the expression of complement component C5 in a cell, wherein the double-stranded RNAi agent comprises a sense strand complementary to an antisense strand, the antisense strand contains a region complementary to a part of the mRNA encoding complement component C5, each strand is about 14 to about 30 nucleotides in length, and the double-stranded RNAi agent has the formula (III): Sense: 5’n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3’ Antisense: 3’n p ’-N a ’-(X’X’X’) k -N b ’-Y’Y’Y’-N b ’-(Z’Z’Z’) l -N a ’-n q ’5’(III) (where: i, j, k, and l are each independently 0 or 1; each n, which may or may not be present p , n q , and n q ’ independently represents an overhang nucleotide; p, q, and q’ are each independently 0 to 6; n p ’ > 0, and at least one n p ’ is linked to the adjacent nucleotide via a phosphorothioate bond; each N a and N a ’ independently represents an oligonucleotide sequence containing either modified or unmodified 0 to 25 nucleotides or a combination thereof, each sequence containing at least two different modified nucleotides; each N b and N b ’ independently represents an oligonucleotide sequence containing either modified or unmodified 0 to 10 nucleotides or a combination thereof; XXX, YYY, ZZZ, X’X’X’, Y’Y’Y’, and Z’Z’Z’ each independently represent one motif of three identical modifications on three consecutive nucleotides, the modification being a 2’-O-methyl or 2’-fluoro modification; the modification on N b is different from the modification on Y, and the modification on N b ’ is different from the modification on Y’; the sense strand is conjugated to at least one ligand, the ligand being one or more GalNAc derivatives linked via a divalent or trivalent branched linker) Provided is a double-stranded RNAi agent represented by

[0072] In yet another aspect, the present invention is a double-stranded RNAi agent capable of inhibiting the expression of complement component C5 in a cell, wherein the double-stranded RNAi agent includes a sense strand complementary to the antisense strand, the antisense strand includes a region complementary to a part of the mRNA encoding complement component C5, each strand is about 14 to about 30 nucleotides in length, and the double-stranded RNAi agent has the formula (III): Sense: 5’n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3’ Antisense: 3’n p ’-N a ’-(X’X’X’) k -N b ’-Y’Y’Y’-N b ’-(Z’Z’Z’) l -N a ’-n q ’5’(III) (wherein: i, j, k, and l are each independently 0 or 1; each n, which may or may not be present, p , n q , and n q ’ independently represents an overhang nucleotide; p, q, and q’ are each independently 0 to 6; n p ’>0, and at least one n p ’ is linked to an adjacent nucleotide via a phosphorothioate bond; each N a and N a ’ independently represents an oligonucleotide sequence containing either modified or unmodified 0 to 25 nucleotides or a combination thereof, and each sequence contains at least two different modified nucleotides; each Nb and N b ’ independently represents an oligonucleotide sequence comprising either modified or unmodified 0 to 10 nucleotides or combinations thereof; XXX, YYY, ZZZ, X’X’X’, Y’Y’Y’, and Z’Z’Z’ each independently represent one motif of three identical modifications on three consecutive nucleotides, and the modification is a 2’-O-methyl or 2’-fluoro modification; N b The modification on N is different from the modification on Y b The modification on N’ is different from the modification on Y’; The sense strand contains at least one phosphorothioate bond; The sense strand is conjugated to at least one ligand, and the ligand is one or more GalNAc derivatives conjugated via a divalent or trivalent branched linker) provided is a double-stranded RNAi agent represented by.

[0073] In another aspect, the present invention is a double-stranded RNAi agent capable of inhibiting the expression of complement component C5 in cells, wherein the double-stranded RNAi agent comprises a sense strand complementary to the antisense strand, the antisense strand contains a region complementary to a part of the mRNA encoding complement component C5, each strand is about 14 to about 30 nucleotides in length, and the double-stranded RNAi agent has the formula (III): Sense: 5’n p -N a -YYY-N a -n q 3’ Antisense: 3’n p ’-N a ’-Y’Y’Y’-N a ’-n q ’5’ (IIIa) (wherein: Each n, which may or may not be present, p n q and n q ’ independently represents an overhang nucleotide; p, q, and q’ are each independently 0 to 6; n p ’ is greater than 0, and at least one n p ’ is linked to an adjacent nucleotide via a phosphorothioate bond; Each N a and N a ’ independently represents an oligonucleotide sequence containing from 0 to 25 nucleotides, either modified or unmodified, or a combination thereof, each sequence containing at least two different modified nucleotides; YYY and Y’Y’Y’ each independently represent one motif of three identical modifications on three consecutive nucleotides, the modification being a 2’-O-methyl or 2’-fluoro modification; The sense strand contains at least one phosphorothioate bond; The sense strand is conjugated to at least one ligand, the ligand being one or more GalNAc derivatives linked via a divalent or trivalent branched linker) A double-stranded RNAi agent represented by

[0074] In one aspect, the present invention provides a double-stranded RNAi agent for inhibiting the expression of complement component C5, wherein the double-stranded RNAi agent comprises a sense strand and an antisense strand forming a double-stranded region, the sense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 1 by no more than 3 nucleotides, the antisense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 5 by no more than 3 nucleotides, substantially all of the nucleotides of the sense strand comprise a modification selected from the group consisting of 2'-O-methyl modification and 2'-fluoro modification, the sense strand comprises phosphorothioate internucleotide linkages at two positions at the 5'-end, substantially all of the nucleotides of the antisense strand comprise a modification selected from the group consisting of 2'-O-methyl modification and 2'-fluoro modification, the antisense strand comprises phosphorothioate internucleotide linkages at two positions at the 5'-end and phosphorothioate internucleotide linkages at two positions at the 3'-end, and the sense strand is conjugated to one or more GalNAc derivatives linked via a branched bivalent or trivalent linker at the 3'-end.

[0075] In one embodiment, all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand are modified nucleotides. In another embodiment, each strand has 19 to 30 nucleotides.

[0076] In one aspect, the present invention provides a cell containing the dsRNA agent of the present invention.

[0077] In one aspect, the present invention provides a vector encoding at least one strand of a dsRNA agent, wherein the dsRNA agent comprises a region complementary to at least a part of the mRNA encoding complement component C5, the dsRNA has a length of 30 base pairs or less, and the dsRNA agent targets the mRNA for cleavage.

[0078] In one embodiment, the complementary region is at least 15 nucleotides in length. In another embodiment, the complementary region is 19 to 21 nucleotides in length. In another embodiment, each strand has 19 to 30 nucleotides.

[0079] In one aspect, the present invention provides a cell comprising the vector of the present invention.

[0080] In one aspect, the present invention provides a pharmaceutical composition for inhibiting the expression of the complement component C5 gene, comprising the dsRNA agent of the present invention.

[0081] In one embodiment, the RNAi agent is administered in a non-buffered solution.

[0082] In one embodiment, the non-buffered solution is physiological saline or water.

[0083] In one embodiment, the RNAi agent is administered together with a buffer solution.

[0084] In one embodiment, the buffer solution comprises an acetate buffer, a citrate buffer, a prolamine buffer, a carbonate buffer, or a phosphate buffer, or any combination thereof.

[0085] In another embodiment, the buffer solution is phosphate buffered saline (PBS).

[0086] In another aspect, the present invention provides a pharmaceutical composition comprising the double-stranded RNAi agent of the present invention and a lipid formulation.

[0087] In one embodiment, the lipid formulation comprises LNP. In another embodiment, the lipid formulation comprises MC3.

[0088] In one aspect, the present invention provides a composition comprising an antisense polynucleotide agent selected from the group consisting of the sequences listed in any one of Tables 3, 4, 5, 6, 19, 18, 20, 21, and 23.

[0089] In another aspect, the present invention provides a composition comprising a sense polynucleotide agent selected from the group consisting of the sequences listed in any one of Tables 3, 4, 5, 6, 19, 18, 20, 21, and 23.

[0090] In yet another aspect, the present invention provides a modified antisense polynucleotide agent selected from the group consisting of the antisense sequences listed in any one of Tables 4, 6, 18, 19, 21, and 23.

[0091] In a further aspect, the present invention provides a modified sense polynucleotide agent selected from the group consisting of the sense sequences listed in any one of Tables 4, 6, 18, 19, 21, and 23.

[0092] In one aspect, the present invention provides a method of treating a subject suffering from a disease or disorder that can benefit from a reduction in the expression of complement component C5. The method comprises administering to the subject a therapeutically effective amount of a dsRNA agent comprising a sense strand and an antisense strand, thereby treating the subject, wherein the sense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 1 by three or fewer nucleotides, and the antisense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 5 by three or fewer nucleotides.

[0093] In another aspect, the present invention provides a method of preventing at least one symptom in a subject suffering from a disease or disorder that can benefit from a reduction in the expression of complement component C5. The method comprises administering to the subject a therapeutically effective amount of a dsRNA agent comprising a sense strand and an antisense strand, thereby preventing at least one symptom in a subject suffering from a disorder that can benefit from a reduction in the expression of C5, wherein the sense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 1 by three or fewer nucleotides, and the antisense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 5 by three or fewer nucleotides.

[0094] In another aspect, the present invention provides a method of treating a subject suffering from a disease or disorder that can benefit from a decrease in the expression of complement component C5. The method includes administering to the subject a therapeutically effective amount of a dsRNA agent comprising a sense strand and an antisense strand, thereby treating the subject, wherein the antisense strand comprises a complementary region comprising at least 15 contiguous nucleotides that differ from any one of the antisense sequences listed in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, 23 by no more than 3 nucleotides.

[0095] In yet another aspect, the present invention provides a method of preventing at least one symptom in a subject suffering from a disease or disorder that can benefit from a decrease in the expression of complement component C5. The method includes administering to the subject a prophylactically effective amount of a dsRNA agent comprising a sense strand and an antisense strand, thereby preventing at least one symptom in a subject suffering from a disorder that can benefit from a decrease in the expression of C5, wherein the antisense strand comprises a complementary region comprising at least 15 contiguous nucleotides that differ from any one of the antisense sequences listed in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23 by no more than 3 nucleotides.

[0096] In one aspect, the present invention provides a method of treating a subject suffering from a disease or disorder that can benefit from a decrease in the expression of complement component C5, the method comprising administering to the subject a therapeutically effective amount of a double-stranded RNAi agent, the double-stranded RNAi agent comprising a sense strand and an antisense strand that form a double-stranded region, the sense strand comprising at least 15 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO: 1 by no more than 3 nucleotides, the antisense strand comprising at least 15 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO: 5 by no more than 3 nucleotides, substantially all of the nucleotides of the antisense strand and substantially all of the nucleotides of the sense strand being modified nucleotides, and the sense strand being conjugated to one or more ligands at the 3' end.

[0097] In one embodiment, all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand are modified nucleotides.

[0098] In one embodiment, the administration is subcutaneous administration.

[0099] In one embodiment, substantially all of the nucleotides of the sense strand are modified nucleotides selected from the group consisting of 2'-O-methyl modification, 2'-fluoro modification, and 3'-terminal dT nucleotide. In another embodiment, substantially all of the nucleotides of the antisense strand are modified nucleotides selected from the group consisting of 2'-O-methyl modification, 2'-fluoro modification, and 3'-terminal dT nucleotide. In another embodiment, the modified nucleotide is a short sequence of deoxy-thymine (dT) nucleotides. In another embodiment, the sense strand contains a phosphorothioate nucleotide internucleotide linkage at the 5'-end. In one embodiment, the antisense strand contains a phosphorothioate nucleotide internucleotide linkage at the 5'-end and a phosphorothioate nucleotide internucleotide linkage at the 3'-end. In yet another embodiment, the sense strand is conjugated to one or more GalNAc derivatives linked via a branched bivalent or trivalent linker at the 3'-end.

[0100] In another aspect, the present invention provides a method for preventing at least one symptom in a subject suffering from a disease or disorder that can benefit from a reduction in the expression of complement component C5, the method comprising the step of prophylactically administering to the subject an effective amount of a double-stranded RNAi agent, the double-stranded RNAi agent comprising a sense strand and an antisense strand forming a double-stranded region, the sense strand comprising at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 1 by 3 or fewer nucleotides, the antisense strand comprising at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 5 by 3 or fewer nucleotides, substantially all of the nucleotides of the antisense strand and substantially all of the nucleotides of the sense strand being modified nucleotides, and the sense strand being conjugated to a ligand at the 3'-end.

[0101] In one embodiment, all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand are modified nucleotides.

[0102] In one embodiment, the administration is subcutaneous administration.

[0103] In one embodiment, substantially all of the nucleotides of the sense strand are modified nucleotides selected from the group consisting of 2'-O-methyl modification, 2'-fluoro modification, and 3'-terminal dT nucleotides. In another embodiment, substantially all of the nucleotides of the antisense strand are modified nucleotides selected from the group consisting of 2'-O-methyl modification, 2'-fluoro modification, and 3'-terminal dT nucleotides. In another embodiment, the modified nucleotide is a short sequence of deoxy-thymine (dT) nucleotides. In another embodiment, the sense strand comprises a phosphorothioate nucleotide internucleotide linkage between two nucleotides at the 5'-end. In one embodiment, the antisense strand comprises a phosphorothioate nucleotide internucleotide linkage between two nucleotides at the 5'-end and a phosphorothioate nucleotide internucleotide linkage between two nucleotides at the 3'-end. In yet another embodiment, the sense strand is conjugated to one or more GalNAc derivatives linked via a branched bivalent or trivalent linker at the 3'-end.

[0104] In one aspect, the present invention provides a method of treating a subject suffering from a disease or disorder that can benefit from a decrease in the expression of complement component C5. The method comprises administering to the subject a therapeutically effective amount of a dsRNA agent comprising a sense strand complementary to the antisense strand, thereby treating the subject and thereby treating a subject suffering from a disease or disorder that can benefit from a decrease in the expression of complement component C5, wherein the antisense strand comprises a region complementary to a portion of the mRNA encoding C5, each strand is about 14 to about 30 nucleotides in length, and the double-stranded RNAi agent has the formula (III): Sense: 5’n p -N a -(XXX) i -N b -YYY-Nb -(ZZZ) j -N a -n q 3’ Antisense: 3’n p ’-N a ’-(X’X’X’) k -N b ’-Y’Y’Y’-N b ’-(Z’Z’Z’) l -N a ’-n q ’5’(III) (where: i, j, k, and l are each independently 0 or 1; p, p’, q, and q’ are each independently 0 to 6; each N a and N a ’ represents an oligonucleotide sequence containing either modified or unmodified 0 to 25 nucleotides or combinations thereof, with each sequence containing at least two different modified nucleotides; each N b and N b ’ represents an oligonucleotide sequence containing either modified or unmodified 0 to 10 nucleotides or combinations thereof; each n p , n p ’, n q , and n q ’ independently represents an overhang nucleotide; XXX, YYY, ZZZ, X’X’X’, Y’Y’Y’, and Z’Z’Z’ each independently represent one motif of three identical modifications on three consecutive nucleotides; the modification on N b is different from the modification on Y, and the modification on N b ’ is different from the modification on Y’; (the sense strand is conjugated to at least one ligand)) is represented by.

[0105] In another aspect, the present invention provides a method of preventing at least one symptom in a subject suffering from a disease or disorder that can benefit from a decrease in the expression of complement component C5. The method comprises administering to the subject a dsRNA agent in a prophylactically effective amount, the dsRNA agent comprising a sense strand complementary to an antisense strand, thereby preventing at least one symptom in a subject suffering from a disorder that can benefit from a decrease in the expression of C5, and thereby preventing at least one symptom in a subject suffering from a disease or disorder that can benefit from a decrease in the expression of complement component C5, wherein the antisense strand comprises a region complementary to a portion of the mRNA encoding C5, each strand is from about 14 to about 30 nucleotides in length, and the double-stranded RNAi agent has the formula (III): Sense: 5’n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3’ Antisense: 3’n p ’-N a ’-(X’X’X’) k -N b ’-Y’Y’Y’-N b ’-(Z’Z’Z’) l -N a ’-n q ’5’(III) (wherein: i, j, k, and l are each independently 0 or 1; p, p’, q, and q’ are each independently 0 to 6; each N a and N a ’ represents an oligonucleotide sequence comprising either modified or unmodified 0 to 25 nucleotides or combinations thereof, each sequence comprising at least two different modified nucleotides; each N b and N b ’ represents an oligonucleotide sequence comprising either modified or unmodified 0 to 10 nucleotides or combinations thereof; each n, which may or may not be present p , n p ’, n q , and n q ’ each independently represent an overhang nucleotide; XXX, YYY, ZZZ, X’X’X’, Y’Y’Y’, and Z’Z’Z’ each independently represent one motif of three identical modifications on three consecutive nucleotides; N b has a modification different from that on Y, and N b ’ has a modification different from that on Y’; The sense strand is conjugated to at least one ligand) is represented by.

[0106] In one embodiment, administration of the dsRNA to a subject causes a decrease in intravascular hemolysis, stabilization of hemoglobin levels, and / or a decrease in C5 protein accumulation.

[0107] In one embodiment, the disorder is a disease associated with complement component C5. In one embodiment, the disease associated with complement component C5 is paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), asthma, rheumatoid arthritis (RA); antiphospholipid antibody syndrome; lupus nephritis; ischemia-reperfusion injury; typical or infectious hemolytic uremic syndrome (tHUS); dense deposit disease (DDD); neuromyelitis optica (NMO); multifocal motor neuropathy (MMN); multiple sclerosis (MS); macular degeneration (e.g., age-related macular degeneration (AMD)); hemolysis, elevated liver enzymes, and low platelets (HELLP) syndrome; thrombotic thrombocytopenic purpura (TTP); spontaneous abortion; microscopic immune vasculitis; epidermolysis bullosa; habitual abortion; pre-eclampsia, traumatic brain injury, myasthenia gravis, cold agglutinin disease, dermatomyositis, bullous pemphigoid, hemolytic uremic syndrome associated with Shiga toxin-producing Escherichia coli (E. coli), C3 glomerulopathy, antineutrophil cytoplasmic antibody-associated vasculitis, humoral and vascular transplant rejection, graft dysfunction, myocardial infarction, allograft, sepsis, coronary artery disease, dermatomyositis, Graves' disease, atherosclerosis, Alzheimer's disease, systemic inflammatory response sepsis, septic shock, spinal cord injury, glomerulonephritis, Hashimoto's thyroiditis, type 1 diabetes, psoriasis, pemphigus, autoimmune hemolytic anemia (AIHA), ITP, Goodpasture syndrome, dog disease, antiphospholipid syndrome (APS), catastrophic APS (CAPS), cardiovascular disease, myocarditis, cerebrovascular accident, peripheral vascular disease, renal vascular disease, mesenteric / intestinal vascular disease, vasculitis, Henoch-Schönlein purpura nephritis, systemic lupus erythematosus-related vasculitis, rheumatoid arthritis-related vasculitis, immune complex vasculitis, Takayasu disease, dilated cardiomyopathy, diabetic angiopathy, Kawasaki disease (arteritis), venous gas embolism (VGE), and restenosis after stent placement, rotational atherectomy, membranous nephropathy, Guillain-Barré syndrome, and percutaneous transluminal coronary angioplasty (PTCA). In another embodiment, the disease associated with complement component C5 is paroxysmal nocturnal hemoglobinuria (PNH). In yet another embodiment, the disease associated with complement component C5 is atypical hemolytic uremic syndrome (aHUS).

[0108] In one embodiment, the subject is a human.

[0109] In another embodiment, the method of the present invention further comprises administering to the subject an anti-complement component C5 antibody, or an antigen-binding fragment thereof.

[0110] In one embodiment, this antibody, or an antigen-binding fragment thereof, inhibits the cleavage of complement component C5 into fragments C5a and C5b. In another embodiment, the anti-complement component C5 antibody is eculizumab.

[0111] In another embodiment, the method of the present invention further comprises administering to the subject a meningococcal vaccine.

[0112] In one embodiment, eculizumab is administered to the subject once a week at a dose of less than about 600 mg for 4 weeks, then the fifth dose is less than about 900 mg about 1 week later, and then at a dose of less than about 900 mg every about 2 weeks.

[0113] In another embodiment, eculizumab is administered to the subject once a week at a dose of less than about 900 mg for 4 weeks, then the fifth dose is less than about 1200 mg about 1 week later, and then at a dose of less than about 1200 mg every about 2 weeks.

[0114] In one embodiment, the subject is less than 18 years old, and eculizumab is administered to the subject once a week at a dose of less than about 900 mg for 4 weeks, then the fifth dose is less than about 1200 mg about 1 week later, and then at a dose of less than about 1200 mg every about 2 weeks.

[0115] In another embodiment, the subject is less than 18 years old, and eculizumab is administered to the subject once a week at a dose of less than about 600 mg for 2 weeks, then the third dose is less than about 900 mg about 1 week later, and then at a dose of less than about 900 mg every about 2 weeks.

[0116] In another embodiment, the subject is under 18 years of age, and eculizumab is administered to the subject once a week for 2 weeks at a dose of less than about 600 mg, then the third dose is less than about 600 mg about 1 week later, and then at a dose of less than about 600 mg every about 2 weeks.

[0117] In yet another embodiment, the subject is under 18 years of age, and eculizumab is administered to the subject once a week for 1 week at a dose of less than about 600 mg, then the second dose is less than about 300 mg about 1 week later, and then at a dose of less than about 300 mg every about 2 weeks.

[0118] In one embodiment, the subject is under 18 years of age, and eculizumab is administered to the subject once a week for 1 week at a dose of less than about 300 mg, then the second dose is less than about 300 mg about 1 week later, and then at a dose of less than about 300 mg every about 2 weeks.

[0119] In another embodiment, the method of the invention further comprises plasma exchange, i.e., plasmapheresis, in the subject. In such an embodiment, eculizumab is administered to the subject at a dose of less than about 600 mg or at a dose of less than about 300 mg.

[0120] In a further embodiment, the method of the invention further comprises plasma infusion in the subject. In such an embodiment, eculizumab is administered to the subject at a dose of less than about 300 mg.

[0121] In one embodiment, eculizumab is administered to the subject at a dose of about 0.01 mg / kg to about 10 mg / kg or about 0.5 mg / kg to about 15 mg / kg. In another embodiment, eculizumab is administered to the subject at a dose of about 5 mg / kg to about 15 mg / kg.

[0122] In one embodiment, eculizumab is administered to the subject at a dose selected from the group consisting of 0.5 mg / kg, 1 mg / kg, 1.5 mg / kg, 3 mg / kg, 5 mg / kg, 7 mg / kg, 10 mg / kg, and 15 mg / kg.

[0123] In one embodiment, eculizumab is administered to a subject by intravenous injection.

[0124] In another embodiment, eculizumab is administered subcutaneously to a subject.

[0125] In one embodiment, the dsRNA agent is administered at a dose of about 0.01 mg / kg to about 10 mg / kg or about 0.5 mg / kg to about 50 mg / kg.

[0126] In another embodiment, the dsRNA agent is administered at a dose of about 10 mg / kg to about 30 mg / kg.

[0127] In one embodiment, the dsRNA agent is administered at a dose selected from the group consisting of 0.5 mg / kg, 1 mg / kg, 1.5 mg / kg, 3 mg / kg, 5 mg / kg, 10 mg / kg, and 30 mg / kg.

[0128] In one embodiment, the dsRNA agent is administered to the subject once a week. In another embodiment, the dsRNA agent is administered to the subject twice a week. In another embodiment, the dsRNA agent is administered to the subject twice a month.

[0129] In one embodiment, the dsRNA agent is administered subcutaneously to a subject.

[0130] In one embodiment, the dsRNA agent and eculizumab are administered subcutaneously to a subject. In another embodiment, the dsRNA agent and eculizumab are administered to the subject simultaneously.

[0131] In one embodiment, the dsRNA agent is first administered to the subject for a period sufficient to reduce the level of complement component C5 in the subject, and then eculizumab is administered at a dose of less than about 600 mg.

[0132] In one embodiment, the level of complement component C5 in a subject is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90%.

[0133] In one embodiment, eculizumab is administered at a dose of about 100-500 mg.

[0134] In one embodiment, the method of the invention further comprises the step of measuring the hemoglobin and / or LDH levels in a subject.

[0135] In one embodiment, the dsRNA is conjugated to a ligand.

[0136] In one embodiment, the ligand is conjugated to the 3' end of the sense strand of the dsRNA.

[0137] In one embodiment, the ligand is an N-acetylgalactosamine (GalNAc) derivative.

[0138] In one aspect, the present invention provides a method for inhibiting the expression of complement component C5 in a cell. The method comprises contacting the cell with a dsRNA agent comprising a sense strand and an antisense strand, wherein the sense strand comprises at least 15 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO: 1 by three or fewer nucleotides, and the antisense strand comprises at least 15 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO: 5 by three or fewer nucleotides; and maintaining the cell produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of the C5 gene, thereby inhibiting the expression of the C5 gene in the cell.

[0139] In another aspect, the present invention provides a method for inhibiting the expression of complement component C5 in a cell. The method comprises contacting the cell with a dsRNA agent comprising a sense strand and an antisense strand, wherein the antisense strand comprises a complementary region comprising at least 15 consecutive nucleotides that differ by no more than three nucleotides from any one of the antisense sequences listed in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23; and maintaining the cell produced in step (a) for a time sufficient to effect degradation of the mRNA transcript of the C5 gene, thereby inhibiting the expression of the C5 gene in the cell.

[0140] In another aspect, the present invention provides a method for inhibiting the expression of complement component C5 in a cell, the method comprising contacting the cell with a dsRNA agent comprising a sense strand and an antisense strand that form a complementary region, wherein the sense strand comprises at least 15 consecutive nucleotides that differ by no more than three nucleotides from the nucleotide sequence of SEQ ID NO: 1, the antisense strand comprises at least 15 consecutive nucleotides that differ by no more than three nucleotides from the nucleotide sequence of SEQ ID NO: 5, substantially all of the nucleotides of the antisense strand and substantially all of the nucleotides of the sense strand are modified nucleotides, and the sense strand is conjugated to one or more ligands at the 3' end; and maintaining the cell produced in the first step for a time sufficient to effect degradation of the mRNA transcript of the C5 gene, thereby inhibiting the expression of the C5 gene in the cell.

[0141] In one embodiment, all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand are modified nucleotides.

[0142] In one embodiment, substantially all of the nucleotides of the sense strand are modified nucleotides selected from the group consisting of 2'-O-methyl modification, 2'-fluoro modification, and 3'-terminal dT nucleotide. In another embodiment, substantially all of the nucleotides of the antisense strand are modified nucleotides selected from the group consisting of 2'-O-methyl modification, 2'-fluoro modification, and 3'-terminal dT nucleotide. In another embodiment, the modified nucleotide is a short sequence of deoxy-thymine (dT) nucleotides. In another embodiment, the sense strand includes a phosphorothioate internucleotide bond between two nucleotides at the 5'-end. In one embodiment, the antisense strand includes a phosphorothioate internucleotide bond between two nucleotides at the 5'-end and a phosphorothioate internucleotide bond between two nucleotides at the 3'-end. In yet another embodiment, the sense strand is conjugated to one or more GalNAc derivatives coupled via a branched bivalent or trivalent linker at the 3'-end.

[0143] In yet another aspect, the present invention provides a method for inhibiting the expression of complement component C5 in a cell. The method comprises the step of contacting the cell with a dsRNA agent comprising a sense strand complementary to the antisense strand, wherein the antisense strand comprises a region complementary to a portion of the mRNA encoding C5, each strand is about 14 to about 30 nucleotides in length, and the double-stranded RNAi agent has the formula (III): Sense: 5’n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3’ Antisense: 3’n p ’-N a ’-(X’X’X’) k -N b ’-Y’Y’Y’-N b ’-(Z’Z’Z’) l -N a ’-n q ’5’ (III) (Wherein: i, j, k, and l are each independently 0 or 1; p, p’, q, and q’ are each independently 0 to 6; each N a and N a ’ represents an oligonucleotide sequence independently comprising either modified or unmodified 0 to 25 nucleotides or combinations thereof, each sequence comprising at least two different modified nucleotides; each N b and N b ’ represents an oligonucleotide sequence independently comprising either modified or unmodified 0 to 10 nucleotides or combinations thereof; each n which may or may not be present p , n p ’, n q , and n q ’ independently represents an overhang nucleotide; XXX, YYY, ZZZ, X’X’X’, Y’Y’Y’, and Z’Z’Z’ each independently represent one motif of three identical modifications on three consecutive nucleotides; The modification on N b is different from the modification on Y, and the modification on N b ’ is different from the modification on Y’; The sense strand is conjugated to at least one ligand) represented by the step; and maintaining the cells produced in step (a) for a time sufficient to obtain degradation of the C5 gene mRNA transcript, thereby inhibiting the expression of the C5 gene in the cells.

[0144] In one embodiment, the cells are in a subject.

[0145] In one embodiment, the subject is human.

[0146] In one embodiment, the human subject has a disease associated with complement component C5.

[0147] In one embodiment, the diseases associated with complement component C5 are paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), asthma, rheumatoid arthritis (RA); antiphospholipid antibody syndrome; lupus nephritis; ischemia-reperfusion injury; typical or infectious hemolytic uremic syndrome (tHUS); dense deposit glomerulonephritis (DDD); neuromyelitis optica (NMO); multifocal motor neuropathy (MMN); multiple sclerosis (MS); macular degeneration (e.g., age-related macular degeneration (AMD)); hemolysis, elevated liver enzymes, and low platelets (HELLP) syndrome; thrombotic thrombocytopenic purpura (TTP); spontaneous abortion; microscopic immune vasculitis; epidermolysis bullosa; habitual abortion; pregnancy-induced hypertension nephropathy, traumatic brain injury, myasthenia gravis, cold agglutinin disease, dermatomyositis, bullous pemphigoid, hemolytic uremic syndrome associated with Shiga toxin-producing Escherichia coli (E. coli), C3 glomerulopathy, antineutrophil cytoplasmic antibody-associated vasculitis, humoral and vascular transplant rejection, graft dysfunction, myocardial infarction, allotransplantation, sepsis, coronary artery disease, dermatomyositis, Graves' disease, atherosclerosis, Alzheimer's disease, systemic inflammatory response sepsis, septic shock, spinal cord injury, glomerulonephritis, Hashimoto's thyroiditis, type 1 diabetes, psoriasis, pemphigus, autoimmune hemolytic anemia (AIHA), ITP, Goodpasture syndrome, dog disease, antiphospholipid syndrome (APS), catastrophic APS (CAPS), cardiovascular disease, myocarditis, cerebrovascular disorder, peripheral vascular disorder, renal vascular disorder, mesenteric / intestinal vascular disorder, vasculitis, Henoch-Schönlein purpura nephritis, systemic lupus erythematosus-related vasculitis, rheumatoid arthritis-related vasculitis, immune complex vasculitis, Takayasu disease, dilated cardiomyopathy, diabetic angiopathy, Kawasaki disease (arteritis), venous gas embolism (VGE), and restenosis after stent placement, rotational atherectomy, membranous nephropathy, Guillain-Barré syndrome, and percutaneous transluminal coronary angioplasty (PTCA). In another embodiment, the disease associated with complement component C5 is paroxysmal nocturnal hemoglobinuria (PNH). In another embodiment, the disease associated with complement component C5 is atypical hemolytic uremic syndrome (aHUS).

[0148] In one embodiment, the method further comprises contacting the cell with an anti-complement component C5 antibody, or an antigen-binding fragment thereof.

[0149] In one embodiment, this antibody, or an antigen-binding fragment thereof, inhibits the cleavage of complement component C5 into fragments C5a and C5b.

[0150] In one embodiment, the anti-complement component C5 antibody, or an antigen-binding fragment thereof, is eculizumab.

[0151] In one embodiment, the method further comprises contacting the cells with a meningococcal vaccine.

[0152] In one embodiment, the cells are contacted with eculizumab once a week for 4 weeks at a dose of less than about 600 mg, then the fifth dose is less than about 900 mg about 1 week later, and then at a dose of less than about 900 mg every about 2 weeks.

[0153] In another embodiment, the cells are contacted with eculizumab once a week for 4 weeks at a dose of less than about 900 mg, then the fifth dose is less than about 1200 mg about 1 week later, and then at a dose of less than about 1200 mg every about 2 weeks.

[0154] In another embodiment, the cells are contacted with eculizumab once a week for 4 weeks at a dose of less than about 900 mg, then the fifth dose is less than about 1200 mg about 1 week later, and then at a dose of less than about 1200 mg every about 2 weeks.

[0155] In yet another embodiment, the cells are contacted with eculizumab once a week for 2 weeks at a dose of less than about 600 mg, then the third dose is less than about 900 mg about 1 week later, and then at a dose of less than about 900 mg every about 2 weeks.

[0156] In one embodiment, the cells are contacted with eculizumab once a week for 2 weeks at a dose of less than about 600 mg, then the third dose is less than about 600 mg about 1 week later, and then at a dose of less than about 600 mg every about 2 weeks.

[0157] In another embodiment, the cells are contacted with eculizumab once a week at a dose of less than about 600 mg per week, then the second administration is less than about 300 mg about one week later, and then at a dose of less than about 300 mg every about two weeks.

[0158] In one embodiment, the cells are contacted with eculizumab once a week at a dose of less than about 300 mg per week, then the second administration is less than about 300 mg about one week later, and then at a dose of less than about 300 mg every about two weeks.

[0159] In one embodiment, the cells are in a subject.

[0160] In one embodiment, the method of the invention further comprises plasmapheresis, i.e., plasma exchange, in the subject. In one embodiment, eculizumab is administered to the subject at a dose of less than about 600 mg. In another embodiment, eculizumab is administered to the subject at a dose of less than about 300 mg.

[0161] In one embodiment, the method of the invention further comprises plasma infusion in the subject. In one embodiment, eculizumab is administered to the subject at a dose of less than about 300 mg.

[0162] In one embodiment, the cells are contacted with eculizumab at a dose of about 0.01 mg / kg to about 10 mg / kg or about 0.5 mg / kg to about 15 mg / kg.

[0163] In another embodiment, the cells are contacted with eculizumab at a dose of about 5 mg / kg to about 15 mg / kg.

[0164] In one embodiment, the cells are contacted with eculizumab at a dose selected from the group consisting of 0.5 mg / kg, 1 mg / kg, 1.5 mg / kg, 3 mg / kg, 5 mg / kg, 7 mg / kg, 10 mg / kg, and 15 mg / kg.

[0165] In one embodiment, eculizumab is administered to a subject by intravenous infusion. In another embodiment, eculizumab is administered subcutaneously to a subject.

[0166] In one embodiment, the cells are contacted with the dsRNA agent at a dose of about 0.01 mg / kg to about 10 mg / kg or about 0.5 mg / kg to about 50 mg / kg.

[0167] In another embodiment, the cells are contacted with the dsRNA agent at a dose of about 10 mg / kg to about 30 mg / kg.

[0168] In one embodiment, the cells are contacted with the dsRNA agent at a dose selected from the group consisting of 0.5 mg / kg, 1 mg / kg, 1.5 mg / kg, 3 mg / kg, 5 mg / kg, 10 mg / kg, and 30 mg / kg.

[0169] In one embodiment, the cells are contacted with the dsRNA agent once a week. In another embodiment, the dsRNA agent is administered to the subject twice a week. In another embodiment, the cells are contacted with the dsRNA agent twice a month.

[0170] In one embodiment, the dsRNA agent is administered subcutaneously to the subject.

[0171] In one embodiment, the dsRNA agent and eculizumab are administered subcutaneously to the subject. In another embodiment, the dsRNA agent and eculizumab are administered to the subject simultaneously.

[0172] In one embodiment, the cells are contacted with the dsRNA agent and eculizumab simultaneously.

[0173] In one embodiment, the dsRNA agent is first administered to the subject for a period sufficient to reduce the level of complement component C5 in the subject, and then eculizumab is administered at a dose of less than about 600 mg.

[0174] In one embodiment, the level of complement component C5 in the subject is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90%.

[0175] In one embodiment, eculizumab is administered at a dose of about 100 - 500 mg.

[0176] In one embodiment, the cells are first contacted with a dsRNA agent for a period sufficient to reduce the level of complement component C5 in the cells, and the cells are then contacted with eculizumab at a dose of less than about 600 mg.

[0177] In one embodiment, the level of complement component C5 in the cells is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90%.

[0178] In one embodiment, the cells are contacted with eculizumab at a dose of about 100 - 500 mg.

[0179] In one aspect, the present invention provides a method of inhibiting the expression of C5 in a subject. The method includes administering to the subject a therapeutically effective amount of a dsRNA agent comprising a sense strand and an antisense strand, thereby inhibiting the expression of C5 in the subject, wherein the sense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 1 by three or fewer nucleotides, and the antisense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 5 by three or fewer nucleotides.

[0180] In another aspect, the present invention provides a method for inhibiting the expression of C5 in a subject. The method includes administering to the subject a therapeutically effective amount of a dsRNA agent comprising a sense strand and an antisense strand, thereby inhibiting the expression of C5 in the subject, wherein the antisense strand comprises a complementary region comprising at least 15 contiguous nucleotides that differ from any one of the antisense sequences listed in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23 by three or fewer nucleotides.

[0181] In another aspect, the present invention provides a method for inhibiting the expression of complement component C5 in a subject, the method comprising administering to the subject a therapeutically effective amount of a dsRNA agent comprising a sense strand and an antisense strand that form a double-stranded region, thereby inhibiting the expression of the C5 gene in the subject, wherein the sense strand comprises at least 15 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO: 1 by three or fewer nucleotides, the antisense strand comprises at least 15 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO: 5 by three or fewer nucleotides, substantially all of the nucleotides of the antisense strand and substantially all of the nucleotides of the sense strand are modified nucleotides, and the sense strand is conjugated to one or more ligands at the 3' end.

[0182] In one embodiment, all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand are modified nucleotides.

[0183] In one embodiment, the administration is subcutaneous administration.

[0184] In one embodiment, substantially all of the nucleotides of the sense strand are modified nucleotides selected from the group consisting of 2'-O-methyl modification, 2'-fluoro modification, and 3'-terminal dT nucleotides. In another embodiment, substantially all of the nucleotides of the antisense strand are modified nucleotides selected from the group consisting of 2'-O-methyl modification, 2'-fluoro modification, and 3'-terminal dT nucleotides. In another embodiment, the modified nucleotide is a short sequence of deoxy-thymine (dT) nucleotides. In another embodiment, the sense strand comprises a phosphorothioate internucleotide linkage between two nucleotides at the 5'-end. In one embodiment, the antisense strand comprises a phosphorothioate internucleotide linkage between two nucleotides at the 5'-end and a phosphorothioate internucleotide linkage between two nucleotides at the 3'-end. In yet another embodiment, the sense strand is conjugated to one or more GalNAc derivatives linked via a branched bivalent or trivalent linker at the 3'-end.

[0185] In another aspect, the present invention provides a method for inhibiting the expression of C5 in a subject. The method comprises administering to the subject a therapeutically effective amount of a dsRNA agent comprising a sense strand complementary to the antisense strand, thereby inhibiting the expression of C5 in the subject, wherein the antisense strand comprises a region complementary to a portion of the mRNA encoding C5, each strand is about 14 to about 30 nucleotides in length, and the double-stranded RNAi agent has the formula (III): Sense: 5’n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3’ Antisense: 3’n p ’-N a ’-(X’X’X’) k -N b ’-Y’Y’Y’-N b ’-(Z’Z’Z’) l -N a ’-n q ’5’(III) (wherein: i, j, k, and l are each independently 0 or 1; p, p’, q, and q’ are each independently from 0 to 6; each N a and N a ’ represents an oligonucleotide sequence independently comprising either modified or unmodified nucleotides from 0 to 25 or combinations thereof, each sequence comprising at least two different modified nucleotides; each N b and N b ’ represents an oligonucleotide sequence independently comprising either modified or unmodified nucleotides from 0 to 10 or combinations thereof; each n, n p ’, n p ’, and n q ’, each of which may or may not be present, independently represents an overhang nucleotide; q XXX, YYY, ZZZ, X’X’X’, Y’Y’Y’, and Z’Z’Z’ each independently represent one motif of three identical modifications on three consecutive nucleotides; The modification on N is different from the modification on Y, and the modification on N ’ is different from the modification on Y’; b wherein the sense strand is conjugated to at least one ligand) b is represented by. (In one embodiment, the method further comprises administering to the subject an anti-complement component C5 antibody, or an antigen-binding fragment thereof.) is represented by.

[0186] (In one embodiment, the method further comprises administering to the subject an anti-complement component C5 antibody, or an antigen-binding fragment thereof.)

[0187] (In one embodiment, the anti-complement component C5 antibody, or an antigen-binding fragment thereof, is eculizumab.)

[0188] (In one embodiment, the antibody, or an antigen-binding fragment thereof, inhibits the cleavage of complement component C5 into fragments C5a and C5b.)

[0189] In one embodiment, the method of the present invention further includes a step of administering a meningococcal vaccine to a subject.

[0190] In one embodiment, eculizumab is administered to a subject once a week for 4 weeks at a dose of less than about 600 mg, then the fifth dose is less than about 900 mg about 1 week later, and then at a dose of less than about 900 mg every about 2 weeks.

[0191] In another embodiment, eculizumab is administered to a subject once a week for 4 weeks at a dose of less than about 900 mg, then the fifth dose is less than about 1200 mg about 1 week later, and then at a dose of less than about 1200 mg every about 2 weeks.

[0192] In one embodiment, the subject is less than 18 years old, and eculizumab is administered to the subject once a week for 4 weeks at a dose of less than about 900 mg, then the fifth dose is less than about 1200 mg about 1 week later, and then at a dose of less than about 1200 mg every about 2 weeks.

[0193] In another embodiment, the subject is less than 18 years old, and eculizumab is administered to the subject once a week for 2 weeks at a dose of less than about 600 mg, then the third dose is less than about 900 mg about 1 week later, and then at a dose of less than about 900 mg every about 2 weeks.

[0194] In one embodiment, the subject is less than 18 years old, and eculizumab is administered to the subject once a week for 2 weeks at a dose of less than about 600 mg, then the third dose is less than about 600 mg about 1 week later, and then at a dose of less than about 600 mg every about 2 weeks.

[0195] In another embodiment, the subject is less than 18 years old, and eculizumab is administered to the subject once a week for 1 week at a dose of less than about 600 mg, then the second dose is less than about 300 mg about 1 week later, and then at a dose of less than about 300 mg every about 2 weeks.

[0196] In yet another embodiment, the subject is under 18 years of age, and eculizumab is administered to the subject once a week at a dose of less than about 300 mg over a one-week period, then the second administration is less than about 300 mg about one week later, and then at a dose of less than about 300 mg every about two weeks.

[0197] In one embodiment, the method further comprises plasma pheresis, i.e., plasma exchange, in the subject. In one embodiment, eculizumab is administered to the subject at a dose of less than about 600 mg. In another embodiment, eculizumab is administered to the subject at a dose of less than about 300 mg.

[0198] In one embodiment, the method further comprises plasma infusion in the subject. In one embodiment, eculizumab is administered to the subject at a dose of less than about 300 mg.

[0199] In one embodiment, eculizumab is administered to the subject at a dose of about 0.01 mg / kg to about 10 mg / kg or about 0.5 mg / kg to about 15 mg / kg. In another embodiment, eculizumab is administered to the subject at a dose of about 5 mg / kg to about 15 mg / kg.

[0200] In another embodiment, eculizumab is administered to the subject at a dose selected from the group consisting of 0.5 mg / kg, 1 mg / kg, 1.5 mg / kg, 3 mg / kg, 5 mg / kg, 7 mg / kg, 10 mg / kg, and 30 mg / kg.

[0201] In one embodiment, eculizumab is administered to the subject by intravenous infusion. In another embodiment, eculizumab is administered subcutaneously to the subject.

[0202] In one embodiment, the dsRNA agent is administered at a dose of about 0.01 mg / kg to about 10 mg / kg or about 0.5 mg / kg to about 15 mg / kg.

[0203] In one embodiment, the dsRNA agent is administered at a dose of about 10 mg / kg to about 30 mg / kg. In another embodiment, the dsRNA agent is administered at a dose selected from the group consisting of 0.5 mg / kg, 1 mg / kg, 1.5 mg / kg, 3 mg / kg, 5 mg / kg, 10 mg / kg, and 30 mg / kg.

[0204] In one embodiment, the dsRNA agent is administered to the subject once a week. In another embodiment, the dsRNA agent is administered to the subject twice a week. In another embodiment, the dsRNA agent is administered to the subject twice a month.

[0205] In one embodiment, the dsRNA agent is administered subcutaneously to the subject.

[0206] In one embodiment, the dsRNA agent and eculizumab are administered subcutaneously to the subject. In another embodiment, the dsRNA agent and eculizumab are administered to the subject simultaneously.

[0207] In one embodiment, the dsRNA agent is first administered to the subject for a period sufficient to reduce the level of complement component C5 in the subject, and then eculizumab is administered at a dose of less than about 600 mg.

[0208] In one embodiment, the level of complement component C5 in the subject is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90%.

[0209] In one embodiment, eculizumab is administered at a dose of about 100 - 500 mg.

[0210] In one embodiment, the dsRNA agent is conjugated to a ligand.

[0211] In one embodiment, the ligand is conjugated to the 3' of the sense strand of the dsRNA agent.

[0212] In one embodiment, the ligand is an N-acetylgalactosamine (GalNAc) derivative.

Brief Description of the Drawings

[0213]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15

Figure 16

Figure 17

Figure 18A

Figure 18B

Figure 18C

Figure 18D

Figure 18E

Figure 18F

Figure 18G

Figure 18H

[0214] The present invention provides an iRNA agent that brings about cleavage of an RNA transcript of a complement component C5 gene via an RNA-induced silencing complex (RISC).

[0215] The iRNA of the present invention has an RNA strand (antisense strand) having a region of about 30 nucleotides or less in length, for example, 15 to 30, 15 to 29, 15 to 28, 15 to 27, 15 to 26, 15 to 25, 15 to 24, 15 to 23, 15 to 22, 15 to 21, 15 to 20, 15 to 19, 15 to 18, 15 to 17, 18 to 30, 18 to 29, 18 to 28, 18 to 27, 18 to 26, 18 to 25, 18 to 24, 18 to 23, 18 to 22, 18 to 21, 18 to 20, 19 to 30, 19 to 29, 19 to 28, 19 to 27, 19 to 26, 19 to 25, 19 to 24, 19 to 23, 19 to 22, 19 to 21, 19 to 20, 20 to 30, 20 to 29, 20 to 28, 20 to 27, 20 to 26, 20 to 25, 20 to 24, 20 to 23, 20 to 22, 20 to 21, 21 to 30, 21 to 29, 21 to 28, 21 to 27, 21 to 26, 21 to 25, 21 to 24, 21 to 23, or 21 to 22 nucleotides in length, and this region is substantially complementary to at least a part of the mRNA transcript of the C5 gene. The use of these iRNAs enables targeted degradation of the mRNA of the C5 gene in mammals. In particular, very low doses of C5 iRNA can specifically and efficiently mediate RNA interference (RNAi) and result in a significant inhibition of the expression of the C5 gene. The inventors have demonstrated that iRNAs targeting C5 can mediate RNAi in vitro and in vivo and result in a significant inhibition of the expression of the C5 gene. Therefore, methods and compositions containing these iRNAs are useful for treating subjects who can benefit from a decrease in the level and / or activity of C5 protein, such as subjects suffering from a disease associated with complement component C5, such as paroxysmal nocturnal hemoglobinuria (PNH).

[0216] The present invention also provides methods and combination therapies for treating a subject suffering from a disorder that can benefit from inhibiting or reducing the expression of the C5 gene, using an iRNA composition that results in cleavage via an RNA-induced silencing complex (RISC) of an RNA transcript of the complement component C5 gene, such as a disease associated with complement component C5, such as paroxysmal nocturnal hemoglobinuria (PNH) and atypical hemolytic uremic syndrome (aHUS).

[0217] The present invention also provides a method for preventing at least one symptom, such as hemolysis, in a subject suffering from a disorder that can benefit from inhibiting or reducing the expression of the C5 gene, for example, a disease associated with complement component C5 such as paroxysmal nocturnal hemoglobinuria (PNH) and atypical hemolytic uremic syndrome (aHUS). The present invention further provides an iRNA composition that results in cleavage of an RNA transcript of the complement component C5 gene via an RNA-induced silencing complex (RISC). The C5 gene can be present within a cell, such as a cell within a subject, e.g., a human.

[0218] The combination therapy of the present invention comprises administering to a subject suffering from a disease associated with complement component C5 an RNAi agent of the present invention and an anti-complement component C5 antibody, or an antigen-binding fragment thereof, such as eculizumab, as a further therapeutic agent. The combination therapy of the present invention uses the iRNA agent of the present invention to target C5 mRNA to reduce (e.g., by about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or about 99%) the C5 level in the subject, and thus reduce the therapeutically (or prophylactically) effective amount of eculizumab required to treat the subject, thereby reducing the cost of treatment and enabling an easier and more convenient method of administering eculizumab, such as subcutaneous administration.

[0219] The following detailed description discloses methods for making and using compositions containing iRNA for inhibiting the expression of the C5 gene, as well as compositions, uses, and methods for treating subjects suffering from diseases and disorders that can benefit from inhibition and / or reduction of the expression of this gene.

[0220] I. Definitions To make the present invention more readily understandable, some terms are first defined. Further, it should be noted that when a value or range of values of a variable is recited, intermediate values and ranges within the recited values are also intended to be part of the present invention.

[0221] The articles "a" and "an" are used herein to refer to one or more (i.e., at least one) of the grammatical objects of the article. By way of example, "an element" means one element or two or more elements, e.g., a plurality of elements.

[0222] The term "including" is used herein to mean the phrase "including but not limited to" and is used synonymously with this phrase.

[0223] The term "or" is used herein to mean the term "and / or" and is used synonymously with this term, unless the context clearly indicates otherwise.

[0224] As used herein, "complement component C5", which is used synonymously with the term "C5", refers in the art to well-known genes and polypeptides also known as CPAMD4, C3 and PZP-like α-2-macroglobulin domain-containing protein, anaphylatoxin C5a analog, hemolytic complement (Hc), and complement C5. The sequence of the human C5 mRNA transcript can be found, for example, in GenBank accession number GI:38016946 (NM_001735.2; SEQ ID NO:1). The sequence of the rhesus monkey C5 mRNA can be found, for example, in GenBank accession number GI:297270262 (XM_001095750.2; SEQ ID NO:2). The sequence of the mouse C5 mRNA can be found, for example, in GenBank accession number GI:291575171 (NM_010406.2; SEQ ID NO:3). The sequence of the rat C5 mRNA can be found, for example, in GenBank accession number GI:392346248 (XM_345342.4; SEQ ID NO:4). Further examples of C5 mRNA sequences are readily available using publicly available databases such as GenBank.

[0225] As used herein, the term "C5" also refers to variations in the native DNA sequence of the C5 gene, such as single nucleotide polymorphisms in the C5 gene. Many SNPs in the C5 gene have been identified and can be found, for example, in NCBI dbSNP (see, e.g., ncbi.nlm.nih.gov / snp). Non-limiting examples of SNPs within the C5 gene can be found at NCBI dbSNP accession numbers rs121909588 and rs121909587.

[0226] As used herein, "target sequence" refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed upon transcription of the C5 gene, including the mRNA that is the product of RNA processing of the primary transcript. In one embodiment, the target portion of the sequence will be at least long enough to function as a substrate for iRNA-directed cleavage at or near the corresponding portion of the nucleotide sequence of the mRNA molecule formed upon transcription of the C5 gene.

[0227] The target sequence can be about 9 to 36 nucleotides in length, for example, about 15 to 30 nucleotides in length. For example, the target sequence can be about 15 to 30 nucleotides, 15 - 29, 15 - 28, 15 - 27, 15 - 26, 15 - 25, 15 - 24, 15 - 23, 15 - 22, 15 - 21, 15 - 20, 15 - 19, 15 - 18, 15 - 17, 18 - 30, 18 - 29, 18 - 28, 18 - 27, 18 - 26, 18 - 25, 18 - 24, 18 - 23, 18 - 22, 18 - 21, 18 - 20, 19 - 30, 19 - 29, 19 - 28, 19 - 27, 19 - 26, 19 - 25, 19 - 24, 19 - 23, 19 - 22, 19 - 21, 19 - 20, 20 - 30, 20 - 29, 20 - 28, 20 - 27, 20 - 26, 20 - 25, 20 - 24, 20 - 23, 20 - 22, 20 - 21, 21 - 30, 21 - 29, 21 - 28, 21 - 27, 21 - 26, 21 - 25, 21 - 24, 21 - 23, or 21 - 22 nucleotides in length. Ranges and lengths intermediate to those described above are also considered to be part of the present invention.

[0228] As used herein, the term "strand containing an array" refers to an oligonucleotide comprising a nucleotide strand represented by an array shown using standard nucleotide nomenclature.

[0229] "G", "C", "A", and "U" each generally represent nucleotides containing guanine, cytosine, adenine, and uracil as bases, respectively. However, it will be understood that the terms "ribonucleotide" or "nucleotide" may also refer to modified nucleotides, or surrogate replacement moieties, as further detailed below (see, e.g., Table 2). One of ordinary skill in the art will fully recognize that guanine, cytosine, adenine, and uracil may be replaced by other moieties without significantly altering the base pairing properties of oligonucleotides containing nucleotides having such replacement moieties. For example, without limitation, a nucleotide containing inosine as its base can base pair with a nucleotide containing adenine, cytosine, or uracil. Thus, a nucleotide containing uracil, guanine, or adenine may be replaced, for example, by a nucleotide containing inosine in the nucleotide sequence of the dsRNA characterized in the present invention. In another example, any adenine and cytosine in an oligonucleotide may be replaced by guanine and uracil, respectively, to form wobble G-U base pairing with a target mRNA. Sequences containing such replacement moieties are suitable for the compositions and methods contemplated in the present invention.

[0230] As used interchangeably herein, the terms "iRNA", "RNAi agent", "iRNA agent", and "RNA interference agent" refer to an agent that contains RNA and mediates targeted cleavage of an RNA transcript via the RNA-induced silencing complex (RISC) pathway, as defined herein. iRNA induces sequence-specific degradation of mRNA by a process known as RNA interference (RNAi). iRNA modulates (e.g., inhibits) the expression of C5 in cells, such as cells in a mammalian subject.

[0231] In one embodiment, the RNAi agent of the present invention includes a single-stranded RNA that interacts with a target RNA sequence, for example, a C5 target mRNA sequence, to direct cleavage of the target RNA. Without wishing to be bound by theory, it is thought that long double-stranded RNAs introduced into cells are broken down into siRNAs by type III endonucleases known as Dicer (Sharp et al. (2001) Genes Dev. 15:485). Dicer, a ribonuclease III-like enzyme, processes dsRNA into short interfering RNAs of 19-23 base pairs with characteristic two-base 3' overhangs (Bernstein, et al., (2001) Nature 409:363). Next, the siRNA is incorporated into the RNA-induced silencing complex (RISC), where one or more helicases unwind the siRNA duplex, allowing the complementary antisense strand to direct target recognition (Nykanen, et al., (2001) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases in the RISC cleave the target to induce silencing (Elbashir, et al., (2001) Genes Dev. 15:188). Here, in one aspect, the present invention relates to a single-stranded RNA (siRNA) that is produced in cells and promotes the formation of the RISC complex that results in silencing of the target gene, namely, the C5 gene. Thus, the term "siRNA" is also used herein to refer to the RNAi described above.

[0232] In another embodiment, the RNAi agent can be a single-stranded siRNA that is introduced into a cell or organism to inhibit a target mRNA. The single-stranded RNAi agent binds to the RISC endonuclease Argonaute 2, which then cleaves the target mRNA. Single-stranded siRNAs are generally 15 to 30 nucleotides in length and are chemically modified. The design and testing of single-stranded siRNAs are described in U.S. Patent No. 8,101,348 and Lima et al., (2012) Cell 150:883-894, the entire contents of each of which are incorporated herein by reference. Any of the antisense nucleotide sequences described herein can be used as a single-stranded siRNA that is chemically modified by the methods described herein or as described in Lima et al., (2012) Cell 150;:883-894.

[0233] In another embodiment, the "iRNA" for use in the compositions, uses, and methods of the invention is double-stranded RNA, referred to herein as "double-stranded RNAi agent", "double-stranded RNA (dsRNA) molecule", "dsRNA agent", or "dsRNA". The term "dsRNA" refers to a ribonucleic acid molecule complex having a double-stranded structure that includes two anti-parallel and substantially complementary nucleic acid strands that have been shown to have "sense" and "antisense" orientations with respect to a target RNA, i.e., the C5 gene. In certain embodiments of the invention, the double-stranded RNA (dsRNA) causes degradation of a target RNA, e.g., mRNA, by a post-transcriptional gene silencing mechanism referred to herein as RNA interference or RNAi.

[0234] Generally, most of the nucleotides of each strand of a dsRNA molecule are ribonucleotides, but as described in detail herein, each or both strands may also include one or more non-ribonucleotides, such as deoxyribonucleotides and / or modified nucleotides. Further, as used herein, an "RNAi agent" may include ribonucleotides having chemical modifications; an RNAi agent may include substantial modifications in multiple nucleotides. Such modifications may include any type of modification disclosed herein or known in the art. Any such modifications when used in siRNA type molecules are encompassed by an "RNAi agent" for the purposes of this specification and the claims.

[0235] The double-stranded region may be of any length that enables specific degradation of a desired target RNA via the RISC pathway, and may be in the range of about 9 to 36 base pairs in length, such as in the range of about 15 to 30 base pairs in length, for example, about 15 to 30, 15 to 29, 15 to 28, 15 to 27, 15 to 26, 15 to 25, 15 to 24, 15 to 23, 15 to 22, 15 to 21, 15 to 20, 15 to 19, 15 to 18, 15 to 17, 18 to 30, 18 to 29, 18 to 28, 18 to 27, 18 to 26, 18 to 25, 18 to 24, 18 to 23, 18 to 22, 18 to 21, 18 to 20, 19 to 30, 19 to 29, 19 to 28, 19 to 27, 19 to 26, 19 to 25, 19 to 24, 19 to 23, 19 to 22, 19 to 21, 19 to 20, 20 to 30, 20 to 29, 20 to 28, 20 to 27, 20 to 26, 20 to 25, 20 to 24, 20 to 23, 20 to 22, 20 to 21, 21 to 30, 21 to 29, 21 to 28, 21 to 27, 21 to 26, 21 to 25, 21 to 24, 21 to 23, or 21 to 22 base pairs in length, and may be of a length of about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs. Ranges and lengths intermediate to those described above are also considered to be part of the present invention.

[0236] The two strands forming the double-stranded structure may be different parts of a larger RNA molecule or they may be separate RNA molecules. When the two strands are part of a larger molecule and are thus joined by a continuous strand of nucleotides between the 3' end of one strand forming the double-stranded structure and the 5' end of the other strand, the joined RNA strands are referred to as a "hairpin loop". The hairpin loop may contain at least one unpaired nucleotide. In certain embodiments, the hairpin loop may contain at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least twenty, at least twenty-three or more unpaired nucleotides.

[0237] When the two substantially complementary strands of the dsRNA are constituted by separate RNA molecules, those molecules may or may not be covalently linked. When the two strands are covalently linked by means other than a continuous strand of nucleotides between the 3' end of one strand forming the double-stranded structure and the 5' end of the other strand, the linked structure is referred to as a "linker". The RNA strands may have the same or different numbers of nucleotides. The maximum number of base pairs is the number of nucleotides in the shortest strand of the dsRNA minus the number of overhangs present in the double-stranded portion. In addition to the double-stranded structure, the RNAi agent may contain one or more nucleotide overhangs.

[0238] In one embodiment, the RNAi agent of the present invention is a 24-30 nucleotide dsRNA that interacts with a target RNA sequence, e.g., a C5 target mRNA sequence, to direct cleavage of the target RNA. Without wishing to be bound by theory, long double-stranded RNAs introduced into cells are degraded into siRNAs by type III endonucleases known as Dicer (Sharp et al. (2001) Genes Dev. 15:485). Dicer, a ribonuclease III-like enzyme, processes dsRNA into 19-23 base pair short interfering RNAs with characteristic two-base 3' overhangs (Bernstein, et al., (2001) Nature 409:363). Next, the siRNA is incorporated into the RNA-induced silencing complex (RISC), where one or more helicases unwind the siRNA duplex, allowing the complementary antisense strand to direct target recognition (Nykanen, et al., (2001) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases in the RISC cleave the target to induce silencing (Elbashir, et al., (2001) Genes Dev. 15:188).

[0239] As used herein, the term "nucleotide overhang" refers to at least one unpaired nucleotide that protrudes from the double-stranded structure of an iRNA, such as dsRNA. For example, a nucleotide overhang exists when the 3' end of one strand of the dsRNA extends beyond the 5' end of the other strand or vice versa. The dsRNA may contain an overhang of at least one nucleotide; alternatively, the overhang may contain at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides or more. The nucleotide overhang may comprise or consist of nucleotide / nucleoside analogs including deoxynucleotides / nucleosides. The overhang may be the sense strand, the antisense strand or any combination thereof. Further, the nucleotides of the overhang may be present at the 5' end, 3' end or both ends of either the antisense strand or the sense strand of the dsRNA.

[0240] In one embodiment, the antisense strand of the dsRNA has an overhang of 1 to 10 nucleotides, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides, at the 3' end and / or 5' end. In one embodiment, the sense strand of the dsRNA has an overhang of 1 to 10 nucleotides, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides, at the 3' end and / or 5' end. In another embodiment, one or more of the nucleotides in the overhang are replaced with nucleoside phosphorothioates.

[0241] "Blunt" or "blunt end" means that there are no unpaired nucleotides at the corresponding end of the double-stranded RNAi agent, i.e., there is no nucleotide overhang. A "blunt end" RNAi agent is double-stranded over its entire length, i.e., it is a dsRNA with no nucleotide overhangs at either end of the molecule. The RNAi agents of the present invention include RNAi agents having a nucleotide overhang at one end (i.e., an agent having one overhang and one blunt end) or RNAi agents having nucleotide overhangs at both ends.

[0242] The term "antisense strand" or "guide strand" refers to a strand of an iRNA, e.g., a dsRNA, that contains a region that is substantially complementary to a target sequence, e.g., a region complementary to C5 mRNA. As used herein, the term "region of complementarity" refers to a region of an antisense strand that is substantially complementary to a sequence, e.g., a target sequence, e.g., a C5 nucleotide sequence, as defined herein. If the region of complementarity is not completely complementary to the target sequence, there may be mismatches in the internal or terminal regions of the molecule. Generally, most tolerated mismatches are present in the terminal regions, e.g., 5, 4, 3, or 2 nucleotides at the 5' end and / or 3' end of the iRNA.

[0243] As used herein, the term "sense strand" or "passenger strand" refers to a strand of an iRNA that contains a region that is substantially complementary to the region of the antisense strand, as defined herein.

[0244] As used herein, the term "cleavage region" refers to the region located immediately adjacent to the cleavage site. The cleavage site is the site at which cleavage occurs in the target. In certain embodiments, the cleavage region comprises three bases immediately adjacent to the cleavage site at either end of the cleavage site. In certain embodiments, the cleavage region comprises two bases immediately adjacent to the cleavage site at either end of the cleavage site. In certain embodiments, the cleavage site specifically occurs at the site joined by nucleotides 10 and 11 of the antisense strand, and the cleavage region comprises nucleotides 11, 12, and 13.

[0245] As used herein, unless otherwise indicated, the term "complementary" when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide containing the first nucleotide sequence to hybridize with an oligonucleotide or polynucleotide containing the second nucleotide sequence under predetermined conditions to form a double-stranded structure, as understood by those of ordinary skill in the art. Such conditions can be, for example, stringent conditions, where stringent conditions can include 400 mM NaCl, 40 mM PIPES (pH 6.4), 1 mM EDTA, 12-16 hours at 50 °C or 70 °C, followed by washing (see, e.g., "Molecular Cloning: A Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press"). Other conditions can be applied, such as physiologically relevant conditions that can occur within an organism. Those of ordinary skill in the art will be able to determine the most appropriate set of conditions for testing the complementarity of two sequences according to the ultimate use of the hybridized nucleotides.

[0246] Among the iRNAs described herein, for example, the complementary sequences in dsRNA include base pairing over the entire length of one or both nucleotide sequences of an oligonucleotide or polynucleotide containing a first nucleotide sequence to an oligonucleotide or polynucleotide containing a second nucleotide sequence. Such sequences may be referred to herein as "perfectly complementary" to each other. However, when a first sequence is referred to herein as "substantially complementary" to a second sequence, the two sequences may be perfectly complementary or, while retaining the ability to hybridize under conditions optimal for their ultimate application, e.g., inhibition of gene expression via the RISC pathway, when performing hybridization to a duplex of up to 30 base pairs, they may form one or more, but generally 5 or fewer, 4 or fewer, 3 or fewer, or 2 or fewer mismatched base pairs. However, if two oligonucleotides are designed to form one or more single-stranded overhangs after hybridization, such overhangs shall not be considered mismatches with respect to the determination of complementarity. For example, for the purposes described herein, a dsRNA containing one 21-nucleotide-long oligonucleotide and another 23-nucleotide-long oligonucleotide may be referred to as "perfectly complementary" if the longer oligonucleotide contains a 21-nucleotide sequence that is perfectly complementary to the shorter oligonucleotide.

[0247] As used herein, the "complementary" sequences can also include, or can be entirely formed of, base pairs formed from non-Watson-Crick base pairs and / or non-natural and modified nucleotides, as long as the above requirements related to their ability to hybridize are met. Examples of such non-Watson-Crick base pairs include, but are not limited to, G:U wobble or Hoogsteen-type base pairs.

[0248] As used herein, the terms "complementary", "fully complementary" and "substantially complementary" may be used in connection with matching bases between the sense and antisense strands of a dsRNA, or between the antisense strand of a dsRNA and a target sequence, as understood from the context of their use.

[0249] As used herein, a polynucleotide "substantially complementary to at least a portion of" a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e.g., an mRNA encoding PCSK9) that includes the 5'UTR, open reading frame (ORF), or 3'UTR. For example, a polynucleotide is complementary to at least a portion of PCSK9 mRNA if its sequence is substantially complementary to a contiguous portion of the mRNA encoding PCSK9.

[0250] Generally, most of the nucleotides of each strand are ribonucleotides, but as described in detail herein, each or both strands may also include one or more non-ribonucleotides, such as deoxyribonucleotides and / or modified nucleotides. Further, "iRNA" may include ribonucleotides having chemical modifications. Such modifications may include any type of modification disclosed herein or known in the art. Any such modification when used in an iRNA molecule is encompassed by "iRNA" for the purposes of this specification and the claims.

[0251] In one aspect of the invention, the agent for use in the methods and compositions of the invention is a single-stranded antisense RNA molecule that inhibits target mRNA via an antisense inhibition mechanism. The single-stranded antisense RNA molecule is complementary to a sequence in the target mRNA. The single-stranded antisense oligonucleotide can stoichiometrically inhibit translation by base pairing to the mRNA and physically interfering with the translation machinery (see Dias, N. et al., (2002) Mol Cancer Ther 1:347-355). The single-stranded antisense RNA molecule is about 15 to about 30 nucleotides in length and can have a sequence complementary to the target sequence. For example, the single-stranded antisense RNA molecule can comprise a sequence that is at least about 15, 16, 17, 18, 19, 20, or more consecutive nucleotides from any one of the antisense sequences described herein.

[0252] The term "lipid nanoparticle" or "LNP" refers to a vesicle that contains a lipid layer encapsulating a nucleic acid molecule, such as a pharmaceutically active molecule such as an iRNA or a plasmid from which the iRNA is transcribed. LNPs are described, for example, in U.S. Patent Nos. 6,858,225, 6,815,432, 8,158,601, and 8,058,069, the entire contents of which are incorporated herein by reference.

[0253] As used herein, "subject" refers to an animal such as a mammal including primates (humans, non-human primates such as monkeys and chimpanzees, etc.), non-primates (cows, pigs, camels, llamas, horses, goats, rabbits, sheep, hamsters, guinea pigs, cats, dogs, rats, mice, horses, and whales, etc.), or birds (such as ducks or geese). In one embodiment, the subject is a human being who is being treated or evaluated for a disease, disorder or condition that may benefit from a decrease in the expression of C5 as described herein; a human being at risk of a disease, disorder or condition that may benefit from a decrease in the expression of C5; a human being suffering from a disease, disorder or condition that may benefit from a decrease in the expression of C5; and / or a human being such as a human being who is being treated for a disease, disorder or condition that may benefit from a decrease in the expression of C5.

[0254] As used herein, the term "treating" or "treatment" refers to, but is not limited to, alleviation or improvement of one or more symptoms (such as hemolysis and / or chronic inflammation) associated with unwanted complement pathway activation; a decrease in the degree of unwanted complement pathway activation; stabilization of the state of chronic inflammation and / or hemolysis (i.e., not getting worse); improvement or alleviation of unwanted complement pathway activation (such as chronic inflammation and / or hemolysis) whether detectable or undetectable, which refers to a beneficial or desired result. "Treatment" can also mean an extension of the survival period compared to the predicted survival period if no treatment is given.

[0255] The term "lowering" in the context of complement component C5 or a disease marker or symptom in a subject refers to a statistically significant decrease in such levels. The decrease can be, for example, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or more, and is preferably lowered to a level recognized as within the normal range of individuals without such a disorder.

[0256] As used herein, "prevent" or "preventing" refers to a reduction in the likelihood that a subject will develop symptoms associated with a disease, disorder or condition for which benefit can be obtained from a decrease in the expression of the C5 gene, such as symptoms of undesirable complement activation such as chronic inflammation, hemolysis and / or thrombosis. The likelihood of developing thrombosis is reduced, for example, if an individual having one or more risk factors for thrombosis does not develop thrombosis, or develops a less severe thrombosis compared to a population having the same risk factors and not receiving the treatment described herein. Not developing a disease, disorder or condition, or a reduction in the occurrence of symptoms associated with such a disease, disorder or condition (e.g., at least about 10% on a clinically recognized scale of the disease or disorder), or a delayed appearance of symptoms (e.g., by days, weeks, months or years) is considered effective prevention.

[0257] As used herein, the term "disease associated with complement component C5" refers to a disease or disorder caused by or associated with complement activation. Such diseases are typically associated with inflammation and / or activation of the immune system, such as lysis by the membrane attack complex, anaphylaxis, and / or hemolysis. Non-limiting examples of diseases associated with complement component C5 include paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), asthma, rheumatoid arthritis (RA); antiphospholipid antibody syndrome; lupus nephritis; ischemia-reperfusion injury; typical or infectious hemolytic uremic syndrome (tHUS); dense deposit glomerulonephritis (DDD); neuromyelitis optica (NMO); multifocal motor neuropathy (MMN); multiple sclerosis (MS); macular degeneration (e.g., age-related macular degeneration (AMD)); hemolysis, elevated liver escape enzymes, and low platelets (HELLP) syndrome; thrombotic thrombocytopenic purpura (TTP); spontaneous abortion; microscopic immune vasculitis; epidermolysis bullosa; habitual abortion; pregnancy-induced hypertension nephropathy, traumatic brain injury, myasthenia gravis, cold agglutinin disease, dermatomyositis, bullous pemphigoid, Shiga toxin-producing Escherichia coli (E.Hemolytic uremic syndrome associated with Escherichia coli, C3 glomerulopathy, antineutrophil cytoplasmic antibody-associated vasculitis (e.g., granulomatosis with polyangiitis (previously known as Wegener's granulomatosis), Churg-Strauss syndrome, and microscopic polyangiitis), humoral and vascular transplant rejection, graft dysfunction, myocardial infarction (e.g., tissue injury and ischemia in myocardial infarction), allograft, sepsis (e.g., poor outcome in sepsis), coronary artery disease, dermatomyositis, Graves' disease, atherosclerosis, Alzheimer's disease, systemic inflammatory response sepsis, septic shock, spinal cord injury, glomerulonephritis, Hashimoto's thyroiditis, type 1 diabetes, psoriasis, pemphigus, autoimmune hemolytic anemia (AIHA), ITP, Goodpasture's syndrome, dog disease, antiphospholipid syndrome (APS), catastrophic APS (CAPS), cardiovascular disease, myocarditis, cerebrovascular disorder, peripheral (e.g., musculoskeletal) vascular disorder, renal vascular disorder, mesenteric / intestinal vascular disorder, vasculitis, Henoch-Schönlein purpura nephritis, systemic lupus erythematosus-related vasculitis, vasculitis associated with rheumatoid arthritis, immune complex vasculitis, Takayasu disease, dilated cardiomyopathy, diabetic angiopathy, Kawasaki disease (arteritis), venous gas embolism (VGE), and restenosis after stent placement, rotational atherectomy, membranous nephropathy, Guillain-Barré syndrome, and percutaneous transluminal coronary angioplasty (PTCA) (see, e.g., Holers (2008) Immunological Reviews 223:300-316; Holers and Thurman (2004) Molecular Immunology 41:147-152; U.S. Patent Application Publication No. 20070172483).

[0258] In one embodiment, a disease associated with complement component C5 is paroxysmal nocturnal hemoglobinuria (PNH). PNH can be classical PNH or another myelodysplastic syndrome and / or myelodysplasia (MDS), e.g., PNH in the case of cytopenia. In another embodiment, a disease associated with complement component C5 is atypical hemolytic uremic syndrome (aHUS).

[0259] II. iRNA of the present invention The present invention provides an iRNA that inhibits the expression of the complement component C5 gene. In one embodiment, the iRNA agent is a double-stranded ribonucleic acid (dsRNA) molecule for inhibiting the expression of the C5 gene in cells, such as cells in a subject suffering from a disease associated with complement component C5, such as PNH, for example, a mammal such as a human. The dsRNA includes an antisense strand having a complementary region that is at least partially complementary to at least a portion of the mRNA formed during the expression of the C5 gene. The complementary region is about 30 nucleotides in length or less (for example, about 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, or 18 nucleotides in length or less). When contacted with cells expressing the C5 gene, the iRNA inhibits the expression of the C5 gene (for example, the C5 gene of a human, primate, non-primate, or bird) by at least about 10% when assayed by, for example, a protein-based method such as PCR or branched DNA (bDNA) assay, or immunofluorescence analysis using, for example, Western blot or flow cytometry techniques.

[0260] The dsRNA includes two RNA strands that are complementary and hybridize to form a double-stranded structure under the conditions in which the dsRNA is used. One strand of the dsRNA (antisense strand) includes a complementary region that is substantially complementary, generally completely complementary, to the target sequence. The target sequence may be derived from the sequence of the mRNA formed during the expression of the C5 gene. The other strand (sense strand) includes a region complementary to the antisense strand and is configured to hybridize with the two strands to form a double-stranded structure when combined under suitable conditions. As described elsewhere herein and as known in the art, the complementary sequences of the dsRNA may also be included as self-complementary regions of one nucleic acid molecule rather than on separate oligonucleotides.

[0261] Generally, the double-stranded structure has a length of 15 to 30 base pairs, for example, 15 to 29, 15 to 28, 15 to 27, 15 to 26, 15 to 25, 15 to 24, 15 to 23, 15 to 22, 15 to 21, 15 to 20, 15 to 19, 15 to 18, 15 to 17, 18 to 30, 18 to 29, 18 to 28, 18 to 27, 18 to 26, 18 to 25, 18 to 24, 18 to 23, 18 to 22, 18 to 21, 18 to 20, 19 to 30, 19 to 29, 19 to 28, 19 to 27, 19 to 26, 19 to 25, 19 to 24, 19 to 23, 19 to 22, 19 to 21, 19 to 20, 20 to 30, 20 to 29, 20 to 28, 20 to 27, 20 to 26, 20 to 25, 20 to 24, 20 to 23, 20 to 22, 20 to 21, 21 to 30, 21 to 29, 21 to 28, 21 to 27, 21 to 26, 21 to 25, 21 to 24, 21 to 23, or 21 to 22 base pairs in length. Ranges and lengths intermediate to those described above are also considered to be part of the present invention.

[0262] Similarly, the region of complementarity of the target sequence has a length of 15 to 30 nucleotides, for example, 15 to 29, 15 to 28, 15 to 27, 15 to 26, 15 to 25, 15 to 24, 15 to 23, 15 to 22, 15 to 21, 15 to 20, 15 to 19, 15 to 18, 15 to 17, 18 to 30, 18 to 29, 18 to 28, 18 to 27, 18 to 26, 18 to 25, 18 to 24, 18 to 23, 18 to 22, 18 to 21, 18 to 20, 19 to 30, 19 to 29, 19 to 28, 19 to 27, 19 to 26, 19 to 25, 19 to 24, 19 to 23, 19 to 22, 19 to 21, 19 to 20, 20 to 30, 20 to 29, 20 to 28, 20 to 27, 20 to 26, 20 to 25, 20 to 24, 20 to 23, 20 to 22, 20 to 21, 21 to 30, 21 to 29, 21 to 28, 21 to 27, 21 to 26, 21 to 25, 21 to 24, 21 to 23, or 21 to 22 nucleotides in length. Ranges and lengths intermediate to those described above are also considered to be part of the present invention.

[0263] In certain embodiments, the dsRNA is from about 15 to about 20 nucleotides in length, or from about 25 to about 30 nucleotides in length. Generally, the dsRNA is long enough to function as a substrate for the Dicer enzyme. For example, it is well known in the art that dsRNA longer than about 21-23 nucleotides in length can function as a substrate for Dicer. As will also be appreciated by those of skill in the art, the region of the RNA targeted for cleavage is, in most cases, part of a larger RNA molecule, often an mRNA molecule. When relevant, a "portion" of the mRNA target is a continuous sequence of the mRNA target that is long enough to be capable of being a substrate for RNAi-directed cleavage (i.e., cleavage via the RISC pathway).

[0264] The double-stranded region is the primary functional part of the dsRNA, for example, about 9 to 36 base pairs, for example, about 10 to 36, 11 to 36, 12 to 36, 13 to 36, 14 to 36, 15 to 36, 9 to 35, 10 to 35, 11 to 35, 12 to 35, 13 to 35, 14 to 35, 15 to 35, 9 to 34, 10 to 34, 11 to 34, 12 to 34, 13 to 34, 14 to 34, 15 to 34, 9 to 33, 10 to 33, 11 to 33, 12 to 33, 13 to 33, 14 to 33, 15 to 33, 9 to 32, 10 to 32, 11 to 32, 12 to 32, 13 to 32, 14 to 32, 15 to 32, 9 to 31, 10 to 31, 11 to 31, 12 to 31, 13 to 32, 14 to 31, 15 to 31, 15 to 30, 15 to 29, 15 to 28, 15 to 27, 15 to 26, 15 to 25, 15 to 24, 15 to 23, 15 to 22, 15 to 21, 15 to 20, 15 to 19, 15 to 18, 15 to 17, 18 to 30, 18 to 29, 18 to 28, 18 to 27, 18 to 26, 18 to 25, 18 to 24, 18 to 23, 18 to 22, 18 to 21, 18 to 20, 19 to 30, 19 to 29, 19 to 28, 19 to 27, 19 to 26, 19 to 25, 19 to 24, 19 to 23, 19 to 22, 19 to 21, 19 to 20, 20 to 30, 20 to 29, 20 to 28, 20 to 27, 20 to 26, 20 to 25, 20 to 24, 20 to 23, 20 to 22, 20 to 21, 21 to 30, 21 to 29, 21 to 28, 21 to 27, 21 to 26, 21 to 25, 21 to 24, 21 to 23, or a double-stranded region of 21 to 22 base pairs. One of ordinary skill in the art will recognize that here, in one embodiment, a complex of an RNA molecule or an RNA molecule having a double-stranded region of more than 30 base pairs, to the extent that it is processed into a functional double-stranded of, for example, 15 to 30 base pairs, targeted for cleavage of the desired RNA, is dsRNA. Thus, one of ordinary skill in the art will recognize that in one embodiment, miRNA is dsRNA. In another embodiment, the dsRNA is not a natural miRNA. In another embodiment, the iRNA agent useful for targeting the expression of C5 is not generated in the target cells by cleavage of larger dsRNAs.

[0265] The dsRNA described in this specification may further include one or more single-stranded nucleotide overhangs, for example, 1, 2, 3, or 4 nucleotides. dsRNA having at least one nucleotide overhang may have unexpectedly excellent inhibitory properties compared to its blunt-end equivalent. The nucleotide overhang may comprise or consist of nucleotide / nucleoside analogs including deoxynucleotides / nucleosides. The overhang may be on the sense strand, the antisense strand, or any combination thereof. Further, the nucleotides of the overhang may be present on the 5'-end, 3'-end, or both ends of either the antisense strand or the sense strand of the dsRNA.

[0266] The dsRNA can be synthesized, for example, by the use of an automated DNA synthesizer (such as those commercially available from Biosearch, Applied Biosystems, Inc., etc.) by standard methods known in the art, as will be described further below.

[0267] The iRNA compounds of the present invention can be prepared using a two-step procedure. First, the individual strands of the double-stranded RNA molecule are prepared separately. Next, the component strands are annealed. The individual strands of the siRNA compound can be prepared using solution-phase or solid-phase organic synthesis or both. Organic synthesis offers the advantage that oligonucleotide strands containing non-natural or modified nucleotides can be readily prepared. The single-stranded oligonucleotides of the present invention can be prepared using solution-phase or solid-phase organic synthesis or both.

[0268] In one aspect, the dsRNA of the present invention includes at least two nucleotide sequences, a sense sequence and an antisense sequence. The sense strand is selected from the group of sequences shown in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23, and the corresponding antisense strand of the sense strand is selected from the group of sequences of any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23. In this aspect, one of the two sequences is complementary to the other of the two sequences, and one of the sequences is substantially complementary to the sequence of the mRNA generated during the expression of the C5 gene. Thus, in this aspect, the dsRNA will comprise two oligonucleotides, where one oligonucleotide is represented as the sense strand in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23, and the second oligonucleotide is represented as the corresponding antisense strand of the sense strand in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23. In one embodiment, the substantially complementary sequence of the dsRNA is contained in a separate oligonucleotide. In another embodiment, the substantially complementary sequence of the dsRNA is contained in one oligonucleotide.

[0269] Some of the sequences in Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23 are represented as modified and / or conjugate sequences, but it will be understood that the RNA of the iRNA of the present invention, for example, the dsRNA of the present invention, may include any one of the sequences described in Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23 that is unmodified, unconjugated, and / or modified and / or conjugated, different from those described in the tables.

[0270] Those skilled in the art are fully aware that dsRNA having a double-stranded structure of about 20 to 23 base pairs, for example, 21 base pairs, has been recognized as particularly effective in inducing RNA interference (Elbashir et al., EMBO 2001, 20:6877-6888). However, other skilled artisans have found that shorter or longer RNA double-stranded structures may also be effective (Chu and Rana (2007) RNA 14:1714-1719; Kim et al. (2005) Nat Biotech 23:222-226). In the above embodiments, depending on the nature of the oligonucleotide sequences shown in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23, the dsRNA described herein may include at least one strand with a minimum length of 21 nucleotides. It can be naturally predicted that a shorter double-stranded having one of the sequences of any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23, with a few nucleotides subtracted at one or both ends, may be equally effective compared to the above dsRNA. Therefore, a dsRNA having at least 15, 16, 17, 18, 19, 20, or more consecutive nucleotide sequences from one of the sequences of any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23, and whose ability to inhibit the expression of the C5 gene differs from that of the dsRNA containing the complete sequence by only about 5, 10, 15, 20, 25, or 30% or less inhibition is considered to be within the scope of the present invention.

[0271] Furthermore, the RNA shown in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23 identifies a site in the C5 transcript that is susceptible to cleavage via RISC. Accordingly, the invention further encompasses iRNAs that target within one of these sites. As used herein, an iRNA is said to target within a particular site of an RNA transcript if the iRNA promotes cleavage of the transcript at any point within that particular site. Such iRNAs generally will comprise at least about 15 contiguous nucleotides from one of the sequences shown in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23, which are bound to an additional nucleotide sequence taken from a region adjacent to the selected sequence in the C5 gene.

[0272] Target sequences generally range from about 15 to 30 nucleotides in length, but for any given target RNA cleavage, the suitability of specific sequences within this range varies. The various software packages and guidelines described herein provide guidance for identifying optimal target sequences for any given gene target, but an empirical approach can also be taken where a "window" or "mask" of a given size (e.g., 21 nucleotides as a non-limiting example) is placed literally or metaphorically (including in silico) on the target RNA sequence to identify sequences within the size range that can function as target sequences. The next potential target sequence can be identified by gradually moving the sequence "window" 1 nucleotide upstream or downstream of the initial target sequence position until a complete set of possible sequences is identified for any given target size selected. This process, along with the systematic synthesis and testing of the identified sequences (using assays described herein or known in the art), can identify the RNA sequence that mediates the best inhibition of target gene expression when targeted with an iRNA agent. Thus, for example, the sequences identified in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23 represent valid target sequences, but further optimization of inhibition efficiency can be achieved, it is contemplated, by gradually "moving the window" 1 nucleotide upstream or downstream of a given sequence to identify sequences having equivalent or better inhibitory properties.

[0273] Furthermore, for any array identified in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23, additional optimization can be achieved by systematically adding or removing nucleotides to generate longer or shorter arrays, and testing the arrays generated by moving a window of longer or shorter size above or below the target RNA from that point. Also, in inhibition assays known in the art and / or described herein, by coupling this approach for generating new candidate targets with testing the efficacy of iRNAs based on their target sequences, the efficiency of inhibition can be further improved. Still further, such optimized arrays can be adjusted, for example, by introduction of modified nucleotides described herein or known in the art, addition or alteration of overhangs, or other modifications known in the art and / or described herein for further optimizing the molecule as an expression inhibitor (e.g., increase in serum stability or circulation half-life, increase in thermal stability, improvement in membrane permeation delivery, targeting to specific locations or cell types, increase in interaction with silencing pathway enzymes, increase in release from endosomes).

[0274] The iRNAs described herein may contain one or more mismatches with the target sequence. In one embodiment, the iRNAs described herein contain three or fewer mismatches. When the antisense strand of the iRNA contains a mismatch with the target sequence, it is preferred that the region of the mismatch is not located at the center of the complementary region. When the antisense strand of the iRNA contains a mismatch with the target sequence, the mismatch is preferably restricted within the last 5 nucleotides from either the 5' or 3' end of the complementary region. For example, for a 23-nucleotide iRNA agent, the strand complementary to the region of the C5 gene generally contains no mismatches within the central 13 nucleotides. It is possible to determine whether an iRNA containing a mismatch with the target sequence is effective in inhibiting the expression of the C5 gene using the methods described herein or methods known in the art. Considering the effectiveness of an iRNA with a mismatch in inhibiting the expression of the C5 gene is particularly important when it is known that a specific complementary region in the C5 gene has polymorphic sequence variations within the population.

[0275] III. Modified iRNAs of the Invention In one embodiment, the RNA of the iRNA of the invention, e.g., dsRNA, is not modified and does not contain, for example, chemical modifications and / or conjugates known in the art and described herein. In another embodiment, the RNA of the iRNA of the invention, e.g., dsRNA, is chemically modified to improve stability or other beneficial properties. In certain embodiments of the invention, substantially all of the nucleotides of the iRNA of the invention are modified. In other embodiments of the invention, all of the nucleotides of the iRNA of the invention are modified. The iRNA of the invention in which "substantially all of the nucleotides are modified" is mostly modified but not completely modified and may contain 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer, or 1 or fewer unmodified nucleotides.

[0276] The nucleic acids employed in the present invention can be synthesized and / or modified by methods well established in the art, such as those described in “Current protocols in nucleic acid chemistry,” Beaucage, S.L. et al. (Eds.), John Wiley & Sons, Inc., New York, NY, USA, which is incorporated herein by reference. Modifications include, for example, terminal modifications, such as 5′-terminal modifications (phosphorylation, conjugation, inverted linkage) or 3′-terminal modifications (conjugation, DNA nucleotides, inverted linkage, etc.); base modifications, such as substitution of a base with a stable base, an unstable base, or a base that base pairs with a wide range of partners, removal of a base (non-basic nucleotide), or conjugated base; sugar modifications (e.g., at the 2′- or 4′-position) or substitution of the sugar; and / or backbone modifications including modification or substitution of the phosphodiester bond. Specific examples of iRNA compounds useful in the embodiments described herein include, but are not limited to, RNAs that contain a modified backbone or do not contain natural internucleoside linkages. RNAs having a modified backbone include, in particular, those having no phosphorus atom in the backbone. For the purposes of the present specification, and as sometimes referred to in the art, modified RNAs having no phosphorus atom in the internucleoside backbone can also be considered oligonucleosides. In certain embodiments, the modified iRNA has a phosphorus atom in its internucleoside backbone.

[0277] Modified RNA backbones include, for example, phosphorothioate, chiral phosphorothioate, phosphorodithioate, phosphotriester, aminoalkyl phosphotriester, methylphosphonate and other alkylphosphonates including 3'-alkylene phosphonate and chiral phosphonate, phosphinate, phosphoramidate including 3'-aminophosphoramidate and aminoalkyl phosphoramidate, thionophosphoramidate, thionoalkylphosphonate, thionoalkylphosphotriester, and boranophosphate having a normal 3'-5' linkage, their 2'-5' linkage analogs, and those having an inverted polarity in which adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Also included are various salts, mixed salts and free acid forms.

[0278] Representative U.S. patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Patent No. 3,687,808; No. 4,469,863; No. 4,476,301; No. 5,023,243; No. 5,177,195; No. 5,188,897; No. 5,264,423; No. 5,276,019; No. 5,278,302; No. 5,286,717; No. 5,321,131; No. 5,399,676; No. 5,405,939; No. 5,453,496; No. 5,455,233; No. 5,466,677; No. 5,476,925; No. 5,519,126; No. 5,536,821; No. 5,541,316; No. 5,550,111; No. 5,563,253; No. 5,571,799; No. 5,587,361; No. 5,625,050; No. 6,028,188; No. 6,124,445; No. 6,160,109; No. 6,169,170; No. 6,172,209; No. 6,239,265; No. 6,277,603; No. 6,326,199; No. 6,346,614; No. 6,444,423; No. 6,531,590; No. 6,534,639; No. 6,608,035; No. 6,683,167; No. 6,858,715; No. 6,867,294; No. 6,878,805; No. 7,015,315; No. 7,041,816; No. 7,273,933; No. 7,321,029; and U.S. Reissue Patent No. RE39464, the entire contents of each of which are hereby incorporated by reference into this specification.

[0279] Modified RNA backbones that do not contain phosphorus atoms internally have a backbone formed by short-chain alkyl or cycloalkyl nucleoside linkages, mixed heteroatom and alkyl or cycloalkyl nucleoside linkages, or one or more short-chain heteroatom or heterocyclic nucleoside linkages. These include those having a morpholino linkage (partially formed from the sugar moiety of the nucleoside); a siloxane backbone; sulfide, sulfoxide, and sulfone backbones; formacetyl and thioformacetyl backbones; methyleneformacetyl and thioformacetyl backbones; alkene-containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having a mixed N, O, S, and CH2 component moiety.

[0280] Representative U.S. patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Patent Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, the entire contents of each of which are incorporated herein by reference.

[0281] In other embodiments, suitable RNA mimetics are contemplated for use in iRNA, where both the sugar and the internucleoside linkages, i.e., the backbone of the nucleotide units, are replaced with novel groups. The base units are maintained for hybridization with a suitable nucleic acid target compound. One such oligomeric compound that has been shown to have excellent hybridization properties is called a peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of RNA is replaced with an amide-containing backbone, specifically, an aminoethylglycine backbone. The nucleobases are retained and are attached directly or indirectly to the azanitrogen atoms of the amide portions of the backbone. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082; 5,714,331; and 5,719,262, the entire contents of each of which are incorporated herein by reference. Further PNA compounds suitable for use in the iRNA of the present invention are described, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.

[0282] Certain embodiments encompassed by the present invention include RNAs having phosphorothioate backbones and oligonucleosides having heteroatom backbones, particularly, the --CH2--NH--CH2--, --CH2--N(CH3)--O--CH2-- [known as the methylene(methylimino) or MMI backbone], --CH2--O--N(CH3)--CH2--, --CH2--N(CH3)--N(CH3)--CH2-- and --N(CH3)--CH2--CH2-- of U.S. Patent No. 5,489,677 described above [wherein the native phosphodiester backbone is represented as --O--P--O--CH2--], and the amide backbone of U.S. Patent No. 5,602,240 described above. In certain embodiments, the RNAs encompassed herein have the morpholino backbone structure of U.S. Patent No. 5,034,506 described above.

[0283] Modified RNAs can also contain one or more substituted sugar moieties. The iRNAs taken up herein, for example, dsRNAs, can contain at the 2'-position one of OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, where alkyl, alkenyl and alkynyl are substituted or unsubstituted C1-C 10 alkyl or C2-C 10 alkenyl and alkynyl. Exemplary suitable modifications include O[(CH2) n O] m CH3, O(CH2). n OCH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n ONH2, and O(CH2) n ON[(CH2) n CH3)]2, where n and m are from 1 to about 10. In other embodiments, the dsRNA is at the 2'-position C1-C 10It contains one of lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, RNA cleavage group, reporter group, intercalator, a group that improves the pharmacodynamic properties of iRNA, or a group that improves the pharmacokinetic properties of iRNA, and other substituents having similar properties. In certain embodiments, the modification is 2'-methoxyethoxy (2'-O-(2-methoxyethyl) or 2'-MOE as it is also known, 2'-O--CH2CH2OCH3) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504), i.e., it contains an alkoxy-alkoxy group. Another exemplary modification is 2'-dimethylaminooxyethoxy, also known as 2'-DMAOE herein, i.e., the O(CH2)2ON(CH3)2 group, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethyl or 2'-DMAEOE), i.e., 2'-O--CH2--O--CH2--N(CH2)2, as described in the examples below.

[0284] Other modifications include 2'-methoxy (2'-OCH3), 2'-aminopropoxy (2'-OCH2CH2CH2NH2), and 2'-fluoro (2'-F). Similar modifications can also be made at other positions in the RNA of the iRNA, particularly at the 3'-terminal nucleotide or at the 3'-position of the sugar in a 2'-5'-linked dsRNA and at the 5'-position of the 5'-terminal nucleotide. The iRNA can also have a sugar mimic such as a cyclobutyl moiety instead of a pentofuranosyl sugar. Representative U.S. patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Patent Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, some of which are owned by the same owner as the present application. The entire contents of each of the above are hereby incorporated by reference into this specification.

[0285] iRNAs can also include nucleobase (often simply referred to as "base" in the art) modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nucleobases include deoxy-thymine (dT), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine (daazaadenine), and other synthetic and natural nucleobases such as 3-deazaguanine and 3-deazaadenine.Additional nucleobases include those disclosed in U.S. Patent No. 3,687,808; those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008; those disclosed in Concise Encyclopedia Of Polymer Science and Engineering, pp. 858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990; those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; and those disclosed by Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pp. 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993. Some of these nucleobases are particularly useful for enhancing the binding affinity of the oligomeric compounds taken up in the present invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O- substitute purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. The 5-methylcytosine substituent has been shown to increase nucleic acid duplex stability by 0.6 to 1.2 °C (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., dsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278), which is an exemplary base substitution, especially when combined with a 2'-O-methoxyethyl sugar modification.

[0286] Representative U.S. patents that teach some preparations of the above-mentioned modified nucleobases as well as some other modified nucleobases include, but are not limited to, the above-mentioned U.S. Patent No. 3,687,808; No. 4,845,205; No. 5,130,30; 5,134,066; No. 5,175,273; No. 5,367,066; No. 5,432,272; 5,457,187; No. 5,459,255; No. 5,484,908; No. 5,502,177; No. 5,525,711; No. 5,552,540; No. 5,587,469; No. 5,594,121; No. 5,596,091; No. 5,614,617; No. 5,681,941; No. 5,750,692; No. 6,015,886; No. 6,147,200; No. 6,166,197; No. 6,222,025; No. 6,235,887; No. 6,380,368; No. 6,528,640; No. 6,639,062; No. 6,617,438; No. 7,045,610; No. 7,427,672; and No. 7,495,088, the entire contents of each of which are hereby incorporated by reference into this specification.

[0287] The RNA of the iRNA can also be modified to include one or more locked nucleic acids (LNAs). A locked nucleic acid is a nucleotide having a modified ribose moiety, which ribose moiety includes an additional bridge connecting the 2' and 4' carbons. This structure effectively "locks" the ribose in the 3'-endo conformational configuration. Adding locked nucleic acids to siRNA has been shown to increase siRNA stability in serum and reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, O.R. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193).

[0288] Exemplary U.S. patents that teach the preparation of locked nucleic acid nucleotides include, but are not limited to, U.S. Patent Nos. 6,268,490; 6,670,461; 6,794,499; 6,998,484; 7,053,207; 7,084,125; and 7,399,845, the entire contents of each of which are incorporated herein by reference.

[0289] Potentially stabilizing modifications to the termini of RNA molecules can include N-(acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2'-O-deoxythymidine (ether), N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3”-phosphate, inverted base dT (idT), and the like. The disclosure of this modification can be found in PCT Publication No. WO 2011 / 005861 pamphlet.

[0290] A. Modified iRNA Containing the Motif of the Present Invention In certain embodiments of the present invention, the double-stranded RNAi agents of the present invention include, for example, agents having chemical modifications disclosed in U.S. Provisional Patent Application No. 61 / 561,710, filed on November 18, 2011, or PCT Publication No. WO 2010 / 065691, filed on November 16, 2012, the entire contents of each of which are incorporated herein by reference in their entirety.

[0291] As shown herein and in U.S. Provisional Patent Application No. 61 / 561,710 or PCT Application No. PCT / US2010 / 065691, better results are obtained by introducing one or more motifs of three identical modifications on three consecutive nucleotides in the sense strand and / or the antisense strand of the RNAi agent, particularly at or near the cleavage site. In certain embodiments, the sense strand and the antisense strand of the RNAi agent can alternatively be fully modified. Introduction of these motifs disrupts the modification pattern of the sense strand and / or the antisense strand, if present. The RNAi agent can be optionally conjugated, for example, on the sense strand, with a GalNAc derivative ligand. The resulting RNAi agent exhibits better gene silencing activity.

[0292] More specifically, it has been unexpectedly discovered that when the sense strand and the antisense strand of the double-stranded RNAi agent are fully modified to have one or more motifs of three identical modifications on three consecutive nucleotides at or near the cleavage site of at least one strand of the RNAi agent, the gene silencing activity of the RNAi agent is significantly improved.

[0293] Accordingly, the present invention provides a double-stranded RNAi agent capable of inhibiting the expression of a target gene (i.e., the complement component C5 (C5) gene) in vivo. The RNAi agent includes a sense strand and an antisense strand. Each strand of the RNAi agent can be in the range of 12 to 30 nucleotides in length. For example, each strand can be 14 to 30 nucleotides in length, 17 to 30 nucleotides in length, 25 to 30 nucleotides in length, 27 to 30 nucleotides in length, 17 to 23 nucleotides in length, 17 to 21 nucleotides in length, 17 to 19 nucleotides in length, 19 to 25 nucleotides in length, 19 to 23 nucleotides in length, 19 to 21 nucleotides in length, 21 to 25 nucleotides in length, or 21 to 23 nucleotides in length.

[0294] The sense strand and the antisense strand typically form a double-stranded RNA (dsRNA), also referred to herein as an "RNAi agent". The double-stranded region of the RNAi agent can be 12 to 30 nucleotide pairs in length. For example, the double-stranded region can be 14 to 30 nucleotide pairs in length, 17 to 30 nucleotide pairs in length, 27 to 30 nucleotide pairs in length, 17 to 23 nucleotide pairs in length, 17 to 21 nucleotide pairs in length, 17 to 19 nucleotide pairs in length, 19 to 25 nucleotide pairs in length, 19 to 23 nucleotide pairs in length, 19 to 21 nucleotide pairs in length, 21 to 25 nucleotide pairs in length, or 21 to 23 nucleotide pairs in length. In another example, the double-stranded region is selected from 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27 nucleotides in length.

[0295] In one embodiment, the RNAi agent may include one or more overhang regions and / or capping groups at the 3'-end, 5'-end, or both ends of one or both strands. The overhang may be 1 to 6 nucleotides in length, for example, 2 to 6 nucleotides in length, 1 to 5 nucleotides in length, 2 to 5 nucleotides in length, 1 to 4 nucleotides in length, 2 to 4 nucleotides in length, 1 to 3 nucleotides in length, 2 to 3 nucleotides in length, or 1 to 2 nucleotides in length. The overhang may be the result of one strand being longer than the other, or the result of two strands of the same length being staggered. The overhang may form a mismatch with the target mRNA, or the overhang may be complementary to the targeted gene sequence, or it may be another sequence. The first and second strands may also be joined by additional bases, for example, to form a hairpin, or by other non-base linkers.

[0296] In one embodiment, each of the nucleotides in the overhang region of the RNAi agent may independently be a modified or unmodified nucleotide including a 2'-sugar modification such as, but not limited to, 2'-F, 2'-O-methyl, thymidine (T), 2'-O-methoxyethyl-5-methyluridine (Teo), 2'-O-methoxyethyladenosine (Aeo), 2'-O-methoxyethyl-5-methylcytidine (m5Ceo), and any combination thereof. For example, TT may be an overhang sequence for either end on either strand. The overhang may form a mismatch with the target mRNA, or the overhang may be complementary to the targeted gene sequence, or it may be another sequence.

[0297] The 5'- or 3'-overhangs in the sense strand, antisense strand, or both strands of the RNAi agent can be phosphorylated. In certain embodiments, the overhang region comprises two nucleotides having a phosphorothioate between two nucleotides, where the two nucleotides can be the same or different. In one embodiment, the overhang is present at the 3'-end of the sense strand, antisense strand, or both strands. In one embodiment, this 3'-overhang is present in the antisense strand. In one embodiment, this 3'-overhang is present in the sense strand.

[0298] The RNAi agent can contain only one overhang that can enhance the interfering activity of RNAi without affecting its overall stability. For example, a single-stranded overhang can be located at the 3'-end of the sense strand or the 3'-end of the antisense strand. RNAi can also have blunt ends located at the 5'-end of the antisense strand (or the 3'-end of the sense strand) or vice versa. Generally, the antisense strand of RNAi has a nucleotide overhang at the 3'-end and a blunt 5'-end. Without wishing to be bound by theory, the asymmetric blunt ends at the 5'-end and the 3'-end overhang of the antisense strand can advantageously act in guiding strand introduction into the RISC process.

[0299] In one embodiment, the RNAi agent is a 19-nucleotide-long double-ended bluntmer, and the sense strand contains at least one motif of three 2'-F modifications in three consecutive nucleotides at positions 7, 8, and 9 from the 5'-end. The antisense strand contains at least one motif of three 2'-O-methyl modifications in three consecutive nucleotides at positions 11, 12, and 13 from the 5'-end.

[0300] In another embodiment, the RNAi agent is a blunt-ended double-strand of 20 nucleotides in length, and the sense strand contains at least one motif of three 2'-F modifications in three consecutive nucleotides at positions 8, 9, and 10 from the 5' end. The antisense strand contains at least one motif of three 2'-O-methyl modifications in three consecutive nucleotides at positions 11, 12, and 13 from the 5' end.

[0301] In yet another embodiment, the RNAi agent is a blunt-ended double-strand of 21 nucleotides in length, and the sense strand contains at least one motif of three 2'-F modifications in three consecutive nucleotides at positions 9, 10, and 11 from the 5' end. The antisense strand contains at least one motif of three 2'-O-methyl modifications in three consecutive nucleotides at positions 11, 12, and 13 from the 5' end.

[0302] In one embodiment, the RNAi agent comprises a 21-nucleotide sense strand and a 23-nucleotide antisense strand. The sense strand contains at least one motif of three 2'-F modifications in three consecutive nucleotides at positions 9, 10, and 11 from the 5'-end; the antisense strand contains at least one motif of three 2'-O-methyl modifications in three consecutive nucleotides at positions 11, 12, and 13 from the 5'-end. One end of the RNAi agent is blunt, while the other end contains a two-nucleotide overhang. Preferably, the two-nucleotide overhang is at the 3'-end of the antisense strand. When the two-nucleotide overhang is at the 3'-end of the antisense strand, there may be two phosphorothioate internucleotide linkages between the three terminal nucleotides, two of the three nucleotides being overhang nucleotides and the third nucleotide being the paired nucleotide adjacent to the overhang nucleotide. In one embodiment, the RNAi agent further has two phosphorothioate internucleotide linkages between the three terminal nucleotides at both the 5'-end of the sense strand and the 5'-end of the antisense strand. In one embodiment, all nucleotides in the sense and antisense strands of the RNAi agent, including the nucleotides that are part of the motif, are modified nucleotides. In one embodiment, each residue is independently modified with, for example, 2'-O-methyl or 3'-fluoro in an alternating motif. Optionally, the RNAi agent further comprises a ligand (preferably, GalNAc3).

[0303] In one embodiment, the RNAi agent comprises a sense strand and an antisense strand. The sense strand is 25 to 30 nucleotide residues in length. Starting from the 5'-terminal nucleotide (position 1), positions 1 to 23 of the first strand contain at least 8 ribonucleotides. The antisense strand is 36 to 66 nucleotide residues in length. Starting from the 3'-terminal nucleotide, it contains at least 8 ribonucleotides at positions paired with positions 1 to 23 of the sense strand to form a double strand. At least the 3'-terminal nucleotides of the antisense strand are not paired with the sense strand, and a maximum of 6 consecutive 3'-terminal nucleotides are not paired with the sense strand, thereby forming a 3'-single-stranded overhang of 1 to 6 nucleotides. The 5'-terminal of the antisense strand contains 10 to 30 consecutive nucleotides not paired with the sense strand, thereby forming a single-stranded 5'-overhang of 10 to 30 nucleotides. At least the 5'-terminal and 3'-terminal nucleotides of the sense strand are bases paired with the nucleotides of the antisense strand when the sense strand and the antisense strand are aligned for maximum complementarity, thereby forming a substantially double-stranded region between the sense strand and the antisense strand. The antisense strand is sufficiently complementary to the target RNA along at least 19 ribonucleotides of the antisense strand length so as to reduce the expression of the target gene when the double-stranded nucleic acid is introduced into mammalian cells. The sense strand contains at least one motif of three 2'-F modifications in three consecutive nucleotides, wherein at least one of the motifs is present at or near the cleavage site. The antisense strand contains at least one motif of three 2'-O-methyl modifications in three consecutive nucleotides at or near the cleavage site.

[0304] In one embodiment, the RNAi agent comprises a sense strand and an antisense strand, the RNAi agent comprising a first strand having a nucleotide length of at least 25 and 29 or less, and a second strand having a length of 30 nucleotides or less, the second strand comprising at least one motif of three 2'-O-methyl modifications at three consecutive nucleotides at positions 11, 12, and 13 from the 5' end; the 3' end of the first strand and the 5' end of the second strand form blunt ends, the second strand is 1 to 4 nucleotides longer than the first strand at its 3' end, the double-stranded region is at least 25 nucleotides long, and the second strand is sufficiently complementary to the target mRNA along at least 19 nucleotides of the second strand length such that when the RNAi agent is introduced into mammalian cells, it reduces the expression of the target gene. The RNAi agent preferentially yields an siRNA comprising the 3' end of the second strand upon dicer cleavage of the RNAi agent, thereby reducing the expression of the target gene in mammals. Optionally, the RNAi agent further comprises a ligand.

[0305] In one embodiment, the sense strand of the RNAi agent comprises at least one motif of three identical modifications at three consecutive nucleotides, and one of the motifs is present at the cleavage site of the sense strand.

[0306] In one embodiment, the antisense strand of the RNAi agent can also comprise at least one motif of three identical modifications at three consecutive nucleotides, and one of the motifs is present at or near the cleavage site of the antisense strand.

[0307] In an RNAi agent having a double-stranded region with a length of 17 to 23 nucleotides, the cleavage site of the antisense strand is typically near the 10th, 11th, and 12th positions from the 5' end. Thus, the three identical modified motifs can start counting from the first nucleotide from the 5' end of the antisense strand, or from the first paired nucleotide within the double-stranded region from the 5' end of the antisense strand, and can be present at the 9th, 10th, 11th positions; 10th, 11th, 12th positions; 11th, 12th, 13th positions; 12th, 13th, 14th positions; or 13th, 14th, 15th positions of the antisense strand. The cleavage site in the antisense strand can also vary depending on the length of the double-stranded region of the RNAi from the 5' end.

[0308] The sense strand of the RNAi agent may contain at least one motif of three identical modifications in three consecutive nucleotides at the cleavage site of the strand; the antisense strand may have at least one motif of three identical modifications in three consecutive nucleotides at or near the cleavage site of the strand. When the sense strand and the antisense strand form a dsRNA double strand, the sense strand and the antisense strand can be aligned such that one motif of three nucleotides in the sense strand and one motif of three nucleotides in the antisense strand have at least one nucleotide overlap, that is, at least one of the three nucleotides of the motif in the sense strand forms a base pair with at least one of the three nucleotides of the motif in the antisense strand. Alternatively, at least two nucleotides may overlap, or all three nucleotides may overlap.

[0309] In one embodiment, the sense strand of the RNAi agent may include two or more motifs of three identical modifications in three consecutive nucleotides. The first motif may be present at or near the cleavage site of the strand, and the other motifs may be wing modifications. As used herein, the term "wing modification" refers to a motif present in another part of the strand away from the motif at or near the cleavage site of the same strand. The wing modification is adjacent to the first motif or separated by at least one or more nucleotides. When the motifs are directly adjacent to each other, the chemical structures of the motifs are different from each other. When the motifs are separated by one or more nucleotides, the chemical structures may be the same or different. Two or more wing modifications may be present. For example, when two wing modifications are present, each wing modification may be present at one end with respect to the first motif at or near the cleavage site or on either side of the lead motif.

[0310] Similar to the sense strand, the antisense strand of the RNAi agent may also include two or more motifs of three identical modifications in three consecutive nucleotides, and at least one of the motifs is present at or near the cleavage site of the strand. This antisense strand may also include one or more wing modifications in a sequence similar to the wing modifications that may be present in the sense strand.

[0311] In one embodiment, the wing modification in the sense strand or antisense strand of the RNAi agent typically does not include the first one or two terminal nucleotides at the 3' end, 5' end, or both ends of the strand.

[0312] In another embodiment, the wing modification in the sense strand or antisense strand of the RNAi agent typically does not include the first one or two paired nucleotides within the double-stranded region at the 3' end, 5' end, or both ends of the strand.

[0313] When the sense strand and the antisense strand of the RNAi agent each contain at least one wing modification, the wing modifications may be located at the same end of the double-stranded region and may have an overlap of 1, 2, or 3 nucleotides.

[0314] When the sense strand and the antisense strand of the RNAi agent each contain at least two wing modifications, the sense strand and the antisense strand may be such that two modifications from one strand are each located at one end of the double-stranded region and have an overlap of 1, 2, or 3 nucleotides; two modifications from one strand are each located at the other end of the double-stranded region and have an overlap of 1, 2, or 3 nucleotides; and two modifications from one strand are located on each side of the lead motif and may be aligned to have an overlap of 1, 2, or 3 nucleotides in the double-stranded region.

[0315] In one embodiment, all nucleotides in the sense strand and the antisense strand of the RNAi agent, including nucleotides that are part of the motif, may be modified. Each nucleotide may be modified with the same or different modifications, which may include one or more changes to one or both of the non-bridging phosphate oxygen and / or the bridging phosphate oxygen; changes to the ribose sugar component, such as the 2'-hydroxyl of the ribose sugar; large-scale substitution of the phosphate moiety with a "dephospho" linker; modification or substitution of natural bases; and substitution or modification of the ribose-phosphate backbone.

[0316] Because nucleic acids are polymers of subunits, many modifications, such as modifications of bases, or phosphate moieties, or non-bridging O of phosphate moieties, are present at repeated positions within the nucleic acid. In some cases, the modification may be present at all of the desired positions in the nucleic acid, but often it is not. As an example, the modification may be present only at the 3' or 5' terminal positions, or only in the terminal region, such as at a position on the terminal nucleotide or only on the last 2, 3, 4, 5, or 10 nucleotides of the strand. The modification may be present in double-stranded regions, single-stranded regions, or both. The modification may be present only in the double-stranded regions of RNA, or only in the single-stranded regions of RNA. For example, phosphorothioate modifications at non-bridging O positions may be present only at one or both ends, or only in the terminal region, such as at a position on the terminal nucleotide or only on the last 2, 3, 4, 5, or 10 nucleotides of the strand, or may be present in double-stranded and single-stranded regions, particularly at the ends. The 5' end or both ends may be phosphorylated.

[0317] For example, it may be possible to enhance stability, include specific bases in the overhang, or include modified nucleotides or nucleotide surrogates in single-stranded overhangs, such as 5' or 3' overhangs, or both. For example, it may be desirable to include purine nucleotides in the overhang. In certain embodiments, all or some of the bases in the 3' or 5' overhang may be modified, for example, with the modifications described herein. Modifications can include, for example, the use of modifications at the 2' position of ribose sugars by modifications known in the art, such as the use of deoxyribonucleotides, 2'-deoxy-2'-fluoro (2'-F) or 2'-O-methyl modifications instead of ribose sugars of nucleobases, and modifications of phosphate groups, such as phosphorothioate modifications. The overhang need not be homologous to the target sequence.

[0318] In one embodiment, each residue of the sense strand and the antisense strand is independently modified with LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-deoxy, 2'-hydroxyl, or 2'-fluoro. The strand may contain two or more modifications. In one embodiment, each residue of the sense strand and the antisense strand is independently modified with 2'-O-methyl or 2'-fluoro.

[0319] Typically, at least two different modifications are present in the sense strand and the antisense strand. Those two modifications can be 2'-O-methyl or 2'-fluoro modifications, or others.

[0320] In one embodiment, N a and / or N b contains an alternating pattern of modifications. As used herein, the term "alternating motif" refers to a motif having one or more modifications, where each modification is present at alternating nucleotides of one strand. Alternating nucleotides can refer to every other nucleotide, every third nucleotide, or a similar pattern. For example, if A, B, and C each represent one type of modification to a nucleotide, the alternating motif can be "ABABABABABAB···", "AABBAABBAABB···", "AABAABAABAAB···", "AAABAAABAAAB···", "AAABBBAAABBB···", or "ABCABCABCABC···", etc.

[0321] The types of modifications included in the alternating motif can be the same or different. For example, if A, B, C, and D each represent one type of modification on a nucleotide, the alternating pattern, i.e., the modification at every other nucleotide, may be the same, but each of the sense strand or the antisense strand can be selected from several possibilities of modifications within an alternating motif such as "ABABAB···", "ACACAC···", "BDBDBD···", or "CDCDCD···".

[0322] In one embodiment, the RNAi agent of the present invention includes a modified pattern of alternating motifs in the sense strand that is shifted relative to the modified pattern of alternating motifs in the antisense strand. This shift can be such that the modified groups of the nucleotides of the sense strand correspond to different modified groups of the nucleotides of the antisense strand, or vice versa. For example, when the sense strand is paired with the antisense strand in the dsRNA duplex, the alternating motif in the sense strand may start from "ABABAB" from the 5' to 3' of the strand, and the alternating motif in the antisense strand may start from "BABABA" from the 5' to 3' of the strand within the duplex region. As another example, the alternating motif in the sense strand may start from "AABBAABB" from the 5' to 3' of the strand, and the alternating motif in the antisense strand may start from "BBAABBAA" from the 5' to 3' of the strand within the duplex region, thereby having a complete or partial shift in the modified pattern between the sense strand and the antisense strand.

[0323] In one embodiment, the RNAi agent includes a pattern of alternating motifs of 2'-O-methyl modification and 2'-F modification in the sense strand, and this pattern has a shift relative to the pattern of alternating motifs of 2'-O-methyl modification and 2'-F modification in the antisense strand first, that is, the 2'-O-methyl modified nucleotides in the sense strand form base pairs with the 2'-F modified nucleotides in the antisense strand, and vice versa. The first position of the sense strand may start with a 2'-F modification, and the first position of the antisense strand may start with a 2'-O-methyl modification.

[0324] The introduction of one or more motifs of three identical modifications on three consecutive nucleotides into the sense strand and / or the antisense strand interrupts the first modified pattern present in the sense strand and / or the antisense strand. This interruption of the modified pattern of the sense strand and / or the antisense strand by introducing one or more motifs of three identical modifications on three consecutive nucleotides unexpectedly enhances the gene silencing activity against the target gene.

[0325] In one embodiment, when a motif of three identical modifications on three consecutive nucleotides is introduced into either strand, the modification of the nucleotide adjacent to the motif is a modification different from the modification of the motif. For example, a part of the sequence containing the motif is "···N a YYYN b ···", where "Y" represents the modification of the motif of three identical modifications in three consecutive nucleotides, and "N a " and "N b " represent the modifications of the nucleotides adjacent to the motif "YYY" that are different from the modification of Y, and N a and N b can be the same or different modifications. Alternatively, N a and / or N b may or may not be present when a wing modification is present.

[0326] The RNAi agent may further include at least one phosphorothioate or methylphosphonate nucleotide internucleotide linkage. Modifications of the phosphorothioate or methylphosphonate nucleotide internucleotide linkages may be present in any nucleotide of the sense strand, the antisense strand, or both strands at any position of the strand. For example, the modification of the internucleotide linkage may be present in all nucleotides in the sense strand and / or the antisense strand; the modification of each internucleotide linkage may be present in an alternating pattern in the sense strand and / or the antisense strand; or the sense strand or the antisense strand may include modifications of both internucleotide linkages in an alternating pattern. The alternating pattern of the modification of the internucleotide linkage in the sense strand may be the same as or different from that in the antisense strand, and the alternating pattern of the modification of the internucleotide linkage in the sense strand may have a shift relative to the alternating pattern of the modification of the internucleotide linkage in the antisense strand. In one embodiment, the double-stranded RNAi agent includes 6 to 8 phosphorothioate nucleotide internucleotide linkages. In one embodiment, the antisense strand includes two phosphorothioate nucleotide internucleotide linkages at the 5' end and two phosphorothioate nucleotide internucleotide linkages at the 3' end, and the sense strand includes at least two phosphorothioate nucleotide internucleotide linkages at the 5' end or the 3' end.

[0327] In one embodiment, the RNAi includes a modification of phosphorothioate or methylphosphonate nucleotide linkages in the overhang region. For example, the overhang region may include two nucleotides having a phosphorothioate or methylphosphonate nucleotide linkage between two nucleotides. The modification of the nucleotide linkage may also be formed to bind the overhang nucleotide to the paired nucleotide at the end within the double-stranded region. For example, at least 2, 3, 4, or all of the overhang nucleotides may be linked by phosphorothioate or methylphosphonate nucleotide linkages, and optionally, there may be additional phosphorothioate or methylphosphonate nucleotide linkages that bind the overhang nucleotide to the paired nucleotide adjacent to the overhang nucleotide. For example, there may be at least two phosphorothioate nucleotide linkages between the three terminal nucleotides, two of the three nucleotides being overhang nucleotides and the third nucleotide being a paired nucleotide adjacent to the overhang nucleotide. These three terminal nucleotides may be present at the 3' end of the antisense strand, the 3' end of the sense strand, the 5' end of the antisense strand, and / or the 5' end of the antisense strand.

[0328] In one embodiment, the two-nucleotide overhang is at the 3' end of the antisense strand, there are two phosphorothioate nucleotide linkages between the three terminal nucleotides, two of the three nucleotides being overhang nucleotides and the third nucleotide being a paired nucleotide adjacent to the overhang nucleotide. Optionally, the RNAi agent may further have two phosphorothioate nucleotide linkages between the three terminal nucleotides at both the 5' end of the sense strand and the 5' end of the antisense strand.

[0329] In one embodiment, the RNAi agent comprises a mismatch with the target, a mismatch within the double strand, or a combination thereof. The mismatch can occur in the overhang region or the double strand region. Base pairs can be evaluated based on their tendency to promote dissociation or melting (e.g., with respect to the free energy of binding or dissociation of a particular pairing, and the simplest approach is to examine the pairs individually, although similar or analogous analyses can also be used). With respect to promoting dissociation: A:U is preferred over G:C; G:U is preferred over G:C; I:C is preferred over G:C (I = inosine). Mismatches, e.g., non-canonical or non-standard pairings (described elsewhere herein), are preferred over canonical (A:T, A:U, G:C) pairings; pairings containing universal bases are preferred over canonical pairings.

[0330] In one embodiment, the RNAi agent comprises at least one of the first 1, 2, 3, 4, or 5 base pairs within the double strand region from the 5’ end of the antisense strand independently selected from the group of A:U, G:U, I:C, and a mismatch pair for promoting dissociation of the antisense strand at the 5’ end of the double strand, e.g., a non-canonical or non-standard pairing or a pairing containing a universal base.

[0331] In one embodiment, the nucleotide at position 1 within the double strand region from the 5’ end of the antisense strand is selected from the group consisting of A, dA, dU, U, and dT. Alternatively, at least one of the first 1, 2, or 3 base pairs within the double strand region from the 5’ end of the antisense strand is an AU base pair. For example, the first base pair within the double strand region from the 5’ end of the antisense strand is an AU base pair.

[0332] In another embodiment, the nucleotide at the 3’ end of the sense strand is deoxy-thymine (dT). In another embodiment, the nucleotide at the 3’ end of the antisense strand is deoxy-thymine (dT). In one embodiment, there is a short sequence of deoxy-thymine nucleotides, e.g., two dT nucleotides at the 3’ end of the sense strand and / or the antisense strand.

[0333] In one embodiment, the sense strand sequence has the formula (I): 5’n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3’(I) (wherein: i and j are each independently 0 or 1; p and q are each independently 0 to 6; each N a represents an oligonucleotide sequence containing 0 to 25 modified nucleotides, each sequence containing at least two different modified nucleotides; each N b represents an oligonucleotide sequence containing 0 to 10 modified nucleotides; each n p and n q each represent an overhang nucleotide; where Nb and Y do not have the same modification; XXX, YYY, and ZZZ each independently represent one motif of three identical modifications in a three - consecutive nucleotide) and may be represented by. Preferably, YYY are all 2’ - F modified nucleotides.

[0334] In one embodiment, N a and / or N b contains an alternating pattern of modifications.

[0335] In one embodiment, the YYY motif is present at or near the cleavage site of the sense strand. For example, when the RNAi agent has a double-stranded region 17 to 23 nucleotides in length, the YYY motif may be present at or near the cleavage site of the sense strand, starting from the first nucleotide from the 5' end; or optionally, starting from the first paired nucleotide within the double-stranded region from the 5' end (e.g., it may be present at positions 6, 7, 8, 7, 8, 9, 8, 9, 10, 9, 10, 11, 10, 11, 12, or 11, 12, 13).

[0336] In one embodiment, i is 1 and j is 0, or i is 0 and j is 1, or both i and j are 1. Accordingly, the sense strand may be represented by the following formula: 5’n p -N a -YYY-N b -ZZZ-N a -n q 3’(Ib); 5’n p -N a -XXX-N b -YYY-N a -n q 3’(Ic); or 5’n p -N a -XXX-N b -YYY-N b -ZZZ-N a -n q 3’(Id).

[0337] When the sense strand is represented by formula (Ib), N b represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. Each N a may independently represent an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0338] When the sense strand is represented as formula (Ic), N brepresents an oligonucleotide sequence containing modified nucleotides of 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0. Each N a may independently represent an oligonucleotide sequence containing modified nucleotides of 2 to 20, 2 to 15, or 2 to 10.

[0339] When the sense strand is represented by formula (Id), each N b may independently represent an oligonucleotide sequence containing modified nucleotides of 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0. Preferably, N b is 0, 1, 2, 3, 4, 5, or 6. Each N a may independently represent an oligonucleotide sequence containing modified nucleotides of 2 to 20, 2 to 15, or 2 to 10.

[0340] Each of X, Y, and Z may be the same as or different from each other.

[0341] In another embodiment, i is 0, j is 0, and the sense strand may be represented by the following formula: 5’n p -N a -YYY-N a -n q 3’(Ia).

[0342] When the sense strand is represented by formula (Ia), each N a may independently represent an oligonucleotide sequence containing modified nucleotides of 2 to 20, 2 to 15, or 2 to 10.

[0343] In one embodiment, the antisense strand sequence of RNAi is formula (II): 5’n q’ -N a ’-(Z’Z’Z’) k -N b ’-Y’Y’Y’-N b ’-(X’X’X’) l -N’ a -n p ’3’(II) (wherein: k and l are each independently 0 or 1; p’ and q’ are each independently from 0 to 6; each N a ’ represents an oligonucleotide sequence independently containing from 0 to 25 modified nucleotides, each sequence containing at least two different modified nucleotides; each N b ’ represents an oligonucleotide sequence independently containing from 0 to 10 modified nucleotides; each n p ’ and n q ’ each independently represent overhang nucleotides; wherein, N b ’ and Y’ do not have the same modification; X’X’X’, Y’Y’Y’ and Z’Z’Z’ each independently represent one motif of three identical modifications in three consecutive nucleotides) and can be represented by.

[0344] In one embodiment, N a ’ and / or N b ’ contains modifications in an alternating pattern.

[0345] The Y’Y’Y’ motif is present at or near the cleavage site of the antisense strand. For example, when the RNAi agent has a double-stranded region 17 to 23 nucleotides in length, the Y’Y’Y’ motif starts counting from the first nucleotide from the 5’ end; or optionally, starting from the 5’ end, from the first paired nucleotide within the double-stranded region, it can be present at positions 9, 10, 11; 10, 11, 12; 11, 12, 13; 12, 13, 14; or 13, 14, 15 of the antisense strand. Preferably, the Y’Y’Y’ motif is present at positions 11, 12, 13.

[0346] In one embodiment, the Y’Y’Y’ motif consists entirely of 2’-OMe modified nucleotides.

[0347] In one embodiment, k is 1, l is 0, or k is 0, l is 1, or both k and l are 1.

[0348] Therefore, the antisense strand can be represented by the following formula: 5’n q’ -N a ’-Z’Z’Z’-N b ’-Y’Y’Y’-N a ’-n p’ 3’(IIb); 5’n q’ -N a ’-Y’Y’Y’-N b ’-X’X’X’-n p’ 3’(IIc); or 5’n q’ -N a ’-Z’Z’Z’-N b ’-Y’Y’Y’-N b ’-X’X’X’-N a ’-n p’ 3’(IId).

[0349] When the antisense strand is represented by formula (IIb), N b ’ represents an oligonucleotide sequence containing modified nucleotides of 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0. Each N a ’ independently represents an oligonucleotide sequence containing modified nucleotides of 2 to 20, 2 to 15, or 2 to 10.

[0350] When the antisense strand is represented as formula (IIc), N b ’ represents an oligonucleotide sequence containing modified nucleotides of 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0. Each N a ’ independently represents an oligonucleotide sequence containing modified nucleotides of 2 to 20, 2 to 15, or 2 to 10.

[0351] When the antisense strand is represented as formula (IId), each N b’ independently represents an oligonucleotide sequence comprising modified nucleotides of 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0. Each N a ’ independently represents an oligonucleotide sequence comprising modified nucleotides of 2 to 20, 2 to 15, or 2 to 10. Preferably, N b is 0, 1, 2, 3, 4, 5, or 6.

[0352] In other embodiments, k is 0, l is 0, and the antisense strand can be represented by the following formula: 5’n p’ -N a’ -Y’Y’Y’-N a’ -n q’ 3’(Ia).

[0353] When the antisense strand is represented as formula (IIa), each N a ’ independently represents an oligonucleotide sequence comprising modified nucleotides of 2 to 20, 2 to 15, or 2 to 10.

[0354] Each of X’, Y’, and Z’ can be the same as or different from each other.

[0355] Each nucleotide of the sense strand and the antisense strand can be independently modified with LNA, HNA, CeNA, 2’-methoxyethyl, 2’-O-methyl, 2’-O-allyl, 2’-C-allyl, 2’-hydroxyl, or 2’-fluoro. For example, each nucleotide of the sense strand and the antisense strand is independently modified with 2’-O-methyl or 2’-fluoro. Each X, Y, Z, X’, Y’, and Z’ can in particular represent a 2’-O-methyl modification or a 2’-fluoro modification.

[0356] In one embodiment, for the sense strand of the RNAi agent, when the double-stranded region is 21 nucleotides, starting from the first nucleotide from the 5'-end; or optionally, starting from the 5'-end, starting from the first paired nucleotide within the double-stranded region, it may contain the YYY motif present at positions 9, 10, and 11 of the strand; Y represents a 2'-F modification. The sense strand may further contain an XXX motif or a ZZZ motif as a wing modification at the terminal opposite to the double-stranded region; XXX and ZZZ each independently represent a 2'-OMe modification or a 2'-F modification.

[0357] In one embodiment, for the antisense strand, starting from the first nucleotide from the 5'-end; or optionally, starting from the 5'-end, starting from the first paired nucleotide within the double-stranded region, it may contain the Y'Y'Y' motif present at positions 11, 12, and 13 of the strand; Y' represents a 2'-O-methyl modification. The antisense strand may further contain an X'X'X' motif or a Z'Z'Z' motif as a wing modification at the terminal opposite to the double-stranded region; X'X'X' and Z'Z'Z' each independently represent a 2'-OMe modification or a 2'-F modification.

[0358] Each of the sense strands represented by any one of the above formulas (Ia), (Ib), (Ic), and (Id) forms a double strand with an antisense strand represented by any one of the formulas (IIa), (IIb), (IIc), and (IId).

[0359] Therefore, the RNAi agent for use in the method of the present invention may contain a sense strand and an antisense strand, each strand having 14 to 30 nucleotides, and the RNAi double strand has the formula (III): Sense: 5’n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3’ Antisense: 3’n p’ -N a ’ -(X’X’X’) k -N b ’ -Y’Y’Y’-N b ’ -(Z’Z’Z’) l -N a ’ -n q ’ 5’ (III) (wherein: i, j, k, and l are each independently 0 or 1; p, p’, q, and q’ are each independently 0 to 6; each N a and N a ’ represents an oligonucleotide sequence containing 0 to 25 modified nucleotides, and each sequence contains at least two different modified nucleotides; each N b and N b ’ represents an oligonucleotide sequence containing 0 to 10 modified nucleotides; here, each n, which may or may not exist, p ’, n p , n q ’, and n q independently represents an overhang nucleotide; XXX, YYY, ZZZ, X’X’X’, Y’Y’Y’, and Z’Z’Z’ each independently represent one motif of three identical modifications on three consecutive nucleotides) is represented by

[0360] In one embodiment, i is 0 and j is 0; or i is 1 and j is 0; or i is 0 and j is 1; or both i and j are 0; or both i and j are 1. In another embodiment, k is 0 and l is 0; or k is 1 and l is 0; k is 0 and l is 1; or both k and l are 0; or both k and l are 1.

[0361] Exemplary combinations of the sense and antisense strands forming the RNAi duplex include the following formula: 5’n p -N a -YYY-N a -n q 3’ 3’n p ’ -N a ’ -Y’Y’Y’-N a ’ n q ’ 5’ (IIIa) 5’n p -N a -YYY-N b -ZZZ-N a -n q 3’ 3’n p ’ -N a ’ -Y’Y’Y’-N b ’ -Z’Z’Z’-N a ’ n q ’ 5’ (IIIb) 5’n p -N a -XXX-N b -YYY-N a -n q 3’ 3’n p ’ -N a ’ -X’X’X’-N b ’ -Y’Y’Y’-N a’ -n q ’ 5' (IIIc) 5'n p -N a -XXX-N b -YYY-N b -ZZZ-N a -n q 3' 3'n p ’ -N a ’ -X’X’X’-N b ’ -Y’Y’Y’-N b ’ -Z’Z’Z’-N a -n q ’ 5' (IIId)

[0362] When the RNAi agent is represented by formula (IIIa), each N a independently represents an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0363] When the RNAi agent is represented by formula (IIIb), each N b independently represents an oligonucleotide sequence containing 1 to 10, 1 to 7, 1 to 5, or 1 to 4 modified nucleotides. Each N a independently represents an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0364] When the RNAi agent is represented by formula (IIIc), each N b and N b ' independently represent an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. Each N a independently represents an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0365] When the RNAi agent is represented by formula (IIId), each N b and N b ’ independently represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. Each N a and N a ’ independently represents an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides. N a and N a ’ and N b and N b ’ each independently contains modifications in an alternating pattern.

[0366] Each of X, Y, and Z in formulas (III), (IIIa), (IIIb), (IIIc), and (IIId) can be the same as or different from each other.

[0367] When the RNAi agent is represented by formulas (III), (IIIa), (IIIb), (IIIc), and (IIId), at least one of the Y nucleotides can form a base pair with one of the Y’ nucleotides. Alternatively, at least two of the Y nucleotides can form base pairs with the corresponding Y’ nucleotides; or all three of the Y nucleotides can all form base pairs with the corresponding Y’ nucleotides.

[0368] When the RNAi agent is represented by formula (IIIb) or (IIId), at least one of the Z nucleotides can form a base pair with one of the Z’ nucleotides. Alternatively, at least two of the Z nucleotides can form base pairs with the corresponding Z’ nucleotides; or all three of the Z nucleotides can all form base pairs with the corresponding Z’ nucleotides.

[0369] When the RNAi agent is represented by formula (IIIc) or (IIId), at least one of the X nucleotides can form a base pair with one of the X' nucleotides. Alternatively, at least two of the X nucleotides form base pairs with the corresponding X' nucleotides; or all three of the X nucleotides all form base pairs with the corresponding X' nucleotides.

[0370] In one embodiment, the modification on the Y nucleotide is different from the modification on the Y' nucleotide, the modification on the Z nucleotide is different from the modification on the Z' nucleotide, and / or the modification on the X nucleotide is different from the modification on the X' nucleotide.

[0371] In one embodiment, when the RNAi agent is represented by formula (IIId), N a The modification is a 2'-O-methyl or 2'-fluoro modification. In another embodiment, when the RNAi agent is represented by formula (IIId), N a The modification is a 2'-O-methyl or 2'-fluoro modification, and n p '>0, and at least one n p ' is linked to the adjacent nucleotide via a phosphorothioate bond. In yet another embodiment, when the RNAi agent is represented by formula (IIId), N a The modification is a 2'-O-methyl or 2'-fluoro modification, and n p '>0, and at least one n p ' is linked to the adjacent nucleotide via a phosphorothioate bond, and the sense strand is conjugated to one or more GalNAc derivatives linked via a divalent or trivalent branched linker (described below). In another embodiment, when the RNAi agent is represented by formula (IIId), N a The modification is a 2'-O-methyl or 2'-fluoro modification, and n p '>0, and at least one n p’ is linked to an adjacent nucleotide via a phosphorothioate bond, the sense strand contains at least one phosphorothioate bond, and the sense strand is conjugated to one or more GalNAc derivatives linked via a divalent or trivalent branched linker.

[0372] In one embodiment, when the RNAi agent is represented by formula (IIIa), N a The modification is a 2'-O-methyl or 2'-fluoro modification, and n p ’ > 0, and at least one n p ’ is linked to an adjacent nucleotide via a phosphorothioate bond, the sense strand contains at least one phosphorothioate bond, and the sense strand is conjugated to one or more GalNAc derivatives linked via a divalent or trivalent branched linker.

[0373] In one embodiment, the RNAi agent is a multimer comprising at least two double strands represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId), and the double strands are linked by a linker. The linker can be cleavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each of the double strands can target the same gene or two different genes; or each of the double strands can target the same gene at two different target sites.

[0374] In one embodiment, the RNAi agent is a multimer comprising 3, 4, 5, 6 or more double strands represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId), and the double strands are linked by a linker. The linker can be cleavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each of the double strands can target the same gene or two different genes; or each of the double strands can target the same gene at two different target sites.

[0375] In one embodiment, two RNAi agents represented by formulas (III), (IIIa), (IIIb), (IIIc), and (IIId) are linked to each other at one or both of the 5'-end and the 3'-end and are optionally conjugated to a ligand. Each of the RNAi agents can target the same gene or two different genes; or each of the RNAi agents can target the same gene at two different target sites.

[0376] A variety of publications describe multimeric RNAi agents that can be used in the methods of the present invention. Such publications include WO 2007 / 091269 pamphlet, US Patent No. 7858769 specification, WO 2010 / 141511 pamphlet, WO 2007 / 117686 pamphlet, WO 2009 / 014887 pamphlet, and WO 2011 / 031520 pamphlet, the entire contents of each of which are incorporated herein by reference.

[0377] As described in more detail below, RNAi agents that include conjugation of one or more carbohydrate moieties to an RNAi agent can optimize one or more properties of the RNAi agent. In many cases, the carbohydrate moiety is attached to a modified subunit of the RNAi agent. For example, the ribose sugar of one or more ribonucleotide subunits of a dsRNA agent can be replaced with another moiety, such as a non-carbohydrate (preferably cyclic) carrier to which a carbohydrate ligand is attached. A ribonucleotide subunit in which the ribose sugar of the subunit is thus replaced is referred to herein as a ribose-substituted modified subunit (RRMS). The cyclic carrier may be a carbocyclic system, i.e., all ring atoms are carbon atoms, or a heterocyclic system, i.e., one or more ring atoms may be heteroatoms, such as nitrogen, oxygen, sulfur. The cyclic carrier may be a monocyclic system or may include two or more rings, such as fused rings. The cyclic carrier may be a completely saturated ring system or may include one or more double bonds.

[0378] The ligand can be bound to the polynucleotide via a carrier. The carrier includes (i) at least one "backbone attachment point", preferably two "backbone attachment points", and (ii) at least one "tethering attachment point". As used herein, a "backbone attachment point" refers to a functional group, such as a hydroxyl group, or generally a backbone, such as a phosphate, or a modified phosphate, such as a sulfur-containing phosphate, and is available for and suitable for the incorporation of the carrier into the backbone of ribonucleic acid and the bonds thereto. A "tethering attachment point" (TAP) refers, in certain embodiments, to a constituent ring atom of a cyclic carrier that connects a selected moiety, such as a carbon atom or a heteroatom (different from the atom providing the backbone attachment point). This moiety can be, for example, a carbohydrate, such as a monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, and polysaccharide. Optionally, the selected moiety is connected to the cyclic carrier by an intervening tether. Thus, the cyclic carrier often contains a functional group, such as an amino group, or generally provides a bond suitable for the incorporation or tethering of another chemical component, such as a ligand, into the constituent ring.

[0379] The RNAi agent may be conjugated to the ligand via a carrier, which may be a cyclic group or a cyclic group; preferably, the cyclic group is selected from pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl, and decalin; preferably, the cyclic group is selected from a serinol backbone or a diethanolamine backbone.

[0380] In certain embodiments, the RNAi agent for use in the methods of the invention is an agent selected from the group of agents listed in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23. These agents may further contain a ligand.

[0381] IV. iRNA Conjugated to a Ligand Another modification of the RNA of the iRNA of the present invention involves chemically attaching to the RNA one or more ligands, moieties or conjugates that improve the activity, cellular distribution or cellular uptake of the iRNA.Such moieties include, but are not limited to, cholesterol moieties (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86: 6553-6556), cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4: 1053-1060), thioethers such as beryl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660: 306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3: 2765-2770), thiocolesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20: 533-538), aliphatic chains such as dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10: 1111-1118; Kabanov et al., FEBS Lett., 1990, 259: 327-330; Svinarchuk et al., Biochimie, 1993, 75: 49-54), phospholipids such as di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36: 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18: 3777-3783), polyamines or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14: 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36: 3651-3654), palmitoyl moieties (Mishra et al., Biochim. Biophys. Acta, 1995, 1264: 229-237), or lipid moieties such as octadecylamine or hexylamino-carbonyloxy cholesterol moieties (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277: 923-937).

[0382] In one embodiment, the ligand alters the distribution, targeting, or lifespan of the iRNA agent into which it is incorporated. In preferred embodiments, the ligand provides improved affinity for a selected target (e.g., a molecule, cell, or cell type), compartment (e.g., a cell or tissue compartment of an organ), body tissue, organ, or region, as compared to a species without such a ligand. Preferred ligands do not participate in duplex pairing in double-stranded nucleic acids.

[0383] The ligand can include natural substances such as proteins (e.g., human serum albumin (HSA), low density lipoprotein (LDL), or globulin); carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, N-acetylgalactosamine, or hyaluronic acid); or lipids. The ligand can also be a recombinant or synthetic molecule such as a synthetic polymer, e.g., a synthetic polyamino acid. Examples of polyamino acids include polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolide) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, or polyphosphazene. Examples of polyamines include polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salts of polyamines, or α-helix peptide.

[0384] The ligand can also include a target group, such as an antibody that binds to a specific cell type, such as a cell or tissue targeting agent, such as lectin, glycoprotein, lipid or protein, such as a kidney cell. The target group can be thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, polyvalent lactose, polyvalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, polyvalent mannose, polyvalent fucose, glycosylated polyamino acid, polyvalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, lipid, cholesterol, steroid, bile acid, folate, vitamin B12, vitamin A, biotin, or an RGD peptide, or an RGD peptide mimetic or aptamer.

[0385] Other examples of ligands include dyes, intercalators (e.g., acridine), cross-linking agents (e.g., psoralen, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases or chelating agents (e.g., EDTA), lipophilic molecules such as cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl) lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphates, aminos, mercaptos, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyaminos, alkyls, substituted alkyls, radiolabeled markers, enzymes, haptens (e.g., biotin), transport / absorption promoters (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole cluster, acridine-imidazole complex, Eu3+ tetraaza macrocycle complex), dinitrophenyl, HRP, or AP.

[0386] A ligand can be a molecule having specific affinity for binding to a protein, such as a glycoprotein, or a peptide, such as a co-ligand, or an antibody, such as an antibody specific for binding to a particular cell type such as a hepatocyte. A ligand may also include hormones and hormone receptors. A ligand may also include non-peptide species such as lipids, lectins, carbohydrates, vitamins, cofactors, polyvalent lactose, polyvalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, or polyvalent mannose, polyvalent fucose or aptamers. A ligand can be, for example, a lipopolysaccharide, an activator of 38MAP kinase, or an activator of NF-κB.

[0387] A ligand can be, for example, a substance that can improve the uptake of an iRNA agent into a cell, such as a drug, by disrupting the microtubules, microfilaments, and / or intermediate filaments of the cell, for example, by disrupting the cytoskeleton. The drug can be, for example, taxol, vincristine, vinblastine, cytochalasin, nocodazole, jasplakinolide, latrunculin A, phalloidin, swinholide A, inadanocin, or myoseverin.

[0388] In certain embodiments, the ligand conjugated to the iRNA described herein acts as a pharmacokinetic modulator (PK modulator). Examples of PK modulators include lipophiles, bile acids, steroids, phospholipid analogs, peptides, protein binders, PEG, vitamins, etc. Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkyl glycerides, diacyl glycerides, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin, etc. Oligonucleotides containing some phosphorothioate linkages are also known to bind to serum proteins, and thus, short oligonucleotides, such as oligonucleotides of about 5 bases, 10 bases, 15 bases or 20 bases containing multiple phosphorothioate linkages in the backbone, are also suitable for use in the present invention as ligands (e.g., PK modulating ligands). Further, aptamers that bind to serum components (e.g., serum proteins) are also suitable for use as PK modulating ligands in the embodiments described herein.

[0389] The ligand-conjugated oligonucleotide of the present invention can be synthesized (as described below) by using an oligonucleotide having a reactive pendant functional group such as one derived from the binding of a binding molecule to the oligonucleotide. This reactive oligonucleotide may be reacted directly with a commercially available ligand, a synthesized ligand having any of various protecting groups, or a ligand to which a binding moiety is attached.

[0390] The oligonucleotides used in the conjugates of the present invention can be conveniently and routinely prepared by well-known techniques of solid-phase synthesis. Apparatus for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may be used in addition to or instead thereof. It is also known to use similar techniques for preparing other oligonucleotides such as phosphorothioate and alkylated derivatives.

[0391] In the ligand-conjugated oligonucleotide and ligand molecule having the sequence-specific binding nucleoside of the present invention, the oligonucleotide and oligonucleoside can be assembled in a suitable DNA synthesizer using standard nucleotide or nucleoside precursors, or nucleotide or nucleoside conjugate precursors already having a binding moiety, ligand-nucleotide or nucleoside conjugate precursors already having a ligand molecule, or non-nucleoside ligand-containing building blocks.

[0392] When using a nucleotide conjugate precursor that already has a linking moiety, the synthesis of the sequence-specific binding nucleoside is typically completed and then the ligand molecule is reacted with the linking moiety to form the ligand conjugate oligonucleotide. In certain embodiments, the oligonucleotides or binding nucleosides of the invention are synthesized by an automated synthesizer using phosphoramidites derived from ligand-nucleoside conjugates in addition to commercially available, standard phosphoramidites and non-standard phosphoramidites commonly used in oligonucleotide synthesis.

[0393] A. Lipid Conjugate In one aspect, the ligand or conjugate is a lipid or lipid-based molecule. Such lipids or lipid-based molecules preferably bind to serum proteins, such as human serum albumin (HSA). HSA-binding ligands enable the distribution of the conjugate to target tissues of the body, such as non-renal target tissues. For example, the target tissue can be the liver, including hepatocytes of the liver. Other molecules that can bind to HSA can also be used as ligands. For example, naproxen or aspirin can be used. Lipid or lipid-based ligands can be used to (a) increase resistance to degradation of the conjugate, (b) increase targeting or transport to target cells or cell membranes, and / or (c) modulate binding to serum proteins, such as HSA.

[0394] The binding of the conjugate to the target tissue can be inhibited, e.g., controlled, using lipid-based ligands. For example, lipids or lipid-based ligands that bind more strongly to HSA are less likely to be targeted to the kidney and thus less likely to be removed from the body. The conjugate can be targeted to the kidney using lipids or lipid-based ligands that bind more weakly to HSA.

[0395] In a preferred embodiment, the lipid-based ligand binds to HSA. Preferably, the lipid-based ligand binds to HSA with sufficient affinity such that the conjugate is preferably distributed to non-renal tissues. However, the affinity is preferably not so strong that the HSA-ligand binding cannot be reversed.

[0396] In another preferred embodiment, the lipid-based ligand binds weakly or not at all to HSA such that the conjugate is preferably distributed to the kidney. Other moieties targeting renal cells may also be used instead of or in addition to the lipid-based ligand.

[0397] In another aspect, the ligand is a moiety, such as a vitamin, that is taken up by target cells, such as proliferating cells. These are particularly useful for treating disorders characterized by unwanted cell proliferation, such as malignant or non-malignant, for example, cancer cells. Exemplary vitamins include vitamins A, E, and K. Other exemplary vitamins include vitamins B, such as folic acid, B12, riboflavin, biotin, pyridoxal or other vitamins or nutrients taken up by target cells such as hepatocytes. HAS and low density lipoprotein (LDL) are also included.

[0398] B. Cell-Permeation Agent In another aspect, the ligand is a cell-permeation agent, preferably a helical cell-permeation agent. Preferably, the agent is amphiphilic. Exemplary agents are peptides such as tat or antennopedia. If the agent is a peptide, it can be modified including the use of peptidomimetics, enantiomers, non-peptides or pseudo-peptide bonds, and D-amino acids. The helical agent is preferably an α-helix agent, which preferably has lipophilic and hydrophobic phases.

[0399] The ligand can be a peptide or a peptidomimetic. A peptidomimetic (also referred to herein as an oligopeptidomimetic) is a molecule that can be folded into a defined three-dimensional structure similar to that of a natural peptide. The binding of peptides and peptidomimetics to an iRNA agent can affect the pharmacokinetic distribution of the iRNA, for example, by enhancing cell recognition and uptake. The peptide or peptidomimetic moiety can be about 5 to 50 amino acids in length, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids in length.

[0400] The peptide or peptidomimetic can be, for example, a cell-penetrating peptide, a cationic peptide, an amphiphilic peptide, or a hydrophobic peptide (e.g., consisting mainly of Tyr, Trp, or Phe). The peptide moiety can be a dendrimer peptide, a constrained peptide, or a cross-linked peptide. In another alternative, the peptide moiety can include a hydrophobic membrane transport sequence (MTS). An exemplary hydrophobic MTS-containing peptide is RFGF having the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO: 9). RFGF analogs containing a hydrophobic MTS (e.g., the amino acid sequence AALLPVLLAAP (SEQ ID NO: 10)) can also be target moieties. The peptide moiety can be a "delivery" peptide capable of transporting large polar molecules including peptides, oligonucleotides, and proteins across the cell membrane. For example, sequences derived from the HIV Tat protein (GRKKRRQRRRPPQ (SEQ ID NO: 11)) and the Drosophila Antennapedia protein (RQIKIWFQNRRMKWKK (SEQ ID NO: 12)) have been found to be capable of functioning as delivery peptides. The peptide or peptidomimetic can be encoded by a random sequence of DNA, such as a peptide identified from a phage display library or a one-bead-one-compound (OBOC) combinatorial library (Lam et al., Nature, 354:82 - 84, 1991). Examples of peptides or peptidomimetics bound to the dsRNA agent via monomer units incorporated for the purpose of cell targeting are peptides such as arginine-glycine-aspartic acid (RGD)-peptides, or RGD mimetics. The peptide moiety can range in length from about 5 amino acids to about 40 amino acids. The peptide moiety can have structural modifications such as to enhance stability or direct conformational properties. Any of the structural modifications described later can be used.

[0401] The RGD peptide moiety for use in the compositions and methods of the present invention can be linear or cyclic and may be modified, such as glycosylated or methylated, to facilitate targeting to a particular tissue. D-amino acids, as well as synthetic RGD mimetics, can be used in the RGD-containing peptides and peptidomimetics. In addition to RGD, other moieties targeting integrin ligands can be used. Preferred conjugates of this ligand target PECAM-1 or VEGF.

[0402] A "cell-penetrating peptide" is capable of penetrating cells, such as microbial cells, such as bacterial or fungal cells, or mammalian cells, such as human cells. Peptides that penetrate microbial cells can be, for example, α-helical linear peptides (e.g., LL-37 or Ceropin P1), disulfide bond-containing peptides (e.g., α-defensin, β-defensin, or bactenecin), or peptides containing only one or two dominant amino acids (e.g., PR-39 or indolicidin). The cell-penetrating peptide can also include a nuclear localization signal (NLS). For example, the cell-penetrating peptide can be a bipartite amphipathic peptide, such as MPG, derived from the fusion peptide domain of HIV-1 gp41 and the NLS of SV40 large T antigen (Simeoni et al., Nucl. Acids Res. 31:2717-2724, 2003).

[0403] C. Carbohydrate Conjugate In certain embodiments of the compositions and methods of the invention, the iRNA oligonucleotides further comprise a carbohydrate. Carbohydrate-conjugated iRNA is advantageous for nucleic acid delivery in vivo as described herein, and the compositions are suitable for therapeutic use in vivo. As used herein, "carbohydrate" refers to a compound that is a carbohydrate per se composed of one or more monosaccharide units having at least 6 carbon atoms (which may be linear, branched, or cyclic) with an oxygen, nitrogen, or sulfur atom bonded to each carbon atom; or a compound having, as part of it, a carbohydrate moiety composed of one or more monosaccharide units, each monosaccharide unit having at least 6 carbon atoms (which may be linear, branched, or cyclic) with an oxygen, nitrogen, or sulfur atom bonded to each carbon atom. Representative carbohydrates include sugars (monosaccharides, disaccharides, trisaccharides, and oligosaccharides containing about 4, 5, 6, 7, 8, or 9 monosaccharide units), and polysaccharides such as starch, glycogen, cellulose, and polysaccharide gums. Specific monosaccharides include sugars having C5 or more (e.g., C5, C6, C7, or C8); disaccharides and trisaccharides include sugars having 2 or 3 monosaccharide units (e.g., C5, C6, C7, or C8).

[0404] In one embodiment, the carbohydrate conjugate for use in the compositions and methods of the invention is a monosaccharide. In one embodiment, the monosaccharide is

Chemical formula

[0405] In another embodiment, the carbohydrate conjugate for use in the compositions and methods of the invention is

Chemical formula

Chemical formula

Chemical formula

[0406] Another representative carbohydrate conjugate for use in the embodiments described herein includes, but is not limited to, [Chemistry] wherein when one of X or Y is an oligonucleotide, the other is hydrogen.

[0407] In certain embodiments, the carbohydrate conjugate further comprises one or more additional ligands as described above, such as, but not limited to, a PK regulator and / or a cell-permeable peptide.

[0408] D. Linker In certain embodiments, the conjugates or ligands described herein can be attached to the iRNA oligonucleotide using a variety of linkers that can be cleavable or non-cleavable.

[0409] The term "linker" or "linking group" means an organic moiety that connects two parts of a compound, for example, covalently bonds two parts of a compound. Linkers typically are direct bonds or atoms such as oxygen or sulfur, units such as NR8, C(O), C(O)NH, SO, SO2, SO2NH, or, without limitation, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkynylheteroarylalkyl, alkynylheteroarylalkenyl, alkynylheteroarylalkynyl, alkylheterocyclylalkyl, alkylheterocyclylalkenyl, alkylheterocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl, alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylheteroaryl (one or more methylenes may be interrupted or terminated by O, S, S(O), SO2, N(R8), C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocyclic), and contain chains of atoms such as; where R8 is hydrogen, acyl, aliphatic or substituted aliphatic.In one embodiment, the linker is from about 1 to 24 atoms, 2 to 24, 3 to 24, 4 to 24, 5 to 24, 6 to 24, 6 to 18, 7 to 18, 8 to 18 atoms, 7-17, 8 to 17, 6 to 16, 7 to 16, or 8 to 16 atoms.

[0410] The cleavable linking group is sufficiently stable outside the cell but, once inside the target cell, is cleaved to release the two moieties that the linker holds together. In a preferred embodiment, the cleavable linking group is cleaved at least about 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold or more, or at least about 100-fold faster inside the target cell or under a first reference condition (e.g., selected to mimic or represent intracellular conditions), in the subject's blood, or under a second reference condition (e.g., selected to mimic or represent conditions found in blood or serum).

[0411] The cleavable linking group is sensitive to a cleaving agent, e.g., the presence of pH, redox potential, or a degradable molecule. Generally, the cleaving agent is more prevalent or found at a higher level or activity inside the cell as compared to in serum or blood. Examples of such degrading agents include, for example, redox agents selected for or having substrate specificity for a particular substrate, including oxidizing or reducing enzymes present inside the cell or reducing agents such as mercaptans that can degrade a redox-cleavable linking group by reduction; esterases; agents capable of forming an endosome or an acidic environment, e.g., an agent that brings about a pH of 5 or less; enzymes, peptidases (which may be substrate-specific), and phosphatases that can hydrolyze or degrade an acid-cleavable linking group by acting as a general acid.

[0412] Cleavable linking groups such as disulfide bonds can be sensitive to pH. While the pH of human serum is 7.4, the average intracellular pH is slightly lower, in the range of about 7.1 - 7.3. Endosomes have a more acidic pH in the range of 5.5 - 6.0, and lysosomes have an even more acidic pH of approximately 5.0. Some linkers, by having a cleavable linking group that is cleaved at a preferred pH, will release the cationic lipid from the ligand inside the cell or release it into a desired compartment of the cell.

[0413] The linker can include a cleavable linking group that is cleavable by a specific enzyme. The type of cleavable linking group incorporated into the linker can depend on the target cell. For example, a ligand targeting the liver can be conjugated to a cationic lipid via a linker containing an ester group. Since hepatocytes are rich in esterases, this linker will be cleaved more efficiently within hepatocytes compared to within cell types that are not rich in esterases. Other cell types rich in esterases include cells of the lung, renal cortex, and testis.

[0414] Linkers containing peptide bonds can be used when targeting cell types rich in peptidases, such as hepatocytes and synoviocytes.

[0415] In general, the suitability of a cleavable candidate linking group can be evaluated by testing the ability of the candidate linking group to be cleaved by a degrading agent (or degrading conditions). It may also be desirable to test the ability of the cleavable candidate linking group to resist cleavage in blood or upon contact with other non-target tissues. Thus, the relative susceptibility to cleavage between a first condition, selected to exhibit cleavage within a target cell, and a second condition, selected to exhibit cleavage within other tissues or in a biological fluid such as blood or serum, can be determined. This evaluation can be carried out in a cell-free system, intracellularly, in cell culture, in an organ or tissue culture, or in a whole animal. It can be useful to perform an initial evaluation under cell-free or culture conditions and confirm it by further evaluation in a whole animal. In a preferred embodiment, a useful candidate compound is cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster intracellularly (or under in vitro conditions selected to mimic intracellular conditions) compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions).

[0416] i. A redox-cleavable linking group In one embodiment, the cleavable linking group is a redox-cleavable linking group that is cleaved after reduction or oxidation. An example of a reductively cleavable linking group is a disulfide linking group (-S-S-). Attention may be paid to the methods described herein to determine whether a candidate cleavable linking group is a suitable "reductively cleavable linking group" or is suitable for use, for example, with a particular iRNA moiety and a particular targeting agent. For example, a candidate can be evaluated by incubation with dithiothreitol (DTT) or other reducing agents using reagents known in the art, which mimics the rate of cleavage that can be observed in cells, such as target cells. A candidate can also be evaluated under conditions selected to mimic blood or serum conditions. In one of them, the candidate compound is cleaved by about 10% or less in blood. In other embodiments, a useful candidate compound is at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster degraded intracellularly (or under in vitro conditions selected to mimic intracellular conditions) compared to in blood (or under in vitro conditions selected to mimic extracellular conditions). The cleavage rate of a candidate compound is determined using a standard enzyme kinetics assay under conditions selected to mimic the intracellular medium and can be compared to conditions selected to mimic the extracellular medium.

[0417] ii. Phosphate-based cleavable linking group In another embodiment, the cleavable linker comprises a phosphate-based cleavable linking group. The phosphate-based cleavable linking group is cleaved by an agent that decomposes or hydrolyzes a phosphate group. An example of an agent that cleaves a phosphate group intracellularly is an enzyme such as an intracellular phosphatase. Examples of phosphate-based linking groups are -O-P(O)(ORk)-O-, -O-P(S)(ORk)-O-, -O-P(S)(SRk)-O-, -S-P(O)(ORk)-O-, -O-P(O)(ORk)-S-, -S-P(O)(ORk)-S-, -O-P(S)(ORk)-S-, -S-P(S)(ORk)-O-, -O-P(O)(Rk)-O-, -O-P(S)(Rk)-O-, -S-P(O)(Rk)-O-, -S-P(S)(Rk)-O-, -S-P(O)(Rk)-S-, -O-P(S)(Rk)-S-. Preferred embodiments are -O-P(O)(OH)-O-, -O-P(S)(OH)-O-, -O-P(S)(SH)-O-, -S-P(O)(OH)-O-, -O-P(O)(OH)-S-, -S-P(O)(OH)-S-, -O-P(S)(OH)-S-, -S-P(S)(OH)-O-, -O-P(O)(H)-O-, -O-P(S)(H)-O-, -S-P(O)(H)-O, -S-P(S)(H)-O-, -S-P(O)(H)-S-, -O-P(S)(H)-S-. A preferred embodiment is -O-P(O)(OH)-O-. These candidates can be evaluated using methods similar to those described above.

[0418] iii. Acid-cleavable linking group In another embodiment, the cleavable linker comprises an acid-cleavable linking group. An acid-cleavable linking group is a linking group that is cleaved under acidic conditions. In a preferred embodiment, the acid-cleavable linking group is cleaved in an acidic environment having a pH of about 6.5 or less (e.g., about 6.0, 5.75, 5.5, 5.25, 5.0, or less), or by an agent such as an enzyme that can act as a general acid. Within a cell, certain low pH organelles such as endosomes and lysosomes can provide a cleavage environment for acid-cleavable linking groups. Examples of acid-cleavable linking groups include, but are not limited to, hydrazones, esters, and esters of amino acids. The acid-cleavable group can be represented by the general formula -C=NN-, C(O)O, or -OC(O). A preferred embodiment is where the carbon (alkoxy group) bonded to the oxygen of the ester is an aryl group, a substituted alkyl group, or a tertiary alkyl group such as dimethylpentyl or t-butyl. These candidates can be evaluated using a method similar to the method described above.

[0419] iv. Ester-based linking groups In another embodiment, the cleavable linker comprises an ester-based cleavable linking group. The ester-based cleavable linking group is cleaved by enzymes such as intracellular esterases and amylases. Examples of ester-based cleavable linking groups include, but are not limited to, esters of alkylene, alkenylene, and alkynylene groups. The ester-cleavable linking group is represented by the general formula -C(O)O- or -OC(O)-. These candidates can be evaluated using a method similar to the method described above.

[0420] v. Peptide-based cleavage groups In yet another embodiment, the cleavable linker comprises a peptide-based cleavable linking group. The peptide-based cleavable linking group is cleaved by enzymes such as peptidases and proteases within cells. The peptide-based cleavable group is a peptide bond formed between amino acids to give oligopeptides (e.g., dipeptides, tripeptides, etc.) and polypeptides. The peptide-based cleavable group does not include an amide group. The amide group can be formed between any alkylene, alkenylene or alkynylene. The peptide bond is a special type of amide bond formed between amino acids to give peptides and proteins. The peptide-based cleavable group is generally limited to peptide bonds (i.e., amide bonds) formed between amino acids to give peptides and proteins and does not include all amide functional groups. The peptide-based cleavable linking group is generally represented by the general formula -NHCHRAC(O)NHCHRBC(O)-, wherein RA and RB are the R groups of two adjacent amino acids. These candidates can be evaluated using a method similar to the method described above.

[0421] In one embodiment, the iRNA of the present invention is conjugated to a carbohydrate via a linker. Non-limiting examples of iRNA carbohydrate conjugates with the linker of the compositions and methods of the present invention include, but are not limited to,

Chemical formula

Chemical formula

[0422] In certain embodiments of the compositions and methods of the present invention, the ligand is one or more “GalNAc” (N-acetylgalactosamine) derivatives linked via a divalent or trivalent branched linker.

[0423] In one embodiment, the dsRNA of the present invention has the formulas (XXXI)-(XXXIV): [Chem.] conjugated to a divalent or trivalent branched linker selected from the group of structures shown in any of wherein: q2A, q2B, q3A, q3B, q4A, q4B, q5A, q5B and q5C each independently represent 0 to 20 each time they appear, and the repeating units may be the same or different; P 2A 、P 2B 、P 3A 、P 3B 、P 4A 、P 4B 、P 5A 、P 5B 、P 5C 、T 2A 、T 2B 、T 3A 、T 3B 、T 4A 、T 4B 、T 4A 、T 5B 、T 5C each independently represent, each time they appear, absent, CO, NH, O, S, OC(O), NHC(O), CH2, CH2NH or CH2O; Q 2A 、Q 2B 、Q 3A 、Q 3B 、Q 4A 、Q 4B 、Q 5A 、Q 5B 、Q 5C each independently represent, each time they appear, absent, alkylene, substituted alkylene, where one or more methylenes may be interrupted or terminated by one or more of O, S, S(O), SO2, N(R N ), C(R’)=C(R”), C≡C or C(O); R 2A 、R 2B 、R 3A 、R 3B 、R 4A 、R 4B 、R 5A 、R 5B 、R 5Ceach independently upon each occurrence, is absent, NH, O, S, CH2, C(O)O, C(O)NH, NHCH(R a )C(O), -C(O)-CH(R a )-NH-, CO, CH=N-O,

Chem.

Chem.

[0424] Examples of suitable divalent and trivalent branched chain linking groups for conjugation to GalNAc derivatives include, but are not limited to, the structures listed above as formula II, VII, XI, X, and XIII.

[0425] Representative patents teaching the preparation of RNA conjugates include, but are not limited to, U.S. Patent Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241; 5,391,723; 5,416,203; 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941; 6,294,664; 6,320,017; 6,576,752; 6,783,931; 6,900,297; 7,037,646; 8,106,022, the entire contents of each of which are hereby incorporated by reference.

[0426] Not all positions of a given compound need to be uniformly modified, and in fact, two or more of the above modifications can be incorporated into a single compound or even into a single nucleoside within the iRNA. The present invention also includes iRNA compounds that are chimeric compounds.

[0427] In the context of the present invention, a "chimeric" iRNA compound or "chimera" is an iRNA compound comprising at least one monomer unit, i.e., two or more chemically distinct regions each composed of nucleotides in the case of a dsRNA compound, preferably a dsRNA. These iRNAs typically contain at least one region where the RNA is modified to confer increased resistance to nuclease degradation, increased cellular uptake, and / or increased binding affinity to the target nucleic acid. A further region of the iRNA can serve as a substrate for an enzyme capable of cleaving an RNA:DNA or RNA:RNA hybrid. By way of example, RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. Thus, activation of RNase H results in cleavage of the RNA target, thereby significantly enhancing the efficiency of iRNA inhibition of gene expression. As a result, when chimeric dsRNAs are used, equivalent results are often obtained with shorter iRNAs compared to phosphorothioate deoxy dsRNAs that hybridize to the same target region. Cleavage of the RNA target can typically be detected by gel electrophoresis and, if necessary, by related nucleic acid hybridization techniques known in the art.

[0428] In some cases, the RNA of the iRNA can be modified by non-ligand groups. Some non-ligand molecules have been conjugated to the iRNA to improve the activity, cellular distribution, or cellular uptake of the iRNA, and procedures for such conjugation are available in the scientific literature.Such non-ligand moieties include cholesterol (Kubo, T. et al., Biochem. Biophys. Res. Comm., 2007, 365(1): 54 - 61; Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86: 6553), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4: 1053), thioethers such as hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660: 306; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3: 2765), thiocolesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20: 533), aliphatic chains such as dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10: 111; Kabanov et al., FEBS Lett., 1990, 259: 327; Svinarchuk et al., Biochimie, 1993, 75: 49), phospholipids such as di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36: 3651; Shea et al., Nucl. Acids Res., 1990, 18: 3777), polyamines or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14: 969), or adamantaneacetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36: 3651), palmitoyl moieties (Mishra et al., Biochim. Biophys. Acta, 1995, 1264: 229), or lipid moieties such as octadecylamine or hexylamino-carbonyl-oxy cholesterol moieties (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277: 923).Representative U.S. patents teaching the preparation of such RNA conjugates are listed above. Typical conjugate protocols involve the synthesis of RNA having an amino linker at one or more positions in the sequence. Next, the amino group is reacted with the conjugated molecule using a suitable coupling agent or activating reagent. The conjugation reaction can be carried out using RNA still attached to a solid support or after cleavage of the RNA in solution phase. Purification of the RNA conjugate by HPLC typically yields a pure conjugate.

[0429] IV. Delivery of the iRNA of the Invention Delivery of the iRNA of the invention to cells, e.g., cells in a subject such as a human subject (e.g., a subject in need of an iRNA agent such as a subject suffering from a disease associated with a complement component C), can be carried out in several different ways. For example, delivery can be effected by contacting the cells with the iRNA of the invention either in vitro or in vivo. In vivo delivery can also be effected directly by administering to the subject a composition comprising the iRNA, e.g., dsRNA. Alternatively, in vivo delivery can be effected indirectly by administering one or more vectors encoding and directing the expression of the iRNA. These alternatives are further described below.

[0430] In general, any method for delivering nucleic acid molecules (in vitro or in vivo) can be adapted for use with the iRNAs of the present invention (see, for example, Akhtar S. and Julian RL., (1992) Trends Cell. Biol. 2(5):139-144 and WO 94 / 02595, which are hereby incorporated by reference in their entirety). In the case of in vivo delivery, factors to be considered for delivering iRNA molecules include, for example, the biological stability of the molecule being delivered, prevention of non-specific effects, and accumulation of the molecule being delivered in the target tissue. The non-specific effects of iRNA can be minimized by local administration, for example, by direct injection or implantation into tissue, or by locally administering the formulation. Local administration to the site of treatment maximizes the local concentration of the agent, limits exposure of the agent to systemic tissues that may be adversely affected by or may degrade the agent, and reduces the total dose of the iRNA molecule administered. Several studies have shown the success of gene product knockdown when iRNA is administered locally. For example, intravitreal delivery of VEGF dsRNA by injection in cynomolgus monkeys (Tolentino, MJ et al., (2004) Retina 24:132-138) and subretinal injection in mice (Reich, SJ et al. (2003) Mol. Vis. 9:210-216) both showed prevention of neovascularization in experimental models of age-related macular degeneration. Furthermore, direct intratumoral administration of dsRNA in mice decreased tumor volume (Pille, J et al. (2005) Mol. Ther. 11:267-274) and could extend the survival of tumor-bearing mice (Kim, WJ et al., (2006) Mol. Ther. 14:343-350; Li, S et al., (2007) Mol. Ther. 15:515-523).RNA interference has also shown success with local delivery to the central nervous system by direct injection (Dorn, G. et al., (2004) Nucleic Acids 32:e49; Tan, P. H. et al. (2005) Gene Ther. 12:59-66; Makimura, H. et al. (2002) BMC Neurosci. 3:18; Shishkina, G. T., et al. (2004) Neuroscience 129:521-528; Thakker, E. R., et al. (2004) Proc. Natl. Acad. Sci. U.S.A. 101:17270-17275; Akaneya, Y., et al. (2005) J. Neurophysiol. 93:594-602) and local delivery to the lung by intranasal administration (Howard, K. A. et al., (2006) Mol. Ther. 14:476-484; Zhang, X. et al., (2004) J. Biol. Chem. 279:10677-10684; Bitko, V. et al., (2005) Nat. Med. 11:50-55). To systemically administer iRNA for the treatment of disease, the RNA can be modified or delivered using a drug delivery system; both methods serve to prevent the rapid degradation of dsRNA by endonucleases and exonucleases in vivo. Modification of the RNA or pharmaceutical carrier enables targeting of the iRNA composition to the target tissue and can also avoid unwanted off-target effects. The iRNA molecule can be modified by chemical conjugation to a lipophilic group such as cholesterol that improves cellular uptake and prevents degradation. For example, iRNA against ApoB conjugated to a lipophilic cholesterol moiety was systemically administered to mice and resulted in knockdown of apoB mRNA in both the liver and jejunum (Soutschek, J. et al., (2004) Nature 432:173-178). Conjugation of iRNA to an aptamer has been shown to inhibit tumor growth and mediate tumor regression in a mouse model of prostate cancer (McNamara, J. O. et al., (2006) Nat. Biotechnol. 24:1005-1015).In alternative embodiments, the iRNA can be delivered using a drug delivery system such as nanoparticles, dendrimers, polymers, liposomes, or cationic delivery systems. Positively charged cationic delivery systems facilitate binding of the iRNA molecule (negatively charged) and also improve interaction with the negatively charged cell membrane to allow efficient uptake of the iRNA by the cell. Cationic lipids, dendrimers, or polymers can be bound to the iRNA or induced to form vesicles or micelles (see, for example, Kim SH.et al.,(2008)Journal of Controlled Release 129(2):107-116) that encapsulate the iRNA. Formation of vesicles or micelles further protects the iRNA from degradation when administered systemically. Methods for making and administering cationic iRNA complexes are within the capabilities of one of ordinary skill in the art (see, for example, Sorensen, DR.,et al.(2003)J.Mol.Biol 327:761-766; Verma, UN.et al.,(2003)Clin.Cancer Res.9:1291-1300; Arnold, AS et al.,(2007)J.Hypertens.25:197-205, which are hereby incorporated by reference in their entirety).Some non-limiting examples of drug delivery systems useful for systemic delivery of iRNA include DOTAP (Sorensen, D.R., et al (2003), supra; Verma, U.N., et al., (2003), supra), Oligofectamine, “solid nucleic acid lipid particles” (Zimmermann, T.S., et al., (2006) Nature 441:111-114), cardiolipin (Chien, P.Y., et al., (2005) Cancer Gene Ther. 12:321-328; Pal, A., et al., (2005) Int J. Oncol. 26:1087-1091), polyethyleneimine (Bonnet M.E., et al., (2008) Pharm. Res. Aug 16 Epub ahead of print; Aigner, A. (2006) J. Biomed. Biotechnol. 71659), Arg-Gly-Asp (RGD) peptide (Liu, S. (2006) Mol. Pharm. 3:472-487), and polyamidoamine (Tomalia, D.A., et al., (2007) Biochem. Soc. Trans. 35:61-67; Yoo, H., et al., (1999) Pharm. Res. 16:1799-1804). In certain embodiments, the iRNA forms a complex with cyclodextrin for systemic administration. Methods for administration and pharmaceutical compositions of iRNAs and cyclodextrins can be found in U.S. Patent No. 7,427,605, which is hereby incorporated by reference in its entirety.

[0431] A. iRNA of the invention encoded by a vector iRNAs targeting C5 genes can be expressed from transcription units inserted into DNA or RNA vectors (see, e.g., Couture, A., et al., TIG. (1996), 12:5-10; International PCT Publication No. WO 00 / 22113 pamphlet by Skillern, A. et al., International PCT Publication No. WO 00 / 22114 pamphlet by Conrad, and U.S. Patent No. 6,054,299 to Conrad). Expression can be transient (from approximately several hours to several weeks) or sustained (from several weeks to several months or longer), depending on the particular construct used and the target tissue or cell type. These transgenes can be introduced as linear constructs, circular plasmids, or viral vectors, which can be either integrating or non-integrating vectors. The transgenes can also be constructed to allow inheritance as extrachromosomal plasmids (Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995) 92:1292).

[0432] One or more individual strands of the iRNA can be transcribed from a promoter in an expression vector. When two separate strands are expressed to produce, for example, dsRNA, two separate expression vectors can be co-introduced into the target cells (e.g., by transfection or infection). Alternatively, each individual strand of the dsRNA can be transcribed by a promoter located on the same expression plasmid. In one embodiment, the dsRNA is expressed as an inverted repeat polynucleotide joined by a linker polynucleotide sequence so as to have a stem-loop structure.

[0433] iRNA expression vectors are generally DNA plasmids or viral vectors. Recombinant constructs for the expression of the iRNAs described herein can be produced using an expression vector compatible with eukaryotic cells, preferably an expression vector compatible with vertebrate cells. Expression vectors for eukaryotic cells are well known in the art and are available from many commercial sources. Such vectors typically provide convenient restriction sites for insertion of the desired nucleic acid segment. Delivery of the iRNA expression vector can be by systemic delivery, for example, by intravenous or intramuscular administration, or by readministration to the patient after administration to target cells transplanted from the patient, or by any other means that allows introduction into the desired target cells.

[0434] The iRNA expression plasmid can be transfected into target cells as a complex with a cationic lipid carrier (e.g., Oligofectamine) or a non-cationic lipid-based carrier (e.g., Transit-TKO™). Multiple lipid transfections for knockdown via iRNAs targeting different regions of the target RNA over a period of more than one week are also envisioned by the present invention. Success of the introduction of the vector into the host cell can be monitored using various known methods. For example, transient transfection can be shown using a reporter such as a fluorescent marker such as green fluorescent protein (GFP). Stable transfection of cells ex vivo can be ensured by using a marker that confers resistance to a specific environmental factor (e.g., an antibiotic and a drug) such as hygromycin B on the transfected cells.

[0435] Viral vector systems that can be used with the methods and compositions described herein include, but are not limited to, (a) adenoviral vectors; (b) retroviral vectors including, but not limited to, lentiviral vectors, Moloney murine leukemia virus, etc.; (c) adeno-associated viral vectors; (d) herpes simplex virus vectors; (e) SV40 vectors; (f) polyomavirus vectors; (g) papillomavirus vectors; (h) picornavirus vectors; (i) orthopox, e.g., vaccinia virus vectors or poxvirus vectors such as fowlpox, e.g., canarypox or fowl pox; and (j) helper-dependent or attenuated adenoviruses. Replication-deficient viruses may also be advantageous. Different vectors will either integrate into the genome of the cell or not. The construct may contain viral sequences for transfection, if desired. Alternatively, the construct may be incorporated into vectors capable of episomal replication, such as EPV and EBV vectors. Constructs for recombinant expression of iRNA generally require regulatory elements, such as promoters, enhancers, etc., to ensure expression of the iRNA in the target cell. Other aspects to be considered for the vectors and constructs are further described below.

[0436] Vectors useful for delivery of iRNA will include regulatory elements (promoters, enhancers, etc.) sufficient for expression of the iRNA in the desired target cell or tissue. The regulatory elements can be selected to provide either constitutive or regulatable / inducible expression.

[0437] The expression of iRNA can be precisely regulated, for example, by using inducible regulatory sequences that are sensitive to specific physiological regulators, such as blood glucose levels or hormones (Docherty et al., 1994, FASEB J. 8:20-24). Such inducible expression systems suitable for controlling the expression of dsRNA in cells or mammals include, for example, regulation by ecdysone, estrogen, progesterone, tetracycline, chemical inducers of dimerization, and isopropyl-β-D1-thiogalactopyranoside (IPTG). One of ordinary skill in the art will be able to select appropriate regulatory / promoter sequences based on the intended use of the iRNA transgene.

[0438] Viral vectors containing nucleic acid sequences encoding iRNA can be used. For example, retroviral vectors can be used (see Miller et al., Meth. Enzymol. 217:581-599 (1993)). These retroviral vectors contain the components necessary for proper packaging of the viral genome and integration into host cell DNA. The nucleic acid sequence encoding iRNA is cloned into one or more vectors that facilitate delivery of the nucleic acid to the patient. Further details regarding retroviral vectors can be found, for example, in Boesen et al., Biotherapy 6:291-302 (1994), which describes the use of a retroviral vector to deliver the mdr1 gene to hematopoietic stem cells to make them more resistant to chemotherapy. Other references demonstrating the use of retroviral vectors in gene therapy are Clowes et al., J. Clin. Invest. 93:644-651 (1994); Kiem et al., Blood 83:1467-1473 (1994); Salmons and Gunzberg, Human Gene Therapy 4:129-141 (1993); and Grossman and Wilson, Curr. Opin. in Genetics and Devel. 3:110-114 (1993). Lentiviral vectors contemplated for use include, for example, the HIV-based vectors described in U.S. Patent Nos. 6,143,520; 5,665,557; and 5,981,276, which are hereby incorporated by reference herein.

[0439] Adenoviruses are also contemplated for use in the delivery of the iRNAs of the present invention. Adenoviruses are, for example, particularly attractive vehicles for delivering genes to the respiratory epithelium. Adenoviruses are naturally infective to the respiratory epithelium and cause a mild disease. Other targets for adenovirus-based delivery systems are the liver, the central nervous system, endothelial cells, and muscle. Adenoviruses have the advantage of being able to infect non-dividing cells. Kozarsky and Wilson, Current Opinion in Genetics and Development 3:499-503 (1993) presents an overview of adenovirus-based gene therapy. Bout et al., Human Gene Therapy 5:3-10 (1994) showed the use of an adenovirus vector to transfer genes to the respiratory epithelium of rhesus monkeys. Other examples of the use of adenoviruses in gene therapy can be found in Rosenfeld et al., Science 252:431-434 (1991); Rosenfeld et al., Cell 68:143-155; Mastrangeli et al. (1992), J. Clin. Invest. 91:225-234 (1993); PCT Publication WO 94 / 12649 pamphlet; and Wang et al., Gene Therapy 2:775-783 (1995). An AV vector suitable for expressing the iRNAs taken up by the present invention, a method for constructing a recombinant AV vector, and a method for delivering the vector into target cells are described in Xia H et al. (2002), Nat. Biotech. 20:1006-1010.

[0440] Adeno-associated virus (AAV) vectors can also be used to deliver the iRNA of the present invention (Walsh et al., Proc. Soc. Exp. Biol. Med. 204:289-300 (1993); U.S. Patent No. 5,436,146). In one embodiment, the iRNA can be expressed as two separate complementary single-stranded RNA molecules from a recombinant AAV vector having, for example, either a U6 or H1 RNA promoter, or a cytomegalovirus (CMV) promoter. AAV vectors suitable for expressing the dsRNA taken up by the present invention, methods for constructing recombinant AV vectors, and methods for delivering the vectors into target cells are described in Samulski R et al. (1987), J. Virol. 61:3096-3101; Fisher K J et al. (1996), J. Virol, 70:520-532; Samulski R et al. (1989), J. Virol. 63:3822-3826; U.S. Patent No. 5,252,479; U.S. Patent No. 5,139,941; International Patent Application No. WO 94 / 13788 pamphlet; and International Patent Application No. WO 93 / 24641 pamphlet, the entire disclosures of which are incorporated herein by reference.

[0441] Another viral vector suitable for delivery of the iRNA of the present invention is a poxvirus such as vaccinia virus, for example, an attenuated vaccinia such as Modified Virus Ankara (MVA) or NYVAC, or an avipox such as fowlpox or canarypox.

[0442] The tropism of viral vectors can be modified by pseudotyping the vector using envelope proteins or other surface antigens from other viruses, or by replacing different viral capsid proteins as needed. For example, lentiviral vectors can be pseudotyped using surface proteins from vesicular stomatitis virus (VSV), rabies, Ebola, Mokola, etc. AAV vectors can be engineered to target different cells by manipulating the vector to express different capsid protein serotypes. See, for example, Rabinowitz J E et al. (2002), J Virol 76:791-801, the entire disclosure of which is incorporated herein by reference.

[0443] Pharmaceutical formulations of the vector can contain the vector in an acceptable diluent, or can contain a sustained release matrix in which the gene delivery vehicle is embedded. Alternatively, when a complete gene delivery vector, such as a retroviral vector, can be produced intact from recombinant cells, the pharmaceutical formulation can contain one or more cells that produce the gene delivery system.

[0444] V. Pharmaceutical Compositions of the Invention The present invention also includes pharmaceutical compositions and formulations containing the iRNA of the present invention. In one embodiment, there is also provided herein a pharmaceutical composition containing the iRNA described herein and a pharmaceutically acceptable carrier.

[0445] As used herein, the term "pharmaceutically acceptable" refers to compounds, materials, compositions, and / or dosage forms that, within the scope of sound medical judgment, are suitable for use in contact with the tissues of human and animal subjects without excessive toxicity, irritation, allergic response, or other problems or complications, commensurate with a reasonable benefit / risk ratio.

[0446] As used herein, the phrase "pharmaceutically acceptable carrier" means a pharmaceutically acceptable material, composition, or vehicle such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricants, talc, magnesium, calcium stearate or zinc stearate, or stearic acid), or a solvent encapsulating material involved in carrying or transporting a compound to or from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject to be treated. Some examples of materials that can serve as pharmaceutically acceptable carriers are: (1) sugars such as lactose, glucose, and sucrose; (2) starches such as corn starch and potato starch; (3) celluloses and their derivatives such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; (4) tragacanth powder; (5) malt; (6) gelatin; (7) lubricants such as magnesium state, sodium lauryl sulfate, and talc; (8) excipients such as cocoa butter and suppository wax; (9) oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; (10) glycols such as propylene glycol; (11) polyols such as glycerin, sorbitol, mannitol, and polyethylene glycol; (12) esters such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free distilled water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffering solutions; (21) polyesters, polycarbonates, and / or polyanhydrides; (22) bulking agents such as polypeptides and amino acids; (23) serum components such as serum albumin, HDL, and LDL; and (22) other non-toxic compatible substances used in pharmaceutical formulations.

[0447] The pharmaceutical composition containing iRNA is useful for treating diseases or disorders related to the expression or activity of C5 gene, such as diseases associated with complement component C5. Such pharmaceutical compositions are formulated based on the mode of delivery. One example is a composition formulated for systemic administration via parenteral administration, such as subcutaneous (SC) or intravenous (IV) delivery. Another example is a composition formulated for direct delivery to the brain parenchyma by injection into the brain, such as by continuous pump infusion. The pharmaceutical composition of the present invention can be administered in a dosage sufficient to inhibit the expression of C5 gene. Generally, a preferred dosage of the iRNA of the present invention ranges from about 0.001 to about 200.0 milligrams per kilogram of the recipient's body weight per day, generally in the range of about 1 to 50 mg per kilogram of body weight per day. For example, dsRNA can be administered at about 0.01 mg / kg, about 0.05 mg / kg, about 0.5 mg / kg, about 1 mg / kg, about 1.5 mg / kg, about 2 mg / kg, about 3 mg / kg, about 10 mg / kg, about 20 mg / kg, about 30 mg / kg, about 40 mg / kg, or about 50 mg / kg per single administration.

[0448] For example, dsRNA can be administered at a dosage of about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8.8, 9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, or about 10 mg / kg. Intermediate values and ranges of the values described are also intended to be part of the present invention.

[0449] In another embodiment, the dsRNA is from about 0.1 to about 50 mg / kg, about 0.25 to about 50 mg / kg, about 0.5 to about 50 mg / kg, about 0.75 to about 50 mg / kg, about 1 to about 50 mg / mg, about 1.5 to about 50 mg / kb, about 2 to about 50 mg / kg, about 2.5 to about 50 mg / kg, about 3 to about 50 mg / kg, about 3.5 to about 50 mg / kg, about 4 to about 50 mg / kg, about 4.5 to about 50 mg / kg, about 5 to about 50 mg / kg, about 7.5 to about 50 mg / kg, about 10 to about 50 mg / kg, about 15 to about 50 mg / kg, about 20 to about 50 mg / kg, about 20 to about 50 mg / kg, about 25 to about 50 mg / kg, about 25 to about 50 mg / kg, about 30 to about 50 mg / kg, about 35 to about 50 mg / kg, about 40 to about 50 mg / kg, about 45 to about 50 mg / kg, about 0.1 to about 45 mg / kg, about 0.25 to about 45 mg / kg, about 0.5 to about 45 mg / kg, about 0.75 to about 45 mg / kg, about 1 to about 45 mg / mg, about 1.5 to about 45 mg / kb, about 2 to about 45 mg / kg, about 2.5 to about 45 mg / kg, about 3 to about 45 mg / kg, about 3.5 to about 45 mg / kg, about 4 to about 45 mg / kg, about 4.5 to about 45 mg / kg, about 5 to about 45 mg / kg, about 7.5 to about 45 mg / kg, about 10 to about 45 mg / kg, about 15 to about 45 mg / kg, about 20 to about 45 mg / kg, about 20 to about 45 mg / kg, about 25 to about 45 mg / kg, about 25 to about 45 mg / kg, about 30 to about 45 mg / kg, about 35 to about 45 mg / kg, about 40 to about 45 mg / kg, about 0.1 to about 40 mg / kg, about 0.25 to about 40 mg / kg, about 0.5 to about 40 mg / kg, about 0.75 to about 40 mg / kg, about 1 to about 40 mg / mg, about 1.5 to about 40 mg / kb, about 2 to about 40 mg / kg, about 2.5 to about 40 mg / kg, about 3 to about 40 mg / kg, about 3.5 to about 40 mg / kg, about 4 to about 40 mg / kg, about 4.5 to about 40 mg / kg, about 5 to about 40 mg / kg, about 7.5 to about 40 mg / kg, about 10 to about 40 mg / kg, about 15 to about 40 mg / kg, about 20 to about 40 mg / kg, about 20 to about 40 mg / kg, about 25 to about 40 mg / kg, about 25 to about 40 mg / kg, about 30 to about 40 mg / kg, about 35 to about 40 mg / kg, about 0.1 to about 30 mg / kg, about 0.25 to about 30 mg / kg, about 0.5 to about 30 mg / kg, about 0.75 to about 30 mg / kg, about 1 to about 30 mg / mg, about 1.5 to about 30 mg / kb, about 2 to about 30 mg / kg, about 2.5 to about 30 mg / kg, about 3 to about 30 mg / kg, about 3.5 to about 30 mg / kg, about 4 to about 30 mg / kg, about 4.5 to about 30 mg / kg, about 5 to about 30 mg / kg, about 7.5 to about 30 mg / kg, about 10 to about 30 mg / kg, about 15 to about 30 mg / kg, about 20 to about 30 mg / kg, about 20 to about 30 mg / kg, about 25 to about 30 mg / kg, about 0.1 to about 20 mg / kg, about 0.25 to about 20 mg / kg, about 0.5 to about 20 mg / kg, about 0.75 to about 20 mg / kg, about 1 to about 20 mg / mg, about 1.5 to about 20 mg / kb, about 2 to about 20 mg / kg, about 2.5 to about 20 mg / kg, about 3 to about 20 mg / kg, about 3.5 to about 20 mg / kg, about 4 to about 20 mg / kg, about 4.5 to about 20 mg / kg, about 5 to about 20 mg / kg, about 7.5 to about 20 mg / kg, about 10 to about 20 mg / kg, or about 15 to about 20 mg / kg, and is administered at the dosage. Intermediate values and ranges of the recited values are also intended to be part of the present invention.

[0450] For example, the dsRNA can be administered at a dosage of about 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, or about 10 mg / kg. Intermediate values and ranges of the recited values are also intended to be part of the present invention.

[0451] In another embodiment, the dsRNA is from about 0.5 to about 50 mg / kg, about 0.75 to about 50 mg / kg, about 1 to about 50 mg / mg, about 1.5 to about 50 mg / kb, about 2 to about 50 mg / kg, about 2.5 to about 50 mg / kg, about 3 to about 50 mg / kg, about 3.5 to about 50 mg / kg, about 4 to about 50 mg / kg, about 4.5 to about 50 mg / kg, about 5 to about 50 mg / kg, about 7.5 to about 50 mg / kg, about 10 to about 50 mg / kg, about 15 to about 50 mg / kg, about 20 to about 50 mg / kg, about 20 to about 50 mg / kg, about 25 to about 50 mg / kg, about 25 to about 50 mg / kg, about 30 to about 50 mg / kg, about 35 to about 50 mg / kg, about 40 to about 50 mg / kg, about 45 to about 50 mg / kg, about 0.5 to about 45 mg / kg, about 0.75 to about 45 mg / kg, about 1 to about 45 mg / mg, about 1.5 to about 45 mg / kb, about 2 to about 45 mg / kg, about 2.5 to about 45 mg / kg, about 3 to about 45 mg / kg, about 3.5 to about 45 mg / kg, about 4 to about 45 mg / kg, about 4.5 to about 45 mg / kg, about 5 to about 45 mg / kg, about 7.5 to about 45 mg / kg, about 10 to about 45 mg / kg, about 15 to about 45 mg / kg, about 20 to about 45 mg / kg, about 20 to about 45 mg / kg, about 25 to about 45 mg / kg, about 25 to about 45 mg / kg, about 30 to about 45 mg / kg, about 35 to about 45 mg / kg, about 40 to about 45 mg / kg, about 0.5 to about 40 mg / kg, about 0.75 to about 40 mg / kg, about 1 to about 40 mg / mg, about 1.5 to about 40 mg / kb, about 2 to about 40 mg / kg, about 2.5 to about 40 mg / kg, about 3 to about 40 mg / kg, about 3.5 to about 40 mg / kg, about 4 to about 40 mg / kg, about 4.5 to about 40 mg / kg, about 5 to about 40 mg / kg, about 7.5 to about 40 mg / kg, about 10 to about 40 mg / kg, about 15 to about 40 mg / kg, about 20 to about 40 mg / kg, about 20 to about 40 mg / kg, about 25 to about 40 mg / kg, about 25 to about 40 mg / kg, about 30 to about 40 mg / kg, about 35 to about 40 mg / kg, about 0.5 to about 30 mg / kg, about 0.75 to about 30 mg / kg, about 1 to about 30 mg / mg, about 1.5 to about 30 mg / kb, about 2 to about 30 mg / kg, about 2.5 to about 30 mg / kg, about 3 to about 30 mg / kg, about 3.5 to about 30 mg / kg, about 4 to about 30 mg / kg, about 4.5 to about 30 mg / kg, about 5 to about 30 mg / kg, about 7.It is administered at a dose of 5 to about 30 mg / kg, about 10 to about 30 mg / kg, about 15 to about 30 mg / kg, about 20 to about 30 mg / kg, about 20 to about 30 mg / kg, about 25 to about 30 mg / kg, about 0.5 to about 20 mg / kg, about 0.75 to about 20 mg / kg, about 1 to about 20 mg / mg, about 1.5 to about 20 mg / kb, about 2 to about 20 mg / kg, about 2.5 to about 20 mg / kg, about 3 to about 20 mg / kg, about 3.5 to about 20 mg / kg, about 4 to about 20 mg / kg, about 4.5 to about 20 mg / kg, about 5 to about 20 mg / kg, about 7.5 to about 20 mg / kg, about 10 to about 20 mg / kg, or about 15 to about 20 mg / kg. In one embodiment, the dsRNA is administered at a dose of about 10 mg / kg to about 30 mg / kg. Intermediate values and ranges of the recited values are also intended to be part of the present invention.

[0452] For example, a single therapeutic dose of iRNA, such as about 0.1, 0.125, 0.15, 0.175, 0.2, 0.225, 0.25, 0.275, 0.3, 0.325, 0.35, 0.375, 0.4, 0.425, 0.45, 0.475, 0.5, 0.525, 0.55, 0.575, 0.6, 0.625, 0.65, 0.675, 0.7, 0.725, 0.75, 0.775, 0.8, 0.825, 0.85, 0.875, 0.9, 0.925, 0.95, 0.975, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 29.5, 30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or about 50 mg / kg, may be administered, for example, subcutaneously or intravenously. Values intermediate to and ranges of the recited values are also intended to be part of the present invention.

[0453] In one embodiment, a therapeutically effective amount of iRNA, such as a dose of about 0.1, 0.125, 0.15, 0.175, 0.2, 0.225, 0.25, 0.275, 0.3, 0.325, 0.35, 0.375, 0.4, 0.425, 0.45, 0.475, 0.5, 0.525, 0.55, 0.575, 0.6, 0.625, 0.65, 0.675, 0.7, 0.725, 0.75, 0.775, 0.8, 0.825, 0.85, 0.875, 0.9, 0.925, 0.95, 0.975, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 29.5, 30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or about 50 mg / kg, is administered subcutaneously or intravenously in multiple doses. The dosing schedule for multiple doses can include daily administration of a therapeutically effective amount of iRNA over a period of 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, or more.

[0454] In other embodiments, a therapeutic amount of iRNA, such as a dose of about 0.1, 0.125, 0.15, 0.175, 0.2, 0.225, 0.25, 0.275, 0.3, 0.325, 0.35, 0.375, 0.4, 0.425, 0.45, 0.475, 0.5, 0.525, 0.55, 0.575, 0.6, 0.625, 0.65, 0.675, 0.7, 0.725, 0.75, 0.775, 0.8, 0.825, 0.85, 0.875, 0.9, 0.925, 0.95, 0.975, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 29.5, 30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or about 50 mg / kg, is administered subcutaneously or intravenously by repeated dosing. The dosing schedule for repeated dosing may include administration of a therapeutic amount of iRNA at regular intervals, such as once a day, every three days, every four days, twice a week, once a week, every other week, or once a month.

[0455] The pharmaceutical composition can be administered by intravenous infusion over a period of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21, 22, 23, 24 minutes, or about 25 minutes, etc. The administration can be repeated regularly, for example, weekly, bi-weekly (i.e., every two weeks) for one month, two months, three months, four months or more. After the initial treatment plan, the therapeutic agent can be administered at a less frequent rate. For example, after administration weekly or bi-weekly for three months, the administration can be repeated once a month for six months, one year or more.

[0456] The pharmaceutical composition can be administered once a day, or the iRNA can be administered as two, three or more sub-doses at appropriate intervals throughout the day, or even via continuous infusion or delivery via a sustained release formulation. In that case, the iRNA contained in each sub-dose needs to be correspondingly less in amount to achieve the total daily dose. The dosage unit can also be formulated for delivery over several days using, for example, conventional sustained release formulations that provide sustained release of the iRNA over a period of several days. Sustained release formulations are well known in the art and are particularly useful for delivering drugs to specific sites and can thus be used in conjunction with the drugs of the present invention. In this embodiment, the dosage unit contains a corresponding multiple of the daily dose.

[0457] In other embodiments, a single administration of the pharmaceutical composition can be long-lasting, such that subsequent doses are administered at intervals of 3, 4, or 5 days or less, or 1, 2, 3, or 4 weeks or less. In certain embodiments of the present invention, a single administration of the pharmaceutical composition of the present invention is administered once a week. In other embodiments of the present invention, a single administration of the pharmaceutical composition of the present invention is administered once every two months (bi-monthly).

[0458] One of ordinary skill in the art will recognize that certain factors, including but not limited to the severity of the disease or disorder, previous treatments, the overall health and / or age of the subject, and other existing diseases, can affect the dosage and duration necessary to effectively treat the subject. Further, treatment of a subject with a therapeutically effective amount of the composition can include a single treatment or a series of treatments. Effective dosages and in vivo half-lives for the individual iRNAs encompassed by the present invention can be approximated using conventional methodologies or based on in vivo testing using appropriate animal models as described elsewhere herein.

[0459] Advances in mouse genetics have generated many mouse models for the study of various human diseases, such as disorders that can benefit from reduced expression of C5. Such models can be used for in vivo testing of iRNAs and for determining therapeutically effective dosages. Suitable mouse models are known in the art and include, for example, the collagen-induced arthritis mouse model (Courtenay, J.S., et al. (1980) Nature 283, 666-668), myocardial ischemia (Homeister JW and Lucchesi BR (1994) Annu Rev Pharmacol Toxicol 34:17-40), the ovalbumin-induced asthma mouse model (e.g., Tomkinson A., et al. (2001). J. Immunol. 166, 5792-5800), (NZB×NZW)F1, MRL / Fas lpr(MRL / lpr) and BXSB mouse models (Theofilopoulos, A. N. and Kono, D. H. 1999. Murine lupus models: gene - specific and genome - wide studies. In Lahita R. G., ed., Systemic Lupus Erythematosus, 3rd edn, p. 145. Academic Press, San Diego, CA), mouse aHUS models (Goicoechea de Jorge et al. (2011) The development of atypical hemolytic uremic syndrome depeds on complement C5, J Am Soc Nephrol 22:137 - 145) can be mentioned.

[0460] The pharmaceutical composition of the present invention can be administered in several ways depending on whether local or systemic treatment is required and the site to be treated. Administration can be local administration (e.g., by transdermal patch), pulmonary administration by inhalation or insufflation of powder or aerosol, for example, by nebulizer, etc.; intratracheal, intranasal, epidermal and transdermal, oral or parenteral administration. Parenteral administration includes intravenous, intra - arterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subcutaneous administration, for example, by an implant device; or intracranial administration by, for example, interstitial, intrathecal or intraventricular administration.

[0461] iRNA can be delivered to target specific tissues such as the liver (e.g., hepatocytes of the liver).

[0462] Pharmaceutical compositions and formulations for topical administration include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, aerosols, solutions and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like are necessary or may be desired. Coated condoms, gloves and the like may also be useful. Suitable topical formulations include those in which the iRNA characterizing the present invention is a mixture with topical delivery agents such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Suitable lipids and liposomes include neutral (e.g., dioleoyl phosphatidylethanolamine DOPE, dimyristoyl phosphatidylcholine DMPC, distearoyl phosphatidylcholine), anionic (e.g., dimyristoyl phosphatidylglycerol DMPG) and cationic (e.g., dioleoyl tetramethylaminopropyl DOTAP and dioleoyl phosphatidylethanolamine DOTMA). The iRNA characterizing the present invention can be encapsulated in liposomes or can form complexes with liposomes, particularly cationic liposomes. Alternatively, the iRNA may be complexed with lipids, particularly cationic lipids. Suitable fatty acids and esters include, but are not limited to, arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, acylcarnitine, acylcholine, or C 1~20 alkyl esters (e.g., isopropyl myristate IPM), monoglycerides, diglycerides or pharmaceutically acceptable salts thereof). Topical formulations are described in detail in U.S. Patent No. 6,747,014, which is incorporated herein by reference.

[0463] A. iRNA Formulations Containing Membrane Molecular Assemblies The iRNA for use in the compositions and methods of the present invention can be formulated for delivery in membrane molecular assemblies, such as liposomes or micelles. As used herein, the term "liposome" refers to vesicles composed of amphiphilic lipids arranged in at least one bilayer, such as one bilayer or multiple bilayers. Liposomes include monolayer and multilayer vesicles having a membrane formed from lipophilic materials and an aqueous interior. The aqueous portion contains the iRNA composition. The lipophilic material separates the aqueous exterior from the aqueous interior and usually does not contain the iRNA composition, but may in some cases. Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Since the liposome membrane is structurally similar to the biological membrane, when the liposome adheres to the tissue, the bilayer of the liposome fuses with the bilayer of the cell membrane. As the fusion of the liposome and the cell progresses, the internal aqueous contents containing the iRNA are delivered to the cell, where the iRNA can specifically bind to the target RNA and mediate RNAi. In some cases, the liposome is also specifically targeted, for example, to direct the iRNA to a specific cell type.

[0464] Liposomes containing RNAi agents can be prepared by various methods. In one example, the lipid component of the liposome is dissolved in a detergent such that micelles are formed from the lipid component. For example, the lipid component can be an amphiphilic cationic lipid or lipid conjugate. The detergent can have a high critical micelle concentration and can be nonionic. Exemplary detergents include cholate, CHAPS, octyl glucoside, deoxycholate, and lauroyl sarcosine. Next, a preparation of the RNAi agent is added to the micelles containing the lipid component. The cationic groups in the lipid interact with the RNAi agent and condense around the RNAi agent to form liposomes. After condensation, the detergent is removed, for example by dialysis, to obtain a liposomal formulation of the RNAi agent.

[0465] Optionally, a carrier compound that aids condensation can be added during the condensation reaction, for example, by controlled addition. For example, the carrier compound can be a polymer other than nucleic acid (e.g., spermine or spermidine). The pH can also be adjusted to assist condensation.

[0466] A method for generating a stable polynucleotide delivery vehicle incorporating a polynucleotide / cationic lipid complex as a component of the delivery vehicle is further described, for example, in WO 96 / 37194 pamphlet, the entire contents of which are incorporated herein by reference. Liposome formation can also include one or more aspects of the exemplary methods described in Felgner, P. L. et al., Proc. Natl. Acad. Sci. USA 8:7413 - 7417, 1987; U.S. Pat. No. 4,897,355; U.S. Pat. No. 5,171,678; Bangham et al., M. Mol. Biol. 23:238, 1965; Olson et al., Biochim. Biophys. Acta 557:9, 1979; Szoka et al., Proc. Natl. Acad. Sci. 75:4194, 1978; Mayhew et al., Biochim. Biophys. Acta 775:169, 1984; Kim et al., Biochim. Biophys. Acta 728:339, 1983; and Fukunaga et al., Endocrinol. 115:757, 1984. Commonly used techniques for preparing lipid aggregates of appropriate size for use as delivery vehicles include sonication as well as freeze-thawing and extrusion (see, for example, Mayer et al., Biochim. Biophys. Acta 858:161, 1986). If consistently small (50 - 200 nm) and relatively uniform aggregates are desired, microfluidization can be used (Mayhew et al., Biochim. Biophys. Acta 775:169, 1984). These methods are readily adaptable to packaging preparations of RNAi agents into liposomes.

[0467] Liposomes are divided into two major classes. Cationic liposomes are positively charged liposomes that interact with negatively charged nucleic acid molecules to form stable complexes. The positively charged nucleic acid / liposome complexes bind to the negatively charged cell surface and are translocated into the endosome. The acidic pH within the endosome causes the liposomes to rupture and release their contents into the cytoplasm (Wang et al., Biochem. Biophys. Res. Commun., 1987, 147, 980-985).

[0468] pH-sensitive and negatively charged liposomes do not complex with nucleic acids but rather entrap them. Since both the nucleic acid and the lipid are similarly charged, repulsion rather than complex formation occurs. Nevertheless, some nucleic acids are entrapped within the aqueous interior of these liposomes. pH-sensitive liposomes have been used to deliver nucleic acids encoding the thymidine kinase gene to cell monolayers in culture. Expression of the foreign gene was detected in the target cells (Zhou et al., Journal of Controlled Release, 1992, 19, 269~274).

[0469] One major type of liposome composition contains phospholipids other than naturally occurring phosphatidylcholine. For example, neutral liposome compositions can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC). Anionic liposome compositions are generally formed from dimyristoyl phosphatidylglycerol, while anionic membrane-fusing liposomes are formed primarily from dioleoyl phosphatidylethanolamine (DOPE). Other types of liposome compositions are formed from phosphatidylcholine (PC) such as soy PC and egg PC, for example. Other types are formed from mixtures of phospholipids and / or phosphatidylcholine and / or cholesterol.

[0470] Examples of other methods for introducing liposomes into cells in vitro and in vivo include U.S. Patent No. 5,283,185; U.S. Patent No. 5,171,678; International Publication No. 94 / 00569 Pamphlet; International Publication No. 93 / 24640 Pamphlet; International Publication No. 91 / 16024 Pamphlet; Felgner, J. Biol. Chem. 269:2550, 1994; Nabel, Proc. Natl. Acad. Sci. 90:11307, 1993; Nabel, Human Gene Ther. 3:649, 1992; Gershon, Biochem. 32:7143, 1993; and Strauss, EMBO J. 11:417, 1992.

[0471] Nonionic liposome systems, particularly those containing nonionic surfactants and cholesterol, have also been tested and their usefulness in drug delivery to the skin has been determined. Nonionic liposome formulations containing Novasome™ I (glyceryl dilaurate / cholesterol / polyoxyethylene-10-stearyl ether) and Novasome™ II (glyceryl distearate / cholesterol / polyoxyethylene-10-stearyl ether) were used to deliver cyclosporine-A to the dermis of mouse skin. The results showed that such nonionic liposome systems are effective in promoting the deposition of cyclosporine-A into different layers of the skin (Hu et al. S.T.P. Pharma. Sci., 1994, 4(6)466).

[0472] Liposomes also include "sterically stabilized" liposomes, and as used herein this term refers to liposomes containing one or more specified lipids which, when incorporated into the liposome, result in an enhanced circulation lifetime compared to liposomes lacking such specified lipids. Examples of sterically stabilized liposomes are those in which a portion of the vesicle-forming lipid moiety of the liposome is (A) monosialoganglioside G M1Those containing one or more glycolipids such as, or (B) those derivatized by one or more hydrophilic polymers such as polyethylene glycol (PEG) moieties. Without being bound by any particular theory, in the art, with respect to sterically stabilized liposomes containing at least gangliosides, sphingomyelin, or PEG-derivatized lipids, the enhanced circulation half-life of these sterically stabilized liposomes is thought to result from a reduced uptake into cells of the reticuloendothelial system (RES) (Allen et al., FEBS Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53, 3765).

[0473] Various liposomes containing one or more glycolipids are known in the art. Papahadjopoulos et al. (Ann. N.Y. Acad. Sci., 1987, 507, 64) reported the ability of monosialoganglioside G M1 , galactosylceramide sulfate, and phosphatidylinositol to improve the blood half-life of liposomes. These findings were elaborated by Gabizon et al. (Proc. Natl. Acad. Sci. U.S.A., 1988, 85, 6949). Both U.S. Patent No. 4,837,028 to Allen et al. and International Publication No. 88 / 04924 pamphlet disclose liposomes containing (1) sphingomyelin and (2) ganglioside G M1 or galactosylceramide sulfate esters. U.S. Patent No. 5,543,152 (Webb et al.) discloses liposomes containing sphingomyelin. Liposomes containing 1,2-sn-dimyristoylphosphatidylcholine are disclosed in International Publication No. 97 / 13499 pamphlet (Lim et al.).

[0474] In one embodiment, cationic liposomes are used. Cationic liposomes have the advantage of being able to fuse with cell membranes. Non-cationic liposomes cannot fuse with cell membranes as efficiently, but can be taken up by macrophages in vivo and used to deliver RNAi agents to macrophages.

[0475] Further advantages of liposomes include the following: Liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water-soluble and lipid-soluble drugs; liposomes can protect RNAi agents encapsulated within their internal compartments from metabolism and degradation (Rosoff, in “Pharmaceutical Dosage Forms,” Lieberman, Rieger and Banker (Eds.), 1988, volume 1, p. 245). Important considerations in the preparation of liposome formulations are the lipid surface charge, vesicle size, and the aqueous volume of the liposomes.

[0476] Small liposomes can be formed using N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA), a positively charged synthetic cationic lipid, which can spontaneously interact with nucleic acids to form lipid-nucleic acid complexes that can fuse with the negatively charged lipids of the cell membranes of tissue culture cells and result in the delivery of RNAi agents (see, for example, Felgner, P.L. et al., Proc. Natl. Acad. Sci. USA 8:7413-7417, 1987, and U.S. Patent No. 4,897,355 for a description of its use with DOTMA and DNA).

[0477] 1,2-Bis(oleoyloxy)-3-(trimethylammonio)propane (DOTAP), a DOTMA analog, can be used in combination with phospholipids to form DNA complex vesicles. Lipofectin (trademark; Bethesda Research Laboratories, Gaithersburg, Md.) is an effective agent for delivering highly anionic nucleic acids into living tissue culture cells containing positively charged DOTMA liposomes that spontaneously interact with negatively charged polynucleotides to form complexes. When sufficiently positively charged liposomes are used, the net charge of the resulting complex is also positive. The positively charged complexes thus prepared spontaneously adhere to the negatively charged cell surface, fuse with the cell membrane, and efficiently deliver functional nucleic acids, for example, into tissue culture cells. Another commercially available cationic lipid, 1,2-bis(oleoyloxy)-3,3-(trimethylammonio)propane ("DOTAP") (Boehringer Mannheim, Indianapolis, Indiana), differs from DOTMA in that the oleoyl moieties are linked by esters rather than ether bonds.

[0478] Other reported cationic lipid compounds include those conjugated to one of two types of lipids and containing compounds such as 5-carboxyspermidine dioctaoleylamide ("DOGS") (Transfectam (trademark), Promega, Madison, Wis.), and dipalmitoyl phosphatidylethanolamine 5-carboxyspermidine amide ("DPPES"), for example, those conjugated to various moieties containing carboxyspermine (see, for example, U.S. Patent No. 5,171,678).

[0479] Another cationic lipid conjugate involves derivatization of lipids with cholesterol (``DC-Chol'') formulated into liposomes in combination with DOPE (see Gao, X. and Huang, L., Biochim. Biophys. Res. Commun. 179:280, 1991). Lipopolyllysine, made by conjugating polylysine to DOPE, has been reported to be effective for transfection in the presence of serum (Zhou, X. et al., Biochim. Biophys. Acta 1065:8, 1991). In certain cell lines, these liposomes containing conjugated cationic lipids are said to exhibit lower toxicity and provide more efficient transfection than DOTMA-containing compositions. Other commercially available cationic lipid products include DMRIE and DMRIE-HP (Vical, La Jolla, California) and Lipofectamine (DOSPA) (Life Technology, Inc., Gaithersburg, Maryland). Other cationic lipids suitable for delivery of oligonucleotides are described in WO 98 / 39359 and WO 96 / 37194.

[0480] Liposomal formulations are particularly suitable for topical administration, and liposomes exhibit several advantages over other formulations. Such advantages include a reduction in side effects associated with high systemic absorption rates of the administered drug, an increase in the accumulation of the administered drug at the desired target, and the ability to administer RNAi agents to the skin. In certain embodiments, liposomes are used to deliver RNAi agents to epidermal cells and also to facilitate the penetration of RNAi agents into dermal tissue, such as the skin. For example, liposomes can be applied topically. Topical delivery of drugs formulated as liposomes has been reported (see, for example, Weiner et al., Journal of Drug Targeting, 1992, vol. 2, 405-410 and du Plessis et al., Antiviral Research, 18, 1992:259-265; Mannino, R.J. and Fould-Fogerite, S., Biotechniques 6:682-690, 1988; Itani, T. et al., Gene 56:267-276, 1987; Nicolau, C. et al. (1987) Meth. Enz. 149:157-176, 1987; Straubinger, R.M. and Papahadjopoulos, D. Meth. Enz. 101:512-527, 1983; Wang, C.Y. and Huang, L., Proc. Natl. Acad. Sci. USA 84:7851-7855, 1987).

[0481] In addition, nonionic liposomal systems, particularly those containing nonionic surfactants and cholesterol, have been investigated to determine their usefulness in drug delivery to the skin. Nonionic liposomal formulations containing Novasome I (glyceryl dilaurate / cholesterol / polyoxyethylene-10-stearyl ether) and Novasome II (glyceryl distearate / cholesterol / polyoxyethylene-10-stearyl ether) have been used to deliver drugs to the dermis of mouse skin. Such formulations containing RNAi agents are useful for treating skin diseases.

[0482] Liposomes containing iRNA can be made to be highly deformable. Such deformability can enable the liposomes to permeate pores smaller than the average radius of the liposomes. For example, transfersomes are a type of deformable liposome. Transfersomes can be made by adding a surface activating agent, usually a surfactant, to a standard liposome composition. Transfersomes containing an RNAi agent can be delivered, for example, by subcutaneous infection, to deliver the RNAi agent to keratinocytes of the skin. To cross intact mammalian skin, the lipid vesicles must permeate a series of micropores each having a diameter of less than 50 nm under the influence of a suitable transdermal gradient. Further, due to their lipid properties, these transfersomes can be self-optimizing (e.g., adaptable to the shape of pores), self-healing, and in many cases, reach their target without breaking, and in many cases, can be self-loading.

[0483] Other formulations suitable for the present invention are described in U.S. Provisional Patent Application No. 61 / 018,616, filed on January 2, 2008; U.S. Provisional Patent Application No. 61 / 018,611, filed on January 2, 2008; U.S. Provisional Patent Application No. 61 / 039,748, filed on March 26, 2008; U.S. Provisional Patent Application No. 61 / 047,087, filed on April 22, 2008; and U.S. Provisional Patent Application No. 61 / 051,528, filed on May 8, 2008. The formulations suitable for the present invention are also described in PCT Application No. PCT / US2007 / 080331, filed on October 3, 2007.

[0484] Transferosomes are yet another type of liposomes and are highly deformable lipid aggregates that are attractive candidates as drug delivery vehicles. Transferosomes can also be described as lipid droplets, which, due to their high deformability, can easily penetrate through pores smaller than the droplets. Transferosomes are adaptable to the environment in which they are used, e.g., self-optimizing (adapting to the shape of pores in the skin), self-healing, often reach their targets without subdivision, and are often self-loading. To prepare transferosomes, it is usually possible to add a surface edge activator, which is a surfactant, to a standard liposome composition. Transferosomes have been used to deliver serum albumin to the skin. Transferosome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.

[0485] Surfactants have found wide use in formulations such as emulsions (including microemulsions) and liposomes. The most common method for classifying and ranking a number of different types of both natural and synthetic surfactants is by use of the hydrophilic / lipophilic balance (HLB). The nature of the hydrophilic group (also known as the “head”) provides the most useful means of classifying the different surfactants used in formulations (Rieger, “Pharmaceutical Dosage Forms”, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

[0486] When the surfactant molecules are not ionized, this surfactant is classified as a nonionic surfactant. Nonionic surfactants find wide applications in pharmaceuticals and beauty products and can be used over a wide range of pH values. Generally, their HLB values range from 2 to about 18 depending on their structures. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Also included in this class are nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated / propoxylated block polymers. Polyoxyethylene surfactants are the most popular members of the nonionic surfactant class.

[0487] When the surfactant molecules carry a negative charge when dissolved or dispersed in water, this surfactant is classified as anionic. Anionic surfactants include carboxylates such as soaps, acyl lactylates, acylamides of amino acids, sulfates such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkylbenzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates. The most important members of the anionic surfactant class are alkyl sulfates and soaps.

[0488] When the surfactant molecules carry a positive charge when dissolved or dispersed in water, this surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. Quaternary ammonium salts are the most used members of this class.

[0489] When the surfactant molecules have the ability to carry either a positive or a negative charge, this surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkyl betaines, and phosphatides.

[0490] The use of surfactants in pharmaceutical products, formulations, and emulsions has been reviewed (Rieger, “Pharmaceutical Dosage Forms”, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

[0491] The iRNA for use in the method of the present invention can also be provided as a micellar formulation. As used herein, a “micelle” is defined as a particular type of molecular aggregate in which all of the hydrophobic portions of the molecules are oriented inwardly and the hydrophilic portions remain in contact with the surrounding aqueous phase, with the amphiphilic molecules arranged in a spherical structure. When the environment is hydrophobic, the reverse arrangement exists.

[0492] A mixed micellar formulation suitable for delivery through a transdermal membrane can be prepared by mixing an aqueous solution of an siRNA composition, an alkali metal C8-C 22 alkyl sulfate, and a micelle-forming compound. Exemplary micelle-forming compounds include lecithin, hyaluronic acid, pharmaceutically acceptable salts of hyaluronic acid, glycolic acid, lactic acid, chamomile extract, cucumber extract, oleic acid, linoleic acid, linolenic acid, monoolein, monooleate, monolaurate, borage oil, evening primrose oil, menthol, trihydroxyoxocholanyl glycine and pharmaceutically acceptable salts thereof, glycerin, polyglycerin, lysine, polylysine, triolein, polyoxyethylene ether and its analogs, polydecanol alkyl ether and its analogs, chenodeoxycholate, deoxycholate, and mixtures thereof. The micelle-forming compound may be added simultaneously with or after the addition of the alkali metal alkyl sulfate. Mixed micelles are formed by mixing substantially any kind of the components, but are formed by vigorous mixing to provide smaller-sized micelles.

[0493] In one method, a first micelle composition containing an siRNA composition and at least an alkali metal alkyl sulfate is prepared. Next, the first micelle composition is mixed with at least three micelle-forming compounds to form a mixed micelle composition. In another method, the micelle composition is prepared by mixing the siRNA composition, the alkali metal alkyl sulfate, and at least one of the micelle-forming compounds, and then adding the remaining micelle-forming compounds while mixing vigorously.

[0494] Phenol and / or m-cresol may be added to the mixed micelle composition to stabilize the formulation and protect against bacterial growth. Alternatively, phenol and / or m-cresol may be added together with the micelle-forming components. An isotonic agent such as glycerin may also be added after the formation of the mixed micelle composition.

[0495] In the delivery of the micelle formulation as a spray, the formulation can be placed in an aerosol dispenser, and the dispenser is filled with a propellant. The propellant under pressure is in liquid form in the dispenser. The ratio of the components is adjusted so that the aqueous phase and the propellant phase become one, i.e., so that there is one phase. If two phases are present, for example, it is necessary to shake the dispenser before dosing a part of the contents by a metering valve. The dosing dose of the pharmaceutical is sprayed from the metering valve in a fine spray form.

[0496] The propellant can include hydrogen-containing chlorofluorocarbons, hydrogen-containing fluorocarbons, dimethyl ether, and diethyl ether. In certain embodiments, HFA 134a (1,1,1,2-tetrafluoroethane) may be used.

[0497] The specific concentration of the essential components can be determined by relatively simple experiments. For absorption through the oral cavity, it is often desirable to increase, for example, at least two-fold or three-fold the dosage for administration by injection or via the gastrointestinal tract.

[0498] B. Lipid Particles The iRNA, i.e., dsRNA, of the present invention may be completely encapsulated in a lipid formulation, such as in an LNP, or may form other nucleic acid-lipid particles.

[0499] As used herein, the term "LNP" refers to stable nucleic acid-lipid particles. LNPs typically include a cationic lipid, a non-cationic lipid, and a lipid that prevents aggregation of the particles (e.g., a PEG-lipid conjugate). LNPs have an extended circulation lifetime after intravenous (i.v.) injection and accumulate at distal sites (e.g., sites physically separated from the site of administration), and are thus extremely useful for systemic application. LNPs include "pSPLP", which contains an encapsulated condensing agent-nucleic acid complex as shown in PCT Publication No. WO 00 / 03683 pamphlet. The particles of the present invention typically have an average particle size of about 50 nm to about 150 nm, more typically about 60 nm to about 130 nm, more typically about 70 nm to about 110 nm, and most typically about 70 nm to about 90 nm, and are substantially non-toxic. In addition, the nucleic acid is resistant to nuclease degradation in an aqueous solution when present in the nucleic acid-lipid particles of the present invention. Nucleic acid-lipid particles and methods for their preparation are disclosed, for example, in U.S. Patent No. 5,976,567; U.S. Patent No. 5,981,501; U.S. Patent No. 6,534,484; U.S. Patent No. 6,586,410; U.S. Patent No. 6,815,432; U.S. Patent Application Publication No. 2010 / 0324120 and PCT Publication No. WO 96 / 40964 pamphlet.

[0500] In one embodiment, the lipid-to-drug ratio (mass / mass ratio) (e.g., the lipid-to-dsRNA ratio) will be in the range of about 1:1 to about 50:1, about 1:1 to about 25:1, about 3:1 to about 15:1, about 4:1 to about 10:1, about 5:1 to about 9:1, or about 6:1 to about 9:1. Intermediate ranges within the above ranges are also considered to be part of the present invention.

[0501] Cationic lipids include, for example, N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(I-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), N-(I-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-dimethyl-2,3-dioleyloxy)propylamine (DODMA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), 1,2-dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1,2-dilinoley (Dilinoley) oxy-3-(dimethylamino)acetoxypropane (DLin-DAC), 1,2-dilinoley (Dilinoley) oxy-3-morpholinopropane (DLin-MA), 1,2-dilinoleoyl-3-dimethylaminopropane (DLinDAP), 1,2-dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA), 1-linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1,2-dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.Cl), 1,2-dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP.(Cl), 1,2-dilinoleyl-oxy-3-(N-methylpiperazino)propane (DLin-MPZ), or 3-(N,N-dilinoleylamino)-1,2-propanediol (DLinAP), 3-(N,N-dioleylamino)-1,2-propanediol (DOAP), 1,2-dilinoleyloxy-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), 1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLinDMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA) or an analog thereof, (3aR,5s,6aS)-N,N-dimethyl-2,2-bis((9Z,12Z)-octadeca-9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine (ALN100), (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraene-19-yl 4-(dimethylamino)butanoate (MC3), 1,1'-(2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1-yl)ethylazanediyl)didodecan-2-ol (Tech G1), or a mixture thereof may be used. The cationic lipid may consist of about 20 mol% to about 50 mol%, or about 40 mol% of the total lipids present in the particles.

[0502] In another embodiment, the compound 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane can be used to prepare lipid-siRNA nanoparticles. The synthesis of 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane is described in U.S. Provisional Patent Application No. 61 / 107,998, filed Oct. 23, 2008, which is incorporated herein by reference.

[0503] In one embodiment, the lipid-siRNA particles comprise 40% 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane: 10% DSPC: 40% cholesterol: 10% PEG-C-DOMG (mole percent), and have a particle size of 63.0 ± 20 nm and an siRNA / lipid ratio of 0.027.

[0504] The ionic / non-cationic lipid can be an anionic lipid or a neutral lipid including, but not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyl oleoyl phosphatidylcholine (POPC), palmitoyl oleoyl phosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidylethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl-phosphatidy(phosphatidy)ethanolamine (SOPE), cholesterol, or a mixture thereof. When cholesterol is included, the non-cationic lipid may be about 5 mol% to about 90 mol%, about 10 mol%, or about 58 mol% of the total lipids present in the particles.

[0505] Conjugate lipids that inhibit particle aggregation can be, for example, but not limited to, polyethylene glycol (PEG)-lipids including PEG-diacylglycerol (DAG), PEG-dialkyloxypropyl (DAA), PEG-phospholipid, PEG-ceramide (Cer), or mixtures thereof. The PEG-DAA conjugate can be, for example, PEG-dilauroxypropyl (Ci2), PEG-dimyrist...

Claims

1. A pharmaceutical composition for use in a method of treating a subject suffering from a disease or disorder in which a benefit can be obtained from a decrease in the expression of complement component C5, the composition comprising a therapeutically effective amount of a double-stranded ribonucleic acid (dsRNA) agent or a pharmaceutically acceptable salt thereof, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, the antisense strand comprises at least 15 consecutive nucleotides from the nucleotide sequence 5'-UAUUAUAAAAAAUAUCUUGCUUUU-3' of SEQ ID NO: 113, the pharmaceutical composition is administered with an anti-complement component C5 antibody, or an antigen-binding fragment thereof, The pharmaceutical composition.

2. The pharmaceutical composition according to claim 1, wherein the antisense strand comprises at least 17 consecutive nucleotides from the nucleotide sequence 5'-UAUUAUAAAAAAUAUCUUGCUUUU-3' of SEQ ID NO:

113.

3. The pharmaceutical composition according to claim 1 or 2, wherein the sense strand comprises at least 17 consecutive nucleotides from the nucleotide sequence 5'-AAGCAAGAUAUUUUUUAUAAUA-3' of SEQ ID NO: 62, and the antisense strand comprises at least 17 consecutive nucleotides from the nucleotide sequence 5'-UAUUAUAAAAAAUAUCUUGCUUUU-3' of SEQ ID NO:

113.

4. The pharmaceutical composition according to any one of claims 1 to 3, wherein the sense strand comprises the nucleotide sequence 5'-AAGCAAGAUAUUUUUUAUAAUA-3' of SEQ ID NO: 62, and the antisense strand comprises the nucleotide sequence 5'-UAUUAUAAAAAAUAUCUUGCUUUU-3' of SEQ ID NO:

113.

5. The pharmaceutical composition according to any one of claims 1 to 4, wherein the dsRNA agent comprises at least one modified nucleotide.

6. The pharmaceutical composition according to any one of claims 1 to 5, wherein all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand comprise modifications.

7. The pharmaceutical composition according to claim 6, wherein at least one modified nucleotide and / or modification is selected from the group consisting of a 3'-terminal deoxy-thymine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, a non-basic nucleotide, a 2'-amino-modified nucleotide, a 2'-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a nucleotide containing a non-natural base, a nucleotide containing a 5'-phosphorothioate group, and a terminal nucleotide conjugated to a cholesteryl derivative or a bisdecylamide group of dodecanoic acid.

8. The pharmaceutical composition according to claim 7, wherein the modified nucleotide comprises a short sequence of 3'-terminal deoxythymine nucleotides (dT).

9. The pharmaceutical composition according to any one of claims 1 to 8, wherein the double-stranded region is at least 17 nucleotide pairs in length.

10. The pharmaceutical composition according to any one of claims 1 to 9, wherein the double-stranded region is 17 - 23 nucleotide pairs in length, 17 - 25 nucleotide pairs in length, 19 - 21 nucleotide pairs in length, 21 - 23 nucleotide pairs in length, or 23 - 27 nucleotide pairs in length.

11. The pharmaceutical composition according to claim 10, wherein the double-stranded region is 21 nucleotide pairs in length.

12. The pharmaceutical composition according to any one of claims 1 to 11, wherein each strand is independently 17 - 30 nucleotides in length, 17 - 23 nucleotides in length, 17 - 21 nucleotides in length, 17 - 19 nucleotides in length, 19 - 25 nucleotides in length, 19 - 23 nucleotides in length, 19 - 21 nucleotides in length, 21 - 25 nucleotides in length, 21 - 23 nucleotides in length, or 30 nucleotides or less in length.

13. The pharmaceutical composition according to any one of claims 1 to 12, wherein at least one strand comprises a 3' overhang of at least one nucleotide or at least two nucleotides.

14. The pharmaceutical composition according to any one of claims 1 to 13, wherein the dsRNA agent further comprises a ligand.

15. The pharmaceutical composition according to claim 14, wherein the ligand is conjugated to the 3' end of the sense strand of the dsRNA agent.

16. The pharmaceutical composition according to claim 14 or 15, wherein the ligand is one or more GalNAc derivatives conjugated via a divalent or trivalent branched linker.

17. The ligand is 【Chemical 1】 The pharmaceutical composition according to claim 16.

18. The pharmaceutical composition according to claim 16, wherein the dsRNA agent is conjugated to a ligand as shown in the following schematic diagram ​ wherein X is O or S.

19. The pharmaceutical composition according to claim 18, wherein X is O.

20. A pharmaceutical composition comprising a pharmaceutically acceptable salt of a therapeutically effective amount of a double-stranded ribonucleic acid (dsRNA) agent for use in a method of treating a subject suffering from a disease or disorder that can benefit from a decrease in the expression of complement component C5, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, the sense strand comprises the nucleotide sequence 5'-asasGfcAfafaUfAfUfuUfuuAfufAfaua-3' of SEQ ID NO: 2876, and the antisense strand comprises the nucleotide sequence 5'-usAfsUfuAfuaAfafaUfcUfuGfcuusususudTdT-3' of SEQ ID NO: 2889, a, g, c and u are 2'-O-methyl (2'-OMe) A, G, C and U, respectively; Af, Gf, Cf and Uf are 2'-fluoro A, G, C and U, respectively; dT is a deoxy-thymine nucleotide; and s is a phosphorothioate bond, and the 3' end of the sense strand is conjugated to a ligand as shown in the following schematic diagram [Chemical Formula 3] wherein X is O, the pharmaceutical composition is administered with an anti-complement component C5 antibody or an antigen-binding fragment thereof. Pharmaceutical composition.

21. The pharmaceutical composition according to any one of claims 1 to 20, wherein the dsRNA agent or the pharmaceutically acceptable salt is present in a non-buffered solution.

22. The pharmaceutical composition according to claim 21, wherein the non-buffered solution is physiological saline or water.

23. The pharmaceutical composition according to any one of claims 1 to 20, wherein the dsRNA agent or the pharmaceutically acceptable salt is present in a buffered solution.

24. The pharmaceutical composition according to claim 23, wherein the buffered solution comprises an acetate buffer, a citrate buffer, a prolamine buffer, a carbonate buffer, or a phosphate buffer or any combination thereof.

25. The pharmaceutical composition according to claim 23, wherein the buffer is phosphate buffered saline (PBS).

26. The pharmaceutical composition according to any one of claims 1 to 25, wherein the anti-complement component C5 antibody is eculizumab.

27. The pharmaceutical composition according to any one of claims 1 to 26, wherein the dsRNA agent or a pharmaceutically acceptable salt thereof reduces intravascular hemolysis, stabilizes hemoglobin levels, and / or reduces C5 protein levels in a subject.

28. The pharmaceutical composition according to any one of claims 1 to 27, wherein the disease or disorder is a disease associated with complement component C5.

29. The disease associated with the complement component C5 is selected from the group consisting of paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), asthma, rheumatoid arthritis (RA); antiphospholipid antibody syndrome; lupus nephritis; ischemia-reperfusion injury; typical or infectious hemolytic uremic syndrome (tHUS); dense deposit glomerulonephritis (DDD); neuromyelitis optica (NMO); multifocal motor neuropathy (MMN); multiple sclerosis (MS); macular degeneration (e.g., age-related macular degeneration (AMD)); hemolysis, elevated liver escape enzymes, and low platelets (HELLP) syndrome; thrombotic thrombocytopenic purpura (TTP); spontaneous abortion; microscopic immune vasculitis; epidermolysis bullosa; habitual abortion; pregnancy-induced hypertension nephropathy, traumatic brain injury, myasthenia gravis, cold agglutinin disease, dermatomyositis, bullous pemphigoid, hemolytic uremic syndrome associated with Shiga toxin-producing Escherichia coli (E. coli), C3 nephropathy, antineutrophil cytoplasmic antibody-associated vasculitis, humoral and vascular transplant rejection, graft dysfunction, myocardial infarction, allograft, sepsis, coronary artery disease, dermatomyositis, Graves' disease, atherosclerosis, Alzheimer's disease, systemic inflammatory response sepsis, septic shock, spinal cord injury, glomerulonephritis, Hashimoto's thyroiditis, type 1 diabetes, psoriasis, pemphigus, autoimmune hemolytic anemia (AIHA), ITP, Goodpasture syndrome, dog disease, antiphospholipid syndrome (APS), catastrophic APS (CAPS), cardiovascular disease, myocarditis, cerebrovascular disorder, peripheral vascular disorder, renal vascular disorder, mesenteric / intestinal vascular disorder, vasculitis, Henoch-Schönlein purpura nephritis, systemic lupus erythematosus-related vasculitis, rheumatoid arthritis-related vasculitis, immune complex vasculitis, Takayasu disease, dilated cardiomyopathy, diabetic angiopathy, Kawasaki disease (arteritis), venous gas embolism (VGE), and restenosis after stent placement, rotational atherectomy, membranous nephropathy, Guillain-Barré syndrome, and percutaneous transluminal coronary angioplasty (PTCA), the pharmaceutical composition according to claim 28.

30. The disease associated with the complement component C5 is paroxysmal nocturnal hemoglobinuria (PNH), the pharmaceutical composition according to claim 29.

31. The disease associated with the complement component C5 is atypical hemolytic uremic syndrome (aHUS), the pharmaceutical composition according to claim 29.

32. The disease associated with the complement component C5 is myasthenia gravis, the pharmaceutical composition according to claim 29.

33. The pharmaceutical composition according to claim 29, wherein the disease associated with the complement component C5 is macular degeneration.

34. The pharmaceutical composition according to claim 29, wherein the disease associated with the complement component C5 is age-related macular degeneration (AMD).

35. The pharmaceutical composition according to any one of claims 1 to 34, wherein the subject is a human.

36. The pharmaceutical composition according to any one of claims 1 to 35, which is for administration to the subject once a week, twice a week, or twice a month.

37. The pharmaceutical composition according to any one of claims 1 to 36, which is for subcutaneous administration.

38. The pharmaceutical composition according to any one of claims 1 to 37, wherein the dsRNA agent or pharmaceutically acceptable salt inhibits the expression of the complement component C5 by at least about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 98% or about 100%.

Images