Primer set for detecting human papillomavirus type 16 (HPV16) and human papillomavirus type 18 (HPV18), method for detecting infection with HPV16 and HPV18, and use of primer set for detecting infection with HPV16 and HPV18

Abstract

A first object of the present invention is a primer set for amplifying the nucleotide sequence of the L2 gene of human papillomavirus type 16 or the L1 gene of human papillomavirus type 18. A second object of the present invention is a method for detecting HPV16 or HPV18 viruses. Another object of the present invention is a method for detecting HPV16 and HPV18 infections. A fourth object of the present invention is a kit for detecting HPV16 or HPV18 infections.

Description

[Technical Field]

[0001] The present invention relates to a primer set for detecting viruses of genotypes 16 and 18 (human papillomavirus types 16 and 18) belonging to the Human Papillomaviridae family, a method for detecting viruses from the Human Papillomaviridae family using the primer set, and the use of the primer set for detecting viruses belonging to the Human Papillomaviridae family. The present invention has its application in medical diagnostics.

[0002] Human papillomaviruses are spherical viruses whose genetic material is a double-stranded DNA. The human papillomavirus family consists of over 200 distinct genotypes classified by differences in their DNA sequences, of which approximately 40 are sexually transmitted. Within this group, 14 oncogenic genotypes have been identified that pose a high risk for tumor formation, including cervical, anal, and head and neck cancers, with genotypes 16 and 18 being the most commonly diagnosed. According to the WHO, HPV16 is responsible for 55% of cervical cancer cases, HPV18 for a further 15%, and the remaining cases are caused by infection with other oncogenic genotypes of human papillomavirus (HPV): genotypes 31, 33, 35, 39, 45, 51, 52, 56, 58, 68, 73, and 82.

[0003] The use of primers in the LAMP method for diagnosing HPV16 and / or HPV18 viruses is known from the following published patent applications: CN102952894A; CN103114033A; CN104805218; CN106939359A; CN10755492A; CN106148571A; EP2192199A1; US2009035750A1; WO2014092647. The LAMP method is disclosed, for example, in WO0028082 and WO0224902. However, the above patent applications do not describe the sensitivity and detection limit of HPV16 and HPV18 viruses. The detection methods in the above mentioned patent applications do not allow their quantitative measurement, the detection being of the end-point type using agarose gel or other markers (hydroxy-naphthol-blue, calcein) based on a color change in the reaction mixture in case of a positive result of the amplification reaction.

[0004] Therefore, there remains a need for a primer set that can be used in a diagnostic method for detecting and genotyping human papillomavirus using LAMP in primary care, and that allows detection of the virus in a short time (≦15 min) with a very low detection limit (≧5 GEq / μl).In addition, the above problems have been solved by the present invention.

[0005] A first object of the present invention is a primer set for amplifying a nucleotide sequence of the L2 gene of human papillomavirus type 16 or the L1 gene of human papillomavirus type 18, characterized in that the primer set comprises an internal primer set comprising the following nucleotide sequences a) and b) of HPV16 and nucleotide sequences c) and d) of HPV18, and an external primer set comprising the following nucleotide sequences e) and f) of HPV16 and nucleotide sequences g) and h) of HPV18: a) 5'CATGCAAACAGGCAGGTA3' (nucleic acid sequence SEQ ID NO: 3 or a sequence complementary thereto, or a sequence resulting from a single nucleotide exchange, substitution or deletion) - (any 18-30 bp nucleotide sequence complementary to the sequence of the L2 gene), either connected by a TTTT bridge to the sequence 5'ATTTGATCAGCAATAGTTTTGCCTT3' - (nucleic acid sequence SEQ ID NO: 5 or a sequence complementary thereto, or a sequence resulting from a single nucleotide exchange, substitution or deletion), b) 5'ATATACCCAGTGCGTCCG3'- (nucleic acid sequence SEQ ID NO: 4 or a sequence complementary thereto, or a sequence resulting from a single nucleotide exchange, substitution or deletion)- (any 18-30 bp nucleotide sequence complementary to a sequence of the L2 gene), either connected by a TTTT bridge or not to the sequence 5'GGAAGTATGGGTGTATTTTTTGGTG3'- (nucleic acid sequence SEQ ID NO: 6 or a sequence complementary thereto, or a sequence resulting from a single nucleotide exchange, substitution or deletion), c) 5'CCCTATTTTTTTGCAGATGGC3' (nucleic acid sequence SEQ ID NO: 9 or a sequence complementary thereto, or a sequence resulting from a single nucleotide exchange, single nucleotide substitution or deletion) - (any 18-30 bp nucleotide sequence complementary to a sequence of the L1 gene) whether connected by a TTTT bridge to the sequence 5'AGGAGGTGGAAGATATACGGTATT3' - (nucleic acid sequence SEQ ID NO: 11 or a sequence complementary thereto, or a sequence resulting from a single nucleotide exchange, single nucleotide substitution or deletion) d) 5'CCAACAGTTAATAATCTAGAGCT3'- (nucleic acid sequence SEQ ID NO: 10 or a sequence complementary thereto, or a sequence resulting from a single nucleotide exchange, single nucleotide substitution, or deletion)- (any 18-30 bp nucleotide sequence complementary to the sequence of the L1 gene) whether connected by a TTTT bridge to the sequence 5'GGCAAGAGTTGTAAATACCGATGA3'- (nucleic acid sequence SEQ ID NO: 12 or a sequence complementary thereto, or a sequence resulting from a single nucleotide exchange, single nucleotide substitution, or deletion). e) 5'AAAACGTGCATCGGCTAC3' nucleic acid sequence SEQ ID NO: 1 or its complement or a sequence resulting from a single nucleotide exchange, single nucleotide substitution or deletion, and f) 5'GAGGCCTTGTTCCCAATG3' nucleic acid sequence SEQ ID NO: 2 or a sequence complementary thereto or resulting from a single nucleotide exchange, single nucleotide substitution or deletion. g) 5'CCTAAGAAACGTAAACGTGTT3' nucleic acid sequence SEQ ID NO: 7 or its complement or a sequence resulting from a single nucleotide exchange, single nucleotide substitution or deletion, and h) 5'CAGGAACCCTAAAATATGGATT3' nucleic acid sequence SEQ ID NO: 8 or a sequence complementary thereto or resulting from a single nucleotide exchange, single nucleotide substitution or deletion.

[0006] In a preferred embodiment of the invention, the primer set comprises a set of loop primer sequences comprising nucleic acid sequences identical to or complementary to the HPV16 L2 gene SEQ ID NO: 13 5'CCTTAGGTATAATGTCAGGTGGACA3' and SEQ ID NO: 14 5'GGTTAGGAATTGGAACAGGGTC3' or a sequence complementary thereto, or a sequence resulting from a single nucleotide exchange, substitution or deletion of a single nucleotide.

[0007] In a further preferred embodiment of the invention, the primer set comprises the HPV18 L1 gene SEQ ID NO: 15 5'GTCACTAGGCCGCCACAA3' and SEQ ID NO: 16 5'CTCCCACAAGCATATTTTATCATGC3' or a sequence complementary thereto, or a sequence resulting from a single nucleotide exchange, substitution or deletion of a single nucleotide.

[0008] A second object of the present invention is a method for detecting human papillomavirus type 16 or type 18, characterized in that selected regions of the nucleic acid sequences of HPV16 and HPV18 are amplified using the primer set of the first object of the present invention, wherein the amplification method is the LAMP method.

[0009] In a preferred embodiment, the amplification is carried out according to a temperature profile: -HPV16: 65℃, 30 minutes -HPV18: 64℃, 40 minutes This is done using

[0010] In a further preferred embodiment of the present invention, the end point reaction is carried out at a temperature profile of 80° C. for 5 minutes.

[0011] A third object of the present invention is a method for detecting infection with HPV16 and HPV18, characterized in that it comprises a detection method as defined in the second object of the present invention.

[0012] A fourth object of the present invention is a kit for detecting infection with HPV16 or HPV18, characterized in that it comprises a primer set as defined in the first object of the present invention.

[0013] In a preferred embodiment of the present invention, the infection detection kit contains 12.5 μl of WarmStart LAMP Master Mix.

[0014] In a further preferred embodiment of the invention, for each amplification primer as defined in the first object of the invention, the primers have the following concentrations: HPV16: 0.12 μM F3, 0.12 μM B3, 0.96 μM FIP, 0.96 μM BIP, 0.24 μM LoopF, 0.24 μM LoopB; and HPV18: 0.15 μM F3, 0.15 μM B3, 1.20 μM FIP, 1.20 μM BIP, 0.30 μM LoopF, 0.30 μM LoopB; BSA-0.25 mg / ml; D-(+)-Trehalose dihydrate-6%; fluorescent marker that interacts with double-stranded DNA-EvaGreen≦1× or fluorescent dye≦0.5 μl or GreenFluorescent Dye ≤ 1 μl or Syto-13 ≤ 16 μM or SYTO-82 ≤ 16 μM or other fluorescent dyes that interact with double-stranded DNA at a concentration that does not inhibit the amplification reaction.

[0015] The advantage of the primer sets of the present invention for detecting HPV16 and HPV18, as well as the methods for detecting HPV16 and HPV18 infection and the methods for detecting the amplification products, is their potential use in medical diagnostics by targeted application in the form of portable genetic analyzers at the point of care (POC). Lyophilization of the reaction mixture of the present invention allows the diagnostic kit to be stored at room temperature without compromising the diagnostic parameters of the test. Meanwhile, detection of the amplification products using fluorescent dyes improves the sensitivity of the method, lowering the detection limit (up to 5 GEq / μl) and enabling quantitative measurement of the virus in the test sample.

[0016] Exemplary embodiments of the invention are illustrated in Figures 1 and 3 (for HPV16 and HPV18, respectively) showing the sensitivity characteristics of the method for obtaining specific signals with the matrices: -HPV16: Human papillomavirus (HPV) type 16 DNA (First WHO International Standard) - 06 / 202, NIBSC -HPV18: Human papillomavirus (HPV) type 18 DNA (First WHO International Standard) - 06 / 206, NIBSC Range of 10,000-5GEq (genome equivalents) HPV16 and HPV18, but no products in NTC; Figure 1: Column 1: Mass marker (Quick-Load® Purple 100bp DNA Ladder, New England Biolabs); Column 2: 5GEq HPV16; Column 3: 10GEq HPV16; Column 4: 20GEq HPV16; Column 5: 25GEq HPV16; Column 6: 50GEq HPV16; Column 7: 100GEq HPV16; Column 8: 1000GEq HPV16; Column 9: 10000GEq HPV16; Column 10: NTC.

[0017] Figure 3: Column 1: Mass marker (Quick-Load® Purple 100bp DNA Ladder, New England Biolabs); Column 2: 10000GEq HPV18; Column 3: 10000GEq HPV18; Column 4: 100GEq HPV18; Column 5: 50GEq HPV18; Column 6: 25GEq HPV18; Column 7: 20GEq HPV18; Column 8: 10GEq HPV18; Column 9: 5GEq HPV18; Column 10: NTC. Figures 2 and 4 show the sensitivity of the method of the invention, measured by setting up a series of dilutions of a DNA reference material. -HPV16: Human papillomavirus (HPV) type 16 DNA, 1st WHO International Standard -06 / 202, NIBSC -HPV18: Human papillomavirus (HPV) type 18 DNA (First WHO International Standard) - 06 / 206, NIBSC The minimum amount of HPV16 and HPV18 bacteria was 5GEq, and product gain was measured in real time. The real-time HPV16 and HPV18 detection results are shown in Tables 1 and 2.

[0018] Figures 5 and 6 demonstrate the specificity of the method of the present invention with a standard matrix of pathogens potentially present in the biological material tested as natural physiological flora, resulting from co-infection or having similar genomic sequences. Figure 5: Column 1: Mass marker (Quick-Load® Purple 100 bp DNA Ladder, New England Biolabs); Column 2: HPV16; Column 3: HPV18; Column 4: Streptococcus agalactia; Column 5: Streptococcus pyogenes; Column 6: Streptococcus mutans; Column 7: Staphylococcus epidermidis; Column 8: Staphylococcus aureus; Column 9: Campylobacter jejuni; Column 10: Trepanoma pallidium; Column 11: HSV1; Column 12: HSV2; Column 13: Candida albicans albicans); Column 14: Borrelia afzeli; Column 15: Borrelia burgdorferi sensu stricto; Column 16: Homo sapiens; Column 17: NTC.Figure 6: Column 1: Mass marker (Quick-Load® Purple 100 bp DNA Ladder, New England Biolabs); Column 2: HPV16; Column 3: HPV18; Column 4: Streptococcus agalactia; Column 5: Streptococcus pyogenes; Column 6: Streptococcus mutans; Column 7: Staphylococcus epidermidis; Column 8: Staphylococcus aureus; Column 9: Campylobacter jejuni; Column 10: Trepanoma pallidium; Column 11: HSV1; Column 12: HSV2; Column 13: Candida albicans albicans); Column 14: Borrelia afzeli; Column 15: Borrelia burgdorferi sensu stricto; Column 16: Homo sapiens; Column 17: NTC. [Example]

[0019] Example 1 Primer Sequences The sequences of the specific oligonucleotides used for the detection of HPV16 genetic material using LAMP technology are shown and characterized below.

[0020] 1. HPV16 L2F3 oligonucleotide sequence: 5'AAAACGTGCATCGGCTAC3' is a sequence identical to the HPV16 L2 gene (5'-3' strand) 3' adjacent to the HPV16 L2F2 primer.

[0021] 2. HPV16 L2B3 oligonucleotide sequence: 5'GAGGCCTTGTTCCCAATG3' is the complementary fragment of the L2 gene of HPV16 (5'-3' strand) 174 nucleotides from the 3' end of oligonucleotide 1.

[0022] 3. HPV16 L2F2 oligonucleotide sequence: 5'CATGCAAACAGGCAGGTA3' is a sequence identical to the L2 gene of HPV16 (5'-3' strand) 15 nucleotides from the 3' end of oligonucleotide 1.

[0023] 4. HPV16 L2B2 oligonucleotide sequence: 5'ATATACCCAGTGCGTCCG3' is a complementary fragment of the L2 gene of HPV16 (5'-3' strand) 154 nucleotides from the 3' end of oligonucleotide 1.

[0024] 5. HPV16 L2F1c oligonucleotide sequence: 5'ATTTGATCAGCAATAGTTTTGCCTT3' is a complementary fragment of the L2 gene of HPV16 (5'-3' strand) 63 nucleotides from the 3' end of oligonucleotide 1.

[0025] 6. HPV16 L2B1c oligonucleotide sequence: 5'GGAAGTATGGGTGTATTTTTTGGTG3' is a sequence identical to the HPV16 L2 gene (5'-3' strand) 98 nucleotides from the 3' end of oligonucleotide 1.

[0026] 7. HPV16 L2LoopF ​​sequence: 5'CCTTAGGTATAATGTCAGGTGGACA3'

[0027] 8. HPV16 L2LoopB oligonucleotide sequence: 5'GGTTAGGAATTGGAACAGGGTC3'

[0028] The oligonucleotide sequences F1c and F2 were preferably linked by a TTTT bridge and used as an FIP. The oligonucleotide sequences B1c and B2 were preferably linked by a TTTT bridge and used as a BIP.

[0029] Example 2 Primer sequences The sequences of the specific oligonucleotides used for the detection of HPV18 genetic material using LAMP technology are shown and characterized below.

[0030] 1. HPV18 L1F3 oligonucleotide sequence: 5'CCTAAGAAACGTAAACGTGTT3' is identical to the HPV18 L1 gene (5'-3' strand) 3' adjacent to the HPV18 L1F2 primer.

[0031] 2. HPV18 L1B3 oligonucleotide sequence: 5'CAGGAACCCTAAAATATGGATT3' is a complementary fragment of the L1 gene of HPV18 (5'-3' strand) 155 nucleotides from the 3' end of oligonucleotide 1, 5' adjacent to primer B2.

[0032] 3. HPV18 L1F2 oligonucleotide sequence: 5'CCCTATTTTTTTGCAGATGGC3' is identical to the L1 gene of HPV18 (5'-3' strand) located directly at the 3' end of oligonucleotide 1.

[0033] 4. HPV18 L1B2 oligonucleotide sequence: 5'CCAACAGTTAATAATCTAGAGCT3' is the complementary fragment of the L1 gene of HPV18 (5'-3' strand) 131 nucleotides from the 3' end of oligonucleotide 1.

[0034] 5. HPV18 L1F1c oligonucleotide sequence: 5'AGGAGGTGGAAGATATACGGTATT3' is the complementary fragment of the L1 gene of HPV18 (5'-3' strand) 41 nucleotides from the 3' end of oligonucleotide 1.

[0035] 6. HPV18 L1B1c oligonucleotide sequence: 5'GGCAAGAGTTGTAAATACCGATGA3' is identical to the L1 gene of HPV18 (5'-3' strand) 70 nucleotides from the 3' end of oligonucleotide 1.

[0036] 7. HPV18 L1LoopF ​​sequence: 5'GTCACTAGGCCGCCACAA3'

[0037] 8. HPV18 L1 LoopB oligonucleotide sequence: 5'CTCCCACAAGCATATTTTATCATGC3'

[0038] The oligonucleotide sequences F1c and F2 were preferably linked by a TTTT bridge and used as an FIP. The oligonucleotide sequences B1c and B2 were preferably linked by a TTTT bridge and used as a BIP.

[0039] Example 3 A method for amplifying the L2 gene of HPV18 and the L1 gene of HPV18 using the oligonucleotides characterized in Example 1 and Example 2 by LAMP technology with the following reaction mixture composition:

[0040] HPV16 12.5μl WarmStart LAMP 2X Master Mix 0.12 μM F3 0.12 μM B3 0.96 μM FIP 0.96 μM BIP 0.24 μM LoopF 0.24 μM Loop B BSA-0.25mg / ml D-(+)-Trehalose dihydrate-6%

[0041] Fluorescent marker that interacts with double-stranded DNA - EvaGreen ≦1X or Fluorescent Dye 50X (New England Biolabs) 0.5 μl or Green Fluorescent Dye (Lucigen) ≦1 μl or Syto-13 ≦16 μM or SYTO-82 ≦16 μM or other fluorescent dye that interacts with double-stranded DNA at a concentration that does not inhibit the amplification reaction.

[0042] DNA template ≥ 5 copies / reaction Total reaction volume up to 25 μl with DNase- and RNase-free water.

[0043] HPV18 12.5μl WarmStart LAMP 2X Master Mix 0.15 μM F3 0.15 μM B3 1.20 μM FIP 1.20 μM BIP 0.30 μM LoopF 0.30 μM LoopB BSA-0.25mg / ml D-(+)-Trehalose dihydrate-6%

[0044] Fluorescent marker that interacts with double-stranded DNA - EvaGreen ≦1X or Fluorescent Dye 50X (New England Biolabs) 0.5 μl or Green Fluorescent Dye (Lucigen) ≦1 μl or Syto-13 ≦16 μM or SYTO-82 ≦16 μM or other fluorescent dye that interacts with double-stranded DNA at a concentration that does not inhibit the amplification reaction.

[0045] DNA template ≥ 5 copies / reaction Total reaction volume up to 25 μl with DNase- and RNase-free water.

[0046] Example 4 A method for amplifying the L1 gene of HPV16 or the L2 gene of HPV18 using the oligonucleotides characterized in Examples 1 and 2 by the LAMP technique with the composition of the reaction mixture characterized in Example 3 and the following temperature profile: 1)HPV16: 65℃, 30 minutes 2) HPV18: 64℃, 40 minutes. 3) For end-point reaction, preferably 80°C for 5 minutes.

[0047] Example 5 A method for amplifying the L1 gene of HPV16 or the L2 gene of HPV18 by the LAMP technique using the oligonucleotides characterized in Examples 1 and 2 with the temperature profile characterized in Example 4 in the reaction mixture composition characterized in Example 3, and a detection method as described below.

[0048] Fluorescent dyes capable of interacting with double-stranded DNA were used. EvaGreen 20X (0.5 μL) or ≦1X (≦16 μM) Green Fluorescent Dye (Lucigen); SYTO-13 and SYTO-82 were added to the reaction mixture in a volume of 1.25 μl each before the start of the reaction, real-time measurements, and / or endpoint measurements. The excitation wavelengths were the same as those for the FAM dye, EvaGreen dye; Fluorescent dye 50X (New England Biolabs), and Green Fluorescent Dye (Lucigen); SYTO-13, 490–500 nm (optimal 494 nm), and 535 nm (optimal 541 nm) for the SYTO-82 dye. The emission wavelengths were the same as for the FAM dye, EvaGreen dye; Green Fluorescent Dye (Lucigen); SYTO-13, 509–530 nm (optimal 518 nm), and 556 nm (optimal 560 nm) for the SYTO-82 dye. The detection method and registration time were changed from 8 min after the start of the reaction with HPV16 and HPV18 and the negative control.

[0049] Example 6 Methods for preparation and lyophilization of reagents for amplifying and detecting HPV16 and L1 HPV18 L2 genes by LAMP technology using oligonucleotides characterized in Examples 1 and 2 with the composition of the reaction mixture characterized in Example 3 and the temperature profile characterized in Example 4, and the detection method described in Example 5.

[0050] Example 7 Description of the Freeze-Drying Process The reaction components, except for the DNA template, were mixed to a total volume of 25 μl according to the composition described in Example 3. The mixture was transferred to a 0.2 ml tube and subjected to a freeze-drying process according to the following parameters:

[0051] The mixture in the test tube was pre-cooled at -20°C for 8 hours. Then, the freeze-drying process was carried out at a temperature of -50°C for 3.5 hours and 5 minutes. -2 The test was carried out under a pressure of 1000 mBar.

[0052] Example 7: Sensitivity of the Method Sensitivity was determined by setting up a series of dilutions of HPV16 and HPV18 standards with a minimum viral load of 5 GEq (HPV16: Human papillomavirus (HPV) type 16 DNA, WHO First International Standard, 06 / 202, NIBSC; HPV18: Human papillomavirus (HPV) type 18 DNA (WHO First International Standard, 06 / 206, NIBSC), where the product increment was measured in real time - Figure 2 and Figure 4 (RealTime-LAMP for diluted series of HPV16 (Figure 2) and HPV18 (Figure 4)).

[0053] The time required to detect the emitted fluorescence of the individual samples is shown in Table 1 (HPV16) and Table 2 (HPV18).

[0054] The characterized primers allowed the detection of both human papillomavirus genotypes (HPV16 and HPV18) at a minimum dose of 5 GEq / μl.

[0055] [Table 1]

[0056] [Table 2]

[0057] The advantages of the amplification methods and oligonucleotides described herein over tests based on RealTime-LAMP technology are due to the much higher sensitivity shown in Figures 1 and 3 and the reduced analysis time shown in Figures 2 and 4 and Tables 1 and 2.

[0058] [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] [Table 3-6] [Table 3-7] [Table 3-8]

Claims

1. 1. A primer set for amplifying a nucleotide sequence of the L2 gene of human papillomavirus type 16 or the L1 gene of human papillomavirus type 18, comprising an inner primer set comprising the following nucleotide sequences a) and b) for HPV16 and the following nucleotide sequences c) and d) for HPV18, and an outer primer set comprising the following nucleotide sequences e) and f) for HPV16 and the following nucleotide sequences g) and h) for HPV18, and further comprising loop primer sequences i) and j) for HPV16 and loop primer sequences k) and l) for HPV18: a) 5'ATTTGATCAGCAATAGTTTTGCCTT 3'-(nucleic acid sequence SEQ ID NO:5)-TTTT bridge-5'CATGCAAACAGGCAGGTA 3'-(nucleic acid sequence SEQ ID NO:3); b) 5'GGAAGTATGGGTGTATTTTTTTGGTG3'-(nucleic acid sequence SEQ ID NO:6)-TTTT bridge-5'ATATACCCAGTGCGTCCG3'-(nucleic acid sequence SEQ ID NO:4); c) 5'AGGAGGTGGAAGATATACGGTATT3'-(nucleic acid sequence SEQ ID NO:11)-TTTT bridge-5'CCCTATTTTTTTGCAGATGGC3'-(nucleic acid sequence SEQ ID NO:9); d) 5'GGCAAGAGTTGTAAATACCGATGA 3'-(nucleic acid sequence SEQ ID NO:12)-TTTT bridge-5'CCAACAGTTAATAATCTAGAGCT 3'-(nucleic acid sequence SEQ ID NO:10); e) the nucleic acid sequence 5'AAAACGTGCATCGGCTAC3' of SEQ ID NO: 1 or a sequence resulting from a single nucleotide substitution or deletion thereof, and f) the nucleic acid sequence 5'GAGGCCTTGTTCCCAATG3' of SEQ ID NO: 2 or a sequence resulting from a single nucleotide substitution or deletion thereof; g) the nucleic acid sequence 5'CCTAAGAAACGTAAACGTGTT3' of SEQ ID NO: 7 or a sequence resulting from a single nucleotide substitution or deletion thereof, and h) the 5'CAGGAACCCTAAAATATGGATT3' nucleic acid sequence of SEQ ID NO: 8 or a sequence resulting from a single nucleotide substitution or deletion thereof; i) the nucleic acid sequence 5'CCTTAGGTATAATGTCAGGTGGACA 3' of SEQ ID NO: 13, or a sequence resulting from a single nucleotide substitution or deletion thereof; j) the nucleic acid sequence 5'GGTTAGGAATTGGAACAGGGTC3' of SEQ ID NO: 14 or a sequence resulting from a single nucleotide substitution or deletion thereof; k) the nucleic acid sequence 5'GTCACTAGGCCGCCACAA3' of SEQ ID NO: 15 or a sequence resulting from a single nucleotide substitution or deletion thereof; l) The nucleic acid sequence of SEQ ID NO: 16, 5'CTCCCACAAGCATATTTTATCATGC3', or a sequence resulting from a single nucleotide substitution or deletion thereof.

2. A method for detecting human papillomavirus type 16 or type 18 in vitro or ex vivo, wherein a selected region of the nucleic acid sequence of said HPV16 or HPV18 is amplified using a primer set a), b), e), f), i), j) for HPV16 or a primer set c), d), g), h), k), l) for HPV18 as described in claim 1, and said amplification method is the LAMP method.

3. The amplification comprises a temperature profile: -HPV16 65℃, 30 minutes -HPV18 64℃, 40 minutes The method of claim 2, wherein the method is carried out by

4. 3. The method of claim 2, wherein the end point reaction is carried out at a temperature profile of 80°C for 5 minutes.

5. A method for detecting infection with HPV16 and HPV18, comprising amplifying HPV16 or HPV18 using the primer set of claim 1.

6. A kit for detecting infection with HPV16 or HPV18, comprising the primer set a), b), e), f), i), j) for HPV16 or the primer set c), d), g), h), k), l) for HPV18 according to claim 1.

7. 10. The kit for detecting infection according to claim 6, comprising the amplification primers of claim 1, wherein the primers are at the following concentrations: HPV16: 0.12 μM of the primer consisting of SEQ ID NO:1, 0.12 μM of the primer consisting of SEQ ID NO:2, 0.96 μM of the inner primer set, 0.96 μM of the outer primer set, 0.24 μM of the primer consisting of SEQ ID NO:13, 0.24 μM of the primer consisting of SEQ ID NO:14; and HPV18: 0.15 μM of the primer consisting of SEQ ID NO:7, 0.15 μM of the primer consisting of SEQ ID NO:8, 1.20 μM of the inner primer set, 1.20 μM of the outer primer set, 0.30 μM of the primer consisting of SEQ ID NO:15, 0.30 μM of the primer consisting of SEQ ID NO:16; BSA-0.25 mg / ml; D-(+)-trehalose dihydrate-6%; a fluorescent marker that interacts with double-stranded DNA or a fluorescent dye that interacts with double-stranded DNA at a concentration that does not inhibit the amplification reaction.

Images