Pharmaceutical composition, its production method and use
Novel CD38 antibodies with enhanced CDC, ADCC, and ADCP activities, developed through Fc segment mutations, address the variability in therapeutic efficacy of existing antibodies, offering improved treatment outcomes for CD38-associated diseases by inhibiting enzyme activity and inducing apoptosis.
Patent Information
- Application Number
- JP2024005374
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2019-11-29
- Filing Date
- 2024-01-17
- Publication Date
- 2025-09-05
- Estimated Expiration
- 2040-11-13
AI Technical Summary
Current CD38 antibodies exhibit variability in therapeutic efficacy due to differences in mechanism of action, leading to rapid exhaustion of NK cells and inefficacy in treating CD38-associated diseases like multiple myeloma and rheumatoid arthritis, with existing modifications in IgG1 Fc regions showing limited improvement.
Development of novel, high-affinity CD38 antibodies with enhanced CDC, ADCC, and ADCP activities, and the ability to inhibit CD38 exoenzyme activity, achieved through immunization with CD38 recombinant protein and introduction of mutations into the Fc segment, resulting in improved tumor-killing efficiency.
The novel antibodies demonstrate superior tumor-killing capabilities with high affinity binding to CD38, inhibiting enzyme activity and inducing apoptosis, while maintaining specificity and reducing erythrocyte lysis, thus providing enhanced therapeutic effects in CD38-associated diseases.
Smart Images

Figure 0007734386000061 
Figure 0007734386000062 
Figure 0007734386000063
Abstract
Description
[Technical Field]
[0001] The present invention relates to an antibody against CD38, a method for producing the same, and uses thereof. [Background technology]
[0002] CD38 is a 46-kDa type II transmembrane glycoprotein with an intracellular 21-amino acid N-terminus, a 21-amino acid transmembrane domain, and a 258-amino acid C-terminus, which is an extracellular domain. CD38 mediates migration and receptor-mediated adhesion through its interaction with CD31 or hyaluronan. CD38 also possesses extracellular enzyme activity, participates in the synthesis of nucleotide metabolites, and plays a role in the regulation of intracellular calcium stores. CD38 is expressed at relatively low levels on some normal tissues, such as bone marrow and lymphoid cells, and on some nonhematopoietic cells. Conversely, CD38 is normally expressed at high levels on plasma cells and on some malignant cells, including those in multiple myeloma (MM) and chronic lymphocytic leukemia (CLL). This differential expression makes it a target molecule for targeted therapy of multiple myeloma cells.
[0003] Multiple myeloma is a plasma cell cancer characterized by the accumulation of malignant cells in the bone marrow and the production of monoclonal immunoglobulin (M protein). While the introduction of new treatments has significantly improved median overall survival rates in recent years, relapse and drug resistance typically occur within one year. Daratumumab, an antibody targeting CD38, has been approved for the treatment of relapsed / refractory multiple myeloma. Other monoclonal antibodies in clinical trials, including isatuximab, MOR202, and TAK-079, are being investigated for the treatment of relapsed / refractory multiple myeloma as well as newly diagnosed multiple myeloma. Antibodies against CD38 have also shown promising therapeutic effects in other malignancies, such as NK / T-cell lymphoma, T-cell acute lymphoblastic leukemia, and immunoglobulin light chain amyloidosis.
[0004] Rheumatoid arthritis (RA) is an autoimmune disease characterized by the proliferation of large numbers of B lymphocytes in the affected synovium. Flow cytometry analysis showed a significant increase in the expression of CD38+, CD3+CD38+, and CD56+CD38+ subpopulations in the peripheral blood of RA patients, and the expression of CD38+ cells correlated significantly with the rheumatoid factor (RF) levels in RA patients. Immunohistochemistry studies showed that CD38 expression was specifically elevated in the synovium of RA patients. ELISA experiments showed that IL-1α and IL-β expression levels in RASF culture medium were significantly reduced after siRNA interference with the CD38 gene, confirming that increased CD38 expression may be involved in immune activation in RA patients (Expression of CD38 in Peripheral Blood and Synovial Tissue in Rheumatoid Arthritis, Yue Longtao et al., Modern Immunology, pp. 89-93, No. 2, 2014). CD38 is significantly elevated in the peripheral blood of patients with other autoimmune diseases, such as systemic lupus erythematosus (SLE), and plays an important role in the development and onset of SLE. In vitro or preclinical animal studies have shown that several CD38 antibodies have highly significant tumor-suppressing effects. However, clinical studies have revealed significant heterogeneity in the therapeutic efficacy and duration of response of different antibodies. This difference is thought to be due to the mechanism of action of the antibodies. For example, after treatment with CD38 antibodies, NK cells in the patient's blood are rapidly exhausted, resulting in a shortage of effector cells, which can limit the efficacy of antibodies that primarily utilize antibody-dependent cellular cytotoxicity (ADCC). Furthermore, antibodies with other mechanisms of action, such as daratumumab (which has complement-dependent cytotoxicity), are also ineffective. CD38 antibodies (daratumumab, CDC) have been shown to be superior to other CD38 antibodies currently undergoing clinical research in terms of overall therapeutic efficacy and survival time. Studies have shown that introducing mutations into the Fc of IgG1 or substituting the hinge region of IgG1 with that of IgG3 can improve the CDC efficacy of antibodies. Recently, there have been studies that show that IgG1 Fc mutations can cause monoclonal antibodies to form hexamers, effectively enhancing the killing power of CD38 antibodies, but production and development remain challenging. Summary of the Invention
[0005] By immunizing mice with CD38 recombinant protein, the present inventors have isolated several novel, high-affinity CD38 antibodies that possess the strongest CDC, ADCC, and antibody-dependent cellular phagocytosis (ADCP) activities of their kind, as well as the ability to inhibit CD38 exoenzyme activity and induce apoptosis upon Fc crosslinking. Furthermore, the novel CD38 antibodies obtained by introducing new mutations into the Fc segment of the antibodies have much higher tumor-killing efficiency than currently commercially available antibodies of the same kind. In one aspect, the present disclosure provides an antibody or antigen-binding portion thereof that binds to CD38 protein.
[0006] In one aspect, the disclosure provides a nucleic acid molecule encoding an antibody or antigen-binding portion thereof according to the previous aspect.
[0007] In one aspect, the present disclosure provides a vector comprising a nucleic acid according to the previous aspect.
[0008] In one aspect, the present disclosure provides a cell comprising the vector described in the previous aspect.
[0009]
[0023] In the antibody, or antigen-binding portion thereof, of any one of the preceding aspects, the antibody, or antigen-binding portion thereof, is humanized.
[0010] In one aspect, the disclosure provides a pharmaceutical composition or kit comprising the antibody or antigen-binding portion thereof of any one of the preceding aspects, or a nucleic acid encoding same, and a pharmaceutically acceptable carrier.
[0011] In one aspect, the present disclosure provides a method of treating a CD38-associated disease, comprising administering to the mammal a therapeutically effective amount of the antibody or antigen-binding fragment thereof, nucleic acid molecule, vector, cell, and / or pharmaceutical composition of any one of the preceding aspects.
[0012] In one aspect, the present disclosure provides the use of an antibody or antigen-binding fragment thereof, nucleic acid molecule, vector, cell and / or pharmaceutical composition according to any one of the preceding aspects in the manufacture of a medicament or kit for treating a CD38-related disease in a mammal.
[0013] The antibody can bind to human CD38 with high affinity, inhibit the CD38 enzyme, and exhibit CDC, ADCC, and / or ADCP killing activity against various tumor cells, thus exhibiting antitumor function, and does not induce erythrocyte lysis. [Brief explanation of the drawings]
[0014] [Figure 1] FIG. 1 shows recombinantly expressed human CD38 extracellular domain protein in HEK293 cells. [Figure 2] FIG. 1 shows the detection of human CD38 / CHO constant-expressing cells by flow cytometry. [Figure 3-1] FIG. 1 shows the complement-dependent cytotoxicity (CDC) effect of chimeric antibodies on Duadi cells. [Figure 3-2] FIG. 1 shows the complement-dependent cytotoxicity (CDC) effect of chimeric antibodies on Duadi cells. [Figure 4-1] FIG. 1 shows the inhibitory effect of chimeric antibodies on CD38 enzyme activity. [Figure 4-2] FIG. 1 shows the inhibitory effect of chimeric antibodies on CD38 enzyme activity. [Figure 5] FIG. 1 shows the antibody-dependent cellular cytotoxicity (ADCC) killing activity of chimeric antibodies against Duadi cells. [Figure 6] FIG. 1 shows antibody-dependent cellular phagocytosis (ADCP) killing activity of chimeric antibodies against Duadi cells. [Figure 7-1] FIG. 1 shows the complement-dependent cytotoxicity (CDC) effect of different humanized antibodies on Daudi cells. [Figure 7-2] FIG. 1 shows the complement-dependent cytotoxicity (CDC) effect of different humanized antibodies on Daudi cells. [Figure 8-1] FIG. 1 shows the measurement of affinity by ELISA. [Figure 8-2] FIG. 1 shows the binding of humanized anti-CD38 antibodies to Daudi cells. [Figure 8-3] FIG. 1 shows the binding of humanized anti-CD38 antibodies to NALM-6 cells. [Figure 8-4] FIG. 1 shows the binding of anti-CD38 humanized antibodies to Ramos.2G6.4C10 cells. [Figure 8-5] FIG. 1 shows the binding of humanized anti-CD38 antibodies to TALL-1 cells. [Figure 9] FIG. 1 shows the expression levels of CD38 in different tumor cells. [Figure 10-1] FIG. 1 shows the complement-dependent cytotoxicity (CDC) effect of humanized anti-CD38 antibodies on Ramos.2G6.4C10. [Figure 10-2] FIG. 1 shows the complement-dependent cytotoxicity (CDC) effect of humanized anti-CD38 antibodies against Daudi. [Figure 10-3] FIG. 1 shows the complement-dependent cytotoxicity (CDC) effect of humanized anti-CD38 antibodies against TALL-1. [Figure 11-1] FIG. 1 shows the antibody-dependent cellular cytotoxicity (ADCC) effect of humanized anti-CD38 antibodies on Ramos.2G6.4C10. [Figure 11-2] FIG. 1 shows the antibody-dependent cellular cytotoxicity (ADCC) effect of humanized anti-CD38 antibodies against NALM-6. [Figure 11-3] FIG. 1 shows the antibody-dependent cellular cytotoxicity (ADCC) effect of humanized anti-CD38 antibodies on RPMI-8226. [Figure 11-4] FIG. 1 shows the antibody-dependent cellular cytotoxicity (ADCC) effect of humanized anti-CD38 antibodies against CCRF-CEM. [Figure 11-5] FIG. 1 shows the antibody-dependent cellular cytotoxicity (ADCC) effect of humanized anti-CD38 antibodies against Daudi. [Figure 11-6] FIG. 1 shows the antibody-dependent cellular cytotoxicity (ADCC) effect of humanized anti-CD38 antibodies against TALL-1. [Figure 11-7] FIG. 1 shows the antibody-dependent cellular cytotoxicity (ADCC) effect of humanized anti-CD38 antibodies against MM.1S. [Figure 11-8] FIG. 1 shows the antibody-dependent cellular cytotoxicity (ADCC) effect of humanized anti-CD38 antibodies against NCI-H929. [Figure 11-9] FIG. 1 shows the antibody-dependent cellular cytotoxicity (ADCC) effect of humanized anti-CD38 antibodies on Raji. [Figure 12-1] FIG. 1 shows the antibody-dependent cellular phagocytosis (ADCP) effect of a humanized anti-CD38 antibody against Daudi. [Figure 12-2] FIG. 1 shows the antibody-dependent cellular phagocytosis (ADCP) effect of a humanized anti-CD38 antibody against TALL-1. [Figure 12-3] FIG. 1 shows antibody-dependent cellular phagocytosis (ADCP) of humanized anti-CD38 antibodies against Ramos.2G6.4C10. [Figure 12-4] FIG. 1 shows antibody-dependent cellular phagocytosis (ADCP) of humanized anti-CD38 antibodies against Raji. [Figure 12-5] FIG. 1 shows antibody-dependent cellular phagocytosis (ADCP) of humanized anti-CD38 antibodies against NALM-6. [Figure 13] FIG. 10 is a diagram analyzing the inhibitory effect of humanized CD38 antibodies on CD38 enzyme activity. [Figure 14] FIG. 1 shows that apoptosis of Daudi cells is induced by a humanized CD38 antibody. [Figure 15] FIG. 10 is a diagram analyzing the induction of human red blood cell degradation with a humanized CD38 antibody. [Figure 16] FIG. 1 shows the effect of CD38 antibody on the growth of subcutaneously transplanted tumors of the human B-cell lymphoma Daudi. DETAILED DESCRIPTION OF THE INVENTION
[0015] I. Definition In the present invention, unless otherwise specified, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, the terms and laboratory procedures related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, and immunology used herein are terms and routine procedures widely used in the corresponding fields. In addition, definitions and explanations of related terms are provided below to better understand the present invention.
[0016] In one aspect, the present disclosure provides antibodies (e.g., monoclonal antibodies) and antigen-binding fragments thereof that specifically bind to CD38. In a specific aspect, the present disclosure provides monoclonal anti-CD38 antibodies that specifically bind to CD38, including variants of a parent antibody. In a specific aspect, the present disclosure provides antibodies that specifically bind to CD38 (e.g., human CD38). In a specific aspect, the present disclosure provides anti-CD38 antibodies that contain one or more amino acid residue modifications (e.g., substitutions of 5 to 13 amino acids in the framework region of the heavy chain variable region), which maintain affinity for the antigen compared to a parent antibody without such modifications.
[0017] Unless otherwise specified, the terms "about" or "approximately" as used herein refer to ±10% of a particular numerical value or range. When required to be an integer, the term is rounded to the nearest integer within ±10% of the particular numerical value or range.
[0018] With respect to antibody chain polypeptide sequences, the term "substantially identical" is understood to refer to antibody chains that exhibit at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more sequence identity to a control polypeptide sequence. With respect to nucleic acid sequences, the term is understood to refer to a nucleotide sequence that exhibits at least 60% or more, at least 65% or more, at least 70% or more, at least 75% or more, at least 80% or more, at least 85% or more, at least 90% or more, at least 95% or more, at least 96% or more, at least 97% or more, at least 98% or more, at least 99% or more sequence identity to a control nucleic acid sequence.
[0019] Sequence "homology" or "identity" has the meaning well known in the art, and the percentage of sequence identity between two nucleic acid or polypeptide molecules or domains can be calculated using conventional techniques. Sequence identity can be measured along the entire length of a polynucleotide or polypeptide or along a region of the molecule (see, e.g., Computational Molecular Biology, Lesk, A.M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, 1990; and others). (See, e.g., Smith, DW, eds., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, AM, and Griffin, HG, eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., Stockton Press, New York, 1991). While there are many methods for determining the identity of two polynucleotides or polypeptides, the term "identity" is well known to those skilled in the art (Carrillo, H. & Lipman, D., SIAM J Applied Math 48:1073 (1988)).
[0020] "Substitutional" variants are those in which at least one amino acid residue in a native sequence has been removed and a different amino acid inserted in its place. The substitutions may be single, where only one amino acid is substituted in the molecule, or multiple, where two or more amino acids are substituted in the same molecule. Multiple substitutions may occur at consecutive sites. Similarly, an amino acid may be replaced by multiple residues, and such variants include both substitutions and insertions. "Insertional" variants are those in which one or more amino acids are inserted adjacent to an amino acid at a particular position in a native sequence. Adjacent amino acids refer to attachment to the α-carboxyl or α-amino functional group of that amino acid. "Deletional" variants are those in which one or more amino acids in a native amino acid sequence have been removed. Typically, deletional variants have one or two amino acids deleted in a specific region of the molecule.
[0021] With respect to antibody variable regions, the term "variable" refers to the specific portions of the associated molecule that vary significantly in sequence among antibodies and are used for specific recognition and binding of a particular antibody to a particular target. However, variability is not uniformly distributed throughout the variable regions of antibodies. The variability is concentrated in three segments called complementarity-determining regions (CDRs, i.e., CDR1, CDR2, and CDR3) or hypervariable regions, all found in the light and heavy chain variable regions. The more conserved portions of the variable regions are called framework (FR) regions or framework sequences. Each naturally occurring heavy and light chain variable region contains four FR regions, both primarily of β-sheet structure, connected via three CDRs that form loops that connect, and in some cases, form part of, the β-sheet structure. The CDRs of each chain are usually contiguous and linked by FR regions and, together with the CDRs from the other chain, contribute to the formation of the target binding site (epitope or determinant) of the antibody (see Kabat et al., Sequences of Proteins of Immunological Interest, National Institutes of Health, Bethesda, MD (1987)). As used herein, immunoglobulin amino acid residues are numbered according to the immunoglobulin amino acid residue numbering system of Kabat et al., unless otherwise specified. A CDR may have the ability to specifically bind to an associated epitope.
[0022] As used herein, an "antibody fragment" or "antigen-binding fragment" of an antibody refers to any portion of a full-length antibody that is less than full-length but contains at least a partial variable region of the antibody that binds to an antigen (e.g., one or more CDRs and / or one or more antibody-binding sites), thereby retaining the binding specificity and at least part of the specific binding ability of the full-length antibody. Thus, an antigen-binding fragment refers to an antibody fragment that contains an antigen-binding portion that binds to the same antigen as the antibody from which the antibody fragment was generated. Antibody fragments include antibody derivatives produced by enzyme-catalyzed treatment of full-length antibodies, as well as synthetically produced derivatives, e.g., recombinantly produced derivatives. Antibodies include antibody fragments. Specific examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, single-chain Fv (scFv), Fv, dsFv, diabody, Fd, and Fd' fragments, as well as other fragments, including modified fragments (see, e.g., Methods in Molecular Biology, Vol. 207: Recombinant Antibodies for Cancer Therapy Methods and Protocols (2003); Chapter 1; p. 3-25, Kipriyanov). Such fragments may include, for example, multiple chains linked by disulfide bonds and / or peptide linkers. Antibody fragments usually contain at least or about 50 amino acids, and typically contain at least or about 200 amino acids. The antigen-binding fragments are immunospecific (i.e., at least 10 nucleotides) when inserted into an antibody framework (e.g., by substituting the corresponding domain). 7 ~10 8 M -1 Ka of at least about 10 7 ~10 8 M -1 The term "functional fragment" or "anti-CD38 antibody analog" includes any antibody fragment that provides an antibody that binds to an antigen (indicating a Ka of the antibody). A "functional fragment" or "anti-CD38 antibody analog" is a fragment or analog that prevents or substantially reduces the ability of the receptor to bind to a ligand or initiate signal transduction. As used herein, a functional fragment generally has the same meaning as an "antibody fragment," and in the case of an antibody, refers to a fragment that prevents or substantially reduces the ability of the receptor to bind to a ligand or initiate signal transduction, such as Fv, Fab, F(ab')2, etc. An "Fv" fragment is a dimer (V) formed by the non-covalent bonding of one heavy chain variable region and one light chain variable region. H -V LIn this configuration, the three CDRs of each variable region interact to form a V H -V L The six CDRs define a target-binding site on the surface of the dimer. Together, the six CDRs confer target-binding specificity to the full-length antibody. However, a single variable region (or half of an Fv containing only three target-specific CDRs) can also function to recognize and bind to a target.
[0023] As used herein, the term "bispecific antibody (BsAb)" refers to an antibody and / or antigen-binding molecule that can specifically bind to two different antigenic determinants. Typically, a bispecific antibody and / or antigen-binding molecule contains two antigen-binding sites, each capable of specifically binding to a different antigenic determinant. In some embodiments, the bispecific antibody and / or antigen-binding molecule can simultaneously bind to two antigenic determinants, particularly two antigenic determinants expressed on two different types of cells.
[0024] As used herein, the term "monoclonal antibody" refers to a population of identical antibodies, meaning that each individual antibody molecule in the monoclonal antibody population is identical to all other antibody molecules. This characteristic is the opposite of a polyclonal population of antibodies, which contains antibodies with a variety of different sequences. Monoclonal antibodies can be prepared by a number of known methods (Smith et al. (2004) J. Clin. Pathol. 57, 912-917 and Nelson et al., J. Clin. Pathol (2000), 53, 111-117). For example, monoclonal antibodies can be prepared by immortalizing B cells, e.g., by fusing them with myeloma cells to produce hybridoma cell lines, or by infecting B cells with a virus such as EBV. Recombinant technology can also be used to prepare antibodies in vitro from a clonal population of host cells by transforming the host cells with a plasmid carrying an artificial sequence of nucleotides encoding the antibody.
[0025] As used herein, the term "hybridoma" or "hybridoma cell" refers to a "hybridoma" refers to a cell or cell line (usually a myeloma or lymphoma cell) produced by the fusion of an antibody-producing lymphocyte with a non-antibody-producing cancer cell. As known to those skilled in the art, a hybridoma can grow and produce a continuous supply of a specific monoclonal antibody. Methods for producing hybridomas are known in the art (see, e.g., Harlow & Lane, 1988). When the term "hybridoma" or "hybridoma cell" is used, it also includes subclones and progeny of hybridomas.
[0026] As used herein, a full-length antibody is an antibody having two full-length heavy chains (e.g., VH-CH1-CH2-CH3 or VH-CH1-CH2-CH3-CH4), two full-length light chains (VL-CL), and a hinge region, including, for example, antibodies produced naturally by antibody-secreting B cells and synthetically produced antibodies having the same regions.
[0027] The term "chimeric antibody" refers to an antibody whose variable region sequences are derived from one species and whose constant region sequences are derived from another species, such as, for example, an antibody whose variable region sequences are derived from a murine antibody and whose constant region sequences are derived from a human antibody.
[0028] "Humanized" antibodies refer to non-human (e.g., murine) antibodies that are chimeric immunoglobulins, immunoglobulin chains, and fragments thereof (e.g., Fv, Fab, Fab', F(ab')2, or other antigen-binding subsequences of antibodies) that contain minimal sequence derived from non-human immunoglobulin. Preferably, humanized antibodies are human immunoglobulins (recipient antibody) in which complementarity-determining region (CDR) residues of the recipient antibody are substituted by CDR residues from a non-human species (donor antibody) such as mouse, rat, or rabbit having the desired specificity, affinity, and capacity.
[0029] During humanization, amino acid residues in the CDR1, CDR2, and / or CDR3 regions of VH and / or VL can also be mutated to improve one or more binding characteristics (e.g., affinity) of the antibody. For example, mutations can be introduced by PCR-mediated mutagenesis, and their effect on antibody binding or other functional properties can be assessed using the in vitro or in vivo assays described herein. Conservative mutations are typically introduced. Such mutations may be amino acid substitutions, additions, or deletions. Furthermore, mutations within a CDR are typically limited to one or two. Thus, the humanized antibodies described in the present invention also include antibodies containing one or two amino acid mutations within a CDR.
[0030] The term "CDR" as used herein refers to a complementarity-determining region, and each heavy and light chain of an antibody molecule is known to have three CDRs. CDRs, also known as hypervariable regions, are present in the variable regions of each heavy and light chain of an antibody, and contain highly variable regions in the primary structure of the CDRs. Herein, the heavy chain CDRs are represented by CDR1, CDR2, and CDR3 at the amino terminus of the amino-terminal sequence derived from the heavy chain, and the light chain CDRs are represented by CDR1, CDR2, and CDR3 at the amino terminus of the amino-terminal sequence derived from the light chain. These regions are adjacent to each other in the tertiary structure and determine the specificity of the antigen binding to the antibody.
[0031] The term "epitope" as used herein refers to any antigenic determinant on an antigen that binds to the paratope of an antibody. Epitopic determinants usually comprise chemically active surface subtypes of molecules such as amino acids or sugar side chains and usually have specific three-dimensional structural characteristics, as well as specific charge characteristics.
[0032] As used herein, the terms "specifically bind" or "immunospecifically bind" with respect to an antibody or antigen-binding fragment thereof are used interchangeably herein and refer to one or more non-covalent interactions between the antibody and the antibody-binding site of the antigen. This refers to the ability of an antibody or antigen-binding fragment to form a bond. The antigen may be an isolated antigen or may be present on tumor cells. Typically, antibodies that immunospecifically bind (or specifically bind) to an antigen are found in concentrations of about 1×10 7 M -1 or approximately 1 x 10 8 M -1 or a larger affinity constant Ka (or 1 × 10 -7 or 1 x 10 -8 The antibody binds to the antigen with a dissociation constant (Kd) of no greater than M. The affinity constant can be measured by standard kinetic methods of antibody reactions, such as immunoassays, surface plasmon resonance (SPR) (Rich and Myszka (2000) Curr. Opin. Biotechnol 11:54; Englebienne (1998) Analyst. 123:1599), isothermal titration calorimetry (ITC), or other kinetic interactions known in the art (see, e.g., Paul, ed.; Fundamental Immunology, 2nd ed.; Raven Press, New York, pages 332-336 (1989)). See also U.S. Pat. No. 7,229,619, which describes exemplary SPR and ITC methods for calculating antibody binding affinity). Devices and methods for detecting and monitoring binding kinetics in real time are known and commercially available (BiaCore 2000, Biacore AB, Upsala, Sweden and GE Healthcare Life Sciences, see Malmqvist (2000) Biochem. Soc. Trans. 27:335).
[0033] As used herein, the terms "polynucleotide" and "nucleic acid molecule" refer to an oligomer or polymer comprising at least two linked nucleotides or nucleotide derivatives, including deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), typically linked by phosphodiester bonds. The term "nucleic acid molecule" as used herein is intended to include DNA molecules and RNA molecules. Nucleic acid molecules may be single-stranded or double-stranded, and may be cDNA.
[0034] As used herein, an isolated nucleic acid molecule is a nucleic acid molecule that is separated from other nucleic acid molecules that are present in the natural source of the nucleic acid molecule. For example, an "isolated" nucleic acid molecule of a cDNA molecule is substantially free of other cellular materials or culture medium when prepared by recombinant techniques, or substantially free of chemical precursors or other chemical components when chemically synthesized. Exemplary isolated nucleic acid molecules provided herein include isolated nucleic acid molecules that encode the provided antibodies or antigen-binding fragments.
[0035] As used herein, "operably linked" with respect to nucleic acid sequences, regions, elements, or domains means that the nucleic acid regions are functionally related to each other. For example, a promoter can be operably linked to a nucleic acid encoding a polypeptide such that it can regulate or mediate transcription of the nucleic acid.
[0036] "Conservative sequence modifications" of the sequences set forth in the sequence listing herein are modifications that do not delete the nucleotide and amino acid sequence encoded by the nucleotide sequence or containing the amino acid sequence that binds to the antigen of the antibody. These conservative sequence modifications include conservative nucleotide and amino acid substitutions, as well as nucleotide and amino acid additions and deletions. For example, modifications can be introduced into the sequence listings set forth herein by standard techniques known in the art (e.g., site-directed mutagenesis and PCR-mediated mutagenesis). Conservative sequence modifications include conservative amino acid substitutions, in which an amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), amino acids with acidic side chains (e.g., aspartic acid, glutamic acid), amino acids with uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), and amino acids with nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phage). Conservative nucleotide and amino acid substitutions that do not eliminate antigen binding are well known in the art (e.g., Brummell et al., Biochem. 32: 1180-1187 (1993); Kobayashi et al., Biochem. 32: 1180-1187 (1993)). Predicted non-essential amino acid residues in anti-CD38 antibodies are preferably replaced with another amino acid residue from the same side chain family. Conservative substitutions of nucleotides and amino acids that do not eliminate antigen binding are well known in the art (e.g., Brummell et al., Biochem. 32: 1180-1187 (1993)); Kobayashi et al., Biochem. 32: 1180-1187 (1993)). Predicted non-essential amino acid residues in anti-CD38 antibodies are preferably replaced with another amino acid residue from the same side chain family. Methods for identifying conservative substitutions of nucleotides and amino acids that do not eliminate antigen binding are well known in the art (e.g., Brummell et al., Biochem. 32: 1180-1187 (1993)); Kobayashi et al., Biochem. 32: 1180-1187 (1993)). al., Protein Eng. 12(10): 879-884 (1999); see Burks et al., Proc. Natl. Acad. Sci. USA 94: 412-417 (1997)).
[0037] Alternatively, in another embodiment, for example, saturation mutagenesis can be used to randomly introduce mutations along all or part of the sequence encoding an anti-CD38 antibody, and the resulting modified anti-CD38 antibodies can be screened for improved binding activity.
[0038] As used herein, "expression" refers to the process of producing a polypeptide by transcription and translation of a polynucleotide. The expression level of a polypeptide can be assessed using any method known in the art, including, for example, methods for determining the amount of polypeptide produced from a host cell. Such methods include, but are not limited to, quantitating polypeptide in a cell lysate by ELISA, gel electrophoresis followed by Coomassie blue staining, Lowry protein assay, and Bradford protein assay.
[0039] As used herein, a "host cell" is a cell used to receive, maintain, replicate, and amplify a vector. A host cell can also express a polypeptide encoded by the vector. When the host cell divides, the nucleic acid contained in the vector is replicated, thereby amplifying the nucleic acid. A host cell can be a eukaryotic or prokaryotic cell. Suitable host cells include, but are not limited to, CHO cells, various COS cells, HeLa cells, and HEK cells such as HEK293 cells.
[0040] As used herein, a "vector" refers to a replicable nucleic acid that can express one or more heterologous proteins when transformed into a suitable host cell. Vectors include those into which a nucleic acid encoding a polypeptide or a fragment thereof can be introduced, typically via restriction enzyme digestion and ligation. Vectors also include vectors containing a nucleic acid encoding a polypeptide. A vector introduces a nucleic acid encoding a polypeptide into a host cell, amplifies the nucleic acid, or expresses / displays the polypeptide encoded by the nucleic acid. While vectors are typically free-standing, they may also be engineered into a chromosome, where a gene or a portion thereof is integrated into the genome. Artificial chromosome vectors, such as yeast artificial vectors and mammalian artificial chromosomes, are also contemplated. The selection and use of these vehicles are well known to those skilled in the art.
[0041] As used herein, vector further includes "viral vectors" or "viral vectors." Viral vectors are genetically engineered viruses that are operably linked to exogenous genes so as to transfer the exogenous genes (as vehicles or shuttles) into cells.
[0042] As used herein, "expression vector" includes vectors capable of expressing DNA that is operably linked to regulatory sequences that can affect expression of DNA fragments, such as, for example, promoter regions. Such additional fragments may include promoter and terminator sequences, and may optionally be used to express one or more copies of the DNA fragment. It may contain an origin, one or more selectable markers, an enhancer, a polyadenylation signal, etc. Expression vectors are typically derived from plasmid or viral DNA, or may contain elements of both. Thus, an expression vector refers to a recombinant DNA or RNA construct, such as a plasmid, phage, recombinant virus, or other vector, that, when introduced into a suitable host cell, results in expression of the cloned DNA. Suitable expression vectors are well known to those of skill in the art, and include expression vectors that are capable of replicating in eukaryotic and / or prokaryotic cells, as well as expression vectors that are free or that integrate into the host cell genome.
[0043] As used herein, "treating" an individual with a disease or symptoms of a disease means that the individual's symptoms are partially or completely alleviated, or remain unchanged after treatment. Thus, treatment includes prophylaxis, treatment, and / or cure. Prevention refers to preventing underlying disease and / or preventing worsening of symptoms or onset of disease. Treatment includes any pharmaceutical use of the provided antibodies or antigen-binding fragments thereof and compositions provided herein.
[0044] As used herein, "therapeutic effect" refers to the effect of treating an individual to alter, generally improve or ameliorate, or cure a disease or disease symptoms.
[0045] As used herein, a "therapeutically effective amount" or "therapeutically effective dose" refers to the amount of a substance, compound, material, or composition containing a compound that is sufficient to produce at least a therapeutic effect after administration to a subject, i.e., the amount necessary to prevent, cure, ameliorate, delay, or partially delay a disease or a symptom of a disease.
[0046] As used herein, a "prophylactically effective amount" or "prophylactically effective dose" refers to an amount of a substance, compound, material, or composition containing a compound that, when administered to a subject, has the desired prophylactic effect, e.g., preventing or delaying the onset or recurrence of a disease or condition, or reducing the likelihood of the onset or recurrence of a disease or condition. A fully prophylactically effective dose need not occur by administering a single dose, but may occur after administering a series of doses. Thus, a prophylactically effective amount can be administered in one or more administrations.
[0047] As used herein, the term "patient" refers to a mammal, such as a human.
[0048] II. MODE FOR CARRYING OUT THE INVENTION In one aspect, the disclosure provides a heavy chain CDR selected from the amino acid sequences SEQ ID NOs: 2-4, 12-14, 22-24, 32-34, 42-44, 52-54, 62-64, 72-74, 82-84, 92-94, 102-144, 112-114, 122-124, 132-34, 142-144, 152-154, 162-164, 172-174, 182-184, 187-189, 192-194, 197-199, 202-204, 207-209, 212-214, 217-219, 222-224, 227-229, 232-234, or any variant thereof, and / or a variant thereof. The present invention provides an antibody or antigen-binding portion thereof that binds to CD38, comprising a light chain CDR selected from the group consisting of 7-9, 17-19, 27-29, 37-39, 47-49, 57-59, 67-69, 77-79, 87-89, 97-99, 107-109, 117-119, 127-129, 137-139, 147-149, 157-159, 167-169, 177-179, 237-239, 242-244, 247-249, 252-254, 257-259, 262-264, 267-269, or any variant thereof.
[0049] In the antibody or antigen-binding portion thereof according to the previous aspect, the amino acid sequence SEQ ID N O: Heavy chain CDR1 selected from 2, 12, 22, 32, 42, 52, 62, 72, 82, 92, 102, 112, 122, 132, 142, 152, 162, 172, 182, 187, 192, 197, 202, 207, 212, 217, 222, 227, 232 or any variant thereof, amino acid sequence SEQ ID NO: 3, 13, 23, 33, 43, 53, 63, 73, 83, 93, 103, 113, 123, 133, 143, 153, 163, 173, 183, 188, 193, 198, 203, 208, 213, 218, 223, 228, 233, or any variant thereof; a heavy chain CDR3 selected from the amino acid sequences SEQ ID NOs: 4, 14, 24, 34, 44, 54, 64, 74, 84, 94, 104, 114, 124, 134, 144, 154, 164, 174, 189, 194, 199, 204, 209, 214, 219, 224, 229, 234, or any variant thereof; and / or a light chain CDR1 selected from the amino acid sequences SEQ ID NOs: 7, 17, 27, 37, 47, 57, 67, 77, 87, 97, 107, 117, 127, 137, 147, 157, 167, 177, 237, 242, 247, 252, 257, 262, 267, or any variant thereof; and a light chain CDR2 selected from the amino acid sequences SEQ ID NOs: 9, 19, 29, 39, 49, 59, 69, 79, 89, 99, 109, 119, 129, 139, 149, 159, 169, 179, 239, 244, 249, 254, 259, 264, 269, or any variant thereof.
[0050] The antibody or antigen-binding portion thereof according to the above aspect comprises a combination of CDRs selected from the heavy chain and light chain described below. (1) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 2-4, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 7-9, respectively. (2) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 12-14, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 17-19, respectively. (3) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 22-24, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 27-29, respectively. (4) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 32-34, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 37-39, respectively. (5) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 42-44, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 47-49, respectively. (6) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 52-54, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 57-59, respectively. (7) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 62-64, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 67-69, respectively. (8) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 72-74, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 77-79, respectively. (9) heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 82-84, respectively, and / or light chain CDRs comprising SEQ ID NOs: 87-89, respectively; 1. CDR2 and CDR3 sequences. (10) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 92-94, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 97-99, respectively. (11) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 102-104, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 107-109, respectively. (12) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 112-114, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 117-119, respectively. (13) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 122-124, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 127-129, respectively. (14) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 132-134, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 137-139, respectively. (15) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 142-144, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 147-149, respectively. (16) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 152-154, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 157-159, respectively. (17) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 162-164, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 167-169, respectively. (18) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 172-174, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 177-179, respectively. (19) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 182-184, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 237-239, respectively. (20) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 182-184, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 242-244, respectively. (21) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 182-184, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 247-249, respectively. (22) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 182-184, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 252-254, respectively. (23) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 182-184, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 257-259, respectively. (24) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 187-189, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 237-239, respectively. (25) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 187-189, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 242-244, respectively. (26) Heavy chain CDR1 and CDR2 containing SEQ ID NOs: 187-189, respectively and CDR3 sequences, and / or light chain CDR1, CDR2 and CDR3 sequences comprising SEQ ID NOs: 247-249, respectively. (27) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 187-189, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 252-254, respectively. (28) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 187-189, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 257-259, respectively. (29) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 192-194, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 237-239, respectively. (30) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 192-194, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 242-244, respectively. (31) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 192-194, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 247-249, respectively. (32) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 192-194, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 252-254, respectively. (33) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 192-194, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 257-259, respectively. (34) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 197-199, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 237-239, respectively. (35) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 197-199, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 242-244, respectively. (36) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 197-199, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 247-249, respectively. (37) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 197-199, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 252-254, respectively. (38) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 197-199, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 257-259, respectively. (39) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 202-204, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 237-239, respectively. (40) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 202-204, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 242-244, respectively. (41) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 202-204, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 247-249, respectively. (42) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 202-204, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 252-254, respectively. (43) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 202-204, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 257-259, respectively. (44) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 207-209, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 237-239, respectively. (45) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 207-209, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 242-244, respectively. (46) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 207-209, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 247-249, respectively. (47) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 207-209, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 252-254, respectively. (48) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 207-209, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 257-259, respectively. (49) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 212-214, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 262-264, respectively. (50) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 212-214, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 267-269, respectively. (51) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 217-219, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 262-264, respectively. (52) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 217-219, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 267-269, respectively. (53) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 222-224, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 262-264, respectively. (54) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 222-224, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 267-269, respectively. (55) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 227-229, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 262-264, respectively. (56) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 227-229, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 267-269, respectively. (57) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 232-234, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 262-264, respectively. (58) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 232-234, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 267-269, respectively.
[0051] In the antibody or antigen-binding portion thereof according to the previous aspect, the amino acid sequence SEQ ID N O: A heavy chain variable region selected from the group consisting of 1, 11, 21, 31, 41, 51, 61, 71, 81, 91, 101, 111, 121, 131, 141, 151, 161, 171, 181, 186, 191, 196, 201, 206, 211, 216, 221, 226, 231, or any variant thereof, and / or a light chain variable region selected from the group consisting of amino acid sequences of SEQ ID NOs: 6, 16, 26, 36, 46, 56, 66, 76, 86, 96, 106, 116, 126, 136, 146, 156, 166, 176, 236, 241, 246, 251, 256, 261, 266, or any variant thereof.
[0052] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 1 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 6 or any variant thereof.
[0053] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 11 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 16 or any variant thereof.
[0054] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 21 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 26 or any variant thereof.
[0055] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 31 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 36 or any variant thereof.
[0056] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 41 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 46 or any variant thereof.
[0057] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 51 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 56 or any variant thereof.
[0058] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 61 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 66 or any variant thereof.
[0059] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 71 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 76 or any variant thereof.
[0060] In one embodiment, the disclosure provides a heavy chain variable region of amino acid sequence SEQ ID NO: 81 or any variant thereof, and a heavy chain variable region of amino acid sequence SEQ ID NO: 86 or any variant thereof. The present invention provides an antibody or antigen-binding portion thereof that binds to human CD38, comprising a light chain variable region of any variant.
[0061] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 91 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 96 or any variant thereof.
[0062] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 101 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 106 or any variant thereof.
[0063] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 111 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 116 or any variant thereof.
[0064] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 121 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 126 or any variant thereof.
[0065] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 131 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 136 or any variant thereof.
[0066] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 141 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 146 or any variant thereof.
[0067] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 151 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 156 or any variant thereof.
[0068] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 161 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 166 or any variant thereof.
[0069] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 171 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 176 or any variant thereof.
[0070] In one embodiment, the disclosure provides a heavy chain variable region of amino acid sequence SEQ ID NO: 181 or any variant thereof, and a heavy chain variable region of amino acid sequence SEQ ID NO: 236 or any variant thereof. The present invention provides an antibody or antigen-binding portion thereof that binds to human CD38, comprising a light chain variable region of any variant of the above.
[0071] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 181 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 241 or any variant thereof.
[0072] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 181 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 246 or any variant thereof.
[0073] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 181 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 251 or any variant thereof.
[0074] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 181 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 256 or any variant thereof.
[0075] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 186 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 236 or any variant thereof.
[0076] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 186 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 241 or any variant thereof.
[0077] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 186 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 246 or any variant thereof.
[0078] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 186 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 251 or any variant thereof.
[0079] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 186 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 256 or any variant thereof.
[0080] In one embodiment, the disclosure provides a heavy chain variable region of amino acid sequence SEQ ID NO: 191 or any variant thereof, and a heavy chain variable region of amino acid sequence SEQ ID NO: 236 or any variant thereof. The present invention provides an antibody or antigen-binding portion thereof that binds to human CD38, comprising a light chain variable region of any variant of the above.
[0081] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 191 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 241 or any variant thereof.
[0082] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 191 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 246 or any variant thereof.
[0083] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 191 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 251 or any variant thereof.
[0084] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 191 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 256 or any variant thereof.
[0085] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 196 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 236 or any variant thereof.
[0086] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 196 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 241 or any variant thereof.
[0087] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 196 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 246 or any variant thereof.
[0088] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 196 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 251 or any variant thereof.
[0089] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 196 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 256 or any variant thereof.
[0090] In one embodiment, the disclosure provides a heavy chain variable region of amino acid sequence SEQ ID NO: 201 or any variant thereof, and a heavy chain variable region of amino acid sequence SEQ ID NO: 236 or any variant thereof. The present invention provides an antibody or antigen-binding portion thereof that binds to human CD38, comprising a light chain variable region of any variant of
[0091] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 201 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 241 or any variant thereof.
[0092] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 201 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 246 or any variant thereof.
[0093] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 201 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 251 or any variant thereof.
[0094] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 201 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 256 or any variant thereof.
[0095] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 206 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 236 or any variant thereof.
[0096] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 206 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 241 or any variant thereof.
[0097] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 206 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 246 or any variant thereof.
[0098] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 206 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 251 or any variant thereof.
[0099] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 206 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 256 or any variant thereof.
[0100] In one embodiment, the disclosure provides a heavy chain variable region of amino acid sequence SEQ ID NO: 211 or any variant thereof, and a heavy chain variable region of amino acid sequence SEQ ID NO: 261 or any variant thereof. The present invention provides an antibody or antigen-binding portion thereof that binds to human CD38, comprising a light chain variable region of any variant of the above.
[0101] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 211 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 266 or any variant thereof.
[0102] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 216 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 261 or any variant thereof.
[0103] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 216 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 266 or any variant thereof.
[0104] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 221 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 261 or any variant thereof.
[0105] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 221 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 266 or any variant thereof.
[0106] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 226 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 261 or any variant thereof.
[0107] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 226 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 266 or any variant thereof.
[0108] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 231 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 261 or any variant thereof.
[0109] In one aspect, the disclosure provides an antibody, or antigen-binding portion thereof, that binds to human CD38, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 231 or any variant thereof, and a light chain variable region of amino acid sequence SEQ ID NO: 266 or any variant thereof.
[0110] In one aspect, the present disclosure provides a bispecific or multispecific molecule comprising any of the above antibodies or antigen-binding portions thereof.
[0111] There is provided a nucleic acid molecule encoding the antibody or antigen-binding portion thereof, or the bispecific or multispecific molecule of any one of the preceding aspects. Preferably, the nucleic acid molecule has the sequence of SEQ and / or an antibody heavy chain nucleic acid sequence selected from SEQ ID NOs: 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 240, 245, 250, 255, 260, 265, 270, or any variant thereof.
[0112] Provided is an antibody or antigen-binding portion thereof that binds to human CD38 and has at least 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or more, sequence identity to the antibody or antigen-binding portion thereof of any one of the preceding aspects.
[0113] Nucleic acid molecules encoding the antibody or antigen-binding portion thereof of any one of the preceding aspects, or nucleic acid molecules having at least 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or more, sequence identity thereto, are provided.
[0114] A vector is provided comprising the nucleic acid of any one of the preceding aspects.
[0115] A cell is provided comprising the vector of any one of the preceding aspects.
[0116] A pharmaceutical composition is provided comprising the antibody or antigen-binding portion thereof of any one of the preceding aspects, or a nucleic acid encoding same, and a pharmaceutically acceptable carrier.
[0117] The antibodies of the present invention are useful as therapeutic or diagnostic tools for various diseases in which CD38 is adversely expressed or found. The diseases or conditions to be treated with the CD38 antibodies of the present invention are preferably tumors or autoimmune diseases. The tumors are preferably selected from multiple myeloma (MM), chronic lymphocytic leukemia (CLL), chronic myeloid leukemia (CML), T-cell acute lymphoblastic leukemia, acute myeloid leukemia (AML), and acute lymphoblastic leukemia (ALL). The autoimmune diseases are preferably selected from rheumatoid arthritis (RA) and systemic lupus erythematosus (SLE).
[0118] A method of treating diseases and conditions with a CD38 antibody of the invention comprises administering to the mammal a therapeutically effective amount of the antibody or antigen-binding fragment, nucleic acid molecule, vector, cell, or pharmaceutical composition of any one of the preceding aspects.
[0119] The present invention provides a use of an antibody or antigen-binding fragment thereof, nucleic acid molecule, vector, cell, or pharmaceutical composition according to any one of the preceding aspects in the preparation of a medicament for treating a CD38-related disease in a mammal.
[0120] In any one of the above aspects, the antibody is coupled to another agent, for example, a labeling or cytotoxic conjugate.
[0121] In one embodiment, the present disclosure further includes a kit, e.g., the kit includes an antibody, fragment, homolog, derivative, etc., of the present disclosure, e.g., a labeled or cytotoxic conjugate, and a protocol for using the antibody, e.g., for killing a specific type of cell. The kit may also include a conjugate that induces a reaction, or the like. The usage protocol may include a guide for using the antibody, conjugate, or the like in vitro, in vivo, or ex vivo. The antibody may be liquid or solid and typically lyophilized. The kit may further include other appropriate reagents, such as buffers, reconstitution solutions, and other necessary components depending on the intended use. Usage protocols for combinations of packaged reagents in predetermined amounts and their use in therapeutic or diagnostic assays are also contemplated. If the antibody is labeled, e.g., with an enzyme, the kit may also include a substrate and a cofactor required for the enzyme (e.g., a substrate precursor that provides a detectable chromophore or fluorophore). Other additives, such as stabilizers and buffers (e.g., blocking buffer or lysis buffer), may also be included. The relative amounts of various reagents can be varied to provide a concentrated reagent solution, thereby providing user flexibility, space savings, reagent conservation, and the like. These reagents may be provided as dry powders, typically lyophilized, and contain excipients that, when dissolved, provide a solution of the appropriate concentration of the reagent.
[0122] The present invention provides a use of the antibody or functional fragment thereof, nucleic acid molecule, vector, cell, pharmaceutical composition, or kit according to any one of the preceding aspects for preparing a reagent for inhibiting the binding of CD38 to CD38R.
[0123] The antibodies of the present invention may also be used in immunoassays, purification methods and other methods that use immunoglobulins or fragments thereof, such uses being well known to those skilled in the art.
[0124] The present invention also provides compositions comprising the anti-CD38 antibodies or fragments thereof of the present invention, which may be suitably combined with a pharmaceutically acceptable carrier, diluent, or excipient, as is well known in the art.
[0125] The term "pharmaceutical composition" as used herein refers to a formulation of various preparations. The formulations containing a therapeutically effective amount of a multivalent antibody may be in sterile liquid solution, liquid suspension, or lyophilized form, and may contain stabilizers or excipients.
[0126] The antibodies of the present invention may be used as a composition to be administered alone or may be used in combination with other active agents.
[0127] It should be understood that the therapeutic agents of the embodiments are administered with suitable pharmaceutically acceptable carriers, excipients, and other agents that are incorporated into the formulation to provide improved transport, delivery, tolerability, etc. Many suitable formulations are described in pharmacopoeias known to medicinal chemists, such as Remington's Pharmaceutical Sciences (15th ed., Mack Publishing Company, Easton, Pa. (1975)), particularly Chapter 87 of Blaug and Seymour. These formulations include, for example, powders, pastes, ointments, gels, waxes, oils, lipids, lipid (cationic or anionic)-containing carriers (e.g., Lipofectin TM ), DNA conjugates, anhydrous slurries, oil-in-water and water-in-oil emulsions, emulsion polyethylene glycol (polyethylene glycol of various molecular weights), semi-solid gels, and polyethylene glycol-containing semi-solid mixtures. Any of the above mixtures may be used in the treatment or method of treatment of the present invention, provided that the active ingredient in the formulation is not inactivated by the formulation, the formulation is physiologically compatible, and the route of administration is acceptable.
[0128] In one embodiment, the antibodies can be used as therapeutic agents. Such agents can be used to treat or prevent the development of inflammatory bowel disease, including rheumatoid arthritis, rheumatoid arthritis, and rheumatoid arthritis. Therapeutic regimens are used to treat, alleviate, and / or prevent diseases or conditions associated with aberrant CD38 expression, activity, and / or signaling. Treatment regimens can be implemented by identifying a subject, e.g., a human patient, having (or at risk for, or developing) a disease or disorder associated with aberrant CD38 expression, activity, and / or signaling, e.g., a CD38-associated disorder, using standard methods. An antibody preparation, preferably one with high specificity and high affinity for a target antigen, is administered to the subject and typically exerts its effect by binding to the target. The administered antibody may eliminate, inhibit, or disrupt the expression, activity, and / or signaling function of the target (e.g., CD38). The administered antibody may eliminate, inhibit, or disrupt the binding of the target (e.g., CD38) to its naturally occurring endogenous ligand. For example, the antibody binds to the target and modulates, blocks, inhibits, reduces, antagonizes, neutralizes, and / or otherwise disrupts CD38 expression, activity, and / or signaling. In some embodiments, an antibody having heavy and light chain CDRs can be administered to a subject to treat a disease or disorder associated with aberrant CD38 expression.
[0129] In another embodiment, antibodies to CD38 are used in methods known in the art related to localization and / or quantification of CD38 (e.g., measuring CD38 and / or CD38 levels in appropriate physiological samples, diagnostic methods, protein imaging). In a specific embodiment, antibodies comprising an antigen-binding domain derived from an antibody specific for CD38 or a derivative, fragment, analog, or homolog thereof are used as pharmaceutically active compounds (hereinafter referred to as "therapeutic agents").
[0130] In another embodiment, CD38 polypeptides can be isolated using antibodies specific for CD38 by standard techniques, such as immunoaffinity, chromatography, or immunoprecipitation. Antibodies (or fragments thereof) against the CD38 protein are used to detect the protein in biological samples. In some embodiments, CD38 is detected in biological samples as part of a clinical trial procedure, for example, to determine the effectiveness of a particular therapeutic regimen. Coupling (i.e., physically linking) the antibody to a detectable substance can be advantageous for detection. Detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin / biotin and avidin / biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazine aminofluorescein, dansylamide, or phycoerythrin; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin; and examples of suitable radioactive materials include 125 I, 131 I, 35 S, or 3 Contains H.
[0131] In another embodiment, an antibody according to the present disclosure can be used as a reagent for detecting the presence of CD38 or a protein fragment thereof in a sample. In some embodiments, the antibody comprises a detectable label. The antibody is a polyclonal antibody, or more preferably, a monoclonal antibody. Full-length antibodies or fragments thereof (e.g., Fab, scFv, or F(ab')2) are used. The term "labeled" with respect to an antibody includes direct labeling of the antibody by coupling (i.e., physically linking) a detectable substance to the antibody, and indirect labeling of the antibody by reaction with another directly labeled reagent. Examples of indirect labeling include detection of a primary antibody using a fluorescently labeled secondary antibody, such as one that allows detection with fluorescently labeled streptavidin, and antibodies end-labeled with biotin. The term "biological sample" is intended to include tissues, cells, and biological fluids isolated from a subject, as well as tissues, cells, and fluids present within the subject's body. Thus, the term "biological sample" includes serum, plasma, etc. or lymph. In other words, the detection methods of the above embodiments are used for detecting analyte mRNA, protein, or genomic DNA in biological samples in vitro and in vivo. For example, in vitro detection techniques for analyte mRNA include Northern hybridization and in situ hybridization. In vitro detection techniques for analyte protein include enzyme-linked immunosorbent assay (ELISA), Western blotting, immunoprecipitation, and immunofluorescence. In vitro detection techniques for analyte genomic DNA include Southern hybridization. Procedures for performing immunoassays are described, for example, in "ELISA: Theory and Practice: Methods in Molecular Biology," Vol. 42, J.R.Crowther (ed.), Human Press, Totowa, NJ, 1995; "Immunoassay," E. Diamandis and T. Christopoulus, Academic Press, Inc., San Diego, Calif., 1996; and "Practice and Theory of Enzyme Immunoassays," P. Tijssen, Elsevier Science Publishers, Amsterdam, 1985. In vivo detection techniques for analyte proteins also include introducing a labeled anti-analyte protein antibody into a subject. For example, the antibody can be labeled with a radioactive label, and the presence and location of the radioactive label in the subject can then be detected by standard imaging techniques.
[0132] The antibodies and derivatives, fragments, analogs, and homologs thereof described herein can be incorporated into pharmaceutical compositions suitable for administration. The principles, precautions, and guidelines for the preparation of such compositions, as well as the selection of their components, are well known in the art and can be found, for example, in Remington's Pharmaceutical Sciences: See Science And Practice Of Pharmacy, 19th Edition (Alfonso R. Gennaro et al., eds.), Mack Pub. Co., Easton Pa.: 1995; Drug Absorption Enhancement: Concepts, Possibilities, Limitations, And Trends, Harwood Academic Publishers, Langhorne, Pa., 1994; and Peptide And Protein Drug Delivery (Advances In Parenteral Sciences, Vol. 4), 1991, M. Dekker, New York.
[0133] Such compositions typically comprise an antibody and a pharmaceutically acceptable carrier. When an antibody fragment is used, the smallest inhibitory fragment that specifically binds to the binding domain of the target protein is preferred. For example, peptide molecules that retain the ability to bind to the target protein sequence can be designed based on the variable region sequence of the antibody. Such peptides can be produced by chemical synthesis and / or recombinant DNA technology (see, for example, Marasco et al., Proc. Natl. Acad. Sci. USA, 90:7889-7893 (1993)).
[0134] As used herein, the term "pharmaceutically acceptable carrier" is intended to include any solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, that are acceptable for pharmaceutical administration. Suitable pharmaceutically acceptable carriers are described in the most recent edition of Remington's Pharmaceutical Sciences, a standard reference text in the field, which is incorporated herein by reference. Preferred examples of such carriers or diluents include, but are not limited to, water, saline, Ringer's solution, dextrose solution, and 5% human serum albumin. Liposomes and non-aqueous carriers (e.g., fixed oils) can also be used. The use of such media and agents for pharmaceutically active substances is well known in the art. Other than conventional media or agents that are not acceptable for antibodies, their use in the compositions is contemplated.
[0135] Pharmaceutical compositions according to the embodiments are formulated to suit their intended route of administration. Exemplary routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (i.e., topical), transmucosal, and rectal administration. Solutions or suspensions for parenteral, intradermal, or subcutaneous administration may contain an injectable sterile diluent such as water, saline, fixed oil, polyethylene glycols, glycerol, propylene glycol, or other synthetic solvents; an antibacterial agent such as benzyl alcohol or methyl 4-hydroxybenzoate; an antioxidant such as ascorbic acid or sodium bisulfite; a chelating agent such as ethylenediaminetetraacetic acid (EDTA); a buffer such as acetate, citrate, or phosphate; and an agent for adjusting osmolality such as sodium chloride or dextrose. pH can be adjusted with acids or bases, e.g., hydrochloric acid or sodium hydroxide. Parenteral formulations may be packaged in ampoules, disposable syringes, or glass or plastic multiple-dose vials.
[0136] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water-soluble solutions) or dispersions, and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Pharmaceutically acceptable carriers suitable for parenteral administration include physiological saline, antibacterial water, Cremophor ELTM (BASF, Parsippany, NJ) or phosphate-buffered saline (PBS). In all cases, the composition must be sterile and fluid for easy injectability. It must be stable under the conditions of manufacture and storage and must be capable of preventing the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. For example, a coating such as lecithin can be used to maintain the desired particle size in the case of dispersion, and surfactants can be used to maintain the proper fluidity. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, such as parahydroxybenzoates, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it is preferable to include isotonic agents, such as sugars, polyols (for example, mannitol, sorbitol), and sodium chloride in the composition. Prolonged absorption of injectable compositions can be achieved by including in the composition an agent which delays absorption, for example, aluminum monostearate or gelatin.
[0137] Sterile injectable solutions can be prepared by incorporating the antibody, if necessary, in the required amount in an appropriate solvent with one or a combination (if necessary) of the ingredients listed above, followed by sterilization by filtration. Typically, dispersions are prepared by incorporating the antibody in a sterile carrier containing a basic dispersion medium and the required other ingredients listed above. Regarding sterile powders for preparing sterile injectable solutions, methods for preparing them include vacuum drying and freeze-drying, which yield powders containing the active ingredient and any additional desired ingredients, and the active ingredient and any additional desired ingredients are derived from these sterile-filtered solutions.
[0138] For administration by inhalation, the compounds are delivered in the form of an aerosol spray from pressured container, dispenser, or nebulizer which contains a suitable propellant, eg, carbon dioxide gas.
[0139] Systemic administration may also be achieved by transmucosal or transdermal means. For transmucosal or transdermal administration, a penetrant appropriate to the barrier to be permeated is used in the formulation. Such penetrants are well known in the art and include, for example, detergents for transmucosal administration, cholate salts, and fusidic acid derivatives. Transmucosal administration can be achieved using nasal sprays or suppositories. For transdermal administration, one or more antibodies can be formulated into pastes, ointments, gels, or creams, as are well known in the art.
[0140] The compounds can also be prepared for rectal delivery in suppositories (eg, with conventional suppository bases such as cocoa butter or other glycerides) or retention enemas.
[0141] In one embodiment, the antibody can be prepared with a carrier that will protect it from rapid excretion from the body, for example, a sustained / controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, for example, ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparing such formulations will be apparent to those skilled in the art.
[0142] It is particularly advantageous to prepare parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. As used herein, dosage unit form refers to a suitable unit physically discretely provided as a unitary dosage for a subject to be treated, each unit containing a predetermined amount of one or more of the antibodies calculated to achieve the desired therapeutic effect in combination with the necessary pharmaceutical carrier. The specifications for the dosage unit form according to the embodiment are determined and directly depend on the inherent characteristics of the antibody and the particular therapeutic effect to be achieved, as well as the limitations inherent in the technology for preparing such antibodies for the treatment of an individual.
[0143] The pharmaceutical compositions may be included in a container, pack, or dispenser together with an administration protocol.
[0144] The formulations described herein preferably contain one or more of the above antibodies, depending on the specific therapeutic situation, and preferably contain antibodies with complementary activities that do not adversely affect each other. Additionally, the compositions may contain agents that enhance the function of the composition, such as cytotoxins, cytokines, chemotherapeutic agents, or growth inhibitors. Such molecules are appropriately combined in amounts effective for the intended purpose. For example, they can be combined in a kit or for use.
[0145] In one embodiment, one or more of the antibodies can be administered in combination therapy, i.e., in combination with other agents, e.g., therapeutic agents (e.g., used to treat pathological conditions or disorders, e.g., various forms of cancer, autoimmune disorders, and inflammatory diseases). As used herein, the term "combination" refers to the administration of agents substantially simultaneously, simultaneously, or sequentially. When administered sequentially, preferably, the first of the two compounds can still be detected at effective concentrations at the treatment site when administration of the second compound begins. In one embodiment, a "combination" can also include the antibody of the present invention and the other therapeutic agent simultaneously in a kit.
[0146] For example, a combination therapy can be used in which one or more antibodies described herein are co-formulated and / or co-administered with one or more additional therapeutic agents (e.g., one or more cytokine and growth factor inhibitors, immunosuppressants, anti-inflammatory agents, metabolic inhibitors, enzyme inhibitors, and / or cytotoxins or cell proliferation inhibitors, as described in more detail below). Such combination therapies can be preferred because they may utilize lower dosages of the administered therapeutic agents, thereby avoiding possible toxicities or complications associated with various monotherapies.
[0147] For clarity and conciseness of description, technical features are described herein as part of the same or separate embodiments, but it is understood that the scope of the present invention includes several embodiments having all the described features or combining several features. [Example]
[0148] Example 1. Preparation of CD38 recombinant protein The nucleotide sequence of the extracellular domain (Val 43-Ile 300) of human CD38 (UniProt KB: P28907) was synthesized, fused to the N-terminus with an IgG kappa signal peptide and a 6xHis tag, and then digested with enzymes to construct the eukaryotic expression plasmid CMV. The pSect-Nhis-CD38 plasmid was obtained by cloning downstream of the promoter. This plasmid was then transfected into HEK293.6E cells and cultured for 7 days. The supernatant was collected and purified on a nickel chelate column to obtain the human CD38 extracellular domain recombinant protein. SDS-PAGE analysis is shown in Figure 1.
[0149] Example 2: Construction of a human CD38 / CHO constant-expressing cell line A lentiviral vector plasmid containing the full-length human CD38 sequence was constructed, and the constructed lentiviral vector plasmid and packaging plasmid were co-transfected into HEK293T cells for lentiviral packaging according to the protocol of the lentiviral packaging kit (Lenti-Pac HIV Expression Packaging Kit, Gene Copoeia, Cat: HPK-LvTR-20). 48 hours after co-transfection, the medium was collected and centrifuged at 500*g for 10 minutes to remove cell debris. The culture supernatant containing lentiviral particles was obtained, filtered through a 0.45 μm PES membrane, dispensed into 1.5 mL EP tubes, and 10 μL was used to obtain 1 x 10 cells. 6 CHO cells were transfected and screened by adding 10 μg / mL puromycin to the medium. After obtaining positive clones, limiting dilution was performed to finally obtain CHO-CD38-1H7 stably expressing human full-length CD38. The results are shown in Figure 2.
[0150] Example 3: Preparation of anti-human CD38 monoclonal antibody 1) Immunization of mice Human CD38 recombinant protein or CHO-CD38-1H7 cells were used as the antigen, mixed with an equal volume of immunoadjuvant (Freund's adjuvant), and six 6-week-old female Balb / c mice in each group were subcutaneously immunized. Two weeks after the first immunization, a booster immunization was administered. After three immunizations, orbital blood samples were collected and serum titers were determined.
[0151] 2) Cell fusion and hybridoma screening Before fusion, 1x10 6 Rush immunotherapy was performed using CHO-CD38-1H7 cells injected via tail vein. Three days later, mice were sacrificed by cervical dislocation. The spleens and some peripheral lymph nodes were collected and ground into DMEM medium. After centrifugation, the supernatant was discarded. Splenocyte clusters were gently dispersed, and 5 mL of red blood cell lysis solution was added. Cells were lysed for 50 seconds. 40 mL of DMEM was added and centrifuged to obtain an erythrocyte-free splenocyte suspension. An appropriate amount of the lymph node and splenocyte mixture was mixed with SP2 / 0 and fused using a BTX electrofusion device. The fused cells were seeded into 96-well plates and cultured in complete DMEM medium containing HAT at 37°C with 5% CO2. After approximately one week, hybridoma cell growth began to be observed. Once proliferation reached over 60%, the supernatant was collected and assayed.
[0152] Example 4: Screening of anti-human CD38 monoclonal antibodies and obtaining antibody sequences 1) Screening by enzyme-linked immunosorbent assay (ELISA) Human CD38 recombinant protein (1 μg / mL) was coated onto a 96-well plate and incubated overnight at 4°C. The next day, the plate was washed three times with PBS, blocked with 200 μL of 2% nonfat dry milk in PBS for 2 hours at room temperature, washed once with PBS, and 50 μL of hybridoma supernatant was added. The plate was then incubated at room temperature for 1 hour. After washing three times with PBST and PBS, 100 μL / well of HRP-conjugated anti-mouse IgG Fc secondary antibody was added and incubated at room temperature for 60 minutes. After washing three times with PBST and PBS, 100 μL of color development solution (TMB solution, Sigma catalog no. T2885) was added and incubated at 37°C for 5 minutes. The reaction was stopped by adding 50 μL of 2M concentrated sulfuric acid solution. The plate was immediately placed on a microplate reader and the OD450 reading was recorded.
[0153] 2) Cell screening for anti-CD38 specific antibodies (FACS) The supernatants of the positive clones that bound to the CD38 antibody detected by ELISA were further examined for their binding to CD38-positive cells. CHO cells and CHO-CD38 constant-expressing cells were prepared and plated in 96-well plates at 5 × 10 4 Cells were added per well, and 50 μL of hybridoma supernatant was added to each well. The wells were incubated at 4°C for 60 minutes, centrifuged to remove the supernatant, washed with 0.5% BSA / PBS, and 50 μL of secondary antibody solution (anti-mouse IgG-Fc-AF647, Jackson ImmunoResearch, Cat: 115-606-071) was added. The wells were incubated at 4°C for 45 minutes, washed with 0.5% BSA / PBS to remove excess secondary antibody, and PBS was added. The cells were resuspended and detected by flow cytometry.
[0154] 3) Gene cloning and expression of anti-human CD38 chimeric antibody CD38-positive hybridoma monoclonals were selected, and total cellular RNA was extracted using the TRNzol lysis method. Single-stranded cDNA was synthesized using a reverse transcription kit (Invitrogen, catalog number 18080051), which was then used as a template to amplify and sequence the antibody variable region sequences in the hybridoma monoclonal cells. The heavy and light chain variable region sequences of the resulting candidate positive clones were as follows:
[0155] Clone: 21H12-G12 SEQ ID Nos: 1-10 Heavy chain VH [ka] Nucleic acid sequence CAGATCCAGTTGGTGCAGTCTGGACCTGAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCTGCAAGGCTTCTGGGTATACTTTCACAAACCATGGAATGAACTGGGTGAAGCAGGCTCCAGGAAAGGGCTTAAAGTGGATGGGCTGGATAAACACCTACACTGGAGAG CCAACATATGGTGAAGACTTCAAGGGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACCTGGCTACATATTTCTGTGCAAGAAAGGGGTTTGTTTACTGGGGCCAAGGGACTCTGGTCACTGTCTCTGTA Light chain VK [ka] Nucleic acid sequence GACATTGTGCTGACCCAATCTCCAGCTTCTTTGGCTGTGTCTCTAGGGCAGAGGGCCACCATGTCCTGCAGAGCCAGTGAAAGTGTTGATATTTATGGCAATAGTTTTATATACTGGTACCAACAGAAACCAGGACAGCCACCCAAACTCCTCATCTATCGTGCATCCATCCTAGAATCTGGGATCCCTGCCAGGTTCAGTGGCAGTGGGTCTAGGACAGACTTCACCCTCACCATTAAT CCTGTGGAGGCTGATGATGTTGCAACCTATTACTGTCAGCAAATTAATGAAGATCCATTCACGTTCGGAGGGGGGACCAAGCTGGAAATAAAA
[0156] Clone: 7C10 - G5 SEQ ID Nos: 11 - 20 Heavy chain VH [Chemical formula] [[ID=,16]] Nucleic acid sequence CAGGCTTATCTACAGCAGTCTGGGGCTGAGCTGGTGAGGTCTGGGGCCTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACATTTACCAGTTACAATATACACTGGGTAAAGCAGACACCTGGACAGGGCCTGAAATGGATTGGATATATCTATCCTGGAAATGGTGGTACTAACTACAATCAGAAGTTCAAGGTCAAGGCCACATTGACTGCAGACACATCCTCCAGCACAGCCTACATGCAGATCAGCAGCCTGACATCTGAAGACTCTGCGGTCTATTTCTGTGCAAGAAGGGGGTCTGATTACGACGGGGGGTTTGCTTCCTGGGGCCAAGGGACTCTGGTCACTGTCTCTGCA Light chain VK [Chemical formula] Nucleic acid sequence GACATTTTGCTGACCCAGTCTCCAGCTTCTTTGGCTGTGTCTCTAGGGCAGAGGGCCACCATATCCTGCAGAGCCAGTAAAAGTGTTGATATTTATGGCAATAGTTTTATACACTGGTACCAGCAGAAACCAGGACAGTCACCCAAACTCCTCATCTATCTTGCATCCAACCTAGATTCTGGGGTCCCTGCCAGGTTCAGTGGCAGTGGGTCTAGGACAGACTTCACCCTCACCATTGATCCTGTGGAGGCTGATGATGCTGCAACCTATTACTGTCAGCAAAATAATGAGGATCCGCTCACGTTCGGTGCTGGGACCAAGCTGGAGCTGAAA
[0157] Clone: 15A1 - G1 SEQ ID Nos: 21 - 30 Heavy chain VH
Chem.
Chem.
[0158] Clone: 51G7-D3 SEQ ID Nos: 31-40 Heavy chain VH [[ID=YEAR=12]]
Chem.
Chem.
[0159] Clone: 17A4-H9 SEQ ID Nos: 41-50 Nucleic acid sequence GCCATCCAGATGACACAATCTTCATCCTCCTTTTCTGTATCTCTAGGAGACAGAGTCACCATTACTTGCAAGGCAAGTGAGGACATATATAATCGGTTAGCTTGGTATCAGCAGAAATCAGGAAATGCTCCAAGGCTCTTAATATCTGGTTCAACCAGTTTGGAAACTGGGGTTCCTTCAAGATTCAGTGGCAGTGGATCTGGAAAGGATTACACTCTCAGCATTATCAGTCTTCAGACTGAAGATGTTGCTACTTATTACTGTCAACAGTTTTGGAGTACTCCGTGGACGTTCGGTGGAGGCACCAAGCTGGAAATAAAA
[0160] Clone: 25C5-E9 SEQ ID Nos: 51-60 Heavy chain VH
Chem.
Chem.
[0161] Clone: 25F8-C4 SEQ ID Nos: 61-70 Heavy chain VH
Chem.
Chem.
[0162] Clone: 40A12-D2 SEQ ID Nos: 71-80 Heavy chain VH
Chem.
Chem.
[0163] Clone: 36G11-E10 SEQ ID Nos: 81-90 Heavy chain VH
Chem.
Chem.
[0164] Clone: 26C12 - G9 SEQ ID Nos: 91 - 100 Heavy chain VH
Chem.
Chem.
[0165] Clone: 20E12-C6 SEQ ID Nos: 101-110 Heavy chain VH
Chem.
Chem.
[0166] Clone: 22D3-F9 SEQ ID Nos: 111-120 Heavy chain VH
Chemical formula
[0167] Clone: 12C7-A11 SEQ ID Nos: 121-130 Heavy chain VH [Chemical] Nucleic acid sequence CAGGTCCAGCTGAAGCAGTCAGGACCTGGCCTAGTGCAGCCCTCACAGAGCCTGTCCATATCCTGCTCAGTCTCTGGTTTCTCATTAACTAGTTATGGTGTACACTGGGTTCGCCAGTCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTGATATGGAGAGGAGGAAGCACAGACTACAATGCAGCTTTCTCGTCCAGACTGAGCATCACCAAGGACAACTCCAAGAGCCAAGTTTTCTTTAAAATGAACAGTCTGCAAGCTGATGACACTGCCATATATTACTGTGCCAAATCTATGATTACGACGGGGAGGTACTTCGATGTCTGGGGCGCAGGGACCACGGTCACCGTCTCCTCA Light chain VK [Chemical formula] Nucleic acid sequence GACATCCAGATGACACAATCTTCATCCTCCTTTTCTGTATCTCTCGGAGACAGAGTCACCATTACTTGCAAGGCAAGTGAGGACATATATAATCGGTTAGCCTGGTATCAGCAGAAACCAGGAAATGCTCCTAGGCTCTTAATATCTGGTGCAGCCAGTTTGGAAACTGGGATTCCTTCAAGATTCAGTGGCAGTGGATCTGGAAAGAATTACACTCTCAGCATTACCAGTCTTCAGACTGAAGATGTTGCTACTTATTACTGTCAACAGTATTGGAGTACTCCGTGGACGTTCGGTGGAGGCACCAAGCTGGAAATAAAA
[0168] Clone: 11F12-E1 SEQ ID Nos: 131-140 Heavy chain VH [Chemical formula] Light chain VK
Chem.
[0169] Clone: 23C4-D1 SEQ ID Nos: 141-150 Heavy chain VH
Chem.
[0170] Clone: 29F3 - G8 SEQ ID Nos: 151 - 160 Heavy chain VH [Chemical formula] Nucleic acid sequence CAGGTCCAGCTGAAGCAGTCAGGACCTGGCCTAGTGCAGCCCTCACAGAGCCTGTCCATAACCTGCACAGTCTCTGGTTTCTCATTAACTAGCTACGGTATACACTGGCTTCGCCAGTCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTGATATGGAGAGGTGGAAGCACAGACTACAATGCAGCTTTCATGTCCAGACTGAGCATCACCAAGGACAACTCCAAGAGCCAAGTTTTCTTTAAAATGAACAGTCTGCAAGCTGATGACACTGCCATATACTACTGTGCCAAAATGAGAGTTACGACGGGGTTTACTATGGACTACTGGGGTCAAGGAACCTCAGTCACCGTCTCCTCA Light chain VK [Chemical formula]<00~01015> Nucleic acid sequence GACATCCAGATGACACAATCTTCATCCTCCTTTTCTGTATCTCTAGGAGACAGAGTCACCATTACTTGCAAGGCAAGTGAGGACATATATAATCGGTTAGCCTGGTATCAGCAGAAACCAGGAAATGCTCCTAGGCTCTTAATATCTGGTGCAACCAGTTTGGAAACTGGGGTTCCTTCAAGATTCAGTGGCAGTGGATCTGGAAAGGATTACACTCTCAGCATTACCAGTCTTCAGACTGAAGATGTTGCTACTTATTACTGTCAACAGTATTGGAGTA ATCCGTACACGTTCGGAGGGGGGACCAAGCTGGAAATAAAA
[0171] Clone: 27F8 SEQ ID Nos: 161-170 Heavy chain VH [Chemical formula] Nucleic acid sequence CAGGTCCAGCTGCAGCAGTCTGGACCTGAGTTGGAGAAGCCTGGCGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGTTACTCATTCACTGTCTACAACATAAACTGGGTGAAACAGAGCAATGGAAAGAGCCTTGAGTGGATTGGAAATATTGATCCTTACTTTGGTGGTACTATTTACAACCAGAAATTCAAGGACAAGGCCACATTGACTGTCGACAAATCCTCCAGCACAGCCTACATGGAGCTCAAGAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGAAAGATCGAGGGGGACGTGGAGGTTTGCTTACTGGGGCCAAGGGACTCTGGTCACTGTCTCTGCA Light chain VK
Chem.
[0172] Clone: 48H1-B11 SEQ ID Nos: 171-180 Heavy chain VH
Chem.
[0173] To express full-length IgG heavy chains in mammalian cells, the heavy chain variable region was cloned into a vector containing the human heavy chain constant region and regulatory elements. Similarly, to express full-length IgG light chains in mammalian cells, the light chain variable region was cloned into a vector containing the human light chain constant region and regulatory elements. After sequencing, the IgG was expressed and secreted into CHO-S mammalian cells. The supernatant was collected and purified by filtration. The IgG was purified by Protein A chromatography. The medium supernatant was loaded onto an appropriately sized Protein A column, washed with 50 mM Tris-HCl pH 8.0 and 250 mM NaCl, and the bound IgG was eluted with 0.1 M glycine-HCl (pH 3.0). The protein was concentrated by ultrafiltration using a concentration tube, and the IgG concentration was measured by OD280 detection and spectrophotometry.
[0174] 4) CDC activity of chimeric antibodies against Daudi cells Daudi cells were resuspended and seeded into a 96-well plate at 50 μL / well, followed by addition of 50 μL of antibody to each well. The humanized antibody was diluted to 10 μg / mL, and three 3-fold serial dilutions were performed using this starting concentration. 50 μL of complement mixture was added to each well, and the 96-well plate was incubated at 37°C and 5% CO. 2 The plates were placed in a 5% CO2 incubator and incubated for 2 hours. Next, 50 μL of 40% CCK-8 solution was added to each well, shaken for 10 seconds, and incubated in a 5% CO2 incubator for 3 hours. The 96-well plate was placed in a microplate reader (BioTek, Synergy HT) to read the OD450 values. Data were collected and the results were calculated using GraphPad Prism 5 software. The results are shown in Figures 3-1 and 3-2.
[0175] 5) Inhibitory effect of chimeric antibodies on CD38 enzyme activity CD38 catalyzes the synthesis and degradation of cyclic adenosine diphosphate ribose (cADPR, cyclic ADP-ribose), thereby catalyzing the synthesis of nicotinamide adenine dinucleotides. NAD+ cyclizes to cyclic adenosine diphosphate ribose (cADPR), which can then be hydrolyzed to ADPR. Because cADPR is unstable, nicotinamide guanine dinucleotide (NGD+) is typically used as a substrate to catalyze and detect the generated cGDPR in studies of CD38 enzyme activity. Anti-CD38 antibodies can bind to CD38 and inhibit the CD38 protease that catalyzes the generation of cGDPR from NGD+. Daudi cells were mixed with gradient-diluted chimeric antibodies and incubated for 15 minutes at room temperature. NGD substrate was added at different time points, mixed uniformly, and then detected. The results are shown in Table 1, Figures 4-1, and 4-2.
[0176] [Table 1]
[0177] 6) ADCC killing activity of chimeric antibodies against Duadi cells Density 1×10 6 Daudi cells were seeded at 50 μL / well in a U-shaped 96-well plate. 50 μL of antibody was added to each well and incubated in a 37°C, 5% CO2 incubator for 30 minutes. PBMC cells were removed from the liquid nitrogen tank and rapidly thawed in a 37°C water bath. The cells were quickly transferred to a 15 mL centrifuge tube, added with RPMI 1640 medium, counted, and centrifuged at 300 g for 10 minutes. The supernatant was discarded, and the cells were diluted to 1 × 10 7The cells were resuspended in RPMI-1640 medium at a density of 100µL / mL. The 96-well plate was removed, and 50µL of PBMC cells were added to each well. The cells were then incubated in a 5% CO2 incubator for 4 hours. 30 minutes before detection, 2µL of cell lysate (100x) was added to the largest well of target cells, and incubation continued at 37°C. After centrifugation at 300xg for 3 minutes, 50µL of the supernatant was transferred to a black ELISA plate. 50µL of LDH detection substrate (pre-dissolved at room temperature) was added to each well and gently mixed. After 10 minutes, 25µL of stop solution was added to each well to stop the activity. The plate was then shaken for 10 seconds and read by fluorescence (excitation wavelength 560nm, emission wavelength 590nm). The results are shown in Figure 5. The chimeric antibody 48H1-B11 exhibited a clear ADCC killing effect on Daudi cells in a dose-dependent manner.
[0178] 7) ADCP killing activity of chimeric antibodies against Duadi cells Daudi cells labeled with 1 μM CFSE were incubated with CD38 + Use 1x10 as target cells 5 50 μL was inoculated into a 96-well plate at a density of 2.5x10 / well, and the antibody was diluted 4-fold. 50 μL was then taken into the well plate. Finally, the antibody was induced with GM-CSF1 for 7 days at a density of 2.5x10 5 100 μl of 1 / ml mature macrophages were added at a macrophage:Daudi ratio of 1:4 and incubated in a 37°C, 5% CO2 incubator for 4 hours. Finally, collected cells were analyzed by flow cytometry. The results are shown in Figure 6. Chimeric antibody 48H1-B11 clearly phagocytized Daudi cells with ADCP, and this phagocytosis was dose-dependent.
[0179] Example 5: Humanization of anti-CD38 antibodies The light chain of the mAb48H1-B11 mouse antibody is mouse IMGT_mVK13-84. First, the humanized framework regions were screened, and IMGT_hVK_1_39, IMGT_hVK_2D_28, IMGT_hVK_3_7, IMGT_hVK_3_20, and IMGT_hVK_4_1 were selected, respectively. CDR grafting was then performed to obtain five humanized light chain variants, h48H1-Vkv1-v5. The heavy chains of the mouse antibodies were IGHV2-5. IMGT_hVH_1_69, IMGT_hVH_2_26, IMGT_hVH_3_23, IMGT_hVH_4_59, IMGT_hVH_5_51, and IMGT_hVH_7_4_1 were selected, respectively, and CDR-grafted to generate six humanized heavy chain variants, h48H1-VHv1-v6. After combining and pairing the light and heavy chain variants, they were transiently expressed in CHO-S cells to determine the affinity and CDC activity of each group and antibody.
[0180] From the light and heavy chain variants that fully retained the CDC activity of the chimeric antibody, human IMGT_hVK3-20 was selected, which had the highest identity to the light chain framework region of the mouse antibody mAb48H1-B11. The humanized sequence was optimized, and human IGKJ4*01, which had the highest identity, was selected as FM4. The human heavy chain germline gene IMGT_hVH4-59 was then selected for CDR grafting, and human IGHJ4*01, which had the highest identity, was selected as FM4. Computer-based homology modeling was performed to analyze the amino acid sequences of the CDR regions and their surrounding frameworks, avoiding concentrated distribution of molecular surface charges or hydrophobic regions. A total of five heavy chain variants, h48H1-VHv7-v11, and two light chain variants, h48H1-VKv7-v8, were obtained. The light and heavy chains were then synthesized in their entirety, and then cloned into eukaryotic expression vectors containing the antibody kappa chain constant region Ckappa or the human IgG1 constant region CH1-CH3. The light and heavy chain plasmids were combined and paired, and then transfected into CHO-S cells and expressed at 37°C for 5-6 days. The culture supernatant was collected and purified using a protein A column.
[0181] The heavy / light chain variable region sequences of the humanized antibody are as follows:
[0182] VH v1: [ka] Nucleic acid sequence CAGGTTCAGCTGGTTCAGTCTGGCGCCGAGCTGAAGAAACCTGGCAGCTCTGTGAAGGTGTCCTGCAAGGTGTCCGGCTTCAGCCTGACAAGCTACGGCATCCACTGGCTGAGACAGGCC CCTGGACAAGGCTTGGAATGGATGGGAGTGATTTGGAGAGGCGGCAGCACCGACTACAACGCCAAGTTTCAGGGCAGAGTGACCATCACCAAGGACAACAGCAAGAGCACCGTGTACATGGAACTGAGCAGCCTGAGAAGCGAGGACACCGCCGTGTACTACTGCGCCAAGGGCAAAGTGACAACCGGCTTCTACTTCGACTTCTGGGGCCAGGGAACCCTGGTCACAGTCTCTTCT
[0183] VH v2: [ka] Nucleic acid sequence CAAGTGACCCTGAAAGAAAGCGGCCCTGTGCTGGTCAAGCCCACCGAAACACTGACCCTGACCTGTACCGTGTCCGGCTTCAGCCTGACAAGCTACGGAATCCACTGGCTGAGACAGCCTCCAGGCAAGGCTCTGGAATGGCTGGCCGTTATTTGGAGAGGCGGCAGCACAGACTACAACGCCAGCCTGAAGTCCAGACTGACCATCAGCAAGGACAACAGCAAGAGCCAGGTGGTGCTGACCATGACCAACATGGACCCTGTGGACACCGCCACCTACTACTGCGCTAAGGGCAAAGTGACCACCGGCTTCTACTTCGACTTTTGGGGCCAGGGCACCCTGGTCACAGTCTCTTCT
[0184] VH v3:
Chem.
[0185] VH v4:
Chem.
[0186] VH v5:
Chem.
[0187] VH v6:
Chem.
[0188] VH v7:
Chem.
[0189] VH v8:
Chem.
[0190] VH v9:
Chem.
[0191] VH v10:
Chem.
[0192] VH v11:
Chem.
[0193] VK v1:
Chem.
[0194] VK v2:
Chem.
[0195] VK v3: [Chemistry] Nucleic acid sequence GAGATCGTGATGACACAGAGCCCTCCAACACTGTCTCTGAGCCCTGGCGAGAGAGTGACCCTGAGCTGTAGAGCCAGCGAGGACATCTACAACAGACTCGTGTGGTATCAGCAGAAGCCCGGCCAGGCTCCTAGACTGCTGATTAGCGGAGTGACCAGCCTGGAAACTAGCATCCCCGCCAGATTCAGCGGCTCTGGCTCTGGCAAGGACTACACCCTGACAATCAGCAGCCTGCAGCCTGAGGACTTCGCCGTGTACTACTGCCAGCAGTACTGGTCTACCCCTTACACCTTCGGCCAGGGCACCAAGGTGGAAATCAAG
[0196] VK v4: [Chemistry] Nucleic acid sequence GAGATCGTGATGACACAGAGCCCCGGCACACTGTCACTGTCTCCAGGCGAAAGAGCCACACTGAGCTGTAGAGCCAGCGAGGACATCTACAACAGACTCGTGTGGTATCAGCAGAAGCCCGGCCAGGCTCCTAGACTGCTGATTAGCGGAGTGACCAGCCTGGAAACAGGCATCCCCGACAGATTCAGCGGCTCTGGCTCTGGCAAGGACTACACCCTGACCATCAGCAGACTGGAACCCGAGGACTTCGCCGTGTACTACTGCCAGCAGTACTGGTCTACCCCTTACACCTTCGGCCAGGGCACCAAGGTGGAAATCAAG
[0197] VK v5: [Chemistry] Nucleic acid sequence GACATCGTGATGACACAGAGCCCTGATAGCCTGGCCGTGTCTCTGGGAGAGAGAGCCACCATCAACTGCAAGGCCAGCGAGGACATCTACAACAGACTCGTGTGGTATCAGCAGAAGCCCGGCCAGCCTCCTAAGCTGCTGATTAGCGGAGTGACCAGCCTGGAAACAGGCGTGCCAGACAGATTCAGCGGCTCTGGCTCTGGCAAGGACTACACCCTGACAATCAGCTCCCTGCAGGCCGAGGATGTGGCCGTGTACTACTGCCAGCAGTACTGGTCTACCCCTTACACCTTCGGCCAGGGCACCAAGGTGGAAATCAAG
[0198] VK v7:
Chem.
[0199] [[ID=二十四]] [[ID=二十五]]VK v8:[[ID=二十六]] [[ID=二十七]] [[ID=二十八]]
Chem.
化
Chem.
[0200] Example 6. CDC killing of different humanized CD38 antibodies against tumor cells Daudi Different cells were seeded into a U-shaped 96-well plate, and different concentrations of antibody were added to each well. The wells were then incubated in a CO2 incubator for 30 minutes. Next, 50 μl of complement mixture was added to each well, and the wells were incubated in a CO2 incubator for 2 hours. Next, 50 μl of CCK-8 solution was added to each well, and the wells were shaken to mix. The plates were then read at absorbance OD450. The results, shown in Figures 7-1 and 7-2, indicate that among the different humanized CD38 antibodies, humanized variants Ab031 and Ab033 exhibited the highest maximal killing rates for Daui cells.
[0201] [Table 2]
[0202] Example 7: Affinity measurement of humanized CD38 antibodies 1) Affinity measurement by ELISA Human CD38 protein was coated onto a 96-well plate and incubated overnight at 4°C. The wells were then discarded, washed three times with wash buffer, and blocked with 2% milk in PBS for 60 minutes. After washing three times with wash buffer, 100 μL of antibody at different dilutions was added to each well and incubated at 37°C for 1 hour. After washing three times with wash buffer, HPR-conjugated goat anti-human IgG Fc (1:5000) was added in 0.5% BSA and incubated at room temperature for 1 hour. After washing three times with wash buffer, 100 μL of TMB substrate solution was added for color development. The reaction was incubated at 37°C for 10 minutes, then stopped with 50 μL of 2M sulfuric acid solution, and the absorbance was measured at 450 nm. As shown in Figure 8-1 and Table 3, the humanized CD38 antibodies Ab031 (EC50 = 0.51 nM) and Ab033 (EC50 = 4.24 nM) bound to CD38 with high affinity, as detected by ELISA.
[0203] [Table 3]
[0204] 2) Affinity measurement using Biacore The humanized variants were captured on a Protein A chip at 0.5 μg / ml in 1:1 monovalent binding mode, with a capture signal of approximately 200 RU. Human CD38 recombinant protein at different concentrations was then applied to the chip as the analyte. The SPR signal changes during the antibody binding and dissociation processes were recorded and fitted to a Langmuir 1:1 kinetic model. The fit with the model was analyzed to provide affinity data. As shown in Table 4, the affinity of humanized antibody AB031 was determined to be 0.28 nm and that of AB033 was 1.43 nm by Biacore.
[0205] [Table 4]
[0206] 3) Cell affinity measurement by FACS Cells at different logarithmic growth phases were taken, blocked with 0.5% BSA for 30 minutes, and then 5 × 10 4 Cells were seeded into a U-shaped 96-well plate at 100 μL per well and centrifuged at 1100 rpm for 3 minutes. The supernatant was discarded, and the cells were gently dispersed. 50 μL / well of gradient-diluted antibody (antibody concentration: 30 μg / mL, diluted 3-fold to obtain a 5-fold gradient) was added and incubated at 4°C for 1 hour. After incubation, the plate was washed three times with 180 μL / well of 0.5% BSA. 30 μL / well of secondary antibody, Alexa Fluro 647 anti-human IgG (Jackson ImmunoResearch, catalog number: 109-606-170), was added and incubated for 45 minutes at 4°C. After incubation, the plate was washed three times with 180 μL / well of 0.5% BSA. Finally, the plate was resuspended in 50 μL / well of PBS and subjected to iQue (Intellicyt, USA) detection. As shown in Figure 8-2 and Table 5, the humanized antibodies AB031 and AB033 were detected by FACS to bind with high affinity to the CD38 molecule expressed on Daudi. Furthermore, the humanized variants AB031 and AB033 also recognized the CD38 molecule expressed on other tumor cells, NALM-6, Ramos.2G6.4C10, and TALL-1 (Figures 8-3 and 8-4). , 8-5).
[0207] [Table 5]
[0208] Example 8: CD38 expression levels in different tumor cells FACS analysis was used to detect the expression levels of CD38 on different tumor cells, and the 1*10 6Different tumor cells were collected by centrifugation, washed once with 3 mL of PBS, and blocked for 20 minutes. After adding 50 μL of diluted primary antibody solution (anti-human CD38 hIgG1-biotin), the cells were incubated on ice for 40 minutes, washed twice, and then 100 μL / well of diluted secondary antibody solution (SA-PE, Jackson, catalog number: 016110084) was added. The cells were incubated on ice in the dark for 30 minutes. After washing twice, the cells were collected by centrifugation, and 200 μL / well of diluted PI solution was added and gently pipetted to mix evenly. Then, the cells were placed in a standard BD Qusntibrite PE tube (BD, catalog number: 340495), and 500 μL of 0.5% BSA / PBS solution was added in the dark. The cells were then incubated on ice and analyzed by flow cytometry. As a result, as shown in Figure 9, CD38 was highly expressed in Daudi and Ramos.2G6.4C10 (ATCC CRL-1923) cells, moderately expressed in RPMI-8226 (ATCC CRM-CCL-155), TALL-1 (Shanghai Sixin Biochemistry Technology Co., Ltd.), and Raji (China National Institute for Food and Drug Control) cells, lowly expressed in NCI-H929 (Nanjing Cobioer Biosciences Co. LTD), CCRF-CEM, and NALM-6 (Shanghai Zhishi Biochemistry Technology Co., Ltd.) cells, and weakly expressed in MM.1S (ATCC CRL-2974), MOLP-8, and WSU-DLCL-2 (Shanghai Sixin Biochemistry Technology Co., Ltd.) cells.
[0209] Example 9. CDC killing of humanized CD38 antibodies against different tumor cells Different cell types were seeded into a U-shaped 96-well plate, and different concentrations of antibody were added to each well. The plate was then incubated in a CO2 incubator for 30 minutes. Next, 50 μl of complement mixture was added per well, and the plate was incubated in a CO2 incubator for 2 hours. Next, 50 μl of CCK-8 solution was added per well, and the plate was shaken to mix evenly. The plate was then read at absorbance OD450. As shown in Figures 10-1, 10-2, and 10-3, humanized antibodies Ab031 and Ab033 demonstrated maximal cell killing of 98% against Ramos.2G6.4C10 cells, 65% against Daudi cells, and 40% against TALL-1 cells.
[0210] Example 10. ADCC killing of humanized CD38 antibodies against different tumor cells Different cells were seeded in a U-shaped 96-well plate, and different concentrations of antibodies were added to each well. The mixture was incubated in an O2 incubator for 30 minutes. 5 PBMC cells were added at 1 / well and incubated in a CO2 incubator for 4 hours. Thirty minutes before detection, cell lysis solution was added and the incubation continued. The supernatant was collected into a black ELISA plate, and LDH detection substrate was added and shaken to mix uniformly. After 10 minutes, stop solution was added to terminate the reaction, and the plate was shaken to mix uniformly. The fluorescence was selected and the plate was read to calculate the killing rate. The formula for calculating the killing rate is as follows:
[0211] JPEG0007734386000060.jpg19100
[0212] As a result, as shown in Figures 11-1, 11-2, 11-3, 11-4, 11-5, 11-6, 11-7, and 11-8, the humanized antibodies Ab031 and Ab033 had a killing rate of 90% against Ramos.2G6.4C10 cells, a killing rate of 65% against NALM-6 cells, a killing rate of 67% against RPMI-8226 cells, a killing rate of 48% against CRFF-CEM cells, a killing rate of 62% against Daudi cells, a killing rate of 40% against TALL-1 cells, a killing rate of 20% against MM.1S cells, a killing rate of 48% against NCI-H929 cells, and a killing rate of 75% against Raji cells.
[0213] Example 11. ADCP killing of humanized CD38 antibodies against different tumor cells CD38 + 1 μM CFSE-labeled Daudi cells were seeded into a 96-well plate as target cells, and gradient-diluted antibody was added. The cells were then incubated in a CO2 incubator. Finally, mature macrophages induced with GM-CSF1 were added at a macrophage:Daudi ratio of 1:4 and incubated in a CO2 incubator for 4 hours. Anti-human CD14 APC antibody dilution was added and the cells were incubated on ice for 20 minutes in the dark. The collected cells were then analyzed by flow cytometry. Macrophages alone served as a control, and CD14 single-positive cells were isolated. In experimental wells, CD14 single-positive cells and CD14 and CSFE double-positive cells were isolated and counted. As a result, as shown in Figures 12-1, 12-2, 12-3, 12-4, and 12-5, the humanized CD38 antibodies Ab031 and Ab033 all exhibit varying degrees of ADCP phagocytosis against the cells Daudi, TALL-1, Ramos.2G6.4C10, Raji, and NALM-6, which express CD38 at different levels.
[0214] Example 12: Inhibitory effect of humanized CD38 antibody on CD38 enzyme activity The CD38 recombinant protein was mixed with gradient-diluted humanized CD38 antibodies Ab031 and Ab0337, incubated at room temperature for 15 minutes, and then NGD substrate was added at different time points, mixed, and detected. As a result, as shown in Figure 13, the chimeric antibody 48H1-B11 and the humanized CD38 antibodies Ab031 and Ab033 showed significant inhibitory effects on CD38 enzyme activity.
[0215] Example 13: Induction of apoptosis by humanized CD38 antibody 2*10 5 Daudi cells were seeded into a 24-well plate and incubated overnight at 37°C. 100 μl / well of diluted and mixed humanized antibodies were added and incubated in a CO2 incubator. After 24 or 48 hours of induction and stimulation, the cells were harvested and 100 μl of Annexin V-FITC reagent was added and gently mixed. Next, propidium iodide staining solution was added and gently mixed. After incubation in the dark at room temperature for 15 minutes, the cells were detected by flow cytometry. Annexin V-FITC emitted green fluorescence, indicating early and late apoptotic cells, while PI emitted red fluorescence. These cells express the apoptotic signal, which indicates that they are terminal apoptotic or dead cells. As a result, as shown in Figure 14, the humanized CD38 antibodies Ab031 and Ab033 were detected to have an apoptotic effect on Daudi cells.
[0216] Example 14: Induction of human erythrocyte degradation by humanized CD38 antibody Human red blood cells were seeded into a 96-well plate, and 50 μl of gradient-diluted antibodies at different concentrations (10 μg / mL and 1 μg / mL) were added. 50 μl of diluted complement was then added (inactivated complement was used as a control). The cells were incubated in a CO2 incubator for 2 hours, and then the cells were observed under a microscope. As shown in Figure 15, neither the humanized CD38 antibodies AB031 nor AB033 induced red blood cell lysis in the control group nor the experimental group.
[0217] Example 15: Antitumor effect of humanized CD38 antibody in a NOD / SCID mouse model with subcutaneous xenografts of Daudi cell lines Raji cells were cultured in RPMI1640 medium containing 10% fetal bovine serum. Raji cells in the logarithmic growth phase were collected, resuspended in PBS to an appropriate concentration, and mixed with matrigel at a 1:1 ratio for subcutaneous tumor inoculation in NOD / SCID mice. 1 × 10 cells were inoculated subcutaneously on the right side of female mice. 7 Raji cells were inoculated, and the average tumor volume was 100 mm 3 Once the tumor size reached 1000 mg / kg, the mice were randomly divided into groups based on tumor size. Each group consisted of 6 mice. The mice in the treatment group were injected with 10 mg / kg of steroids into their tail vein twice a week for a total of 2 weeks, and tumor volume was monitored. Tumor volume was calculated as tumor volume (mm 3 )=1 / 2×(a×b 2 ) (where a represents the major axis and b represents the minor axis).
[0218] As shown in Figure 16, CD38 antibodies (3 / 10 mg / kg, IP, D0, 3) significantly suppressed the production of subcutaneously transplanted human B-cell lymphoma tumors in Daudi mice and caused some tumor disappearance. Among these, CM313-1 is humanized antibody Ab031, CM313-2 is humanized antibody Ab033, CM313-3 is antibody-005 (US20150231235A1), and CM313-4 is 38SB19 (US20110293606A1).
[0219] (Addendum) The present disclosure includes the following aspects. Section 1: heavy chain CDRs selected from the amino acid sequences SEQ ID NOs: 2-4, 12-14, 22-24, 32-34, 42-44, 52-54, 62-64, 72-74, 82-84, 92-94, 102-144, 112-114, 122-124, 132-34, 142-144, 152-154, 162-164, 172-174, 182-184, 187-189, 192-194, 197-199, 202-204, 207-209, 212-214, 217-219, 222-224, 227-229, 232-234 or any variant thereof; and / or amino acid sequences SEQ ID NOs: An antibody or antigen-binding portion thereof that binds to CD38, comprising a light chain CDR selected from NO:7-9, 17-19, 27-29, 37-39, 47-49, 57-59, 67-69, 77-79, 87-89, 97-99, 107-109, 117-119, 127-129, 137-139, 147-149, 157-159, 167-169, 177-179, 237-239, 242-244, 247-249, 252-254, 257-259, 262-264, 267-269, or any variant thereof. Section 2: Heavy chain CDR1 selected from amino acid sequences SEQ ID NOs: 2, 12, 22, 32, 42, 52, 62, 72, 82, 92, 102, 112, 122, 132, 142, 152, 162, 172, 182, 187, 192, 197, 202, 207, 212, 217, 222, 227, 232 or any variant thereof, 3, 13, 23, 33, 43, 53, 63, 73, 83, 93, 103, 113, 123, 133, 143, 153, 163, 173, 183, 188, 193, 198, 203, 208, 213, 218, 223, 228, 233, or any variant thereof, a heavy chain CDR3 selected from the amino acid sequence SEQ ID NOs: 4, 14, 24, 34, 44, 54, 64, 74, 84, 94, 104, 114, 124, 134, 144, 154, 164, 174, 184, 189, 194, 199, 204, 209, 214, 219, 224, 229, 234, or any variant thereof; and / or a light chain CDR1 selected from the amino acid sequence SEQ ID NOs: 7, 17, 27, 37, 47, 57, 67, 77, 87, 97, 107, 117, 127, 137, 147, 157, 167, 177, 237, 242, 247, 252, 257, 262, 267, or any variant thereof; 8, 18, 28, 38, 48, 58, 68, 78, 88, 98, 108, 118, 128, 138, 148, 158, 168, 178, 238, 243, 248, 253, 258, 263, 268, or any variant thereof; and a light chain CDR3 selected from amino acid sequences of SEQ ID NOs: 9, 19, 29, 39, 49, 59, 69, 79, 89, 99, 109, 119, 129, 139, 149, 159, 169, 179, 239, 244, 249, 254, 259, 264, 269, or any variant thereof. Section 3: The antibody or antigen-binding portion thereof of any one of the preceding paragraphs, comprising a combination of heavy and light chain CDRs selected from the group consisting of: (1) heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 2-4, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 7-9, respectively; (2) heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 12-14, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 17-19, respectively; (3) heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 22-24, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 27-29, respectively; (4) heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 32-34, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 37-39, respectively; (5) heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 42-44, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 47-49, respectively; (6) heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 52-54, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 57-59, respectively; (7) heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 62-64, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 67-69, respectively; (8) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 72-74, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 77-79, respectively. (9) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 82-84, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 87-89, respectively. (10) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 92-94, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 97-99, respectively. (11) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 102-104, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 107-109, respectively. (12) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 112-114, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 117-119, respectively. (13) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 122-124, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 127-129, respectively. (14) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 132-134, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 137-139, respectively. (15) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 142-144, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 147-149, respectively. (16) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 152-154, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 157-159, respectively. (17) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 162-164, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 167-169, respectively. (18) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 172-174, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 177-179, respectively. (19) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 182-184, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 237-239, respectively. (20) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 182-184, respectively, and / or SEQ ID NOs: 242-244, respectively. Light chain CDR1, CDR2, and CDR3 sequences (21) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 182-184, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 247-249, respectively. (22) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 182-184, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 252-254, respectively. (23) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 182-184, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 257-259, respectively. (24) Heavy chain CDR1, CDR2, and CDR3 sequences each comprising SEQ ID NOs: 187-189, and / or light chain CDR1, CDR2, and CDR3 sequences each comprising SEQ ID NOs: 237-239. (25) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 187-189, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 242-244, respectively. (26) Heavy chain CDR1, CDR2, and CDR3 sequences each comprising SEQ ID NOs: 187-189, and / or light chain CDR1, CDR2, and CDR3 sequences each comprising SEQ ID NOs: 247-249. (27) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 187-189, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 252-254, respectively. (28) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 187-189, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 257-259, respectively. (29) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 192-194, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 237-239, respectively. (30) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 192-194, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 242-244, respectively. (31) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 192-194, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 247-249, respectively. (32) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 192-194, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 252-254, respectively. (33) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 192-194, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 257-259, respectively. (34) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 197-199, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 237-239, respectively. (35) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 197-199, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 242-244, respectively. (36) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 197-199, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 247-249, respectively. (37) Heavy chain CDR1 and CDR2 containing SEQ ID NOs: 197-199, respectively and CDR3 sequences, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 252-254, respectively. (38) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 197-199, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 257-259, respectively. (39) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 202-204, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 237-239, respectively. (40) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 202-204, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 242-244, respectively. (41) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 202-204, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 247-249, respectively. (42) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 202-204, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 252-254, respectively. (43) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 202-204, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 257-259, respectively. (44) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 207-209, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 237-239, respectively. (45) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 207-209, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 242-244, respectively. (46) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 207-209, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 247-249, respectively. (47) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 207-209, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 252-254, respectively. (48) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 207-209, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 257-259, respectively. (49) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 212-214, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 262-264, respectively. (50) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 212-214, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 267-269, respectively. (51) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 217-219, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 262-264, respectively. (52) Heavy chain CDR1, CDR2, and CDR3 sequences each comprising SEQ ID NOs: 217-219, and / or light chain CDR1, CDR2, and CDR3 sequences each comprising SEQ ID NOs: 267-269. (53) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 222-224, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 262-264, respectively. (54) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 222-224, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 267-269, respectively. (55) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 227-229, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 262-264, respectively. (56) Heavy chain CDR1, CDR2, and CDR3 sequences each comprising SEQ ID NOs: 227-229, and / or light chain CDR1, CDR2, and CDR3 sequences each comprising SEQ ID NOs: 267-269. (57) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 232-234, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 262-264, respectively. (58) Heavy chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 232-234, respectively, and / or light chain CDR1, CDR2, and CDR3 sequences comprising SEQ ID NOs: 267-269, respectively. Section 4: a heavy chain variable region selected from the amino acid sequences of SEQ ID NOs: 1, 11, 21, 31, 41, 51, 61, 71, 81, 91, 101, 111, 121, 131, 141, 151, 161, 171, 181, 186, 191, 196, 201, 206, 211, 216, 221, 226, 231, or any variant thereof; and / or an amino acid sequence SEQ 1. An antibody, or antigen-binding portion thereof, comprising a light chain variable region selected from ID NOs: 6, 16, 26, 36, 46, 56, 66, 76, 86, 96, 106, 116, 126, 136, 146, 156, 166, 176, 236, 241, 246, 251, 256, 261, 266, or any variant thereof, Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 1 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 6 or any variant thereof, Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 11 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 16 or any variant thereof, Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 21 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 26 or any variant thereof, Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 31 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 36 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 41 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 46 or any variant thereof, Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 51 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 56 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 61 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 66 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 71 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 76 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 81 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 86 or any variant thereof. Including variable regions, Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 91 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 96 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 101 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 106 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 111 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 116 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 121 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 126 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 131 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 136 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 141 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 146 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 151 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 156 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 161 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 166 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 171 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 176 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 181 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 236 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 181 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 241 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 181 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 246 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 181 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 251 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 181 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 256 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 186 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 236 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 186 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 241 or any variant thereof; Preferably, the heavy chain of the amino acid sequence SEQ ID NO: 186 or any variant thereof a light chain variable region and a light chain variable region of the amino acid sequence SEQ ID NO: 246 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 186 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 251 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 186 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 256 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 191 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 236 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 191 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 241 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 191 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 246 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 191 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 251 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 191 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 256 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 196 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 236 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 196 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 241 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 196 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 246 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 196 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 251 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 196 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 256 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 201 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 236 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 201 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 241 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 201 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 246 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 201 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 251 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 201 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 256 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 206 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 236 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 206 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 241 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 206 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 246 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 206 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 251 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 206 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 256 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 211 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 261 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 211 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 266 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 216 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 261 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 216 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 266 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 221 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 261 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 221 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 266 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 226 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 261 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 226 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 266 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 231 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 261 or any variant thereof; Preferably, the heavy chain variable region has the amino acid sequence SEQ ID NO: 231 or any variant thereof, and the light chain variable region has the amino acid sequence SEQ ID NO: 266 or any variant thereof. Item 3. The antibody or antigen-binding portion thereof according to Item 1 or 2. Section 5: A bispecific or multispecific molecule comprising the antibody or antigen-binding portion thereof according to any one of items 1 to 4. Item 6: The antibody or antigen-binding portion thereof according to any one of Aspects 1 to 4, or the bispecific or multispecific molecule according to Aspect 5, wherein the antibody or antigen-binding portion thereof is humanized. Section 7: A nucleic acid molecule encoding the antibody or antigen-binding portion thereof of any one of Aspects 1 to 4, or the bispecific or multispecific molecule of Aspect 5, wherein the nucleic acid molecule preferably comprises an antibody heavy chain nucleic acid sequence selected from SEQ ID NOs: 5, 15, 25, 35, 45, 55, 65, 75, 85, 95, 105, 115, 125, 135, 145, 155, 165, 175, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, or any variant thereof, and / or a nucleic acid molecule encoding the antibody or antigen-binding portion thereof of any one of Aspects 1 to 4, or the bispecific or multispecific molecule of Aspect 5, wherein the nucleic acid molecule comprises an antibody heavy chain nucleic acid sequence selected from SEQ ID NOs: 5, 15, 25, 35, 45, 55, 65, 75, 85, 95, 105, 115, 125, 135, 145, 155, 165, 175, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, or any variant thereof, and / or a nucleic acid molecule encoding the antibody or antigen-binding portion thereof of any one of Aspects 1 to 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 240, 245, 250, 255, 260, 265, 270, or any variant thereof. Section 8: A vector comprising the nucleic acid according to Item 7. Section 9: A cell comprising the nucleic acid according to Item 7 or the vector according to Item 8. Section 10: A composition comprising the antibody or antigen-binding portion thereof according to any one of Aspects 1 to 4, the bispecific or multispecific molecule according to Aspect 5, the antibody or antigen-binding portion thereof, or the bispecific or multispecific molecule according to Aspect 6, the nucleic acid according to Aspect 7, the vector according to Aspect 8, and / or the cell according to Aspect 9. Section 11: A kit comprising the antibody or antigen-binding portion thereof according to any one of Aspects 1 to 4, the bispecific or multispecific molecule according to Aspect 5, the antibody or antigen-binding portion thereof, or the bispecific or multispecific molecule according to Aspect 6, the nucleic acid according to Aspect 7, the vector according to Aspect 8, the cell according to Aspect 9, and / or the composition according to Aspect 10. Section 12: Use of the antibody or antigen-binding portion thereof according to any one of Aspects 1 to 4, the bispecific or multispecific molecule according to Aspect 5, the antibody or antigen-binding portion thereof, or the bispecific or multispecific molecule according to Aspect 6, the nucleic acid molecule according to Aspect 7, the vector according to Aspect 8, the cell according to Aspect 9, and / or the composition according to Aspect 10 in the preparation of a medicament or kit for treating a CD38-associated disease, wherein the CD38-associated disease is preferably selected from tumors and autoimmune diseases, and preferably the tumor is selected from multiple myeloma (MM), NK / T-cell lymphoma, immunoglobulin light-chain amyloidosis, chronic lymphocytic leukemia (CLL), chronic myeloid leukemia (CML), T-cell acute lymphoblastic leukemia, acute myeloid leukemia (AML), and acute lymphoblastic leukemia (ALL), and preferably the autoimmune disease is selected from rheumatoid arthritis (RA) or systemic lupus erythematosus (SLE).
Claims
1. An antibody or antigen-binding portion thereof that binds to CD38, comprising the following heavy and light chain CDRs: a heavy chain CDR1 comprising the amino acid sequence of SEQ ID NO: 217; a heavy chain CDR2 comprising the amino acid sequence of SEQ ID NO: 218; a heavy chain CDR3 comprising the amino acid sequence of SEQ ID NO: 219; a light chain CDR1 comprising the amino acid sequence of SEQ ID NO: 262; a light chain CDR2 comprising the amino acid sequence of SEQ ID NO: 263; and A light chain CDR3 comprising the amino acid sequence of SEQ ID NO:
264.
2. 2. The antibody or antigen-binding portion thereof of claim 1, comprising a heavy chain variable region of amino acid sequence SEQ ID NO: 216 and a light chain variable region of amino acid sequence SEQ ID NO:
261.
3. A bispecific or multispecific molecule comprising an antibody or antigen-binding portion thereof according to claim 1 or claim 2.
4. A nucleic acid molecule encoding an antibody or antigen-binding portion thereof according to claim 1 or claim 2, or a bispecific or multispecific molecule according to claim 3.
5. The nucleic acid molecule of claim 4, wherein the nucleic acid molecule comprises the nucleic acid sequence of SEQ ID NO: 220 and the nucleic acid sequence of SEQ ID NO:
265.
6. A vector comprising the nucleic acid molecule of claim 4 or claim 5.
7. A cell comprising the nucleic acid molecule of claim 4 or claim 5, or the vector of claim 6.
8. A composition comprising an antibody or antigen-binding portion thereof according to claim 1 or claim 2, a bispecific or multispecific molecule according to claim 3, a nucleic acid molecule according to claim 4 or claim 5, a vector according to claim 6 and / or a cell according to claim 7.
9. 10. A kit comprising an antibody or antigen-binding portion thereof according to claim 1 or claim 2, a bispecific or multispecific molecule according to claim 3, a nucleic acid molecule according to claim 4 or claim 5, a vector according to claim 6, a cell according to claim 7 and / or a composition according to claim 8.
10. 10. An antibody or antigen-binding portion thereof according to claim 1 or claim 2, a bispecific or multispecific molecule according to claim 3, a nucleic acid molecule according to claim 4 or claim 5, a vector according to claim 6, a cell according to claim 7 and / or a composition according to claim 8 for use in the treatment of a CD38-related disease.
11. The antibody or antigen-binding portion thereof, bispecific or multispecific molecule, nucleic acid molecule, vector, cell and / or composition of claim 10, wherein the CD38-associated disease is a tumor or an autoimmune disease.
12. 12. The antibody or antigen-binding portion thereof, bispecific or multispecific molecule, nucleic acid molecule, vector, cell and / or composition of claim 11, wherein the tumor is selected from multiple myeloma (MM), NK / T-cell lymphoma, immunoglobulin light chain amyloidosis, chronic lymphocytic leukemia (CLL), chronic myeloid leukemia (CML), T-cell acute lymphoblastic leukemia, acute myeloid leukemia (AML) and acute lymphoblastic leukemia (ALL).
13. The antibody or antigen-binding portion thereof, bispecific or multispecific molecule, nucleic acid molecule, vector, cell and / or composition of claim 11, wherein the autoimmune disease is selected from rheumatoid arthritis (RA) and systemic lupus erythematosus (SLE).
Citation Information
Patent Citations
An antitumor combination agent containing an antibody that specifically recognizes CD38 and cytarabine.
JP2012510463A
Subcutaneous dosing of Anti-CD38 antibodies
WO2019140410A1