Stevia plants with low flower bud formation ability

By genetically modifying stevia plants at specific positions, the flower bud formation is reduced, enhancing leaf productivity and steviol glycoside content, addressing the lack of understanding in stevia genetics.

JP7739174B2Active Publication Date: 2025-09-16SUNTORY HLDG LTD
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
JP2021513650
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-04-11
Filing Date
2020-04-07
Publication Date
2025-09-16
Estimated Expiration
2040-04-07

AI Technical Summary

Technical Problem

The genetic information of stevia plants is not well understood, limiting the development of stevia varieties with desirable traits such as reduced flower bud formation.

Method used

Development of stevia plants with specific genetic modifications, including alleles at positions corresponding to SEQ ID NOs: 150, 1, 2, 3, 4, 5, and 6, to reduce flower bud formation, and methods for producing and screening these plants using techniques like CAPS and TaqMan PCR.

Benefits of technology

The resulting stevia plants exhibit lower flower bud formation, redirecting resources to leaf growth, thereby increasing leaf productivity and steviol glycoside content.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007739174000016
    Figure 0007739174000016
  • Figure 0007739174000017
    Figure 0007739174000017
  • Figure 0007739174000018
    Figure 0007739174000018
Patent Text Reader

Abstract

The present invention provides a stevia plant body that has less ability to form flower buds compared to a wild type stevia species. Further, the present invention provides: a method for producing the stevia plant body having less ability to form flower buds; and an extract and a purified steviol glycoside product obtained from the aforesaid plant body.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a stevia plant having low flower bud formation ability, a method for producing the same, and a screening method therefor. [Background technology]

[0002] Stevia is a perennial plant of the Asteraceae family native to Paraguay in South America. Stevia contains various sweet components that are tens to hundreds of times sweeter than sugar, and these sweet components are extracted and used as natural sweeteners (Patent Document 1). However, much remains unknown about the genetic information of stevia and the genes involved in regulating biological events. [Prior art documents] [Patent documents]

[0003] [Patent Document 1] WO2018 / 124142 DISCLOSURE OF THE INVENTION [Problem to be solved by the invention]

[0004] Further elucidation of the genetic information of stevia is required. [Means for solving the problem]

[0005] The present invention provides a stevia plant having a low ability to form flower buds, as well as methods for producing and screening for said plant.

[0006] In one aspect, the present invention provides: [1] Stevia plants with lower flower bud formation ability than wild-type plants. [2] The plant body described in [1] is heterozygous or homozygous for an allele in which the base at the position corresponding to position 90 of SEQ ID NO: 150 is G, and / or is heterozygous or homozygous for an allele in which the base at the position corresponding to position 108 of SEQ ID NO: 150 is G. [3] The plant according to [1] or [2], further having at least one of the following genetic characteristics (1) to (7): (1) The individual is homozygous for an allele in which the base at the position corresponding to position 40 of SEQ ID NO:2 is T. (2) It is homozygous for an allele in which the base at the position corresponding to position 44 of SEQ ID NO:3 is T. (3) The allele is homozygous for a C at the position corresponding to position 48 of SEQ ID NO:4. (4) The allele is homozygous for a deletion corresponding to positions 55 to 72 of SEQ ID NO: 5. (5) The allele is homozygous for an A at the position corresponding to position 201 of SEQ ID NO:1. (6) Heterozygous for an allele in which the base at the position corresponding to position 49 of SEQ ID NO:6 is A. (7) The allele is homozygous for an A at the position corresponding to position 49 of SEQ ID NO:6.

[0007] [4] A plant according to [3], which has at least one of the following characteristics (1) to (2): (1) Contains 3% or more RebD per unit mass of dried leaves. (2) Contains 0.2% or more RebM per unit mass of dry leaves. [5] The plant according to any one of [1] to [4], which is a non-genetically modified plant. [6] The plant according to any one of [1] to [5], which comprises a stevia plant that has been subjected to a mutagenesis treatment and its progeny plants. [7] A seed, tissue, tissue culture or cell of the plant according to any one of [1] to [6]. [8] The tissue, tissue culture or cell according to [7], which is selected from an embryo, a meristematic cell, a pollen, a leaf, a root, a root tip, a petal, a protoplast, a leaf slice and a callus. [9] A method for producing a stevia plant with reduced flower bud formation ability, comprising the step of crossbreeding the plant according to any one of [1] to [6] with a second stevia plant.

[10] The method according to [9], wherein the second plant is the plant according to any one of [1] to [6].

[0008]

[11] An extract of the plant body according to any one of [1] to [6], or the seed, tissue, tissue culture or cell according to [7] or [8].

[12] A method for producing a stevia extract, comprising a step of obtaining an extract from the plant body according to any one of [1] to [6], or the seed, tissue, tissue culture, or cell according to [7] or [8].

[13] A method for producing a purified steviol glycoside product, comprising the steps of obtaining an extract from the plant body described in any one of [1] to [6], or the seed, tissue, tissue culture, or cell described in [7] or [8], and purifying steviol glycoside from the obtained extract.

[14]

[13] The method of claim 13, wherein the steviol glycoside comprises rebaudioside A, rebaudioside B, rebaudioside C, rebaudioside D, rebaudioside E, rebaudioside F, rebaudioside M, rebaudioside N, rebaudioside O, stevioside, steviolbioside, rubusoside, dulcoside A, or a combination thereof.

[15]

[11] Providing the extract or a purified product thereof; Adding the extract or purified product to a food or drink, a sweetening composition, a flavoring agent, or a raw material for a pharmaceutical product. A method for producing a food or drink, a sweetening composition, a flavoring agent, or a pharmaceutical, comprising the steps of:

[0009]

[16] A method for screening stevia plants with low flower bud formation ability, comprising a step of detecting the presence and / or absence of genetic traits of being heterozygous or homozygous for an allele in which the base at the position corresponding to position 90 of SEQ ID NO: 150 is G and / or the base at the position corresponding to position 108 of SEQ ID NO: 150 is G from the genome of a test stevia plant.

[17] The method according to

[16] , further comprising the step of detecting the presence and / or absence of the following genetic features (1) to (7) from the genome of a test stevia plant: (1) The individual is homozygous for an allele in which the base at the position corresponding to position 40 of SEQ ID NO:2 is T. (2) It is homozygous for an allele in which the base at the position corresponding to position 44 of SEQ ID NO:3 is T. (3) The allele is homozygous for a C at the position corresponding to position 48 of SEQ ID NO:4. (4) The allele is homozygous for a deletion corresponding to positions 55 to 72 of SEQ ID NO: 5. (5) The allele is homozygous for an A at the position corresponding to position 201 of SEQ ID NO:1. (6) The genome of the test stevia plant is heterozygous for an allele in which the base at the position corresponding to position 49 of SEQ ID NO: 6 is A. (7) The test stevia plant is homozygous for an allele in which the base at the position corresponding to position 49 of SEQ ID NO: 6 is A in the genome of the test stevia plant.

[18] The method according to

[16] or

[17] , wherein the step of detecting a genetic characteristic is carried out using the CAPS method, the dCAPS method, or the TaqMan PCR method.

[19] The method according to any one of

[16] to

[18] , further comprising a step of evaluating the flower bud formation ability of the test stevia plant tissue.

[0010]

[20] A screening kit for stevia plants with low flower bud formation ability, comprising a reagent for detecting the presence and / or absence of the genetic trait of being heterozygous or homozygous for an allele in which the base at the position corresponding to position 90 of SEQ ID NO: 150 is G, and / or being heterozygous or homozygous for an allele in which the base at the position corresponding to position 108 of SEQ ID NO: 150 is G. [twenty one] The kit according to

[20] , further comprising a reagent for detecting the presence and / or absence of the following genetic characteristics (1) to (7): (1) The individual is homozygous for an allele in which the base at the position corresponding to position 40 of SEQ ID NO:2 is T. (2) It is homozygous for an allele in which the base at the position corresponding to position 44 of SEQ ID NO:3 is T. (3) The allele is homozygous for a C at the position corresponding to position 48 of SEQ ID NO:4. (4) The allele is homozygous for a deletion corresponding to positions 55 to 72 of SEQ ID NO: 5. (5) The allele is homozygous for an A at the position corresponding to position 201 of SEQ ID NO:1. (6) Heterozygous for an allele in which the base at the position corresponding to position 49 of SEQ ID NO:6 is A. (7) The allele is homozygous for an A at the position corresponding to position 49 of SEQ ID NO:6. [twenty two] The kit according to

[20] or

[21] , wherein the reagents include primers and / or probes used in the CAPS method, the dCAPS method, or the TaqMan PCR method. [twenty three] A method for producing a stevia plant with low flower bud formation ability, comprising the step of introducing a mutation from A to G at a position corresponding to position 90 of SEQ ID NO: 150, and / or the step of introducing a mutation from T to G at a position corresponding to position 108 of SEQ ID NO: 150. [twenty four] The method according to

[23] , wherein the introduction of mutations is carried out by mutagenesis treatment. [Effects of the Invention]

[0011] The present invention makes it possible to obtain a stevia plant with low flower bud formation ability, to provide a means for producing such a plant, leaves obtained from such a plant, and foods and beverages containing extracts obtained from the leaves. When the flower bud formation ability is low, nutrients that would normally be used for flower bud formation are used for leaf growth, which is expected to improve leaf productivity and, ultimately, increase the content of steviol glycosides accumulated in the leaves. [Brief explanation of the drawings]

[0012] [Figure 1] Figure 1 shows the frequency distribution of sweet substance content in M1 generation individuals. The vertical axis shows the number of individuals, and the horizontal axis shows the concentration (%) of sweet substances in the dried leaves. [Figure 2] Figure 2 shows the distribution of sweet substance content in mutant C49A-positive individuals (C49A+) and negative individuals (C49A-) from segregation population A. The vertical axis represents the concentration (%) of sweet substances in dried leaves, and the dotted line represents the average value of the sweet substance concentration for all individuals belonging to segregation population A. [Figure 3] Figure 3 shows the distribution of sweet substance content in mutant C49A-positive individuals (C49A+) and mutant C49A-negative individuals (C49A-) of segregating population B. The vertical axis represents the sweet substance concentration (%) in the dried leaves, and the dotted line represents the average sweet substance concentration of all individuals belonging to segregating population B. DETAILED DESCRIPTION OF THE INVENTION

[0013] The present invention will be described in detail below. The following embodiments are merely examples for explaining the present invention, and are not intended to limit the present invention to such embodiments. The present invention can be embodied in various forms without departing from the gist of the present invention. All documents cited in this specification, as well as published patent applications, patent publications, and other patent documents, are incorporated herein by reference. This specification also incorporates the contents of the specification and drawings of Japanese Patent Application No. 2019-075610, filed on April 11, 2019, from which the present application claims priority.

[0014] 1. Stevia plants with low flower bud formation ability The present invention provides a stevia plant having reduced flower bud formation ability compared to the wild type (hereinafter, sometimes collectively referred to as "the plant of the present invention" or "the stevia plant of the present invention"). Stevia is a plant with the scientific name Stevia Rebaudiana Bertoni.

[0015] "Lower flower bud formation ability compared to the wild-type" means, for example, that when cultivated under the same cultivation conditions under short-day conditions, the number of flower buds produced in a given period is less than that of a wild-type Stevia plant. More specifically, for example, when cultivated under the same cultivation conditions under short-day conditions, the number of flower buds produced in a given period is 20% or more, 25% or more, 30% or more, 35% or more, 40% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% less than that of a wild-type Stevia plant. "100% less" means that when one or more flower buds are formed in a wild-type Stevia plant, no flower buds are formed (i.e., the number of flower buds is zero). Short-day conditions are dark periods of more than 10 hours, preferably 11 hours or more. The predetermined period refers to the period during which a wild-type stevia plant forms flower buds under short-day conditions, and may be, for example, 2 weeks, 3 weeks, 4 weeks, etc. Alternatively, as an indicator of "lower flower bud formation ability compared to the wild type," the number of flower buds after 3 weeks of cultivation under a 12-hour light period, which is 5 or less, for example, 5, 4, 3, 2, 1, or 0, or the number of flower buds after 3 weeks of cultivation under an 8-hour light period, which is 10 or less, for example, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or 0, may be used.

[0016] In one aspect, the Stevia plant of the present invention has at least one genetic feature (hereinafter, sometimes referred to as "genetic feature X of the present invention") of being homozygous or heterozygous for an allele in which the base at the position corresponding to position 90 of SEQ ID NO: 150 is G (hereinafter, sometimes referred to as "genetic feature X-1 of the present invention") and being homozygous or heterozygous for an allele in which the base at the position corresponding to position 108 of SEQ ID NO: 150 is G (hereinafter, sometimes referred to as "genetic feature X-2 of the present invention").

[0017] In one aspect, the stevia plant of the present invention has the genetic characteristic of being homozygous for an allele in which the base at the position corresponding to position 201 of SEQ ID NO: 1 is A (hereinafter, sometimes referred to as "genetic characteristic A of the present invention"). In another embodiment, the Stevia plant of the present invention has at least one of the following genetic characteristics (B-1) to (B-4) (hereinafter, sometimes referred to as "genetic characteristic B of the present invention"). (B-1) The allele in which the base at the position corresponding to position 40 of SEQ ID NO: 2 is T is homozygous (hereinafter, sometimes referred to as "genetic characteristic B-1 of the present invention"). (B-2) Homozygous for an allele in which the base at the position corresponding to position 44 of SEQ ID NO: 3 is T (hereinafter, sometimes referred to as "genetic characteristic B-2 of the present invention"). (B-3) Homozygous for an allele in which the base at the position corresponding to position 48 of SEQ ID NO: 4 is C (hereinafter, sometimes referred to as "genetic feature B-3 of the present invention"). (B-4) Homozygous for an allele lacking the portion corresponding to positions 55 to 72 of SEQ ID NO: 5 (hereinafter, sometimes referred to as "genetic feature B-4 of the present invention"). In another aspect, the Stevia plant of the present invention has the genetic characteristic of being heterozygous for an allele in which the base at the position corresponding to position 49 of SEQ ID NO: 6 is A (hereinafter, sometimes referred to as "genetic characteristic C of the present invention"). In another aspect, the Stevia plant of the present invention has the genetic characteristic of being homozygous for an allele in which the base at the position corresponding to position 49 of SEQ ID NO: 6 is A (hereinafter, sometimes referred to as "genetic characteristic D of the present invention").

[0018] In a preferred embodiment, a Stevia plant of the present invention has genetic feature X of the present invention (i.e., at least one of genetic features X-1 and X-2 of the present invention) and genetic feature A. In another preferred embodiment, a Stevia plant of the present invention has genetic feature X of the present invention and genetic feature B (i.e., at least one of genetic features B-1 to B-4 of the present invention). In another preferred embodiment, a Stevia plant of the present invention has genetic feature X of the present invention and genetic feature C or D. In another preferred embodiment, a Stevia plant of the present invention has genetic feature X, genetic feature A, and genetic feature B of the present invention. In another preferred embodiment, a Stevia plant of the present invention has genetic feature X, genetic feature A, and genetic feature C or D of the present invention. In another preferred embodiment, a Stevia plant of the present invention has genetic feature X, genetic feature B, and genetic feature C or D of the present invention. In a more preferred embodiment, a Stevia plant of the present invention has all of the genetic features X, A, B, and C or D of the present invention.

[0019] When a sequence identical to a reference sequence (e.g., SEQ ID NOs: 1 to 6, 150, etc.) exists in the genome, the "position (or portion) corresponding to ..." refers to a position or portion (e.g., 201st position, 40th position, 44th position, 45th position, 46th position, 47th position, 48th position, 49th position, 50th position, 51st position, 52nd position, 53rd position, 54th position, 55th position, 56th position, 57th position, 58th position, 59th position, 60th position, 61st position, 62nd position, 63rd position, 64th position, 65th position, 66th position, 67th position, 68th position, 69th position, 70th position, 71st position, 72nd position, 73rd position, 8The term "reference sequence" refers to a sequence in the genome that is identical to the reference sequence (e.g., positions 55 to 72, 49, 90 / 108, etc.), and if no sequence identical to the reference sequence exists in the genome, it refers to a position or portion of the sequence in the genome that corresponds to the position or portion of the reference sequence. Whether a sequence identical to or corresponding to the reference sequence exists in the genome can be determined, for example, by amplifying the genomic DNA of a target stevia plant with primers that can amplify the reference sequence by PCR, sequencing the amplified product, and performing alignment analysis of the obtained sequence with the reference sequence. Non-limiting examples of sequences corresponding to a reference sequence include nucleotide sequences that have 60% or more, 70% or more, 75% or more, 80% or more, 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 98.1% or more, 98.4% or more, 98.7% or more, 99% or more, 99.2% or more, 99.5% or more, or 99.8% or more sequence identity to the reference sequence. A position or portion in a sequence corresponding to a reference sequence in a genome that corresponds to a position or portion in the reference sequence can be determined by taking into account the nucleotide sequence before and after the position or portion in the reference sequence. For example, by performing alignment analysis between a reference sequence and a sequence corresponding to the reference sequence in a genome, a position or portion in the sequence corresponding to the reference sequence in a genome that corresponds to the position or portion in the reference sequence can be determined.

[0020] For example, taking the "position corresponding to position 201 of SEQ ID NO: 1" of genetic feature A of the present invention as an example, if the genome of a stevia plant has a portion consisting of the same nucleotide sequence as SEQ ID NO: 1, the "position corresponding to position 201 of SEQ ID NO: 1" is the 201st position from the 5' side of the portion in the genome consisting of the same nucleotide sequence as SEQ ID NO: 1. On the other hand, if the genome of a stevia plant has a portion consisting of a nucleotide sequence that is not identical to SEQ ID NO: 1 but is equivalent to SEQ ID NO: 1, the genome does not have a portion consisting of the same nucleotide sequence as SEQ ID NO: 1. Therefore, the "position corresponding to position 201 of SEQ ID NO: 1" does not necessarily correspond to the 201st position from the 5' side of the portion corresponding to SEQ ID NO: 1. However, by taking into account the nucleotide sequences before and after position 201 of SEQ ID NO: 1, etc., the "position corresponding to position 201 of SEQ ID NO: 1" in the genome of such a stevia plant can be identified. For example, the "position corresponding to position 201 of SEQ ID NO: 1" in the genome of a stevia plant can be identified by alignment analysis of the nucleotide sequence of the portion in the genome of a stevia plant that corresponds to SEQ ID NO: 1 with the nucleotide sequence of SEQ ID NO: 1.

[0021] A "portion consisting of a nucleotide sequence corresponding to SEQ ID NO: 1" means, for example, a portion consisting of a nucleotide sequence that has 60% or more, 70% or more, 75% or more, 80% or more, 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 98.1% or more, 98.4% or more, 98.7% or more, 99% or more, 99.2% or more, 99.5% or more, or 99.8% or more sequence identity to the nucleotide sequence of SEQ ID NO: 1.

[0022] In some embodiments, the "portion consisting of a nucleotide sequence corresponding to SEQ ID NO: 1" includes a portion of the genome of a stevia plant that can be amplified by PCR using a forward primer that hybridizes to a complementary sequence of a portion 15 to 25 bases long from the 5' end of SEQ ID NO: 1 and a reverse primer that hybridizes to a portion 15 to 25 bases long from the 3' end of SEQ ID NO: 1. For simplicity, the genetic characteristic A of the present invention has been used as an example for the explanation here, but the same applies to the genetic characteristics X (including genetic characteristics X-1 and X-2), B (including genetic characteristics B-1 to B-4), C, and D of the present invention.

[0023] In a specific embodiment, the "portion consisting of the nucleotide sequence corresponding to SEQ ID NO: 150" includes, for example, a portion of the genome of a Stevia plant that can be amplified by PCR using a forward primer containing the nucleotide sequence of SEQ ID NO: 151 and a reverse primer containing the nucleotide sequence of SEQ ID NO: 152. In a specific embodiment, the "portion consisting of a nucleotide sequence corresponding to SEQ ID NO: 1" includes, for example, a portion of the genome of a stevia plant that can be amplified by PCR using a forward primer containing the nucleotide sequence of SEQ ID NO: 7 and a reverse primer containing the nucleotide sequence of SEQ ID NO: 8. In a specific embodiment, the "portion consisting of a nucleotide sequence corresponding to SEQ ID NO: 2" includes, for example, a portion of the genome of a stevia plant that can be amplified by PCR using a forward primer containing the nucleotide sequence of SEQ ID NO: 9 and a reverse primer containing the nucleotide sequence of SEQ ID NO: 10. In a specific embodiment, the "portion consisting of the nucleotide sequence corresponding to SEQ ID NO: 3" includes, for example, a portion of the genome of a stevia plant that can be amplified by PCR using a forward primer containing the nucleotide sequence of SEQ ID NO: 11 and a reverse primer containing the nucleotide sequence of SEQ ID NO: 12. In a specific embodiment, the "portion consisting of the nucleotide sequence corresponding to SEQ ID NO: 4" includes, for example, a portion of the genome of a stevia plant that can be amplified by PCR using a forward primer containing the nucleotide sequence of SEQ ID NO: 13 and a reverse primer containing the nucleotide sequence of SEQ ID NO: 14. In a specific embodiment, the "portion consisting of the nucleotide sequence corresponding to SEQ ID NO: 5" includes, for example, a portion of the genome of a stevia plant that can be amplified by PCR using a forward primer containing the nucleotide sequence of SEQ ID NO: 15 and a reverse primer containing the nucleotide sequence of SEQ ID NO: 16. In a specific embodiment, the "portion consisting of the nucleotide sequence corresponding to SEQ ID NO: 6" includes, for example, a portion of the genome of a stevia plant that can be amplified by PCR using a forward primer containing the nucleotide sequence of SEQ ID NO: 17 and a reverse primer containing the nucleotide sequence of SEQ ID NO: 18.

[0024] In a specific embodiment, the "allele in which the base at the position corresponding to position 90 of SEQ ID NO: 150 is G" comprises the base sequence of SEQ ID NO: 153 or 154. In a specific embodiment, the "allele in which the base at the position corresponding to position 108 of SEQ ID NO: 150 is G" comprises the base sequence of SEQ ID NO: 155 or 156. In a specific embodiment, the "allele in which the base at the position corresponding to position 201 of SEQ ID NO: 1 is A" includes the base sequence of SEQ ID NO: 19, 20, or 21. In a specific embodiment, the "allele in which the base at the position corresponding to position 40 of SEQ ID NO: 2 is T" comprises the base sequence of SEQ ID NO: 22, 23, or 24. In a specific embodiment, the "allele in which the base at the position corresponding to position 44 of SEQ ID NO: 3 is T" comprises the base sequence of SEQ ID NO: 25, 26, or 27. In a specific embodiment, the "allele in which the base at the position corresponding to position 48 of SEQ ID NO: 4 is C" comprises the base sequence of SEQ ID NO: 28, 29, or 30. In a specific embodiment, the "allele lacking the portion corresponding to positions 55 to 72 of SEQ ID NO: 5" comprises the base sequence of SEQ ID NO: 31, 32, or 33. In a specific embodiment, the "allele in which the base at the position corresponding to position 49 of SEQ ID NO: 6 is A" includes the base sequence of SEQ ID NO: 34, 35, or 36.

[0025] Here, positions selected from the group consisting of (X-1) the position corresponding to position 90 in SEQ ID NO: 150, (X-2) the position corresponding to position 108 in SEQ ID NO: 150, (A) the position corresponding to position 201 in SEQ ID NO: 1, (B-1) the position corresponding to position 40 in SEQ ID NO: 2, (B-2) the position corresponding to position 44 in SEQ ID NO: 3, (B-3) the position corresponding to position 48 in SEQ ID NO: 4, (B-4) the portion corresponding to positions 55 to 72 in SEQ ID NO: 5, and (C) the position corresponding to position 49 in SEQ ID NO: 6 may be collectively referred to as the "polymorphic site of the present invention" or the "mutation site of the present invention." Furthermore, mutations selected from the group consisting of (X-1) an A to G mutation at a position corresponding to position 90 of SEQ ID NO: 150, (X-2) a T to G mutation at a position corresponding to position 108 of SEQ ID NO: 150, (A) a C to A mutation at a position corresponding to position 201 of SEQ ID NO: 1, (B-1) an A to T mutation at a position corresponding to position 40 of SEQ ID NO: 2, (B-2) a C to T mutation at a position corresponding to position 44 of SEQ ID NO: 3, (B-3) a G to C mutation at a position corresponding to position 48 of SEQ ID NO: 4, (B-4) a deletion of a portion corresponding to positions 55 to 72 of SEQ ID NO: 5, and (C) a C to A mutation at a position corresponding to position 49 of SEQ ID NO: 6 may be collectively referred to as "polymorphisms of the present invention" or "mutations of the present invention."

[0026] The above genetic characteristics were analyzed using PCR, TaqMan PCR, sequencing, microarray, Invader, TILLING, random amplified polymorphic DNA (RAD), restriction fragment length polymorphism (RFLP), PCR-SSCP, amplified fragment length polymorphism (AFLP), simple sequence length polymorphism (SSLP), cleaved amplified polymorphic sequence (CAPS), derived cleaved amplified polymorphic sequence (dCAPS), allele-specific oligonucleotide (ASO), ARMS, denaturing gradient gel electrophoresis (DGGE), chemical cleavage of mismatch (CCM), DOL, MALDI-TOF / MS, TDI, padlock probe, molecular beacon, dynamic allele-specific hybridization (DASH), UCAN, ECA, PINPOINT, primer oligo base extension (PROBE), very short extension (VSET), and Survivor Detection can be performed by, but is not limited to, assay, Sniper assay, Luminex assay, GOOD method, LCx method, SNaPshot method, Mass ARRAY method, pyrosequencing method, SNP-IT method, melting curve analysis method, etc.

[0027] In a particular embodiment, the genetic characteristics of the present invention can be detected using the following combination of primer sets and restriction enzymes. If a candidate plant has genetic characteristic X-1, for example, PCR amplification is performed on the genomic DNA of the candidate plant using a forward primer having the nucleotide sequence shown in SEQ ID NO: 157 and a reverse primer having the nucleotide sequence shown in SEQ ID NO: 158, and the resulting PCR product (approximately 115 bp long, for example, SEQ ID NO: 159) is treated with the restriction enzyme AluI, resulting in bands of approximately 90 bp long (for example, SEQ ID NO: 160) and approximately 25 bp long (for example, SEQ ID NO: 161).On the other hand, if PCR amplification yields a PCR product (approximately 115 bp long) of SEQ ID NO: 162, for example, and treatment with the AluI restriction enzyme yields only a band of approximately 115 bp long (for example, SEQ ID NO: 162), then the candidate plant does not have genetic characteristic X-1.

[0028] If a candidate plant has genetic characteristic X-2, for example, PCR amplification is performed on the genomic DNA of the candidate plant using a forward primer having the nucleotide sequence shown in SEQ ID NO: 157 and a reverse primer having the nucleotide sequence shown in SEQ ID NO: 163, and the resulting PCR product (approximately 137 bp long, for example, SEQ ID NO: 164) is treated with the restriction enzyme ApaI, resulting in bands of approximately 112 bp long (for example, SEQ ID NO: 165) and approximately 25 bp long (for example, SEQ ID NO: 166).On the other hand, if PCR amplification yields a PCR product (approximately 137 bp long) of SEQ ID NO: 167, and treatment with the ApaI restriction enzyme yields only a band of approximately 137 bp long (for example, SEQ ID NO: 167), the candidate plant does not have genetic characteristic X-2.

[0029] If a candidate plant has genetic characteristic A, for example, PCR amplification of the genomic DNA of the candidate plant is performed using a forward primer having the nucleotide sequence shown in SEQ ID NO: 37 and a reverse primer having the nucleotide sequence shown in SEQ ID NO: 38, and the resulting PCR product (approximately 196 bp long, e.g., SEQ ID NO: 39) is treated with the restriction enzyme Hpy188I, resulting in a band of approximately 96 bp long (e.g., SEQ ID NO: 41) and a band of approximately 100 bp long (e.g., SEQ ID NO: 42).On the other hand, if PCR amplification yields a PCR product (approximately 196 bp long) of SEQ ID NO: 40, and restriction enzyme treatment with the restriction enzyme Hpy188I produces restriction enzyme products of approximately 43 bp (e.g., SEQ ID NO: 43) and approximately 57 bp (e.g., SEQ ID NO: 44), the candidate plant does not have genetic characteristic A.

[0030] If a candidate plant has genetic characteristic B-1, for example, PCR amplification of the genomic DNA of the candidate plant using a forward primer having the nucleotide sequence shown in SEQ ID NO: 45 and a reverse primer having the nucleotide sequence shown in SEQ ID NO: 46 will only yield a band of about 297 bp (e.g., SEQ ID NO: 47) even if the resulting PCR product (about 297 bp long, e.g., SEQ ID NO: 47) is treated with the KpnI restriction enzyme.On the other hand, if PCR amplification yields a PCR product (about 297 bp long) of SEQ ID NO: 48, and the treatment with the KpnI restriction enzyme produces a restriction enzyme product of about 258 bp (e.g., SEQ ID NO: 49), the candidate plant does not have genetic characteristic B-1.

[0031] When a candidate plant has genetic characteristic B-2, for example, PCR amplification is performed on the genomic DNA of the candidate plant using a forward primer having the nucleotide sequence shown in SEQ ID NO: 50 and a reverse primer having the nucleotide sequence shown in SEQ ID NO: 51, and the resulting PCR product (approximately 383 bp long, for example, SEQ ID NO: 52) is treated with XbaI restriction enzyme, but only a band of approximately 383 bp long (for example, SEQ ID NO: 52) is obtained. On the other hand, when PCR amplification is performed, for example, a PCR product of SEQ ID NO: 53 (approximately 383bp length) is obtained, and if a restriction enzyme digestion product of about 344 bp length (for example, SEQ ID NO: 54) is produced by the restriction enzyme XbaI, the candidate plant does not have the genetic characteristic B-2.

[0032] When a candidate plant has genetic characteristic B-3, for example, PCR amplification is performed on the genomic DNA of the candidate plant using a forward primer having the nucleotide sequence shown in SEQ ID NO: 55 and a reverse primer having the nucleotide sequence shown in SEQ ID NO: 56, and the resulting PCR product (approximately 390 bp long, for example, SEQ ID NO: 57) is treated with the AflII restriction enzyme, but only a band of approximately 390 bp long (for example, SEQ ID NO: 57) is obtained. On the other hand, when PCR amplification is performed, for example, a PCR product of SEQ ID NO: 58 (approximately 390 bp length) is obtained, and if the restriction enzyme AflII produces a restriction enzyme digestion product of about 347 bp length (for example, SEQ ID NO: 59), the candidate plant does not have the genetic characteristic B-3.

[0033] If a candidate plant has genetic characteristic B-4, PCR amplification of the genomic DNA of the candidate plant using a forward primer having the nucleotide sequence shown in SEQ ID NO: 60 and a reverse primer having the nucleotide sequence shown in SEQ ID NO: 61 will produce only a PCR product of about 140 bp (e.g., SEQ ID NO: 62).On the other hand, if PCR products of 140 bp (e.g., SEQ ID NO: 62) and 158 bp (e.g., SEQ ID NO: 63) are produced, the candidate plant does not have genetic characteristic B-4.

[0034] If a candidate plant has genetic characteristics C or D, for example, PCR amplification is performed on the genomic DNA of the candidate plant using a forward primer having the nucleotide sequence shown in SEQ ID NO: 64 and a reverse primer having the nucleotide sequence shown in SEQ ID NO: 65, and the resulting PCR product (approximately 367 bp long, for example, SEQ ID NO: 66) is treated with the restriction enzyme SpeI to obtain bands of approximately 367 bp long (for example, SEQ ID NO: 66) and approximately 321 bp long (for example, SEQ ID NO: 68).On the other hand, if PCR amplification yields, for example, a PCR product (approximately 367 bp long) of SEQ ID NO: 67, and the treatment with the restriction enzyme SpeI yields only an approximately 367 bp long restriction enzyme product (for example, SEQ ID NO: 67), the candidate plant does not have genetic characteristics C or D. With respect to the above bp length, "about" means ±5 bp. Restriction enzyme treatment can be carried out according to the conditions recommended by the vendor of each restriction enzyme used.

[0035] The flower bud formation ability can be evaluated, for example, by any known method or the method described in Example 6. Non-limiting examples of methods for evaluating the flower bud formation ability include the following methods. (1) Test stevia plants are cultivated under short-day conditions for a predetermined period of time. (2) Count the number of flower buds formed. The test stevia plant may be grown alone or together with a wild-type stevia plant (control) under the same conditions. When grown alone, the evaluation method may include a step of comparing the number of flower buds formed on the test stevia plant with the number of flower buds formed on a wild-type stevia plant grown under similar conditions (e.g., based on data from the literature or a separate experiment). When grown together with a wild-type stevia plant, the evaluation method may include a step of comparing the number of flower buds formed on the test stevia plant with the number of flower buds formed on the wild-type stevia plant grown together. As described above, the short-day conditions are set so that the dark period is longer than 10 hours, preferably longer than 11 hours. Specific lengths of the dark period may be, for example, 11, 12, 13, 14, 15, 16, 17, or 18 hours. The predetermined cultivation period is not particularly limited as long as it is a period during which the wild-type stevia plant can form flower buds under short-day conditions, and may be, for example, 2 weeks, 3 weeks, or 4 weeks.

[0036] In one embodiment, the plant of the present invention contains 3% or more RebD per unit mass of dried leaves, which means, for example, that a given mass of dried leaves (e.g., 50 mg) contains 3% or more RebD by mass (e.g., 1.5 mg or more). In this embodiment, the proportion of RebD per unit mass of dried leaves is not limited, and may be, for example, 3.0% or more, 3.1% or more, 3.2% or more, 3.3% or more, 3.4% or more, 3.5% or more, 3.6% or more, 3.7% or more, 3.8% or more, 3.9% or more, 4.0% or more, 4.1% or more, 4.2% or more, 4.3% or more, 4.4% or more, 4.5% or more, 4.6% or more, 4.7% or more, 4.8% or more, 4.9% or more, 5.0% or more, 5.1% or more, 5.2% or more, 5.3% or more, 5.4% or more, 5.5% or more, 5.6% or more, 5.7% or more, 5.8% or more, 5.9% or more, 6.0% or more, etc., with 3.3% or more being preferred, and 3.6% or more being more preferred. The upper limit of the proportion of RebD per unit mass of dried leaves is not particularly limited, and may be, for example, 20%, 15%, 10%, etc. As shown in the Examples, genetic characteristics A to D are highly relevant to this embodiment. Here, the dried leaves refer to fresh leaves of the stevia plant of the present invention that have been dried to reduce the water content to 3 to 4% by weight.

[0037] In one embodiment, the plant of the present invention contains 2.6% or more RebD and 0.4% or more RebM per unit mass of dried leaves, which means, for example, that a given mass of dried leaves (e.g., 50 mg) contains 2.6% or more RebD by mass (e.g., 1.3 mg or more per 50 mg of dried leaves) and 0.4% or more RebM by mass (e.g., 0.2 mg or more per 50 mg of dried leaves). In this embodiment, the ratio of RebD to RebM per unit mass of dried leaves (ratio of RebD:ratio of RebM) is not limited, and may be, for example, (2.6% or more:0.4% or more), (2.8% or more:0.4% or more), (3% or more:0.4% or more), (3.2% or more:0.4% or more), (3.4% or more:0.4% or more), (3.6% or more:0.4% or more), (3.8% or more:0.4% or more), (4% or more:0.4% or more), (4.2% or more:0.4% or more) ), (4.4% or more: 0.4% or more), (4.6% or more: 0.4% or more), (4.8% or more: 0.4% or more), (5% or more: 0.4% or more), (2.6% or more: 0.5% or more), (2.8% or more: 0.5% or more), (3% or more: 0.5% or more), (3.2% or more: 0.5% or more), (3.4% or more: 0.5% or more), (3.6% or more: 0.5% or more), (3.8% or more: 0.5% or more), (4% or more: 0.5% or more), (4.2% or more: 0.5% or more), (4 .4% or more: 0.5% or more), (4.6% or more: 0.5% or more), (4.8% or more: 0.5% or more), (5% or more: 0.5% or more), (2.6% or more: 0.6% or more), (2.8% or more: 0.6% or more), (3% or more: 0.6% or more) Above), (3.2% or more: 0.6% or more), (3.4% or more: 0.6% or more), (3.6% or more: 0.6% or more), (3.8% or more: 0.6% or more), (4% or more: 0.6% or more), (4.2% or more: 0.6% or more), (4.4% or more above: 0.6% or more), (4.6% or more: 0.6% or more), (4.8% or more: 0.6% or more), (5% or more: 0.6% or more), (2.6% or more: 0.7% or more), (2.8% or more: 0.7% or more), (3% or more: 0.7% or more), (3.2% or more: 0.7% or more), (3.4% or more: 0.7% or more), (3.6% or more: 0.7% or more), (3.8% or more: 0.7% or more), (4% or more: 0.7% or more), (4.2% or more: 0.7% or more), (4.4% or more: 0.7% or more), (4.6% or more: 0.7% or more), (4.8% or more: 0.7% or more), (5% or more: 0.7% or more), (2.6% or more: 0.8% or more), (2.8% or more: 0.8% or more), (3% or more: 0.8% or more), (3.2% or more: 0.8% or more), (3.4% or more: 0.8% or more), (3.6% or more: 0.8% or more), (3.8% or more: 0.8% or more), (4% or more: 0.8% or more), (4.2% or more: 0.8% or more), (4.4% or more: 0.8% or more), (4.6% or more: 0.8% or more), (4.8% or more: 0.8% or more), (5% or more: 0.8% or more), etc. may be used, and (3.6% or more: 0.4% or more) is preferred. The upper limit of the proportion of RebD per unit mass of dried leaves is not particularly limited, but may be, for example, 20%, 15%, 10%, etc. The upper limit of the proportion of RebM is also not particularly limited, but may be, for example, 10%, 5%, 3%, etc. As shown in the examples, genetic characteristics A to D are highly relevant to this embodiment.

[0038] In one embodiment, the plant of the present invention contains a total of 3.7% or more RebD and RebM per unit mass of dried leaves, which means, for example, that the total mass of RebD and RebM contained in a given mass of dried leaves (e.g., 50 mg) is 3.7% by mass or more (e.g., 1.85 mg or more). In this embodiment, the total proportion of RebD and RebM per unit mass of dried leaves is not limited to, and may be, for example, 3.7% or more, 3.8% or more, 3.9% or more, 4.0% or more, 4.1% or more, 4.2% or more, 4.3% or more, 4.4% or more, 4.5% or more, 4.6% or more, 4.7% or more, 4.8% or more, 4.9% or more, 5.0% or more, 5.1% or more, 5.2% or more, 5.3% or more, 5.4% or more, 5.5% or more, 5.6% or more, 5.7% or more, 5.8% or more, 5.9% or more, 6.0% or more, 6.1% or more, 6.2% or more, 6.3% or more, 6.4% or more, 6.5% or more, 6.6% or more, 6.7% or more, 6.8% or more, 6.9% or more, 7.0% or more, etc., with 4.9% or more being preferred. The upper limit of the total proportion of RebD and RebM per unit mass of dried leaves is not particularly limited, and may be, for example, 25%, 20%, 15%, etc. As shown in the Examples, genetic characteristics A to D are highly relevant to this embodiment.

[0039] In one aspect, the plant of the present invention has a total mass ratio of RebD and RebM to total steviol glycosides (TSG) of 37.8% or more. This means that, for example, when the total mass of RebD and RebM contained in leaves (e.g., dried or fresh leaves) is expressed as RebD + RebM / TSG% as a ratio to the total mass of steviol glycosides obtained from the leaves, the value of RebD + RebM / TSG is 37.8% or more. In this embodiment, the value of RebD+RebM / TSG is, but not limited to, for example, 37.8% or more, 37.9% or more, 38.0% or more, 38.1% or more, 38.2% or more, 38.3% or more, 38.4% or more, 38.5% or more, 38.6% or more, 38.7% or more, 38.8% or more, 38.9% or more, 39.0% or more, 39.2% or more, 39.4% or more, 39.6% or more, 39.8% or more, 40.0% or more, The mass ratio may be 40.2% or more, 40.4% or more, 40.6% or more, 40.8% or more, 41.0% or more, 41.2% or more, 41.4% or more, 41.6% or more, 41.8% or more, 42.0% or more, 42.4% or more, 42.8% or more, 43.2% or more, 43.6% or more, 44.0% or more, 44.4% or more, 44.8% or more, 45.2% or more, 45.6% or more, 46.0% or more, etc., with 38.1% or more being preferred. The upper limit of the mass ratio of RebD + RebM to total steviol glycosides is not particularly limited, but may be, for example, 85%, 75%, 65%, 55%, etc. As shown in the examples, genetic characteristics A to D are highly associated with this embodiment.

[0040] TSG is a collective term for measurable steviol glycosides and does not include unknown steviol glycosides or steviol glycosides present in amounts below the detection limit. Preferably, total steviol glycosides are any combination of two or more selected from the group consisting of RebA, RebB, RebD, RebE, RebF, RebI, RebJ, RebK, RebM, RebN, RebO, RebQ, RebR, dulcoside A, rubusoside, steviolmonosides, steviolbioside, and stevioside. For example, in one embodiment, total steviol glycosides may consist of RebA, RebB, RebM, RebD, RebF, RebM, and stevioside. In another embodiment, total steviol glycosides may consist of RebA, RebB, RebM, RebD, RebF, RebM, RebN, RebO, and stevioside. In certain embodiments, the total steviol glycosides consist of RebA, RebB, RebC, RebD, RebF, RebM, RebN, and RebO.

[0041] In one embodiment, the plant of the present invention contains 0.2% or more RebM per unit mass of dried leaves, which means, for example, that the mass of RebM contained in a given mass of dried leaves (e.g., 50 mg) is 0.2% by mass or more (e.g., 0.1 mg or more). In this embodiment, the proportion of RebM per unit mass of dried leaves is not limited, and may be, for example, 0.20% or more, 0.25% or more, 0.30% or more, 0.35% or more, 0.40% or more, 0.45% or more, 0.50% or more, 0.55% or more, 0.60% or more, 0.65% or more, 0.70% or more, 0.75% or more, 0.80% or more, 0.85% or more, 0.90% or more, 0.95% or more, 1.00% or more, 1.05% or more, 1.10% or more, 1.15% or more, 1.20% or more, 1.25% or more, 1.30% or more, 1.35% or more, 1.40% or more, 1.45% or more, etc., with 0.4% or more being preferred. The upper limit of the proportion of RebM per unit mass of dried leaves is not particularly limited, and may be, for example, 15%, 10%, 5%, etc. As shown in the Examples, genetic characteristic B is highly relevant to this embodiment.

[0042] In one aspect, the plant of the present invention has a mass ratio of RebM to total steviol glycosides of 2% or more. This means that, for example, when the mass of RebM contained in leaves (e.g., dried or fresh leaves) is expressed as RebM / TSG% as a ratio to the total mass of steviol glycosides obtained from the leaves, the RebM / TSG value is 2% or more. The RebM / TSG value in this embodiment is not limited, and may be, for example, 2% or more, 2.5% or more, 3% or more, 3.5% or more, 4% or more, 4.5% or more, 5% or more, 5.5% or more, 6% or more, 6.5% or more, 7% or more, 7.5% or more, 8% or more, 8.5% or more, 9% or more, 9.5% or more, 10% or more, 10.5% or more, 11% or more, 12% or more, 13% or more, 14% or more, 15% or more, 16% or more, 17% or more, 18% or more, 19% or more, 20% or more, etc., with 3.5% or more being preferred. The upper limit of the mass ratio of RebM to total steviol glycosides is not particularly limited, and may be, for example, 50%, 45%, 40%, 35%, etc. As shown in the Examples, genetic characteristic B is highly associated with this embodiment.

[0043] In one aspect, when the amount (g) of rebaudioside M contained in 100 g of leaves (e.g., dried leaves or fresh leaves) of a wild-type stevia plant is taken as 100%, the plant of the present invention has 300% or more, 400% or more, 500% or more, 600% or more, 700% or more, 800% or more, 900% or more, 1100% or more, 120% or more of rebaudioside M compared to wild-type stevia species. The genetic characteristic B is highly correlated with this embodiment.

[0044] In one embodiment, the plant of the present invention contains 1% or more RebD per unit mass of dried leaves, which means, for example, that the mass of RebD contained in a given mass of dried leaves (e.g., 50 mg) is 1% by mass or more (e.g., 0.5 mg or more). In this embodiment, the proportion of RebD per unit mass of dried leaves is not limited, and may be, for example, 1.00% or more, 1.05% or more, 1.10% or more, 1.15% or more, 1.20% or more, 1.25% or more, 1.30% or more, 1.35% or more, 1.40% or more, 1.45% or more, 1.50% or more, 1.55% or more, 1.60% or more, 1.65% or more, 1.70% or more, 1.75% or more, 1.80% or more, 1.85% or more, 1.90% or more, 1.95% or more, 2.00% or more, 2.05% or more, 2.10% or more, 2.15% or more, 2.20% or more, 2.30% or more, 2.40% or more, 2.50% or more, 2.60% or more, 2.70% or more, 2.80% or more, 2.90% or more, 2.95% or more, 2.10% or more, 2.15% or more, 2.25% or more, 2.30% or more, 2.40% or more, 2.50% or more, 2.60% or more, 2.75 ... The upper limit of the proportion of RebD per unit mass of dried leaves is not particularly limited, and may be, for example, 15%, 10%, 5%, or 6%. As shown in the Examples, genetic feature B is highly associated with this aspect.

[0045] In one embodiment, when the contents of RebM and RebD in leaves (e.g., dried or fresh leaves) of a plant of the present invention are expressed as a RebM / RebD ratio, the lower limit of the RebM / RebD value is 0.2 or more, 0.3 or more, 0.4 or more, 0.5 or more, 0.6 or more, 0.8 or more, or 1.0 or more. On the other hand, the upper limit of the RebM / RebD value is 0.3 or less, 0.4 or less, 0.5 or less, 0.6 or less, 0.8 or less, 1.0 or less, 1.1 or less, or 1.2 or less. The combination of the lower limit and the upper limit is not particularly limited as long as the upper limit exceeds the lower limit, but is preferably 0.2 or more and 1.2 or less, or 0.6 or more and 1.1 or less. As shown in the Examples, genetic characteristic B is highly associated with this embodiment.

[0046] In one aspect, when the content of RebM and RebD in leaves (e.g., dried or fresh leaves) of a plant of the present invention is expressed as (RebD+RebM) / TSG% as a ratio to the total amount of steviol glycosides, the lower limit of the (RebD+RebM) / TSG value is 14% or more, 16% or more, 18% or more, 20% or more, 22% or more, 24% or more, 26% or more, 28% or more, 30% or more, 32% or more, 34% or more, 36% or more, or 38% or more. On the other hand, the upper limit of the (RebD+RebM) / TSG value is 18% or less, 20% or less, 22% or less, 24% or less, 26% or less, 28% or less, 30% or less, 32% or less, 34% or less, 36% or less, 38% or less, or 40% or less. The combination of the upper and lower limits is not particularly limited as long as the upper limit is higher than the lower limit, but is preferably 14% or more and 40% or less, or 16% or more and 40% or less. As shown in the Examples, genetic characteristic B is highly associated with this embodiment.

[0047] RebD and RebM can be extracted in the form of an extract by reacting fresh or dried leaves of the plant of the present invention with an appropriate solvent (an aqueous solvent such as water, or an organic solvent such as alcohol, ether, or acetone). The extraction conditions can be determined by reference to the methods described in Ohta et al., J. Appl. Glycosci., Vol. 57, No. 3, 199-209 (2010) or WO2010 / 038911, or the methods described in the Examples below. Furthermore, RebD can be purified from the extract thus obtained by known methods such as ethyl acetate or other organic solvent:water gradients, high performance liquid chromatography (HPLC), gas chromatography, time-of-flight mass spectrometry (TOF-MS), and ultra (high) performance liquid chromatography (UPLC).

[0048] The content of RebD or RebM can be measured by the method described in Ohta et al. or WO2010 / 038911, or the method described in the Examples below. Specifically, the content of RebD or RebM can be measured by sampling fresh leaves from the stevia plant of the present invention and performing LC / MS-MS.

[0049] The plants of the present invention may include not only whole plants but also plant organs (e.g., leaves, petals, stems, roots, seeds, etc.), plant tissues (e.g., epidermis, phloem, parenchyma, xylem, vascular bundles, palisade tissue, spongy tissue, etc.), or various forms of plant cells (e.g., suspension culture cells), protoplasts, leaf slices, callus, etc. Furthermore, the leaves may be dried leaves as described above.

[0050] The plant of the present invention may also include tissue cultures or plant cultured cells, since plants can be regenerated by culturing such tissue cultures or plant cultured cells. Examples of plant tissue cultures or plant cultured cells of the present invention include, but are not limited to, embryos, meristematic cells, pollen, leaves, roots, root tips, petals, protoplasts, leaf slices, and callus.

[0051] 2. Method for producing the plant of the present invention In another embodiment, the present invention provides a method for producing a stevia plant having a lower ability to form flower buds than the wild-type stevia plant (hereinafter, sometimes referred to as the "production method of the present invention"), which comprises a step of crossing the stevia plant of the present invention with a second stevia plant. The "Stevia plant having a lower ability to form flower buds than the wild type" produced by this method has the same phenotype and genetic properties as the plant of the present invention. The flower bud formation ability, the ranges of RebD and RebM contents, etc. in the plants obtained by the production method of the present invention are as described above for the plants of the present invention.

[0052] In one embodiment, a plant obtained by the production method of the present invention has genetic feature X of the present invention. In one embodiment, a plant obtained by the production method of the present invention has genetic feature A of the present invention. In another embodiment, a plant obtained by the production method of the present invention has genetic feature B of the present invention. In another embodiment, a plant obtained by the production method of the present invention has genetic feature C or D of the present invention. In a preferred embodiment, a plant obtained by the production method of the present invention has genetic feature X and genetic feature A of the present invention. In another preferred embodiment, a plant obtained by the production method of the present invention has genetic feature X and genetic feature B of the present invention. In another preferred embodiment, a plant obtained by the production method of the present invention has genetic feature X and genetic feature C or D of the present invention. In another preferred embodiment, a plant obtained by the production method of the present invention has genetic feature X, genetic feature A, and genetic feature B of the present invention. In another preferred embodiment, a plant obtained by the production method of the present invention has genetic feature X, genetic feature A, and genetic feature C or D of the present invention. In another preferred embodiment, a plant obtained by the production method of the present invention has genetic feature X, genetic feature A, and genetic feature C or D of the present invention. In a more preferred embodiment, the plant obtained by the production method of the present invention has all of the genetic characteristics X, A, B, and C or D of the present invention.

[0053] In the production method of the present invention, "crossing" means crossing a plant of the present invention (first generation (S1)) with a second plant (S1) to obtain a progeny plant (a plant of the second generation (S2) produced by the production method of the present invention). Backcrossing is preferred as the crossing method. "Backcrossing" is a technique in which a progeny plant (S2) born between a plant of the present invention and a second plant is further crossed with a plant of the present invention (i.e., a plant having the genetic characteristic of the present invention) (S1) to produce a plant having the genetic characteristic of the present invention. When the second plant (S1) used in the production method of the present invention has the same phenotype and genetic properties as the plant of the present invention, this is essentially backcrossing. The genetic polymorphism of the present invention is inherited according to Mendel's laws, and therefore the phenotype correlated with the genetic polymorphism, i.e., the phenotype of low flower bud formation ability, is also inherited according to Mendel's laws.

[0054] Alternatively, the plant of the present invention can be produced by self-pollination, which can be achieved by self-pollinating the pistil of the plant of the present invention with pollen from the stamen of the plant of the present invention.

[0055] Since the plant produced by the production method of the present invention has the same phenotype and genetic properties as the plant of the present invention, it is possible to produce a stevia plant having a phenotype equivalent to that of the plant of the present invention by further crossing the plant produced by the production method of the present invention with a third stevia plant.

[0056] In another embodiment, the plant of the present invention can be produced by regenerating the plant through culturing the tissue culture or plant cell culture described above. The culturing conditions are the same as those for culturing tissue culture or plant cell culture of wild-type Stevia plants and are well known (Protocols for In Vitro Cultures and Secondary Metabolite Analysis of Aromatic and Medicinal Plants, Method in Molecular Biology, Vol. 1391, pp. 113-123).

[0057] In yet another embodiment, the plant of the present invention can be produced by introducing the mutation of the present invention into the genome of a stevia plant. The introduction of the mutation may be carried out by genetic recombination techniques or non-genetically modified techniques. An example of a "non-genetically modified technique" is a method of inducing a mutation in a gene of a host cell (or a host plant) without introducing an exogenous gene. Such a method includes the application of a mutagen to plant cells. Examples of such mutagen include ethyl methanesulfonate (EMS) and sodium azide. For example, plant cells can be treated with ethyl methanesulfonate (EMS) at concentrations of 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, or 1.0%. The treatment time is 1 to 48 hours, 2 to 36 hours, 3 to 30 hours, 4 to 28 hours, 5 to 26 hours, or 6 to 24 hours. The treatment procedure itself is known, and can be carried out by immersing the water-absorbed seeds that have undergone the water absorption process in a treatment solution containing the mutagen at the above concentration for the above treatment time.

[0058] Alternatively, as an example of a non-genetically modified method, plant cells can be irradiated with radiation or light such as X-rays, gamma rays, or ultraviolet rays. In this case, cells irradiated with an appropriate amount of ultraviolet light (ultraviolet lamp intensity, distance, and time) can be cultured on a selective medium, and then cells, calli, or plants with the desired traits can be selected. The irradiation intensity is 0.01 to 100 Gr, 0.03 to 75 Gr, 0.05 to 50 Gr, 0.07 to 25 Gr, 0.09 to 20 Gr, 0.1 to 15 Gr, 0.1 to 10 Gr, 0.5 to 10 Gr, and 1 to 10 Gr, the irradiation distance is 1 cm to 200 m, 5 cm to 100 m, 7 cm to 75 m, 9 cm to 50 m, 10 cm to 30 m, 10 cm to 20 m, and 10 cm to 10 m, and the irradiation time is 1 minute to 2 years, 2 minutes to 1 year, 3 minutes to 0.5 years, 4 minutes to 1 month, 5 minutes to 2 weeks, or 10 minutes to 1 week. The irradiation intensity, distance, and time vary depending on the type of radiation and the state of the target (cells, callus, plant body), but can be adjusted appropriately by one skilled in the art.

[0059] In addition, techniques such as cell fusion, anther culture (haploid rearing), and distant crossing (haploid rearing) are also known. Generally, plant cells may undergo mutations during cultivation, and therefore it is preferable to return them to individual plants in order to maintain traits more stably. Plants obtained by subsequently performing genetic modification (e.g., by genome editing) using the plant body of the present invention as a host (e.g., plants to which genetic modification has been performed using the plant body of the present invention as a host to further impart another trait) are not excluded from the scope of the present invention.

[0060] Plants having multiple different genetic characteristics of the present invention can also be produced by crossbreeding plants having different genetic characteristics of the present invention. For example, a plant having genetic characteristics X and A of the present invention can be obtained by crossbreeding a plant having genetic characteristic X of the present invention with a plant having genetic characteristic A of the present invention. Plants having genetic characteristics X and B of the present invention, plants having genetic characteristics X and C or D of the present invention, plants having genetic characteristics A and B of the present invention, plants having genetic characteristics A and C or D of the present invention, plants having genetic characteristics B and C or D of the present invention, etc. can also be obtained by similar crossbreeding. Furthermore, for example, a plant having genetic characteristics X, A, and B of the present invention can be obtained by crossbreeding a plant having genetic characteristics X and A of the present invention with a plant having genetic characteristic B of the present invention, crossbreeding a plant having genetic characteristics X and B of the present invention with a plant having genetic characteristic A of the present invention, crossbreeding a plant having genetic characteristic X of the present invention with a plant having genetic characteristics A and B of the present invention, or crossbreeding a plant having genetic characteristic X of the present invention with a plant having genetic characteristics A and B of the present invention. Plants having the genetic characteristics X, B, C, or D of the present invention, and plants having the genetic characteristics A, B, C, or D of the present invention can also be obtained by similar crossing. It is preferable to carry out crossing over two or more generations, but in cases where the genetic characteristics are heterozygous, etc., plants having the desired combination of genetic characteristics can sometimes be obtained in one generation.

[0061] 3. Screening method for plants of the present invention The plants of the present invention and plants having the same phenotype and genetic properties as the plants of the present invention can be screened by detecting the genetic features of the present invention from the tissues of the plants. Here, "screening" means distinguishing the plants of the present invention from other plants and selecting the plants of the present invention. Therefore, in another aspect, the present invention provides a method for screening a Stevia plant having low flower bud formation ability (hereinafter, may be referred to as "the screening method of the present invention"), which comprises a step of detecting the presence and / or absence of at least one of the genetic features X, A, B, C, and D of the present invention from the genome of a test plant.

[0062] In one embodiment, the genetic feature to be detected is genetic feature X of the present invention. In another embodiment, the genetic feature to be detected is genetic feature A of the present invention. In another embodiment, the genetic feature to be detected is genetic feature B of the present invention. In another embodiment, the genetic feature to be detected is genetic feature C of the present invention. In another embodiment, the genetic feature to be detected is genetic feature D of the present invention. In a preferred embodiment, the genetic features to be detected are genetic feature X and genetic feature A of the present invention. In another preferred embodiment, the genetic features to be detected are genetic feature X and genetic feature B of the present invention. In another preferred embodiment, the genetic features to be detected are genetic feature X and genetic feature C or D of the present invention. In another preferred embodiment, the genetic features to be detected are genetic feature X, genetic feature A, and genetic feature B of the present invention. In another preferred embodiment, the genetic features to be detected are genetic feature X, genetic feature A, and genetic feature C or D of the present invention. In another preferred embodiment, the genetic features to be detected are genetic feature X, genetic feature B, and genetic feature C or D of the present invention. In a more preferred embodiment, the genetic features to be detected are all of genetic features X, A, B, and C or D of the present invention. The screening method of the present invention may further comprise the step of selecting, from the test plants, a plant in which the presence of at least one of the above genetic characteristics has been detected.

[0063] The presence of the genetic trait of the present invention (X-1) an allele in which the base at the position corresponding to position 90 of SEQ ID NO: 150 is G (for example, an allele containing the base sequence of SEQ ID NO: 153 or 154); (X-2) an allele in which the base at the position corresponding to position 108 of SEQ ID NO: 150 is G (for example, an allele containing the base sequence of SEQ ID NO: 155 or 156); (A) an allele in which the base at the position corresponding to position 201 of SEQ ID NO: 1 is A (for example, an allele containing the base sequence of SEQ ID NO: 69); (B-1) an allele in which the base at the position corresponding to position 40 of SEQ ID NO: 2 is T (for example, an allele containing the base sequence of SEQ ID NO: 70); (B-2) an allele in which the base at the position corresponding to position 44 of SEQ ID NO: 3 is T (for example, an allele containing the base sequence of SEQ ID NO: 71); (B-3) an allele in which the base at the position corresponding to position 48 of SEQ ID NO: 4 is C (for example, an allele containing the base sequence of SEQ ID NO: 72); (B-4) an allele lacking a portion corresponding to positions 55 to 72 of SEQ ID NO: 5 (for example, an allele containing the nucleotide sequence of SEQ ID NO: 73), and (C) An allele in which the base at the position corresponding to position 49 of SEQ ID NO: 6 is A (for example, an allele containing the base sequence of SEQ ID NO: 74). and / or detecting the presence of an allele selected from the group consisting of: (x-1) an allele in which the base at the position corresponding to position 90 of SEQ ID NO: 150 is A (for example, an allele containing the base sequence of SEQ ID NO: 168 or 169); (x-2) an allele in which the nucleotide at the position corresponding to position 108 of SEQ ID NO: 150 is T (for example, an allele containing the nucleotide sequence of SEQ ID NO: 170 or 171); (a) an allele in which the base at the position corresponding to position 201 of SEQ ID NO: 1 is T (for example, an allele containing the base sequence of SEQ ID NO: 1); (b-1) an allele in which the base at the position corresponding to position 44 of SEQ ID NO: 2 is A (for example, an allele containing the base sequence of SEQ ID NO: 2); (b-2) an allele in which the base at the position corresponding to position 40 of SEQ ID NO: 3 is C (for example, an allele containing the base sequence of SEQ ID NO: 3); (b-3) an allele in which the base at the position corresponding to position 48 of SEQ ID NO: 4 is G (for example, an allele containing the base sequence of SEQ ID NO: 4); (b-4) an allele in which the portion corresponding to positions 55 to 72 of SEQ ID NO: 5 is not deleted (for example, an allele containing the nucleotide sequence of SEQ ID NO: 5), and (c) an allele in which the base at the position corresponding to position 49 of SEQ ID NO: 6 is C (for example, an allele containing the base sequence of SEQ ID NO: 6) detecting the absence of an allele selected from the group consisting of: can be determined by

[0064] The absence of the genetic features of the present invention (X-1) an allele in which the base at the position corresponding to position 90 of SEQ ID NO: 150 is G (for example, an allele containing the base sequence of SEQ ID NO: 153 or 154); (X-2) an allele in which the base at the position corresponding to position 108 of SEQ ID NO: 150 is G (for example, an allele containing the base sequence of SEQ ID NO: 155 or 156); (A) an allele in which the base at the position corresponding to position 201 of SEQ ID NO: 1 is A (for example, an allele containing the base sequence of SEQ ID NO: 69); (B-1) an allele in which the base at the position corresponding to position 40 of SEQ ID NO: 2 is T (for example, an allele containing the base sequence of SEQ ID NO: 70); (B-2) an allele in which the base at the position corresponding to position 44 of SEQ ID NO: 3 is T (for example, an allele containing the base sequence of SEQ ID NO: 71); (B-3) an allele in which the base at the position corresponding to position 48 of SEQ ID NO: 4 is C (for example, an allele containing the base sequence of SEQ ID NO: 72); (B-4) an allele lacking a portion corresponding to positions 55 to 72 of SEQ ID NO: 5 (for example, an allele containing the nucleotide sequence of SEQ ID NO: 73), and (C) An allele in which the base at the position corresponding to position 49 of SEQ ID NO: 6 is A (for example, an allele containing the base sequence of SEQ ID NO: 74). and / or detecting the absence of an allele selected from the group consisting of: (x-1) an allele in which the base at the position corresponding to position 90 of SEQ ID NO: 150 is A (for example, an allele containing the base sequence of SEQ ID NO: 168 or 169); (x-2) an allele in which the nucleotide at the position corresponding to position 108 of SEQ ID NO: 150 is T (for example, an allele containing the nucleotide sequence of SEQ ID NO: 170 or 171); (a) an allele in which the base at the position corresponding to position 201 of SEQ ID NO: 1 is T (for example, an allele containing the base sequence of SEQ ID NO: 1); (b-1) an allele in which the base at the position corresponding to position 44 of SEQ ID NO: 2 is A (for example, an allele containing the base sequence of SEQ ID NO: 2); (b-2) an allele in which the base at the position corresponding to position 40 of SEQ ID NO: 3 is C (for example, an allele containing the base sequence of SEQ ID NO: 3); (b-3) an allele in which the base at the position corresponding to position 48 of SEQ ID NO: 4 is G (for example, an allele containing the base sequence of SEQ ID NO: 4); (b-4) an allele in which the portion corresponding to positions 55 to 72 of SEQ ID NO: 5 is not deleted (for example, an allele containing the nucleotide sequence of SEQ ID NO: 5), and (c) an allele in which the base at the position corresponding to position 49 of SEQ ID NO: 6 is C (for example, an allele containing the base sequence of SEQ ID NO: 6) detecting the presence of an allele selected from the group consisting of: can be determined by

[0065] Specific examples of methods for detecting genetic characteristics of the present invention include PCR, TaqMan PCR, sequencing, microarray, Invader, TILLING, RAD, RFLP, PCR-SSCP, AFLP, SSLP, CAPS, dCAPS, ASO, ARMS, DGGE, CCM, DOL, MALDI-TOF / MS, TDI, padlock probe, molecular beacon, DASH, UCAN, ECA, PINPOINT, PROBE, VSET, Survivor assay, Sniper assay, Luminex assay, GOOD, LCx, SNaPshot, Mass ARRAY, pyrosequencing, SNP-IT, and melting curve analysis, but are not limited to these.

[0066] In the case of PCR, it is preferable to prepare a primer whose 3'-end has a sequence complementary to the polymorphic site of the present invention. When a primer designed in this way is used, if the template sample contains a polymorphism, the primer will completely hybridize to the template, and the polymerase extension reaction will proceed. However, if the template does not contain the mutation of the present invention, the nucleotide at the 3'-end of the primer will mismatch with the template, and the extension reaction will not occur. Therefore, PCR amplification is performed using such primers, and the amplified product is analyzed by agarose gel electrophoresis or the like. If an amplified product of a predetermined size is confirmed, it means that the sample template contains a mutation. If an amplified product is not present, it can be determined that the template does not contain a mutation. Alternatively, the genetic characteristics of the present invention can be detected by designing primer sequences that do not overlap with the polymorphisms of the present invention and that enable PCR amplification of the genetic mutations of the present invention, and sequencing the base sequences of the amplified nucleotide fragments. For information on PCR and agarose gel electrophoresis, see Sambrook, Fritsch and Maniatis, "Molecular Cloning: A Laboratory Manual" 2nd Edition (1989), Cold Spring Harbor Laboratory Press.

[0067] The TaqMan PCR method is a method that uses a PCR reaction using fluorescently labeled allele-specific oligos and Taq DNA polymerase (Livak, KJ Genet. Anal. 14, 143 (1999); Morris T. et al., J. Clin. Microbiol. 34, 2933 (1996)). The sequencing method is a method for analyzing the presence or absence of a mutation by amplifying a region containing the mutation by PCR and sequencing the DNA sequence using a dye terminator or the like (Sambrook, Fritsch and Maniatis, supra). A DNA microarray is an array of nucleotide probes fixed to a support, and includes DNA chips, gene chips, microchips, bead arrays, and the like. The presence or absence of the polymorphisms of the present invention can be comprehensively detected by using probes containing sequences complementary to the polymorphisms of the present invention. Examples of DNA microarray assays, such as DNA chips, include the GeneChip assay (Affymetrix; see U.S. Patent Nos. 6,045,996, 5,925,525, and 5,858,659). GeneChip technology utilizes a miniaturized, high-density microarray of oligonucleotide probes attached to a chip.

[0068] The Invader method combines hybridization of two types of reporter probes specific to each allele of a polymorphism such as an SNP and one type of Invader probe to template DNA, and cleavage of the DNA with a cleavase enzyme that has special endonuclease activity that recognizes and cleaves the DNA structure (Livak, KJ Biomol. Eng. 14, 143-149 (1999); Morris T. et al., J. Clin.Microbiol. 34, 2933 (1996); Lyamichev, V. et al., Science, 260, 778-783 (1993), etc.). The TILLING (Targeting Induced Local Lesions IN Genomes) method is a method for screening for mutation mismatches in the genome of a population of mutants that have undergone mutation introduction by PCR amplification and CEL I nuclease treatment.

[0069] In one embodiment, the genetic feature X-1 of the present invention can be detected by the dCAPS method using, but not limited to, the following primer set and restriction enzymes. Primer set: A primer set comprising a forward primer containing any sequence of 15 or more contiguous bases located on the 5' side of position 90 of SEQ ID NO: 150 (e.g., SEQ ID NO: 157), and a reverse primer containing a contiguous sequence of 15 to 25 bases from the 3' end of a sequence selected from SEQ ID NOs: 158, 172 to 183. The primer sequences can be optimized within a range that satisfies the above conditions. For details on optimizing primer design, see, for example, Sambrook and Russell, "Molecular Cloning: A Laboratory Manual" 3rd Edition (2001), Cold Spring Harbor Laboratory Press, etc. Furthermore, each of the above primers may be 15 to 50 bases long, 18 to 48 bases long, 20 to 45 bases long, 30 to 65 bases long, etc.

[0070] Restriction enzymes: The restriction enzymes corresponding to each of SEQ ID NOs: 158, 172 to 183 are shown below. [Table 1]

[0071] In a specific embodiment, the genetic feature X-1 of the present invention can be detected by the dCAPS method using the following primer set and restriction enzymes. [Table 2]

[0072] In one embodiment, the genetic feature X-2 of the present invention can be detected by the dCAPS method using, but not limited to, the following primer set and restriction enzymes. Primer set: A primer set comprising a forward primer containing any sequence of 15 or more contiguous bases located on the 5' side of position 108 of SEQ ID NO: 150 (e.g., SEQ ID NO: 157), and a reverse primer containing a contiguous sequence of 15 to 29 bases from the 3' end of a sequence selected from SEQ ID NOs: 163, 184 to 191. The primer sequences can be optimized within a range that satisfies the above conditions. For details on optimizing primer design, see, for example, Sambrook and Russell, et al., supra. Each of the primers may be 15 to 50 bases long, 18 to 48 bases long, 20 to 45 bases long, 30 to 65 bases long, etc.

[0073] Restriction enzymes: The restriction enzymes corresponding to each of SEQ ID NOs: 163, 184 to 191 are shown below. [Table 3]

[0074] In a specific embodiment, the genetic feature X-2 of the present invention can be detected by the dCAPS method using the following primer set and restriction enzymes. [Table 4]

[0075] In one aspect, genetic characteristic A of the present invention can be detected by the CAPS method using, without limitation, a primer set capable of amplifying a region including any of the sequences set forth in SEQ ID NOS: 19 to 21, and a restriction enzyme that cleaves the polynucleotides of SEQ ID NOS: 19 to 21 but not the polynucleotides of SEQ ID NOS: 75 to 77, or a restriction enzyme (e.g., Hpy188I) that does not cleave the polynucleotides of SEQ ID NOS: 19 to 21 but cleaves the polynucleotides of SEQ ID NOS: 75 to 77. Non-limiting examples of primer sets include the following. Forward primer: ATGGTTTGGGAATAGCTCTGTTGTT (SEQ ID NO: 37) Reverse primer: AGAACTTTGTTCTTGAACCTCTTG (SEQ ID NO: 38)

[0076] In one embodiment, genetic characteristic B of the present invention can be detected by, but is not limited to, the dCAPS method using the following primer set and restriction enzymes. (B-1) a primer set comprising a forward primer comprising the nucleotide sequence shown in SEQ ID NO: 45 and a reverse primer comprising the nucleotide sequence shown in SEQ ID NO: 46; (B-2) a primer set comprising a forward primer comprising the nucleotide sequence shown in SEQ ID NO: 50 and a reverse primer comprising the nucleotide sequence shown in SEQ ID NO: 51; (B-3) a primer set comprising a forward primer comprising the nucleotide sequence shown in SEQ ID NO: 55 and a reverse primer comprising the nucleotide sequence shown in SEQ ID NO: 56, or (B-4) A primer set comprising a forward primer containing the base sequence shown in SEQ ID NO: 60 and a reverse primer containing the base sequence shown in SEQ ID NO: 61.

[0077] However, the primer set is not limited to those having the sequences of SEQ ID NO: 45, 46, 50, 51, 55, 56, 60, or 61. For example, the forward primer may have at its 3' end the sequence of SEQ ID NO: 45, 50, 55, or 60 extending 15 bases upstream from the 3' end (see the table below), and the reverse primer may have at its 3' end the sequence of SEQ ID NO: 46, 51, 56, or 61 extending 15 bases upstream from the 3' end (see the table below). Such primers may be 15 to 50 bases long, or 20 to 45 bases long. [Table 5]

[0078] The primer set is not limited to those having the sequences of SEQ ID NO: 45, 46, 50, 51, 55, 56, 60, or 61. For example, the forward primer may have or contain any sequence of 15 or more consecutive bases in SEQ ID NO: 45, 50, 55, or 60, and the reverse primer may have or contain any sequence of 15 or more consecutive bases in SEQ ID NO: 46, 51, 56, or 61. (B-1″) A primer set comprising a forward primer having or including any sequence of 15 or more consecutive bases in SEQ ID NO: 45 and a reverse primer having or including any sequence of 15 or more consecutive bases in SEQ ID NO: 46; (B-2'') A primer set comprising a forward primer having or including any sequence of 15 or more consecutive bases in SEQ ID NO: 50 and a reverse primer having or including any sequence of 15 or more consecutive bases in SEQ ID NO: 51; (B-3'') A primer set comprising a forward primer having or comprising any sequence of 15 or more consecutive bases in SEQ ID NO: 55 and a reverse primer having or comprising any sequence of 15 or more consecutive bases in SEQ ID NO: 56, or (B-4'') a primer set comprising a forward primer having or comprising any sequence of 15 or more consecutive bases in SEQ ID NO: 60 and a reverse primer having or comprising any sequence of 15 or more consecutive bases in SEQ ID NO: 61. Such a primer may be 15 to 50 bases long, 20 to 45 bases long, or 30 to 65 bases long, as long as the above-mentioned arbitrary sequence of 15 or more consecutive bases is present at the 3' end.

[0079] Restriction enzymes to be used in combination with the above primers include the following: [Table 6]

[0080] In one embodiment, the genetic characteristic C or D of the present invention can be detected by the dCAPS method using the following primer set and restriction enzymes. Primer set: A primer set comprising: a forward primer comprising a sequence selected from SEQ ID NOs: 86 to 109, 192 located at the 3' end; and an arbitrary contiguous sequence (e.g., a contiguous sequence of any length) continuing from position 28 of SEQ ID NO: 6 on the 5' side, which is optionally added to the 5' end of the forward primer; and a reverse primer comprising a sequence complementary to an arbitrary contiguous sequence of 20 or more bases located on the 3' side of position 50 of SEQ ID NO: 6 (e.g., SEQ ID NOs: 65, 110). The primer sequences can be optimized within a range that satisfies the above-mentioned conditions. For details on optimizing primer design, see, for example, Sambrook and Russell et al. Each of the primers may be 15 to 50 bases long, 18 to 48 bases long, 20 to 45 bases long, 30 to 65 bases long, etc.

[0081] Restriction enzymes: The restriction enzymes corresponding to each of SEQ ID NOs: 86 to 109 and 192 are shown below. In the sequences below, "R" represents A or G, and "Y" represents C or T. [Table 7]

[0082] In a specific embodiment, the genetic characteristic C or D of the present invention can be detected by the dCAPS method using the following primer set and restriction enzymes. [Table 8]

[0083] The screening method of the present invention may further include a step of evaluating the flower bud formation ability of a test stevia plant in which a genetic feature of the present invention has been detected. The evaluation of flower bud formation ability is as described in the section on the plant of the present invention. In this embodiment, an individual with low flower bud formation ability may be selected from the test stevia plants in which a genetic feature of the present invention has been detected, and this may be crossed with another stevia plant, and the screening method of the present invention may be applied to the resulting offspring plant. Therefore, the screening method of the present invention may include one or more of the following steps. (i) detecting a genetic feature of the present invention (e.g., genetic feature X of the present invention) from the genome of a test stevia plant; (ii) evaluating the flower bud formation ability of the test stevia plant tissue in which the genetic characteristics of the present invention have been detected; (iii) selecting individuals with low flower bud formation ability from among the test stevia plants in which the genetic characteristics of the present invention have been detected; (iv) crossbreeding the selected individuals with low flower bud formation ability with other stevia plants; (v) detecting a genetic feature of the present invention (e.g., genetic feature X of the present invention) from the genome of the offspring plant obtained by crossing; (vi) assessing the flower bud formation ability of the offspring plant tissue in which the genetic trait of the present invention has been detected; (vii) A step of selecting individuals with low flower bud formation ability from among the offspring plants in which the genetic characteristics of the present invention have been detected.

[0084] The selected individuals with low flower bud formation ability may be, for example, individuals in the top 50%, top 40%, top 30%, top 20%, top 10%, top 5%, top 4%, top 3%, top 2%, or top 1% of test stevia plants in which the genetic feature of the present invention has been detected, in terms of low flower bud formation ability. Furthermore, the other stevia plants to be crossed may or may not contain the genetic feature of the present invention. In the above embodiment, steps (iv) to (vii) can be repeated multiple times. In this manner, stevia plants with lower flower bud formation ability can be screened.

[0085] In the screening method of the present invention, the test stevia plant may be a natural plant or a non-genetically modified plant. The non-genetically modified plant is as described in the section on the plant of the present invention. In the screening method of the present invention, the test stevia plant may include a stevia plant that has been subjected to a mutagenesis treatment and its progeny plants. The mutagenesis treatment is as described in the section on the plant of the present invention, and includes treatment with a mutagen, treatment with radiation or light, etc.

[0086] The present invention also provides the primer sets described above, for example, the primer sets described in Table 2 above, the primer sets described in Table 4 above, a primer set comprising the forward primer of SEQ ID NO: 37 and the reverse primer of SEQ ID NO: 38 above, any one or more primer sets selected from the group consisting of (B-1) to (B-4), (B-1') to (B-4'), and (B-1'') to (B-4'') above, and / or the primer sets described in Table 8 above. The present invention further provides a primer set capable of amplifying by PCR a region having a nucleotide sequence selected from the group consisting of SEQ ID NOs: 150, 164, 1 to 6, 69 to 74, for example, a primer set of a forward primer comprising the nucleotide sequence of SEQ ID NO: 151 and a reverse primer comprising the nucleotide sequence of SEQ ID NO: 152, a primer set of a forward primer comprising the nucleotide sequence of SEQ ID NO: 7 and a reverse primer comprising the nucleotide sequence of SEQ ID NO: 8, a primer set of a forward primer comprising the nucleotide sequence of SEQ ID NO: 9 and a reverse primer comprising the nucleotide sequence of SEQ ID NO: 10, a primer set of a forward primer comprising the nucleotide sequence of SEQ ID NO: 11 and a reverse primer comprising the nucleotide sequence of SEQ ID NO: 12, a primer set of a forward primer comprising the nucleotide sequence of SEQ ID NO: 13 and a reverse primer comprising the nucleotide sequence of SEQ ID NO: 14, a primer set of a forward primer comprising the nucleotide sequence of SEQ ID NO: 15 and a reverse primer comprising the nucleotide sequence of SEQ ID NO: 16, a primer set of a forward primer comprising the nucleotide sequence of SEQ ID NO: 17 and a reverse primer comprising the nucleotide sequence of SEQ ID NO: 18.

[0087] Furthermore, the present invention provides probes capable of detecting the presence and / or absence of the genetic features of the present invention (hereinafter, sometimes referred to as "probes of the present invention"). The probes of the present invention may have a structure suitable for various detection methods for the presence and / or absence of the genetic features of the present invention. For example, the probes of the present invention may contain a nucleotide sequence complementary to a portion of the genome containing the mutation site of the present invention. Non-limiting examples of such probes include those containing a nucleotide sequence selected from SEQ ID NOs: 153-156, 168-171, 19-36, 75-77, and 135-149. Of these sequences, SEQ ID NOs: 153-156 and 19-36 are specific to alleles containing the mutation of the present invention, while SEQ ID NOs: 168-171, 75-77, and 135-149 are specific to alleles not containing the mutation of the present invention. The presence of the genetic features of the present invention can be detected by detecting an allele containing the mutation of the present invention and / or not detecting an allele not containing the mutation of the present invention, and the absence of the genetic features of the present invention can be detected by not detecting an allele containing the mutation of the present invention and / or detecting an allele not containing the mutation of the present invention. The probe of the present invention preferably has a label. Non-limiting examples of such labels include fluorescent labels, luminescent labels, radioactive labels, dyes, enzymes, quenchers, moieties that bind to detectable labels, etc. In a specific embodiment, the probe of the present invention has a base sequence complementary to a base sequence selected from SEQ ID NOs: 153 to 156, 168 to 171, 19 to 36, 75 to 77, and 135 to 149, and a label.

[0088] The present invention further provides a primer set, such as a primer set described in Table 2, which includes a forward primer containing any sequence of 15 or more contiguous bases located on the 5' side of position 90 of SEQ ID NO: 150 (e.g., SEQ ID NO: 157), and a reverse primer containing a contiguous sequence 15 to 25 bases long from the 3' end of a sequence selected from SEQ ID NOs: 158, 172 to 183, and a kit, such as a screening kit, which includes the primer set and the corresponding restriction enzymes.

[0089] The present invention further provides a primer set, such as a primer set shown in Table 4, comprising a forward primer containing any sequence of 15 or more contiguous bases located on the 5' side of position 108 of SEQ ID NO: 150 (e.g., SEQ ID NO: 157), and a reverse primer containing a contiguous sequence 15 to 25 bases long from the 3' end of a sequence selected from SEQ ID NOs: 163, and 184 to 191, and a kit, such as a screening kit, comprising the primer set and the corresponding restriction enzymes.

[0090] The present invention further provides a kit, such as a screening kit, comprising a primer set capable of amplifying a region containing any of the sequences set forth in SEQ ID NOs: 19 to 21, for example, a primer set comprising a combination of a forward primer containing the nucleotide sequence of SEQ ID NO: 7 and a reverse primer containing the nucleotide sequence of SEQ ID NO: 8, and a restriction enzyme that cleaves the polynucleotides of SEQ ID NOs: 19 to 21 but not the polynucleotides of SEQ ID NOs: 75 to 77, or a restriction enzyme (e.g., Hpy188I) that does not cleave the polynucleotides of SEQ ID NOs: 19 to 21 but cleaves the polynucleotides of SEQ ID NOs: 75 to 77.

[0091] The present invention further provides a kit, such as a screening kit, comprising one or more primer sets selected from the group consisting of (B-1) to (B-4), (B-1') to (B-4'), and (B-1") to (B-4"). The kit may also include a restriction enzyme. In the kit, when one or more primer sets selected from the group consisting of (B-1), (B-1'), and (B-1'') are used, the restriction enzyme contained in the kit is KpnI. In the kit, when one or more primer sets selected from the group consisting of (B-2), (B-2') and (B-2'') are used, the restriction enzyme contained in the kit is XbaI. In the kit, when one or more primer sets selected from the group consisting of (B-3), (B-3') and (B-3'') are used, the restriction enzyme contained in the kit is AflII.

[0092] The present invention further provides a primer set, for example, a primer set described in Table 8, which includes a forward primer comprising a sequence selected from SEQ ID NOs: 86 to 109, and 192 located at the 3' end and any contiguous sequence (e.g., a contiguous sequence of any length) continuing from position 28 of SEQ ID NO: 6 on the 5' side, which is optionally added to the 5' end of the sequence, and a reverse primer comprising a sequence complementary to any contiguous sequence of 20 or more bases located on the 3' side of position 50 of SEQ ID NO: 6 (e.g., SEQ ID NOs: 65, 110), and a kit, for example, a screening kit, which includes the primer set and the corresponding restriction enzymes.

[0093] In another embodiment of the kit, When the primer set includes a forward primer having or including any sequence of 15 or more consecutive bases in SEQ ID NO: 45, the restriction enzyme includes KpnI, When the primer set includes a forward primer having or including any sequence of 15 or more consecutive bases in SEQ ID NO: 50, the restriction enzyme includes XbaI, When the primer set includes a forward primer having or including any sequence of 15 or more consecutive bases in SEQ ID NO: 55, the restriction enzyme includes AflII.

[0094] The present invention also provides a screening kit comprising a primer set capable of amplifying by PCR a region having a nucleotide sequence selected from the group consisting of SEQ ID NOs: 153 to 156, 168 to 171, 1 to 6, 19 to 36, 69 to 77, and 135 to 149, and the probe of the present invention.

[0095] These primer sets, probes, and kits can be used to detect the genetic characteristics of the present invention, can be used in the screening methods of the present invention, etc. Furthermore, these primer sets and kits may include instructions including explanations regarding the detection of the genetic characteristics of the present invention or the screening methods of the present invention, such as instruction manuals, or media on which information regarding the methods of use is recorded, such as flexible disks, CDs, DVDs, Blu-ray disks, memory cards, USB memory, etc.

[0096] 5. Manufacturing method of plant-derived extract and products using said extract In a further aspect of the present invention, there is provided a method for producing a stevia extract (hereinafter sometimes referred to as a "method for producing an extract of the present invention"), which comprises the step of obtaining an extract from the plant of the present invention, or the seeds or leaves (e.g., dried or fresh leaves) of the plant. Furthermore, there is provided a method for producing a purified steviol glycoside product (hereinafter sometimes referred to as a "method for producing a purified steviol glycoside product of the present invention"), which comprises the step of purifying steviol glycosides from the extract obtained by the method for producing an extract of the present invention. Specifically, there is provided a method for producing a purified steviol glycoside product, which includes the steps of obtaining an extract containing steviol glycosides from the stevia plant of the present invention, a stevia plant selected by the screening method of the present invention, or a stevia plant produced by the method of the present invention, and purifying the steviol glycosides from the obtained extract.

[0097] An extract containing steviol glycosides can be obtained by reacting fresh or dried leaves of the plant of the present invention with an appropriate solvent (an aqueous solvent such as water, or an organic solvent such as alcohol, ether, or acetone). The extraction conditions can be determined by reference to the methods described in Ohta et al. or WO2010 / 038911, or the methods described in the Examples below. Alternatively, individual steviol glycosides can be purified from extracts containing steviol glycosides using known methods such as ethyl acetate or other organic solvent:water gradients, high performance liquid chromatography (HPLC), gas chromatography, time-of-flight mass spectrometry (TOF-MS), and ultra (high) performance liquid chromatography (UPLC).

[0098] Steviol glycosides include RebA, RebB, RebC, RebD, RebE, RebF, RebI, RebJ, RebK, RebM, RebNRebO, RebQ, RebR, dulcoside A, rubusoside, steviolmonoside, steviolbioside, stevioside, etc. In one embodiment, the steviol glycosides include RebA, RebB, RebC, RebD, RebE, RebF, RebM, RebN, RebO, stevioside, steviolbioside, rubusoside, dulcoside A, or a combination thereof. In a preferred embodiment, the steviol glycosides include RebD, RebM, or a combination thereof.

[0099] One embodiment of the extract obtained by the method for producing an extract of the present invention (hereinafter referred to as "the extract of the present invention") contains a higher content of RebD, RebM, or both, compared to wild-type Stevia species. The extract of the present invention has an increased level of RebD, RebM, or both, by 300% or more, 400% or more, 500% or more, 600% or more, 700% or more, 800% or more, 900% or more, 1100% or more, 1200% or more, 1300% or more, 1400% or more, 1500% or more, 1600% or more, 1700% or more, 1800% or more, 1900% or more, 2000% or more, 2100% or more, 2200% or more, 2300% or more, 2400% or more, 2500% or more compared to an extract obtained from a wild-type Stevia species. , 2600% or more, 2700% or more, 2800% or more, 2900% or more, 3000% or more, 3100% or more, 3200% or more, 3300% or more, 3400% or more, 3500% or more, 3600% or more, 3700% or more, 3800% or more, 3900% or more, 4000% or more, 4100% or more, 4200% or more, 4300% or more, 4400% or more, 4500% or more, 4600% or more, 4700% or more, 4800% or more, 4900% or more, or 5000% or more higher. Here, the extract of the present invention and the extract obtained from a wild-type Stevia species may be obtained by the same method.

[0100] By mixing the extract of the present invention thus obtained and / or a steviol glycoside purified product (e.g., RebD and / or RebM) obtained by the method for producing a steviol glycoside purified product of the present invention with other ingredients, a pharmaceutical product, flavor, or food or beverage product containing steviol glycoside can be produced. Therefore, in another embodiment, the present invention provides a method for producing a pharmaceutical product, flavor, or food or beverage product, which includes a step of mixing the extract of the present invention and / or a steviol glycoside purified product obtained by the method for producing a steviol glycoside purified product of the present invention with other ingredients. Furthermore, the present invention provides a pharmaceutical product, flavor, or food or beverage product containing steviol glycoside obtained by the above production method. Here, "food or beverage product" refers to beverages and foods. Accordingly, in one embodiment, the present invention provides a pharmaceutical product, flavor, beverage, or food product, as well as a method for producing the pharmaceutical product, flavor, beverage, or food product.

[0101] 6. Nucleotide sequence related to the plant of the present invention In another embodiment, the present invention provides a nucleotide sequence related to the Stevia plant of the present invention. The nucleotide sequence of a stevia plant having genetic feature X-1 comprises or consists of a nucleotide sequence selected from SEQ ID NOs: 153 and 154. The nucleotide sequence of a stevia plant having genetic feature X-2 comprises or consists of a nucleotide sequence selected from SEQ ID NOs: 155 and 156. The nucleotide sequence of a stevia plant having genetic feature A comprises or consists of a nucleotide sequence selected from SEQ ID NOs: 19 to 21 and 69. The nucleotide sequence of a stevia plant having genetic feature B-1 comprises or consists of a nucleotide sequence selected from SEQ ID NOs: 22 to 24 and 70. The nucleotide sequence of a stevia plant having genetic feature B-2 comprises or consists of a nucleotide sequence selected from SEQ ID NOs: 25 to 27 and 71. The nucleotide sequence of a stevia plant having genetic feature B-3 comprises or consists of a nucleotide sequence selected from SEQ ID NOs: 28 to 30 and 72. The nucleotide sequence of a stevia plant having genetic feature B-4 comprises or consists of a nucleotide sequence selected from SEQ ID NOs: 31 to 33, 62 and 73. The nucleotide sequence of a stevia plant having genetic characteristic C or D comprises or consists of a nucleotide sequence selected from SEQ ID NOs: 34 to 36 and 74. [Example]

[0102] Experimental examples and working examples relating to the present invention are described below, but the present invention is not limited to these specific embodiments.

[0103] [Example 1] Verification of the association between RebM content and genetic characteristic B (1) Using commercially available stevia seeds, individuals were selected based on growth conditions, leaf morphology, total steviol glycoside (TSG), RebA, RebD, and RebM contents, resulting in two segregating populations, Population I and Population II. Verification was performed using 62 individuals from Population I and 109 individuals from Population II. Individuals were divided into three groups based on RebM content: 0.2% or more, 0.1% to less than 0.2%, and 0% to less than 0.1%, and the presence or absence of genetic feature B-1 was investigated. Specifically, PCR was performed using the following primers, and a restriction enzyme (KpnI) was added to the PCR product. The enzyme reaction was carried out at 37°C, followed by restriction enzyme digestion. After restriction enzyme digestion, electrophoresis was performed using a microchip electrophoresis device, LabChip GX Touch HT, and the markers were identified based on the band pattern after electrophoresis. The primer sequences are as follows: Fw primer: 5'-TAATCATCCAAACCCTAATCTCGCCAAACAACCGGGTAC-3' (SEQ ID NO: 45) Rv primer: 5'-GAGGAAGACATTGGCAACTC-3' (SEQ ID NO: 46) The resulting PCR product (approximately 297 bp long) was treated with KpnI restriction enzyme, and those that did not produce a restriction enzyme product of approximately 260 bp (e.g., SEQ ID NO: 49) were determined to be B-1 positive. As a result, the group containing 0.2% or more was preferentially detected by this genetic characteristic, proving that the frequency of positive individuals differed statistically significantly between groups (goodness-of-fit test using chi-square test; the null hypothesis is that the marker test results are not linked to the phenotype and the frequency distribution is uniform. See the table below for test results). [Table 9] [Table 10]

[0104] [Example 2] Verification of the association between RebM content and genetic characteristic B (2) When high-RebM plants were selected using genetic feature B, it was possible to select individuals with a RebM ratio of 2% or more even in segregating populations other than the validation population, as shown in the table below, confirming that it can be used as a practical selection marker. The results of the selection of high-RebM plants are shown in the table below. A "○" in the table indicates that the test result for genetic feature B was positive. The genetic characteristic B-1 was detected in the same manner as in Example 1, and the genetic characteristics B-2 to B-4 were detected as follows.

[0105] To detect genetic feature B-2, PCR was performed using the following primers, and a restriction enzyme (XbaI) was added to the PCR product. The PCR product was then subjected to an enzymatic reaction at 37°C and treated with the restriction enzyme. After restriction enzyme treatment, electrophoresis was performed using a microchip electrophoresis device, LabChip GX Touch HT, and the markers were identified based on the band pattern after electrophoresis. The primer sequences are as follows: Fw primer: 5'-AAGGTTCTTTATTTTTAAACTTATGTTAATTTATTGTATCTAG-3' (SEQ ID NO: 50) Rv primer: 5'-CCTTATGTACACATGCTACAC-3' (SEQ ID NO: 51) The resulting PCR product (approximately 383 bp in length) was treated with XbaI restriction enzyme, and those that did not produce a restriction enzyme product of approximately 344 bp (for example, SEQ ID NO: 54) were determined to be B-2 positive.

[0106] To detect genetic feature B-3, PCR was performed using the following primers, and a restriction enzyme (AflII) was added to the PCR product. The PCR product was then subjected to an enzymatic reaction at 37°C and treated with the restriction enzyme. After restriction enzyme treatment, electrophoresis was performed using a microchip electrophoresis device, LabChip GX Touch HT, and the markers were identified based on the band pattern after electrophoresis. The primer sequences are as follows: Fw primer: 5'-CGATGGTTTTTGCTACATGAAAACCCTAGAAGACGAAACCCGCTTAA-3' (SEQ ID NO: 55) Rv primer: 5'-ACCAGCAATAATCCTTGAATTAG-3' (SEQ ID NO: 56) The resulting PCR product (approximately 390 bp in length) was treated with AflII restriction enzyme, and those that did not produce a restriction enzyme product of approximately 347 bp (for example, SEQ ID NO: 59) were determined to be B-3 positive.

[0107] To detect genetic characteristic B-4, PCR was performed using the following primers. The PCR products were electrophoresed using a microchip electrophoresis device, LabChip GX Touch HT, and the markers were identified based on the band pattern after electrophoresis. The primer sequences are as follows: Fw primer: 5'-CGCAAACACGTATACTAATC-3' (SEQ ID NO: 60) Rv primer: 5'-TTTAGCATGGTATGTACAAC-3' (SEQ ID NO: 61) Those that produced only a PCR product of approximately 140 bp (eg, SEQ ID NO: 62) were considered B-4 positive. [Table 11]

[0108] [Example 3] Verification of the association between high TSG stevia plants and genetic trait C (1) Isolation of individuals with high sweetness content (M0 generation) Approximately 2,000 wild-type stevia seeds (commercial variety, introduced in August 2014) (by weight) were divided into three groups and genetically modified by treating each group with 0.1%, 0.2%, or 0.3% ethylene methane sulfonic acid (EMS). The EMS-treated and untreated seeds were sown in a greenhouse at the Suntory Research Center to obtain seedlings of the EMS-treated generation (M0 generation). No difference in germination rate was observed between the treatment concentrations. Fresh leaves were sampled from the EMS-treated (M0) and untreated plants, and the concentrations of sweet components were quantified using LC / MS-MS (Shimadzu LCMS8050). Specifically, 0.25 g of fresh leaves were freeze-dried, and 0.05 g of the crushed leaves were added to pure water. Extraction was performed by sonication for 20 minutes, followed by centrifugation and filtration to obtain 0.33 ml of extract. This extract was analyzed using LC / MS-MS in ion mode (Shimadzu LCMS8050) to quantify the concentrations of RebA, RebB, RebC, RebD, RebF, RebM, RebN, and RebO. The sum of these concentrations was used to determine the concentration of sweet components. An individual with a sweet component concentration of approximately 20% was designated parental individual 1 (P1). A parental individual with a sweet component concentration of 5% in dried leaves, derived from a different population of Stevia plants, was selected as parental individual 2 (P2).

[0109] (2) Isolation of individuals with high sweetness content (M1 generation) and genetic analysis Parental individuals 1 (P1) and 2 (P2) were crossed to produce the first generation (M1 generation) seeds. These seeds were then sown in a greenhouse at the Suntory Research Center to obtain M1 generation seedlings (a segregating population of 1,603 individuals). Fresh leaves were sampled from the M1 generation individuals, and sweet components were quantified using LC / MS-MS (Shimadzu LCMS8050) in the same manner as in (1) above. The results are shown in Figure 1. Genomic DNA was extracted from fresh leaves of the 30 individuals with the highest sweetener content (high-sweetener individuals) and the 30 individuals with the lowest sweetener content (low-sweetener individuals), and mutations present only in one of the two populations were investigated. Among the mutations detected by genome analysis, 306 mutations with sufficient genomic information (sequence coverage of 5x or more), discontinuous mutations, and no insertions or deletions were examined to determine which individuals each mutation was present in. The results revealed that a C to A mutation at position 49 of SEQ ID NO: 1 (C49A) was present in individuals with high sweetener content but not in individuals with low sweetener content.

[0110] (3) Verification of the relationship between the C49A mutation and the amount of sweet substances Stevia plants heterozygous for the C49A mutation were crossed with stevia plants lacking the C49A mutation to obtain two segregating populations (segregating population A (443 individuals) and segregating population B (446 individuals)). The presence or absence of the C49A mutation and the content of sweet components in each individual of both segregating populations were investigated. The dCAPS method was used to investigate the presence or absence of the C49A mutation. Genomic DNA was extracted from each individual, and PCR was performed using the following primers. A restriction enzyme (SpeI) was added to the PCR product, and the enzyme reaction was carried out at 37°C. After restriction enzyme treatment, electrophoresis was performed using a microchip electrophoresis device, LabChip GX Touch HT (PerkinElmer), and the markers were identified based on the band pattern after electrophoresis. Forward primer: 5'-TTATTTAATGATCCAATGGAGGGGGTGATTCAGGTAATAAAAGGCACT-3' (SEQ ID NO: 112) Reverse primer: 5'-TGAGGGTTCTCAATTGATTTCCGATTGG-3' (SEQ ID NO: 65) The resulting PCR product of approximately 367 bp (for example, SEQ ID NO: 66 or 67) was subjected to SpeI restriction enzyme treatment, and those that produced a restriction enzyme treatment product of approximately 321 bp (for example, SEQ ID NO: 68) were determined to be positive for the C49A mutation. The content of sweet components was determined in the same manner as in (1). The distribution of sweet component contents in the mutation C49A-positive and -negative individuals of each segregating population is shown in Figures 2 and 3. These results show that the sweet component contents in the mutation C49A-positive individuals are higher than the average sweet component contents of each segregating population as a whole.

[0111] The mean and median values ​​of the sweet substance contents in the mutation C49A-positive and -negative individuals of each segregating population are also summarized below. [Table 12]

[0112] [Example 4] Verification of the association between high-RebD stevia plants and genetic characteristics A to C 1. Preparation of Test Strains A male plant (P1) with genetic characteristics of high TSG content was crossed with a female plant (P2) with genetic characteristics of high RebM content, and the first generation hybrid (S1 generation) seeds were collected and sown in the greenhouse at the Suntory Research Center to obtain S1 generation seedlings. The genetic characteristics of a high RebM content type include at least one of the following characteristics: B-1: Homozygous for the allele in which the base at the position corresponding to position 40 of SEQ ID NO:2 is T. B-2: Homozygous for the allele in which the base at the position corresponding to position 44 of SEQ ID NO:3 is T. B-3: Homozygous for the allele in which the base at the position corresponding to position 48 of SEQ ID NO: 4 is C. B-4: Homozygous for an allele lacking the portion corresponding to positions 55 to 72 of SEQ ID NO: 5. As shown in Examples 1 and 2, these genetic characteristics are associated with high RebM content properties. The genetic characteristics of the high TSG content type are as follows: C: Heterozygous for the allele in which the base at the position corresponding to position 49 of SEQ ID NO:6 is A. As shown in Example 3, the above genetic traits are associated with high TSG content traits. Furthermore, both P1 and P2 are the descendants of individuals whose genes were modified by treatment with ethyl methanesulfonate (EMS).

[0113] Appropriate amounts of fresh leaves were sampled from P1, P2, and S1 generations of individuals. 0.25 g of fresh leaves were freeze-dried, and 0.05 g of the crushed leaves were added to pure water. Extraction was performed by sonication for 20 minutes, followed by centrifugation and filtration to obtain 0.33 ml of extract. This extract was analyzed using LC / MS-MS in ion mode (Shimadzu LCMS8050) to quantify the concentrations of RebA, RebB, RebC, RebD, RebF, RebM, RebN, and RebO (mass % of dry leaf mass). The sum of these was used as the total steviol glycoside (TSG) concentration. The results are shown in the table below. [Table 13] As shown by the above results, crossing P1 with P2 yielded high-RebD individuals with a RebD content exceeding 3.3 mass% on a dry leaf basis (S1-1 to S1-3).

[0114] [Example 5] Detection of genetic traits specific to high-RebD stevia plants Genomic DNA was extracted from fresh leaves of each individual tested in Example 4, and the presence or absence of genetic characteristics B-1 and C was investigated. To detect genetic feature B-1, PCR was performed using the following primers, and a restriction enzyme (KpnI) was added to the PCR product. The PCR product was then subjected to an enzymatic reaction at 37°C and treated with the restriction enzyme. After restriction enzyme treatment, electrophoresis was performed using a microchip electrophoresis device, LabChip GX Touch HT, and the markers were identified based on the band pattern after electrophoresis. The primer sequences are as follows: Fw primer: 5'-TAATCATCCAAACCCTAATCTCGCCAAACAACCGGGTAC-3' (SEQ ID NO: 45) Rv primer: 5'-GAGGAAGACATTGGCAACTC-3' (SEQ ID NO: 46) The resulting PCR product (approximately 297 bp in length) was treated with KpnI restriction enzyme, and those that did not produce a restriction enzyme product of approximately 260 bp (for example, SEQ ID NO: 49) were determined to be positive for genetic characteristic B-1.

[0115] To detect genetic characteristic C, PCR was performed using the following primers, and a restriction enzyme (SpeI) was added to the PCR product and the enzyme reaction was carried out at 37°C. After restriction enzyme treatment, electrophoresis was performed using a microchip electrophoresis device, LabChip GX Touch HT (PerkinElmer), and the markers were identified based on the band pattern after electrophoresis. Forward primer: 5'-TTATTTAATGATCCAATGGAGGGGGTGATTCAGGTAATAAAAGGCACT-3' (SEQ ID NO: 112) Reverse primer: 5'-TGAGGGTTCTCAATTGATTTCCGATTGG-3' (SEQ ID NO: 65) The resulting PCR product of approximately 367 bp (for example, SEQ ID NO: 66 or 67) was subjected to SpeI restriction enzyme treatment, and those that produced a restriction enzyme treatment product of approximately 321 bp (for example, SEQ ID NO: 68) were determined to be genetic characteristic C positive.

[0116] The results are shown in Table 14 below. In the table, "◯" indicates that the corresponding mutation was detected, and "×" indicates that it was not detected. [Table 14] As shown by the above results, individuals possessing genetic characteristic B-1 tended to have a higher RebM content than individuals without the genetic characteristic B-1, and individuals possessing genetic characteristic C tended to have a higher TSG content than individuals without the genetic characteristic C. This confirms the results shown in the above-mentioned prior application by the present applicant.

[0117] To identify markers for identifying individuals with high RebD content, genomic DNA was extracted from fresh leaves of each individual and sequenced using NGS (HiSeq 2500, Illumina). As a result, the following genetic characteristics were found exclusively in individuals with high RebD content: A: Homozygous for the allele in which the base at the position corresponding to position 201 of SEQ ID NO:1 is A. As shown by the above results, all of the individuals with high RebD content (S1-1 to S1-3) possessed genetic characteristics A, B-1, and C, and tended to have higher RebD content than individuals that did not possess genetic characteristic A.

[0118] [Example 6] Verification of the relationship between flower bud formation ability and genetic characteristic X Two wild-type stevia plant lines (W101 and W102) and one mutant stevia plant line (M101), a descendant of an individual whose genes had been modified by mutagenesis treatment with ethyl methanesulfonate (EMS), were planted using cuttings, and the plants with eight true leaves were transferred to the conditions shown in the table below. After three weeks, the number of flower buds was counted. The results are shown in the table below (average of three plants for each treatment, minimum to maximum values ​​in parentheses). [Table 15] As shown in the above results, the flower bud formation ability of M101 is significantly lower than that of the wild-type line. To investigate the genetic characteristics associated with this phenotype, we determined and compared the gene sequences of each line. As a result, genetic characteristics X-1 and X-2 were found only in M101. [Industrial Applicability]

[0119] The present invention makes it possible to provide stevia plants with high leaf and steviol glycoside yields, thereby improving the efficiency of steviol glycoside production. Furthermore, the present invention makes it possible to select individuals with low flower bud formation ability before flower bud formation, thereby improving breeding efficiency.

Claims

1. A stevia plant that is heterozygous or homozygous for an allele in which the base at the position corresponding to position 90 of SEQ ID NO: 150 is G, and that is heterozygous or homozygous for an allele in which the base at the position corresponding to position 108 of SEQ ID NO: 150 is G, and that has reduced flower bud formation ability compared to the wild type.

2. The plant body according to claim 1, further having at least one of the following genetic characteristics (1) to (7): (1) It is homozygous for an allele in which the base at the position corresponding to position 40 of SEQ ID NO:2 is T. (2) It is homozygous for an allele in which the base at the position corresponding to position 44 of SEQ ID NO:3 is T. (3) It is homozygous for an allele in which the base at the position corresponding to position 48 of SEQ ID NO: 4 is C. (4) It is homozygous for an allele lacking the portion corresponding to positions 55 to 72 of SEQ ID NO:

5. (5) It is homozygous for an allele in which the base at the position corresponding to position 201 of SEQ ID NO: 1 is A. (6) It is heterozygous for an allele in which the base at the position corresponding to position 49 of SEQ ID NO: 6 is A. (7) It is homozygous for an allele in which the base at the position corresponding to position 49 of SEQ ID NO:6 is A.

3. The plant body according to claim 2, having at least one of the following characteristics (1) to (2): (1) Contains 3% or more RebD per unit mass of dried leaves. (2) Contains 0.2% or more RebM per unit mass of dried leaves.

4. A seed, tissue, tissue culture, or cell of the plant body according to any one of claims 1 to 3, which is heterozygous or homozygous for an allele in which the base at position 90 of SEQ ID NO: 150 is G, and which is heterozygous or homozygous for an allele in which the base at position 108 of SEQ ID NO: 150 is G.

5. 5. The tissue, tissue culture or cell of claim 4, selected from an embryo, a meristematic cell, a leaf, a root, a root tip, a petal, a protoplast, a leaf slice and a callus.

6. A method for producing a stevia plant having reduced flower bud formation ability, comprising a step of crossing the plant according to any one of claims 1 to 3 with a second stevia plant.

7. The method according to claim 6, wherein the second plant is a plant according to any one of claims 1 to 3.

8. A method for producing a stevia extract, comprising a step of obtaining an extract from the plant body according to any one of claims 1 to 3, or the seed, tissue, tissue culture or cell according to claim 4 or 5.

9. A method for producing a purified steviol glycoside product, comprising the steps of obtaining an extract from the plant body according to any one of claims 1 to 3, or the seed, tissue, tissue culture, or cell according to claim 4 or 5, and purifying steviol glycoside from the obtained extract.

10. 10. The method of claim 9, wherein the steviol glycoside comprises rebaudioside A, rebaudioside B, rebaudioside C, rebaudioside D, rebaudioside E, rebaudioside F, rebaudioside M, rebaudioside N, rebaudioside O, stevioside, steviolbioside, rubusoside, dulcoside A, or a combination thereof.

11. Obtaining an extract from a plant body according to any one of claims 1 to 3, or a seed, tissue, tissue culture or cell according to claim 4 or 5; and adding the extract to a food or drink, a sweetening composition, a flavoring agent, or a raw material for a pharmaceutical product; A method for producing a food or drink, a sweetening composition, a flavoring agent, or a pharmaceutical, comprising the steps of:

12. Obtaining an extract from the plant body according to any one of claims 1 to 3, or the seed, tissue, tissue culture or cell according to claim 4 or 5; purifying steviol glycosides from the extract; and adding the steviol glycoside to a food or drink, a sweetening composition, a flavoring agent, or a raw material for a pharmaceutical product. A method for producing a food or drink, a sweetening composition, a flavoring agent, or a pharmaceutical, comprising the steps of:

13. A method for screening a stevia plant with low flower bud formation ability, comprising a step of detecting the presence or absence of genetic characteristics of being heterozygous or homozygous for alleles in which the base at the position corresponding to position 90 of SEQ ID NO: 150 is G and the base at the position corresponding to position 108 of SEQ ID NO: 150 is G from the genome of a test stevia plant.

14. The method according to claim 13, further comprising the step of detecting the presence and / or absence of the following genetic features (1) to (7) from the genome of a test stevia plant: (1) It is homozygous for an allele in which the base at the position corresponding to position 40 of SEQ ID NO:2 is T. (2) It is homozygous for an allele in which the base at the position corresponding to position 44 of SEQ ID NO:3 is T. (3) It is homozygous for an allele in which the base at the position corresponding to position 48 of SEQ ID NO: 4 is C. (4) It is homozygous for an allele lacking the portion corresponding to positions 55 to 72 of SEQ ID NO:

5. (5) It is homozygous for an allele in which the base at the position corresponding to position 201 of SEQ ID NO: 1 is A. (6) The genome of the test stevia plant is heterozygous for an allele in which the base at the position corresponding to position 49 of SEQ ID NO: 6 is A. (7) The test stevia plant is homozygous for an allele in which the base at the position corresponding to position 49 of SEQ ID NO: 6 is A in the genome of the test stevia plant.

15. The method according to claim 13 or 14, wherein the step of detecting the genetic characteristic is carried out using the CAPS method, the dCAPS method, or the TaqMan PCR method.

16. The method according to any one of claims 13 to 15, further comprising a step of evaluating the flower bud formation ability of the test stevia plant tissue.

17. A screening kit for stevia plants with low flower bud formation ability, comprising a primer and / or a probe for detecting the presence or absence of a genetic trait of being heterozygous or homozygous for an allele in which the base at the position corresponding to position 90 of SEQ ID NO: 150 is G, and a primer and / or a probe for detecting the presence or absence of a genetic trait of being heterozygous or homozygous for an allele in which the base at the position corresponding to position 108 of SEQ ID NO: 150 is G.

18. The kit according to claim 17, further comprising primers and / or probes for detecting the presence and / or absence of the following genetic features (1) to (7): (1) It is homozygous for an allele in which the base at the position corresponding to position 40 of SEQ ID NO:2 is T. (2) It is homozygous for an allele in which the base at the position corresponding to position 44 of SEQ ID NO:3 is T. (3) It is homozygous for an allele in which the base at the position corresponding to position 48 of SEQ ID NO: 4 is C. (4) It is homozygous for an allele lacking the portion corresponding to positions 55 to 72 of SEQ ID NO:

5. (5) It is homozygous for an allele in which the base at the position corresponding to position 201 of SEQ ID NO: 1 is A. (6) It is heterozygous for an allele in which the base at the position corresponding to position 49 of SEQ ID NO: 6 is A. (7) It is homozygous for an allele in which the base at the position corresponding to position 49 of SEQ ID NO:6 is A.

19. The kit according to claim 17 or 18, wherein the reagents comprise primers and / or probes used in the CAPS method, the dCAPS method, or the TaqMan PCR method.

20. A method for producing a stevia plant with low flower bud formation ability, comprising the steps of: introducing an A to G mutation at a position corresponding to position 90 of SEQ ID NO: 150; and introducing a T to G mutation at a position corresponding to position 108 of SEQ ID NO: 150.

Citation Information

Patent Citations

  • Method for producing plant body having delayed flower bud formation, plant body obtained by using the same and utilization thereof

    JP2005295878A

  • Stevia plants with increased rebaudioside d content

    JP2016515814A

  • Stevia rebaudiana with altered steviol glycoside composition

    WO1999049724A1

  • Single nucleotide polymorphism (SNP) markers for stevia

    WO2016049531A1

  • High rebaudioside c-content stevia plant

    WO2018124142A1