Method for measuring the number of bacteria capable of oxidizing iron in soil

Abstract

To provide a method for detecting and measuring bacteria comprising iron oxidation ability in soil, the method capable of selectively detecting bacteria having iron oxidation ability and measuring the number of bacteria quickly.SOLUTION: There is provided a method for measuring the number of bacteria having iron oxidation ability from inside of soil, and the method comprises: an extraction step for extracting a microbial population from inside of soil; an amplification step for quantitatively amplifying a gene region related to an iron oxidation enzyme system, by a quantitative PCR method, with a DNA included in the microbial population extracted in the extraction step, as a casting mold; and a step for calculating the number of bacteria for substituting a cycle number (Ct value) which is required until reaching to a threshold value in the amplification step, to a predetermined relational expression for calculating the number of bacteria having the iron oxidation ability in the microbial population. The relational expression is an expression which is derived on the basis of, the cycle number (Ct value) required until reaching to the threshold value and the number of known bacteria included in each stage diluted sample, when performing the quantitative PCR method with the DNA included in a stage diluted sample in which the number of bacteria is known, as the casting mold.SELECTED DRAWING: Figure 1

Description

[Technical Field]

[0001] The present invention relates to a method for measuring the number of bacteria capable of oxidizing iron in soil, and more particularly to a method for measuring the number of bacteria capable of oxidizing iron in soil by quantitative PCR. [Background technology]

[0002] Pollutants originating from industrial wastewater and former industrial sites include a wide variety of substances, such as persistent organic compounds such as PCBs, BHC, and DDT, and metal ions such as iron, chromium, manganese, zinc, and mercury. These pollutants must be removed from the perspective of purifying industrial wastewater and preventing the spread of pollutants from former industrial sites.

[0003] As a conventional technique for removing mercury contained in the above-mentioned pollutants, there is a method for purifying contaminated soil using mercury-resistant iron-oxidizing bacteria. According to this method, mercury-resistant iron-oxidizing bacteria not only oxidize iron but also mercury ions (Hg 2+ ) metallic mercury (Hg 0 ), and as mercury-resistant iron-oxidizing bacteria are cultivated, iron ions are oxidized, which reduces mercury ions to metallic mercury and vaporizes them, thereby purifying soil or water contaminated with mercury compounds and / or mercury ions.

[0004] When using iron-oxidizing bacteria to remove mercury from soil, it is necessary to check whether iron-oxidizing bacteria are present in the soil at an appropriate concentration during treatment, because adding too few bacteria to the soil will affect the treatment efficiency. Furthermore, if iron-oxidizing bacteria remain in the environment after the mercury removal treatment is completed, this can also be problematic, so it is necessary to check whether iron-oxidizing bacteria remain in the soil after treatment.

[0005] Conventionally, to identify iron-oxidizing bacteria in soil, an aqueous solution was mixed with the soil, the supernatant was introduced into 9K medium, which is a culture medium for iron-oxidizing bacteria, and the presence or absence of bacteria was determined by the turbidity of the culture medium. Quantitative analysis was also carried out using a dilution method and microscopic observation.

[0006] However, such an identification method requires a great deal of time and effort to identify and quantify iron-oxidizing bacteria in soil.

[0007] Furthermore, Patent Document 1 discloses a method for detecting iron-oxidizing bacteria by amplifying DNA within the 16s ribosomal RNA gene region of novel salt-tolerant iron-oxidizing bacteria. This method allows for the identification of the number of iron-oxidizing bacteria more quickly than the above-mentioned culture method, dilution method, and microscopic observation. [Prior art documents] [Patent documents]

[0008] [Patent Document 1] Japanese Patent Application Laid-Open No. 2005-73646 Summary of the Invention [Problem to be solved by the invention]

[0009] However, because the iron-oxidizing bacteria described in Patent Document 1 are halotolerant iron-oxidizing bacteria, it is unclear whether the DNA of mercury-resistant iron-oxidizing bacteria that can live in mercury-contaminated soil can be effectively amplified. Although 16s ribosomal RNA is commonly used, it is unclear whether the base sequence of the 16s ribosomal RNA of halotolerant iron-oxidizing bacteria is well conserved in the 16s ribosomal RNA of mercury-resistant iron-oxidizing bacteria.

[0010] In view of the above problems, the object of the present invention is to provide a method for detecting and measuring bacteria having iron oxidizing ability in soil, which can selectively detect bacteria having iron oxidizing ability and quickly measure their number. [Means for solving the problem]

[0011] The present inventors have conducted extensive research to achieve the above-mentioned object, and as a result, they came up with the idea that if the DNA region of a gene involved in the iron oxidizing enzyme system is amplified by PCR as a template, bacteria having the amplified DNA will necessarily have iron oxidizing ability. They verified this idea, and further combined it with a method for rapid identification and quantification of bacterial counts using quantitative PCR, and found that all of the above-mentioned problems can be solved.

[0012] That is, in order to achieve the above object, the method for measuring the number of bacteria having iron oxidizing ability in soil according to the invention described in claim 1 comprises the steps of: The method comprises an extraction step of extracting a microbial population from soil; an amplification step of quantitatively amplifying a gene region involved in the iron oxidizing enzyme system by quantitative PCR using DNA contained in the microbial population extracted in the extraction step as a template; and a bacterial count calculation step of calculating the number of bacteria having iron oxidizing ability in the microbial population by substituting the number of cycles (Ct value) required to reach a threshold value in the amplification step into a predetermined relational equation, wherein the relational equation is derived by performing quantitative PCR using DNA contained in serially diluted samples with a known number of bacteria as a template, and based on the number of cycles (Ct value) required to reach a threshold value and the known number of bacteria contained in each serially diluted sample.

[0013] According to this invention, DNA contained in a microbial community extracted from soil is used as a template to amplify a gene region involved in the iron oxidizing enzyme system, thereby enabling the selective detection of microorganisms containing genes for the iron oxidizing enzyme system, i.e., bacteria capable of oxidizing iron. Furthermore, the predetermined relationship between the number of bacteria in a serially diluted sample and the number of cycles (Ct value) required to reach a certain threshold when quantitative PCR is performed using the DNA contained in the serially diluted sample as a template can be used. Therefore, the number of bacteria capable of oxidizing iron in a microbial community can be calculated by substituting the number of cycles (Ct value) required to reach the threshold in the amplification step into this relationship. Furthermore, selective detection and calculation of the number of bacteria capable of oxidizing iron can be rapidly performed through the extraction step, amplification step, and bacterial count calculation steps.

[0014] The invention described in claim 2 is characterized in that, in the method for measuring the number of bacteria capable of oxidizing iron in soil described in claim 1, the extraction solvent used in the extraction step is at least one acidic extraction solvent selected from sulfuric acid and an aqueous solution of a sulfate compound.

[0015] According to this invention, the extraction solvent used in the extraction step is at least one acidic extraction solvent selected from sulfuric acid or an aqueous solution of a sulfate compound, so that the activity of the iron-oxidizing bacteria can be maintained at a high level during extraction, and the extraction rate of the iron-oxidizing bacteria in the extraction step is improved.

[0016] The invention described in claim 3 is characterized in that, in the method for measuring the number of bacteria having iron oxidation ability described in claim 1 or 2, the DNA region of the gene encoding rusticyanin is used as the gene region involved in the iron oxidation enzyme system.

[0017] According to this invention, since rusticyanin is a gene encoding an iron oxidizing enzyme, if the rusticyanin gene region can be amplified, it can be concluded that the microorganism containing the template DNA is a bacterium with iron oxidizing ability.

[0018] The invention described in claim 4 is a method for measuring the number of bacteria having iron oxidation ability described in claim 3, characterized in that in the amplification step, the gene region involved in the iron oxidation enzyme system is amplified using either a primer set consisting of a forward primer composed of nucleotides containing the base sequence shown in SEQ ID NO: 1 and a reverse primer composed of nucleotides containing the base sequence shown in SEQ ID NO: 2, or a primer set consisting of a forward primer composed of nucleotides containing the base sequence shown in SEQ ID NO: 3 and a reverse primer composed of nucleotides containing the base sequence shown in SEQ ID NO: 4.

[0019] This invention specifically specifies the region to be amplified in the gene encoding rusticyanin in the invention of claim 3, and thus it is possible to reliably amplify each specific region of the rusticyanin gene. [Effects of the Invention]

[0020] According to the present invention, DNA contained in a microbial community extracted from soil is used as a template to amplify a gene region involved in the iron oxidizing enzyme system, thereby enabling the selective detection of microorganisms containing genes for the iron oxidizing enzyme system, i.e., bacteria capable of oxidizing iron. Furthermore, a predetermined relationship is established between the number of bacteria in a serially diluted sample and the number of cycles (Ct value) required to reach a certain threshold when performing quantitative PCR using the DNA contained in the serially diluted sample as a template. Therefore, by substituting the number of cycles (Ct value) required to reach the threshold in the amplification step into this relationship, the number of bacteria capable of oxidizing iron in the microbial community can be calculated. Furthermore, selective detection and calculation of the number of bacteria capable of oxidizing iron can be rapidly performed through the extraction step, amplification step, and bacterial count calculation steps.

[0021] Therefore, when removing mercury in soil using iron-oxidizing bacteria, after adding the iron-oxidizing bacteria to mercury-contaminated soil, it is possible to quickly confirm whether iron-oxidizing bacteria are present in the soil at an appropriate concentration during the mercury removal treatment and determine whether further iron-oxidizing bacteria should be added.Furthermore, after the mercury removal treatment using iron-oxidizing bacteria is completed, it is possible to quickly confirm whether iron-oxidizing bacteria remain in the treated soil, thereby shortening the construction period for mercury removal treatment. [Brief explanation of the drawings]

[0022] [Figure 1] 1 is a flowchart of a method for measuring the number of bacteria capable of oxidizing iron in soil according to the present invention. [Figure 2] FIG. 1 shows a relational expression calculated from the relationship between the Ct value and the number of plasmid DNAs (number of bacteria) containing genes involved in the iron oxidase system, which was prepared by quantitative PCR using primer set I. [Figure 3] FIG. 1 shows a relational expression calculated from the relationship between the Ct value and the number of plasmid DNAs (number of bacteria) containing genes involved in the iron oxidase system, which was prepared by quantitative PCR using primer set II. DETAILED DESCRIPTION OF THE INVENTION

[0023] 1 is a flowchart of the method of the present invention for measuring the number of bacteria capable of oxidizing iron in soil. The method of the present invention for measuring the number of bacteria capable of oxidizing iron in soil includes an extraction step, an amplification step, and a bacterial count step.

[0024] [Extraction process (S100)] In this step, a microbial community is extracted from soil. The soil may be any soil in which bacteria having a gene region involved in the iron oxidizing enzyme system are present. The soil may be soil in which such bacteria naturally exist, or soil to which bacteria having a gene region involved in the iron oxidizing enzyme system have been artificially added for the purpose of, for example, purifying contaminated soil.

[0025] Extraction can be performed with any solvent capable of extracting microbial communities from soil sand, silt, clay, etc. Aqueous solvents are preferred to avoid a decrease in activity or death of microbial communities during extraction. A representative example of bacteria having a gene region involved in the iron oxidizing enzyme system is Acidithiobacillus ferrooxidans (hereinafter also referred to as A. ferrooxidans). Because A. ferrooxidans grows best under acidic conditions of pH 2.0 to 3.5, an acidic solvent of pH 5 or less, preferably pH 3.5 or less, is more preferred. Furthermore, because it contains sulfur as a nutrient source, at least one acidic extraction solvent selected from sulfuric acid and aqueous solutions of sulfuric acid compounds is particularly preferred.

[0026] The extraction procedure is carried out by adding the soil to the solvent and mixing and stirring. The mixing and stirring time is, for example, 1 to 10 hours, preferably 2 to 9 hours, and particularly preferably 3 to 8 hours. The temperature during the extraction procedure is, for example, 5 to 40°C, preferably 15 to 35°C, and preferably 25 to 30°C.

[0027] Thereafter, the soil is left to stand until the solid and liquid components are separated, and the supernatant is collected as a microbial community (this is the extraction step (S100)).

[0028] [Amplification step (S110)] In this step, the DNA contained in the microorganisms extracted in the extraction step (S100) is used as a template to quantitatively amplify a gene region involved in the iron oxidizing enzyme system by quantitative PCR.

[0029] The gene involved in the iron oxidation enzyme system may be any gene that encodes an iron oxidation enzyme system, and examples include the gene encoding the high-potential iron-sulfur protein Iro discovered in the A. ferrooxidans JCM17309 strain, the gene encoding Hip discovered in the same standard strain ATCC33020, the genes encoding the blue copper protein rusticyanin (RusA) and cytochrome c (Cyc1, Cyc2) in the A. ferrooxidans ATCC23270 strain (and the A. ferrooxidans ATCC33020 strain), and the gene encoding the blue copper protein rusticyanin (RusB) in the A. ferrooxidans JCM17309 strain.

[0030] From the viewpoint of selectivity, it is particularly preferred that the gene involved in the iron oxidizing enzyme system be selected from the group consisting of genes encoding rusticyanin (RusA and RusB) of A. ferrooxidans. A primer set is designed to amplify the gene region involved in the iron oxidase system by PCR. The primer set is a pair of primers consisting of a forward primer and a reverse primer for amplification of a specific region of a template DNA.

[0031] The forward primer consists of nucleotides containing the base sequence of the sense strand including the start codon of the gene involved in the iron oxidative enzyme system, and the reverse primer consists of nucleotides containing a portion of the base sequence of the antisense strand near the 3' end of the gene involved in the iron oxidative enzyme system.

[0032] The primer set may be any primer set that can specifically amplify a gene region involved in the iron oxidase system by PCR. Preferably, one of the following primer sets is selected: a forward primer consisting of nucleotides containing the base sequence shown in SEQ ID NO: 1 (5'-GATGGCCGGTACTCTGGATA-3') and a reverse primer consisting of nucleotides containing the base sequence shown in SEQ ID NO: 2 (5'-AATCTCCAAGGTCGGGTTCT-3'); or a forward primer consisting of nucleotides containing the base sequence shown in SEQ ID NO: 3 (5'-CATATGTATACACAGAACACGATGAAAA-3') and a reverse primer consisting of nucleotides containing the base sequence shown in SEQ ID NO: 4 (5'-CTTGACAACGATCTTACCGAACATA-3').

[0033] Quantitative PCR is a modification of the polymerase chain reaction (PCR) that allows rapid quantification of the product, providing an indirect measure of the total amount of nucleic acid before amplification occurs.

[0034] Examples of quantitative PCR include agarose gel electrophoresis and real-time PCR, but from the viewpoint of rapid identification and quantification of bacterial counts, it is preferable to use real-time PCR, which measures PCR amplification over time (in real time) and quantifies template DNA based on the amplification rate.

[0035] Examples of real-time PCR methods include the intercalation method (SYBR Green method), which uses fluorescent molecules that intercalate between double-stranded DNA to measure the amount of DNA amplification, and the TaqMan Probe method (hydrolysis probe method), which uses FRET (fluorescence resonance energy transfer) to measure DNA amplification.

[0036] Reagents for carrying out real-time PCR are commercially available, and real-time PCR can be carried out using these commercially available reagents according to the manufacturer's instructions.

[0037] For example, in the case of the SYBR Green method, SYBR Premix Ex Taq II (Tli RNaseH Plus) (Takara Bio, Japan) can be used, and in the case of the TaqMan Probe method, Custom TaqMan MGB probe (Thermo Fisher Scientific) can be used.

[0038] Furthermore, when using real-time PCR, the conditions can be set with reference to PLOS ONE, Vol. 8, No. 9, pp. 1-9, published August 21, 2014 (by Shunsuke Takahashi et al.) (the amplification step (S110)).

[0039] [Bacteria count calculation step (S120)] In this step, the number of cycles (Ct value) required to reach a threshold value (a certain amount of amplification) in the amplification step (S110) is substituted into a previously determined relational equation to calculate the number of bacteria capable of oxidizing iron in the microbial community.

[0040] The relational expression is derived by performing quantitative PCR using DNA contained in serially diluted samples with a known number of bacteria as a template, and based on the number of cycles (Ct value) required to reach the threshold value and the known number of bacteria contained in each serially diluted sample. An example of how to determine the relational expression is described below.

[0041] First, a plasmid containing a gene region involved in the iron oxidative enzyme system is prepared as a template DNA by cloning the gene region involved in the iron oxidative enzyme system into an appropriate plasmid vector.

[0042] The gene region involved in the iron oxidative enzyme system can be obtained as an amplified DNA fragment by PCR using, for example, the genomic DNA of A. ferrooxidans strains JCM17309, ATCC33020, and ATCC23270 as a template, appropriately designed primers that amplify the gene region involved in the iron oxidative enzyme system, and using these primers. The JCM17309, ATCC33020, and ATCC23270 strains are available from strain distribution organizations. On the other hand, the amplified DNA fragment can be cloned by arbitrarily selecting a plasmid vector from various commercially available products such as pET-based plasmid vectors and pUC plasmid vectors, following the instructions for the plasmid vector.

[0043] The resulting plasmid containing the gene region involved in the iron oxidizing enzyme system is introduced into E. coli using competent cells of the bacteria, the E. coli containing the plasmid are grown, and the plasmid DNA is extracted.

[0044] The extracted plasmid DNA containing the gene region involved in the iron oxidative enzyme system was quantified, and the mass of the quantified plasmid DNA was divided by the molecular weight of the plasmid containing the cloned DNA fragment (the gene region involved in the iron oxidative enzyme system), and the mass was calculated using Avogadro's constant (6.03 × 10 23 ) to obtain the number of plasmid DNAs. Since it is known that the copy number of the gene involved in the iron oxidizing enzyme system in A. ferrooxidans is 1, when using A. ferrooxidans, this number of plasmid DNAs can be regarded as the number of bacteria.

[0045] Next, a plasmid DNA containing a gene region involved in the iron oxidase system is serially diluted to prepare multiple serially diluted samples, and quantitative PCR is performed on each of these serially diluted samples to determine the Ct value of each sample. Quantitative PCR can be performed, for example, by real-time PCR, and PCR conditions can be set with reference to PLOS ONE, Vol. 8, No. 9, pp. 1-9, published August 21, 2014 (by Shunsuke Takahashi et al.).

[0046] The Ct value and the number of bacteria for each sample are plotted on a graph with the Ct value on the vertical axis and the number of bacteria on the horizontal axis, and the regression equation obtained by the least squares method can be used as the above-mentioned relational equation. The reliability of the obtained relational equation can be evaluated, for example, by the coefficient of determination (R 2 ) is 0.9 or more, preferably 0.99 or more.

[0047] The number of bacteria capable of oxidizing iron in the microbial community is calculated by substituting the Ct value required to reach the threshold value in the amplification step (S110) into the relational expression previously determined as described above.

[0048] If iron-oxidizing bacteria exist that have n copies of a gene involved in the iron-oxidizing enzyme system, and if iron-oxidizing bacteria with n copies of a gene involved in the iron-oxidizing enzyme system are to be detected in a microbial community, the calculated number of bacteria can be corrected to 1 / n. [Example]

[0049] EXAMPLES The present invention will be specifically explained below by showing examples, but the present invention is not limited to these examples.

[0050] <1. Creating a relational equation> 1-1. Construction of a plasmid carrying the rusticyanin gene region Iron-oxidizing bacteria (Acidithiobacillus ferridurans ATCC33020 strain) carrying the rusticyanin gene were obtained from RIKEN and cultured at 30°C for 24 hours with shaking in 9K medium adjusted to pH 3. The composition of the 9K medium is as follows:

[0051] Composition of 9K medium K2HPO40.5g (NH4)2SO4 3.0g KCl 0.1g 0.5g MgSO4·7H2O FeSO4·7H2O 50.0g Ca(NO3)210.0mg 1.0 ml of 10N H2SO4 1.0L distilled water

[0052] DNA was extracted from the culture medium using ISOIL for Beads Beating (Nippon Gene, Japan), and the rusticyanin gene regions (the regions shown in SEQ ID NO: 5 and SEQ ID NO: 6, respectively) were amplified by PCR using the extracted DNA as a template.

[0053] PCR conditions Each PCR reaction mixture (25 μL) contained 20 ng of genomic DNA, 2× MightyAmp Buffer Ver.2 (Takara), 0.25 μM of each primer, and 1.25 units of MightyAmp DNA polymerase (Takara). The cycling conditions were an initial denaturation at 98°C for 2 minutes, followed by 35 cycles of 98°C for 10 seconds, 55°C for 15 seconds, and 68°C for 1 minute.

[0054] The amplified product (3 μL) was mixed with 1 μL EZ-Vision One DNA Dye (Amresco Inc., USA) and separated by electrophoresis on a 2% agarose gel to confirm the generation of a single product of the expected molecular weight.

[0055] The PCR product was purified using Econo Spin IIa (Gene Design, Japan), cloned into SIID31972 (plasmid), and transformed into E. coli HST08 Premium Competent Cells (Takara).

[0056] Positive transformants were then selected on LB agar medium supplemented with ampicillin (100 μg / ml), and single colonies confirmed by PCR to contain the plasmid with the expected insert DNA were grown overnight in 5 mL of LB medium supplemented with ampicillin (100 μg / ml).

[0057] The culture was centrifuged at 7,6106 × g to pellet the cells, and plasmid DNA was extracted from the cells using a QIAprep Spin miniprep kit according to the manufacturer's instructions (Qiagen). The purified plasmid was quantified using an ND-1000 instrument (Thermo Fisher Scientific). The number of rusticyanin genes present in the extracted plasmid DNA was calculated based on the quantified DNA concentration and the molecular weight of SIID31972 containing the inserted DNA fragment.

[0058] 1-2. Creation of a relational equation using the primer set of SEQ ID NOs: 1 and 2 The plasmid containing the region shown in SEQ ID NO:5 obtained in "1-1. Preparation of a plasmid incorporating the rusticyanin gene region" was serially diluted to prepare two samples each of diluted samples 1 to 5. The dilution concentrations are shown in Table 1 below.

[0059] [Table 1]

[0060] Using the plasmid DNA of these diluted samples 1 to 5 as templates, real-time PCR was carried out using a primer set consisting of a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: 2 (hereinafter also referred to as primer set I).

[0061] The sequences of the primers and the PCR conditions are as follows:

[0062] Primer sequence (5'-3') SEQ ID NO: 1 (fw): GATGGCCGGTACTCTGGATA SEQ ID NO: 2 (rev): AATCTCCCAAGGTCGGGTTCT

[0063] PCR conditions Real-time PCR was performed in a Rotor-GeneQ quantitative thermal cycler (QIAGEN) using SYBR Premix Ex Taq II (Tli RNaseH Plus) (Takara Bio, Japan).

[0064] Each reaction mixture (20 μl) contained 2.0 μl of each of the above samples and 0.2 mM of each primer. The cycling conditions for real-time PCR were an initial denaturation at 95°C for 30 seconds, followed by 35 cycles of 95°C for 5 seconds, 60°C for 20 seconds, and 72°C for 20 seconds.

[0065] From these results, growth curves (not shown) were created for each dilution step, a baseline was set between cycles where no increase in fluorescence was observed, and the point where the threshold and the amplification curve intersected was taken as the threshold cycle (Ct value) on the vertical axis, and the number of plasmid DNA (number of bacteria) in each diluted sample was plotted on the horizontal axis to create calibration curve 1 (relationship equation). This calibration curve 1 is shown in Figure 2.

[0066] 1-3. Creation of a relational equation using the primer set of SEQ ID NOs: 3 and 4 The plasmid containing the region shown in SEQ ID NO: 6 obtained in "1-1. Preparation of a plasmid incorporating the rusticyanin gene region" was serially diluted to prepare two samples each of diluted samples 1 to 5. The dilution concentrations are as shown in Table 2 below.

[0067] [Table 2]

[0068] Using the plasmid DNA of diluted samples 1 to 5 in Table 2 as templates, real-time PCR was carried out using a primer set consisting of a forward primer of SEQ ID NO: 3 and a reverse primer of SEQ ID NO: 4 (hereinafter also referred to as primer set II).

[0069] The sequences of the primers and the PCR conditions are as follows:

[0070] Primer sequence (5'-3') SEQ ID NO: 3 (fw): CATATGTATACACAGAACACGATGAAAA SEQ ID NO: 4 (rev): CTTGACAACGATCTTACCGAACATA The PCR conditions were the same as those used to prepare the standard curve 1.

[0071] From these results, similar to standard curve 1, the Ct value was plotted on the vertical axis and the number of plasmid DNA (number of bacteria) in each diluted sample on the horizontal axis to create standard curve 2 (relationship equation). This standard curve is shown in Figure 3.

[0072] As shown in Figures 2 and 3, highly reliable relationship equations were obtained for the region containing sequence number 5 and the region containing sequence number 6 using the corresponding primer sets.

[0073] 2. Quantitation of iron-oxidizing bacteria in soil The MON-1 strain of A. ferrooxidans (receiving institution: National Institute of Technology and Evaluation, Patent Microorganisms Deposit Center, date of receipt: March 25, 2021, receipt number: NITE AP-03451) was added to and mixed with the soil and left in a thermostatic chamber at 30°C for two weeks. After two weeks, 10 g of this soil was collected and placed in a 0.05% sulfuric acid acidic solution. After mixing and stirring for six hours, the supernatant was collected. The MON-1 strain of A. ferrooxidans was obtained by Hg-exchange of the SUG 2-2 strain of A. ferrooxidans collected from the soil of a hot spring in Japan.2+ Mercury-resistant bacteria isolated from cultures containing increasing concentrations of mercury. 2+ This strain exhibits high mercury tolerance and can grow even in a ferrous iron-containing inorganic salt medium.

[0074] The collected supernatant was centrifuged at 10,000 rpm or more for 10 minutes, and the precipitate was collected. The collected precipitate was divided into two sections, designated soil samples No. 1 and No. 2.

[0075] Extraction was performed from each soil sample using an ISOIL for Beads Beating kit (Nippon Gene, Japan) according to the manufacturer's instructions.

[0076] The resulting extract was purified using the DNeasy PowerClean Pro Cleanup Kit (QIAGEN, GER) according to the manufacturer's instructions to obtain purified DNA for PCR. Next, real-time PCR was performed using the purified DNA obtained from soil sample No. 1 as a template and the primer set of SEQ ID NOs: 1 and 2.

[0077] Real-time PCR was performed in a Rotor-GeneQ quantitative thermal cycler (QIAGEN) using SYBR Premix Ex Taq II (Tli RNaseH Plus) (Takara Bio, Japan).

[0078] The PCR conditions were as follows:

[0079] The reaction mixture (20 μl) contained 2.0 μl of purified DNA obtained from soil sample No. 1 and 0.2 mM of each of the primers of SEQ ID NOs: 1 and 2.

[0080] The cycling conditions for real-time PCR were an initial denaturation at 95°C for 30 seconds, followed by 35 cycles of 95°C for 5 seconds, 60°C for 20 seconds, and 72°C for 20 seconds.

[0081] From these results, a growth curve (not shown) was created, and the point where the threshold line and the amplification curve intersected was determined as the threshold cycle (Ct value).

[0082] This Ct value was substituted into the relational formula of standard curve 1 (see Figure 2) to determine the gene copy number (number of bacteria).

[0083] Similarly, real-time PCR was performed using the purified DNA obtained from soil sample No. 2 as a template and the primer set of SEQ ID NOs: 3 and 4. The PCR conditions were the same as when soil sample No. 1 was used, except for the primer set, so further description is omitted.

[0084] The Ct values ​​obtained from the results of real-time PCR were substituted into the relational equation of standard curve 2 (see FIG. 3) to determine the number of rusticyanin genes (number of bacteria).

[0085] The results are shown in Table 3.

[0086] [Table 3]

[0087] In Table 3, the initial value is the number of bacteria added immediately after the MON-1 strain of A. ferrooxidans was added to the soil. As shown in Table 2, when the number of bacteria was calculated using the respective relational equations of primer sets I and II, the error between them was within 10%, indicating that the number of bacteria could be quantified with high accuracy.

Claims

1. an extraction step of extracting microbial communities from soil; an amplification step in which a gene region involved in the iron oxidase system is quantitatively amplified by quantitative PCR using DNA contained in the microorganisms extracted in the extraction step as a template; a bacterial count calculation step of calculating the number of iron-oxidizing bacteria in the microbial community by substituting the number of cycles (Ct value) required to reach a threshold value in the amplification step into a previously determined relational expression, a method for measuring the number of bacteria capable of oxidizing iron in soil, the method comprising: performing quantitative PCR using DNA contained in serially diluted samples with a known number of bacteria as a template; and deriving the relational expression based on the number of cycles (Ct value) required to reach a threshold value and the known number of bacteria contained in each serially diluted sample; the gene region involved in the iron oxidizing enzyme system is a DNA region of a gene encoding rusticyanin (RusA) of A. ferrooxidans; In the amplification step, A method for measuring the number of bacteria capable of oxidizing iron in soil, comprising amplifying a DNA region of a gene encoding rusticyanin (RusA) of A. ferrooxidans using a primer set consisting of a forward primer composed of nucleotides containing the base sequence shown in SEQ ID NO: 1 and a reverse primer composed of nucleotides containing the base sequence shown in SEQ ID NO:

2.

2. 2. The method for measuring the number of bacteria having iron-oxidizing ability according to claim 1, wherein the extraction solvent used in the extraction step is at least one acidic extraction solvent selected from sulfuric acid and an aqueous solution of a sulfate compound.

Images